WorldWideScience

Sample records for molecular sex identification

  1. Molecular study for the sex identification in Japanese quails ...

    African Journals Online (AJOL)

    In many birds' species such as Japanese quail, sex determination in young and many adult birds is very difficult. Nowadays, sex identification of animals throughout their lives is possible by molecular genetic techniques such as polymerase chain reaction (PCR). The aim of this study was to determine the sex of Japanese ...

  2. Molecular study for the sex identification in Japanese quails ...

    African Journals Online (AJOL)

    use

    2011-12-14

    Dec 14, 2011 ... The aim of this study was to determine the sex of. Japanese quail (Coturnix japonica) by DNA analysis. Chromo ... M, 100 bp DNA ladder (Fermentas, Germany); lane 1, negative control. (without DNA) .... low cost and reduced risk of contamination, and preven- .... Improving the reliability of molecular sexing.

  3. Molecular sex identification of painted storks (Mycteria leucocephala ...

    Indian Academy of Sciences (India)

    2Unit of Forensic and Management, Department of Wildlife and National Parks of Peninsular Malaysia, Km10,. Jalan Cheras, 56100, Kuala Lumpur, Malaysia. 3Faculty of Science ..... M. A. and Campos F. 2002 Using FTA cards to store avian blood for genetic studies. Their application in sex determination. Mol. Ecol. Notes 2 ...

  4. A universal and reliable assay for molecular sex identification of three-spined sticklebacks (Gasterosteus aculeatus).

    Science.gov (United States)

    Toli, E-A; Calboli, F C F; Shikano, T; Merilä, J

    2016-11-01

    In heterogametic species, biological differences between the two sexes are ubiquitous, and hence, errors in sex identification can be a significant source of noise and bias in studies where sex-related sources of variation are of interest or need to be controlled for. We developed and validated a universal multimarker assay for reliable sex identification of three-spined sticklebacks (Gasterosteus aculeatus). The assay makes use of genotype scores from three sex-linked loci and utilizes Bayesian probabilistic inference to identify sex of the genotyped individuals. The results, validated with 286 phenotypically sexed individuals from six populations of sticklebacks representing all major genetic lineages (cf. Pacific, Atlantic and Japan Sea), indicate that in contrast to commonly used single-marker-based sex identification assays, the developed multimarker assay should be 100% accurate. As the markers in the assay can be scored from agarose gels, it provides a quick and cost-efficient tool for universal sex identification of three-spined sticklebacks. The general principle of combining information from multiple markers to improve the reliability of sex identification is transferable and can be utilized to develop and validate similar assays for other species. © 2016 John Wiley & Sons Ltd.

  5. Molecular Method for Sex Identification of Half-Smooth Tongue Sole (Cynoglossus semilaevis Using a Novel Sex-Linked Microsatellite Marker

    Directory of Open Access Journals (Sweden)

    Xiaolin Liao

    2014-07-01

    Full Text Available Half-smooth tongue sole (Cynoglossus semilaevis is one of the most important flatfish species for aquaculture in China. To produce a monosex population, we attempted to develop a marker-assisted sex control technique in this sexually size dimorphic fish. In this study, we identified a co-dominant sex-linked marker (i.e., CyseSLM by screening genomic microsatellites and further developed a novel molecular method for sex identification in the tongue sole. CyseSLM has a sequence similarity of 73%–75% with stickleback, medaka, Fugu and Tetraodon. At this locus, two alleles (i.e., A244 and A234 were amplified from 119 tongue sole individuals with primer pairs CyseSLM-F1 and CyseSLM-R. Allele A244 was present in all individuals, while allele A234 (female-associated allele, FAA was mostly present in females with exceptions in four male individuals. Compared with the sequence of A244, A234 has a 10-bp deletion and 28 SNPs. A specific primer (CyseSLM-F2 was then designed based on the A234 sequence, which amplified a 204 bp fragment in all females and four males with primer CyseSLM-R. A time-efficient multiplex PCR program was developed using primers CyseSLM-F2, CyseSLM-R and the newly designed primer CyseSLM-F3. The multiplex PCR products with co-dominant pattern could be detected by agarose gel electrophoresis, which accurately identified the genetic sex of the tongue sole. Therefore, we have developed a rapid and reliable method for sex identification in tongue sole with a newly identified sex-linked microsatellite marker.

  6. Marcadores moleculares na predição do sexo em plantas de mamoeiro Molecular markers for sex identification in papaya

    Directory of Open Access Journals (Sweden)

    Eder Jorge de Oliveira

    2007-12-01

    Full Text Available O objetivo deste trabalho foi validar marcadores moleculares, previamente identificados como ligados ao sexo do mamoeiro, para utilização na seleção indireta em genótipos comerciais. Foram analisadas duas variedades do grupo Solo e dois híbridos do grupo Formosa, com utilização de 20 plantas por genótipo, quatro marcadores do tipo SCAR (Sequence Characterized Amplified Region e um RAPD (Random Amplified Polymorphic DNA. O RAPD BC210 permitiu a identificação de todas as plantas femininas e hermafroditas, o que revela grande potencial para ser usado na seleção assistida em alguns dos genótipos mais cultivados no Brasil. Os marcadores do tipo SCAR não permitiram a identificação correta do sexo dos genótipos, pois detectou-se a presença de falso-positivos e falso-negativos nas análises.The objective of this work was the validation of previous discovered sex related molecular markers of papaya, aiming at the indirect selection of Brazilian commercial genotypes. Two varieties of the Solo group and two hybrids of the Formosa group (20 plants for genotype, four SCAR (Sequence Characterized Amplified Region and one RAPD (Random Amplified Polymorphic DNA markers were used. All hermaphrodite and female plants were correctly predicted by RAPD BC210, showing its high potential for marker assisted selection in important commercial genotypes used in Brazil. The SCAR markers did not show the true sex identification of these genotypes, revealing the presence of false positives and negatives in the analyses.

  7. Molecular sex differences in human serum.

    Directory of Open Access Journals (Sweden)

    Jordan M Ramsey

    Full Text Available Sex is an important factor in the prevalence, incidence, progression, and response to treatment of many medical conditions, including autoimmune and cardiovascular diseases and psychiatric conditions. Identification of molecular differences between typical males and females can provide a valuable basis for exploring conditions differentially affected by sex.Using multiplexed immunoassays, we analyzed 174 serum molecules in 9 independent cohorts of typical individuals, comprising 196 males and 196 females. Sex differences in analyte levels were quantified using a meta-analysis approach and put into biological context using k-means to generate clusters of analytes with distinct biological functions. Natural sex differences were established in these analyte groups and these were applied to illustrate sexually dimorphic analyte expression in a cohort of 22 males and 22 females with Asperger syndrome. Reproducible sex differences were found in the levels of 77 analytes in serum of typical controls, and these comprised clusters of molecules enriched with distinct biological functions. Analytes involved in fatty acid oxidation/hormone regulation, immune cell growth and activation, and cell death were found at higher levels in females, and analytes involved in immune cell chemotaxis and other indistinct functions were higher in males. Comparison of these naturally occurring sex differences against a cohort of people with Asperger syndrome indicated that a cluster of analytes that had functions related to fatty acid oxidation/hormone regulation was associated with sex and the occurrence of this condition.Sex-specific molecular differences were detected in serum of typical controls and these were reproducible across independent cohorts. This study extends current knowledge of sex differences in biological functions involved in metabolism and immune function. Deviations from typical sex differences were found in a cluster of molecules in Asperger syndrome

  8. Bulked segregant analysis of the pirarucu (Arapaima gigas) genome for identification of sex-specific molecular markers.

    Science.gov (United States)

    Almeida, I G; Ianella, P; Faria, M T; Paiva, S R; Caetano, A R

    2013-12-04

    Arapaima gigas (Osteoglossidae) is one of the largest fish species in the Amazon Basin, attaining lengths of over 2.5 m and weights of over 100 kg. Its flesh is prized, and it has great potential for production in aquaculture systems. However, live pirarucu cannot be reliably sexed visually, even after sexual development, since this species does not have clear external sexual dimorphism. Simple and inexpensive methods for sexing immature pirarucu based on DNA markers would facilitate production of this species in commercial operations. We analyzed A. gigas male and female DNA pools with 566 RAPD primers, generating 2609 fragments, with an estimated 1341 segregating polymorphic markers, and an estimated average spacing of 714 kb, which corresponds to less than 0.1% of the species' genome. Two putative sex-specific fragments were initially identified in bulked samples; but they were not confirmed in a study of individual male and female samples. We suggest that A. gigas has developed a non-chromosomal system of sex determination or, alternatively, that the species has undergone a recent loss of the chromosome carrying the sex-determining locus.

  9. Personal identification and sex determination using cheiloscopy

    Directory of Open Access Journals (Sweden)

    Ravindra Naik Gugulothu

    2015-01-01

    Full Text Available Introduction: Identification of an individual is a prerequisite for certification of death and for personal, social, and legal reasons. The study of lip prints (cheiloscopy was thought of as a method of identification of a person. It is safe to assume that cheiloscopy, in its present stage of development, has become a means of criminal identification dealing with lip prints. Aims and Objectives: To evaluate the lip prints of different individuals in various parts of the lip, to find out the incidence of any particular pattern in relation to specific gender, to ascertain the authenticity of lip prints as a tool for identification of an individual and establish its evidentiary value. Materials and Methods: The study was conducted on 500 subjects, which included 250 males (4 twins and 250 females, in the age group of 18-30 years. After application of lipstick evenly, the lip print of each subject was obtained on a simple bond paper. The lip prints of each individual were scanned using an image scanner set at a resolution of 600 dpi for better interpretation. Results: We had correctly matched the gender of 487 individuals out of 500 samples taken. We also found that no lip prints were similar among the 500 subjects and even in twins. Interpretation and Conclusion: Along with other traditional methods, cheiloscopy can also serve as a very important tool in the identification of a person based on the characteristic arrangement of lines and grooves appearing on the red portion of the lips. It can be used for sex determination and personal identification for forensic purposes.

  10. Molecular sexing of threatened Gyps vultures: an important strategy for conservation breeding and ecological studies.

    Science.gov (United States)

    Ghorpade, Prabhakar B; Gupta, Praveen K; Prakash, Vibhu; Cuthbert, Richard J; Kulkarni, Mandar; Prakash, Nikita; Das, Asit; Sharma, Anil K; Saini, Mohini

    2012-12-01

    During the last two decades populations of three resident species of Gyps vulture have declined dramatically and are now threatened with extinction in South Asia. Sex identification of vultures is of key importance for the purpose of conservation breeding as it is desirable to have an equal sex ratio in these monogamous species which are housed together in large colony aviaries. Because vultures are monomorphic, with no differences in external morphology or plumage colour between the sexes, other methods are required for sex identification. Molecular methods for sex identification in birds rely on allelic length or nucleotide sequence discrimination of the chromohelicase-DNA binding (CHD) gene located on male and female chromosomes ZZ and ZW, respectively. We characterized the partial sequences of CHD alleles from Gyps indicus, Gyps bengalensis, Gyps himalayensis and Aegypius monachus and analysed the applicability of five molecular methods of sex identification of 46 individual vultures including 26 known-sex G. bengalensis and G. indicus. The results revealed that W-specific PCR in combination with ZW-common PCR is a quick, accurate and simple method, and is ideal for sex identification of vultures. The method is also suitable to augment ecological studies for identifying sex of these endangered birds during necropsy examinations especially when gonads are not apparent, possibly due to regression during non-breeding seasons.

  11. Sex identification of Nigerian indigenous chicks using Auto-sexing ...

    African Journals Online (AJOL)

    Sexing has been a challenging task in Nigerian indigenous chickens due to the monomorphism of chicks which makes it impossible to distinguish the male from the female until eight weeks. . Therefore, this study was carried out to determine the sex of Nigerian indigenous chicks using the common auto-sexing methods.

  12. Application of a sex identification technique in juvenile ostriches and ...

    African Journals Online (AJOL)

    DNA-based sex identification provides a solution and is amenable to large-scale application. The application of the multiplex polymerase chain reaction (PCR) was used to determine the sex of 6-months old juvenile ostriches. The blood from four mature males and four mature females were used to verify the assay. The test ...

  13. Identification of sex using lateral cephalogram: Role of cephalofacial parameters

    Directory of Open Access Journals (Sweden)

    Almas Binnal

    2012-01-01

    Full Text Available Introduction: Recognition of sex is an important aspect of identification of an individual. Apart from pelvis, skull exhibits highest sexual dimorphism in the human body- Lateral cephalograms are an invaluable tool in identification of sex as they reveal architectural and morphological details of the skull on a single radiograph- The equipment required for lateral cephalometry is readily available and the technique is cost-effective, easy to perform, offers quick results, reproducible and can be implemented in any special training for the forensic examiner. The present study was undertaken to evaluate the role of lateral cephalograms and the nine cephalometric variables in the identification of sex and also to derive a discriminant function equation for identification of sex. Materials and methods: A total of 100 lateral cephalograms were taken of 50 male and 50 female subjects aged between 25 and 54 years belonging to South Indian population. The nine derived cephabmetnc parameters were used to arrive at a discriminant function equation which was further assessed for its reliability among the study subjects. Results: Among nine cephalometric parameters used, seven were reliable in the identification of sex. The derived discriminant function equation accurately identified 88% of the male study subjects as males and 84% of the female subjects as females. Conclusion: The lateral cephalograms and the nine cephalometric variables employed in the study are simple and reliable tools of sexual discrimination. The derived discriminant functional equation can be used to accurately identify sex of an individual belonging to South Indian population

  14. Sex determination in Medfly: A molecular approach

    International Nuclear Information System (INIS)

    Saccone, G.; Pane, A.; Testa, G.; Santoro, M.; De Martino, G.; Di Paola, F.; Polito, L.C.; Louis, C.

    2000-01-01

    With the aim of developing new strategies of control to limit the damages inflicted on fruit crops by Ceratitis capitata (Wied.) (Medfly), a biotechnological approach is undertaken whereby female viability would be impaired or male viability would be improved following the introduction of specific genes into the genome of C. capitata. Only males will then be mass produced and released in the infested areas after sterilisation (Louis et al. 1987). Such conditional lethal or 'advantageous' genes could be expressed in transgenic flies either female-specifically or male-specifically by using cis regulative sequences obtained from previously isolated endogenous Ceratitis genes (Saccone et al. 1996, 1998). By using molecular strategies based on a subtractive technique, we have recently isolated male-specifically expressed genes in the Medfly. Furthermore, we present the current status of the research on the Ceratitis dsx gene, showing sex-specific alternative splicing as in Drosophila, and on the tra-inaZ strategy to induce in Drosophila flies female-specific conditional lethality

  15. Molecular DNA Analysis in Forensic Identification.

    Science.gov (United States)

    Dumache, Raluca; Ciocan, Veronica; Muresan, Camelia; Enache, Alexandra

    2016-01-01

    Serological and biochemical identification methods used in forensics have several major disadvantages, such as: long time in processing biological sample and lack of sensitivity and specificity. In the last 30 years, DNA molecular analysis has become an important tool in forensic investigations. DNA profiling is based on the short tandem repeats (STR) and aids in human identification from biological samples. Forensic genetics, can provide information on the events which occurred at the crime scene or to supplement other methods of forensic identification. Currently, the methods used in identification are based on polymerase chain reaction (PCR) analyses. This method analyses the autosomal STRs, the Y-chromosome, and the mitochondrial DNA. Correlation of biological samples present at the crime scene with identification, selection, and the probative value factor is therefore the first aspect to be taken into consideration in the forensic genetic analysis. In the last decade, because of the advances in the field of molecular biology, new biomarkers such as: microRNAs (miR), messenger RNA (mRNA), and DNA methylation have been studied and proposed to be used in the forensic identifications of body fluids.

  16. Sex identification of four penguin species using locus-specific PCR.

    Science.gov (United States)

    Zhang, Peijun; Han, Jiabo; Liu, Quansheng; Zhang, Junxin; Zhang, Xianfeng

    2013-01-01

    Traditional methods for sex identification are not applicable to sexually monomorphic species, leading to difficulties in the management of their breeding programs. To identify sex in sexually monomorphic birds, molecular methods have been established. Two established primer pairs (2550F/2718R and p8/p2) amplify the CHD1 gene region from both the Z and W chromosomes. Here, we evaluated the use of these primers for sex identification in four sexually monomorphic penguin species: king penguins (Aptenodytes patagonicus), rockhopper penguins (Eudyptes chrysocome), gentoo penguins (Pygoscelis papua), and Magellanic penguins (Spheniscus magellanicus). For all species except rockhopper penguins, primer pair 2550F/2718R resulted in two distinct CHD1Z and CHD1W PCR bands, allowing for sex identification. For rockhopper penguins, only primer pair p8/p2 yielded different CHD1Z and CHD1W bands, which were faint and similar in size making them difficult to distinguish. As a result, we designed a new primer pair (PL/PR) that efficiently determined the gender of individuals from all four penguin species. Sequencing of the PCR products confirmed that they were from the CHD1 gene region. Primer pair PL/PR can be evaluated for use in sexing other penguin species, which will be crucial for the management of new penguin breeding programs. © 2012 Wiley Periodicals, Inc.

  17. Molecular basis of the evolution of sex

    International Nuclear Information System (INIS)

    Bernstein, H.; Hopf, F.A.; Michod, R.E.

    1987-01-01

    In this review, the authors present evidence for a hypothesis that the primary benefit of sexual reproduction is repair of DNA and masking of mutations, as opposed to the traditional view that sexual reproduction is an adaptation for producing genetic variation through allelic recombination. The two fundamental aspects of sex, recombination and outcrossing, are adaptive responses to the two major sources of noise in transmitting genetic information, DNA damage and replication errors. The authors refer to this view as the repair hypothesis, and review types of DNA damage that occur in various organisms. In dealing with damage, recombination produces a form of informational noise, allelic recombination, as a by-product. Recombinational repair is the only repair process known which can overcome double-strand damages in DNA. The authors provide a rationale for their theory of the origin and evolution of sex explained as a continuum by the repair hypothesis. Alternate theories are also described

  18. Molecular identification of the Sporothrix schenckii complex.

    Science.gov (United States)

    Oliveira, Manoel Marques Evangelista; Almeida-Paes, Rodrigo; Gutierrez-Galhardo, Maria Clara; Zancope-Oliveira, Rosely M

    2014-01-01

    Sporothrix schenckii, an ascomycetous dimorphic organism that for over a century was recognized as the sole agent of sporotrichosis, a subcutaneous mycosis with a worldwide distribution. However, it has been proposed, based on physiologic and molecular aspects, that S. schenckii is a complex of distinct species: Sporothrix brasiliensis, Sporothrix mexicana, Sporothrix globosa, S. schenckii sensu strictu, Sporothrix luriei, and Sporothrix albicans (formerly Sporothrix pallida). Human disease has a broad range of clinical manifestations and can be classified into fixed cutaneous, lymphocutaneous, disseminated cutaneous, and extracutaneous sporotrichosis. The gold standard for the diagnosis of sporotrichosis is the culture; however, serologic, histopathologic and molecular approaches have been recently adopted for the diagnosis of this mycosis. Few molecular methods have been applied to the diagnosis of sporotrichosis to detect S. schenckii DNA from clinical specimens, and to identify Sporothrix spp. in culture. Until now, Sporothrix is the unique clinically relevant dimorphic fungus without an elucidated genome sequence, thus limiting molecular knowledge about the cryptic species of this complex, and the sexual form of all S. schenckii complex species. In this review we shall focus on the current diagnosis of the sporotrichosis, and discuss the current molecular tools applied to the diagnosis and identification of the Sporothrix complex species. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  19. Toward the identification of molecular cogs.

    Science.gov (United States)

    Dziubiński, Maciej; Lesyng, Bogdan

    2016-04-05

    Computer simulations of molecular systems allow determination of microscopic interactions between individual atoms or groups of atoms, as well as studies of intramolecular motions. Nevertheless, description of structural transformations at the mezoscopic level and identification of causal relations associated with these transformations is very difficult. Structural and functional properties are related to free energy changes. Therefore, to better understand structural and functional properties of molecular systems, it is required to deepen our knowledge of free energy contributions arising from molecular subsystems in the course of structural transformations. The method presented in this work quantifies the energetic contribution of each pair of atoms to the total free energy change along a given collective variable. Next, with the help of a genetic clustering algorithm, the method proposes a division of the system into two groups of atoms referred to as molecular cogs. Atoms which cooperate to push the system forward along a collective variable are referred to as forward cogs, and those which work in the opposite direction as reverse cogs. The procedure was tested on several small molecules for which the genetic clustering algorithm successfully found optimal partitionings into molecular cogs. The primary result of the method is a plot depicting the energetic contributions of the identified molecular cogs to the total Potential of Mean Force (PMF) change. Case-studies presented in this work should help better understand the implications of our approach, and were intended to pave the way to a future, publicly available implementation. © 2015 Wiley Periodicals, Inc.

  20. Molecular Sexing in Songbirds (Passeriformes) and its Importance

    OpenAIRE

    KABASAKAL, Bekir; ALBAYRAK, Tamer

    2018-01-01

    In many passerinespecies, adults do not show sexual dimorphism and sexual dichromatism. For thisreason, external morphology is not often used for sex determination.Furthermore, traditional sexing methods are often used for adults inreproductive period and cannot be used for nestlings. Molecular sexdetermination provides an alternative method which is easier than thetraditional methods. In this manner, it is very important for many studies onbehavioural ecology, conservation biology and popula...

  1. Sex speeds adaptation by altering the dynamics of molecular evolution.

    Science.gov (United States)

    McDonald, Michael J; Rice, Daniel P; Desai, Michael M

    2016-03-10

    Sex and recombination are pervasive throughout nature despite their substantial costs. Understanding the evolutionary forces that maintain these phenomena is a central challenge in biology. One longstanding hypothesis argues that sex is beneficial because recombination speeds adaptation. Theory has proposed several distinct population genetic mechanisms that could underlie this advantage. For example, sex can promote the fixation of beneficial mutations either by alleviating interference competition (the Fisher-Muller effect) or by separating them from deleterious load (the ruby in the rubbish effect). Previous experiments confirm that sex can increase the rate of adaptation, but these studies did not observe the evolutionary dynamics that drive this effect at the genomic level. Here we present the first, to our knowledge, comparison between the sequence-level dynamics of adaptation in experimental sexual and asexual Saccharomyces cerevisiae populations, which allows us to identify the specific mechanisms by which sex speeds adaptation. We find that sex alters the molecular signatures of evolution by changing the spectrum of mutations that fix, and confirm theoretical predictions that it does so by alleviating clonal interference. We also show that substantially deleterious mutations hitchhike to fixation in adapting asexual populations. In contrast, recombination prevents such mutations from fixing. Our results demonstrate that sex both speeds adaptation and alters its molecular signature by allowing natural selection to more efficiently sort beneficial from deleterious mutations.

  2. Endoscopic Sex Identification in Chelonians and Birds (Psittacines, Passerines, and Raptors).

    Science.gov (United States)

    Divers, Stephen J

    2015-09-01

    Despite the advent of DNA probes for sex identification of many avian and some reptile species, clinicians involved with zoos, conservation projects, or breeders may still be asked to perform "surgical sexing." This article describes the practical approach to performing endoscopic sex identification in psittacines and chelonians, including patient preparation, anesthesia, and endoscopic procedure. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Sex Change in Clownfish: Molecular Insights from Transcriptome Analysis

    KAUST Repository

    Casas, Laura

    2016-10-17

    Sequential hermaphroditism is a unique reproductive strategy among teleosts that is displayed mainly in fish species living in the coral reef environment. The reproductive biology of hermaphrodites has long been intriguing; however, very little is known about the molecular pathways underlying their sex change. Here, we provide the first de novo transcriptome analyses of a hermaphrodite teleost´s undergoing sex change in its natural environment. Our study has examined relative gene expression across multiple groups—rather than just two contrasting conditions— and has allowed us to explore the differential expression patterns throughout the whole process. Our analysis has highlighted the rapid and complex genomic response of the brain associated with sex change, which is subsequently transmitted to the gonads, identifying a large number of candidate genes, some well-known and some novel, involved in the process. The present study provides strong evidence of the importance of the sex steroidogenic machinery during sex change in clownfish, with the aromatase gene playing a central role, both in the brain and the gonad. This work constitutes the first genome-wide study in a social sex-changing species and provides insights into the genetic mechanism governing social sex change and gonadal restructuring in protandrous hermaphrodites.

  4. Antifungal activity and molecular identification of endophytic fungi ...

    African Journals Online (AJOL)

    Antifungal activity and molecular identification of endophytic fungi from the angiosperm Rhodomyrtus tomentosa. Juthatip Jeenkeawpieam, Souwalak Phongpaichit, Vatcharin Rukachaisirikul, Jariya Sakayaroj ...

  5. Molecular Genetic Identification Of Some Flax Mutants

    International Nuclear Information System (INIS)

    AMER, I.M.; MOUSTAFA, H.A.M.

    2009-01-01

    Five flax genotypes (Linum usitatissimum L.) i.e., commercial cultivar Sakha 2, the mother variety Giza 4 and three mutant types induced by gamma rays, were screened for their salinity tolerance in field experiments (salinity concentration was 8600 and 8300 ppm for soil and irrigation water, respectively). Mutation 6 was the most salt tolerant as compared to the other four genotypes.RAPD technique was used to detect some molecular markers associated with salt tolerance in flax (Mut 6), RAPD-PCR results using 12 random primers exhibited 149 amplified fragments; 91.9% of them were polymorphic and twelve molecular markers (8.1%) for salt tolerant (mutant 6) were identified with molecular size ranged from 191 to 4159 bp and only eight primers successes to amplify these specific markers. Concerning the other mutants, Mut 15 and Mut 25 exhibited 4.3% and 16.2% specific markers, respectively. The induced mutants exhibited genetic similarity to the parent variety were about 51%, 58.3% and 61.1% for Mut 25, Mut 6 and Mut 15, respectively. These specific markers (SM) are used for identification of the induced mutations and it is important for new variety registration.

  6. Self-Esteem, Parent Identification and Sex Role Development in Preschool Age Boys and Girls

    Science.gov (United States)

    Flammer, Donald P.

    1971-01-01

    Self esteem was shown to be associated more closely to high sex role orientation for boys and low sex role adoption for girls; while father identification, for boys only, was related to moderate levels of sex role orientation and sex role preference. Bibliography. (Author)

  7. Molecular identification of tsetse fly (Diptera: Glossinidae) species ...

    African Journals Online (AJOL)

    Christopher

    2015-05-13

    May 13, 2015 ... plates (Bauer and Wetzel, 1976). The blood is usually collected ... number of males and females, although sex was not considerd in the identification. .... Basic local alignment search tool (BLAST) of the DNA sequences of COII ...

  8. Molecular prey identification in Central European piscivores.

    Science.gov (United States)

    Thalinger, Bettina; Oehm, Johannes; Mayr, Hannes; Obwexer, Armin; Zeisler, Christiane; Traugott, Michael

    2016-01-01

    Diet analysis is an important aspect when investigating the ecology of fish-eating animals and essential for assessing their functional role in food webs across aquatic and terrestrial ecosystems. The identification of fish remains in dietary samples, however, can be time-consuming and unsatisfying using conventional morphological analysis of prey remains. Here, we present a two-step multiplex PCR system, comprised of six assays, allowing for rapid, sensitive and specific detection of fish DNA in dietary samples. This approach encompasses 78 fish and lamprey species native to Central European freshwaters and enables the identification of 31 species, six genera, two families, two orders and two fish family clusters. All targeted taxa were successfully amplified from 25 template molecules, and each assay was specific when tested against a wide range of invertebrates and vertebrates inhabiting aquatic environments. The applicability of the multiplex PCR system was evaluated in a feeding trial, wherein it outperformed morphological prey analysis regarding species-specific prey identification in faeces of Eurasian otters. Additionally, a wide spectrum of fish species was detected in field-collected faecal samples and regurgitated pellets of Common Kingfishers and Great Cormorants, demonstrating the broad applicability of the approach. In conclusion, this multiplex PCR system provides an efficient, easy to use and cost-effective tool for assessing the trophic ecology of piscivores in Central Europe. Furthermore, the multiplex PCRs and the primers described therein will be applicable wherever DNA of the targeted fish species needs to be detected at high sensitivity and specificity. © 2015 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  9. Restricted Freedom: Negotiating Same-Sex Identifications in the Residential Spaces of a South African University

    Science.gov (United States)

    Msibi, Thabo; Jagessar, Valenshia

    2015-01-01

    International higher education research focused on students who claim same-sex identifications in university residential spaces has tended to prioritise the "gay as victim" discourse, often leading to the pathologising of same-sex identification. While there is emerging research seeking to challenge this dimension of scholarship by…

  10. Molecular identification of polydorid polychaetes (Annelida ...

    African Journals Online (AJOL)

    The early detection and correct identification of polydorid polychaete species is essential as they are often encountered as invasive alien pests in aquaculture facilities or the intertidal where they may modify the ecosystem. Accurate identification is, however, often hampered by high levels of morphological similarity among ...

  11. Identification, molecular characterization, and analysis of the ...

    Indian Academy of Sciences (India)

    Qiyan Du. E-mail: 041019@htu.edu.cn. Abstract. Sox7, Sox17, and Sox18 are members of the ... chondrogenesis, in endoderm development, and in sex determination and ...... Stimulating protein 1, ubiquitous zinc finger transcription factor. +.

  12. Molecular identification of the first SIFamide receptor

    DEFF Research Database (Denmark)

    Jørgensen, Lars M; Hauser, Frank; Cazzamali, Giuseppe

    2006-01-01

    , an impressive sequence conservation (67-77% amino acid sequence identities between the seven-transmembrane areas; 82-87% sequence similarities). The identification of well-conserved SIFamide receptor orthologues in all other insects with a sequenced genome, suggests that the SIFamide/receptor couple must have...... an essential function in arthropods. This paper is the first report on the identification of a SIFamide receptor....

  13. Proteomic identification of gender molecular markers in Bothrops jararaca venom.

    Science.gov (United States)

    Zelanis, André; Menezes, Milene C; Kitano, Eduardo S; Liberato, Tarcísio; Tashima, Alexandre K; Pinto, Antonio F M; Sherman, Nicholas E; Ho, Paulo L; Fox, Jay W; Serrano, Solange M T

    2016-04-29

    Variation in the snake venom proteome is a well-documented phenomenon; however, sex-based variation in the venom proteome/peptidome is poorly understood. Bothrops jararaca shows significant sexual size dimorphism and here we report a comparative proteomic/peptidomic analysis of venoms from male and female specimens and correlate it with the evaluation of important venom features. We demonstrate that adult male and female venoms have distinct profiles of proteolytic activity upon fibrinogen and gelatin. These differences were clearly reflected in their different profiles of SDS-PAGE, two-dimensional electrophoresis and glycosylated proteins. Identification of differential protein bands and spots between male or female venoms revealed gender-specific molecular markers. However, the proteome comparison by in-solution trypsin digestion and label-free quantification analysis showed that the overall profiles of male and female venoms are similar at the polypeptide chain level but show striking variation regarding their attached carbohydrate moieties. The analysis of the peptidomes of male and female venoms revealed different contents of peptides, while the bradykinin potentiating peptides (BPPs) showed rather similar profiles. Furthermore we confirmed the ubiquitous presence of four BPPs that lack the C-terminal Q-I-P-P sequence only in the female venom as gender molecular markers. As a result of these studies we demonstrate that the sexual size dimorphism is associated with differences in the venom proteome/peptidome in B. jararaca species. Moreover, gender-based variations contributed by different glycosylation levels in toxins impact venom complexity. Bothrops jararaca is primarily a nocturnal and generalist snake species, however, it exhibits a notable ontogenetic shift in diet and in venom proteome upon neonate to adult transition. As is common in the Bothrops genus, B. jararaca shows significant sexual dimorphism in snout-vent length and weight, with females being

  14. Molecular study of developmental sex disorders in children

    African Journals Online (AJOL)

    Soheir S. AboElella

    2015-03-07

    Mar 7, 2015 ... development, causing divergences between genetic sex, gonadal sex and phenotypic sex ... neonatal history of failure to thrive, vomiting, skin pigmen- tations and .... of them (12 & 14) suffered from hypoglycemia. Hormonal ...

  15. Conflicted Identification in the Sex Education Classroom: Balancing Professional Values With Organizational Mandates.

    Science.gov (United States)

    Williams, Elizabeth A; Jensen, Robin E

    2016-09-01

    Despite enormous resources spent on sex education, the United States faces an epidemic of unplanned pregnancy and sexually transmitted infections among young people. Little research has examined the role sex educators play in alleviating or exacerbating this problem. In this study, we interviewed 50 sex educators employed by public schools throughout a Midwestern, U.S. state about their experiences in the sex education classroom. Twenty-two interviewees communicated feelings of conflicted identification and provided examples of the ways in which they experienced this subjectivity in the context of their employment. We find these interviews shed light on the as-yet-understudied communicative experience of conflicted identification by delineating key sources of such conflict and discursive strategies used in its negotiation. Our results suggest that those who experience conflicted identification and who have a sense of multiple or nested identifications within their overarching professional identity may be safeguarded to some extent from eventual organizational disidentification. © The Author(s) 2015.

  16. Gender Identification in Date Palm Using Molecular Markers.

    Science.gov (United States)

    Awan, Faisal Saeed; Maryam; Jaskani, Muhammad J; Sadia, Bushra

    2017-01-01

    Breeding of date palm is complicated because of its long life cycle and heterozygous nature. Sexual propagation of date palm does not produce true-to-type plants. Sex of date palms cannot be identified until the first flowering stage. Molecular markers such as random amplified polymorphic DNA (RAPD), sequence-characterized amplified regions (SCAR), and simple sequence repeats (SSR) have successfully been used to identify the sex-linked loci in the plant genome and to isolate the corresponding genes. This chapter highlights the use of three molecular markers including RAPD, SCAR, and SSR to identify the gender of date palm seedlings.

  17. Molecular prey identification in Central European piscivores

    OpenAIRE

    Thalinger, Bettina; Oehm, Johannes; Mayr, Hannes; Obwexer, Armin; Zeisler, Christiane; Traugott, Michael

    2015-01-01

    Abstract Diet analysis is an important aspect when investigating the ecology of fish?eating animals and essential for assessing their functional role in food webs across aquatic and terrestrial ecosystems. The identification of fish remains in dietary samples, however, can be time?consuming and unsatisfying using conventional morphological analysis of prey remains. Here, we present a two?step multiplex PCR system, comprised of six assays, allowing for rapid, sensitive and specific detection o...

  18. Molecular species identification and population genetics of ...

    African Journals Online (AJOL)

    Molecular genetic techniques, such as DNA barcoding and genotyping, are increasingly being used to assist with the conservation and management of chondrichthyans worldwide. Southern Africa is a shark biodiversity hotspot, with a large number of endemic species. According to the IUCN Red List, a quarter of South ...

  19. Molecular Identification of Methicillin-Resistant Staphylococcus ...

    African Journals Online (AJOL)

    We use the molecular techniques of PCR and PFGE to identify MRSA from clinical isolates of Staphylococcus aureus causing infections among hospitalized patients in Benin-City, Nigeria. A total of 36 isolates were obtained from the University of Benin Teaching Hospital between July-September, 2007. The MRSA strains ...

  20. Molecular identification and genotyping of Microsporidia in selected hosts

    Czech Academy of Sciences Publication Activity Database

    Valenčáková, A.; Balent, P.; Ravaszová, P.; Horák, Aleš; Oborník, Miroslav; Halanová, M.; Malčeková, B.; Novotný, F.; Goldová, M.

    2012-01-01

    Roč. 110, č. 2 (2012), s. 689-693 ISSN 0932-0113 Institutional research plan: CEZ:AV0Z60220518 Keywords : ENCEPHALITOZOON-CUNICULI * RIBOSOMAL-RNA * SPECIES IDENTIFICATION * AIDS PATIENTS * PET RABBITS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.852, year: 2012

  1. Seasonal abundance and molecular identification of West Nile virus ...

    African Journals Online (AJOL)

    Seasonal abundance and molecular identification of West Nile virus vectors, Culex pipens and Culex ... Background: West Nile virus (WNV) infection, is an arbovirus infection with high morbidity and mortality, the vector respon- sible for both human ... Major diseases transmitted are known as Arboviral dis- eases because ...

  2. Molecular cytogenetic identification of a novel dwarf wheat line with ...

    Indian Academy of Sciences (India)

    2012-01-08

    Jan 8, 2012 ... of a pAs1 hybridization band on 2DL chromosome of 31505-1. Two SSR ... [Chen G, Zheng Q, Bao Y, Liu S, Wang H and Li X 2012 Molecular cytogenetic identification of a novel dwarf wheat line with ..... translocations (Fedak and Han 2005; Li et al. ... growth (Cambridge, UK: Cambridge University Press).

  3. Molecular identification of Lodoicea maldivica (coco de mer seeds

    Directory of Open Access Journals (Sweden)

    Mok Chuen-shing

    2011-09-01

    Full Text Available Abstract Background The edible endosperm of Lodoicea maldivica with the common name of coco de mer is used in Chinese medicine for treating cough. Native to Seychelles, Lodoicea maldivica seeds have commanded high prices for centuries due to its scarcity. This study aims to develop a molecular identification method for the authentication of Lodoicea maldivica seeds. Methods DNA was extracted from the sample. Two polymerase chain reaction (PCR systems were developed to amplify a region of the chloroplast DNA and the nuclear phosphoribulokinase (PRK region specific to Lodoicea maldivica respectively. DNA sequence of a sample was determined and compared with that of the Lodoicea maldivica reference material. Results The PRK gene of Lodoicea maldivica was successfully amplified and sequenced for identification. Conclusion A new molecular method for the identification of Lodoicea maldivica seeds in fresh, frozen or dried forms was developed.

  4. Molecular sexing of threatened Gyps vultures: an important strategy for conservation breeding and ecological studies

    OpenAIRE

    Ghorpade, Prabhakar B; Gupta, Praveen K; Prakash, Vibhu; Cuthbert, Richard J; Kulkarni, Mandar; Prakash, Nikita; Das, Asit; Sharma, Anil K; Saini, Mohini

    2012-01-01

    During the last two decades populations of three resident species of Gyps vulture have declined dramatically and are now threatened with extinction in South Asia. Sex identification of vultures is of key importance for the purpose of conservation breeding as it is desirable to have an equal sex ratio in these monogamous species which are housed together in large colony aviaries. Because vultures are monomorphic, with no differences in external morphology or plumage colour between the sexes, o...

  5. The isolated Leptospira Spp. Identification by molecular biological techniques

    Directory of Open Access Journals (Sweden)

    Duangjai Suwancharoen

    2017-01-01

    Full Text Available Leptospirosis is a zoonotic disease caused by the bacteria of Leptospira spp. Identification of this bacterium relies on serotyping and genotyping. Data base for animal causative serovars in Thailand is limited. As the unknown serovars are found in the laboratory, they need to be sent overseas for referent identification. To reduce the cost, this research intended to develop a leptospiral identification method which is user–friendly and able to classify efficiently. Ten Leptospira isolations were cultured from urine samples. They were identified by three molecular biological techniques, including Pulsed-Field Gel Electrophoresis (PFGE, Variable Number Tandem Repeat (VNTR and Multilocus Sequence Typing (MLST. These methods were developed and compared to find the most suitable one for leptospiral identification. VNTR was found to be inappropriate since it could not identify the agents and it did not show the PCR product. PFGE and MLST gave the same results of the unknown 1 and 2 which were L.weilii sv Samin st Samin. Unknown 4 showed different results by each technique. Unknown 5 to 10 were likely to be L.meyeri sv Ranarum st ICF and Leptonema illini sv Illini st 3055 by PFGE but MLST could not identify the serovar. However, molecular biological technique for Leptospira identification should be done by several methods in order to confirm the result of each other.

  6. DNA barcode-based molecular identification system for fish species.

    Science.gov (United States)

    Kim, Sungmin; Eo, Hae-Seok; Koo, Hyeyoung; Choi, Jun-Kil; Kim, Won

    2010-12-01

    In this study, we applied DNA barcoding to identify species using short DNA sequence analysis. We examined the utility of DNA barcoding by identifying 53 Korean freshwater fish species, 233 other freshwater fish species, and 1339 saltwater fish species. We successfully developed a web-based molecular identification system for fish (MISF) using a profile hidden Markov model. MISF facilitates efficient and reliable species identification, overcoming the limitations of conventional taxonomic approaches. MISF is freely accessible at http://bioinfosys.snu.ac.kr:8080/MISF/misf.jsp .

  7. Sex Change in Clownfish: Molecular Insights from Transcriptome Analysis

    KAUST Repository

    Casas, Laura; Saborido-Rey, Fran; Ryu, Tae Woo; Michell, Craig; Ravasi, Timothy; Irigoien, Xabier

    2016-01-01

    steroidogenic machinery during sex change in clownfish, with the aromatase gene playing a central role, both in the brain and the gonad. This work constitutes the first genome-wide study in a social sex-changing species and provides insights into the genetic

  8. Sex identification of polar bears from blood and tissue samples

    Science.gov (United States)

    Amstrup, Steven C.; Garner, G.W.; Cronin, M.A.; Patton, J.C.

    1993-01-01

    Polar bears (Ursus maritimus) can be adversely affected by hunting and other human perturbations because of low population densities and low reproduction rates. The sustainable take of adult females may be as low as 1.5% of the population. Females and accompanying young are most vulnerable to hunting, and hunters have not consistently reported the sex composition of the harvest, therefore a method to confirm the sexes of polar bears harvested in Alaska is needed. Evidence of the sex of harvested animals is often not available, but blood or other tissue samples often are. We extracted DNA from tissue and blood samples, and amplified segments of zinc finger (ZFX and ZFY) genes from both X and Y chromosomes with the polymerase chain reaction. Digestion of amplified portions of the X chromosome with the restriction enzyme HaeIII resulted in subdivision of the original amplified segment into four smaller fragments. Digestion with HaeIII did not subdivide the original segment amplified from the Y chromosome. The differing fragment sizes produced patterns in gel electrophoresis that distinguished samples from male and female bears 100% of the time. This technique is applicable to the investigation of many wildlife management and research questions.

  9. Mayfly and fish species identification and sex determination in bleak (Alburnus alburnus) by MALDI-TOF mass spectrometry.

    Science.gov (United States)

    Maasz, G; Takács, P; Boda, P; Varbiro, G; Pirger, Z

    2017-12-01

    Besides food quality control of fish or cephalopods, the novel mass spectrometry (MS) approaches could be effective and beneficial methods for the investigation of biodiversity in ecological research. Our aims were to verify the applicability of MALDI-TOF MS in the rapid identification of closely related species, and to further develop it for sex determination in phenotypically similar fish focusing on the low mass range. For MALDI-TOF MS spectra analysis, ClinProTools software was applied, but our observed classification was also confirmed by Self Organizing Map. For verifying the wide applicability of the method, brains from invertebrate and vertebrate species were used in order to detect the species related markers from two mayflies and eight fish as well as sex-related markers within bleak. Seven Ephemera larvae and sixty-one fish species related markers were observed and nineteen sex-related markers were identified in bleak. Similar patterns were observed between the individuals within one species. In contrast, there were markedly diverse patterns between the different species and sexes visualized by SOMs. Two different Ephemera species and male or female fish were identified with 100% accuracy. The various fish species were classified into 8 species with a high level of accuracy (96.2%). Based on MS data, dendrogram was generated from different fish species by using ClinProTools software. This MS-based dendrogram shows relatively high correspondence with the phylogenetic relationships of both the studied species and orders. In summary, MALDI-TOF MS provides a cheap, reliable, sensitive and fast identification tool for researchers in the case of closely related species using mass spectra acquired in a low mass range to define specific molecular profiles. Moreover, we presented evidence for the first time for determination of sex within one fish species by using this method. We conclude that it is a powerful tool that can revolutionize ecological and

  10. Molecular diagnostic testing for Klinefelter syndrome and other male sex chromosome aneuploidies

    Directory of Open Access Journals (Sweden)

    Hager Karl

    2012-04-01

    Full Text Available Abstract Background Male sex chromosome aneuploidies are underdiagnosed despite concomitant physical and behavioral manifestations. Objective To develop a non-invasive, rapid and high-throughput molecular diagnostic assay for detection of male sex chromosome aneuploidies, including 47,XXY (Klinefelter, 47,XYY, 48,XXYY and 48,XXXY syndromes. Methods The assay utilizes three XYM and four XA markers to interrogate Y:X and X:autosome ratios, respectively. The seven markers were PCR amplified using genomic DNA isolated from a cohort of 323 males with aneuploid (n = 117 and 46,XY (n = 206 karyotypes. The resulting PCR products were subjected to Pyrosequencing, a quantitative DNA sequencing method. Results Receiver operator characteristic (ROC curves were used to establish thresholds for the discrimination of aneuploid from normal samples. The XYM markers permitted the identification of 47,XXY, 48,XXXY and 47,XYY syndromes with 100% sensitivity and specificity in both purified DNA and buccal swab samples. The 48,XXYY karyotype was delineated by XA marker data from 46,XY; an X allele threshold of 43% also permitted detection of 48,XXYY with 100% sensitivity and specificity. Analysis of X chromosome-specific biallelic SNPs demonstrated that 43 of 45 individuals (96% with 48,XXYY karyotype had two distinct X chromosomes, while 2 (4% had a duplicate X, providing evidence that 48,XXYY may result from nondisjunction during early mitotic divisions of a 46,XY embryo. Conclusions Quantitative Pyrosequencing, with high-throughput potential, can detect male sex chromosome aneuploidies with 100% sensitivity.

  11. Identification of a sex pheromone of the chrysanthemum lace bug Corythucha marmorata (Hemiptera: Tingidae).

    Science.gov (United States)

    Watanabe, Kisaki; Shimizu, Nobuhiro

    2017-08-04

    Although the nymphs of Corythucha marmorata form clusters on the undersides of host plant leaves, as frequently observed for Hemiptera, the adults are scattered in the vicinity of the nymph population. By investigating the biological activities of volatile secretions from the adult, we found that the secretions activated male mounting behaviour. A chemical analysis revealed that borneol was a common component of the secretions from both sexes. The absolute configuration of the natural product was the (+)-enantiomer of borneol and the optical isomer was undetectable. Although (+)-borneol showed significant sex pheromone activity against males, the antipode (-)-borneol also induced sex pheromone activity, albeit only slightly. Males may not have a strict identification mechanism based on stereochemistry. To verify the origin of this sex pheromone, we analysed the components of the essential oil of the leaves of Solidago canadensis L. (Compositae: Asteraceae), a host plant; bornyl acetate was detected to be a major component. The plant-produced bornyl acetate had different stereochemistry from the sex pheromone. The results suggested that the adults do not utilise the secondary metabolites of plants but biosynthesise this sex pheromone themselves. This is the first report on sex pheromone identification in Tingidae.

  12. Manipulation of arthropod sex determination by endosymbionts : Diversity and molecular mechanisms

    NARCIS (Netherlands)

    Ma, W. -J.; Vavre, F.; Beukeboom, L. W.

    2014-01-01

    Arthropods exhibit a large variety of sex determination systems both at the chromosomal and molecular level. Male heterogamety, female heterogamety, and haplodiploidy occur frequently, but partially different genes are involved. Endosymbionts, such as Wolbachia, Cardinium, Rickettsia, and

  13. Rapid Molecular Identification of Human Taeniid Cestodes by Pyrosequencing Approach

    Science.gov (United States)

    Thanchomnang, Tongjit; Tantrawatpan, Chairat; Intapan, Pewpan M.; Sanpool, Oranuch; Janwan, Penchom; Lulitanond, Viraphong; Tourtip, Somjintana; Yamasaki, Hiroshi; Maleewong, Wanchai

    2014-01-01

    Taenia saginata, T. solium, and T. asiatica are causative agents of taeniasis in humans. The difficulty of morphological identification of human taeniids can lead to misdiagnosis or confusion. To overcome this problem, several molecular methods have been developed, but use of these tends to be time-consuming. Here, a rapid and high-throughput pyrosequencing approach was developed for the identification of three human taeniids originating from various countries. Primers targeting the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene of the three Taenia species were designed. Variations in a 26-nucleotide target region were used for identification. The reproducibility and accuracy of the pyrosequencing technology was confirmed by Sanger sequencing. This technique will be a valuable tool to distinguish between sympatric human taeniids that occur in Thailand, Asia and Pacific countries. This method could potentially be used for the molecular identification of the taeniid species that might be associated with suspicious cysts and lesions, or cyst residues in humans or livestock at the slaughterhouse. PMID:24945530

  14. Rapid molecular identification of human taeniid cestodes by pyrosequencing approach.

    Directory of Open Access Journals (Sweden)

    Tongjit Thanchomnang

    Full Text Available Taenia saginata, T. solium, and T. asiatica are causative agents of taeniasis in humans. The difficulty of morphological identification of human taeniids can lead to misdiagnosis or confusion. To overcome this problem, several molecular methods have been developed, but use of these tends to be time-consuming. Here, a rapid and high-throughput pyrosequencing approach was developed for the identification of three human taeniids originating from various countries. Primers targeting the mitochondrial cytochrome c oxidase subunit 1 (cox1 gene of the three Taenia species were designed. Variations in a 26-nucleotide target region were used for identification. The reproducibility and accuracy of the pyrosequencing technology was confirmed by Sanger sequencing. This technique will be a valuable tool to distinguish between sympatric human taeniids that occur in Thailand, Asia and Pacific countries. This method could potentially be used for the molecular identification of the taeniid species that might be associated with suspicious cysts and lesions, or cyst residues in humans or livestock at the slaughterhouse.

  15. Species identification and sex determination of the genus Nepenthes (Nepenthaceae).

    Science.gov (United States)

    Mokkamul, Piya; Chaveerach, Arunrat; Sudmoon, Runglawan; Tanee, Tawatchai

    2007-02-15

    Nepenthes species are well known for their ornamentally attractive pitchers. The species diversity was randomly surveyed in some conservation areas of Thailand and three species were found, namely N. gracilis Korth., N. mirabilis Druce. and N. smilesii Hemsl. Young plants as unknown species from Chatuchak market were added in plant sampled set. Thirty two Inter Simple Sequence Repeat (ISSR) primers were screened and 13 successful primers were used to produce DNA banding patterns for constructing a dendrogram. The dendrogram is potentially power tool to identify unknown species from Chatuchak market, differentiate species population, population by geographical areas and sex determination. The geographical area of N. mirabilis was specified to Southern and Northeastern regions and finally, subdivided into exact areas according to province. Male and female plants of N. gracilis at Phu Wua Wildlife Sanctuary and N. mirabilis at Bung Khonglong non-hunting area were determined. Two unknown species from Chatuchak market were analyzed to be N. mirabilis with the genetic similarities (S) 77.2 to 84.7. Be more sex specific in all sample studied, 37 Random Amplified Polymorphic DNA (RAPD) primers were investigated. The result shows that only one RAPD primer show high resolution results at about 750 bp specific male-related marker.

  16. Sex differences in the timing of identification among children and adults with autism spectrum disorders

    NARCIS (Netherlands)

    Begeer, S.; Mandell, S.; Wijnker-Holmes, B.; Venderbosch, S.; Rem, D.; Stekelenburg, F.; Koot, H.M.

    2013-01-01

    To examine differences by sex in the timing of identification of individuals with autism spectrum disorders (ASD), survey data were collected in the Netherlands from 2,275 males and females with autistic disorder, Asperger's syndrome and PDD-NOS. Among participants <18 years of age, females with

  17. Transcriptome Sequencing Analysis and Functional Identification of Sex Differentiation Genes from the Mosquito Parasitic Nematode, Romanomermis wuchangensis.

    Directory of Open Access Journals (Sweden)

    Mingyue Duan

    Full Text Available Mosquito-transmitted diseases like malaria and dengue fever are global problem and an estimated 50-100 million of dengue or dengue hemorrhagic fever cases are reported worldwide every year. The mermithid nematode Romanomermis wuchangensis has been successfully used as an ecosystem-friendly biocontrol agent for mosquito prevention in laboratory studies. However, this nematode can not undergo sex differentiation in vitro culture, which has seriously affected their application of biocontrol in the field. In this study, based on transcriptome sequencing analysis of R. wuchangensis, Rwucmab-3, Rwuclaf-1 and Rwuctra-2 were cloned and used to investigate molecular regulatory function of sex differentiation. qRT-PCR results demonstrated that the expression level of Rwucmab-3 between male and female displayed obvious difference on the 3rd day of parasitic stage, which was earlier than Rwuclaf-1 and Rwuctra-2, highlighting sex differentiation process may start on the 3rd day of parasitic stage. Besides, FITC was used as a marker to test dsRNA uptake efficiency of R. wuchangensis, which fluorescence intensity increased with FITC concentration after 16 h incubation, indicating this nematode can successfully ingest soaking solution via its cuticle. RNAi results revealed the sex ratio of R. wuchangensis from RNAi treated groups soaked in dsRNA of Rwucmab-3 was significantly higher than gfp dsRNA treated groups and control groups, highlighting RNAi of Rwumab-3 may hinder the development of male nematodes. These results suggest that Rwucmab-3 mainly involves in the initiation of sex differentiation and the development of male sexual dimorphism. Rwuclaf-1 and Rwuctra-2 may play vital role in nematode reproductive and developmental system. In conclusion, transcript sequences presented in this study could provide more bioinformatics resources for future studies on gene cloning and other molecular regulatory mechanism in R. wuchangensis. Moreover, identification

  18. Molecular study of developmental sex disorders in children ...

    African Journals Online (AJOL)

    Background: Sex determination and differentiation in humans are processes that involve the interaction of several genes such as SRY, SOX9 genes which are important in the development of the male genital system. Also NR5A1 gene plays an important role in the development of gonads and the adrenal glands. Aim of the ...

  19. Molecular analysis of sex chromosome-linked mutants in the ...

    Indian Academy of Sciences (India)

    2010-09-06

    Sep 6, 2010 ... 1Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, ... In Bombyx mori, the W chromosome determines the female sex. .... located on an autosome, and there is no difference in the ex- ..... tral nervous system or in a brain-controlled body wall muscle.

  20. Unbiased identification of patients with disorders of sex development.

    Directory of Open Access Journals (Sweden)

    David A Hanauer

    Full Text Available Disorders of sex development (DSD represent a collection of rare diseases that generate substantial controversy regarding best practices for diagnosis and treatment. A significant barrier preventing a better understanding of how patients with these conditions should be evaluated and treated, especially from a psychological standpoint, is the lack of systematic and standardized approaches to identify cases for study inclusion. Common approaches include "hand-picked" subjects already known to the practice, which could introduce bias. We implemented an informatics-based approach to identify patients with DSD from electronic health records (EHRs at three large, academic children's hospitals. The informatics approach involved comprehensively searching EHRs at each hospital using a combination of structured billing codes as an initial filtering strategy followed by keywords applied to the free text clinical documentation. The informatics approach was implemented to replicate the functionality of an EHR search engine (EMERSE available at one of the hospitals. At the two hospitals that did not have EMERSE, we compared case ascertainment using the informatics method to traditional approaches employed for identifying subjects. Potential cases identified using all approaches were manually reviewed by experts in DSD to verify eligibility criteria. At the two institutions where both the informatics and traditional approaches were applied, the informatics approach identified substantially higher numbers of potential study subjects. The traditional approaches yielded 14 and 28 patients with DSD, respectively; the informatics approach yielded 226 and 77 patients, respectively. The informatics approach missed only a few cases that the traditional approaches identified, largely because those cases were known to the study team, but patient data were not in the particular children's hospital EHR. The use of informatics approaches to search electronic documentation

  1. Identification of Pseudallescheria and Scedosporium Species by Three Molecular Methods▿

    Science.gov (United States)

    Lu, Qiaoyun; Gerrits van den Ende, A. H. G.; Bakkers, J. M. J. E.; Sun, Jiufeng; Lackner, M.; Najafzadeh, M. J.; Melchers, W. J. G.; Li, Ruoyu; de Hoog, G. S.

    2011-01-01

    The major clinically relevant species in Scedosporium (teleomorph Pseudallescheria) are Pseudallescheria boydii, Scedosporium aurantiacum, Scedosporium apiospermum, and Scedosporium prolificans, while Pseudallescheria minutispora, Petriellopsis desertorum, and Scedosporium dehoogii are exceptional agents of disease. Three molecular methods targeting the partial β-tubulin gene were developed and evaluated to identify six closely related species of the S. apiospermum complex using quantitative real-time PCR (qPCR), PCR-based reverse line blot (PCR-RLB), and loop-mediated isothermal amplification (LAMP). qPCR was not specific enough for the identification of all species but had the highest sensitivity. The PCR-RLB assay was efficient for the identification of five species. LAMP distinguished all six species unambiguously. The analytical sensitivities of qPCR, PCR-RLB, and LAMP combined with MagNAPure, CTAB (cetyltrimethylammonium bromide), and FTA filter (Whatman) extraction were 50, 5 × 103, and 5 × 102 cells/μl, respectively. When LAMP was combined with a simplified DNA extraction method using an FTA filter, identification to the species level was achieved within 2 h, including DNA extraction. The FTA-LAMP assay is therefore recommended as a cost-effective, simple, and rapid method for the identification of Scedosporium species. PMID:21177887

  2. Pythium insidiosum: morphological and molecular identification of Brazilian isolates

    Directory of Open Access Journals (Sweden)

    Maria Isabel de Azevedo

    2012-07-01

    Full Text Available Pythium insidiosum is an oomycete belonging to the kingdom Stramenipila and it is the etiologic agent of pythiosis. Pythiosis is a life-threatening infectious disease characterized by the development of chronic lesions on cutaneous and subcutaneous, intestinal, and bone tissues in humans and many species of animals. The identification of P. insidiosum is important in order to implement a rapid and definitive diagnosis and an effective treatment. This study reports the identification of 54 isolates of P. insidiosum of horses, dogs and sheep that presented suspicious clinical lesions of pythiosis from different regions in Brazil, by using morphological and molecular assays. Throughout the PCR it was possible to confirm the identity of all Brazilian isolates as being P. insidiosum.

  3. Phenotypic and Molecular Identification of Bacteria Involved in Decubitus Ulcers

    Directory of Open Access Journals (Sweden)

    Mehran Dolati

    2017-07-01

    Full Text Available Background:    Bacterial secondary infection of pressure ulcers (bedsores, so called as decubitus ulcers, leads to ulcer development and it interferes with the healing process. Thus, such infections can be lethal due to the sepsis if no constructive medicinal measures regarded. Drug resistance of bacteria in pressure ulcers leads to healing inhibition. Molecular identification of bacteria involved in such infections seem necessary as culture and phenotypic approaches may result in misidentification. . The purpose of this study was to isolate and identify aerobic bacteria detected in bedsores in three Hospitals: Rasool-e-Akram, Imam Hossein and Tajrish Shohada Hospitals, Tehran, Iran.Methods:    To this end, decubitus ulcer samples of 49 patients were obtained using sterile swabs. After direct microscopic examination, the swabs were used to streak BHI agar plates supplemented with %5 defibrinated sheep blood for enrichment of probable aerobic cultures. Bacterial isolates diagnosed by biochemical tests. Antibiotic susceptibility of the isolates determined based on CLSI guideline. For molecular identification, PCR amplification of the 16S rRNA gene performed using Eubacterial universal primers. Then, the PCR products were sequenced and the nucleotide sequences of the PCR products were analyzed by BLASTN similarity search program available at NCBI. Results:   Among the isolates, Pseudomonas aeruginosa (36% had the highest frequency, followed by Staphylococcus aureus (32% and Escherichia coli (30%. The frequencies of Klebsiella pneumonia and Proteus spp. were 10% and 8%, respectively. Most of the isolated bacteria showed a widespread antibiotic resistance. Molecular identification of the bacterial isolates resulted in 6 isolates of Escherichia coli, two isolates of each of Proteus mirabilis and Shigella spp., 4 isolates of Enterobacter cloacae, and 1 isolate of each of Cronobacter sakazakii and Morganella morganii.Conclusion:

  4. Identification of receptors of main sex-pheromone components of three Lepidopteran species.

    Science.gov (United States)

    Mitsuno, Hidefumi; Sakurai, Takeshi; Murai, Masatoshi; Yasuda, Tetsuya; Kugimiya, Soichi; Ozawa, Rika; Toyohara, Haruhiko; Takabayashi, Junji; Miyoshi, Hideto; Nishioka, Takaaki

    2008-09-01

    Male moths discriminate conspecific female-emitted sex pheromones. Although the chemical components of sex pheromones have been identified in more than 500 moth species, only three components in Bombyx mori and Heliothis virescens have had their receptors identified. Here we report the identification of receptors for the main sex-pheromone components in three moth species, Plutella xylostella, Mythimna separata and Diaphania indica. We cloned putative sex-pheromone receptor genes PxOR1, MsOR1 and DiOR1 from P. xylostella, M. separata and D. indica, respectively. Each of the three genes was exclusively expressed with an Or83b orthologous gene in male olfactory receptor neurons (ORNs) that are surrounded by supporting cells expressing pheromone-binding-protein (PBP) genes. By two-electrode voltage-clamp recording, we tested the ligand specificity of Xenopus oocytes co-expressing PxOR1, MsOR1 or DiOR1 with an OR83b family protein. Among the seven sex-pheromone components of the three moth species, the oocytes dose-dependently responded only to the main sex-pheromone component of the corresponding moth species. In our study, PBPs were not essential for ligand specificity of the receptors. On the phylogenetic tree of insect olfactory receptors, the six sex-pheromone receptors identified in the present and previous studies are grouped in the same subfamily but have no relation with the taxonomy of moths. It is most likely that sex-pheromone receptors have randomly evolved from ancestral sex-pheromone receptors before the speciation of moths and that their ligand specificity was modified by mutations of local amino acid sequences after speciation.

  5. Sex-role identification of normal adolescent males and females as related to school achievement.

    Science.gov (United States)

    Hock, R A; Curry, J F

    1983-12-01

    The historical view of masculinity/femininity posited essentially bipolar opposites, with the presence of one set of characteristics precluding the other. More recent studies of sex-role stereotypes have defined sexual orientation within clusters of socially desirable attributes which males and females perceive as differentiating males from females. This view negates the contention that psychological sex roles are composed of bipolar opposites, and concludes that the constructs of masculinity and femininity are independent dimensions rather than a single bipolar dimension. Little is known about the sex-role functioning of adolescents, yet it is during adolescence that qualitative shifts occur in interpersonal relationships and concurrent changes occur in cognitive functioning, with adolescents shifting toward hypothetical thinking and abstract ideal notions. In view of these changes, much can be learned about adult functioning by studying the sex-role perceptions of adolescents related to familial and social variables. This study examines the sex-role perceptions that adolescents hold of fathers, mothers, ideal males, ideal females, and selves. Differences exist between male and female adolescents, and significant linkages exist between sex-role identification and academic achievement.

  6. Fast sex identification in wild mammals using PCR amplification of the Sry gene

    Czech Academy of Sciences Publication Activity Database

    Bryja, Josef; Konečný, A.

    2003-01-01

    Roč. 52, č. 3 (2003), s. 269-274 ISSN 0139-7893 R&D Projects: GA ČR GA524/01/1316; GA ČR GP206/02/P068 Institutional research plan: CEZ:AV0Z6093917 Keywords : sex identification * Sry gene * rodents Subject RIV: EG - Zoology Impact factor: 0.494, year: 2003 http://www.ivb.cz/folia/52/3/269-274.pdf

  7. Molecular identification and phylogenetic study of Demodex caprae.

    Science.gov (United States)

    Zhao, Ya-E; Cheng, Juan; Hu, Li; Ma, Jun-Xian

    2014-10-01

    The DNA barcode has been widely used in species identification and phylogenetic analysis since 2003, but there have been no reports in Demodex. In this study, to obtain an appropriate DNA barcode for Demodex, molecular identification of Demodex caprae based on mitochondrial cox1 was conducted. Firstly, individual adults and eggs of D. caprae were obtained for genomic DNA (gDNA) extraction; Secondly, mitochondrial cox1 fragment was amplified, cloned, and sequenced; Thirdly, cox1 fragments of D. caprae were aligned with those of other Demodex retrieved from GenBank; Finally, the intra- and inter-specific divergences were computed and the phylogenetic trees were reconstructed to analyze phylogenetic relationship in Demodex. Results obtained from seven 429-bp fragments of D. caprae showed that sequence identities were above 99.1% among three adults and four eggs. The intraspecific divergences in D. caprae, Demodex folliculorum, Demodex brevis, and Demodex canis were 0.0-0.9, 0.5-0.9, 0.0-0.2, and 0.0-0.5%, respectively, while the interspecific divergences between D. caprae and D. folliculorum, D. canis, and D. brevis were 20.3-20.9, 21.8-23.0, and 25.0-25.3, respectively. The interspecific divergences were 10 times higher than intraspecific ones, indicating considerable barcoding gap. Furthermore, the phylogenetic trees showed that four Demodex species gathered separately, representing independent species; and Demodex folliculorum gathered with canine Demodex, D. caprae, and D. brevis in sequence. In conclusion, the selected 429-bp mitochondrial cox1 gene is an appropriate DNA barcode for molecular classification, identification, and phylogenetic analysis of Demodex. D. caprae is an independent species and D. folliculorum is closer to D. canis than to D. caprae or D. brevis.

  8. Gender identification and sex reassignment surgery in the trans population: a survey study in France.

    Science.gov (United States)

    Giami, Alain; Beaubatie, Emmanuelle

    2014-11-01

    Drawing from controversies between medical, legal, and associative actors about the obligation of sex reassignment surgeries (SRS) for people who intend to change their civil status, this article discusses the role that medical procedures, and particularly SRS, play in contemporary gender identifications and transition pathways in France. In 2010, the French National Institute of Health and Medical Research conducted a national survey in order to study the sociodemographic characteristics, access to medical, and psychological care, and state of health among trans individuals. After a long period of ethnographic work during which a partnership was established with trans actors to map the social, medical, and political landscape of trans communities, a questionnaire was developed and distributed between July and October 2010 in collaboration with most of the trans organizations and public and private health professionals operating in France. Overall, 381 self-identified trans individuals returned the anonymous self-administered questionnaire. The results highlighted the heterogeneity of the trans population, whose definition cannot be reduced to a group of individuals undergoing standardized hormonal treatments and SRS. Two central indicators, sex assigned at birth and gender self-identification, enabled us to describe and analyze different medical and legal pathways with a particular focus on SRS, which is often compulsory for a change of civil status in France. Although SRS remains an important factor in an individual's subjective evaluation of the success of the transition pathway, its practice varies depending on one's sex assigned at birth and gender identification.

  9. Sex identification and reconstruction of length of humerus from its fragments: An Egyptian study

    Directory of Open Access Journals (Sweden)

    Dalia Mohamed Ali

    2016-06-01

    Full Text Available The aim of this study was to calculate the total length of the humerus and identify the sex from its fragments in Egyptians. One hundred and fifty dry adult right humeri (75 male and 75 female were studied. The humeri were divided into seven fragments according to specific anatomical landmarks. Data obtained was subjected to descriptive statistical analysis. The longest fragmentary portion revealed a good result with closest proximity to the total length of humerus. All fragments showed significant sexual differences (P < 0.001 between males and females except H2. Total length of humerus revealed the highest percentage of accuracy (93.3% followed by H4 (86.7% and H7 (83.3% for sex identification. Finally, from measurements of different humeral fragments in Egyptian population; the length of the humerus can be estimated and the sex can be identified.

  10. Molecular identification of clinical Nocardia isolates from India.

    Science.gov (United States)

    Rudramurthy, Shivaprakash M; Honnavar, Prasanna; Kaur, Harsimran; Samanta, Palash; Ray, Pallab; Ghosh, Anup; Chakrabarti, Arunaloke

    2015-10-01

    The epidemiology of nocardiosis is evolving with increasing number of Nocardia spp. causing human infection. In recent years, molecular techniques have been used to identify Nocardia spp. There are limited data available on the spectrum of Nocardia spp. isolated from clinical samples in India. Here, a molecular study was carried on 30 clinical isolates maintained in our National Culture Collection to evaluate the techniques used for identifying the agents. The isolates were identified by sequencing two promising genes: the 16S rRNA gene and hsp65. Both hsp65 and the 16S rRNA gene could reliably identify 90 % of Nocardia isolates, i.e. N. farcinica, N. cyriacigeorgica, N. brasiliensis, N. otitidiscaviarum, N. amamiensis and N. pneumoniae. The mean percentage dissimilarity of sequence identification was higher using the hsp65 gene (4 %, range 0-7.9 %) compared with the 16S rRNA gene (2.3 %, range 0-8.9 %). Two isolates that showed ambiguous results in both the short segment of the 16S rRNA gene and hsp65 sequences could be resolved by sequencing a larger fragment (∼1000 bp) of the 16S rRNA gene. Both of these isolates were identified as N. beijingensis with similarities of 99.8 and 100 % compared with the standard strain. Genotyping of N. cyriacigeorgica strains was performed using hsp65 gene sequences and compared with previously described genotypes. Our N. cyriacigeorgica isolates belonged to genotype 1 (n = 4) and genotype 2 (n = 2). The present study highlights a wide spectrum of Nocardia spp. in India and emphasizes the need for molecular techniques for identification to the species level.

  11. [Molecular mechanisms in sex determination: from gene regulation to pathology].

    Science.gov (United States)

    Ravel, C; Chantot-Bastaraud, S; Siffroi, J-P

    2004-01-01

    Testis determination is the complex process by which the bipotential gonad becomes a normal testis during embryo development. As a consequence, this process leads to sexual differentiation corresponding to the masculinization of both genital track and external genitalia. The whole phenomenon is under genetic control and is particularly driven by the presence of the Y chromosome and by the SRY gene, which acts as the key initiator of the early steps of testis determination. However, many other autosomal genes, present in both males and females, are expressed during testis formation in a gene activation pathway, which is far to be totally elucidated. All these genes act in a dosage-sensitive manner by which quantitative gene abnormalities, due to chromosomal deletions, duplications or mosaicism, may lead to testis determination failure and sex reversal.

  12. Sexing sirenians: validation of visual and molecular sex determination in both wild dugongs (Dugong dugon) and Florida manatees (Trichechus manatus latirostris). Aquatic Mammals 35(2):187-192.

    Science.gov (United States)

    Bonde, Robert K.; Lanyon, J.; Sneath, H.; Ovenden, J.; Broderick, D.

    2009-01-01

    Sexing wild marine mammals that show little to no sexual dimorphism is challenging. For sirenians that are difficult to catch or approach closely, molecular sexing from tissue biopsies offers an alternative method to visual discrimination. This paper reports the results of a field study to validate the use of two sexing methods: (1) visual discrimination of sex vs (2) molecular sexing based on a multiplex PCR assay which amplifies the male-specific SRY gene and differentiates ZFX and ZFY gametologues. Skin samples from 628 dugongs (Dugong dugon) and 100 Florida manatees (Trichechus manatus latirostris) were analysed and assigned as male or female based on molecular sex. These individuals were also assigned a sex based on either direct observation of the genitalia and/or the association of the individual with a calf. Individuals of both species showed 93 to 96% congruence between visual and molecular sexing. For the remaining 4 to 7%, the discrepancies could be explained by human error. To mitigate this error rate, we recommend using both of these robust techniques, with routine inclusion of sex primers into microsatellite panels employed for identity, along with trained field observers and stringent sample handling.

  13. Sexing sirenians: Validation of visual and molecular sex determination in both wild dugongs (Dugong dugon) and Florida manatees (Trichechus manatus latirostris)

    Science.gov (United States)

    Lanyon, J.M.; Sneath, H.L.; Ovenden, J.R.; Broderick, D.; Bonde, R.K.

    2009-01-01

    Sexing wild marine mammals that show little to no sexual dimorphism is challenging. For sirenians that are difficult to catch or approach closely, molecular sexing from tissue biopsies offers an alternative method to visual discrimination. This paper reports the results of a field study to validate the use of two sexing methods: (1) visual discrimination of sex vs (2) molecular sexing based on a multiplex PCR assay which amplifies the male-specific SRY gene and differentiates ZFX and ZFY gametologues. Skin samples from 628 dugongs (Dugong dugon) and 100 Florida manatees (Trichechus manatus latirostris) were analysed and assigned as male or female based on molecular sex. These individuals were also assigned a sex based on either direct observation of the genitalia and/or the association of the individual with a calf. Individuals of both species showed 93 to 96% congruence between visual and molecular sexing. For the remaining 4 to 7%, the discrepancies could be explained by human error. To mitigate this error rate, we recommend using both of these robust techniques, with routine inclusion of sex primers into microsatellite panels employed for identity, along with trained field observers and stringent sample handling.

  14. [Molecular techniques applied in species identification of Toxocara].

    Science.gov (United States)

    Fogt, Renata

    2006-01-01

    Toxocarosis is still an important and actual problem in human medicine. It can manifest as visceral (VLM), ocular (OLM) or covert (CT) larva migrans syndroms. Complicated life cycle of Toxocara, lack of easy and practical methods of species differentiation of the adult nematode and embarrassing in recognition of the infection in definitive hosts create difficulties in fighting with the infection. Although studies on human toxocarosis have been continued for over 50 years there is no conclusive answer, which of species--T. canis or T. cati constitutes a greater risk of transmission of the nematode to man. Neither blood serological examinations nor microscopic observations of the morphological features of the nematode give the satisfied answer on the question. Since the 90-ths molecular methods were developed for species identification and became useful tools being widely applied in parasitological diagnosis. This paper cover the survey of methods of DNA analyses used for identification of Toxocara species. The review may be helpful for researchers focused on Toxocara and toxocarosis as well as on detection of new species. The following techniques are described: PCR (Polymerase Chain Reaction), RFLP (Restriction Fragment Length Polymorphism), RAPD (Random Amplified Polymorphic DNA) and SSCP (Single Strand Conformation Polymorphism).

  15. Sex-Specific Effects of Gender Identification on Pain Study Recruitment.

    Science.gov (United States)

    Mattos Feijó, Larissa; Tarman, Guliz Zeynep; Fontaine, Charlotte; Harrison, Richard; Johnstone, Tom; Salomons, Tim

    2018-02-01

    Epidemiological, clinical, and laboratory studies show sex differences in pain responses, with women more sensitive to nociceptive stimulation and more vulnerable to long-term pain conditions than men. Because of evidence that men are culturally reinforced for the ability to endure (or under-report) pain, some of these findings might be explained by sociocultural beliefs about gender-appropriate behavior. One potential manifestation of these effects might be differential participation in pain studies, with men adhering to stereotypical masculine roles viewing participation as a way to demonstrate their masculinity. To test this possibility, we assessed gender identification in 137 healthy participants. At the end of the assessment, they were asked if they would like to participate in other research studies. Interested participants were then asked to participate in a study involving administration of pain-evoking stimulation. We compared individuals who agreed to participate in the pain study with those who declined. We observed a significant Sex × Participation interaction in masculine gender identification, such that men (but not women) who agreed to participate identified significantly more with masculine gender. Among masculine gender traits examined, we found that high levels of aggression and competitiveness were the strongest predictors of pain study participation. Our results suggest that men in pain studies might have higher levels of masculine gender identification than the wider male population. Taken together with previous findings of lower levels of pain sensitivity (or reporting) in masculine-identifying male participants, these results suggest an explanation for some of the sex-related differences observed in pain responses. To examine whether sex and gender affect willingness to participate in pain studies, we assessed gender identification in men and women, then attempted to recruit them to participate in a pain study. Men who agree to participate

  16. Molecular assay to fraud identification of meat products.

    Science.gov (United States)

    Doosti, Abbas; Ghasemi Dehkordi, Payam; Rahimi, Ebrahim

    2014-01-01

    Detection of species fraud in meat products is important for consumer protection and food industries. A molecular technique such as PCR method for detection of beef, sheep, pork, chicken, donkey, and horse meats in food products was established. The purpose of this study was to identification of fraud and adulteration in industrial meat products by PCR-RFLP assay in Iran. In present study, 224 meat products include 68 sausages, 48 frankfurters, 55 hamburgers, 33 hams and 20 cold cut meats were collected from different companies and food markets in Iran. Genomic DNA was extracted and PCR was performed for gene amplification of meat species using specific oligonucleotid primers. Raw meat samples are served as the positive control. For differentiation between donkey's and horse's meat, the mitochondrial DNA segment (cytochrome-b gene) was amplified and products were digested with AluI restriction enzyme. Results showed that 6 of 68 fermented sausages (8.82%), 4 of 48 frankfurters (8.33%), 4 of 55 hamburgers (7.27%), 2 of 33 hams (6.6%), and 1 of 20 cold cut meat (5%) were found to contain Haram (unlawful or prohibited) meat. These results indicate that 7.58% of the total samples were not containing Halal (lawful or permitted) meat and have another meat. These findings showed that molecular methods such as PCR and PCR-RFLP are potentially reliable techniques for detection of meat type in meat products for Halal authentication.

  17. Molecular identification of Coccidioides spp. in soil samples from Brazil.

    Science.gov (United States)

    de Macêdo, Regina C L; Rosado, Alexandre S; da Mota, Fabio F; Cavalcante, Maria A S; Eulálio, Kelsen D; Filho, Antônio D; Martins, Liline M S; Lazéra, Márcia S; Wanke, Bodo

    2011-05-16

    Since 1991 several outbreaks of acute coccidioidomycosis (CM) were diagnosed in the semi-arid Northeast of Brazil, mainly related to disturbance of armadillo burrows caused by hunters while digging them for the capture of these animals. This activity causes dust contaminated with arthroconidia of Coccidioides posadasii, which, once inhaled, cause the mycosis. We report on the identification of C. posadasii in soil samples related to outbreaks of CM. Twenty four soil samples had their DNA extracted and subsequently submitted to a semi-nested PCR technique using specific primers. While only 6 (25%) soil samples were positive for C. posadasii by mice inoculation, all (100%) were positive by the molecular tool. This methodology represents a simple, sensitive and specific molecular technique to determine the environmental distribution of Coccidioides spp. in endemic areas, but cannot distinguish the species. Moreover, it may be useful to identify culture isolates. Key-words: 1. Coccidioidomycosis. 2. Coccidioides spp. 3. C. posadasii. 4. Semi-arid. 5. Semi-nested PCR.

  18. Molecular identification of Coccidioides spp. in soil samples from Brazil

    Directory of Open Access Journals (Sweden)

    Filho Antônio D

    2011-05-01

    Full Text Available Abstract Background Since 1991 several outbreaks of acute coccidioidomycosis (CM were diagnosed in the semi-arid Northeast of Brazil, mainly related to disturbance of armadillo burrows caused by hunters while digging them for the capture of these animals. This activity causes dust contaminated with arthroconidia of Coccidioides posadasii, which, once inhaled, cause the mycosis. We report on the identification of C. posadasii in soil samples related to outbreaks of CM. Results Twenty four soil samples had their DNA extracted and subsequently submitted to a semi-nested PCR technique using specific primers. While only 6 (25% soil samples were positive for C. posadasii by mice inoculation, all (100% were positive by the molecular tool. Conclusion This methodology represents a simple, sensitive and specific molecular technique to determine the environmental distribution of Coccidioides spp. in endemic areas, but cannot distinguish the species. Moreover, it may be useful to identify culture isolates. Key-words: 1. Coccidioidomycosis. 2. Coccidioides spp. 3. C. posadasii. 4. Semi-arid. 5. Semi-nested PCR

  19. Patterns of molecular evolution of an avian neo-sex chromosome.

    Science.gov (United States)

    Pala, Irene; Hasselquist, Dennis; Bensch, Staffan; Hansson, Bengt

    2012-12-01

    Newer parts of sex chromosomes, neo-sex chromosomes, offer unique possibilities for studying gene degeneration and sequence evolution in response to loss of recombination and population size decrease. We have recently described a neo-sex chromosome system in Sylvioidea passerines that has resulted from a fusion between the first half (10 Mb) of chromosome 4a and the ancestral sex chromosomes. In this study, we report the results of molecular analyses of neo-Z and neo-W gametologs and intronic parts of neo-Z and autosomal genes on the second half of chromosome 4a in three species within different Sylvioidea lineages (Acrocephalidea, Timaliidae, and Alaudidae). In line with hypotheses of neo-sex chromosome evolution, we observe 1) lower genetic diversity of neo-Z genes compared with autosomal genes, 2) moderate synonymous and weak nonsynonymous sequence divergence between neo-Z and neo-W gametologs, and 3) lower GC content on neo-W than neo-Z gametologs. Phylogenetic reconstruction of eight neo-Z and neo-W gametologs suggests that recombination continued after the split of Alaudidae from the rest of the Sylvioidea lineages (i.e., after ~42.2 Ma) and with some exceptions also after the split of Acrocephalidea and Timaliidae (i.e., after ~39.4 Ma). The Sylvioidea neo-sex chromosome shares classical evolutionary features with the ancestral sex chromosomes but, as expected from its more recent origin, shows weaker divergence between gametologs.

  20. Molecular and Pathotype Identification of Potato Cyst Nematodes

    Directory of Open Access Journals (Sweden)

    Mulyadi Mulyadi

    2014-07-01

    Full Text Available In Indonesia, potato cyst nematode (PCN was first reported in Bumiaji, Kota Batu, East Java by PT Syngenta and was identified as Globodera rostochiensis. Based on the surveillances, G. rostochiensis were also found in Batur, Banjarnegara, and Kejajar, Wonosobo, and Pangalengan, Bandung. In addition, in Batur, Banjarnegara, another species which was identified as G. pallida was found. The aim of this research were to identify the species of PCN using molecular method, pathotype identification, and to study the distributions of PCN especially in Java. The PCN are collected from potato planting areas in Kota Batu, East Java; Wonosobo and Banjarnegara, Central Java; and Pangalengan, Bandung, West Java. PCN were extracted and isolated from soil, and then identified by  morphological and molecular analysis. PCN were found in potato planting areas in Kota Batu, East Java; Wonosobo and Banjarnegara, Central Java; and Pangalengan, West Java. Based on the morphological characters, molecular method, and the differential host test, the PCN identified as G. rostochiensis are amplified an approximately 434 bp with pathotype Ro2.   Di Indonesia, nematoda sista kentang (NSK pertama dilaporkan di Bumiaji, Kota Batu, Jawa Timur oleh PT Syngenta yang diidentifikasi sebagai Globodera rostochiensis. Berdasarkan hasil survei, NSK ditemukan di Batur, Banjarnegara dan Kejajar, Wonosobo, Pangalengan. Spesies G. pallida juga ditemukan Batur, Banjarnegara. Penelitian ini bertujuan untuk mengidentifikasi spesies NSK menggunakan metode molekuler, identifikasi patotipe NSK, dan untuk mengetahui penyebaran NSK khususnya di Pulau Jawa. Sampel NSK dikumpulkan dari lahan pertanaman kentang di Bumiaji, Kota Batu, Jawa Timur; Wonosobo dan Banjarnegara, Jawa Tengah; serta Pangalengan, Bandung, Jawa Tengah. NSK diekstraksi dan diisolasi dari tanah yang selanjutnya diidentifikasi secara morfologi dan analisis molekuler. NSK yang terdapat pada lahan pertanaman kentang ditemukan di

  1. A grass molecular identification system for forensic botany: a critical evaluation of the strengths and limitations.

    Science.gov (United States)

    Ward, Jodie; Gilmore, Simon R; Robertson, James; Peakall, Rod

    2009-11-01

    Plant material is frequently encountered in criminal investigations but often overlooked as potential evidence. We designed a DNA-based molecular identification system for 100 Australian grasses that consisted of a series of polymerase chain reaction assays that enabled the progressive identification of grasses to different taxonomic levels. The identification system was based on DNA sequence variation at four chloroplast and two mitochondrial loci. Seventeen informative indels and 68 single-nucleotide polymorphisms were utilized as molecular markers for subfamily to species-level identification. To identify an unknown sample to subfamily level required a minimum of four markers or nine markers for species identification. The accuracy of the system was confirmed by blind tests. We have demonstrated "proof of concept" of a molecular identification system for trace botanical samples. Our evaluation suggests that the adoption of a system that combines this approach with DNA sequencing could assist the morphological identification of grasses found as forensic evidence.

  2. Sex determination of Pohnpei Micronesian kingfishers using morphological and molecular genetic techniques

    Science.gov (United States)

    Kesler, Dylan C.; Lopes, I.F.; Haig, Susan M.

    2006-01-01

    Conservation-oriented studies of Micronesian Kingfishers (Todiramphus cinnamominus) have been hindered by a lack of basic natural history information, despite the status of the Guam subspecies (T. c. cinnamominus) as one of the most endangered species in the world. We used tissue samples and morphometric measures from museum specimens and wild-captured Pohnpei Micronesian Kingfishers (T. c. reichenbachii) to develop methods for sex determination. We present a modified molecular protocol and a discriminant function that yields the probability that a particular individual is male or female. Our results revealed that females were significantly larger than males, and the discriminant function correctly predicted sex in 73% (30/41) of the individuals. The sex of 86% (18/21) of individuals was correctly assigned when a moderate reliability threshold was set. Sex determination using molecular genetic techniques was more reliable than methods based on morphology. Our results will facilitate recovery efforts for the critically endangered Guam Micronesian Kingfisher and provide a basis for sex determination in the 11 other endangered congeners in the Pacific Basin.

  3. Effects of sex, gender role identification, and gender relevance of two types of stressors on cardiovascular and subjective responses: Sex and gender match and mismatch effects

    NARCIS (Netherlands)

    van Well, S.; Kolk, A.M.; Klugkist, I.G.

    2008-01-01

    The authors tested the hypothesis that a match between the gender relevance of a stressor and one’s sex or gender role identification would elicit higher cardiovascular responses. Healthy female and male undergraduates (n = 108) were exposed to two stressors: the Cold Pressor Test (CPT) and the

  4. The Use of Fta Card on Dna Sample Preparation for Molecular of Plant Disease Identification

    OpenAIRE

    Sulistyawati, Purnamila; Rimbawanto, Anto

    2007-01-01

    Accurate and guick identification of pathogen is key to control the spread of plant disesases. Morphological identification is often ineffective because it requires fruit body which often are not presence, rely on characters which may be highly variable within and among species and can be slow and time consuming. Molecular identification of plant disease can overcome most of the shortcomings of morphological identification. Application of FTA Cardn for sample collection is crucial for the su...

  5. Commercialized non-Camellia tea: traditional function and molecular identification

    Directory of Open Access Journals (Sweden)

    Ping Long

    2014-06-01

    Full Text Available Non-Camellia tea is a part of the colorful Chinese tea culture, and is also widely used as beverage and medicine in folk for disease prevention and treatment. In this study, 37 samples were collected, including 33 kinds of non-Camellia teas and 4 kinds of teas (Camellia. Traditional functions of non-Camellia teas were investigated. Furthermore, non-Camellia teas of original plants were characterized and identified by molecular methods. Four candidate regions (rbcL, matK, ITS2, psbA-trnH were amplified by polymerase chain reaction. In addition, DNA barcodes were used for the first time to discriminate the commercial non-Camellia tea and their adulterants, and to evaluate their safety. This study showed that BLASTN and the relevant phylogenetic tree are efficient tools for identification of the commercial non-Camellia tea and their adulterants. However, some sequences from original plants have not been found and there is a limitation of sequence number of original plants in GenBank. Submitting more original plant sequences to the GenBank will be helpful for evaluating the safety of non-Camellia teas.

  6. A novel male-associated marker for sex identification in Ussuri catfish Pseudobagrus ussuriensis

    Science.gov (United States)

    Zhu, Chuankun; Pan, Zhengjun; Wang, Hui; Chang, Guoliang; Ding, Huaiyu

    2017-08-01

    The Ussuri catfish Pseudobagrus ussuriensis is a promising aquaculture fish with sexual dimorphism that males grow 2-3 times faster than females. Therefore, all-male breeding could increase production of this fish, and sex-linked markers would be useful during the breeding process. In this study, a male-associated marker named PuGT54 was isolated in P. ussuriensis from a previously constructed microsatellite library. A total of 185 P. ussuriensis individuals containing 95 females and 90 males were used to test the usage of this maker. And results showed that sexes of all individuals were successfully identified, indicating the high reliability and accuracy of this marker for sex identification. Furthermore, the male-specific fragment amplified by this maker was cloned and sequenced, which was 118 base pairs in length. As homologous genes of this fragment was not found through BLASTn, detailed information of the male-specific fragment is unknown presently. Nevertheless, this marker would be helpful in conservation, breeding and ecological study of P. ussuriensis.

  7. Molecular identification of Tribolium castaneum and T. confusum ...

    Indian Academy of Sciences (India)

    ful alternative method to identify the two sibling flour beetle species. ∗ ... represents a valuable addition or alternative to traditional phenotypic identification methods. Also, DNA ..... Buczkowski G. and Bennett G. 2009 Survey and identification.

  8. An optimised protocol for molecular identification of Eimeria from chickens☆

    Science.gov (United States)

    Kumar, Saroj; Garg, Rajat; Moftah, Abdalgader; Clark, Emily L.; Macdonald, Sarah E.; Chaudhry, Abdul S.; Sparagano, Olivier; Banerjee, Partha S.; Kundu, Krishnendu; Tomley, Fiona M.; Blake, Damer P.

    2014-01-01

    Molecular approaches supporting identification of Eimeria parasites infecting chickens have been available for more than 20 years, although they have largely failed to replace traditional measures such as microscopy and pathology. Limitations of microscopy-led diagnostics, including a requirement for specialist parasitological expertise and low sample throughput, are yet to be outweighed by the difficulties associated with accessing genomic DNA from environmental Eimeria samples. A key step towards the use of Eimeria species-specific PCR as a sensitive and reproducible discriminatory tool for use in the field is the production of a standardised protocol that includes sample collection and DNA template preparation, as well as primer selection from the numerous PCR assays now published. Such a protocol will facilitate development of valuable epidemiological datasets which may be easily compared between studies and laboratories. The outcome of an optimisation process undertaken in laboratories in India and the UK is described here, identifying four steps. First, samples were collected into a 2% (w/v) potassium dichromate solution. Second, oocysts were enriched by flotation in saturated saline. Third, genomic DNA was extracted using a QIAamp DNA Stool mini kit protocol including a mechanical homogenisation step. Finally, nested PCR was carried out using previously published primers targeting the internal transcribed spacer region 1 (ITS-1). Alternative methods tested included sample processing in the presence of faecal material, DNA extraction using a traditional phenol/chloroform protocol, the use of SCAR multiplex PCR (one tube and two tube versions) and speciation using the morphometric tool COCCIMORPH for the first time with field samples. PMID:24138724

  9. Molecular sexing of tucuxi dolphins (Sotalia guianensis and Sotalia fluviatilis using samples from biopsy darting and decomposed carcasses

    Directory of Open Access Journals (Sweden)

    Haydée A. Cunha

    2007-01-01

    Full Text Available We tested the zinc-finger sex chromosome-linked genes Zfx/Zfy and the sex-determining region Y (Sry genes for gender determination of biopsy samples from marine and riverine tucuxi dolphins (Sotalia guianensis and S. fluviatilis. We also evaluated the performance of these genes with decomposed carcasses, for which sexing cannot rely on the direct examination of the reproductive tract. Both systems proved reliable for sexing 46 fresh and decomposed samples, making them especially useful when biopsy darting is coupled with photo-identification studies.

  10. Isolation and molecular identification of yeast strains from “Rabilé” a ...

    African Journals Online (AJOL)

    Isolation and molecular identification of yeast strains from “Rabilé” a starter of local fermented drink. Ibrahim Keita, Marius K Somda, Aly Savadogo, Iliassou Mogmenga, Ousmane Koita, Alfred S Traore ...

  11. National, regional, and global sex ratios of infant, child, and under-5 mortality and identification of countries with outlying ratios: a systematic assessment

    OpenAIRE

    Alkema, Leontine; Chao, Fengqing; You, Danzhen; Pedersen, Jon; Sawyer, Cheryl C

    2014-01-01

    Background: Under natural circumstances, the sex ratio of male to female mortality up to the age of 5 years is greater than one but sex discrimination can change sex ratios. The estimation of mortality by sex and identification of countries with outlying levels is challenging because of issues with data availability and quality, and because sex ratios might vary naturally based on differences in mortality levels and associated cause of death distributions. Methods: For this systematic anal...

  12. HIV, HBV, and HCV molecular epidemiology among trans (transvestites, transsexuals, and transgender) sex workers in Argentina.

    Science.gov (United States)

    Carobene, Mauricio; Bolcic, Federico; Farías, María Sol Dos Ramos; Quarleri, Jorge; Avila, María Mercedes

    2014-01-01

    Commercial sex work is frequent among male-to-female transvestites, transsexuals and transgenders in Argentina, leading to high susceptibility to HIV, HBV, and HCV among other sexually transmitted infections. In a global context of scarce data on the trans sex workers population, this study was aimed to study the genomic characterization of these viruses. Plasma presence of HIV, HBV, and HCV genomic material was evaluated in samples from 273 trans sex workers. Genomic sequences of HIV-gag, pol, and vif-vpu genes, HBV-S gene, and HCV-5'UT and NS5B genes were obtained. Molecular characterization involved phylogenetic analysis and several in silico tools. Resistance-associated mutations in HIV and HBV pol genes were also analyzed. The HIV genomic characterization in 62 trans sex workers samples showed that 54.8% of the isolates corresponded to BF intersubtype recombinants, and 38.7% to subtype B. The remaining were classified as subtypes C (4.8%) and A (1.6%). HBV and HCV co-infection prevalence among HIV positive trans sex workers yielded rates of 3.2% and 6.5% respectively. Drug resistance-associated mutations were found in 12/62 (19%) HIV pol sequences, but none among HBV. Based on phylogenetic relationships, HIV isolates characterized as subtypes BF and B appeared intermingled with those from other high-risk groups. Despite trans sex workers declared not to have received antiviral treatment, complex drug resistance-associated mutation patterns were found in several HIV isolates. Planned prevention, screening, and treatment are needed to reduce further transmission and morbidity. © 2013 Wiley Periodicals, Inc.

  13. Cystic Echinococcoses in Mongolia: Molecular Identification, Serology and Risk Factors

    Science.gov (United States)

    Ito, Akira; Dorjsuren, Temuulen; Davaasuren, Anu; Yanagida, Tetsuya; Sako, Yasuhito; Nakaya, Kazuhiro; Nakao, Minoru; Bat-Ochir, Oyun-Erdene; Ayushkhuu, Tsendjav; Gonchigsengee, Nyamkhuu; Li, Tiaoying; Agvaandaram, Gurbadam; Davaajav, Abmed; Boldbaatar, Chinchuluun; Chuluunbaatar, Gantigmaa

    2014-01-01

    Background Cystic echinococcosis (CE) is a globally distributed cestode zoonosis that causes hepatic cysts. Although Echinococcus granulosus sensu stricto (s.s.) is the major causative agent of CE worldwide, recent molecular epidemiological studies have revealed that E. canadensis is common in countries where camels are present. One such country is Mongolia. Methodology/Principal Findings Forty-three human hepatic CE cases that were confirmed histopathologically at the National Center of Pathology (NCP) in Ulaanbaatar (UB) were identified by analysis of mitochondrial cox 1 gene as being caused by either E. canadensis (n = 31, 72.1%) or E. granulosus s.s. (n = 12, 27.9%). The majority of the E. canadensis cases were strain G6/7 (29/31, 93.5%). Twenty three haplotypes were identified. Sixteen of 39 CE cases with data on age, sex and province of residence were citizens of UB (41.0%), with 13 of the 16 cases from UB caused by E. canadensis (G6/7) (81.3%). Among these 13 cases, nine were children (69.2%). All pediatric cases (n  =  18) were due to E. canadensis with 17 of the 18 cases (94.4%) due to strain G6/7. Serum samples were available for 31 of the 43 CE cases, with 22 (71.0%) samples positive by ELISA to recombinant Antigen B8/1 (rAgB). Nine of 10 CE cases caused by E. granulosus s.s. (90.0%) and 13 of 20 CE cases by E. canadensis (G6/7) (65.0%) were seropositive. The one CE case caused by E. canadensis (G10) was seronegative. CE cases caused by E. granulosus s.s. showed higher absorbance values (median value 1.131) than those caused by E. canadensis (G6/7) (median value 0.106) (p  =  0.0137). Conclusion/Significance The main species/strains in the study population were E. canadenis and E. granulossus s.s. with E. canadensis the predominant species identified in children. The reason why E. canadensis appears to be so common in children is unknown. PMID:24945801

  14. Identification of Emotional Facial Expressions: Effects of Expression, Intensity, and Sex on Eye Gaze.

    Directory of Open Access Journals (Sweden)

    Laura Jean Wells

    Full Text Available The identification of emotional expressions is vital for social interaction, and can be affected by various factors, including the expressed emotion, the intensity of the expression, the sex of the face, and the gender of the observer. This study investigates how these factors affect the speed and accuracy of expression recognition, as well as dwell time on the two most significant areas of the face: the eyes and the mouth. Participants were asked to identify expressions from female and male faces displaying six expressions (anger, disgust, fear, happiness, sadness, and surprise, each with three levels of intensity (low, moderate, and normal. Overall, responses were fastest and most accurate for happy expressions, but slowest and least accurate for fearful expressions. More intense expressions were also classified most accurately. Reaction time showed a different pattern, with slowest response times recorded for expressions of moderate intensity. Overall, responses were slowest, but also most accurate, for female faces. Relative to male observers, women showed greater accuracy and speed when recognizing female expressions. Dwell time analyses revealed that attention to the eyes was about three times greater than on the mouth, with fearful eyes in particular attracting longer dwell times. The mouth region was attended to the most for fearful, angry, and disgusted expressions and least for surprise. These results extend upon previous findings to show important effects of expression, emotion intensity, and sex on expression recognition and gaze behaviour, and may have implications for understanding the ways in which emotion recognition abilities break down.

  15. Identification of Emotional Facial Expressions: Effects of Expression, Intensity, and Sex on Eye Gaze.

    Science.gov (United States)

    Wells, Laura Jean; Gillespie, Steven Mark; Rotshtein, Pia

    2016-01-01

    The identification of emotional expressions is vital for social interaction, and can be affected by various factors, including the expressed emotion, the intensity of the expression, the sex of the face, and the gender of the observer. This study investigates how these factors affect the speed and accuracy of expression recognition, as well as dwell time on the two most significant areas of the face: the eyes and the mouth. Participants were asked to identify expressions from female and male faces displaying six expressions (anger, disgust, fear, happiness, sadness, and surprise), each with three levels of intensity (low, moderate, and normal). Overall, responses were fastest and most accurate for happy expressions, but slowest and least accurate for fearful expressions. More intense expressions were also classified most accurately. Reaction time showed a different pattern, with slowest response times recorded for expressions of moderate intensity. Overall, responses were slowest, but also most accurate, for female faces. Relative to male observers, women showed greater accuracy and speed when recognizing female expressions. Dwell time analyses revealed that attention to the eyes was about three times greater than on the mouth, with fearful eyes in particular attracting longer dwell times. The mouth region was attended to the most for fearful, angry, and disgusted expressions and least for surprise. These results extend upon previous findings to show important effects of expression, emotion intensity, and sex on expression recognition and gaze behaviour, and may have implications for understanding the ways in which emotion recognition abilities break down.

  16. Molecular and pathological identification of feline coronavirus type I

    African Journals Online (AJOL)

    DR. NJ TONUKARI

    2012-06-05

    Jun 5, 2012 ... In this study, we described the isolation and molecular characterization of .... fecv2b) designed in the regions of S-protein gene were used to differentiate ..... The molecular dynamics of feline coronaviruses. Vet. Microbiol.

  17. Molecular cytogenetic characterization of the dioecious Cannabis sativa with an XY chromosome sex determination system.

    Directory of Open Access Journals (Sweden)

    Mikhail G Divashuk

    Full Text Available Hemp (Cannabis sativa L. was karyotyped using by DAPI/C-banding staining to provide chromosome measurements, and by fluorescence in situ hybridization with probes for 45 rDNA (pTa71, 5S rDNA (pCT4.2, a subtelomeric repeat (CS-1 and the Arabidopsis telomere probes. The karyotype has 18 autosomes plus a sex chromosome pair (XX in female and XY in male plants. The autosomes are difficult to distinguish morphologically, but three pairs could be distinguished using the probes. The Y chromosome is larger than the autosomes, and carries a fully heterochromatic DAPI positive arm and CS-1 repeats only on the less intensely DAPI-stained, euchromatic arm. The X is the largest chromosome of all, and carries CS-1 subtelomeric repeats on both arms. The meiotic configuration of the sex bivalent locates a pseudoautosomal region of the Y chromosome at the end of the euchromatic CS-1-carrying arm. Our molecular cytogenetic study of the C. sativa sex chromosomes is a starting point for helping to make C. sativa a promising model to study sex chromosome evolution.

  18. Molecular cytogenetic characterization of the dioecious Cannabis sativa with an XY chromosome sex determination system.

    Science.gov (United States)

    Divashuk, Mikhail G; Alexandrov, Oleg S; Razumova, Olga V; Kirov, Ilya V; Karlov, Gennady I

    2014-01-01

    Hemp (Cannabis sativa L.) was karyotyped using by DAPI/C-banding staining to provide chromosome measurements, and by fluorescence in situ hybridization with probes for 45 rDNA (pTa71), 5S rDNA (pCT4.2), a subtelomeric repeat (CS-1) and the Arabidopsis telomere probes. The karyotype has 18 autosomes plus a sex chromosome pair (XX in female and XY in male plants). The autosomes are difficult to distinguish morphologically, but three pairs could be distinguished using the probes. The Y chromosome is larger than the autosomes, and carries a fully heterochromatic DAPI positive arm and CS-1 repeats only on the less intensely DAPI-stained, euchromatic arm. The X is the largest chromosome of all, and carries CS-1 subtelomeric repeats on both arms. The meiotic configuration of the sex bivalent locates a pseudoautosomal region of the Y chromosome at the end of the euchromatic CS-1-carrying arm. Our molecular cytogenetic study of the C. sativa sex chromosomes is a starting point for helping to make C. sativa a promising model to study sex chromosome evolution.

  19. Molecular identification of tick-borne hemoparasites in equines from Northwestern Colombia

    Directory of Open Access Journals (Sweden)

    Yeison Agudelo-Ruíz

    2017-05-01

    Full Text Available Objetive. To detect and identify Anaplasmataceae agents and piroplasms in equines from the slaughterhouse “La Rinconada” at Rionegro municipality in Antioquia. Materials and Methods. A descriptive cross-sectional study was carried out on equines selected by convenience during a period of 2015. Information about species, sex, age and origin of the animals. Whole blood was collected for DNA extraction procedure, and a PCR targeting a 360bp of Anaplasmataceae 16S ribosomal gene and 450bp of 18S ribosomal gene of Piroplasm were used for detection. PCR amplicons selected were submitted to direct sequencing for identification of hemoparasites through genetic analysis. Results. 135 equine samples from Antioquia, Cordoba y Sucre were analyzed. 78% were horses, 16% were donkeys and 6% were mules. Anaplasmataceae agents were not detected in any sample, meanwhile 13% were positive to piroplasm PCR. Sequence analysis reveals the circulation of Theileria equi in northwestern Colombia. Conclusion. This work presents the first molecular evidence of at least three genotypes of T. equi in equines of northwestern Colombia.

  20. Identification of the female-produced sex pheromone of the leafminer Holocacista capensis infesting grapevine in South Africa

    NARCIS (Netherlands)

    Wang, H.-L.; Geertsema, H.; Nieukerken, van E.J.; Löfstedt, C.

    2015-01-01

    We report the first identification of a sex pheromone in a heliozelid moth, Holocacista capensis van Nieukerken & Geertsema. This leafminer recently infested grapevine in South Africa. Compared to solvent extraction of pheromone glands, solid phase microextraction (SPME) proved to be highly

  1. Identification and Elimination of Sex Stereotypes in and from School Textbooks. Some Suggestions for Action in the Arab World.

    Science.gov (United States)

    Abu Nasr, Julinda; And Others

    This document is divided into two parts: (1) "A Study of Sex Role Stereotype in Arabic Readers" and (2) "A Guide for the Identification and Elimination of Sexism in Arabic Textbooks." In part 1, a sample of 79 Arabic readers were read word for word and the images pertaining to females were recorded. The results of the survey…

  2. Identification of a sex-linked SNP marker in the salmon louse (Lepeophtheirus salmonis using RAD sequencing.

    Directory of Open Access Journals (Sweden)

    Stephen N Carmichael

    Full Text Available The salmon louse (Lepeophtheirus salmonis (Krøyer, 1837 is a parasitic copepod that can, if untreated, cause considerable damage to Atlantic salmon (Salmo salar Linnaeus, 1758 and incurs significant costs to the Atlantic salmon mariculture industry. Salmon lice are gonochoristic and normally show sex ratios close to 1:1. While this observation suggests that sex determination in salmon lice is genetic, with only minor environmental influences, the mechanism of sex determination in the salmon louse is unknown. This paper describes the identification of a sex-linked Single Nucleotide Polymorphism (SNP marker, providing the first evidence for a genetic mechanism of sex determination in the salmon louse. Restriction site-associated DNA sequencing (RAD-seq was used to isolate SNP markers in a laboratory-maintained salmon louse strain. A total of 85 million raw Illumina 100 base paired-end reads produced 281,838 unique RAD-tags across 24 unrelated individuals. RAD marker Lsa101901 showed complete association with phenotypic sex for all individuals analysed, being heterozygous in females and homozygous in males. Using an allele-specific PCR assay for genotyping, this SNP association pattern was further confirmed for three unrelated salmon louse strains, displaying complete association with phenotypic sex in a total of 96 genotyped individuals. The marker Lsa101901 was located in the coding region of the prohibitin-2 gene, which showed a sex-dependent differential expression, with mRNA levels determined by RT-qPCR about 1.8-fold higher in adult female than adult male salmon lice. This study's observations of a novel sex-linked SNP marker are consistent with sex determination in the salmon louse being genetic and following a female heterozygous system. Marker Lsa101901 provides a tool to determine the genetic sex of salmon lice, and could be useful in the development of control strategies.

  3. White piedra: molecular identification of Trichosporon inkin in members of the same family.

    Science.gov (United States)

    Richini-Pereira, Virgínia Bodelão; Camargo, Rosângela Maria Pires de; Bagagli, Eduardo; Marques, Silvio Alencar

    2012-06-01

    White piedra is a superficial mycosis caused by the genus Trichosporon and characterized by nodules on hair shaft. The authors report a family referred to as pediculosis. Mycological culture on Mycosel® plus molecular identification was performed to precisely identify the etiology. A Trichosporon spp. infection was revealed. The molecular procedure identified the agent as Trichosporon inkin. White piedra and infection caused by T. inkin are rarely reported in Southern Brazil. The molecular tools are essentials on identifying the Trichosporon species.

  4. A rapid, one step molecular identification of Trichoderma citrinoviride and Trichoderma reesei.

    Science.gov (United States)

    Saroj, Dina B; Dengeti, Shrinivas N; Aher, Supriya; Gupta, Anil K

    2015-06-01

    Trichoderma species are widely used as production hosts for industrial enzymes. Identification of Trichoderma species requires a complex molecular biology based identification involving amplification and sequencing of multiple genes. Industrial laboratories are required to run identification tests repeatedly in cell banking procedures and also to prove absence of production host in the product. Such demands can be fulfilled by a brief method which enables confirmation of strain identity. This communication describes one step identification method for two common Trichoderma species; T. citrinoviride and T. reesei, based on identification of polymorphic region in the nucleotide sequence of translation elongation factor 1 alpha. A unique forward primer and common reverse primer resulted in 153 and 139 bp amplicon for T. citrinoviride and T. reesei, respectively. Simplification was further introduced by using mycelium as template for PCR amplification. Method described in this communication allows rapid, one step identification of two Trichoderma species.

  5. A simple and rapid molecular method for Leptospira species identification

    NARCIS (Netherlands)

    Ahmed, Ahmed; Anthony, Richard M.; Hartskeerl, Rudy A.

    2010-01-01

    Serological and DNA-based classification systems only have little correlation. Currently serological and molecular methods for characterizing Leptospira are complex and costly restricting their world-wide distribution and use. Ligation mediated amplification combined with microarray analysis

  6. Molecular identification of endophytic fungi from Aquilaria sinensis ...

    African Journals Online (AJOL)

    Molecular phylogenetic analysis demonstrated that Botryosphaeria, Colletotrichum gloeosporioides, Phomopsis and Cylindrocladium species are members of the agarwood-producing wounded tree, while Phoma, Mycosphaerella, Sagenomella, Alternaria and Ramichloridium species is able to colonize the non-resinous ...

  7. Identification of a myometrial molecular profile for dystocic labor.

    LENUS (Irish Health Repository)

    Brennan, Donal J

    2011-01-01

    The most common indication for cesarean section (CS) in nulliparous women is dystocia secondary to ineffective myometrial contractility. The aim of this study was to identify a molecular profile in myometrium associated with dystocic labor.

  8. Molecular identification of tsetse fly ( Diptera: Glossinidae ) species ...

    African Journals Online (AJOL)

    Inspite of the few mixed clusters, the pattern produced in the phylogenetic trees can provide a good guide to support any other method of Glossina identification. It was recommended that evaluations be made to validate other genetic markers that can produce better resolutions to identify tsetse fly species using phylogenetic ...

  9. Seasonal abundance and molecular identification of West Nile virus ...

    African Journals Online (AJOL)

    Methods: Mosquitoes belonging to the Culex pipens complex were captured in three different locations located within Abeokuta Metropolis between March 2012 and January 2013. Individual species were identified using morphometric methods. Amplification of the Ace2 gene by PCR confirmed morphormetric identification ...

  10. MOLECULAR GENETIC IDENTIFICATION OF THE SLOVENE HOME GUARDVICTIMS

    Directory of Open Access Journals (Sweden)

    Irena Zupanič Pajnič

    2008-11-01

    The research showed a high probability (from 99.9999 % to 99.999999 % that allthree victims of the killings under the Storžič Mountain are related to the living relatives,speaking in favour of the positive identification of the victims

  11. Prevalence, incidence and molecular identification of root-knot ...

    African Journals Online (AJOL)

    Tomato is a widely grown vegetable in Pakistan. However, its production is severely constrained by root knot nematodes (RKNs). Accurate identification of RKNs is essential for an appropriate control program. The current study evaluated the prevalence, incidence and diversity of RKNs of tomato crops grown in the Khyber ...

  12. Transcriptomic analysis of endangered Chinese salamander: identification of immune, sex and reproduction-related genes and genetic markers.

    Directory of Open Access Journals (Sweden)

    Rongbo Che

    Full Text Available The Chinese salamander (Hynobius chinensis, an endangered amphibian species of salamander endemic to China, has attracted much attention because of its value of studying paleontology evolutionary history and decreasing population size. Despite increasing interest in the Hynobius chinensis genome, genomic resources for the species are still very limited. A comprehensive transcriptome of Hynobius chinensis, which will provide a resource for genome annotation, candidate genes identification and molecular marker development should be generated to supplement it.We performed a de novo assembly of Hynobius chinensis transcriptome by Illumina sequencing. A total of 148,510 nonredundant unigenes with an average length of approximately 580 bp were obtained. In all, 60,388 (40.66% unigenes showed homologous matches in at least one database and 33,537 (22.58% unigenes were annotated by all four databases. In total, 41,553 unigenes were categorized into 62 sub-categories by BLAST2GO search, and 19,468 transcripts were assigned to 140 KEGG pathways. A large number of unigenes involved in immune system, local adaptation, reproduction and sex determination were identified, as well as 31,982 simple sequence repeats (SSRs and 460,923 putative single nucleotide polymorphisms (SNPs.This dataset represents the first transcriptome analysis of the Chinese salamander (Hynobius chinensis, an endangered species, to be also the first time of hynobiidae. The transcriptome will provide valuable resource for further research in discovery of new genes, protection of population, adaptive evolution and survey of various pathways, as well as development of molecule markers in Chinese salamander; and reference information for closely related species.

  13. [Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].

    Science.gov (United States)

    Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi

    2013-01-01

    Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.

  14. Morphological and molecular identification of ticks infesting Boa constrictor (Squamata, Boidae in Manaus (Central Brazilian Amazon

    Directory of Open Access Journals (Sweden)

    Leonardo Costa Fiorini

    2014-12-01

    Full Text Available The Boa constrictor is one of the world's largest vertebrate carnivores and is often found in urban areas in the city of Manaus, Brazil. The morphological identification of ticks collected from 27 snakes indicated the occurrence of Amblyomma dissimile Koch 1844 on all individuals sampled. In contrast, Amblyomma rotundatum Koch was found on only two snakes. An analysis of the 16S rRNA molecular marker confirmed the morphological identification of these ectoparasites.

  15. Molecular identification of Coccidioides spp. in soil samples from Brazil

    OpenAIRE

    de Macêdo, Regina CL; Rosado, Alexandre S; da Mota, Fabio F; Cavalcante, Maria AS; Eulálio, Kelsen D; Filho, Antônio D; Martins, Liline MS; Lazéra, Márcia S; Wanke, Bodo

    2011-01-01

    Abstract Background Since 1991 several outbreaks of acute coccidioidomycosis (CM) were diagnosed in the semi-arid Northeast of Brazil, mainly related to disturbance of armadillo burrows caused by hunters while digging them for the capture of these animals. This activity causes dust contaminated with arthroconidia of Coccidioides posadasii, which, once inhaled, cause the mycosis. We report on the identification of C. posadasii in soil samples related to outbreaks of CM. Results Twenty four soi...

  16. Rapid molecular identification and characteristics of Lactobacillus strains.

    Science.gov (United States)

    Markiewicz, L H; Biedrzycka, E; Wasilewska, E; Bielecka, M

    2010-09-01

    Eleven type strains and 24 Lactobacillus isolates, preliminarily classified to the species due to phenotypic features, were investigated. Standard methods of identification with species-specific PCRs and typing with PFGE (with ApaI, NotI and SmaI restriction enzymes) allowed us to distinguish 16 unique strains belonging to 5 species (L. acidophilus, L. delbrueckii ssp. bulgaricus, L. plantarum, L. rhamnosus, L. salivarius). Alternative approach with 16S-23S rDNA ARDRA identification (with merely two restrictases, BsuRI and TaqI) and PCR-based typing (RAPD with two random- and rep-PCR with (GTG)(5) primers) showed to be more discriminative, i.e. 21 unique strains were classified in the same species as above. As a result, 7 out of 24 phenotypically species-assigned isolates were reclassified. The alternative procedure of rapid identification and typing of Lactobacillus isolates appeared to be equally effective and shortened from 1 week to 2-3 d (in comparison to the standard methods).

  17. Molecular subgroups of medulloblastoma identification using noninvasive magnetic resonance spectroscopy.

    Science.gov (United States)

    Blüml, Stefan; Margol, Ashley S; Sposto, Richard; Kennedy, Rebekah J; Robison, Nathan J; Vali, Marzieh; Hung, Long T; Muthugounder, Sakunthala; Finlay, Jonathan L; Erdreich-Epstein, Anat; Gilles, Floyd H; Judkins, Alexander R; Krieger, Mark D; Dhall, Girish; Nelson, Marvin D; Asgharzadeh, Shahab

    2016-01-01

    Medulloblastomas in children can be categorized into 4 molecular subgroups with differing clinical characteristics, such that subgroup determination aids in prognostication and risk-adaptive treatment strategies. Magnetic resonance spectroscopy (MRS) is a widely available, noninvasive tool that is used to determine the metabolic characteristics of tumors and provide diagnostic information without the need for tumor tissue. In this study, we investigated the hypothesis that metabolite concentrations measured by MRS would differ between molecular subgroups of medulloblastoma and allow accurate subgroup determination. MRS was used to measure metabolites in medulloblastomas across molecular subgroups (SHH = 12, Groups 3/4 = 17, WNT = 1). Levels of 14 metabolites were analyzed to determine those that were the most discriminant for medulloblastoma subgroups in order to construct a multivariable classifier for distinguishing between combined Group 3/4 and SHH tumors. Medulloblastomas across molecular subgroups revealed distinct spectral features. Group 3 and Group 4 tumors demonstrated metabolic profiles with readily detectable taurine, lower levels of lipids, and high levels of creatine. SHH tumors showed prominent choline and lipid with low levels of creatine and little or no evidence of taurine. A 5-metabolite subgroup classifier inclusive of creatine, myo-inositol, taurine, aspartate, and lipid 13a was developed that could discriminate between Group 3/4 and SHH medulloblastomas with excellent accuracy (cross-validated area under the curve [AUC] = 0.88). The data show that medulloblastomas of Group 3/4 differ metabolically as measured using MRS when compared with SHH molecular subgroups. MRS is a useful and accurate tool to determine medulloblastoma molecular subgroups. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Rapid molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus L., based on large Y-chromosomal insertions.

    Science.gov (United States)

    Bakker, Theo C M; Giger, Thomas; Frommen, Joachim G; Largiadèr, Carlo R

    2017-08-01

    There is a need for rapid and reliable molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus, the supermodel species for evolutionary biology. A DNA region at the 5' end of the sex-linked microsatellite Gac4202 was sequenced for the X chromosome of six females and the Y chromosome of five males from three populations. The Y chromosome contained two large insertions, which did not recombine with the phenotype of sex in a cross of 322 individuals. Genetic variation (SNPs and indels) within the insertions was smaller than on flanking DNA sequences. Three molecular PCR-based sex tests were developed, in which the first, the second or both insertions were covered. In five European populations (from DE, CH, NL, GB) of three-spined sticklebacks, tests with both insertions combined showed two clearly separated bands on agarose minigels in males and one band in females. The tests with the separate insertions gave similar results. Thus, the new molecular sexing method gave rapid and reliable results for sexing three-spined sticklebacks and is an improvement and/or alternative to existing methods.

  19. Sponge cell culture? A molecular identification method for sponge cells

    NARCIS (Netherlands)

    Sipkema, D.; Heilig, G.H.J.; Akkermans, A.D.L.; Osinga, R.; Tramper, J.; Wijffels, R.H.

    2003-01-01

    Dissociated sponge cells are easily confused with unicellular organisms. This has been an obstacle in the development of sponge-cell lines. We developed a molecular detection method to identify cells of the sponge Dysidea avara in dissociated cell cultures. The 18S ribosomal RNA gene from a Dysidea

  20. molecular identification of rotavirus strains associated with diarrhea

    African Journals Online (AJOL)

    DR. AMINU

    ABSTRACT. The study was carried out to determine the molecular characteristics of the rotavirus strains associated with diarrhea among children in Kwara state, Nigeria. A total of 150 stool samples were collected from diarrheic children. The stool samples were screened for rotavirus,using Enzyme linked Immunosorbent ...

  1. Molecular identification of rotavirus strains associated with diarrhea ...

    African Journals Online (AJOL)

    The study was carried out to determine the molecular characteristics of the rotavirus strains associated with diarrhea among children in Kwara state, Nigeria. A total of 150 stool samples were collected from diarrheic children. The stool samples were screened for rotavirus,using Enzyme linked Immunosorbent assay (ELISA).

  2. Identification of new molecular alterations in Fatal Familial Insomnia.

    Science.gov (United States)

    Fatal familial insomnia (FFI) is an autosomal dominant prion disease caused by a D178N mutation in PRNP in combination with methionine (Met) at codon 129 in the mutated allele of the same gene (D178N-129M haplotype). The present study analyzes pathological and molecular features in seven FFI cases c...

  3. Molecular identification of the insect adipokinetic hormone receptors

    DEFF Research Database (Denmark)

    Staubli, Frank; Jørgensen, Thomas J D; Cazzamali, Giuseppe

    2002-01-01

    identified the first insect AKH receptors, namely those from the fruitfly Drosophila melanogaster and the silkworm Bombyx mori. These results represent a breakthrough for insect molecular endocrinology, because it will lead to the cloning of all AKH receptors from all model insects used in AKH research, and...

  4. In silico identification of anthropogenic chemicals as ligands of zebrafish sex hormone binding globulin

    International Nuclear Information System (INIS)

    Thorsteinson, Nels; Ban, Fuqiang; Santos-Filho, Osvaldo; Tabaei, Seyed M.H.; Miguel-Queralt, Solange; Underhill, Caroline; Cherkasov, Artem; Hammond, Geoffrey L.

    2009-01-01

    Anthropogenic compounds with the capacity to interact with the steroid-binding site of sex hormone binding globulin (SHBG) pose health risks to humans and other vertebrates including fish. Building on studies of human SHBG, we have applied in silico drug discovery methods to identify potential binders for SHBG in zebrafish (Danio rerio) as a model aquatic organism. Computational methods, including; homology modeling, molecular dynamics simulations, virtual screening, and 3D QSAR analysis, successfully identified 6 non-steroidal substances from the ZINC chemical database that bind to zebrafish SHBG (zfSHBG) with low-micromolar to nanomolar affinities, as determined by a competitive ligand-binding assay. We also screened 80,000 commercial substances listed by the European Chemicals Bureau and Environment Canada, and 6 non-steroidal hits from this in silico screen were tested experimentally for zfSHBG binding. All 6 of these compounds displaced the [ 3 H]5α-dihydrotestosterone used as labeled ligand in the zfSHBG screening assay when tested at a 33 μM concentration, and 3 of them (hexestrol, 4-tert-octylcatechol, and dihydrobenzo(a)pyren-7(8H)-one) bind to zfSHBG in the micromolar range. The study demonstrates the feasibility of large-scale in silico screening of anthropogenic compounds that may disrupt or highjack functionally important protein:ligand interactions. Such studies could increase the awareness of hazards posed by existing commercial chemicals at relatively low cost

  5. Advances in Dendrobium molecular research: Applications in genetic variation, identification and breeding.

    Science.gov (United States)

    Teixeira da Silva, Jaime A; Jin, Xiaohua; Dobránszki, Judit; Lu, Jiangjie; Wang, Huizhong; Zotz, Gerhard; Cardoso, Jean Carlos; Zeng, Songjun

    2016-02-01

    Orchids of the genus Dendrobium are of great economic importance in global horticultural trade and in Asian traditional medicine. For both areas, research yielding solid information on taxonomy, phylogeny, and breeding of this genus are essential. Traditional morphological and cytological characterization are used in combination with molecular results in classification and identification. Markers may be useful when used alone but are not always reliable in identification. The number of species studied and identified by molecular markers is small at present. Conventional breeding methods are time-consuming and laborious. In the past two decades, promising advances have been made in taxonomy, phylogeny and breeding of Dendrobium species due to the intensive use of molecular markers. In this review, we focus on the main molecular techniques used in 121 published studies and discuss their importance and possibilities in speeding up the breeding of new cultivars and hybrids. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. An application of coherence resonances in molecular transition identification

    International Nuclear Information System (INIS)

    Alekseev, V.A.; Salomaa, R.

    1978-01-01

    In Λ-type three level configurations having long lived lower levels extremely sharp two photon resonances occur. We want to draw attention to the use of these resonances for distinguishing the hyperfine splitting of lower and upper set of levels of molecular transitions. A new feature in the theoretical model is that the saturator and probe beams are coupled to both transitions rendering possible the appearance of interference between the resonances. (author)

  7. Molecular Identification, Enzyme Assay, and Metabolic Profiling of Trichoderma spp.

    Science.gov (United States)

    Bae, Soo-Jung; Park, Young-Hwan; Bae, Hyeun-Jong; Jeon, Junhyun; Bae, Hanhong

    2017-06-28

    The goal of this study was to identify and characterize selected Trichoderma isolates by metabolic profiling and enzyme assay for evaluation of their potential as biocontrol agents against plant pathogens. Trichoderma isolates were obtained from the Rural Development Administration Genebank Information Center (Wanju, Republic of Korea). Eleven Trichoderma isolates were re-identified using ribosomal DNA internal transcribed spacer (ITS) regions. ITS sequence results showed new identification of Trichoderma isolates. In addition, metabolic profiling of the ethyl acetate extracts of the liquid cultures of five Trichoderma isolates that showed the best anti- Phytophthora activities was conducted using gas chromatography-mass spectrometry. Metabolic profiling revealed that Trichoderma isolates shared common metabolites with well-known antifungal activities. Enzyme assays indicated strong cell walldegrading enzyme activities of Trichoderma isolates. Overall, our results indicated that the selected Trichoderma isolates have great potential for use as biocontrol agents against plant pathogens.

  8. Molecular Methods To Improve Diagnosis and Identification of Mucormycosis▿

    Science.gov (United States)

    Hammond, Sarah P.; Bialek, Ralf; Milner, Danny A.; Petschnigg, Eva M.; Baden, Lindsey R.; Marty, Francisco M.

    2011-01-01

    Mucormycosis is difficult to diagnose. Samples from suspected cases often fail to grow Mucorales in microbiologic cultures. We identified all hematologic malignancy and stem cell transplant patients diagnosed with proven mucormycosis between 2001 and 2009 at Brigham and Women's Hospital/Dana-Farber Cancer Institute. Seminested PCR targeting Mucorales 18S ribosomal DNA and sequencing were performed on formalin-fixed paraffin-embedded tissue samples. Of 29 cases of mucormycosis, 27 had tissue samples available for PCR and sequencing. Mucorales PCR was positive in 22. Among 12 culture-positive cases, 10 were PCR positive and sequencing was concordant with culture results to the genus level in 9. Among 15 culture-negative cases, PCR was positive and sequencing allowed genus identification in 12. Mucorales PCR is useful for confirmation of the diagnosis of mucormycosis and for further characterization of the infection in cases where cultures are negative. PMID:21508149

  9. Molecular methods to improve diagnosis and identification of mucormycosis.

    Science.gov (United States)

    Hammond, Sarah P; Bialek, Ralf; Milner, Danny A; Petschnigg, Eva M; Baden, Lindsey R; Marty, Francisco M

    2011-06-01

    Mucormycosis is difficult to diagnose. Samples from suspected cases often fail to grow Mucorales in microbiologic cultures. We identified all hematologic malignancy and stem cell transplant patients diagnosed with proven mucormycosis between 2001 and 2009 at Brigham and Women's Hospital/Dana-Farber Cancer Institute. Seminested PCR targeting Mucorales 18S ribosomal DNA and sequencing were performed on formalin-fixed paraffin-embedded tissue samples. Of 29 cases of mucormycosis, 27 had tissue samples available for PCR and sequencing. Mucorales PCR was positive in 22. Among 12 culture-positive cases, 10 were PCR positive and sequencing was concordant with culture results to the genus level in 9. Among 15 culture-negative cases, PCR was positive and sequencing allowed genus identification in 12. Mucorales PCR is useful for confirmation of the diagnosis of mucormycosis and for further characterization of the infection in cases where cultures are negative.

  10. Molecular Identification of Adult and Juvenile Linyphiid and Theridiid Spiders in Alpine Glacier Foreland Communities

    Science.gov (United States)

    Raso, Lorna; Sint, Daniela; Rief, Alexander; Kaufmann, Rüdiger; Traugott, Michael

    2014-01-01

    In glacier forelands spiders constitute a large proportion of the invertebrate community. Therefore, it is important to be able to determine the species that can be found in these areas. Linyphiid and theridiid spider identification is currently not possible in juvenile specimens using traditional morphological based methods, however, a large proportion of the population in these areas are usually juveniles. Molecular methods permit identification of species at different life stages, making juvenile identification possible. In this study we tested a molecular tool to identify the 10 most common species of Linyphiidae and Theridiidae found in three glacier foreland communities of the Austrian Alps. Two multiplex PCR systems were developed and over 90% of the 753 field-collected spiders were identified successfully. The species targeted were found to be common in all three valleys during the summer of 2010. A comparison between the molecular and morphological data showed that although there was a slight difference in the results, the overall outcome was the same independently of the identification method used. We believe the quick and reliable identification of the spiders via the multiplex PCR assays developed here will aid the study of these families in Alpine habitats. PMID:25050841

  11. Identification of some Rice Mutants using Morphological and Molecular Methods

    International Nuclear Information System (INIS)

    Sobieh, S.E.S.

    2006-01-01

    This investigation was conducted at the experimental farm of plant research department, nuclear research center, atomic energy authority, abu zaabal in order to verify four rice genotypes i.e sakha 102, giza 178, high yielding mutant (Ms 6) and high yielding mutant (MG 16). the (UPOV) rice descriptor was used to identify the germplasm morphologically .Molecular RAPD-PCR was used to identify genetic variability on the molecular level for the tested genotypes. 1- the results indicated that according to (UPOV) rice descriptor eight morphological traits were completely different between mutant Ms 6 in comparison with the parent sakha 102 and mut. MG 16 in comparison parent giza 178, the traits were ; stem thickness, stem length, panicle length, 1000-grain weight, grain length, grain width decorticated grain length and decorticated grain width. 2- using 10 arbitrary primers, through four rice genotypes on the molecular level using RAPD markers. the size of the amplified fragments were ranged from 0.201 to 2.036 k bp. two primers OPB-13 and OPB-16 showed no polymorphism among genotypes tested. 3- the total number of amplicons produced by the 8 polymorphic RAPD profiels was 66. the total number of monomorphic amplicons was 32. however, the total number of polymorphic amplicons was 34. 4- the percentage of polymorphism ranged from (22.22%) for primer OPA-18 to (90%) for primer OPB-11. 5-the highest genetic similarity (90.3%) was between sakha 102 and high yielding mut. (Ms 6). the genetic similarity (75.5%) was between giza 178 and high yielding mut.(MG 16). 6- one positive unique marker amplified by OPA-18 Primer identified the high yielding mutant Ms 6 but three positive unique markers amplified by OPB-17 primer and OPA-18 primer identified the high yielding mutant MG 16

  12. Molecular techniques for the identification and detection of microorganisms relevant for the food industry

    NARCIS (Netherlands)

    Klijn, N.

    1996-01-01

    The research described in this thesis concerns the development and application in food microbiology of molecular identification and detection techniques based on 16S rRNA sequences. The technologies developed were applied to study the microbial ecology of two groups of bacteria, namely

  13. An immunological approach of sperm sexing and different methods for identification of X- and Y-chromosome bearing sperm

    Directory of Open Access Journals (Sweden)

    Shiv Kumar Yadav

    2017-05-01

    Full Text Available Separation of X- and Y-chromosome bearing sperm has been practiced for selection of desired sex of offspring to increase the profit in livestock industries. At present, fluorescence-activated cell sorter is the only successful method for separation of X- and Y-chromosome bearing sperm. This technology is based on the differences in DNA content between these two types of sperm and has been commercialized for bovine sperm. However, this technology still has problems in terms of high economic cost, sperm damage, and lower pregnancy rates compared to unsorted semen. Therefore, an inexpensive, convenient, and non-invasive approach for sperm sexing would be of benefit to agricultural sector. Within this perspective, immunological sperm sexing method is one of the attractive choices to separate X- and Y-chromosome bearing sperm. This article reviews the current knowledge about immunological approaches, viz., H-Y antigen, sex-specific antigens, and differentially expressed proteins for sperm sexing. Moreover, this review also highlighted the different methods for identification of X- and Y-sperm.

  14. Molecular Identification of Cryptosporidium Species from Pet Snakes in Thailand.

    Science.gov (United States)

    Yimming, Benjarat; Pattanatanang, Khampee; Sanyathitiseree, Pornchai; Inpankaew, Tawin; Kamyingkird, Ketsarin; Pinyopanuwat, Nongnuch; Chimnoi, Wissanuwat; Phasuk, Jumnongjit

    2016-08-01

    Cryptosporidium is an important pathogen causing gastrointestinal disease in snakes and is distributed worldwide. The main objectives of this study were to detect and identify Cryptosporidium species in captive snakes from exotic pet shops and snake farms in Thailand. In total, 165 fecal samples were examined from 8 snake species, boa constrictor (Boa constrictor constrictor), corn snake (Elaphe guttata), ball python (Python regius), milk snake (Lampropeltis triangulum), king snake (Lampropeltis getula), rock python (Python sebae), rainbow boa (Epicrates cenchria), and carpet python (Morelia spilota). Cryptosporidium oocysts were examined using the dimethyl sulfoxide (DMSO)-modified acid-fast staining and a molecular method based on nested-PCR, PCR-RFLP analysis, and sequencing amplification of the SSU rRNA gene. DMSO-modified acid-fast staining revealed the presence of Cryptosporidium oocysts in 12 out of 165 (7.3%) samples, whereas PCR produced positive results in 40 (24.2%) samples. Molecular characterization indicated the presence of Cryptosporidium parvum (mouse genotype) as the most common species in 24 samples (60%) from 5 species of snake followed by Cryptosporidium serpentis in 9 samples (22.5%) from 2 species of snake and Cryptosporidium muris in 3 samples (7.5%) from P. regius.

  15. Molecular Genotype Identification of Different Chickens: Major Histocompatibility Complex

    Directory of Open Access Journals (Sweden)

    Hongzhi Wang

    2014-09-01

    Full Text Available Chicken is a main poultry in China. Molecular breeding for disease resistance plays an important role in the control of diseases, especially infectious diseases. Choice of genes for disease resistance is the key technology of molecular breeding. The major histocompatibility complex (MHC is of great interest to poultry breeding scientists for its extraordinary polymorphism and close relation with traits of resistance against infectious diseases. The MHC-B haplotype plays an important role in the study of disease resistance in chicken. The traditional chicken MHC-B haplotype is commonly defined by serologic reactions of erythrocytes and the majority of studies have been conducted in Leghorn and broiler but study about other chicken breeds is little. In this study, firstly, the microsatellite marker LEI0258 which is located within the MHC was sequenced by using target sequence capture assay in different chicken breeds, and then according to the number of repeated structures and polymorphic sequences in microsatellite, sequence information for the region defined by LEI0258 was obtained for different haplotypes. Afterwards, we identified the relation between MHC-B haplotypes and disease resistance. Collectively, these observed results provided the reference data for disease-resistant breeding association with blood type and for further study of MHC gene function in poultry.

  16. Molecular genetic identification of some wheat cultivars in the sudan

    International Nuclear Information System (INIS)

    Mekki, I. I; El Amin, H. B.

    2002-01-01

    Four wheat (Triticum aestivum L.) cultivars, namely condor, El-Nellene, Wadi El Neil and Debeira were characterized on biochemical and molecular bases. The biochemical ones were protein-banding patterns, using sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and isozymes to identify the biochemical genetic fingerprint of the four cultivars. Water-soluble protein-banding pattern showed no polymorphisms among the tested cultivars. The data from starch gel electrophoresis of enzymes, malate dehydrogenase (MDH), esterase (EST) and acid phosphate (ACPH) showed that the cultivars are monomorphic. Further trials to identify the molecular genetic fingerprints of the studied cultivars were carried out using RAPD-PCR twenty-five primers were tested to perform. RAPD-PCR analysis. From the PCR products, a phylogenetic map, i.e, dendrogram, was constructed for the studied cultivars which depicted tow groups. The first group contained Wadi El Neil and Deberia with 48.4% similarity, and the second group contained Condor and El Neileen with 100% similarity. There was no similarity between Condor and Debeira (100% dissimilarity). Therefor, these data can be used subsequently for genetic engineering research and for wheat breeding programmes in the Sudan.(Author)

  17. Xylella fastidiosa: Host Range and Advance in Molecular Identification Techniques

    Science.gov (United States)

    Baldi, Paolo; La Porta, Nicola

    2017-01-01

    In the never ending struggle against plant pathogenic bacteria, a major goal is the early identification and classification of infecting microorganisms. Xylella fastidiosa, a Gram-negative bacterium belonging to the family Xanthmonadaceae, is no exception as this pathogen showed a broad range of vectors and host plants, many of which may carry the pathogen for a long time without showing any symptom. Till the last years, most of the diseases caused by X. fastidiosa have been reported from North and South America, but recently a widespread infection of olive quick decline syndrome caused by this fastidious pathogen appeared in Apulia (south-eastern Italy), and several cases of X. fastidiosa infection have been reported in other European Countries. At least five different subspecies of X. fastidiosa have been reported and classified: fastidiosa, multiplex, pauca, sandyi, and tashke. A sixth subspecies (morus) has been recently proposed. Therefore, it is vital to develop fast and reliable methods that allow the pathogen detection during the very early stages of infection, in order to prevent further spreading of this dangerous bacterium. To this purpose, the classical immunological methods such as ELISA and immunofluorescence are not always sensitive enough. However, PCR-based methods exploiting specific primers for the amplification of target regions of genomic DNA have been developed and are becoming a powerful tool for the detection and identification of many species of bacteria. The aim of this review is to illustrate the application of the most commonly used PCR approaches to X. fastidiosa study, ranging from classical PCR, to several PCR-based detection methods: random amplified polymorphic DNA (RAPD), quantitative real-time PCR (qRT-PCR), nested-PCR (N-PCR), immunocapture PCR (IC-PCR), short sequence repeats (SSRs, also called VNTR), single nucleotide polymorphisms (SNPs) and multilocus sequence typing (MLST). Amplification and sequence analysis of specific

  18. Xylella fastidiosa: Host Range and Advance in Molecular Identification Techniques

    Directory of Open Access Journals (Sweden)

    Paolo Baldi

    2017-06-01

    Full Text Available In the never ending struggle against plant pathogenic bacteria, a major goal is the early identification and classification of infecting microorganisms. Xylella fastidiosa, a Gram-negative bacterium belonging to the family Xanthmonadaceae, is no exception as this pathogen showed a broad range of vectors and host plants, many of which may carry the pathogen for a long time without showing any symptom. Till the last years, most of the diseases caused by X. fastidiosa have been reported from North and South America, but recently a widespread infection of olive quick decline syndrome caused by this fastidious pathogen appeared in Apulia (south-eastern Italy, and several cases of X. fastidiosa infection have been reported in other European Countries. At least five different subspecies of X. fastidiosa have been reported and classified: fastidiosa, multiplex, pauca, sandyi, and tashke. A sixth subspecies (morus has been recently proposed. Therefore, it is vital to develop fast and reliable methods that allow the pathogen detection during the very early stages of infection, in order to prevent further spreading of this dangerous bacterium. To this purpose, the classical immunological methods such as ELISA and immunofluorescence are not always sensitive enough. However, PCR-based methods exploiting specific primers for the amplification of target regions of genomic DNA have been developed and are becoming a powerful tool for the detection and identification of many species of bacteria. The aim of this review is to illustrate the application of the most commonly used PCR approaches to X. fastidiosa study, ranging from classical PCR, to several PCR-based detection methods: random amplified polymorphic DNA (RAPD, quantitative real-time PCR (qRT-PCR, nested-PCR (N-PCR, immunocapture PCR (IC-PCR, short sequence repeats (SSRs, also called VNTR, single nucleotide polymorphisms (SNPs and multilocus sequence typing (MLST. Amplification and sequence analysis of

  19. Molecular identification and characterization of prohibitin from Echinococcus granulosus.

    Science.gov (United States)

    Zhong, Xiuqin; Song, Xingju; Wang, Ning; Hu, Dandan; Liu, Tinayu; Wang, Tao; Gu, Xiaobin; Lai, Weimin; Peng, Xuerong; Yang, Guangyou

    2016-02-01

    Prohibitin (PHB) is a widely distributed protein that functions as a molecular chaperone, is involved in the regulation of cell cycle, and maintains mitochondrial structure and functions of the anti-apoptosis, senescence, and proliferation. The aim of this study was to characterize PHB in Echinococcus granulosus (EgPHB), a harmful cestode parasite of humans, many livestock species, and wild animals. We found that EgPHB is a conserved SPFH (stomatin, prohibitin, flotillin, and HflK/C) domain-containing protein, consisting of 289 amino acids, which shares 42.66-99.31% identity with PHBs from other parasites and mammals. EgPHB was located mainly in the tegument issue of protoscoleces, in the inner body of adult worms, and was expressed widely in the germinal layer. This is the first report on prohibitin from E. granulosus, and EgPHB is considered to be a valuable protein to study more in the future.

  20. Molecular Identification of Gambierdiscus and Fukuyoa (Dinophyceae from Environmental Samples

    Directory of Open Access Journals (Sweden)

    Kirsty F. Smith

    2017-08-01

    Full Text Available Ciguatera Fish Poisoning (CFP is increasing across the Pacific and the distribution of the causative dinoflagellates appears to be expanding. Subtle differences in thecal plate morphology are used to distinguish dinoflagellate species, which are difficult to determine using light microscopy. For these reasons we sought to develop a Quantitative PCR assay that would detect all species from both Gambierdiscus and Fukuyoa genera in order to rapidly screen environmental samples for potentially toxic species. Additionally, a specific assay for F. paulensis was developed as this species is of concern in New Zealand coastal waters. Using the assays we analyzed 31 samples from three locations around New Zealand and the Kingdom of Tonga. Fourteen samples in total were positive for Gambierdiscus/Fukuyoa and two samples were also positive using the F. paulensis assay. Samples from the Kermadec Islands were further characterized using high-throughput sequencing metabarcoding. The majority of reads corresponded to Gambierdiscus species with three species identified at all sites (G. australes, G. honu and G. polynesiensis. This is the first confirmed identification of G. polynesiensis, a known ciguatoxin producer, in New Zealand waters. Other known toxin-producing genera were also detected, included Alexandrium, Amphidinium, Azadinium, Dinophysis, Ostreopsis, and Prorocentrum.

  1. Identification of a myometrial molecular profile for dystocic labor

    Science.gov (United States)

    2011-01-01

    Background The most common indication for cesarean section (CS) in nulliparous women is dystocia secondary to ineffective myometrial contractility. The aim of this study was to identify a molecular profile in myometrium associated with dystocic labor. Methods Myometrial biopsies were obtained from the upper incisional margins of nulliparous women undergoing lower segment CS for dystocia (n = 4) and control women undergoing CS in the second stage who had demonstrated efficient uterine action during the first stage of labor (n = 4). All patients were in spontaneous (non-induced) labor and had received intrapartum oxytocin to accelerate labor. RNA was extracted from biopsies and hybridized to Affymetrix HuGene U133A Plus 2 microarrays. Internal validation was performed using quantitative SYBR Green Real-Time PCR. Results Seventy genes were differentially expressed between the two groups. 58 genes were down-regulated in the dystocia group. Gene ontology analysis revealed 12 of the 58 down-regulated genes were involved in the immune response. These included (ERAP2, (8.67 fold change (FC)) HLA-DQB1 (7.88 FC) CD28 (2.60 FC), LILRA3 (2.87 FC) and TGFBR3 (2.1 FC)) Hierarchical clustering demonstrated a difference in global gene expression patterns between the samples from dystocic and non-dystocic labours. RT-PCR validation was performed on 4 genes ERAP2, CD28, LILRA3 and TGFBR3 Conclusion These findings suggest an underlying molecular basis for dystocia in nulliparous women in spontaneous labor. Differentially expressed genes suggest an important role for the immune response in dystocic labor and may provide important indicators for new diagnostic assays and potential intrapartum therapeutic targets. PMID:21999197

  2. Identification of a Myometrial Molecular Profile for Dystocic Labor

    LENUS (Irish Health Repository)

    Brennan, Donal J

    2011-10-16

    Abstract Background The most common indication for cesarean section (CS) in nulliparous women is dystocia secondary to ineffective myometrial contractility. The aim of this study was to identify a molecular profile in myometrium associated with dystocic labor. Methods Myometrial biopsies were obtained from the upper incisional margins of nulliparous women undergoing lower segment CS for dystocia (n = 4) and control women undergoing CS in the second stage who had demonstrated efficient uterine action during the first stage of labor (n = 4). All patients were in spontaneous (non-induced) labor and had received intrapartum oxytocin to accelerate labor. RNA was extracted from biopsies and hybridized to Affymetrix HuGene U133A Plus 2 microarrays. Internal validation was performed using quantitative SYBR Green Real-Time PCR. Results Seventy genes were differentially expressed between the two groups. 58 genes were down-regulated in the dystocia group. Gene ontology analysis revealed 12 of the 58 down-regulated genes were involved in the immune response. These included (ERAP2, (8.67 fold change (FC)) HLA-DQB1 (7.88 FC) CD28 (2.60 FC), LILRA3 (2.87 FC) and TGFBR3 (2.1 FC)) Hierarchical clustering demonstrated a difference in global gene expression patterns between the samples from dystocic and non-dystocic labours. RT-PCR validation was performed on 4 genes ERAP2, CD28, LILRA3 and TGFBR3 Conclusion These findings suggest an underlying molecular basis for dystocia in nulliparous women in spontaneous labor. Differentially expressed genes suggest an important role for the immune response in dystocic labor and may provide important indicators for new diagnostic assays and potential intrapartum therapeutic targets.

  3. 46, XX male: a case study of clinical, hormonal and molecular cytogenetic evaluation of sex development disorder

    International Nuclear Information System (INIS)

    Ali, S.; Shahid, S.M.; Azhar, A.

    2012-01-01

    Disorders of sex development (DSD) create medical and social dilemma. Maleness with XX genotype is a rare genetic condition affecting one in 24,000 new-born males. The XX male syndrome is a varied condition characterized by a spectrum of clinical presentation. ranging from normal male genitalia to ambiguous sex. Chromosomal anomalies are important cause of lack of development in secondary sexual characteristics, delayed puberty, miscarriage, infertility and other associated problems. An individual having ambiguous sex may have lifelong impact on social, psychological and sexual functions. The present case study describes the hormonal, clinical and molecular cytogenetics data of sex development disorders in a patient who was phenotypically male but cytogenetic analysis revealed 46.XX. (author)

  4. Isolation and molecular identification of Lactobacillus brevis from traditional vinegar

    Directory of Open Access Journals (Sweden)

    Zeynab Ebrahimi

    2016-09-01

    Full Text Available Introduction: Vinegar is a popular condiment in the world that different materials and methods have been used to produce it. In Iran natural vinegar is also prepared mostly in a traditional way by using different fruits such as grapes and apples. Natural vinegar has beneficent properties and because of this, it is recommended to be used by traditional and Islamic medicine. Vinegar contains acetic acid bacteria, lactic acid bacteria and yeast. Acetic acid bacteria and yeasts are involved in the production of vinegar and lactic acid bacteria improve the flavor of vinegar. The aim of this study was isolation and identification of lactic acid bacteria especially Lactobacillus brevis from traditional vinegar. Materials and methods: After collecting a few traditional vinegars, the vinegar samples cultured for isolation of lactic acid bacteria on MRS broth and agar media contained nystatin as an anti-yeast antibiotic. Then some microbiological tests including catalase, gram staining and fermentation of carbohydrates were performed. Then, they were cultured at different temperatures, pH and different concentrations of salts. Finally, three isolates bacteria with biochemical properties of Lactobacillus brevis were evaluated by16 srDNA gene amplification. Results: Twelve lactobacilli were isolated from three vinegar samples. All isolated bacteria were catalase-negative and gram-positive. They could be able to grow at pH around 4.5 and 5.6, and at 2, 4 and 5.6% of salt concentrations. Most of the bacteria grew at 15oC, whereas one isolated grew at 45oC. Sequencing and Blast results showed that the three strains are Lactobacillus brevis. Discussion and conclusion: Lactobacillus brevis and Lactobacillus plantrum were found in traditional vinegars. Although isolation of Lactobacillus plantrum from vinegar was reported previously, as far as we could determine, it is for the first time that we could isolate Lactobacillus brevis from vinegar.

  5. Molecular identification of the chitinase genes in Plasmodium relictum.

    Science.gov (United States)

    Garcia-Longoria, Luz; Hellgren, Olof; Bensch, Staffan

    2014-06-18

    Malaria parasites need to synthesize chitinase in order to go through the peritrophic membrane, which is created around the mosquito midgut, to complete its life cycle. In mammalian malaria species, the chitinase gene comprises either a large or a short copy. In the avian malaria parasites Plasmodium gallinaceum both copies are present, suggesting that a gene duplication in the ancestor to these extant species preceded the loss of either the long or the short copy in Plasmodium parasites of mammals. Plasmodium gallinaceum is not the most widespread and harmful parasite of birds. This study is the first to search for and identify the chitinase gene in one of the most prevalent avian malaria parasites, Plasmodium relictum. Both copies of P. gallinaceum chitinase were used as reference sequences for primer design. Different sequences of Plasmodium spp. were used to build the phylogenetic tree of chitinase gene. The gene encoding for chitinase was identified in isolates of two mitochondrial lineages of P. relictum (SGS1 and GRW4). The chitinase found in these two lineages consists both of the long (PrCHT1) and the short (PrCHT2) copy. The genetic differences found in the long copy of the chitinase gene between SGS1 and GRW4 were higher than the difference observed for the cytochrome b gene. The identification of both copies in P. relictum sheds light on the phylogenetic relationship of the chitinase gene in the genus Plasmodium. Due to its high variability, the chitinase gene could be used to study the genetic population structure in isolates from different host species and geographic regions.

  6. Molecular identification of bacteria associated with canine periodontal disease.

    Science.gov (United States)

    Riggio, Marcello P; Lennon, Alan; Taylor, David J; Bennett, David

    2011-06-02

    Periodontal disease is one of the most common diseases of adult dogs, with up to 80% of animals affected. The aetiology of the disease is poorly studied, although bacteria are known to play a major role. The purpose of this study was to identify the bacteria associated with canine gingivitis and periodontitis and to compare this with the normal oral flora. Swabs were obtained from the gingival margin of three dogs with gingivitis and three orally healthy controls, and subgingival plaque was collected from three dogs with periodontitis. Samples were subjected to routine bacterial culture. The prevalent species identified in the normal, gingivitis and periodontitis groups were uncultured bacterium (12.5% of isolates), Bacteroides heparinolyticus/Pasteurella dagmatis (10.0%) and Actinomyces canis (19.4%), respectively. Bacteria were also identified using culture-independent methods (16S rRNA gene sequencing) and the predominant species identified were Pseudomonas sp. (30.9% of clones analysed), Porphyromonas cangingivalis (16.1%) and Desulfomicrobium orale (12.0%) in the normal, gingivitis and periodontitis groups, respectively. Uncultured species accounted for 13.2%, 2.0% and 10.5%, and potentially novel species for 38.2%, 38.3% and 35.3%, of clones in the normal, gingivitis and periodontitis groups, respectively. This is the first study to use utilise culture-independent methods for the identification of bacteria associated with this disease. It is concluded that the canine oral flora in health and disease is highly diverse and also contains a high proportion of uncultured and, in particular, potentially novel species. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Molecular phylogenetic identification of Fasciola flukes in Nepal.

    Science.gov (United States)

    Shoriki, Takuya; Ichikawa-Seki, Madoka; Devkota, Bhuminand; Rana, Hari B; Devkota, Shiva P; Humagain, Sudeep K; Itagaki, Tadashi

    2014-12-01

    Eighty-one Fasciola flukes collected from 8 districts in Nepal were analyzed for their species identification on the basis of their spermatogenic status and nuclear ribosomal internal transcribed spacer 1 (ITS1) and for their phylogenetic relation with Fasciola flukes from other Asian countries on the basis of the mitochondrial NADH dehydrogenase subunit 1 (nad1) gene. Sixty-one flukes (75.3%) were aspermic Fasciola sp., and 20 flukes (24.7%) were identified as Fasciola gigantica. All of the aspermic flukes displayed the Fh/Fg type in ITS1, which was predominant in aspermic Fasciola sp. from China, and most (60 flukes) displayed the Fsp-ND1-N1 haplotype in the nad1, which had an identical nucleotide sequence to the major haplotype (Fg-C2) of the aspermic flukes from China. These results suggest that aspermic Fasciola sp. was introduced into Nepal from China. Furthermore, the results of the diversity indices, neutrality indices, and median-joining network analysis with reference haplotypes from Asian countries suggest that aspermic Fasciola sp. rapidly expanded its distribution. In contrasts, F. gigantica displayed 10 nad1 haplotypes, which showed higher population diversity indices than the haplotypes of aspermic flukes, indicating that the F. gigantica population was clearly distributed in Nepal earlier than the aspermic Fasciola population. Although the F. gigantica haplotypes from Nepal formed a star-like phylogeny consisting of a main founder haplotype (Fg-ND1-N1), together with some F. gigantica haplotypes from Myanmar and Thailand, the Nepal population differed genetically from F. gigantica populations of neighboring countries as each country had distinct founder haplotype(s). Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Sex pheromones of the southern armyworm moth: isolation, identification, and synthesis.

    Science.gov (United States)

    Jacobson, M; Redfern, R E; Jones, W A; Aldridge, M H

    1970-10-30

    Two sex pheromones have been isolated from the female southern armyworm moth, Prodenia eridania (Cramer), and identified as cis-9-tetradecen-1-ol acetate, identical with the sex pheromone of the fall armyworm moth, Spodoptera frugiperda (J. E. Smith), and cis-9,trans-12-tetradecadien-1-ol acetate.

  9. Identification of SOX3 as an XX male sex reversal gene in mice and humans.

    Science.gov (United States)

    Sutton, Edwina; Hughes, James; White, Stefan; Sekido, Ryohei; Tan, Jacqueline; Arboleda, Valerie; Rogers, Nicholas; Knower, Kevin; Rowley, Lynn; Eyre, Helen; Rizzoti, Karine; McAninch, Dale; Goncalves, Joao; Slee, Jennie; Turbitt, Erin; Bruno, Damien; Bengtsson, Henrik; Harley, Vincent; Vilain, Eric; Sinclair, Andrew; Lovell-Badge, Robin; Thomas, Paul

    2011-01-01

    Sex in mammals is genetically determined and is defined at the cellular level by sex chromosome complement (XY males and XX females). The Y chromosome-linked gene sex-determining region Y (SRY) is believed to be the master initiator of male sex determination in almost all eutherian and metatherian mammals, functioning to upregulate expression of its direct target gene Sry-related HMG box-containing gene 9 (SOX9). Data suggest that SRY evolved from SOX3, although there is no direct functional evidence to support this hypothesis. Indeed, loss-of-function mutations in SOX3 do not affect sex determination in mice or humans. To further investigate Sox3 function in vivo, we generated transgenic mice overexpressing Sox3. Here, we report that in one of these transgenic lines, Sox3 was ectopically expressed in the bipotential gonad and that this led to frequent complete XX male sex reversal. Further analysis indicated that Sox3 induced testis differentiation in this particular line of mice by upregulating expression of Sox9 via a similar mechanism to Sry. Importantly, we also identified genomic rearrangements within the SOX3 regulatory region in three patients with XX male sex reversal. Together, these data suggest that SOX3 and SRY are functionally interchangeable in sex determination and support the notion that SRY evolved from SOX3 via a regulatory mutation that led to its de novo expression in the early gonad.

  10. Identification of SOX3 as an XX male sex reversal gene in mice and humans

    Science.gov (United States)

    Sutton, Edwina; Hughes, James; White, Stefan; Sekido, Ryohei; Tan, Jacqueline; Arboleda, Valerie; Rogers, Nicholas; Knower, Kevin; Rowley, Lynn; Eyre, Helen; Rizzoti, Karine; McAninch, Dale; Goncalves, Joao; Slee, Jennie; Turbitt, Erin; Bruno, Damien; Bengtsson, Henrik; Harley, Vincent; Vilain, Eric; Sinclair, Andrew; Lovell-Badge, Robin; Thomas, Paul

    2010-01-01

    Sex in mammals is genetically determined and is defined at the cellular level by sex chromosome complement (XY males and XX females). The Y chromosome–linked gene sex-determining region Y (SRY) is believed to be the master initiator of male sex determination in almost all eutherian and metatherian mammals, functioning to upregulate expression of its direct target gene Sry-related HMG box–containing gene 9 (SOX9). Data suggest that SRY evolved from SOX3, although there is no direct functional evidence to support this hypothesis. Indeed, loss-of-function mutations in SOX3 do not affect sex determination in mice or humans. To further investigate Sox3 function in vivo, we generated transgenic mice overexpressing Sox3. Here, we report that in one of these transgenic lines, Sox3 was ectopically expressed in the bipotential gonad and that this led to frequent complete XX male sex reversal. Further analysis indicated that Sox3 induced testis differentiation in this particular line of mice by upregulating expression of Sox9 via a similar mechanism to Sry. Importantly, we also identified genomic rearrangements within the SOX3 regulatory region in three patients with XX male sex reversal. Together, these data suggest that SOX3 and SRY are functionally interchangeable in sex determination and support the notion that SRY evolved from SOX3 via a regulatory mutation that led to its de novo expression in the early gonad. PMID:21183788

  11. Molecular identification of a malaria merozoite surface sheddase.

    Directory of Open Access Journals (Sweden)

    Philippa K Harris

    2005-11-01

    Full Text Available Proteolytic shedding of surface proteins during invasion by apicomplexan parasites is a widespread phenomenon, thought to represent a mechanism by which the parasites disengage adhesin-receptor complexes in order to gain entry into their host cell. Erythrocyte invasion by merozoites of the malaria parasite Plasmodium falciparum requires the shedding of ectodomain components of two essential surface proteins, called MSP1 and AMA1. Both are released by the same merozoite surface "sheddase," but the molecular identity and mode of action of this protease is unknown. Here we identify it as PfSUB2, an integral membrane subtilisin-like protease (subtilase. We show that PfSUB2 is stored in apical secretory organelles called micronemes. Upon merozoite release it is secreted onto the parasite surface and translocates to its posterior pole in an actin-dependent manner, a trafficking pattern predicted of the sheddase. Subtilase propeptides are usually selective inhibitors of their cognate protease, and the PfSUB2 propeptide is no exception; we show that recombinant PfSUB2 propeptide binds specifically to mature parasite-derived PfSUB2 and is a potent, selective inhibitor of MSP1 and AMA1 shedding, directly establishing PfSUB2 as the sheddase. PfSUB2 is a new potential target for drugs designed to prevent erythrocyte invasion by the malaria parasite.

  12. Identification of a molecular pH sensor in coral.

    Science.gov (United States)

    Barott, Katie L; Barron, Megan E; Tresguerres, Martin

    2017-11-15

    Maintaining stable intracellular pH (pHi) is essential for homeostasis, and requires the ability to both sense pH changes that may result from internal and external sources, and to regulate downstream compensatory pH pathways. Here we identified the cAMP-producing enzyme soluble adenylyl cyclase (sAC) as the first molecular pH sensor in corals. sAC protein was detected throughout coral tissues, including those involved in symbiosis and calcification. Application of a sAC-specific inhibitor caused significant and reversible pHi acidosis in isolated coral cells under both dark and light conditions, indicating sAC is essential for sensing and regulating pHi perturbations caused by respiration and photosynthesis. Furthermore, pHi regulation during external acidification was also dependent on sAC activity. Thus, sAC is a sensor and regulator of pH disturbances from both metabolic and external origin in corals. Since sAC is present in all coral cell types, and the cAMP pathway can regulate virtually every aspect of cell physiology through post-translational modifications of proteins, sAC is likely to trigger multiple homeostatic mechanisms in response to pH disturbances. This is also the first evidence that sAC modulates pHi in any non-mammalian animal. Since corals are basal metazoans, our results indicate this function is evolutionarily conserved across animals. © 2017 The Author(s).

  13. Molecular identification of Mango, Mangifera indica L.var. totupura

    Science.gov (United States)

    Jagarlamudi, Sankar; G, Rosaiah; Kurapati, Ravi Kumar; Pinnamaneni, Rajasekhar

    2011-01-01

    Mango (>Mangifera indica) belonging to Anacardiaceae family is a fruit that grows in tropical regions. It is considered as the King of fruits. The present work was taken up to identify a tool in identifying the mango species at the molecular level. The chloroplast trnL-F region was amplified from extracted total genomic DNA using the polymerase chain reaction (PCR) and sequenced. Sequence of the dominant DGGE band revealed that Mangifera indica in tested leaves was Mangifera indica (100% similarity to the ITS sequences of Mangifera indica). This sequence was deposited in NCBI with the accession no. GQ927757. Abbreviations AFLP - Amplified fragment length polymorphism , cpDNA - Chloroplast DNA, DDGE - Denaturing gradient gel electrophoresis, DNA - Deoxyribo nucleic acid, EDTA - Ethylenediamine tetraacetic acid, HCl - Hydrochloric acid, ISSR - Inter simple sequence repeats, ITS - Internal transcribed spacer, MATAB - Methyl Ammonium Bromide, Na2SO3 - Sodium sulphite, NaCl - Sodium chloride, NCBI - National Centre for Biotechnology Information, PCR - Polymerase chain reaction, PEG - Polyethylene glycol, RAPD - Randomly amplified polymorphic DNA, trnL-F - Transfer RNA genes start codon- termination codon. PMID:21423885

  14. Identification and molecular characterization of Parkin in Clonorchis sinensis.

    Science.gov (United States)

    Bai, Xuelian; Kim, Tae Im; Lee, Ji-Yun; Dai, Fuhong; Hong, Sung-Jong

    2015-02-01

    Clonorchis sinensis habitating in the bile duct of mammals causes clonorchiasis endemic in East Asian countries. Parkin is a RING-between-RING protein and has E3-ubiquitin ligase activity catalyzing ubiquitination and degradation of substrate proteins. A cDNA clone of C. sinensis was predicted to encode a polypeptide homologous to parkin (CsParkin) including 5 domains (Ubl, RING0, RING1, IBR, and RING2). The cysteine and histidine residues binding to Zn(2+) were all conserved and participated in formation of tertiary structural RINGs. Conserved residues were also an E2-binding site in RING1 domain and a catalytic cysteine residue in the RING2 domain. Native CsParkin was determined to have an estimated molecular weight of 45.7 kDa from C. sinensis adults by immunoblotting. CsParkin revealed E3-ubiquitin ligase activity and higher expression in metacercariae than in adults. CsParkin was localized in the locomotive and male reproductive organs of C. sinensis adults, and extensively in metacercariae. Parkin has been found to participate in regulating mitochondrial function and energy metabolism in mammalian cells. From these results, it is suggested that CsParkin play roles in energy metabolism of the locomotive organs, and possibly in protein metabolism of the reproductive organs of C. sinensis.

  15. Morphological and Molecular Identification of Colletotrichum acutatum from Tomato Fruit

    Directory of Open Access Journals (Sweden)

    Svetlana Živković

    2010-01-01

    Full Text Available Colletotrichum gloeosporioides, Colletotrichum acutatum, Colletotrichum coccodes, and Colletotrichum dematium are the four main species of Colletotrichum that cause tomato anthracnose. In Serbia, the occurrence of anthracnose on tomato fruit has been recorded during the last several years. Typical fruit symptoms include dark, sunken, and circular lesion with orange conidial masses. Pathogen isolates were obtained from a diseased tomato fruits, on PDA medium forming a white to gray colonies. The cultures developed black acervuli around the center of the colony. Conidia were hyaline, aseptate, and fusiform or rarely cylindrical. Appressoria were smooth, simple, clavate to ovate, and variedfrom light to dark brown. Pathogenicity tests with representative isolates were conducted on symptomless, detached tomato fruits. All tested isolates caused anthracnose lesions on tomato fruit after 7 days of incubation. Koch’s postulates were fulfilled by reisolationfrom inoculated tomato fruits. PCR analysis (using species-specific primer pair, CaInt2/ITS4 of genomic DNA from tomato isolates resulted in an amplification product of 490 bp, specific for C. acutatum, further confirming the identity of the pathogen. Based onmorphological and molecular characteristics, the isolates from tomato fruit were determined as C. acutatum.

  16. Molecular Identification of Nosema species in East Azerbaijan province, Iran

    Directory of Open Access Journals (Sweden)

    Razmaraii, N.

    2013-05-01

    Full Text Available Nosema is a genus of microsporidia, which have significant negative impacts on honeybees. The aim of thisstudy is the epidemiological evaluation and molecular characterization of Nosema spices in various countiesof East-Azerbaijan province (Northwest of Iran. 387 samples were collected from colonies maintained invarious counties of East-Azerbaijan province. Samples after preparation were examined by a lightmicroscope for presence of Nosema spores. PCR method (SSUrRNA gene was used to differentiatebetween Nosema apis (N. apis and N. ceranae. Descriptive statistics were used for data analysis. Totalinfection prevalence of the microscopic evaluation and PCR tests were 225 (58.1% and 260 (67.1%respectively, total validity of PCR test against the microscopic test was computed equal to 1.1 in this case.Disease distribution in various counties of study area was variable and N. ceranae was the only Nosema species found to infect honeybees. The one species presence and different distribution of Nosema positive samples in various counties of East-Azerbaijan province may be due to multiple reasons. Furthermore,epidemiological information helps us to improve disease management practices in the studied area, apply new hygiene policy and reduce extra costs of production.

  17. Phenotypic and molecular identification of Fonsecaea pedrosoi strains isolated from chromoblastomycosis patients in Mexico and Venezuela.

    Science.gov (United States)

    Carolina Rojas, O; León-Cachón, Rafael B R; Pérez-Maya, Antonio Alí; Aguirre-Garza, Marcelino; Moreno-Treviño, María G; González, Gloria M

    2015-05-01

    Chromoblastomycosis is a chronic granulomatous disease caused frequently by fungi of the Fonsecaea genus. The objective of this study was the phenotypic and molecular identification of F. pedrosoi strains isolated from chromoblastomycosis patients in Mexico and Venezuela. Ten strains were included in this study. For phenotypic identification, we used macroscopic and microscopic morphologies, carbohydrate assimilation test, urea hydrolysis, cixcloheximide tolerance, proteolitic activity and the thermotolerance test. The antifungal activity of five drugs was evaluated against the isolates. Molecular identification was performed by sequencing the internal transcribed spacer (ITS) ribosomal DNA regions of the isolated strains. The physiological analysis and morphological features were variable and the precise identification was not possible. All isolates were susceptible to itraconazole, terbinafine, voriconazole and posaconazole. Amphotericin B was the least effective drug. The alignment of the 559-nucleotide ITS sequences from our strains compared with sequences of GenBank revealed high homology with F. pedrosoi (EU285266.1). In this study, all patients were from rural areas, six from Mexico and four from Venezuela. Ten isolates were identified by phenotypic and molecular analysis, using ITS sequence and demonstrated that nine isolates from Mexico and Venezuela were 100% homologous and one isolate showed a small genetic distance. © 2015 Blackwell Verlag GmbH.

  18. Identification of Sex Pheromones and Sex Pheromone Mimics for Two North American Click Beetle Species (Coleoptera: Elateridae) in the Genus Cardiophorus Esch.

    Science.gov (United States)

    Serrano, Jacqueline M; Collignon, R Maxwell; Zou, Yunfan; Millar, Jocelyn G

    2018-04-01

    To date, all known or suspected pheromones of click beetles (Coleoptera: Elateridae) have been identified solely from species native to Europe and Asia; reports of identifications from North American species dating from the 1970s have since proven to be incorrect. While conducting bioassays of pheromones of a longhorned beetle (Coleoptera: Cerambycidae), we serendipitously discovered that males of Cardiophorus tenebrosus L. and Cardiophorus edwardsi Horn were specifically attracted to the cerambycid pheromone fuscumol acetate, (E)-6,10-dimethylundeca-5,9-dien-2-yl acetate, suggesting that this compound might also be a sex pheromone for the two Cardiophorus species. Further field bioassays and electrophysiological assays with the enantiomers of fuscumol acetate determined that males were specifically attracted by the (R)-enantiomer. However, subsequent analyses of extracts of volatiles from female C. tenebrosus and C. edwardsi showed that the females actually produced a different compound, which was identified as (3R,6E)-3,7,11-trimethyl-6,10-dodecadienoic acid methyl ester (methyl (3R,6E)-2,3-dihydrofarnesoate). In field trials, both the racemate and the (R)-enantiomer of the pheromone attracted similar numbers of male beetles, suggesting that the (S)-enantiomer was not interfering with responses to the insect-produced (R)-enantiomer. This report constitutes the first conclusive identification of sex pheromones for any North American click beetle species. Possible reasons for the strong and specific attraction of males to fuscumol acetate, which is markedly different in structure to the actual pheromone, are discussed.

  19. MORPHOLOGICAL AND MOLECULAR IDENTIFICATION OF Fusarium SPECIES AND THEIR PATHOGENICITY FOR WHEAT

    Directory of Open Access Journals (Sweden)

    Jelena Poštić

    2012-12-01

    Full Text Available From the root and lower stem parts of weeds and plant debris of maize, wheat, oat and sunflower we isolated 300 isolates of Fusarium spp. and performed morphological and molecular identification. With molecular identification using AFLP method we determined 14 Fusarium species: F. acuminatum, F. avenaceum, F. concolor, F. crookwellense, F. equiseti, F. graminearum, F. oxysporum, F. proliferatum, F. semitectum, F. solani, F. sporotrichioides, F. subglutinans, F. venenatum and F. verticillioides.By comparing results of morphological and molecular identification we found out that determination of 16,7% isolates was incorrect. Out of 300 isolates identified with molecular methods, 50 did not belong to the species determined with morphological determination.With pathogenicity tests of 30 chosen Fusarium isolates we determined that many of them were pathogenic to wheat and maize seedlings and to wheat heads. The most pathogenic were isolates of F. graminearum from A. retroflexus, A. theophrasti and C. album, F. venenatum from maize debris and and A. theophrasti, F. crookwellense from A. lappa. Antifungal influence of 11 essential oils on mycelia growth and sporulation of chosen Fusarium isolates determined that essential oils of T. vulgaris, P. anisum and E. caryophyllus had the strongest effect on mycelial growth. Influence of essential oils on sporulation was not statistically significant.

  20. Isolation and Identification of 9-methylgermacrene-B as the Putative Sex Pheromone of Lutzomyia cruzi (Mangabeira, 1938 (Diptera: Psychodidae

    Directory of Open Access Journals (Sweden)

    Brazil Reginaldo P

    2002-01-01

    Full Text Available Lutzomyia (Lutzomyia cruzi has been named as a probable vector of Leishmania chagasi in Corumbá, Mato Grosso do Sul, Brazil. Taxonomically L. cruzi is closely related to the L. longipalpis species complex. Females of L. cruzi and L. longipalpis are morphologically indistinguishable and associated males must be examined carefully to confirm identifications. Chemical analysis hexane extracts of male L. cruzi has revealed the presence of a 9-methylgermacrene-B (C16, a homosesquiterpene (mw 218 previously shown to be the sex pheromone of one of the members of the L. longipalpis species complex.

  1. Adult Sex Identification Using Three-Dimensional Computed Tomography (3D-CT of the Pelvis: A Study Among a Sample of the Egyptian Population

    Directory of Open Access Journals (Sweden)

    Enas M. A. Mostafa

    2016-06-01

    Full Text Available Sex identification of unknown human skeletal remains is of great importance in establishing identity and individuality. In adults, the hip bone is the most reliable sex indicator because of its sexual dimorphism. Each population should have its own specific standards of identification. The objective of this study is to develop a logistic regression formula for adult sex identification using threedimensional computed tomography (3D-CT of the pelvis and to perform an assessment of its validity in sex determination among a sample of the Egyptian population in the Suez Canal region. 141 pelvic-abdominal CT images (free of any pelvic orthopaedic disorder were included; they were reconstructed to produce 3D-CT pelvic images which were divided into a calibration group (47 male and 47 female and a test group (47 CT images the sex of which was unknown to the observers. Twenty radiometric variables were measured for the calibration group. A logit response formula for sex prediction was developed and applied on the test group for sex prediction. The logit response formula for the test sample showed sensitivity, specificity, and an overall accuracy of 100%. The proposed method represents a quick and reliable metric method in establishing sex from a CT image of the pelvis bone.

  2. Sex identification and PIT-tagging: tools and prospects for studying intersexual differences in freshwater fishes

    DEFF Research Database (Denmark)

    Hulthén, K.; Chapman, B.B.; Nilsson, P.A.

    2014-01-01

    the probability of survival within the size range tagged (119–280 m ), nor were there differences in timing of migration the following season between individuals sexed and tagged in spring and individuals tagged in autumn (i.e. outside the reproductive period). Also, a similar per cent of R. rutilus sexed...... and tagged in spring and tagged in autumn migrated the following season (34·5 and 34·7%). Moreover, long-term recapture data revealed no significant differences in body condition between R. rutilus individuals sexed and tagged in spring, individuals tagged in autumn and unmanipulated individuals....... The observed sex ratio of recaptured fish did not differ from the expected values of equal recapture rates between males and females. Hence, there is no observable evidence for an adverse effect of tagging close to the reproductive period and therefore this method is suitable for studying intersexual...

  3. Screening and identification of a microsatellite marker associated with sex in Wami tilapia, Oreochromis urolepis hornorum.

    Science.gov (United States)

    Zhu, Huaping; Liu, Zhigang; Lu, Maixin; Gao, Fengying; Ke, Xiaoli; Ma, Dongmei; Huang, Zhanghan; Cao, Jianmeng; Wang, Miao

    2016-06-01

    In this study, primer pairs of 15 microsatellite markers associated with sex determination of tilapia were selected and amplified in Wami tilapia, Oreochromis urolepis hornorum. While one marker, UNH168, on linkage group 3 (LG3) was associated (P tilapia chromosome pair (chromosome 1, equivalent to LG3). This sex-linked microsatellite marker could potentially be used for marker-assisted selection in tilapia breeding programmes to produce monosex male tilapia.

  4. The Impact of Sex Differences on Odor Identification and Facial Affect Recognition in Patients with Schizophrenia Spectrum Disorders.

    Science.gov (United States)

    Mossaheb, Nilufar; Kaufmann, Rainer M; Schlögelhofer, Monika; Aninilkumparambil, Thushara; Himmelbauer, Claudia; Gold, Anna; Zehetmayer, Sonja; Hoffmann, Holger; Traue, Harald C; Aschauer, Harald

    2018-01-01

    Social interactive functions such as facial emotion recognition and smell identification have been shown to differ between women and men. However, little is known about how these differences are mirrored in patients with schizophrenia and how these abilities interact with each other and with other clinical variables in patients vs. healthy controls. Standardized instruments were used to assess facial emotion recognition [Facially Expressed Emotion Labelling (FEEL)] and smell identification [University of Pennsylvania Smell Identification Test (UPSIT)] in 51 patients with schizophrenia spectrum disorders and 79 healthy controls; furthermore, working memory functions and clinical variables were assessed. In both the univariate and the multivariate results, illness showed a significant influence on UPSIT and FEEL. The inclusion of age and working memory in the MANOVA resulted in a differential effect with sex and working memory as remaining significant factors. Duration of illness was correlated with both emotion recognition and smell identification in men only, whereas immediate general psychopathology and negative symptoms were associated with emotion recognition only in women. Being affected by schizophrenia spectrum disorder impacts one's ability to correctly recognize facial affects and identify odors. Converging evidence suggests a link between the investigated basic and social cognitive abilities in patients with schizophrenia spectrum disorders with a strong contribution of working memory and differential effects of modulators in women vs. men.

  5. The Impact of Sex Differences on Odor Identification and Facial Affect Recognition in Patients with Schizophrenia Spectrum Disorders

    Directory of Open Access Journals (Sweden)

    Nilufar Mossaheb

    2018-01-01

    Full Text Available BackgroundSocial interactive functions such as facial emotion recognition and smell identification have been shown to differ between women and men. However, little is known about how these differences are mirrored in patients with schizophrenia and how these abilities interact with each other and with other clinical variables in patients vs. healthy controls.MethodsStandardized instruments were used to assess facial emotion recognition [Facially Expressed Emotion Labelling (FEEL] and smell identification [University of Pennsylvania Smell Identification Test (UPSIT] in 51 patients with schizophrenia spectrum disorders and 79 healthy controls; furthermore, working memory functions and clinical variables were assessed.ResultsIn both the univariate and the multivariate results, illness showed a significant influence on UPSIT and FEEL. The inclusion of age and working memory in the MANOVA resulted in a differential effect with sex and working memory as remaining significant factors. Duration of illness was correlated with both emotion recognition and smell identification in men only, whereas immediate general psychopathology and negative symptoms were associated with emotion recognition only in women.ConclusionBeing affected by schizophrenia spectrum disorder impacts one’s ability to correctly recognize facial affects and identify odors. Converging evidence suggests a link between the investigated basic and social cognitive abilities in patients with schizophrenia spectrum disorders with a strong contribution of working memory and differential effects of modulators in women vs. men.

  6. Identification and characterization of tebuconazole transformation products in soil by combining suspect screening and molecular typology

    International Nuclear Information System (INIS)

    Storck, Veronika; Lucini, Luigi; Mamy, Laure; Ferrari, Federico; Papadopoulou, Evangelia S.; Nikolaki, Sofia; Karas, Panagiotis A.; Servien, Remi; Karpouzas, Dimitrios G.; Trevisan, Marco; Benoit, Pierre; Martin-Laurent, Fabrice

    2016-01-01

    Pesticides generate transformation products (TPs) when they are released into the environment. These TPs may be of ecotoxicological importance. Past studies have demonstrated how difficult it is to predict the occurrence of pesticide TPs and their environmental risk. The monitoring approaches mostly used in current regulatory frameworks target only known ecotoxicologically relevant TPs. Here, we present a novel combined approach which identifies and categorizes known and unknown pesticide TPs in soil by combining suspect screening time-of-flight mass spectrometry with in silico molecular typology. We used an empirical and theoretical pesticide TP library for compound identification by both non-target and target time-of-flight (tandem) mass spectrometry, followed by structural proposition through a molecular structure correlation program. In silico molecular typology was then used to group TPs according to common molecular descriptors and to indirectly elucidate their environmental parameters by analogy to known pesticide compounds with similar molecular descriptors. This approach was evaluated via the identification of TPs of the triazole fungicide tebuconazole occurring in soil during a field dissipation study. Overall, 22 empirical and 12 yet unknown TPs were detected, and categorized into three groups with defined environmental properties. This approach combining suspect screening time-of-flight mass spectrometry with molecular typology could be extended to other organic pollutants and used to rationalize the choice of TPs to be investigated towards a more comprehensive environmental risk assessment scheme. - Highlights: • Combined method to detect and categorize pesticide transformation products in soil. • Detection by QTOF-MS of new tebuconazole transformation products without standards. • Estimation by in silico molecular typology of their environmental parameters. • Method to rationally choose relevant transformation products to be studied. • The

  7. Recent advances in high-throughput molecular marker identification for superficial and invasive bladder cancers

    DEFF Research Database (Denmark)

    Andersen, Lars Dyrskjøt; Zieger, Karsten; Ørntoft, Torben Falck

    2007-01-01

    individually contributed to the management of the disease. However, the development of high-throughput techniques for simultaneous assessment of a large number of markers has allowed classification of tumors into clinically relevant molecular subgroups beyond those possible by pathological classification. Here......Bladder cancer is the fifth most common neoplasm in industrialized countries. Due to frequent recurrences of the superficial form of this disease, bladder cancer ranks as one of the most common cancers. Despite the description of a large number of tumor markers for bladder cancers, none have......, we review the recent advances in high-throughput molecular marker identification for superficial and invasive bladder cancers....

  8. Toxocariasis in Carnivora from Argentinean Patagonia: Species molecular identification, hosts, and geographical distribution

    Directory of Open Access Journals (Sweden)

    R.M. Vega

    2018-04-01

    Full Text Available Twenty four specimens of seven species belonging to the families Felidae, Mustelidae, and Canidae were obtained in Lanín and Nahuel Huapi National Parks from March 1996 to April 2016. Specimens were processed by necropsy in order to contribute to the knowledge of toxocariasis in wild carnivores of Argentinean Patagonia. The only Puma concolor and the seven Leopardus geoffroyi were positive for Toxocara cati. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP of the ITS-1 region from larval and adult DNA was carried out to confirm parasite species identification. This is the first molecular determination of T. cati from wild felids in Argentina and the study also fill gaps about the spatial distribution and hosts for Toxocara cati. Keywords: Toxocara cati, Puma concolor, Leopardus geoffroyi, Molecular identification, Argentina

  9. Molecular identification of blow flies recovered from human cadavers during crime scene investigations in Malaysia.

    Science.gov (United States)

    Kavitha, Rajagopal; Nazni, Wasi Ahmad; Tan, Tian Chye; Lee, Han Lim; Isa, Mohd Noor Mat; Azirun, Mohd Sofian

    2012-12-01

    Forensic entomology applies knowledge about insects associated with decedent in crime scene investigation. It is possible to calculate a minimum postmortem interval (PMI) by determining the age and species of the oldest blow fly larvae feeding on decedent. This study was conducted in Malaysia to identify maggot specimens collected during crime scene investigations. The usefulness of the molecular and morphological approach in species identifications was evaluated in 10 morphologically identified blow fly larvae sampled from 10 different crime scenes in Malaysia. The molecular identification method involved the sequencing of a total length of 2.2 kilo base pairs encompassing the 'barcode' fragments of the mitochondrial cytochrome oxidase I (COI), cytochrome oxidase II (COII) and t-RNA leucine genes. Phylogenetic analyses confirmed the presence of Chrysomya megacephala, Chrysomya rufifacies and Chrysomya nigripes. In addition, one unidentified blow fly species was found based on phylogenetic tree analysis.

  10. Molecular identification of Mucorales in human tissues: contribution of PCR electrospray-ionization mass spectrometry.

    Science.gov (United States)

    Alanio, A; Garcia-Hermoso, D; Mercier-Delarue, S; Lanternier, F; Gits-Muselli, M; Menotti, J; Denis, B; Bergeron, A; Legrand, M; Lortholary, O; Bretagne, S

    2015-06-01

    Molecular methods are crucial for mucormycosis diagnosis because cultures are frequently negative, even if microscopy suggests the presence of hyphae in tissues. We assessed PCR/electrospray-ionization mass spectrometry (PCR/ESI-MS) for Mucorales identification in 19 unfixed tissue samples from 13 patients with proven or probable mucormycosis and compared the results with culture, quantitative real-time PCR, 16S-23S rRNA gene internal transcribed spacer region (ITS PCR) and 18S PCR sequencing. Concordance with culture identification to both genus and species levels was higher for PCR/ESI-MS than for the other techniques. Thus, PCR/ESI-MS is suitable for Mucorales identification, within 6 hours, for tissue samples for which microscopy results suggest the presence of hyphae. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  11. Automated identification and quantification of glycerophospholipid molecular species by multiple precursor ion scanning

    DEFF Research Database (Denmark)

    Ejsing, Christer S.; Duchoslav, Eva; Sampaio, Julio

    2006-01-01

    We report a method for the identification and quantification of glycerophospholipid molecular species that is based on the simultaneous automated acquisition and processing of 41 precursor ion spectra, specific for acyl anions of common fatty acids moieties and several lipid class-specific fragment...... of glycerophospholipids. The automated analysis of total lipid extracts was powered by a robotic nanoflow ion source and produced currently the most detailed description of the glycerophospholipidome....

  12. Molecular identification of Cryptosporidium spp. in seagulls, pigeons, dogs, and cats in Thailand

    OpenAIRE

    Koompapong Khuanchai; Mori Hirotake; Thammasonthijarern Nipa; Prasertbun Rapeepun; Pintong Ai-rada; Popruk Supaluk; Rojekittikhun Wichit; Chaisiri Kittipong; Sukthana Yaowalark; Mahittikorn Aongart

    2014-01-01

    Zoonotic Cryptosporidium spp., particularly C. meleagridis, C. canis, and C. felis, are enteric protozoa responsible for major public health concerns around the world. To determine the spread of this parasite in Thailand, we conducted molecular identification of Cryptosporidium spp. from animal samples around the country, by collecting and investigating the feces of seagulls (Chroicocephalus brunnicephalus and Chroicocephalus ridibundus), domestic pigeons (Columba livia domestica), dogs, and ...

  13. Molecular identification of Cryptosporidium spp. in animal and human hosts from the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Hajdušek, Ondřej; Ditrich, Oleg; Šlapeta, J.

    2004-01-01

    Roč. 122, č. 3 (2004), s. 183-192 ISSN 0304-4017 R&D Projects: GA AV ČR IBS6022006 Grant - others:GA MŠk1(CZ) 1260/2001 Institutional research plan: CEZ:AV0Z6022909 Keywords : Cryptosporidium * molecular identification * SSU rRNA Subject RIV: EE - Microbiology, Virology Impact factor: 1.445, year: 2004

  14. Species identification refined by molecular scatology in a community of sympatric carnivores in Xinjiang, China

    OpenAIRE

    LAGUARDIA, Alice; WANG, Jun; SHI, Fang-Lei; SHI, Kun; RIORDAN, Philip

    2015-01-01

    Many ecological studies and conservation management plans employ noninvasive scat sampling based on the assumption that species’ scats can be correctly identified in the field. However, in habitats with sympatric similarly sized carnivores, misidentification of scats is frequent and can lead to bias in research results. To address the scat identification dilemma, molecular scatology techniques have been developed to extract DNA from the donor cells present on the outer lining of the scat samp...

  15. Separation and Molecular Identification of Resistant Bacteria to Lead from Behbahan Bidboland Gas Refinery Wastewater (Iran)

    OpenAIRE

    Azam Mehrbakhsh; Monir Doudi; Hossein Motamedi

    2016-01-01

    Heavy metals are one of the pollution sources in environment. The pollution due to these metals is the problem that could have negative impact on water. Human is faced with these poisons effects due to occupational reasons. The lead is regarded as heavy metal whose industrial applications cause environmental pollution in high rate.The aim of this project was Separation and Molecular Identification of Resistant Bacteria to Lead from Behbahan Bidboland Gas Refinery Wastewater (Iran). For thi...

  16. Species identification refined by molecular scatology in a community of sympatric carnivores in Xinjiang, China.

    Science.gov (United States)

    Laguardia, Alice; Wang, Jun; Shi, Fang-Lei; Shi, Kun; Riordan, Philip

    2015-03-18

    Many ecological studies and conservation management plans employ noninvasive scat sampling based on the assumption that species' scats can be correctly identified in the field. However, in habitats with sympatric similarly sized carnivores, misidentification of scats is frequent and can lead to bias in research results. To address the scat identification dilemma, molecular scatology techniques have been developed to extract DNA from the donor cells present on the outer lining of the scat samples. A total of 100 samples were collected in the winter of 2009 and 2011 in Taxkorgan region of Xinjiang, China. DNA was extracted successfully from 88% of samples and genetic species identification showed that more than half the scats identified in the field as snow leopard (Panthera uncia) actually belonged to fox (Vulpes vulpes). Correlation between scat characteristics and species were investigated, showing that diameter and dry weight of the scat were significantly different between the species. However it was not possible to define a precise range of values for each species because of extensive overlap between the morphological values. This preliminary study confirms that identification of snow leopard feces in the field is misleading. Research that relies upon scat samples to assess distribution or diet of the snow leopard should therefore employ molecular scatology techniques. These methods are financially accessible and employ relatively simple laboratory procedures that can give an indisputable response to species identification from scats.

  17. [Identification of the genetic sex chromosomes in the monogenic blowfly Chrysomya rufifacies (Calliphoridae, Diptera)].

    Science.gov (United States)

    Ullerich, F H

    1975-01-01

    Previous investigations have shown the sex determination in the monogenic blowfly Chrysomya rufifacies to be controlled by a cytologically not discernible homogametry-heterogamety mechanism in the female. Female-producing (thelygenic) females are assumed to be heterozygous for a dominant female sex realizer (F') with sex-predetermining properties, while male-producing (arrhenogenic) females as well as males are supposed to be homozygous for the recessive allele (f). In order to identify the genetic sex chromosomes of C. rufifacies among its five pairs of long euchromatic chromosomes (nos. 1-5) plus one pair of small heterochromatic ones (no. 6), all chromosomes were marked by reciprocal translocations induced by X-ray treatment of adult males. The inheritance of thirteen different heteroxygous translocations has been analyzed. All of the translocations (eleven) between two of the four longer chromosomes did not show sex-linked inheritance, thus demonstrating the autosomal character of the chromosomes nos 1, 2, 3 and 4. The same is true for the translocation T6 (2/6). Therefore the small heterochromatic chromosome no. 6, corresponding to the morphlogically differentiated six chromosomes within the amphogenic calliphorid species, remains without sex determining function in the monogenic fly. This could be confirmed by the analysis of monosomic (monosomy-6) and trisomic (trisomy-6) individuals, which resulted from meiotic non-disfunction in T6/+ translocation heterozygotes. Contrary to these translocations, the heteroxygous 5/2 translocation (T14) exhibited sex-linked inheritance: There was but a very low frequency (0,76 per cent) of recombinants resulting from crossing-over between F'/f and the translocation breakage point in theylgenic F1 T14/+females. The sex-linked inheritance of T14 was confirmed by the progeny of a thelygenic F1 T14/+ female crossed to a homozygous T14/T14 translocation male.Among the offspring of that F1 T14/+ female, which had received the

  18. Molecular imprinted polymer-coated optical fiber sensor for the identification of low molecular weight molecules.

    Science.gov (United States)

    Lépinay, Sandrine; Ianoul, Anatoli; Albert, Jacques

    2014-10-01

    A biomimetic optical probe for detecting low molecular weight molecules (maltol, 3-hydroxy-2-methyl-4H-pyran-4-one, molecular weight of 126.11 g/mol), was designed, fabricated, and characterized. The sensor couples a molecular imprinted polymer (MIP) and the Bragg grating refractometry technology into an optical fiber. The probe is fabricated first by inscribing tilted grating planes in the core of the fiber, and then by photopolymerization to immobilize a maltol imprinted MIP on the fiber cladding surface over the Bragg grating. The sensor response to the presence of maltol in different media is obtained by spectral interrogation of the fiber transmission signal. The results showed that the limit of detection of the sensor reached 1 ng/mL in pure water with a sensitivity of 6.3 × 10(8)pm/M. The selectivity of the sensor against other compounds and its reusability were also studied experimentally. Finally, the unambiguous detection of concentrations as little as 10nM of maltol in complex media (real food samples) by the MIP-coated tilted fiber Bragg grating sensor was demonstrated. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Molecular definition of vaginal microbiota in East African commercial sex workers.

    Science.gov (United States)

    Schellenberg, John J; Links, Matthew G; Hill, Janet E; Dumonceaux, Tim J; Kimani, Joshua; Jaoko, Walter; Wachihi, Charles; Mungai, Jane Njeri; Peters, Geoffrey A; Tyler, Shaun; Graham, Morag; Severini, Alberto; Fowke, Keith R; Ball, T Blake; Plummer, Francis A

    2011-06-01

    Resistance to HIV infection in a cohort of commercial sex workers living in Nairobi, Kenya, is linked to mucosal and antiinflammatory factors that may be influenced by the vaginal microbiota. Since bacterial vaginosis (BV), a polymicrobial dysbiosis characterized by low levels of protective Lactobacillus organisms, is an established risk factor for HIV infection, we investigated whether vaginal microbiology was associated with HIV-exposed seronegative (HESN) or HIV-seropositive (HIV(+)) status in this cohort. A subset of 44 individuals was selected for deep-sequencing analysis based on the chaperonin 60 (cpn60) universal target (UT), including HESN individuals (n = 16), other HIV-seronegative controls (HIV-N, n = 16), and HIV(+) individuals (n = 12). Our findings indicate exceptionally high phylogenetic resolution of the cpn60 UT using reads as short as 200 bp, with 54 species in 29 genera detected in this group. Contrary to our initial hypothesis, few differences between HESN and HIV-N women were observed. Several HIV(+) women had distinct profiles dominated by Escherichia coli. The deep-sequencing phylogenetic profile of the vaginal microbiota corresponds closely to BV(+) and BV(-) diagnoses by microscopy, elucidating BV at the molecular level. A cluster of samples with intermediate abundance of Lactobacillus and dominant Gardnerella was identified, defining a distinct BV phenotype that may represent a transitional stage between BV(+) and BV(-). Several alpha- and betaproteobacteria, including the recently described species Variovorax paradoxus, were found to correlate positively with increased Lactobacillus levels that define the BV(-) ("normal") phenotype. We conclude that cpn60 UT is ideally suited to next-generation sequencing technologies for further investigation of microbial community dynamics and mucosal immunity underlying HIV resistance in this cohort.

  20. Towards mosquito sterile insect technique programmes: Exploring genetic, molecular, mechanical and behavioural methods of sex separation in mosquitoes

    Czech Academy of Sciences Publication Activity Database

    Gilles, J. R. L.; Schetelig, M. F.; Scolari, F.; Marec, František; Capurro, M.L.; Franz, G.; Bourtzis, K.

    132S, č. 1 (2014), S178-S187 ISSN 0001-706X R&D Projects: GA ČR GA523/09/2106 Grant - others:Deutsche Forschungsgemeinschalft(DE) SCHE 1833/1 Institutional support: RVO:60077344 Keywords : female elimination * vector control * genetic sexing strains (GSS) Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.270, year: 2014 http://www.sciencedirect.com/science/article/pii/S0001706X13002209?via=ihub

  1. Isolation, identification and field tests of the sex pheromone of the carambola fruit borer, Eucosma notanthes.

    Science.gov (United States)

    Hung, C C; Hwang, J S; Hung, M D; Yen, Y P; Hou, R F

    2001-09-01

    Two components, (Z)-8-dodecenyl acetate (Z8-12:Ac) and (Z)-8-dodecenol (Z8-12:OH), were isolated from sex pheromone glands of the carambola fruit borer, Eucosma notanthes, and were identified by GC, and GC-MS, chemical derivatization, and comparison of retention times. The ratio of the alcohol to acetate in the sex pheromone extracts was 2.7. However, synthetic mixtures (1 mg) in ratios ranging from 0.5 to 1.5 were more effective than other blends in trapping male moths in field tests.

  2. Comparing culture and molecular methods for the identification of microorganisms involved in necrotizing soft tissue infections

    DEFF Research Database (Denmark)

    Rudkjøbing, Vibeke Børsholt; Thomsen, Trine Rolighed; Xu, Yijuan

    2016-01-01

    BACKGROUND: Necrotizing soft tissue infections (NSTIs) are a group of infections affecting all soft tissues. NSTI involves necrosis of the afflicted tissue and is potentially life threatening due to major and rapid destruction of tissue, which often leads to septic shock and organ failure. The gold...... to culture. Although the molecular methods generally gave concordant results, our results indicate that Microseq may misidentify or overlook microorganisms that can be detected by other molecular methods. Half of the patients were found to be infected with S. pyogenes, but several atypical findings were also...... that clinicians should be prepared to diagnose and treat any combination of microbial pathogens. Some of the tested molecular methods offer a faster turnaround time combined with a high specificity, which makes supplemental use of such methods attractive for identification of microorganisms, especially...

  3. Review Recent progress in identification and characterization of loci associated with sex-linked congenital cataract.

    Science.gov (United States)

    Zhang, D D; Du, J Z; Topolewski, J; Wang, X M

    2016-07-29

    Congenital cataract is a common cause of blindness in children; however, its pathogenesis remains unclear. Genetic factors have been shown to play an important role in the pathogenesis of congenital cataract. The current genetic models of congenital cataract include autosomal dominant, autosomal recessive, and sex-linked inheritance. Sex-linked congenital cataract could be inherited through the X or Y chromosome. Congenital cataract is a symptom associated with several X-linked disorders, including Nance-Horan syndrome, Lowe syndrome, Conradi-Hünermann-Happle syndrome, oculo-facio-cardio-dental syndrome, and Alport syndrome. On the other hand, the mechanism and characteristics of Y-linked congenital cataract remains to be identified. Despite its rarity, sex-linked congenital cataract has been known to seriously affect the quality of life of patients. In this review, we present our current understanding of the genes and loci associated with sex-linked congenital cataract. This could help identify novel approaches for the prevention, early diagnosis, and comprehensive disease treatment.

  4. Identification and field and laboratory tests of the sex pheromone of Cerconota anonella Sepp. (Lepidoptera: Oecophoridae)

    Czech Academy of Sciences Publication Activity Database

    Pires, E. V.; Mendonca, A. L.; Vaníčková, Lucie; Serra, M. S. J.; da Silva, R. C. C.; dos Santos, D. C.; Campos, R. S.; Santana, A. E. G.; do Nascimento, R. R.

    2016-01-01

    Roč. 140, 1/2 (2016), s. 72-80 ISSN 0931-2048 Institutional support: RVO:61388963 Keywords : Annona fruit borer * GC x GC-TOFMS * GC-EAD * sex pheromone Subject RIV: EG - Zoology Impact factor: 1.641, year: 2016

  5. Identification and functional characterization of a sex pheromone receptor in the silkmoth Bombyx mori

    Science.gov (United States)

    Sakurai, Takeshi; Nakagawa, Takao; Mitsuno, Hidefumi; Mori, Hajime; Endo, Yasuhisa; Tanoue, Shintarou; Yasukochi, Yuji; Touhara, Kazushige; Nishioka, Takaaki

    2004-01-01

    Sex pheromones released by female moths are detected with high specificity and sensitivity in the olfactory sensilla of antennae of conspecific males. Bombykol in the silkmoth Bombyx mori was the first sex pheromone to be identified. Here we identify a male-specific G protein-coupled olfactory receptor gene, B. mori olfactory receptor 1 (BmOR-1), that appears to encode a bombykol receptor. The BmOR-1 gene is located on the Z sex chromosome, has an eight-exon/seven-intron structure, and exhibits male-specific expression in the pheromone receptor neurons of male moth antenna during late pupal and adult stages. Bombykol stimulation of Xenopus laevis oocytes expressing BmOR-1 and BmGαq elicited robust dose-dependent inward currents on two-electrode voltage clamp recordings, demonstrating that the binding of bombykol to BmOR-1 leads to the activation of a BmGαq-mediated signaling cascade. Antennae of female moths infected with BmOR-1-recombinant baculovirus showed electrophysiological responses to bombykol but not to bombykal. These results provide evidence that BmOR-1 is a G protein-coupled sex pheromone receptor that recognizes bombykol. PMID:15545611

  6. Sex, Sexual Orientation, and Identification of Positive and Negative Facial Affect

    Science.gov (United States)

    Rahman, Qazi; Wilson, Glenn D.; Abrahams, Sharon

    2004-01-01

    Sex and sexual orientation related differences in processing of happy and sad facial emotions were examined using an experimental facial emotion recognition paradigm with a large sample (N=240). Analysis of covariance (controlling for age and IQ) revealed that women (irrespective of sexual orientation) had faster reaction times than men for…

  7. Analyses of Dynamics in Dairy Products and Identification of Lactic Acid Bacteria Population by Molecular Methods

    Directory of Open Access Journals (Sweden)

    Aytül Sofu

    2017-01-01

    Full Text Available Lactic acid bacteria (LAB with different ecological niches are widely seen in fermented meat, vegetables, dairy products and cereals as well as in fermented beverages. Lactic acid bacteria are the most important group of bacteria in dairy industry due to their probiotic characteristics and fermentation agents as starter culture. In the taxonomy of the lactic acid bacteria; by means of rep-PCR, which is the analysis of repetitive sequences that are based on 16S ribosomal RNA (rRNA gene sequence, it is possible to conduct structural microbial community analyses such as Restriction Fragment Length Polymorphism (RFLP analysis of DNA fragments of different sizes cut with enzymes, Random Amplified Polymorphic DNA (RAPD polymorphic DNA amplified randomly at low temperatures and Amplified Fragment-Length Polymorphism (AFLP-PCR of cut genomic DNA. Besides, in the recent years, non-culture-based molecular methods such as Pulse Field Gel Electrophoresis (PFGE, Denaturing Gradient Gel Electrophoresis (DGGE, Thermal Gradient Gel Electrophoresis (TGGE, and Fluorescence In-situ Hybridization (FISH have replaced classical methods once used for the identification of LAB. Identification of lactic acid bacteria culture independent regardless of the method will be one of the most important methods used in the future pyrosequencing as a Next Generation Sequencing (NGS techniques. This paper reviews molecular-method based studies conducted on the identification of LAB species in dairy products.

  8. Challenges to a molecular approach to prey identification in the Burmese python, Python molurus bivittatus

    Science.gov (United States)

    Falk, Bryan; Reed, Robert N.

    2015-01-01

    Molecular approaches to prey identification are increasingly useful in elucidating predator–prey relationships, and we aimed to investigate the feasibility of these methods to document the species identities of prey consumed by invasive Burmese pythons in Florida. We were particularly interested in the diet of young snakes, because visual identification of prey from this size class has proven difficult. We successfully extracted DNA from the gastrointestinal contents of 43 young pythons, as well as from several control samples, and attempted amplification of DNA mini-barcodes, a 130-bp region of COX1. Using a PNA clamp to exclude python DNA, we found that prey DNA was not present in sufficient quality for amplification of this locus in 86% of our samples. All samples from the GI tracts of young pythons contained only hair, and the six samples we were able to identify to species were hispid cotton rats. This suggests that young Burmese pythons prey predominantly on small mammals and that prey diversity among snakes of this size class is low. We discuss prolonged gastrointestinal transit times and extreme gastric breakdown as possible causes of DNA degradation that limit the success of a molecular approach to prey identification in Burmese pythons

  9. Sex Attractants of the Banana Moth, Opogona sacchari Bojer (Lepidoptera: Tineidae): Provisional Identification and Field Evaluation

    Science.gov (United States)

    BACKGROUND: The banana moth, Opogona sacchari Bojer, is a ployphagous agricultural pest in many tropical areas of the world. The identification of an attractant for male O. sacchari could offer new methods for detection, study and control. RESULTS: A male electroantennographically active compound w...

  10. Identification of a sex pheromone of the chrysanthemum lace bug Corythucha marmorata (Hemiptera: Tingidae)

    OpenAIRE

    Watanabe, Kisaki; Shimizu, Nobuhiro

    2017-01-01

    Although the nymphs of Corythucha marmorata form clusters on the undersides of host plant leaves, as frequently observed for Hemiptera, the adults are scattered in the vicinity of the nymph population. By investigating the biological activities of volatile secretions from the adult, we found that the secretions activated male mounting behaviour. A chemical analysis revealed that borneol was a common component of the secretions from both sexes. The absolute configuration of the natural product...

  11. The place of molecular methods in the identification of dermatophytes and the determination of their feasibility

    Directory of Open Access Journals (Sweden)

    Fatma Bıyık

    2013-03-01

    Full Text Available Background and Design: Unlike opportunistic fungi, dermatophytes cannot be isolated on the conventional culture media in a few days. Their growing periods cover approximately two weeks in a suitable media and identification are made with conventional methods as typical macroscopic and microscopic appearance. However, successful results are not always obtained with the phenotypic features, and thus, diagnostic problems and delay in diagnosis and treatment may arise. For this reason, the methods based on nucleic acid amplification have been necessary. In this study, we aimed to identify 56 dermatophytes strains, which were identified by conventional methods, by molecular methods and to investigate the correlation between the two methods and to determine the usability of molecular methods in routine laboratories. Materials and Methods: Several clinical samples of 270 patients with suspected dermatophytoses (hair+scalp, skin and nail scrapings were examined by conventional methods; Sabouraud dextrose agar, corn meal agar and potato dextrose agar were used for isolation. In case of necessity to hydrolyze urea, to be used different vitamins in Trichophyton agar media were investigated. Polymerase chain reaction (PCR and sequence analyses were done for the molecular diagnosis. Results: Using conventional methods, 37 strains (66,1% were identified as Trichophyton(T rubrum, four (7.1% - T.mentagrophytes, four (7.1% - T.tonsurans, one (1.8% - T.violaceum, eight (14.3% - Trichophyton spp., one (1.8% - Microsporum(M canis, and one (1.8% - Microsporum spp. According to the molecular and sequence analyses results (T1PCR, 25GAPCR, ITSPCR-RFLP and sequence analyses, 41 (73.8% strains were identified as T.rubrum, 10 (17.8% - T.interdigitale, one (1.8% - T. violaceum, two (3.6% - M. canis, one (1.8% - Peacilomyces lilacinus, and one (1,8% - Aspergillus fumigatus. Discussion: This study suggests that, molecular methods offer fast and reliable results in

  12. Identification of potent inhibitors against snake venom metalloproteinase (SVMP) using molecular docking and molecular dynamics studies.

    Science.gov (United States)

    Chinnasamy, Sathishkumar; Chinnasamy, Selvakkumar; Nagamani, Selvaraman; Muthusamy, Karthikeyan

    2015-01-01

    Snake venom metalloproteinase (SVMP) (Echis coloratus (Carpet viper) is a multifunctional enzyme that is involved in producing several symptoms that follow a snakebite, such as severe local hemorrhage, nervous system effects and tissue necrosis. Because the three-dimensional (3D) structure of SVMP is not known, models were constructed, and the best model was selected based on its stereo-chemical quality. The stability of the modeled protein was analyzed through molecular dynamics (MD) simulation studies. Structure-based virtual screening was performed, and 15 potential molecules with the highest binding energies were selected. Further analysis was carried out with induced fit docking, Prime/MM-GBSA (ΔGBind calculations), quantum-polarized ligand docking, and density functional theory calculations. Further, the stability of the lead molecules in the SVMP-active site was examined using MD simulation. The results showed that the selected lead molecules were highly stable in the active site of SVMP. Hence, these molecules could potentially be selective inhibitors of SVMP. These lead molecules can be experimentally validated, and their backbone structural scaffold could serve as building blocks in designing drug-like molecules for snake antivenom.

  13. Gender identification of Grasshopper Sparrows comparing behavioral, morphological, and molecular techniques

    Science.gov (United States)

    Ammer, F.K.; Wood, P.B.; McPherson, R.J.

    2008-01-01

    Correct gender identification in monomorphic species is often difficult especially if males and females do not display obvious behavioral and breeding differences. We compared gender specific morphology and behavior with recently developed DNA techniques for gender identification in the monomorphic Grasshopper Sparrow (Ammodramus savannarum). Gender was ascertained with DNA in 213 individuals using the 2550F/2718R primer set and 3% agarose gel electrophoresis. Field observations using behavior and breeding characteristics to identify gender matched DNA analyses with 100% accuracy for adult males and females. Gender was identified with DNA for all captured juveniles that did not display gender specific traits or behaviors in the field. The molecular techniques used offered a high level of accuracy and may be useful in studies of dispersal mechanisms and winter assemblage composition in monomorphic species.

  14. Rapid and Accurate Molecular Identification of the Emerging Multidrug-Resistant Pathogen Candida auris.

    Science.gov (United States)

    Kordalewska, Milena; Zhao, Yanan; Lockhart, Shawn R; Chowdhary, Anuradha; Berrio, Indira; Perlin, David S

    2017-08-01

    Candida auris is an emerging multidrug-resistant fungal pathogen causing nosocomial and invasive infections associated with high mortality. C. auris is commonly misidentified as several different yeast species by commercially available phenotypic identification platforms. Thus, there is an urgent need for a reliable diagnostic method. In this paper, we present fast, robust, easy-to-perform and interpret PCR and real-time PCR assays to identify C. auris and related species: Candida duobushaemulonii , Candida haemulonii , and Candida lusitaniae Targeting rDNA region nucleotide sequences, primers specific for C. auris only or C. auris and related species were designed. A panel of 140 clinical fungal isolates was used in both PCR and real-time PCR assays followed by electrophoresis or melting temperature analysis, respectively. The identification results from the assays were 100% concordant with DNA sequencing results. These molecular assays overcome the deficiencies of existing phenotypic tests to identify C. auris and related species. Copyright © 2017 Kordalewska et al.

  15. Molecular identification of microorganisms associated to the rhizosphere of vanilla plants in Colombia

    International Nuclear Information System (INIS)

    Alvarez Lopez, Claudia Lucia; Osorio Vega, Nelson Walter; Marin Montoya, Mauricio Alejandro

    2013-01-01

    The cultivation of vanilla (Vanilla planifolia) is highly promising in Colombia, but more research is needed on its agronomical management and beneficial microorganisms that grow associated to its rhizosphere, on which the plant depends for its nutrition and growth. This study involved the identification of microorganisms associated to the rhizosphere of vanilla plants in a crop located in Sopetran, Colombia. The microbes were isolated in selective media for functional groups such as cellulolytic, proteolytic, inorganic and organic phosphate (phytate) solubilizers, and asymbiotic nitrogen fixing bacteria. After isolation and purification, 109 microbial isolates were obtained. DNA was extracted from 52 selected isolates for molecular identification based on its and 16s RDNA sequencing, for fungi and bacteria, respectively. The diversity of rhizosphere microorganisms found was significant. Bacteria such as Bacillus Megaterium, Pseudomonas koreensis and Acinetobacter sp., and the Fungus Plectosphaerella sp., may have a high potential to be used as biofertilizers to improve vanilla plant nutrition and growth.

  16. Identification of control targets in Boolean molecular network models via computational algebra.

    Science.gov (United States)

    Murrugarra, David; Veliz-Cuba, Alan; Aguilar, Boris; Laubenbacher, Reinhard

    2016-09-23

    Many problems in biomedicine and other areas of the life sciences can be characterized as control problems, with the goal of finding strategies to change a disease or otherwise undesirable state of a biological system into another, more desirable, state through an intervention, such as a drug or other therapeutic treatment. The identification of such strategies is typically based on a mathematical model of the process to be altered through targeted control inputs. This paper focuses on processes at the molecular level that determine the state of an individual cell, involving signaling or gene regulation. The mathematical model type considered is that of Boolean networks. The potential control targets can be represented by a set of nodes and edges that can be manipulated to produce a desired effect on the system. This paper presents a method for the identification of potential intervention targets in Boolean molecular network models using algebraic techniques. The approach exploits an algebraic representation of Boolean networks to encode the control candidates in the network wiring diagram as the solutions of a system of polynomials equations, and then uses computational algebra techniques to find such controllers. The control methods in this paper are validated through the identification of combinatorial interventions in the signaling pathways of previously reported control targets in two well studied systems, a p53-mdm2 network and a blood T cell lymphocyte granular leukemia survival signaling network. Supplementary data is available online and our code in Macaulay2 and Matlab are available via http://www.ms.uky.edu/~dmu228/ControlAlg . This paper presents a novel method for the identification of intervention targets in Boolean network models. The results in this paper show that the proposed methods are useful and efficient for moderately large networks.

  17. Comparison of biochemical and molecular methods for the identification of bacterial isolates associated with failed loggerhead sea turtle eggs.

    Science.gov (United States)

    Awong-Taylor, J; Craven, K S; Griffiths, L; Bass, C; Muscarella, M

    2008-05-01

    Comparison of biochemical vs molecular methods for identification of microbial populations associated with failed loggerhead turtle eggs. Two biochemical (API and Microgen) and one molecular methods (16s rRNA analysis) were compared in the areas of cost, identification, corroboration of data with other methods, ease of use, resources and software. The molecular method was costly and identified only 66% of the isolates tested compared with 74% for API. A 74% discrepancy in identifications occurred between API and 16s rRNA analysis. The two biochemical methods were comparable in cost, but Microgen was easier to use and yielded the lowest discrepancy among identifications (29%) when compared with both API 20 enteric (API 20E) and API 20 nonenteric (API 20NE) combined. A comparison of API 20E and API 20NE indicated an 83% discrepancy between the two methods. The Microgen identification system appears to be better suited than API or 16s rRNA analysis for identification of environmental isolates associated with failed loggerhead eggs. Most identification methods are not intended for use with environmental isolates. A comparison of identification systems would provide better options for identifying environmental bacteria for ecological studies.

  18. First molecular identification and characterization of classical swine fever virus isolates from Nepal.

    Science.gov (United States)

    Postel, Alexander; Jha, Vijay C; Schmeiser, Stefanie; Becher, Paul

    2013-01-01

    Classical swine fever (CSF) is a major constraint to pig production worldwide, and in many developing countries, the epidemiological status is unknown. Here, for the first time, molecular identification and characterization of CSFV isolates from two recent outbreaks in Nepal are presented. Analysis of full-length E2-encoding sequences revealed that these isolates belonged to CSFV subgenotype 2.2 and had highest genetic similarity to isolates from India. Hence, for CSFV, Nepal and India should be regarded as one epidemiological unit. Both Nepalese isolates exhibited significant sequence differences, excluding a direct epidemiological connection and suggesting that CSFV is endemic in that country.

  19. Identification of a Novel Retrotransposon with Sex Chromosome-Specific Distribution in Silene latifolia

    Czech Academy of Sciences Publication Activity Database

    Králová, Tereza; Čegan, Radim; Kubát, Zdeněk; Vrána, Jan; Vyskot, Boris; Vogel, Ivan; Kejnovský, Eduard; Hobza, Roman

    2014-01-01

    Roč. 143, 1-3 (2014), s. 87-95 ISSN 1424-8581 R&D Projects: GA MŠk(CZ) LM2010005; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GA522/09/0083; GA MŠk(CZ) LO1204 Institutional support: RVO:68081707 Keywords : Microdissection * Sex chromosomes * Silene latifolia (white campion) Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 1.561, year: 2014

  20. Molecular mechanisms of temperature-dependent sex determination in the context of ecological developmental biology.

    Science.gov (United States)

    Matsumoto, Yuiko; Crews, David

    2012-05-06

    Temperature-dependent sex determination (TSD) is a prime example of phenotypic plasticity in that gonadal sex is determined by the temperature of the incubating egg. In the red-eared slider turtle (Trachemys scripta), the effect of temperature can be overridden by exogenous ligands, i.e., sex steroid hormones and steroid metabolism enzyme inhibitors, during the temperature-sensitive period (TSP) of development. Precisely how the physical signal of temperature is transduced into a biological signal that ultimately results in sex determination remains unknown. In this review, we discuss the sex determining pathway underlying TSD by focusing on two candidate sex determining genes, Forkhead box protein L2 (FoxL2) and Doublesex mab3- related transcription factor 1 (Dmrt1). They appear to be involved in transducing the environmental temperature signal into a biological signal that subsequently determines gonadal sex. FoxL2 and Dmrt1 exhibit gonad-typical patterns of expression in response to temperature during the TSP in the red-eared slider turtle. Further, the biologically active ligands regulate the expression of FoxL2 and Dmrt1 during development to modify gonad trajectory. The precise regulatory mechanisms of expression of these genes by temperature or exogenous ligands are not clear. However, the environment often influences developmental gene expression by altering the epigenetic status in regulatory regions. Here, we will discuss if the regulation of FoxL2 and Dmrt1 expression by environment is mediated through epigenetic mechanisms during development in species with TSD. Published by Elsevier Ireland Ltd.

  1. Morphological and molecular identification of nasopharyngeal bot fly larvae infesting red deer (Cervus elaphus) in Austria.

    Science.gov (United States)

    Leitner, Natascha; Schwarzmann, Laurin; Zittra, Carina; Palmieri, Nicola; Eigner, Barbara; Otranto, Domenico; Glawischnig, Walter; Fuehrer, Hans-Peter

    2016-11-01

    Nasopharyngeal myiases are caused by larvae of bot flies (Diptera: Oestridae), which have evolved a high specificity for their hosts. Bot flies (n = 916) were collected from 137 (57.6 %) out of 238 red deer (Cervus elaphus) hunted in Vorarlberg and Tyrol (Western Austria). After being stored in 75 % ethanol, larvae were identified to species level and developmental stage using morphological and morphometric keys. Larvae were also molecularly characterized by polymerase chain reaction (PCR) amplification and partial sequencing of the mitochondrial cytochrome oxidase subunit I gene. Morphological and molecular analysis allowed identification of larvae as Cephenemyia auribarbis and Pharyngomyia picta. Genetic variations were also examined within the specimens collected in both geographical locations.

  2. Molecular phylogeny analysis and species identification of Dendrobium (Orchidaceae) in China.

    Science.gov (United States)

    Feng, Shang-Guo; Lu, Jiang-Jie; Gao, Ling; Liu, Jun-Jun; Wang, Hui-Zhong

    2014-04-01

    Dendrobium plants are important commercial herbs in China, widely used in traditional medicine and ornamental horticulture. In this study, sequence-related amplified polymorphism (SRAP) markers were applied to molecular phylogeny analysis and species identification of 31 Chinese Dendrobium species. Fourteen SRAP primer pairs produced 727 loci, 97% of which (706) showed polymorphism. Average polymorphism information content of the SRAP pairs was 0.987 (0.982-0.991), showing that plenty of genetic diversity exists at the interspecies level of Chinese Dendrobium. The molecular phylogeny analysis (UPGMA) grouped the 31 Dendrobium species into six clusters. We obtained 18 species-specific markers, which can be used to identify 10 of the 31 species. Our results indicate the SRAP marker system is informative and would facilitate further application in germplasm appraisal, evolution, and genetic diversity studies in the genus Dendrobium.

  3. An investigation on non-invasive fungal sinusitis; Molecular identification of etiologic agents

    Directory of Open Access Journals (Sweden)

    Abdolrasoul Mohammadi

    2017-01-01

    Full Text Available Background: Fungal sinusitis is increasing worldwide in the past two decades. It is divided into two types including invasive and noninvasive. Noninvasive types contain allergic fungal sinusitis (AFS and fungus ball. AFS is a hypersensitivity reaction to fungal allergens in the mucosa of the sinonasal tract in atopic individuals. The fungus ball is a different type of noninvasive fungal rhinosinusitis which is delineated as an accumulation of debris and fungal elements inside a paranasal sinus. Fungal sinusitis caused by various fungi such as Aspergillus species, Penicillium, Mucor, Rhizopus, and phaeohyphomycetes. The aim of the present study is to identify fungal species isolated from noninvasive fungal sinusitis by molecular methods. Materials and Methods: During 2015–2016, a total of 100 suspected patients were examined for fungal sinusitis. Functional endoscopic sinus surgery was performed using the Messerklinger technique. Clinical samples were identified by phenotypic and molecular methods. Polymerase chain reaction (PCR sequencing of ITS1-5.8S-ITS2 region and PCR-restriction fragment length polymorphism with Msp I restriction enzyme was performed for molecular identification of molds and yeasts, respectively. Results: Twenty-seven out of 100 suspected cases (27% had fungal sinusitis. Nasal congestion (59% and headache (19% were the most common clinical signs among patients. Fifteen patients (55.5% were male and 12 patients (44.5% were female. Aspergillus flavus was the most prevalent fungal species (26%, followed by Penicillium chrysogenum (18.5% and Candida glabrata species complex (15%. Conclusion: Since clinical manifestations, computed tomography scan, endoscopy, and histopathological findings are very nonspecific in AFS and fungus ball; therefore, molecular investigations are compulsory for precise identification of etiologic agents and appropriate management of these fungal infections.

  4. Elucidation of molecular kinetic schemes from macroscopic traces using system identification.

    Directory of Open Access Journals (Sweden)

    Miguel Fribourg

    2017-02-01

    Full Text Available Overall cellular responses to biologically-relevant stimuli are mediated by networks of simpler lower-level processes. Although information about some of these processes can now be obtained by visualizing and recording events at the molecular level, this is still possible only in especially favorable cases. Therefore the development of methods to extract the dynamics and relationships between the different lower-level (microscopic processes from the overall (macroscopic response remains a crucial challenge in the understanding of many aspects of physiology. Here we have devised a hybrid computational-analytical method to accomplish this task, the SYStems-based MOLecular kinetic scheme Extractor (SYSMOLE. SYSMOLE utilizes system-identification input-output analysis to obtain a transfer function between the stimulus and the overall cellular response in the Laplace-transformed domain. It then derives a Markov-chain state molecular kinetic scheme uniquely associated with the transfer function by means of a classification procedure and an analytical step that imposes general biological constraints. We first tested SYSMOLE with synthetic data and evaluated its performance in terms of its rate of convergence to the correct molecular kinetic scheme and its robustness to noise. We then examined its performance on real experimental traces by analyzing macroscopic calcium-current traces elicited by membrane depolarization. SYSMOLE derived the correct, previously known molecular kinetic scheme describing the activation and inactivation of the underlying calcium channels and correctly identified the accepted mechanism of action of nifedipine, a calcium-channel blocker clinically used in patients with cardiovascular disease. Finally, we applied SYSMOLE to study the pharmacology of a new class of glutamate antipsychotic drugs and their crosstalk mechanism through a heteromeric complex of G protein-coupled receptors. Our results indicate that our methodology

  5. Identification and behavioral evaluation of sex pheromone components of the Chinese pine caterpillar moth, Dendrolimus tabulaeformis.

    Directory of Open Access Journals (Sweden)

    Xiang-Bo Kong

    Full Text Available BACKGROUND: The Chinese pine caterpillar moth, Dendrolimus tabulaeformis Tsai and Liu (Lepidoptera: Lasiocampidae is the most important defoliator of coniferous trees in northern China. Outbreaks occur over enormous areas and often lead to the death of forests during 2-3 successive years of defoliation. The sex pheromone of D. tabulaeformis was investigated to define its chemistry and behavioral activity. METHODOLOGY/PRINCIPAL FINDINGS: Sex pheromone was collected from calling female D. tabulaeformis by headspace solid phase microextraction (SPME and by solvent extraction of pheromone glands. Extracts were analyzed by coupled gas chromatography/mass spectrometry (GC-MS and coupled GC-electroantennographic detection (GC-EAD, using antennae from male moths. Five components from the extracts elicited antennal responses. These compounds were identified by a combination of retention indices, electron impact mass spectral matches, and derivatization as (Z-5-dodecenyl acetate (Z5-12:OAc, (Z-5-dodecenyl alcohol (Z5-12:OH, (5Z,7E-5,7-dodecadien-1-yl acetate (Z5,E7-12:OAc, (5Z,7E-5,7-dodecadien-1-yl propionate (Z5,E7-12:OPr, and (5Z,7E-5,7-dodecadien-1-ol (Z5,E7-12:OH. Behavioral assays showed that male D. tabulaeformis strongly discriminated against incomplete and aberrant blend ratios. The correct ratio of Z5,E7-12:OAc, Z5,E7-12:OH, and Z5,E7-12:OPr was essential for optimal upwind flight and source contact. The two monoenes, Z5-12:OAc and Z5-12:OH, alone or binary mixtures, had no effect on behavioral responses when added to the optimal three-component blend. CONCLUSIONS/SIGNIFICANCE: The fact that deviations from the optimal ratio of 100:100:4.5 of Z5,E7-12:OAc, Z5,EZ7-12:OH, and Z5,E7-12:OPr resulted in marked decreases in male responses suggests that biosynthesis of the pheromone components is precisely controlled. The optimal blend of the sex pheromone components of D. tabulaeformis worked out in this study should find immediate use in monitoring

  6. Molecular and cellular sex differences at the intersection of stress and arousal.

    Science.gov (United States)

    Valentino, Rita J; Reyes, Beverly; Van Bockstaele, Elisabeth; Bangasser, Debra

    2012-01-01

    Elucidating the mechanisms underlying sex biases in the prevalence and severity of diseases can advance our understanding of their pathophysiological basis and serve as a guide for developing treatments. A well-established sex difference in psychiatry is the higher incidence of mood and anxiety disorders in females. These disorders share stress as a potential etiological contributor and hyperarousal as a core symptom, suggesting that the distinction between sexes lies at the intersection of stress and arousal systems. This review focuses on the link between the stress axis and the brain norepinephrine arousal system as a key point at which sex differences occur and are translated to differences in the expression of mood disorders. Evidence for a circuit designed to relay emotion-related information via the limbic corticotropin-releasing factor (CRF) system to the locus coeruleus (LC)-norepinephrine arousal system is reviewed. This is followed by recent novel findings of sex differences in CRF receptor signaling and trafficking that would result in an enhanced arousal response and a compromised ability to adapt to chronic stress in females. Finally, we discuss the evidence for sex differences in LC dendritic structure that allow for an increased receipt and processing of limbic information in females compared to males. Together these complementary sets of data suggest that in females, the LC arousal system is poised to process more limbic information and to respond to some of this information in an enhanced manner compared to males. The clinical and therapeutic considerations arising from this perspective are discussed. This article is part of a Special Issue entitled 'Anxiety and Depression'. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Strategy for identification & characterization of Bartonella henselae with conventional & molecular methods

    Directory of Open Access Journals (Sweden)

    Kavita Diddi

    2013-01-01

    Full Text Available Background & objectives: Bartonella henselae is a fastidious gram-negative bacterium usually causing self limiting infections in immunocompetent individuals but often causes potentially life threatening infection, such as bacillary angiomatosis in immunocompromised patients. Both diagnosis of infections and research into molecular mechanisms of pathogenesis have been hindered by lack of appropriate and reliable diagnostic techniques. We undertook this study to standardize methods to characterize B. henselae in clinical samples to diagnose Bartonella infection correctly. Methods: B. henselae ATCC 49882 strain was procured from American type culture collection, USA. This strain was revived and maintained in the laboratory, and identification and characterization of this strain was done by conventional and molecular techniques, which included culture on various media, staining by different methods including electron microscopy, biochemical analysis by conventional methods and API, polymerase chain reaction (PCR for amplification of citrate synthase gene followed by restriction fragment length polymorphism (RFLP. Results: This organism was biochemically inert due to slow growth and generated unique identification code with API. The amplification of the citrate-synthase gene with primers yielded a 381 bp product followed by specific RFLP profile for B. henselae. Interpretation & conclusions: Bartonella is fastidious and fragile organism and should be handled carefully. Extra effort and careful observation are required to isolate and characterize this organism.

  8. Relative profile analysis of molecular markers for identification and genetic discrimination of loaches (Pisces, Nemacheilidae).

    Science.gov (United States)

    Patil, Tejas Suresh; Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Bhosale, Amrut Ravindra; Govindwar, Sanjay Prabhu; Muley, Dipak Vishwanathrao

    2016-01-01

    Genus Nemacheilus, Nemachilichthys and Schistura belong to the family Nemacheilidae of the order Cypriniformes. The present investigation was undertaken to observe genetic diversity, phylogenetic relationship and to develop a molecular-based tool for taxonomic identification. For this purpose, four different types of molecular markers were utilized in which 29 random amplified polymorphic DNA (RAPD), 25 inter-simple sequence repeat (ISSR) markers, and 10 amplified fragment length polymorphism (AFLP) marker sets were screened and mitochondrial COI gene was sequenced. This study added COI barcodes for the identification of Nemacheilus anguilla, Nemachilichthys rueppelli and Schistura denisoni. RAPD showed higher polymorphism (100%) than the ISSR (93.75-100%) and AFLP (93.86-98.96%). The polymorphic information content (PIC), heterozygosity, multiplex ratio, and gene diversity was observed highest for AFLP primers, whereas the major allele frequency was observed higher for RAPD (0.5556) and lowest for AFLP (0.1667). The COI region of all individuals was successfully amplified and sequenced, which gave a 100% species resolution. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  9. Molecular and Morphological Identification of Mealybug Species (Hemiptera: Pseudococcidae) in Brazilian Vineyards

    Science.gov (United States)

    Pacheco da Silva, Vitor C.; Bertin, Aline; Blin, Aurélie; Germain, Jean-François; Bernardi, Daniel; Rignol, Guylène; Botton, Marcos; Malausa, Thibaut

    2014-01-01

    Mealybugs (Hemiptera: Pseudococcidae) are pests constraining the international trade of Brazilian table grapes. They damage grapes by transmitting viruses and toxins, causing defoliation, chlorosis, and vigor losses and favoring the development of sooty mold. Difficulties in mealybug identification remain an obstacle to the adequate management of these pests. In this study, our primary aim was to identify the principal mealybug species infesting the major table grape-producing regions in Brazil, by morphological and molecular characterization. Our secondary aim was to develop a rapid identification kit based on species-specific Polymerase Chain Reactions, to facilitate the routine identification of the most common pest species. We surveyed 40 sites infested with mealybugs and identified 17 species: Dysmicoccus brevipes (Cockerell), Dysmicoccus sylvarum Williams and Granara de Willink, Dysmicoccus texensis (Tinsley), Ferrisia cristinae Kaydan and Gullan, Ferrisia meridionalis Williams, Ferrisia terani Williams and Granara de Willink, Phenacoccus baccharidis Williams, Phenacoccus parvus Morrison, Phenacoccus solenopsis Tinsley, Planococcus citri (Risso), Pseudococcus viburni (Signoret), Pseudococcus cryptus Hempel, four taxa closely related each of to Pseudococcus viburni, Pseudococcus sociabilis Hambleton, Pseudococcus maritimus (Ehrhorn) and Pseudococcus meridionalis Prado, and one specimen from the genus Pseudococcus Westwood. The PCR method developed effectively identified five mealybug species of economic interest on grape in Brazil: D. brevipes, Pl. citri, Ps. viburni, Ph. solenopsis and Planococcus ficus (Signoret). Nevertheless, it is not possible to assure that this procedure is reliable for taxa that have not been sampled already and might be very closely related to the target species. PMID:25062012

  10. Molecular and morphological identification of mealybug species (Hemiptera: Pseudococcidae in Brazilian vineyards.

    Directory of Open Access Journals (Sweden)

    Vitor C Pacheco da Silva

    Full Text Available Mealybugs (Hemiptera: Pseudococcidae are pests constraining the international trade of Brazilian table grapes. They damage grapes by transmitting viruses and toxins, causing defoliation, chlorosis, and vigor losses and favoring the development of sooty mold. Difficulties in mealybug identification remain an obstacle to the adequate management of these pests. In this study, our primary aim was to identify the principal mealybug species infesting the major table grape-producing regions in Brazil, by morphological and molecular characterization. Our secondary aim was to develop a rapid identification kit based on species-specific Polymerase Chain Reactions, to facilitate the routine identification of the most common pest species. We surveyed 40 sites infested with mealybugs and identified 17 species: Dysmicoccus brevipes (Cockerell, Dysmicoccus sylvarum Williams and Granara de Willink, Dysmicoccus texensis (Tinsley, Ferrisia cristinae Kaydan and Gullan, Ferrisia meridionalis Williams, Ferrisia terani Williams and Granara de Willink, Phenacoccus baccharidis Williams, Phenacoccus parvus Morrison, Phenacoccus solenopsis Tinsley, Planococcus citri (Risso, Pseudococcus viburni (Signoret, Pseudococcus cryptus Hempel, four taxa closely related each of to Pseudococcus viburni, Pseudococcus sociabilis Hambleton, Pseudococcus maritimus (Ehrhorn and Pseudococcus meridionalis Prado, and one specimen from the genus Pseudococcus Westwood. The PCR method developed effectively identified five mealybug species of economic interest on grape in Brazil: D. brevipes, Pl. citri, Ps. viburni, Ph. solenopsis and Planococcus ficus (Signoret. Nevertheless, it is not possible to assure that this procedure is reliable for taxa that have not been sampled already and might be very closely related to the target species.

  11. Advances in molecular identification, taxonomy, genetic variation and diagnosis of Toxocara spp.

    Science.gov (United States)

    Chen, Jia; Zhou, Dong-Hui; Nisbet, Alasdair J; Xu, Min-Jun; Huang, Si-Yang; Li, Ming-Wei; Wang, Chun-Ren; Zhu, Xing-Quan

    2012-10-01

    The genus Toxocara contains parasitic nematodes of human and animal health significance, such as Toxocara canis, Toxocara cati and Toxocara vitulorum. T. canis and T. cati are among the most prevalent parasites of dogs and cats with a worldwide distribution. Human infection with T. canis and T. cati, which can cause a number of clinical manifestations such as visceral larva migrans (VLMs), ocular larva migrans (OLMs), eosinophilic meningoencephalitis (EME), covert toxocariasis (CT) and neurotoxocariasis, is considered the most prevalent neglected helminthiasis in industrialized countries. The accurate identification Toxocara spp. and their unequivocal differentiation from each other and from other ascaridoid nematodes causing VLMs and OLMs has important implications for studying their taxonomy, epidemiology, population genetics, diagnosis and control. Due to the limitations of traditional (morphological) approaches for identification and diagnosis of Toxocara spp., PCR-based techniques utilizing a range of genetic markers in the nuclear and mitochondrial genomes have been developed as useful alternative approaches because of their high sensitivity, specificity, rapidity and utility. In this article, we summarize the current state of knowledge and advances in molecular identification, taxonomy, genetic variation and diagnosis of Toxocara spp. with prospects for further studies. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Fluorescent Molecular Rotor-in-Paraffin Waxes for Thermometry and Biometric Identification.

    Science.gov (United States)

    Jin, Young-Jae; Dogra, Rubal; Cheong, In Woo; Kwak, Giseop

    2015-07-08

    Novel thermoresponsive sensor systems consisting of a molecular rotor (MR) and paraffin wax (PW) were developed for various thermometric and biometric identification applications. Polydiphenylacetylenes (PDPAs) coupled with long alkyl chains were used as MRs, and PWs of hydrocarbons having 16-20 carbons were utilized as phase-change materials. The PDPAs were successfully dissolved in the molten PWs and did not act as an impurity that prevents phase transition of the PWs. These PDPA-in-PW hybrids had almost the same enthalpies and phase-transition temperatures as the corresponding pure PWs. The hybrids exhibited highly reversible fluorescence (FL) changes at the critical temperatures during phase transition of the PWs. These hybrids were impregnated into common filter paper in the molten state by absorption or were encapsulated into urea resin to enhance their mechanical integrity and cyclic stability during repeated use. The wax papers could be utilized in highly advanced applications including FL image writing/erasing, an array-type thermo-indicator, and fingerprint/palmprint identification. The present findings should facilitate the development of novel fluorescent sensor systems for biometric identification and are potentially applicable for biological and biomedical thermometry.

  13. Molecular identification of python species: development and validation of a novel assay for forensic investigations.

    Science.gov (United States)

    Ciavaglia, Sherryn A; Tobe, Shanan S; Donnellan, Stephen C; Henry, Julianne M; Linacre, Adrian M T

    2015-05-01

    Python snake species are often encountered in illegal activities and the question of species identity can be pertinent to such criminal investigations. Morphological identification of species of pythons can be confounded by many issues and molecular examination by DNA analysis can provide an alternative and objective means of identification. Our paper reports on the development and validation of a PCR primer pair that amplifies a segment of the mitochondrial cytochrome b gene that has been suggested previously as a good candidate locus for differentiating python species. We used this DNA region to perform species identification of pythons, even when the template DNA was of poor quality, as might be the case with forensic evidentiary items. Validation tests are presented to demonstrate the characteristics of the assay. Tests involved the cross-species amplification of this marker in non-target species, minimum amount of DNA template required, effects of degradation on product amplification and a blind trial to simulate a casework scenario that provided 100% correct identity. Our results demonstrate that this assay performs reliably and robustly on pythons and can be applied directly to forensic investigations where the presence of a species of python is in question. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  14. Molecular Diagnosis of 5α-Reductase Type II Deficiency in Brazilian Siblings with 46,XY Disorder of Sex Development

    Directory of Open Access Journals (Sweden)

    Maricilda Palandi de Mello

    2011-12-01

    Full Text Available The steroid 5α-reductase type II enzyme catalyzes the conversion of testosterone (T to dihydrotestosterone (DHT, and its deficiency leads to undervirilization in 46,XY individuals, due to an impairment of this conversion in genital tissues. Molecular analysis in the steroid 5α-reductase type II gene (SRD5A2 was performed in two 46,XY female siblings. SRD5A2 gene sequencing revealed that the patients were homozygous for p.Gln126Arg missense mutation, which results from the CGA > CAA nucleotide substitution. The molecular result confirmed clinical diagnosis of 46,XY disorder of sex development (DSD for the older sister and directed the investigation to other family members. Studies on SRD5A2 protein structure showed severe changes at NADPH binding region indicating that structural modeling analysis can be useful to evaluate the deleterious role of a mutation as causing 5α-reductase type II enzyme deficiency.

  15. Molecular identification of bacteria in tracheal aspirate fluid from mechanically ventilated preterm infants.

    Directory of Open Access Journals (Sweden)

    Peter M Mourani

    Full Text Available BACKGROUND: Despite strong evidence linking infections to the pathogenesis of bronchopulmonary dysplasia (BPD, limitations of bacterial culture methods have precluded systematic studies of airway organisms relative to disease outcomes. Application of molecular bacterial identification strategies may provide new insight into the role of bacterial acquisition in the airways of preterm infants at risk for BPD. METHODS: Serial (within 72 hours, 7, 14, and 21 days of life tracheal aspirate samples were collected from 10 preterm infants with gestational age ≤34 weeks at birth, and birth weight of 500-1250 g who required mechanical ventilation for at least 21 days. Samples were analyzed by quantitative real time PCR assays for total bacterial load and by pyrosequencing for bacterial identification. RESULTS: Subjects were diagnosed with mild (1, moderate (3, or severe (5 BPD. One patient died prior to determination of disease severity. 107,487 sequences were analyzed, with mean of 3,359 (range 1,724-4,915 per sample. 2 of 10 samples collected 70copies/reaction. 72 organisms were observed in total. Seven organisms represented the dominant organism (>50% of total sequences in 31/32 samples with positive sequences. A dominant organism represented>90% of total sequences in 13 samples. Staphylococcus, Ureaplasmaparvum, and Ureaplasmaurealyticum were the most frequently identified dominant organisms, but Pseudomonas, Enterococcus, and Escherichia were also identified. CONCLUSIONS: Early bacterial colonization with diverse species occursafter the first 3 days of life in the airways of intubated preterm infants, and can be characterized by bacterial load and marked species diversity. Molecular identification of bacteria in the lower airways of preterm infants has the potential to yield further insight into the pathogenesis of BPD.

  16. Identification of the sex-determining locus in grass puffer (Takifugu niphobles) provides evidence for sex-chromosome turnover in a subset of Takifugu species

    Science.gov (United States)

    Atsumi, Kazufumi; Kamiya, Takashi; Nozawa, Aoi; Aoki, Yuma; Tasumi, Satoshi; Koyama, Takashi; Nakamura, Osamu; Suzuki, Yuzuru

    2018-01-01

    There is increasing evidence for frequent turnover in sex chromosomes in vertebrates. Yet experimental systems suitable for tracing the detailed process of turnover are rare. In theory, homologous turnover is possible if the new sex-determining locus is established on the existing sex-chromosome. However, there is no empirical evidence for such an event. The genus Takifugu includes fugu (Takifugu rubripes) and its two closely-related species whose sex is most likely determined by a SNP at the Amhr2 locus. In these species, males are heterozygous, with G and C alleles at the SNP site, while females are homozygous for the C allele. To determine if a shift in the sex-determining locus occurred in another member of this genus, we used genetic mapping to characterize the sex-chromosome systems of Takifugu niphobles. We found that the G allele of Amhr2 is absent in T. niphobles. Nevertheless, our initial mapping suggests a linkage between the phenotypic sex and the chromosome 19, which harbors the Amhr2 locus. Subsequent high-resolution analysis using a sex-reversed fish demonstrated that the sex-determining locus maps to the proximal end of chromosome 19, far from the Amhr2 locus. Thus, it is likely that homologous turnover involving these species has occurred. The data also showed that there is a male-specific reduction of recombination around the sex-determining locus. Nevertheless, no evidence for sex-chromosome differentiation was detected: the reduced recombination depended on phenotypic sex rather than genotypic sex; no X- or Y-specific maker was obtained; the YY individual was viable. Furthermore, fine-scale mapping narrowed down the new sex-determining locus to the interval corresponding to approximately 300-kb of sequence in the fugu genome. Thus, T. niphobles is determined to have a young and small sex-determining region that is suitable for studying an early phase of sex-chromosome evolution and the mechanisms underlying turnover of sex chromosome. PMID

  17. The Seasonality and Ecology of the Anopheles gambiae complex (Dipetra: Culicidae) in Liberia Using Molecular Identification.

    Science.gov (United States)

    Fahmy, N T; Villinski, J T; Bolay, F; Stoops, C A; Tageldin, R A; Fakoli, L; Okasha, O; Obenauer, P J; Diclaro, J W

    2015-05-01

    Members of the Anopheles gambiae sensu lato (Giles) complex define a group of seven morphologically indistinguishable species, including the principal malaria vectors in Sub-Saharan Africa. Members of this complex differ in behavior and ability to transmit malaria; hence, precise identification of member species is critical to monitoring and evaluating malaria threat levels. We collected mosquitoes from five counties in Liberia every other month from May 2011 until May 2012, using various trapping techniques. A. gambiae complex members were identified using molecular techniques based on differences in the ribosomal DNA (rDNA) region between species and the molecular forms (S and M) of A. gambiae sensu stricto (s.s) specimens. In total, 1,696 A. gambiae mosquitoes were collected and identified. DNA was extracted from legs of each specimen with species identification determined by multiplex polymerase chain reaction using specific primers. The molecular forms (M or S) of A. gambiae s.s were determined by restriction fragment length polymorphism. Bivariate and multivariate logistic regression models identified environmental variables associated with genomic differentiation. Our results indicate widespread occurrence of A. gambiae s.s., the principal malaria vector in the complex, although two Anopheles melas Theobald/A. merus Donitz mosquitoes were detected. We found 72.6, 25.5, and 1.9% of A. gambiae s.s specimens were S, M, and hybrid forms, respectively. Statistical analysis indicates that the S form was more likely to be found in rural areas during rainy seasons and indoor catchments. This information will enhance vector control efforts in Liberia. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  18. Total and high molecular weight adiponectin have similar utility for the identification of insulin resistance

    Directory of Open Access Journals (Sweden)

    Aguilar-Salinas Carlos A

    2010-06-01

    Full Text Available Abstract Background Insulin resistance (IR and related metabolic disturbances are characterized by low levels of adiponectin. High molecular weight adiponectin (HMWA is considered the active form of adiponectin and a better marker of IR than total adiponectin. The objective of this study is to compare the utility of total adiponectin, HMWA and the HMWA/total adiponectin index (SA index for the identification of IR and related metabolic conditions. Methods A cross-sectional analysis was performed in a group of ambulatory subjects, aged 20 to 70 years, in Mexico City. Areas under the receiver operator characteristic (ROC curve for total, HMWA and the SA index were plotted for the identification of metabolic disturbances. Sensitivity and specificity, positive and negative predictive values, and accuracy for the identification of IR were calculated. Results The study included 101 men and 168 women. The areas under the ROC curve for total and HMWA for the identification of IR (0.664 vs. 0.669, P = 0.74, obesity (0.592 vs. 0.610, P = 0.32, hypertriglyceridemia (0.661 vs. 0.671, P = 0.50 and hypoalphalipoproteinemia (0.624 vs. 0.633, P = 0.58 were similar. A total adiponectin level of 8.03 μg/ml was associated with a sensitivity of 57.6%, a specificity of 65.9%, a positive predictive value of 50.0%, a negative predictive value of 72.4%, and an accuracy of 62.7% for the diagnosis of IR. The corresponding figures for a HMWA value of 4.25 μg/dl were 59.6%, 67.1%, 51.8%, 73.7% and 64.2%. The area under the ROC curve of the SA index for the identification of IR was 0.622 [95% CI 0.554-0.691], obesity 0.613 [95% CI 0.536-0.689], hypertriglyceridemia 0.616 [95% CI 0.549-0.683], and hypoalphalipoproteinemia 0.606 [95% CI 0.535-0.677]. Conclusions Total adiponectin, HMWA and the SA index had similar utility for the identification of IR and metabolic disturbances.

  19. Identification of volatile sex pheromone components released by the southern armyworm,Spodoptera eridania (Cramer).

    Science.gov (United States)

    Teal, P E; Mitchell, E R; Tumlinson, J H; Heath, R R; Sugie, H

    1985-06-01

    Analysis of sex pheromone gland extracts and volatile pheromone components collected from the calling female southern armyworm,Spodoptera eridania (Cramer), by high-resolution capillary gas chromatography and mass spectroscopy indicated that a number of 14-carbon mono- and diunsaturated acetates and a monounsaturated 16-carbon acetate were produced. Gland extracts also indicated the presence of (Z)-9-tetradecen-1-ol. However, this compound was not found in collections of volatiles. Field trapping studies indicated that the volatile blend composed of (Z)-9-tetradecen-1-ol acetate (60%), (Z)-9-(E)-12-tetradecadien-1-ol acetate (17%), (Z)-9-(Z)-12-tetradecadien-1-ol acetate (15%), (Z)-9-(E)-11-tetradecadien-1-ol acetate (5%), and (Z)-11-hexadecen-1-ol acetate (3 %) was an effective trap bait for males of this species. The addition of (Z)-9-tetradecen-1-ol to the acetate blends tested resulted in the capture of beet armyworm,S. exigua (Hubner), males which provides further evidence that the alcohol is a pheromone component of this species.

  20. An evaluation of a diagnostic test to identify the sex of farmed rainbow trout, using sex-specific molecular markers Evaluación de un test diagnóstico para identificar el sexo en truchas arcoíris por medio de marcadores moleculares específicos

    Directory of Open Access Journals (Sweden)

    María E López

    2012-11-01

    Full Text Available In trout farming males exhibits lower growth rate and precocious sexual maturation in contrast to females. Since these traits are detrimental for intensive production, all females populations are most appreciated by fish farmers. Molecular markers sex-specific have been developed for rainbow trout that can be useful to diagnose the phenotypic sex of individuals. We evaluated the use of two SCAR markers (OmyP9 & Omy163, which show polymorphisms between males and females in rainbow trout as a diagnostic test for sexing farmed trout. Adult trout (n = 131 were genotyped to assess the association of the SCAR markers with phenotypic sex. To evaluate the correct performance of the SCAR marker in sex diagnosis, each marker and both were analyzed to estimate its specificity (the proportion of males that are correctly identified, sensitivity (the proportion of females that are correctly identified and predictive value (the probability of the correct positive or negative female identification. Significant associations with phenotypic sex of both SCAR markers with sex were found. The sensitivity and predictive (positive and negative indexes show higher values when both SCAR markers were considered (95.7, 77.4 and 94.4%, respectively. For joined SCAR markers a likelihood ratio (LR+ of 3.43 was obtained indicating its utility to establish a diagnostic test for sexing trout by use of marker-based analysis.En el cultivo de truchas los individuos del sexo masculino presentan menor tasa de crecimiento y maduración sexual precoz, características que no presentan las hembras. Debido a estos rasgos indeseables para el cultivo intensivo, el uso de poblaciones todo hembra es una práctica habitual en el cultivo de truchas. Para trucha arcoíris se han desarrollado marcadores moleculares sexo específico que pueden utilizarse en el diagnóstico temprano del sexo, en condiciones de cultivo. Se evaluó la aplicación de dos marcadores SCAR (OmyP9 y Omy163, que muestran

  1. Molecular identification of hard ticks (Ixodes sp.) infesting rodents in Selangor, Malaysia

    Science.gov (United States)

    Ishak, Siti Nabilah; Shiang, Lim Fang; Taib, Farah Shafawati Mohd; Jing, Khoo Jing; Nor, Shukor Md; Yusof, Muhammad Afif; Sah, Shahrul Anuar Mohd; Sitam, Frankie Thomas; Japning, Jeffrine Rovie Ryan

    2018-04-01

    This study aims to identify hard ticks (Ixodes sp.) infesting rodents in three different sites in Selangor, Malaysia using a molecular approach. A total of 11 individual ticks infesting four different host species (Rattus tiomanicus, Rattus ratus, Maxomys surifer and Sundamys muelleri) were examined based on its morphological features, followed by molecular identification using mitochondrial 16S rDNA gene. Confirmation of the species identity was accomplished by using BLAST program. Clustering analysis based on 16S rDNA sequences was carried out by constructing Neighbour-joining (NJ) and Maximum parsimony (MP) tree using MEGA 7 to clarify the genetic identity of Ixodes sp. Based on morphological features, all individual ticks were only able to be identified up to genus level as most of the samples were fully engorged, damaged and lacked morphological characters. However, molecular analysis of samples revealed 99% similarity with Ixodes granulatus from the GenBank database. Thus, the result of this study showed that all these ticks (Ixodes granulatus) were genetically affiliated to a monophyletic group with highly homogenous sequences.

  2. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

    Science.gov (United States)

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

    2017-02-01

    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  3. Identification of bioflavonoid as fusion inhibitor of dengue virus using molecular docking approach

    Directory of Open Access Journals (Sweden)

    Asif Mir

    Full Text Available Dengue virus with four distinct serotypes belongs to Flavivirus, poses a significant threat to human health and becomes an emerging global problem. Membrane fusion is a central molecular event during viral entry into host cell. To prevent viral infection it is necessary to interrupt the virus replication at an early stage of attachment. Dengue Virus (DENV envelope protein experiences conformational changes and it causes the virus to fuse with host cell. Hinge region movement of domain I and II in envelope protein facilitates the fusion process. Small molecules that bind in this pocket may have the ability to interrupt the conformational changes that trigger fusion process. We chose different flavonoids (baicalein, fisetin, hesperetin, naringenin/ naringin, quercetin and rutin that possess anti dengue activity. Molecular docking analysis was done to examine the inhibitory effect of flavonoids against envelope protein of DENV-2. Results manifest quercetin (flavonoid found in Carica papaya, apple and even in lemon as the only flavone that can interrupt the fusion process of virus by inhibiting the hinge region movement and by blocking the conformational rearrangement in envelope protein. These novel findings using computational approach are worthwhile and will be a bridge to check the efficacy of compounds using appropriate animal model under In vivo studies. This information can be used by new techniques and provides a way to control dengue virus infection. Keywords: Dengue virus, Inhibitor identification, Molecular docking, Interaction analysis

  4. Molecular identification of protozoa causing AIDS-associated cholangiopathy in Buenos Aires, Argentina.

    Science.gov (United States)

    Nétor Velásquez, Jorge; Marta, Edgardo; Alicia di Risio, Cecilia; Etchart, Cristina; Gancedo, Elisa; Victor Chertcoff, Agustín; Bruno Malandrini, Jorge; Germán Astudillo, Osvaldo; Carnevale, Silvana

    2012-12-01

    Several species of microsporidia and coccidia are protozoa parasites responsible for cholan-giopathy disease in patients infected with human immunodeficiency virus (HIV). The goals of this work were to identift opportunistic protozoa by molecular methods and describe the clinical manifestations at the gastrointestinal tract and the biliary system in patients with AIDS-associated cholangiopathy from Buenos Aires, Argentina. This study included 11 adult HIV-infected individuals with diagnosis ofAIDS- associated cholangiopathy. An upper gastrointestinal endoscopy with biopsy specimen collection and a stool analysis for parasites were performed on each patient. The ultrasound analysis revealed bile ducts compromise. An endoscopic retrograde cholangiopancreatography and a magnetic resonance cholangiography were carried out. The identification to the species level was performed on biopsy specimens by molecular methods. Microorganisms were identified in 10 cases. The diagnosis in patients with sclerosing cholangitis was cryptosporidiosis in 3 cases, cystoisosporosis in 1 and microsporidiosis in 1. In patients with sclerosing cholangitis and papillary stenosis the diagnosis was microsporidiosis in 2 cases, cryptosporidiosis in 2 and cryptosporidiosis associated with microsporidiosis in 1. In 3 cases with cryptosporidiosis the species was Cryptosporidium hominis, 1 of them was associated with Enterocytozoon bieneusi, and the other 2 were coinfected with Cryptosporidium parvum. In the 4 cases with microsporidiosis the species was Enterocytozoon bieneusi. These results suggest that molecular methods may be useful tools to identify emerging protozoa in patients with AIDS-associated cholangiopathy.

  5. Prevalence and Molecular Identification of Nematode and Dipteran Parasites in an Australian Alpine Grasshopper (Kosciuscola tristis)

    Science.gov (United States)

    Umbers, Kate D. L.; Byatt, Lachlan J.; Hill, Nichola J.; Bartolini, Remo J.; Hose, Grant C.; Herberstein, Marie E.; Power, Michelle L

    2015-01-01

    In alpine Australia, Orthoptera are abundant, dominant herbivores, important prey species, and hosts for parasites and parasitoids. Despite the central role of orthopterans in alpine ecosystems, the impact of parasites on orthopteran populations is under-explored. In this study we describe the relationship between parasite prevalence and host sex, body size and year of collection. We accessed an existing, preserved collection of 640 Kosciuscola tristis collected from across its range between 2007 and 2011. Upon dissection we collected juvenile parasites and used molecular tools to identify them to three families (Nematoda; Mermithidae, and Arthropoda: Diptera: Tachinidae and Sarcophagidae). The prevalence of nematodes ranged from 3.5% to 25.0% and dipterans from 2.4% to 20.0%. Contrary to predictions, we found no associations between parasite prevalence and grasshopper sex or size. Although there was an association between prevalence of both nematodes and dipterans with year of collection, this is likely driven by a small sample size in the first year. Our results provide a foundation for future studies into parasite prevalence within the alpine environment and the abiotic factors that might influence these associations. PMID:25919745

  6. Identification of the sex pheromone of the tree infesting Cossid Moth Coryphodema tristis (Lepidoptera: Cossidae).

    Science.gov (United States)

    Bouwer, Marc Clement; Slippers, Bernard; Degefu, Dawit; Wingfield, Michael John; Lawson, Simon; Rohwer, Egmont Richard

    2015-01-01

    The cossid moth (Coryphodema tristis) has a broad range of native tree hosts in South Africa. The moth recently moved into non-native Eucalyptus plantations in South Africa, on which it now causes significant damage. Here we investigate the chemicals involved in pheromone communication between the sexes of this moth in order to better understand its ecology, and with a view to potentially develop management tools for it. In particular, we characterize female gland extracts and headspace samples through coupled gas chromatography electro-antennographic detection (GC-EAD) and two dimensional gas chromatography mass spectrometry (GCxGC-MS). Tentative identities of the potential pheromone compounds were confirmed by comparing both retention time and mass spectra with authentic standards. Two electrophysiologically active pheromone compounds, tetradecyl acetate (14:OAc) and Z9-tetradecenyl acetate (Z9-14:OAc) were identified from pheromone gland extracts, and an additional compound (Z9-14:OH) from headspace samples. We further determined dose response curves for the identified compounds and six other structurally similar compounds that are common to the order Cossidae. Male antennae showed superior sensitivity toward Z9-14:OAc, Z7-tetradecenyl acetate (Z7-14:OAc), E9-tetradecenyl acetate (E9-14:OAc), Z9-tetradecenol (Z9-14:OH) and Z9-tetradecenal (Z9-14:Ald) when compared to female antennae. While we could show electrophysiological responses to single pheromone compounds, behavioral attraction of males was dependent on the synergistic effect of at least two of these compounds. Signal specificity is shown to be gained through pheromone blends. A field trial showed that a significant number of males were caught only in traps baited with a combination of Z9-14:OAc (circa 95% of the ratio) and Z9-14:OH. Addition of 14:OAc to this mixture also improved the number of males caught, although not significantly. This study represents a major step towards developing a useful

  7. Identification of the sex pheromone of the tree infesting Cossid Moth Coryphodema tristis (Lepidoptera: Cossidae.

    Directory of Open Access Journals (Sweden)

    Marc Clement Bouwer

    Full Text Available The cossid moth (Coryphodema tristis has a broad range of native tree hosts in South Africa. The moth recently moved into non-native Eucalyptus plantations in South Africa, on which it now causes significant damage. Here we investigate the chemicals involved in pheromone communication between the sexes of this moth in order to better understand its ecology, and with a view to potentially develop management tools for it. In particular, we characterize female gland extracts and headspace samples through coupled gas chromatography electro-antennographic detection (GC-EAD and two dimensional gas chromatography mass spectrometry (GCxGC-MS. Tentative identities of the potential pheromone compounds were confirmed by comparing both retention time and mass spectra with authentic standards. Two electrophysiologically active pheromone compounds, tetradecyl acetate (14:OAc and Z9-tetradecenyl acetate (Z9-14:OAc were identified from pheromone gland extracts, and an additional compound (Z9-14:OH from headspace samples. We further determined dose response curves for the identified compounds and six other structurally similar compounds that are common to the order Cossidae. Male antennae showed superior sensitivity toward Z9-14:OAc, Z7-tetradecenyl acetate (Z7-14:OAc, E9-tetradecenyl acetate (E9-14:OAc, Z9-tetradecenol (Z9-14:OH and Z9-tetradecenal (Z9-14:Ald when compared to female antennae. While we could show electrophysiological responses to single pheromone compounds, behavioral attraction of males was dependent on the synergistic effect of at least two of these compounds. Signal specificity is shown to be gained through pheromone blends. A field trial showed that a significant number of males were caught only in traps baited with a combination of Z9-14:OAc (circa 95% of the ratio and Z9-14:OH. Addition of 14:OAc to this mixture also improved the number of males caught, although not significantly. This study represents a major step towards developing a

  8. [Molecular identification of astragali radix and its adulterants by ITS sequences].

    Science.gov (United States)

    Cui, Zhan-Hu; Li, Yue; Yuan, Qing-Jun; Zhou, Li-She; Li, Min-Hui

    2012-12-01

    To explore a new method for identification Astragali Radix from its adulterants by using ITS sequence. Thirteen samples of the different Astragali Radix materials and 6 samples of the adulterants of the roots of Hedysarum polybotrys, Medicago sativa and Althaea rosea were collected. ITS sequence was amplified by PCR and sequenced unidirectionally. The interspecific K-2-P distances of Astragali Radix and its adulterants were calculated, and NJ tree and UPGMA tree were constructed by MEGA 4. ITS sequences were obtained from 19 samples respectively, there were Astragali Radix 646-650 bp, H. polybotrys 664 bp, Medicago sativa 659 bp, Althaea rosea 728 bp, which were registered in the GenBank. Phylogeny trees reconstruction using NJ and UPGMA analysis based on ITS nucleotide sequences can effectively distinguish Astragali Radix from adulterants. ITS sequence can be used to identify Astragali Radix from its adulterants successfully and is an efficient molecular marker for authentication of Astragali Radix and its adulterants.

  9. Vibrio parahaemolyticus: A Review on the Pathogenesis, Prevalence and Advance Molecular Identification Techniques

    Directory of Open Access Journals (Sweden)

    Vengadesh eLetchumanan

    2014-12-01

    Full Text Available Vibrio parahaemolyticus is a Gram-negative halophilic bacterium that is found in estuarine, marine and coastal environments. Vibrio parahaemolyticus is the leading causal agent of human acute gastroenteritis following the consumption of raw, undercooked or mishandled marine products. In rare cases, Vibrio parahaemolyticus causes wound infection, ear infection or septicaemia in individuals with pre-existing medical conditions. Vibrio parahaemolyticus has two hemolysins virulence factors that are thermostable direct hemolysin (tdh-a pore-forming protein that contributes to the invasiveness of the bacterium in humans, and TDH-related hemolysin (trh, which plays a similar role as thermostable direct hemolysin (tdh in the disease pathogenesis. In addition, the bacterium is also encodes for adhesions and type III secretion systems (T3SS1 and T3SS2 to ensure its survival in the environment. This review aims at discussing the Vibrio parahemolyticus growth and characteristics, pathogenesis, prevalence and advances in molecular identification techniques.

  10. Pigments Characterization and Molecular Identification of Bacterial Symbionts of Brown Algae Padinasp. Collected from Karimunjawa Island

    Directory of Open Access Journals (Sweden)

    Damar Bayu Murti

    2016-06-01

    Full Text Available The search for carotenoids in nature has been extensively studied because of their applications in foods. One treasure of the biopigment source is symbiotic-microorganisms with marine biota. The advantages of symbiont bacteria are easy to culture and sensitize pigments. The use of symbiont bacteria helps to conserve fish, coral reefs, seagrass, and seaweed. Therefore, the bacteria keeps their existence in their ecosystems. In this study, bacterial symbionts were successfully isolated from brown algae Padina sp. The bacterial symbionts had yellow pigment associated with carotenoids. The pigments were characterized using High Performance Liquid Chromatography (HPLC with a Photo Diode Array (PDA detector. The carotenoid pigments in the bacterial symbionts were identified as dinoxanthin, lutein and neoxanthin. Molecular identification by using a 16S rRNA gene sequence method, reveals that the bacterial symbionts were closely related to Bacillus marisflavi with a homology of 99%. Keywords :carotenoid pigments, brown algae, Padina, bacterial symbionts, 16S rRNA

  11. Species identification and molecular typing of human Brucella isolates from Kuwait.

    Science.gov (United States)

    Mustafa, Abu S; Habibi, Nazima; Osman, Amr; Shaheed, Faraz; Khan, Mohd W

    2017-01-01

    Brucellosis is a zoonotic disease of major concern in Kuwait and the Middle East. Human brucellosis can be caused by several Brucella species with varying degree of pathogenesis, and relapses are common after apparently successful therapy. The classical biochemical methods for identification of Brucella are time-consuming, cumbersome, and provide information limited to the species level only. In contrast, molecular methods are rapid and provide differentiation at intra-species level. In this study, four molecular methods [16S rRNA gene sequencing, real-time PCR, enterobacterial repetitive intergenic consensus (ERIC)-PCR and multilocus variable-number tandem-repeat analysis (MLVA)-8, MLVA-11 and MLVA-16 were evaluated for the identification and typing of 75 strains of Brucella isolated in Kuwait. 16S rRNA gene sequencing of all isolates showed 90-99% sequence identity with B. melitensis and real-time PCR with genus- and species- specific primers identified all isolates as B. melitensis. The results of ERIC-PCR suggested the existence of 75 ERIC genotypes of B. melitensis with a discriminatory index of 0.997. Cluster classification of these genotypes divided them into two clusters, A and B, diverging at ~25%. The maximum number of genotypes (n = 51) were found in cluster B5. MLVA-8 analysis identified all isolates as B. melitensis, and MLVA-8, MLVA-11 and MLVA-16 typing divided the isolates into 10, 32 and 71 MLVA types, respectively. Furthermore, the combined minimum spanning tree analysis demonstrated that, compared to MLVA types discovered all over the world, the Kuwaiti isolates were a distinct group of MLVA-11 and MLVA-16 types in the East Mediterranean Region.

  12. Molecular identification of nematode larvae different from those of the Trichinella genus detected by muscle digestion.

    Science.gov (United States)

    Marucci, Gianluca; Interisano, Maria; La Rosa, Giuseppe; Pozio, Edoardo

    2013-05-20

    Although larvae of the genus Trichinella are the most common parasite species detected in vertebrate muscles using artificial digestion, nematode larvae belonging to other genera are sometimes detected and incorrectly identified as Trichinella. However, it is often very difficult to identify these larvae at the species, genus or family level using microscopy because of the absence of specific morphological characters or cuticle damage, and the only means of identification is PCR and sequencing of specific molecular markers (12S mtDNA; COI; 18S rDNA; and ITS1). From 2008 to 2011, 18 nematode isolates not belonging to the genus Trichinella were collected from different host species. Eleven of these isolates were successfully identified at the species, genus or superfamily level: larvae from two common kestrels, three hooded crows, a hen harrier and a domestic pig were identified as Toxocara cati; larvae from a badger were identified as Toxocara canis; larvae from a domestic pig were identified as a free-living nematode of the genus Panagrolaimus; larvae from a wild boar were identified as belonging to the Metastrongylus genus; and larvae from a rough-legged buzzard were identified as belonging to the superfamily Filarioidea. The recovery of nematodes belonging to genera other than Trichinella during routine meat inspection suggests that the persons performing the analyses need to be informed of the possibility of false positives and that a molecular-based identification system that allows for a rapid and reliable response must be adopted (i.e., a DNA barcoding-like system). Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Molecular identification of Nocardia species using the sodA gene

    Directory of Open Access Journals (Sweden)

    K. Sánchez-Herrera

    2017-09-01

    Full Text Available Currently for bacterial identification and classification the rrs gene encoding 16S rRNA is used as a reference method for the analysis of strains of the genus Nocardia. However, it does not have enough polymorphism to differentiate them at the species level. This fact makes it necessary to search for molecular targets that can provide better identification. The sodA gene (encoding the enzyme superoxide dismutase has had good results in identifying species of other Actinomycetes. In this study the sodA gene is proposed for the identification and differentiation at the species level of the genus Nocardia. We used 41 type species of various collections; a 386 bp fragment of the sodA gene was amplified and sequenced, and a phylogenetic analysis was performed comparing the genes rrs (1171 bp, hsp65 (401 bp, secA1 (494 bp, gyrB (1195 bp and rpoB (401 bp. The sequences were aligned using the Clustal X program. Evolutionary trees according to the neighbour-joining method were created with the programs Phylo_win and MEGA 6. The specific variability of the sodA genus of the genus Nocardia was analysed. A high phylogenetic resolution, significant genetic variability, and specificity and reliability were observed for the differentiation of the isolates at the species level. The polymorphism observed in the sodA gene sequence contains variable regions that allow the discrimination of closely related Nocardia species. The clear specificity, despite its small size, proves to be of great advantage for use in taxonomic studies and clinical diagnosis of the genus Nocardia.

  14. Molecular identification of livestock breeds: a tool for modern conservation biology.

    Science.gov (United States)

    Yaro, Mohammed; Munyard, Kylie A; Stear, Michael J; Groth, David M

    2017-05-01

    Global livestock genetic diversity includes all of the species, breeds and strains of domestic animals, and their variations. Although a recent census indicated that there were 40 species and over 8000 breeds of domestic animals; for the purpose of conservation biology the diversity between and within breeds rather than species is regarded to be of crucial importance. This domestic animal genetic diversity has developed through three main evolutionary events, from speciation (about 3 million years ago) through domestication (about 12000 years ago) to specialised breeding (starting about 200 years ago). These events and their impacts on global animal genetic resources have been well documented in the literature. The key importance of global domestic animal resources in terms of economic, scientific and cultural heritage has also been addressed. In spite of their importance, there is a growing number of reports on the alarming erosion of domestic animal genetic resources. This erosion of is happening in spite of several global conservation initiatives designed to mitigate it. Herein we discuss these conservation interventions and highlight their strengths and weaknesses. However, pivotal to the success of these conservation initiatives is the reliability of the genetic assignment of individual members to a target breed. Finally, we discuss the prospect of using improved breed identification methodologies to develop a reliable breed-specific molecular identification tool that is easily applicable to populations of livestock breeds in various ecosystems. These identification tools, when developed, will not only facilitate the regular monitoring of threatened or endangered breed populations, but also enhance the development of more efficient and sustainable livestock production systems. © 2016 Cambridge Philosophical Society.

  15. A molecular identification system for grasses: a novel technology for forensic botany.

    Science.gov (United States)

    Ward, J; Peakall, R; Gilmore, S R; Robertson, J

    2005-09-10

    Our present inability to rapidly, accurately and cost-effectively identify trace botanical evidence remains the major impediment to the routine application of forensic botany. Grasses are amongst the most likely plant species encountered as forensic trace evidence and have the potential to provide links between crime scenes and individuals or other vital crime scene information. We are designing a molecular DNA-based identification system for grasses consisting of several PCR assays that, like a traditional morphological taxonomic key, provide criteria that progressively identify an unknown grass sample to a given taxonomic rank. In a prior study of DNA sequences across 20 phylogenetically representative grass species, we identified a series of potentially informative indels in the grass mitochondrial genome. In this study we designed and tested five PCR assays spanning these indels and assessed the feasibility of these assays to aid identification of unknown grass samples. We confirmed that for our control set of 20 samples, on which the design of the PCR assays was based, the five primer combinations produced the expected results. Using these PCR assays in a 'blind test', we were able to identify 25 unknown grass samples with some restrictions. Species belonging to genera represented in our control set were all correctly identified to genus with one exception. Similarly, genera belonging to tribes in the control set were correctly identified to the tribal level. Finally, for those samples for which neither the tribal or genus specific PCR assays were designed, we could confidently exclude these samples from belonging to certain tribes and genera. The results confirmed the utility of the PCR assays and the feasibility of developing a robust full-scale usable grass identification system for forensic purposes.

  16. Molecular identification of Mycobacterium tuberculosis complex isolates from Kermanshah Province, Iran

    Directory of Open Access Journals (Sweden)

    Roghieh Moghaddam

    2016-01-01

    Full Text Available Tuberculosis is one of the most important zoonotic diseases in the world. Rapid diagnosis of the disease and identification of species is extremely important for proper treatment of the disease as some species of the complex are resistant to the first-line of tuberculosis drugs. The aim of present study was molecular identification of Mycobacterium tuberculosis (MTB complex isolates from Kermanshah Province, Iran, which were submitted to the Tuberculosis Reference Laboratory at Razi Vaccine and Serum Research Institute (Tehran, Iran. To identify the genus Mycobacterium, all isolates were subjected to 16S rRNA polymerase chain reaction (PCR, and PCR-IS6110 was subsequently used to confirm that the isolates belonged to MTB complex. Finally, region of difference (RD typing was used to identify the species in the complex. The results of 16S rRNA and IS6110 PCR analysis showed the presence of 543-bp and 245-bp bands, respectively. Furthermore, 146bp, 172bp, 235bp, and 369bp at RD1, RD4, RD9, and RD12, respectively, were observed during RD typing. Thus, based on the results, all isolates were identified as MTB. It is worth mentioning that most tuberculosis cases are identified on the basis of acid-fast bacilli detection, and antibiotic therapy is immediately initiated subsequently. Moreover, it should be noted that some of these acid-fast positive cases might not be of genus Mycobacterium, and thus, the antibiotics prescribed might threaten the health of the patients. Additionally, if the identified bacilli are not within MTB complex, the drug therapy would differ. However, Mycobacterium bovis, which is a member of MTB complex and is resistant to pyrazinamide, requires exact strain identification. Based on the findings, individual isolates should be identified by RD typing methods, which could clearly discriminate the species from each other.

  17. Molecular identification and cluster analysis of homofermentative thermophilic lactobacilli isolated from dairy products.

    Science.gov (United States)

    Andrighetto, C; De Dea, P; Lombardi, A; Neviani, E; Rossetti, L; Giraffa, G

    1998-10-01

    Twenty-five strains of thermophilic lactobacilli isolated from yoghurt and from semi-hard and hard cheeses (in parallel with nine type or reference strains) were identified and grouped according to their genetic relatedness. Strains were identified by sugar fermentation patterns using the "API 50 CHL" galleries, by species-specific DNA probes in dot-blot hybridization experiments, by amplification and restriction analysis of the 16S rRNA gene (ARDRA) and by polymerase chain reaction (PCR) using species-specific oligonucleotide primers. Strains were classified as Lactobacillus delbrueckii subsp. lactis and subsp. bulgaricus, L. helveticus, and L. acidophilus. Strains which were atypical by sugar fermentation patterns were also identified. Most of the strains could not be grouped using carbohydrate fermentation profiles. PCR fingerprinting was used to identify DNA profiles for the 25 lactobacilli. Experimentally obtained PCR profiles enabled discrimination of all strains, which were grouped according to the similarities in their combined patterns. In general, the clustering of the strains corresponded well with species delineation obtained by molecular identification. The dendrogram of genetic relatedness enabled the unambiguous identification of most of the strains which were shown to be atypical by the sugar fermentation profile, except for a discrepancy in one L. delbrueckii subsp. lactis strain and one atypical Lactobacillus sp. strain.

  18. Molecular identification based on ITS sequences for Kappaphycus and Eucheuma cultivated in China

    Science.gov (United States)

    Zhao, Sufen; He, Peimin

    2011-11-01

    The systematic classification of the Eucheumatoideae is difficult because of their variable morphology and interpretation of reproductive structures. Kappaphycus and Eucheuma specimens cultivated on the Hainan and Fujian coast of China were introduced from Vietnam, the Philippines and Indonesia. Combined with morphological characteristics, all Kappaphycus and Eucheuma cultivated strains were identified by internal transcribed spacer (ITS) sequences. The phylogenetic tree was constructed using neighbor-joining and maximum likelihood methods. The results indicate that different ITS sequence lengths occurred in the different genera and species. An obvious difference in morphology could be found in the protuberance shape between Kappaphycus and Eucheuma. The protuberance in Eucheuma was thorn-like and in Kappaphycus was wartlike or papillate. Their ITS sequence lengths differed significantly in nucleotide variation rates up to 58.55%-63.90%. All nucleotide variations occurred in the ITS1 and ITS2 regions except for five nucleotide transversions in the 5.8S rDNA region. In addition, the difference was at the branches among congeneric species. Kappaphycus sp. had branches with small buds, while K. alvarezii did not have such a feature. The nucleotide variation rates varied from 7.02% to 7.48% among species; within the same species of the clades it was K. alvarezii, Kappaphycus sp., and E. denticulatum. The results indicate that ITS sequence analysis was an effective way for identification of interspecies and intraspecies phylogenetic relationships and might provide a clue for molecular identification of algal Eucheumatoideae.

  19. Morphological and molecular identification of phytophthora species from maple trees in Serbia

    Directory of Open Access Journals (Sweden)

    Milenković Ivan

    2014-01-01

    Full Text Available The paper presents the results of the study performed with aims to determine the presence and diversity of Phytophthora species on maple trees in Serbia. Due to high aggressiveness and their multicyclic nature, presence of these pathogens is posing significant threat to forestry and biodiversity. In total, 29 samples of water, soil and tissues were taken from 10 different localities, and six different maple hosts were tested. After the isolation tests, 17 samples from five different maple hosts were positive for the presence of Phytophthora spp., and 31 isolates were obtained. After the detailed morphological and physiological classification, four distinct groups of isolates were separated. DNA was extracted from selected representative isolates and molecular identification with sequencing of ITS region was performed. Used ITS4 and ITS6 primers successfully amplified the genomic DNA of chosen isolates and morphological identification of obtained isolates was confirmed after the sequencing. Four different Phytophthora species were detected, including P. cactorum, P. gonapodyides, P. plurivora and P. lacustris. The most common isolated species was homothallic, and with very variable and semipapillate sporangia, P. plurivora with 22 obtained isolates. This is the first report of P. plurivora and P. gonapodyides on A. campestre, P. plurivora and P. lacustris on Acer heldreichii and first report of P. lacustris on A. pseudoplatanus and A. tataricum in Serbia. [Projekat Ministarstva nauke Republike Srbije, br. TR 37008

  20. Molecular identification of parasitic nematodes (Nematoda: Strongylida) in feces of wild ruminants from Tunisia.

    Science.gov (United States)

    Said, Yousra; Gharbi, Mohamed; Mhadhbi, Moez; Dhibi, Moktar; Lahmar, Samia

    2017-11-08

    In Tunisia and other North African countries, there is a lack of knowledge about parasite biodiversity within threatened wild ruminants and there are not any studies on their gastrointestinal nematodes. Thus the aim of this study was to identify gastrointestinal fauna in the faecal samples of Tunisian wild ruminants. A total of 262 faecal samples were collected from domestic sheep and goat, and wild ruminants (Addax, Barbary sheep, Barbary red deer, Dorcas gazelle, Slender-horned gazelle and Scimitar-horned Oryx) living in protected areas. Samples were examined with floatation (saturated sodium chloride solution), polymerase chain reaction and sequencing of the second internal transcribed spacer region of the rDNA. Microscopic analysis allowed the identification of only Nematodirus genus or molecular tools allowed a first identification of five gastrointestinal nematode species in North African wild ruminants: Chabertia ovina (1.6%), Camelostrongylus mentulatus (1.6%), Marshallagia marshalli (4.7%), Nematodirus helvetianus (62.5%) and Nematodirus spathiger (29.7%). This study reported the first records of C. mentulatus and M. marshalli in Addax and of M. marshalli in Dorcas gazelle and it was the first reported record of N. helvetianus and M. marshalli in Tunisia.

  1. A Molecular Method for the Identification of Honey Bee Subspecies Used by Beekeepers in Russia

    Science.gov (United States)

    Syromyatnikov, Mikhail Y.; Borodachev, Anatoly V.; Kokina, Anastasia V.; Popov, Vasily N.

    2018-01-01

    Apis mellifera L. includes several recognized subspecies that differ in their biological properties and agricultural characteristics. Distinguishing between honey bee subspecies is complicated. We analyzed the Folmer region of the COX1 gene in honey bee subspecies cultivated at bee farms in Russia and identified subspecies-specific SNPs. DNA analysis revealed two clearly distinct haplogroups in A. mellifera mellifera. The first one was characterized by multiple cytosine-thymine (thymine–cytosine) transitions, one adenine-guanine substitution, and one thymine–adenine substitution. The nucleotide sequence of the second haplogroup coincided with sequences from other subspecies, except the unique C/A SNP at position 421 of the 658-bp Folmer region. A. mellifera carnica and A. mellifera carpatica could be distinguished from A. mellifera mellifera and A. mellifera caucasica by the presence of the A/G SNP at position 99 of the 658-bp Folmer region. The G/A SNP at position 448 was typical for A. mellifera carnica. A. mellifera caucasica COX1 sequence lacked all the above-mentioned sites. We developed a procedure for rapid identification of honey bee subspecies by PCR with restriction fragment length polymorphism (RFLP) using mutagenic primers. The developed molecular method for honey bee subspecies identification is fast and inexpensive. PMID:29382048

  2. Codling moth cytogenetics: karyotype, chromosomal location of rDNA, and molecular differentiation of sex chromosomes

    Czech Academy of Sciences Publication Activity Database

    Fuková, Iva; Nguyen, Petr; Marec, František

    Roč. 48, - ( 2005 ), s. 1083-1092 ISSN 0831-2796 R&D Projects: GA AV ČR(CZ) IAA6007307 Grant - others:IAEA(AT) 12055/R Institutional research plan: CEZ:AV0Z50070508 Keywords : CGH * codling moth * FISH Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.070, year: 2005

  3. Molecular markers to assess genetic diversity and mutant identifications in Jatropha curcas

    International Nuclear Information System (INIS)

    Azhar Mohamad; Yie Min Kwan; Fatin Mastura Derani; Abdul Rahim Harun

    2010-01-01

    Jatropha curcas (Linnaeus) belongs to the Euphorbiaceae family, is a multipurpose use, drought resistant and perennial plant. It is an economic important crop, which generates wide interest in understanding the genetic diversity of the species towards selection and breeding of superior genotypes. Jatropha accessions are closely related family species. Thus, better understanding of the effectiveness of the different DNA-based markers is an important step towards plant germplasm characterization and evaluation. It is becoming a prerequisite for more effective application of marker techniques in breeding programs. Inter-simple sequence repeats (ISSRs) has shown rapid, simple, reproducible and inexpensive means in molecular taxonomy, conservation breeding and genetic diversity analysis. These markers were used to understand diversity and differentiate amongst accessions of Jatropha population and mutant lines generated by acute gamma radiation. The ISSR for marker applications are essential to facilitate management, conservation and genetic improvement programs towards improvement of bio-diesel production and medication substances. A total of 62 ISSR primers were optimized for polymorphism evaluations on five foreign accessions (Africa, India, Myanmar, Indonesia, Thailand), nine local accessions and two mutants of Jatropha. Optimization was resulted 54 ISSR primers affirmative for the polymorphism evaluation study, which encountered 12 ISSR primers, showed significance polymorphism amongst the accessions and mutants. Marker derived from ISSR profiling is a powerful method for identification and molecular classification of Jatropha from accession to generated mutant varieties. (author)

  4. Identification of Novel Aldose Reductase Inhibitors from Spices: A Molecular Docking and Simulation Study.

    Directory of Open Access Journals (Sweden)

    Priya Antony

    Full Text Available Hyperglycemia in diabetic patients results in a diverse range of complications such as diabetic retinopathy, neuropathy, nephropathy and cardiovascular diseases. The role of aldose reductase (AR, the key enzyme in the polyol pathway, in these complications is well established. Due to notable side-effects of several drugs, phytochemicals as an alternative has gained considerable importance for the treatment of several ailments. In order to evaluate the inhibitory effects of dietary spices on AR, a collection of phytochemicals were identified from Zingiber officinale (ginger, Curcuma longa (turmeric Allium sativum (garlic and Trigonella foenum graecum (fenugreek. Molecular docking was performed for lead identification and molecular dynamics simulations were performed to study the dynamic behaviour of these protein-ligand interactions. Gingerenones A, B and C, lariciresinol, quercetin and calebin A from these spices exhibited high docking score, binding affinity and sustained protein-ligand interactions. Rescoring of protein ligand interactions at the end of MD simulations produced binding scores that were better than the initially docked conformations. Docking results, ligand interactions and ADMET properties of these molecules were significantly better than commercially available AR inhibitors like epalrestat, sorbinil and ranirestat. Thus, these natural molecules could be potent AR inhibitors.

  5. Molecular identification of Cryptosporidium spp. in seagulls, pigeons, dogs, and cats in Thailand.

    Science.gov (United States)

    Koompapong, Khuanchai; Mori, Hirotake; Thammasonthijarern, Nipa; Prasertbun, Rapeepun; Pintong, Ai-rada; Popruk, Supaluk; Rojekittikhun, Wichit; Chaisiri, Kittipong; Sukthana, Yaowalark; Mahittikorn, Aongart

    2014-01-01

    Zoonotic Cryptosporidium spp., particularly C. meleagridis, C. canis, and C. felis, are enteric protozoa responsible for major public health concerns around the world. To determine the spread of this parasite in Thailand, we conducted molecular identification of Cryptosporidium spp. from animal samples around the country, by collecting and investigating the feces of seagulls (Chroicocephalus brunnicephalus and Chroicocephalus ridibundus), domestic pigeons (Columba livia domestica), dogs, and cats. Seagull and pigeon samples were collected at the seaside and on the riverside to evaluate their potential for waterborne transmission. Ten pigeon samples were combined into one set, and a total of seven sets were collected. Seventy seagull samples were combined into one set, and a total of 13 sets were collected. In addition, 111 dog samples were collected from cattle farms, and 95 dog and 80 cat samples were collected from a temple. We identified C. meleagridis in pigeons, Cryptosporidium avian genotype III in seagulls, C. canis in dogs, and C. felis in cats. In the temple, the prevalence was 2.1% (2/95) for dogs and 2.5% (2/80) for cats. No Cryptosporidium was found in dog samples from cattle farms. These are the first findings of C. meleagridis in domestic pigeons, and Cryptosporidium avian genotype III in seagulls. Our study invites further molecular epidemiological investigations of Cryptosporidium in these animals and their environment to evaluate the public health risk in Thailand. K. Koompapong et al., published by EDP Sciences, 2014

  6. Molecular identification of Cryptosporidium spp. in seagulls, pigeons, dogs, and cats in Thailand

    Directory of Open Access Journals (Sweden)

    Koompapong Khuanchai

    2014-01-01

    Full Text Available Zoonotic Cryptosporidium spp., particularly C. meleagridis, C. canis, and C. felis, are enteric protozoa responsible for major public health concerns around the world. To determine the spread of this parasite in Thailand, we conducted molecular identification of Cryptosporidium spp. from animal samples around the country, by collecting and investigating the feces of seagulls (Chroicocephalus brunnicephalus and Chroicocephalus ridibundus, domestic pigeons (Columba livia domestica, dogs, and cats. Seagull and pigeon samples were collected at the seaside and on the riverside to evaluate their potential for waterborne transmission. Ten pigeon samples were combined into one set, and a total of seven sets were collected. Seventy seagull samples were combined into one set, and a total of 13 sets were collected. In addition, 111 dog samples were collected from cattle farms, and 95 dog and 80 cat samples were collected from a temple. We identified C. meleagridis in pigeons, Cryptosporidium avian genotype III in seagulls, C. canis in dogs, and C. felis in cats. In the temple, the prevalence was 2.1% (2/95 for dogs and 2.5% (2/80 for cats. No Cryptosporidium was found in dog samples from cattle farms. These are the first findings of C. meleagridis in domestic pigeons, and Cryptosporidium avian genotype III in seagulls. Our study invites further molecular epidemiological investigations of Cryptosporidium in these animals and their environment to evaluate the public health risk in Thailand.

  7. Molecular identification of black-pigmented bacteria from subgingival samples of cats suffering from periodontal disease.

    Science.gov (United States)

    Pérez-Salcedo, L; Laguna, E; Sánchez, M C; Marín, M J; O'Connor, A; González, I; Sanz, M; Herrera, D

    2015-04-01

    To characterise the black-pigmented bacterial species found in the subgingival samples of cats with periodontal disease using molecular-based microbiological techniques. Sixty-five subgingival samples obtained from 50 cats with periodontal disease were analysed by polymerase chain reaction amplified ribosomal DNA restriction analysis and cloning and sequencing of the 16S rRNA genes. Among the 65 subgingival samples, eight phylogenetic profiles were obtained, of which the most prevalent species were: Porphyromonas gulae (40%), P. gingivalis/P. gulae (36 · 9%), P. gulae/Porphyromonas sp. UQD 406 (9 · 2%), Odoribacter denticanis (6 · 2%), P. gulae/Porphyromonas sp. UQD 348 (1 · 5%) and P. circumdentaria (1 · 5%). When compared with the species resulting from biochemical diagnosis, the identification of P. gulae was congruent in 70% of the cases, while colonies identified as P. intermedia-like corresponded in 80% of cases to P. gulae. The use of molecular-based microbiological diagnostic techniques resulted in a predominance of Porphyromonas spp. in the subgingival plaque of cats suffering from periodontal disease. Further characterisation of these bacteria identified P. gulae, O. denticanis and P. circumdentaria. The more frequently detected phylogenetic profiles corresponded to P. gingivalis and P. gulae. © 2015 British Small Animal Veterinary Association.

  8. Identification of Novel Aldose Reductase Inhibitors from Spices: A Molecular Docking and Simulation Study.

    Science.gov (United States)

    Antony, Priya; Vijayan, Ranjit

    2015-01-01

    Hyperglycemia in diabetic patients results in a diverse range of complications such as diabetic retinopathy, neuropathy, nephropathy and cardiovascular diseases. The role of aldose reductase (AR), the key enzyme in the polyol pathway, in these complications is well established. Due to notable side-effects of several drugs, phytochemicals as an alternative has gained considerable importance for the treatment of several ailments. In order to evaluate the inhibitory effects of dietary spices on AR, a collection of phytochemicals were identified from Zingiber officinale (ginger), Curcuma longa (turmeric) Allium sativum (garlic) and Trigonella foenum graecum (fenugreek). Molecular docking was performed for lead identification and molecular dynamics simulations were performed to study the dynamic behaviour of these protein-ligand interactions. Gingerenones A, B and C, lariciresinol, quercetin and calebin A from these spices exhibited high docking score, binding affinity and sustained protein-ligand interactions. Rescoring of protein ligand interactions at the end of MD simulations produced binding scores that were better than the initially docked conformations. Docking results, ligand interactions and ADMET properties of these molecules were significantly better than commercially available AR inhibitors like epalrestat, sorbinil and ranirestat. Thus, these natural molecules could be potent AR inhibitors.

  9. Morphological, molecular, and mycotoxigenic identification of dominant filamentous fungi from moldy civil cheese.

    Science.gov (United States)

    Cakmakci, Songul; Cetin, Bulent; Gurses, Mustafa; Dagdemir, Elif; Hayaloglu, Ali Adnan

    2012-11-01

    Moldy Civil is a mold-ripened variety of cheese produced mainly in eastern Turkey. This cheese is produced with Civil cheese and whey curd cheese (Lor). Civil cheese has had a geographical presence since 2009 and is manufactured with skim milk. In the production of Moldy Civil cheese, Civil cheese or a mixture of Civil and Lor cheese is pressed into goat skins or plastic bags and ripened for 3 months or longer. During the ripening period, natural contaminating molds grow on the surface of and inside the cheese. In this study, 186 mold strains were isolated from 41 samples of Moldy Civil cheese, and 165 of these strains were identified as Penicillium roqueforti. Identification and mycotoxicologic analyses were conducted using morphotypic and molecular methods. PCR amplicons of the ITS1-5.8S-ITS4 region were subjected to sequence analysis. This research is the first using molecular methods on Moldy Civil cheese. Mycotoxicologic analyses were conducted using thin-layer chromatography, and random amplified polymorphic DNA genotypes were determined using the ari1 primer. Of 165 isolates, only 28 produced no penicillic acid, P. roqueforti toxin, or roquefortine.

  10. Identification of the sources of primary organic aerosols at urban schools: A molecular marker approach

    International Nuclear Information System (INIS)

    Crilley, Leigh R.; Qadir, Raeed M.; Ayoko, Godwin A.; Schnelle-Kreis, Jürgen; Abbaszade, Gülcin; Orasche, Jürgen; Zimmermann, Ralf; Morawska, Lidia

    2014-01-01

    Children are particularly susceptible to air pollution and schools are examples of urban microenvironments that can account for a large portion of children's exposure to airborne particles. Thus this paper aimed to determine the sources of primary airborne particles that children are exposed to at school by analyzing selected organic molecular markers at 11 urban schools in Brisbane, Australia. Positive matrix factorization analysis identified four sources at the schools: vehicle emissions, biomass burning, meat cooking and plant wax emissions accounting for 45%, 29%, 16% and 7%, of the organic carbon respectively. Biomass burning peaked in winter due to prescribed burning of bushland around Brisbane. Overall, the results indicated that both local (traffic) and regional (biomass burning) sources of primary organic aerosols influence the levels of ambient particles that children are exposed at the schools. These results have implications for potential control strategies for mitigating exposure at schools. - Highlights: • Selected organic molecular markers at 11 urban schools were analyzed. • Four sources of primary organic aerosols were identified by PMF at the schools. • Both local and regional sources were found to influence exposure at the schools. • The results have implications for mitigation of children's exposure at schools. - The identification of the most important sources of primary organic aerosols at urban schools has implications for control strategies for mitigating children's exposure at schools

  11. Molecular identification of Giardia duodenalis isolates from domestic dogs and cats in Wroclaw, Poland.

    Science.gov (United States)

    Piekarska, Jolanta; Bajzert, Joanna; Gorczykowski, Michał; Kantyka, Magdalena; Podkowik, Magdalena

    2016-09-01

    Giardia duodenalis (G. intestinalis) is a common protozoan causing gastrointestinal disorders in many species of mammals. The genus of Giardia has high molecular diversity. Dogs and cats, in addition to their typical infection with assemblages C, D and F, may be a reservoir of zoonotic assemblages (A and B). The aim of this study was a genetic characteristic of Giardia isolates of dogs and cats from the area of Wroclaw (Poland). A total of 128 and 33 faecal samples from dogs and cats, respectively, were analyzed by routine coprological methods. The animals were diagnosed on the presence of G. duodenalis antigens in faeces soluble with the use of SNAP Giardia (IDEXX Laboratories) immunosorbent assay. 27 DNA isolates of Giardia were subjected to molecular identification (PCR-RFLP). The prevalence of G. duodenalis was 21.1% (27/128) in dogs and 15.1% (5/33) in cats. In dogs, C assemblage was present in 18 (81%) positive stool samples, D assemblage in 2 (9%) samples, B assemblage present in one (4.5%), and mixed assemblages (C and D) occurred in one (4.5%) sample. F assemblage was found in 4 (80%) cats' positive stool samples and A assemblage occurred in one case (20%). Confirmation of the presence of A and B zoonotic assemblages suggests that infected pets can be a threat to human health. This study describes for the first time the presence of mixed infections within host-specific C and D assemblages in dogs in Poland.

  12. Molecular detection and identification of Rickettsiales pathogens in dog ticks from Costa Rica.

    Science.gov (United States)

    Campos-Calderón, Liliana; Ábrego-Sánchez, Leyda; Solórzano-Morales, Antony; Alberti, Alberto; Tore, Gessica; Zobba, Rosanna; Jiménez-Rocha, Ana E; Dolz, Gaby

    2016-10-01

    Although vector-borne diseases are globally widespread with considerable impact on animal production and on public health, few reports document their presence in Central America. This study focuses on the detection and molecular identification of species belonging to selected bacterial genera (Ehrlichia, Anaplasma and Rickettsia) in ticks sampled from dogs in Costa Rica by targeting several genes: 16S rRNA/dsb genes for Ehrlichia; 16S rRNA/groEL genes for Anaplasma, and ompA/gltA/groEL genes for Rickettsia. PCR and sequence analyses provides evidences of Ehrlichia canis, Anaplasma platys, and Anaplasma phagocytophilum infection in Rhipicephalus sanguineus s.l ticks, and allow establishing the presence of Rickettsia monacensis in Ixodes boliviensis. Furthermore, the presence of recently discovered Mediterranean A. platys-like strains is reported for the first time in Central America. Results provide new background on geographical distribution of selected tick-transmitted bacterial pathogens in Costa Rica and on their molecular epidemiology, and are pivotal to the development of effective and reliable diagnostic tools in Central America. Copyright © 2016 Elsevier GmbH. All rights reserved.

  13. Molecular identification and phylogenetic analysis of Dipetalonema evansi (LEWIS, 1882) in camels (Camelus dromedarius) of Iran.

    Science.gov (United States)

    Sazmand, Alireza; Eigner, Barbara; Mirzaei, Mohammad; Hekmatimoghaddam, Seyedhossein; Harl, Josef; Duscher, Georg Gerhard; Fuehrer, Hans-Peter; Joachim, Anja

    2016-04-01

    Despite the economic importance of camels, the parasites that affect them have not received adequate attention so far and molecular studies are scarce compared to other livestock. In this study, we characterized peripheral blood microfilariae in 200 healthy one-humped camels (Camelus dromedarius) from south-east Iran by microscopy and molecular tools to receive a more detailed insight into prevalence and species that affect them. Moreover, adult specimens of the filarial nematode Dipetalonema evansi were collected from the carcass of an infected animal. Microscopic examination was performed on Giemsa-stained blood smears, and blood was also spotted on Whatman FTA(®) cards for DNA analysis. Genomic DNA was extracted, and PCR was carried out for the detection of filaroid helminths, followed by sequence analysis of positive samples. Four samples were positive for microfilariae by microscopy, while 16 animals (8 %) were positive by PCR. Sequence analysis revealed D. evansi in all cases. Phylogenetic analysis of a cytochrome C oxidase subunit I (COI) sequence of filaroid nematodes showed that most species in a single genus cluster in the same clade; however, D. evansi and D. gracile are not monophyletic and branch rather at the base of the tree. Further studies on the life cycle of D. evansi, specifically the identification of intermediate host(s), have become feasible with the provision of the first specific COI sequences in this study.

  14. Identification of Sex-determining Loci in Pacific White Shrimp Litopeneaus vannamei Using Linkage and Association Analysis.

    Science.gov (United States)

    Yu, Yang; Zhang, Xiaojun; Yuan, Jianbo; Wang, Quanchao; Li, Shihao; Huang, Hao; Li, Fuhua; Xiang, Jianhai

    2017-06-01

    The Pacific white shrimp Litopenaeus vannamei is a predominant aquaculture shrimp species in the world. Like other animals, the L. vannamei exhibited sexual dimorphism in growth trait. Mapping of the sex-determining locus will be very helpful to clarify the sex determination system and further benefit the shrimp aquaculture industry towards the production of mono-sex stocks. Based on the data used for high-density linkage map construction, linkage-mapping analysis was conducted. The sex determination region was mapped in linkage group (LG) 18. A large region from 0 to 21.205 cM in LG18 showed significant association with sex. However, none of the markers in this region showed complete association with sex in the other populations. So an association analysis was designed using the female parent, pool of female progenies, male parent, and pool of male progenies. Markers were de novo developed and those showing significant differences between female and male pools were identified. Among them, three sex-associated markers including one fully associated marker were identified. Integration of linkage and association analysis showed that the sex determination region was fine-mapped in a small region along LG18. The identified sex-associated marker can be used for the sex detection of this species at genetic level. The fine-mapped sex-determining region will contribute to the mapping of sex-determining gene and help to clarify sex determination system for L. vannamei.

  15. Model-based evaluation of the use of polycyclic aromatic hydrocarbons molecular diagnostic ratios as a source identification tool

    International Nuclear Information System (INIS)

    Katsoyiannis, Athanasios; Breivik, Knut

    2014-01-01

    Polycyclic Aromatic Hydrocarbons (PAHs) molecular diagnostic ratios (MDRs) are unitless concentration ratios of pair-PAHs with the same molecular weight (MW); MDRs have long been used as a tool for PAHs source identification purposes. In the present paper, the efficiency of the MDR methodology is evaluated through the use of a multimedia fate model, the calculation of characteristic travel distances (CTD) and the estimation of air concentrations for individual PAHs as a function of distance from an initial point source. The results show that PAHs with the same MW are sometimes characterized by substantially different CTDs and therefore their air concentrations and hence MDRs are predicted to change as the distance from the original source increases. From the assessed pair-PAHs, the biggest CTD difference is seen for Fluoranthene (107 km) vs. Pyrene (26 km). This study provides a strong indication that MDRs are of limited use as a source identification tool. -- Highlights: • Model-based evaluation of the PAHs molecular diagnostic ratios efficiency. • Individual PAHs are characterized by different characteristic travel distances. • MDRs are proven to be a limited tool for source identification. • Use of MDRs for other environmental media is likely unfeasible. -- PAHs molecular diagnostic ratios which change greatly as a function of distance from the emitting source are improper for source identification purposes

  16. Prenatal Immune Challenge in Mice Leads to Partly Sex-Dependent Behavioral, Microglial, and Molecular Abnormalities Associated with Schizophrenia

    Directory of Open Access Journals (Sweden)

    Chin W. Hui

    2018-02-01

    Full Text Available Epidemiological studies revealed that environmental factors comprising prenatal infection are strongly linked to risk for later development of neuropsychiatric disorders such as schizophrenia. Considering strong sex differences in schizophrenia and its increased prevalence in males, we designed a methodological approach to investigate possible sex differences in pathophysiological mechanisms. Prenatal immune challenge was modeled by systemic administration of the viral mimic polyinosinic-polycytidylic acid (Poly I:C to C57BL/6 mice at embryonic day 9.5. The consequences on behavior, gene expression, and microglia—brain immune cells that are critical for normal development—were characterized in male vs. female offspring at adulthood. The cerebral cortex, hippocampus, and cerebellum, regions where structural and functional alterations were mainly described in schizophrenia patients, were selected for cellular and molecular analyses. Confocal and electron microscopy revealed most pronounced differences in microglial distribution, arborization, cellular stress, and synaptic interactions in the hippocampus of male vs. female offspring exposed to Poly I:C. Sex differences in microglia were also measured under both steady-state and Poly I:C conditions. These microglial alterations were accompanied by behavioral impairment, affecting for instance sensorimotor gating, in males. Consistent with these results, increased expression of genes related to inflammation was measured in cerebral cortex and hippocampus of males challenged with Poly I:C. Overall, these findings suggest that schizophrenia's higher incidence in males might be associated, among other mechanisms, with an increased microglial reactivity to prenatal immune challenges, hence determining disease outcomes into adulthood.

  17. Molecular identification of Lutzomyia migonei (Diptera: Psychodidae) as a potential vector for Leishmania infantum (Kinetoplastida: Trypanosomatidae).

    Science.gov (United States)

    Rodrigues, Ana Caroline Moura; Melo, Luciana Magalhães; Magalhães, Rafaela Damasceno; de Moraes, Nélio Batista; de Souza Júnior, Antônio Domingos; Bevilaqua, Claudia Maria Leal

    2016-04-15

    Visceral leishmaniasis (VL) in Brazil is caused by the protozoan Leishmania infantum. This parasite is transmitted by the bite of a female sand fly. The most important sand fly species in VL transmission is Lutzomyia longipalpis. In Fortaleza, the capital of Ceará State, Brazil, the simultaneous occurrence of Lutzomyia migonei and L. longipalpis was detected in localities where VL transmission is observed. The purpose of this study was to determine conclusively if L. migonei can be found naturally infected with L. infantum in key focus in Fortaleza. Using a CDC traps we performed phlebotomine capture during one year. External morphological features and qPCR targeting species-specific gene sequences of Lutzomyia species were used to identify the female phlebotomine sand flies. The molecular identification of the Leishmania species was performed using qPCR targeting species-specific gene sequences of L. infantum and Leishmania braziliensis. The males L. migonei abundance was higher in the rainy season. Humidity and rainfall positively correlated with males L. migonei abundance, while temperature showed a negative correlation. The correlation between the density of L. migonei female with rainfall, relative air humidity, and temperature were not statistically significant. According to the molecular data produced by qPCR amplifications, three positive sand flies were identified as L. longipalpis, and one was identified as L. migonei. The infection rate was 0.35% and 0.18%, respectively. The parasite load was 32,492±2572 L. infantum in L. migonei while the L. longipalpis had parasite loads between 2,444,964.6±116,000 and 6,287,130±124,277. Our findings confirm L. migonei as a potential vector of VL in Fortaleza at a molecular level. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Isolation and Molecular Identification of Some Blue-Green Algae (Cyanobacteria from Freshwater Sites in Tokat Province of Turkey

    Directory of Open Access Journals (Sweden)

    Tunay Karan

    2017-11-01

    Full Text Available Collected blue-green algae (cyanobacteria from freshwater sites throughout Tokat province and its outlying areas were isolated in laboratory environment and their morphological systematics were determined and also their species identifications were studied by molecular methods. Seven different species of blue-green algae collected from seven different sites were isolated by purifying in cultures in laboratory environment. DNA extractions were made from isolated cells and extracted DNAs were amplified by using PCR. Cyanobacteria specific primers were used to amplify 16S rRNA and phycocyanine gene regions using PCR. Phylogenetic identification of species were conducted by evaluation of obtained sequence analysis data by using computer software. According to species identification by sequence analysis, it was seen that molecular data supports morphological systematics.

  19. Variation, sex, and social cooperation: molecular population genetics of the social amoeba Dictyostelium discoideum.

    Directory of Open Access Journals (Sweden)

    Jonathan M Flowers

    2010-07-01

    Full Text Available Dictyostelium discoideum is a eukaryotic microbial model system for multicellular development, cell-cell signaling, and social behavior. Key models of social evolution require an understanding of genetic relationships between individuals across the genome or possibly at specific genes, but the nature of variation within D. discoideum is largely unknown. We re-sequenced 137 gene fragments in wild North American strains of D. discoideum and examined the levels and patterns of nucleotide variation in this social microbial species. We observe surprisingly low levels of nucleotide variation in D. discoideum across these strains, with a mean nucleotide diversity (pi of 0.08%, and no strong population stratification among North American strains. We also do not find any clear relationship between nucleotide divergence between strains and levels of social dominance and kin discrimination. Kin discrimination experiments, however, show that strains collected from the same location show greater ability to distinguish self from non-self than do strains from different geographic areas. This suggests that a greater ability to recognize self versus non-self may arise among strains that are more likely to encounter each other in nature, which would lead to preferential formation of fruiting bodies with clonemates and may prevent the evolution of cheating behaviors within D. discoideum populations. Finally, despite the fact that sex has rarely been observed in this species, we document a rapid decay of linkage disequilibrium between SNPs, the presence of recombinant genotypes among natural strains, and high estimates of the population recombination parameter rho. The SNP data indicate that recombination is widespread within D. discoideum and that sex as a form of social interaction is likely to be an important aspect of the life cycle.

  20. National, regional, and global sex ratios of infant, child, and under-5 mortality and identification of countries with outlying ratios: a systematic assessment.

    Science.gov (United States)

    Alkema, Leontine; Chao, Fengqing; You, Danzhen; Pedersen, Jon; Sawyer, Cheryl C

    2014-09-01

    Under natural circumstances, the sex ratio of male to female mortality up to the age of 5 years is greater than one but sex discrimination can change sex ratios. The estimation of mortality by sex and identification of countries with outlying levels is challenging because of issues with data availability and quality, and because sex ratios might vary naturally based on differences in mortality levels and associated cause of death distributions. For this systematic analysis, we estimated country-specific mortality sex ratios for infants, children aged 1-4 years, and children under the age of 5 years (under 5s) for all countries from 1990 (or the earliest year of data collection) to 2012 using a Bayesian hierarchical time series model, accounting for various data quality issues and assessing the uncertainty in sex ratios. We simultaneously estimated the global relation between sex ratios and mortality levels and constructed estimates of expected and excess female mortality rates to identify countries with outlying sex ratios. Global sex ratios in 2012 were 1·13 (90% uncertainty interval 1·12-1·15) for infants, 0·95 (0·93-0·97) for children aged 1-5 years, and 1·08 (1·07-1·09) for under 5s, an increase since 1990 of 0·01 (-0·01 to 0·02) for infants, 0·04 (0·02 to 0·06) for children aged 1-4 years, and 0·02 (0·01 to 0·04) for under 5s. Levels and trends varied across regions and countries. Sex ratios were lowest in southern Asia for 1990 and 2012 for all age groups. Highest sex ratios were seen in developed regions and the Caucasus and central Asia region. Decreasing mortality was associated with increasing sex ratios, except at very low infant mortality, where sex ratios decreased with total mortality. For 2012, we identified 15 countries with outlying under-5 sex ratios, of which ten countries had female mortality higher than expected (Afghanistan, Bahrain, Bangladesh, China, Egypt, India, Iran, Jordan, Nepal, and Pakistan). Although excess female

  1. Iris colour as an indicator of age feature in female Brazilian tanagers (Passeriformes: Emberizidae confirmed by a molecular sexing technique

    Directory of Open Access Journals (Sweden)

    Denise Monnerat Nogueira

    2008-12-01

    Full Text Available The Brazilian tanager, Ramphocelus bresilius is an endemic species from Brazil that is sexually dimorphic in adult plumage. Young males are similar to adult and young females until their second year. Adults and young females are not distinguishable in plumage. We tested whether iris colour can be used to separate adult females from immature females. We used for the first time the molecular sexing technique based on CHD-genes to confirm the sex of the individuals classified as "female plumage with red iris", and to identify the sex of individuals classified as "female plumage and brown iris". The adult males were used as a positive control. DNA samples from 190 individuals were analysed. The sizes of the PCR products were identified as 350 base pairs (bp for CHD-Z and 388 bp for CHD-W. We confirmed that adult females have a red iris and the young females a brown iris. We could also separate young males and females which present the same iris colour and plumage. Although there are indications that the iris colour can be used by birds to identify the adults in co-operative breeding species such as the Brazilian tanager, more behavioural data are required to understand the role of iris coloration in this species. Rev. Biol. Trop. 56 (4: 1629-1633. Epub 2008 December 12.El ave Ramphocelus bresilius es una especie endémica de Brasil con dimorfismo sexual en el plumaje del adulto. Los machos jóvenes son similares a las hembras adultas y jóvenes hasta el segundo año de vida. Adultos y hembras jóvenes son indistinguibles por el plumaje. Evaluamos si el color del iris puede ser utilizado para distinguir hembras adultas de hembras inmaduras. Utilizamos por primera vez la técnica molecular de identificación de sexos basada en los genes CHD para confirmar el género de individuos clasificados como plumaje femenino con iris rojo, y para identificar el sexo de los individuos clasificados como plumaje femenino e iris marrón. Usamos machos adultos como

  2. IDENTIFICATION OF PARAMECIUM BURSARIA SYNGENS THROUGH MOLECULAR MARKERS – COMPARATIVE ANALYSIS OF MITOCHONDRIAL CYTOCHROME C OXIDASE SUBUNIT I (COI

    Directory of Open Access Journals (Sweden)

    Patrycja Zagata

    2014-08-01

    Full Text Available The aim of this study is an identification of Paramecium bursaria syngens originating from different geographical locations and proving the correlation between distributions and belonging to any of five syngens. Ten strains of Paramecium bursaria belonging to five different syngens and strain of Paramecium multimicronucleatum were investigated using molecular marker — mitochondrial cytochrome c oxidase subunit I (COI. According to results, obtained in this study, using phylogenetic methods like Neighbor Joining (NJ and Maximum Likelihood (ML, relationship between analyzing strains through their clustering in clusters and correlation between strains belonging to any syngen and syngen’s distribution was confirmed. Phylograms constructed using NJ and ML methods revealed strains’ grouping in five clusters. Results which were obtained revealed usefulness of COI as a biomarker, which is important in identification of Paramecium bursaria syngens. This reports to a great potential of COI as a molecular marker and obtaining dependable results through combination of molecular methods with classical ones.

  3. Identification of HNPCC by Molecular Analysis of Colorectal and Endometrial Tumors

    Directory of Open Access Journals (Sweden)

    H. F. A. Vasen

    2004-01-01

    Full Text Available Hereditary nonpolyposis colorectal cancer (HNPCC, Lynch syndrome is a dominantly inherited syndrome characterized by the development of colorectal cancer, endometrial cancer and other cancers and the presence of microsatellite instability (MSI in tumors. The Bethesda guidelines have been proposed for the identification of families suspected of HNPCC that require further molecular analysis. We have evaluated the yield of MSI-analysis in a large series of Dutch families suspected of HNPCC. We also analysed whether the loss of mismatch repair (MMR protein detected by immunohistochemistry (IHC of colorectal cancer (CRC and endometrial cancer correlated with the presence of MSI and/or a MMR gene mutation. The results showed that the Bethesda criteria with a few modifications are appropriate to identify families eligible for genetic testing. In addition, we found that MSI and IHC-analysis of CRC using antibodies against MLH1, MSH2, MSH6 and PMS2 proteins are equally effective for identifying carriers of the known MMR gene defects. However, as long as the role of other putative MMR genes in hereditary CRC has not been elucidated, IHC-analysis cannot completely replace MSI. For this reason, we prefer MSI-analysis as first step in families suspected of HNPCC. On the other hand, in families fulfilling the revised Amsterdam criteria in which the probability of detecting a mutation is relatively high, we would recommend IHC as first diagnostic step because the result might predict the specific underlying MMR gene mutation. MSI or IHC-analysis of endometrial cancer alone was found to be less sensitive compared with these tests performed in colorectal cancer. Therefore, probably the best approach in the analysis of this cancer is to perform both techniques. The identification of HNPCC is important as it makes it possible to target effective preventative measures. Our studies showed that MSI and IHC analysis of colorectal and endometrial cancer, are reliable

  4. Molecular status of human immunodeficiency virus, hepatitis B virus, and hepatitis C virus among transgender commercial sex workers in Surakarta, Indonesia

    Science.gov (United States)

    Prasetyo, Afiono Agung; Sari, Yulia; Dharmawan, Ruben; Marwoto

    2017-02-01

    Sexual contact and other risk behavior among transgender working as commercial sex workers are important factors for sexual and blood-borne virus (BBV) infections. However, there no data concerning the molecular status of human immunodeficiency virus (HIV), hepatitis B virus (HBV) and hepatitis C virus (HCV) circulated among transgender working as commercial sex workers. Blood samples obtained from transgender working as commercial sex workers in Surakarta were examined for HIV antibodies, HBsAg and HCV antibodies, respectively, by immunological assays. All blood samples were also subjected for viral nucleic acid extraction and molecular detection of HIV, HBV and HCV by nested RT-PCR. The PCR products were purified from agarose gels, and the nucleotide sequences were retrieved and molecular analyzed. HIV, HBV and HCV was detected in 26.9% (7/26), 19.2% (5/26) and 46.2% (12/26), respectively. HIV CRF01_AE and B were found to be circulating in the community. HBV genotype B3 predominated, followed by C1. HCV genotype 1a predominated among HCV-infected transgender working as commercial sex workers, followed by 1c, 3a, and 4a. HIV, HBV, and HCV were found circulating in the transgender working as commercial sex workers in Surakarta, Indonesia.

  5. Thermal parameter identification for non-Fourier heat transfer from molecular dynamics

    Science.gov (United States)

    Singh, Amit; Tadmor, Ellad B.

    2015-10-01

    Fourier's law leads to a diffusive model of heat transfer in which a thermal signal propagates infinitely fast and the only material parameter is the thermal conductivity. In micro- and nano-scale systems, non-Fourier effects involving coupled diffusion and wavelike propagation of heat can become important. An extension of Fourier's law to account for such effects leads to a Jeffreys-type model for heat transfer with two relaxation times. We propose a new Thermal Parameter Identification (TPI) method for obtaining the Jeffreys-type thermal parameters from molecular dynamics simulations. The TPI method makes use of a nonlinear regression-based approach for obtaining the coefficients in analytical expressions for cosine and sine-weighted averages of temperature and heat flux over the length of the system. The method is applied to argon nanobeams over a range of temperature and system sizes. The results for thermal conductivity are found to be in good agreement with standard Green-Kubo and direct method calculations. The TPI method is more efficient for systems with high diffusivity and has the advantage, that unlike the direct method, it is free from the influence of thermostats. In addition, the method provides the thermal relaxation times for argon. Using the determined parameters, the Jeffreys-type model is able to reproduce the molecular dynamics results for a short-duration heat pulse where wavelike propagation of heat is observed thereby confirming the existence of second sound in argon. An implementation of the TPI method in MATLAB is available as part of the online supplementary material.

  6. Molecular identification and characterization of Rhizoctonia solani AG-3 isolates causing black scurf of potato

    International Nuclear Information System (INIS)

    Zaidy, M.E.; Othman, M.R.; Mahmoud, M.

    2018-01-01

    Twenty-six isolates of Rhizoctonia solani AG-3 were collected from four potato growing area of Saudi Arabia. Yield damages due to this infection is reported to range from 7-64% (average of 35%), depending on many factors. Molecular identification of R. solani AG-3 isolates by ITS-regions and characterization was done by inter simple sequence repeat (ISSR) markers. Twenty-six isolates of R. solani used in the current study were isolated from potato fields in four major potato-producing regions of Saudi Arabia. All isolates were inoculated on potato and observations on the percentage of disease incidence were recorded. Genomic DNA extraction of R. solani AG-3 isolates was used by A specific and sensitive PCR and ISSR primers. A single splinter of nearly 500 bp was only amplified once genomic DNA from R. solani AG-3 isolates. Amplicon size of three ISSR primers ranged from 0.3 to 2.8 Kb in isolates. Using the three primers, the tested isolates were separated on the basis of genetic similarity coefficients (GSC). The range of the GSC was beginning at 0.62 and ending at 1.00. In unweighted pair-group method arithmetic averages (UPGMA) analysis, the R. solani isolates grouped into five clusters. The present method provided rapid and reliable detection of R. solani AG-3 isolates. Molecular characterization have great genetic variation in the R. solani AG-3 population, without any correlation between aggressiveness, geographical regions and genetic variation based on ISSR markers. (author)

  7. Molecular identification of Malaysian Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) using life stage specific mitochondrial DNA.

    Science.gov (United States)

    Kavitha, R; Tan, T C; Lee, H L; Nazni, W A; Sofian, A M

    2013-06-01

    DNA identification of blow fly species can be a very useful tool in forensic entomology. One of the potential benefits that mitochondrial DNA (mtDNA) has offered in the field of forensic entomology is species determination. Conventional identification methods have limitations for sibling and closely related species of blow fly and stage and quality of the specimen used. This could be overcome by DNA-based identification methods using mitochondrial DNA which does not demand intact or undamaged specimens. Mitochondrial DNA is usually isolated from whole blow fly and legs. Alternate sources for mitochondrial DNA isolation namely, egg, larva, puparium and empty puparium were explored in this study. The sequence of DNA obtained for each sample for every life cycle stage was 100% identical for a particular species, indicating that the egg, 1st instar, 2nd instar, 3rd instar, pupa, empty puparium and adult from the same species and obtained from same generation will exhibit similar DNA sequences. The present study also highlighted the usefulness of collecting all life cycle stages of blow fly during crime scene investigation with proper preservation and subsequent molecular analysis. Molecular identification provides a strong basis for species identification and will prove an invaluable contribution to forensic entomology as an investigative tool in Malaysia.

  8. Isolation and identification of Salmonella spp. in environmental water by molecular technology in Taiwan

    Science.gov (United States)

    Kuo, Chun Wei; Hao Huang, Kuan; Hsu, Bing Mu; Tsai, Hsien Lung; Tseng, Shao Feng; Shen, Tsung Yu; Kao, Po Min; Shen, Shu Min; Chen, Jung Sheng

    2013-04-01

    Salmonella spp. is one of the most important causal agents of waterborne diseases. The taxonomy of Salmonella is very complicated and its genus comprises more than 2,500 serotypes. The detection of Salmonella in environmental water samples by routines culture methods using selective media and characterization of suspicious colonies based on biochemical tests and serological assay are generally time consuming. To overcome this drawback, it is desirable to use effective method which provides a higher discrimination and more rapid identification about Salmonella in environmental water. The aim of this study is to investigate the occurrence of Salmonella using molecular technology and to identify the serovars of Salmonella isolates from 70 environmental water samples in Taiwan. The analytical procedures include membrane filtration, non-selective pre-enrichment, selective enrichment of Salmonella. After that, we isolated Salmonella strains by selective culture plates. Both selective enrichment and culture plates were detected by Polymerase Chain Reaction (PCR). Finally, the serovars of Salmonella were confirmed by using biochemical tests and serological assay. In this study, 15 water samples (21.4%) were identified as Salmonella by PCR. The positive water samples will further identify their serotypes by culture method. The presence of Salmonella in environmental water indicates the possibility of waterborne transmission in drinking watershed. Consequently, the authorities need to provide sufficient source protection and to maintain the system for disease prevention. Keywords: Salmonella spp., serological assay, PCR

  9. Optimal identification of semi-rigid domains in macromolecules from molecular dynamics simulation.

    Directory of Open Access Journals (Sweden)

    Stefan Bernhard

    Full Text Available Biological function relies on the fact that biomolecules can switch between different conformations and aggregation states. Such transitions involve a rearrangement of parts of the biomolecules involved that act as dynamic domains. The reliable identification of such domains is thus a key problem in biophysics. In this work we present a method to identify semi-rigid domains based on dynamical data that can be obtained from molecular dynamics simulations or experiments. To this end the average inter-atomic distance-deviations are computed. The resulting matrix is then clustered by a constrained quadratic optimization problem. The reliability and performance of the method are demonstrated for two artificial peptides. Furthermore we correlate the mechanical properties with biological malfunction in three variants of amyloidogenic transthyretin protein, where the method reveals that a pathological mutation destabilizes the natural dimer structure of the protein. Finally the method is used to identify functional domains of the GroEL-GroES chaperone, thus illustrating the efficiency of the method for large biomolecular machines.

  10. Identification of fine-leaved species of genus Festuca by molecular methods

    International Nuclear Information System (INIS)

    Stukonis, V.; Armoniene, R.; Kemesyte, V.

    2015-01-01

    Festuca (L.) is a taxonomically complex genus of family Poaceae. The fine-leaved species of fescue are well adapted to grow in sandy and dry habitats, therefore, they can be used for establishment of lawns of minimal maintenance as well as recultivations of damaged soils. Breeding for the new varieties to meet these purposes requires reliable methods for identification of the species. The discrimination of fine-leaved fescue species based on morphological features is rather difficult, therefore reliable molecular marker would greatly facilitate it and eliminate the need to wait till floral organs are fully formed. Seven fine-leaved species of genus Festuca collected in Lithuania, namely, F. ovina, F. trachyphylla, F. polesica, F. psammophila, F. sabulosa, F. pseudovina and F. wolgensis were investigated at the Institute of Agriculture, Lithuanian Research Centre for Agriculture and Forestry. The ISSR markers, seed storage proteins and isozymes were tested for their ability to distinguish between the fine-leaved species of the genus Festuca. Seed storage protein and ISSR fingerprint profiles could be used to distinguish between fine-leaved species of Festuca, except for closely related F. sabulosa and F. polesica species. Isozyme fingerprints did not contain sufficient number of species specific bands and were not feasible to discriminate between species. (author)

  11. Molecular identification and artificial cultivation of a wild isolate of oyster mushroom in Albania

    Directory of Open Access Journals (Sweden)

    Jordan Merkuri

    2016-03-01

    Full Text Available Basidiomata of a wild mushroom macroscopically recognised as Pleurotus ostreatus were observed on an oak trunk in a mixed wood of northern Albania. Pure cultures of the fungus were then obtained on potato-dextrose-agar medium. Molecular analyses of genomic DNA of the fungus confirmed its identification. The rDNA ITS region nucleotide sequence of the studied Pleurotacea matched at 99% those of two P. ostreatus strains already present in NCBI GenBank database. The rDNA ITS nucelotide sequences of two pure cultures of the Albanian P. ostreatus were deposited in EMBL database under the accession numbers LN849458 and LN849459. One of the fungus isolates was subsequently cultivated under protected and semi-natural conditions. Productivity and biological efficiency of the Albanian P. ostreatus ranged from about 10% to 16% and from 33 to 53.33%, respectively. This seems to be the first report on the artificial cultivation of P. ostreatus in Albania and could have, in the next future, a high economic impact on development and diffusion of this important edible mushroom over the country.

  12. Molecular identification, phylogeny and geographic distribution of Brazilian mangrove oysters (Crassostrea

    Directory of Open Access Journals (Sweden)

    Aline Grasielle Costa de Melo

    2010-01-01

    Full Text Available Oysters (Ostreidae manifest a high degree of phenotypic plasticity, whereby morphology is of limited value for species identification and taxonomy. By using molecular data, the aim was to genetically characterize the species of Crassostrea occurring along the Brazilian coast, and phylogenetically relate these to other Crassostrea from different parts of the world. Sequencing of the partial cytochrome oxidase c subunit I gene (COI, revealed a total of three species of Crassostrea at 16 locations along the Brazilian coast. C. gasar was found from Curuçá (Pará state to Santos (São Paulo state, and C. rhizophorae from Fortim (Ceará state to Florianópolis (Santa Catarina state, although small individuals of the latter species were also found at Ajuruteua beach (municipality of Bragança, Pará state. An unidentified Crassostrea species was found only on Canela Island, Bragança. Crassostrea gasar and C. rhizophorae grouped with C. virginica, thereby forming a monophyletic Atlantic group, whereas Crassostrea sp. from Canela Island was shown to be more similar to Indo-Pacific oysters, and either arrived in the Atlantic Ocean before the convergence of the Isthmus of Panama or was accidentally brought to Brazil by ship.

  13. Molecular identification, phylogeny and geographic distribution of Brazilian mangrove oysters (Crassostrea)

    Science.gov (United States)

    2010-01-01

    Oysters (Ostreidae) manifest a high degree of phenotypic plasticity, whereby morphology is of limited value for species identification and taxonomy. By using molecular data, the aim was to genetically characterize the species of Crassostrea occurring along the Brazilian coast, and phylogenetically relate these to other Crassostrea from different parts of the world. Sequencing of the partial cytochrome oxidase c subunit I gene (COI), revealed a total of three species of Crassostrea at 16 locations along the Brazilian coast. C. gasar was found from Curuçá (Pará state) to Santos (São Paulo state), and C. rhizophorae from Fortim (Ceará state) to Florianópolis (Santa Catarina state), although small individuals of the latter species were also found at Ajuruteua beach (municipality of Bragança, Pará state). An unidentified Crassostrea species was found only on Canela Island, Bragança. Crassostrea gasar and C. rhizophorae grouped with C. virginica, thereby forming a monophyletic Atlantic group, whereas Crassostrea sp. from Canela Island was shown to be more similar to Indo-Pacific oysters, and either arrived in the Atlantic Ocean before the convergence of the Isthmus of Panama or was accidentally brought to Brazil by ship. PMID:21637433

  14. Isotopic diagnosis and molecular identification of cucumber mosaic virus and satellite RNA infecting tomato in Shanghai

    International Nuclear Information System (INIS)

    Zhang Huarong; Du Zhiyou; Liao Qiansheng; Zhang Hen

    2006-01-01

    In summer of 2004 and 2005, typical viral disease symptoms were found on field tomato from Shanghai, which remarkably reduced the yield of tomato. Total RNA of tomato leaves and purified virions were detected by hybridization with 32 P probes conducted with partial sequence of CMV RNA3 and full cDNA of CMV satRNA. Viruses were also confirmed by analyzing dsRNA extracted from tomato leaves. Full sequence of CMV RNA3 was gained by RT-PCR and the result of sequencing indicated that genomic RNA3 belongs to subgroup II. Two 15nt complementary ssDNA as amplification primers. Phylogenetic analysis showed that the identity of this 383nt satellite and some documented satRNAs was 72.6 to 99.5% at the nucleotide level. Several mutation sites were found at the 3' terminus of the newly discovered satRNA. By Isotopic diagnosis and molecular Identification, variation of CMV and its satRNA were found in Tomato from Shanghai, Which may influence the viral disease prevalence and the emergence of new symptom. (authors)

  15. Isolation and molecular identification of Sunshine virus, a novel paramyxovirus found in Australian snakes.

    Science.gov (United States)

    Hyndman, Timothy H; Marschang, Rachel E; Wellehan, James F X; Nicholls, Philip K

    2012-10-01

    This paper describes the isolation and molecular identification of a novel paramyxovirus found during an investigation of an outbreak of neurorespiratory disease in a collection of Australian pythons. Using Illumina® high-throughput sequencing, a 17,187 nucleotide sequence was assembled from RNA extracts from infected viper heart cells (VH2) displaying widespread cytopathic effects in the form of multinucleate giant cells. The sequence appears to contain all the coding regions of the genome, including the following predicted paramyxoviral open reading frames (ORFs): 3'--Nucleocapsid (N)--putative Phosphoprotein (P)--Matrix (M)--Fusion (F)--putative attachment protein--Polymerase (L)--5'. There is also a 540 nucleotide ORF between the N and putative P genes that may be an additional coding region. Phylogenetic analyses of the complete N, M, F and L genes support the clustering of this virus within the family Paramyxoviridae but outside both of the current subfamilies: Paramyxovirinae and Pneumovirinae. We propose to name this new virus, Sunshine virus, after the geographic origin of the first isolate--the Sunshine Coast of Queensland, Australia. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Identification of prognostic molecular features in the reactive stroma of human breast and prostate cancer.

    Directory of Open Access Journals (Sweden)

    Anne Planche

    Full Text Available Primary tumor growth induces host tissue responses that are believed to support and promote tumor progression. Identification of the molecular characteristics of the tumor microenvironment and elucidation of its crosstalk with tumor cells may therefore be crucial for improving our understanding of the processes implicated in cancer progression, identifying potential therapeutic targets, and uncovering stromal gene expression signatures that may predict clinical outcome. A key issue to resolve, therefore, is whether the stromal response to tumor growth is largely a generic phenomenon, irrespective of the tumor type or whether the response reflects tumor-specific properties. To address similarity or distinction of stromal gene expression changes during cancer progression, oligonucleotide-based Affymetrix microarray technology was used to compare the transcriptomes of laser-microdissected stromal cells derived from invasive human breast and prostate carcinoma. Invasive breast and prostate cancer-associated stroma was observed to display distinct transcriptomes, with a limited number of shared genes. Interestingly, both breast and prostate tumor-specific dysregulated stromal genes were observed to cluster breast and prostate cancer patients, respectively, into two distinct groups with statistically different clinical outcomes. By contrast, a gene signature that was common to the reactive stroma of both tumor types did not have survival predictive value. Univariate Cox analysis identified genes whose expression level was most strongly associated with patient survival. Taken together, these observations suggest that the tumor microenvironment displays distinct features according to the tumor type that provides survival-predictive value.

  17. Molecular identification of Taenia spp. in the Eurasian lynx (Lynx lynx) from Finland.

    Science.gov (United States)

    Lavikainen, A; Haukisalmi, V; Deksne, G; Holmala, K; Lejeune, M; Isomursu, M; Jokelainen, P; Näreaho, A; Laakkonen, J; Hoberg, E P; Sukura, A

    2013-04-01

    Cestodes of the genus Taenia are parasites of mammals, with mainly carnivores as definitive and herbivores as intermediate hosts. Various medium-sized cats, Lynx spp., are involved in the life cycles of several species of Taenia. The aim of the present study was to identify Taenia tapeworms in the Eurasian lynx (Lynx lynx) from Finland. In total, 135 tapeworms from 72 lynx were subjected to molecular identification based on sequences of 2 mtDNA regions, the cytochrome c oxidase subunit 1 and the NADH dehydrogenase subunit 1 genes. Available morphological characters of the rostellar hooks and strobila were compared. Two species of Taenia were found: T. laticollis (127 samples) and an unknown Taenia sp. (5 samples). The latter could not be identified to species based on mtDNA, and the rostellar hooks were short relative to those described among other Taenia spp. recorded in felids from the Holarctic region. In the phylogenetic analyses of mtDNA sequences, T. laticollis was placed as a sister species of T. macrocystis, and the unknown Taenia sp. was closely related to T. hydatigena and T. regis. Our analyses suggest that these distinct taeniid tapeworms represent a putative new species of Taenia. The only currently recognized definitive host is L. lynx and the intermediate host is unknown.

  18. Isolation and molecular identification of endophytic diazotrophs from seeds and stems of three cereal crops.

    Directory of Open Access Journals (Sweden)

    Huawei Liu

    Full Text Available Ten strains of endophytic diazotroph were isolated and identified from the plants collected from three different agricultural crop species, wheat, rice and maize, using the nitrogen-free selective isolation conditions. The nitrogen-fixing ability of endophytic diazotroph was verified by the nifH-PCR assay that showed positive nitrogen fixation ability. These identified strains were classified by 879F-RAPD and 16S rRNA sequence analysis. RAPD analyses revealed that the 10 strains were clustered into seven 879F-RAPD groups, suggesting a clonal origin. 16S rRNA sequencing analyses allowed the assignment of the 10 strains to known groups of nitrogen-fixing bacteria, including organisms from the genera Paenibacillus, Enterobacter, Klebsiella and Pantoea. These representative genus are not endophytic diazotrophs in the conventional sense. They may have obtained nitrogen fixation ability through lateral gene transfer, however, the evolutionary forces of lateral gene transfer are not well known. Molecular identification results from 16S rRNA analyses were also confirmed by morphological and biochemical data. The test strains SH6A and MZB showed positive effect on the growth of plants.

  19. Identification of small molecular ligands as potent inhibitors of fatty acid metabolism in Mycobacterium tuberculosis

    Science.gov (United States)

    Malikanti, Ramesh; Vadija, Rajender; Veeravarapu, Hymavathi; Mustyala, Kiran Kumar; Malkhed, Vasavi; Vuruputuri, Uma

    2017-12-01

    Tuberculosis (Tb) is one of the major health challenges for the global scientific community. The 3-hydroxy butyryl-CoA dehydrogenase (Fad B2) protein belongs to 3-hydroxyl acetyl-CoA dehydrogenase family, which plays a key role in the fatty acid metabolism and β-oxidation in the cell membrane of Mycobacterium tuberculosis (Mtb). In the present study the Fad B2 protein is targeted for the identification of potential drug candidates for tuberculosis. The 3D model of the target protein Fad B2, was generated using homology modeling approach and was validated. The plausible binding site of the Fad B2 protein was identified from computational binding pocket prediction tools, which ranges from ASN120 to VAL150 amino acid residues. Virtual screening was carried out with the databases, Ligand box UOS and hit definder, at the binding site region. 133 docked complex structures were generated as an output. The identified ligands show good glide scores and glide energies. All the ligand molecules contain benzyl amine pharmacophore in common, which show specific and selective binding interactions with the SER122 and ASN146 residues of the Fad B2 protein. The ADME properties of all the ligand molecules were observed to be within the acceptable range. It is suggested from the result of the present study that the docked molecular structures with a benzyl amine pharmacophore act as potential ligands for Fad B2 protein binding and as leads in Tb drug discovery.

  20. Innovative molecular approach to the identification of Colossoma macropomum and its hybrids

    Directory of Open Access Journals (Sweden)

    Fátima Gomes

    2012-06-01

    Full Text Available Tambaqui (Colossoma macropomum is the fish species most commonly raised in the Brazilian fish farms. The species is highly adaptable to captive conditions, and is both fast-growing and relatively fecund. In recent years, artificial breeding has produced hybrids with Characiform species, known as "Tambacu" and "Tambatinga". Identifying hybrids is a difficult process, given their morphological similarities with the parent species. This study presents an innovative molecular approach to the identification of hybrids based primarily on Multiplex PCR of a nuclear gene (α-Tropomyosin, which was tested on 93 specimens obtained from fish farms in northern Brazil. The sequencing of a 505-bp fragment of the Control Region (CR permitted the identification of the maternal lineage of the specimen, all of which corresponded to C. macropomum. Unexpectedly, only two CR haplotype were found in 93 samples, a very low genetic diversity for the pisciculture of Tambaqui. Multiplex PCR identified 42 hybrids, in contrast with 23 identified by the supplier on the basis of external morphology. This innovative tool has considerable potential for the development of the Brazilian aquaculture, given the possibility of the systematic identification of the genetic traits of both fry-producing stocks, and the fry and juveniles raised in farms.O Tambaqui (Colossoma macropomum é a espécie de peixe mais comumente cultivada em pisciculturas no Brasil. A espécie é altamente adaptada às condições de cativeiro, apresentando rápido crescimento e alta fecundidade. Nos últimos anos tem ocorrido o cruzamento artificial entre espécies de Characiformes, produzindo os híbridos "Tambacu" e "Tambatinga". A identificação de híbridos é uma tarefa difícil, em virtude da grande similaridade morfológica entre as espécies parentais. O presente estudo apresenta uma abordagem molecular inovadora para identificação de híbridos com base em PCR Multiplex de um gene nuclear (

  1. Development of a blood-based molecular biomarker test for identification of schizophrenia before disease onset

    NARCIS (Netherlands)

    M.K. Chan (Man K.); M.-O. Krebs (M-O); D. Cox; P.C. Guest (Paul); R.H. Yolken; H. Rahmoune (Hassan); M. Rothermundt (Matthias); J. Steiner (Johann); F.M. Leweke (Marcus); N.J.M. van Beveren (Nico); D. Niebuhr (David); N. Weber (Natalya); D. Cowan (David); P. Suarez-Pinilla; B. Crespo-Facorro (Benedicto); C. Mam-Lam-Fook; J. Bourgin; R.J. Wenstrup (Richard); R.R. Kaldate; J.D. Cooper (Jason); S. Bahn (Sabine)

    2015-01-01

    markdownabstractRecent research efforts have progressively shifted towards preventative psychiatry and prognostic identification of individuals before disease onset. We describe the development of a serum biomarker test for the identification of individuals at risk of developing schizophrenia based

  2. Quantitative sexing (Q-Sexing) and relative quantitative sexing (RQ ...

    African Journals Online (AJOL)

    samer

    Key words: Polymerase chain reaction (PCR), quantitative real time polymerase chain reaction (qPCR), quantitative sexing, Siberian tiger. INTRODUCTION. Animal molecular sexing .... 43:3-12. Ellegren H (1996). First gene on the avian W chromosome (CHD) provides a tag for universal sexing of non-ratite birds. Proc.

  3. Preliminary Study to Test the Feasibility of Sex Identification of Human (Homo sapiens) Bones Based on Differences in Elemental Profiles Determined by Handheld X-ray Fluorescence.

    Science.gov (United States)

    Nganvongpanit, Korakot; Buddhachat, Kittisak; Brown, Janine L; Klinhom, Sarisa; Pitakarnnop, Tanita; Mahakkanukrauh, Pasuk

    2016-09-01

    Sex assignment of human remains is a crucial step in forensic anthropological studies. The aim of this study was to examine elemental differences between male and female bones using X-ray fluorescence (XRF) and determine if elemental profiling could be used for sex discrimination. Cranium, humerus, and os coxae of 60 skeletons (30 male, 30 female) from the Chiang Mai University Skeletal Collection were scanned by XRF and differences in elemental profiles between male and female bones determined using discriminant analysis. In the cranium, three elements (S, Ca, Pb) were significantly higher in males and five elements (Si, Mn, Fe, Zn, Ag) plus light elements (atomic number lower than 12) were higher in females. In humerus and os coxae, nine elements were significantly higher in male and one element was higher in female samples. The accuracy rate for sex estimation was 60, 63, and 61 % for cranium, humerus, and os coxae, respectively, and 67 % when data for all three bones were combined. We conclude that there are sex differences in bone elemental profiles; however, the accuracy of XRF analyses for discriminating between male and female samples was low compared to standard morphometric and molecular methods. XRF could be used on small samples that cannot be sexed by traditional morphological methods, but more work is needed to increase the power of this technique for gender assignment.

  4. Molecular identification and histopathological study of natural Streptococcus agalactiae infection in hybrid tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Laith, A A; Ambak, Mohd Azmi; Hassan, Marina; Sheriff, Shahreza Md; Nadirah, Musa; Draman, Ahmad Shuhaimi; Wahab, Wahidah; Ibrahim, Wan Nurhafizah Wan; Aznan, Alia Syafiqah; Jabar, Amina; Najiah, Musa

    2017-01-01

    The main objective of this study was to emphasize on histopathological examinations and molecular identification of Streptococcus agalactiae isolated from natural infections in hybrid tilapia ( Oreochromis niloticus ) in Temerloh Pahang, Malaysia, as well as to determine the susceptibility of the pathogen strains to various currently available antimicrobial agents. The diseased fishes were observed for variable clinical signs including fin hemorrhages, alterations in behavior associated with erratic swimming, exophthalmia, and mortality. Tissue samples from the eyes, brain, kidney, liver, and spleen were taken for bacterial isolation. Identification of S. agalactiae was screened by biochemical methods and confirmed by VITEK 2 and 16S rRNA gene sequencing. The antibiogram profiling of the isolate was tested against 18 standard antibiotics included nitrofurantoin, flumequine, florfenicol, amoxylin, doxycycline, oleandomycin, tetracycline, ampicillin, lincomycin, colistin sulfate, oxolinic acid, novobiocin, spiramycin, erythromycin, fosfomycin, neomycin, gentamycin, and polymyxin B. The histopathological analysis of eyes, brain, liver, kidney, and spleen was observed for abnormalities related to S. agalactiae infection. The suspected colonies of S. agalactiae identified by biochemical methods was observed as Gram-positive chained cocci, β-hemolytic, and non-motile. The isolate was confirmed as S. agalactiae by VITEK 2 (99% similarity), reconfirmed by 16S rRNA gene sequencing (99% similarity) and deposited in GenBank with accession no. KT869025. The isolate was observed to be resistance to neomycin and gentamicin. The most consistent gross findings were marked hemorrhages, erosions of caudal fin, and exophthalmos. Microscopic examination confirmed the presence of marked congestion and infiltration of inflammatory cell in the eye, brain, kidney, liver, and spleen. Eye samples showed damage of the lens capsule, hyperemic and hemorrhagic choroid tissue, and retina

  5. Molecular identification and histopathological study of natural Streptococcus agalactiae infection in hybrid tilapia (Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Laith Abdul Razzak

    2017-01-01

    Full Text Available Aim: The main objective of this study was to emphasize on histopathological examinations and molecular identification of Streptococcus agalactiae isolated from natural infections in hybrid tilapia (Oreochromis niloticus in Temerloh Pahang, Malaysia, as well as to determine the susceptibility of the pathogen strains to various currently available antimicrobial agents. Materials and Methods: The diseased fishes were observed for variable clinical signs including fin hemorrhages, alterations in behavior associated with erratic swimming, exophthalmia, and mortality. Tissue samples from the eyes, brain, kidney, liver, and spleen were taken for bacterial isolation. Identification of S. agalactiae was screened by biochemical methods and confirmed by VITEK 2 and 16S rRNA gene sequencing. The antibiogram profiling of the isolate was tested against 18 standard antibiotics included nitrofurantoin, flumequine, florfenicol, amoxylin, doxycycline, oleandomycin, tetracycline, ampicillin, lincomycin, colistin sulfate, oxolinic acid, novobiocin, spiramycin, erythromycin, fosfomycin, neomycin, gentamycin, and polymyxin B. The histopathological analysis of eyes, brain, liver, kidney, and spleen was observed for abnormalities related to S. agalactiae infection. Results: The suspected colonies of S. agalactiae identified by biochemical methods was observed as Gram-positive chained cocci, β-hemolytic, and non-motile. The isolate was confirmed as S. agalactiae by VITEK 2 (99% similarity, reconfirmed by 16S rRNA gene sequencing (99% similarity and deposited in GenBank with accession no. KT869025. The isolate was observed to be resistance to neomycin and gentamicin. The most consistent gross findings were marked hemorrhages, erosions of caudal fin, and exophthalmos. Microscopic examination confirmed the presence of marked congestion and infiltration of inflammatory cell in the eye, brain, kidney, liver, and spleen. Eye samples showed damage of the lens capsule

  6. Species identification of Aspergillus section Flavi isolates from Portuguese almonds using phenotypic, including MALDI-TOF ICMS, and molecular approaches

    OpenAIRE

    Rodrigues, Paula; Venâncio, Armando; Lima, Nelson

    2011-01-01

    Section Flavi is one of the most significant Sections in the genus Aspergillus. Taxonomy of this section currently depends on multivariate approaches, entailing phenotypic and molecular traits. This work aimed to identify isolates from section Flavi by combining various classic phenotypic and genotypic methods as well as the novel approach based on spectral analysis by MALDI-TOF ICMS, and to evaluate the discriminatory power of the various approaches in species identification. Methods and ...

  7. Molecular status of Human Immunodeficiency Virus, Hepatitis B virus, and Hepatitis C virus among injecting drug male commercial sex workers in Surakarta, Indonesia

    Science.gov (United States)

    Agung Prasetyo, Afiono; Marwoto; Arifin Adnan, Zainal; Hartono

    2018-05-01

    Male commercial sex workers are one of the high-risk community for blood-borne viruses. However, there are no data concerning the molecular status of Human Immunodeficiency Virus (HIV), Hepatitis B Virus (HBV), and Hepatitis C Virus (HCV) circulated among male commercial sex workers with injecting drug habits in Surakarta, Indonesia. Blood samples obtained from injecting drug male commercial sex workers in Surakarta were examined for HIV antibodies, HBsAg, and HCV antibodies, respectively, by immunological assays. Blood samples were also subjected to viral nucleic acid extraction and molecular detection of HIV, HBV, and HCV by nested (RT) PCRs. The PCR products were purified from agarose gels, and the nucleotide sequences were retrieved and molecular analyzed. HIV, HBV, and HCV were detected in 29.4% (10/34), 17.6% (6/34), and 52.9% (18/34), respectively. HIV CRF01_AE and B were found to be circulating in the community. HBV genotype B3 was predominated, followed by C1. HCV genotype 1a was predominated, followed by 1c, 3a, 1b, and 4a. HIV, HBV, and HCV were found circulating in the male commercial sex workers with injecting drug habits in Surakarta, Indonesia.

  8. Identification of clinically relevant Corynebacterium strains by Api Coryne, MALDI-TOF-mass spectrometry and molecular approaches.

    Science.gov (United States)

    Alibi, S; Ferjani, A; Gaillot, O; Marzouk, M; Courcol, R; Boukadida, J

    2015-09-01

    We evaluated the Bruker Biotyper matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (MS) for the identification of 97 Corynebacterium clinical in comparison to identification strains by Api Coryne and MALDI-TOF-MS using 16S rRNA gene and hypervariable region of rpoB genes sequencing as a reference method. C. striatum was the predominant species isolated followed by C. amycolatum. There was an agreement between Api Coryne strips and MALDI-TOF-MS identification in 88.65% of cases. MALDI-TOF-MS was unable to differentiate C. aurimucosum from C. minutissimum and C. minutissimum from C. singulare but reliably identify 92 of 97 (94.84%) strains. Two strains remained incompletely identified to the species level by MALDI-TOF-MS and molecular approaches. They belonged to Cellulomonas and Pseudoclavibacter genus. In conclusion, MALDI-TOF-MS is a rapid and reliable method for the identification of Corynebacterium species. However, some limits have been noted and have to be resolved by the application of molecular methods. Copyright © 2015. Published by Elsevier SAS.

  9. Identification of morphological and molecular Aspergillus species isolated from patients based on beta-tubulin gene sequencing

    Directory of Open Access Journals (Sweden)

    Mahnaz Kheirkhah

    2017-06-01

    Full Text Available Background: Aspergillus species are opportunistic pathogens among immunocompromised patients. In terms of pathogenesis and mycotoxin production, they are in great value. The aim of the this study was to evaluate of beta-tubulin gene for identification of clinical Aspergillus species by PCR-sequencing method compared to morphological features of clinical isolates (such as conidial shape in direct microscopic examination, colony shape in culture, and physiological tests. Materials and Methods: In this study, 465 patients referred to the Shefa laboratory of Isfahan were evaluated. Morphological and molecular identification of clinical samples were performed using culture on sabouraud agar, malt extract agar, czapekdox agar, direct microscopy, and PCR-sequencing of beta tubulin gene, respectively. Sequences were analyzed in comparison with gene bank data. Results: Thirty nine out of 465 suspected cases (8.4% had aspergillosis. The most prevalent species were Aspergillus flavus (56.4%, A. oryzae (20.5%, and A. fumigatus (10.2%, respectively. Fifty nine percent of patients were females and 49% were males. Conclusion: In comparison with phenotypic tests, sequencing of beta-tubulin gene for identification of Aspergillus species is at great value. Replacement of molecular techniques with conventional tests is recommended for precise identification of microorganism for better management of infection.

  10. The Role of Ovarian Sex Steroids in Metabolic Homeostasis, Obesity, and Postmenopausal Breast Cancer: Molecular Mechanisms and Therapeutic Implications

    Directory of Open Access Journals (Sweden)

    Viroj Boonyaratanakornkit

    2015-01-01

    Full Text Available Obese postmenopausal women have an increased risk of breast cancer and are likely to have a worse prognosis than nonobese postmenopausal women. The cessation of ovarian function after menopause results in withdrawal of ovarian sex steroid hormones, estrogen, and progesterone. Accumulating evidence suggests that the withdrawal of estrogen and progesterone causes homeostasis imbalances, including decreases in insulin sensitivity and leptin secretion and changes in glucose and lipid metabolism, resulting in a total reduction in energy expenditure. Together with a decrease in physical activity and consumption of a high fat diet, these factors significantly contribute to obesity in postmenopausal women. Obesity may contribute to breast cancer development through several mechanisms. Obesity causes localized inflammation, an increase in local estrogen production, and changes in cellular metabolism. In addition, obese women have a higher risk of insulin insensitivity, and an increase in insulin and other growth factor secretion. In this review, we describe our current understanding of the molecular actions of estrogen and progesterone and their contributions to cellular metabolism, obesity, inflammation, and postmenopausal breast cancer. We also discuss how modifications of estrogen and progesterone actions might be used as a therapeutic approach for obesity and postmenopausal breast cancer.

  11. Mitochondrial markers for molecular identification of Aedes mosquitoes (Diptera: Culicidae) involved in transmission of arboviral disease in West Africa.

    Science.gov (United States)

    Cook, Shelley; Diallo, Mawlouth; Sall, Amadou A; Cooper, Alan; Holmes, Edward C

    2005-01-01

    Correct classification of the insect vector is central to the study of arboviral disease. A simple molecular method for identification of the main vectors of the mosquito-borne viruses, dengue, yellow fever, and Rift Valley fever in Senegal, West Africa, was developed. We present a system in which the five mosquito species (Diptera: Culicidae) responsible for the majority of flaviviral disease transmission in Senegal can be reliably identified using small amounts of DNA coextracted during flaviviral screening procedures, via an easy amplification of the mitochondrial gene cytochrome oxidase c subunit I or II (COI or COII, respectively). We observed that despite very similar morphology, the two cryptic disease vector species Aedes furcifer Edwards and Aedes taylori Edwards are highly divergent at the molecular level. This sequence variation was used as a basis for the development of a polymerase chain reaction-restriction fragment-length polymorphism system for the differentiation of the two species. We also present the first investigation of the phylogeny of the culicine mosquitoes based on all COI and COII sequences currently available. There seems to be very low intraspecific variation in both genes, whereas interspecific variation is high. As a consequence, COI and COII are ideal candidates for the molecular identification of disease vectors to species level, whereas deeper divergences remain equivocal by using these genes. This system provides a new technique for the accurate identification of culicine disease vectors in West Africa and provides a basis for the expansion of such methods into the study of a range of diseases.

  12. Rapid identification of ascomycetous yeasts from clinical specimens by a molecular method based on flow cytometry and comparison with identifications from phenotypic assays.

    Science.gov (United States)

    Page, Brent T; Shields, Christine E; Merz, William G; Kurtzman, Cletus P

    2006-09-01

    This study was designed to compare the identification of ascomycetous yeasts recovered from clinical specimens by using phenotypic assays (PA) and a molecular flow cytometric (FC) method. Large-subunit rRNA domains 1 and 2 (D1/D2) gene sequence analysis was also performed and served as the reference for correct strain identification. A panel of 88 clinical isolates was tested that included representatives of nine commonly encountered species and six infrequently encountered species. The PA included germ tube production, fermentation of seven carbohydrates, morphology on corn meal agar, urease and phenoloxidase activities, and carbohydrate assimilation tests when needed. The FC method (Luminex) employed species-specific oligonucleotides attached to polystyrene beads, which were hybridized with D1/D2 amplicons from the unidentified isolates. The PA identified 81 of 88 strains correctly but misidentified 4 of Candida dubliniensis, 1 of C. bovina, 1 of C. palmioleophila, and 1 of C. bracarensis. The FC method correctly identified 79 of 88 strains and did not misidentify any isolate but did not identify nine isolates because oligonucleotide probes were not available in the current library. The FC assay takes approximately 5 h, whereas the PA takes from 2 h to 5 days for identification. In conclusion, PA did well with the commonly encountered species, was not accurate for uncommon species, and takes significantly longer than the FC method. These data strongly support the potential of FC technology for rapid and accurate identification of medically important yeasts. With the introduction of new antifungals, rapid, accurate identification of pathogenic yeasts is more important than ever for guiding antifungal chemotherapy.

  13. Morphological and molecular identification of Phytophthora capsici L. in pipiana pumpkin and its greenhouse management

    Directory of Open Access Journals (Sweden)

    José Francisco Díaz-Nájera

    2015-01-01

    Full Text Available L a calabaza pipiana es importante en la alimentación de la población en el centro-sur de México . Sus semillas se consumen directamente tostadas y aderezadas con sal; además, son el ingrediente principal para elaborar platillos típicos como el mole verde o pipian, así como diferentes dulces tradicionales. Algunos microorganismos del suelo causan severos problemas en frutos, lo que afecta el rendimiento. El objetivo del estudio fue identificar morfológica y molecularmente al oomicete causante de la pudrición de frutos de calabaza pipiana, y evaluar opciones de control químico y biológico en invernadero. Durante agosto y septiembre de 2011, en la zona norte del estado de Guerrero, se colectaron frutos de calabaza pipiana con síntomas de pudrición. La identificación morfológica se realizó con las claves propuestas por Gallegly y Hong (2008, y la molecular fue mediante la reacción en cadena de la polimerasa, ITS-PCR. En ambas pruebas se identificó a Phytophthora capsici como el causante de la pudrición de frutos de calabaza pipiana. Las secuencias obtenidas tuvieron 99 % de similitud con P. capsici en sandía de Estados Unidos y en calabaza de Italia, depositadas en el banco de genes (GenBank. Los ingredientes activos, propamocarb+fosetil y metalaxil+clorotalonil, mostraron control al retrasar seis días la presencia del patógeno en frutos, mientras que los agentes de biocontrol la retardaron cuatro días.

  14. Use of molecular markers in identification and characterization of resistance to rice blast in India.

    Directory of Open Access Journals (Sweden)

    Manoj Kumar Yadav

    Full Text Available Rice blast disease caused by Magnaporthe oryzae is one of the most destructive disease causing huge losses to rice yield in different parts of the world. Therefore, an attempt has been made to find out the resistance by screening and studying the genetic diversity of eighty released rice varieties by National Rice Research Institute, Cuttack (NRVs using molecular markers linked to twelve major blast resistance (R genes viz Pib, Piz, Piz-t, Pik, Pik-p, Pikm Pik-h, Pita/Pita-2, Pi2, Pi9, Pi1 and Pi5. Out of which, nineteen varieties (23.75% showed resistance, twenty one were moderately resistant (26.25% while remaining forty varieties (50% showed susceptible in uniform blast nursery. Rice varieties possessing blast resistance genes varied from four to twelve and the frequencies of the resistance genes ranged from 0 to 100%. The cluster analysis grouped the eighty NRVs into two major clusters at 63% level of genetic similarity coefficient. The PIC value for seventeen markers varied from 0 to 0.37 at an average of 0.20. Out of seventeen markers, only five markers, 195R-1, Pi9-i, Pita3, YL155/YL87 and 40N23r corresponded to three broad spectrum R genes viz. Pi9, Pita/Pita2 and Pi5 were found to be significantly associated with the blast disease with explaining phenotypic variance from 3.5% to 7.7%. The population structure analysis and PCoA divided the entire 80 NRVs into two sub-groups. The outcome of this study would help to formulate strategies for improving rice blast resistance through genetic studies, plant-pathogen interaction, identification of novel R genes, development of new resistant varieties through marker-assisted breeding for improving rice blast resistance in India and worldwide.

  15. Molecular identification of common Salmonella serovars using multiplex DNA sensor-based suspension array.

    Science.gov (United States)

    Aydin, Muhsin; Carter-Conger, Jacqueline; Gao, Ning; Gilmore, David F; Ricke, Steven C; Ahn, Soohyoun

    2018-04-01

    Salmonella is one of major foodborne pathogens and the leading cause of foodborne illness-related hospitalizations and deaths. It is critical to develop a sensitive and rapid detection assay that can identify Salmonella to ensure food safety. In this study, a DNA sensor-based suspension array system of high multiplexing ability was developed to identify eight Salmonella serovars commonly associated with foodborne outbreaks to the serotype level. Each DNA sensor was prepared by activating pre-encoded microspheres with oligonucleotide probes that are targeting virulence genes and serovar-specific regions. The mixture of 12 different types of DNA sensors were loaded into a 96-well microplate and used as a 12-plex DNA sensor array platform. DNA isolated from Salmonella was amplified by multiplex polymerase chain reaction (mPCR), and the presence of Salmonella was determined by reading fluorescent signals from hybridization between probes on DNA sensors and fluorescently labeled target DNA using the Bio-Plex® system. The developed multiplex array was able to detect synthetic DNA at the concentration as low as 100 fM and various Salmonella serovars as low as 100 CFU/mL within 1 h post-PCR. Sensitivity of this assay was further improved to 1 CFU/mL with 6-h enrichment. The array system also correctly and specifically identified serotype of tested Salmonella strains without any cross-reactivity with other common foodborne pathogens. Our results indicate the developed DNA sensor suspension array can be a rapid and reliable high-throughput method for simultaneous detection and molecular identification of common Salmonella serotypes.

  16. Molecular Network-Based Identification of Competing Endogenous RNAs in Thyroid Carcinoma

    Directory of Open Access Journals (Sweden)

    Minjia Lu

    2018-01-01

    Full Text Available RNAs may act as competing endogenous RNAs (ceRNAs, a critical mechanism in determining gene expression regulations in many cancers. However, the roles of ceRNAs in thyroid carcinoma remains elusive. In this study, we have developed a novel pipeline called Molecular Network-based Identification of ceRNA (MNIceRNA to identify ceRNAs in thyroid carcinoma. MNIceRNA first constructs micro RNA (miRNA–messenger RNA (mRNAlong non-coding RNA (lncRNA networks from miRcode database and weighted correlation network analysis (WGCNA, based on which to identify key drivers of differentially expressed RNAs between normal and tumor samples. It then infers ceRNAs of the identified key drivers using the long non-coding competing endogenous database (lnCeDB. We applied the pipeline into The Cancer Genome Atlas (TCGA thyroid carcinoma data. As a result, 598 lncRNAs, 1025 mRNAs, and 90 microRNA (miRNAs were inferred to be differentially expressed between normal and thyroid cancer samples. We then obtained eight key driver miRNAs, among which hsa-mir-221 and hsa-mir-222 were key driver RNAs identified by both miRNA–mRNA–lncRNA and WGCNA network. In addition, hsa-mir-375 was inferred to be significant for patients’ survival with 34 associated ceRNAs, among which RUNX2, DUSP6 and SEMA3D are known oncogenes regulating cellular proliferation and differentiation in thyroid cancer. These ceRNAs are critical in revealing the secrets behind thyroid cancer progression and may serve as future therapeutic biomarkers.

  17. Molecular identification of Mycoplasma synoviae from seroprevalent commercial breeder farms at Chittagong district, Bangladesh

    Directory of Open Access Journals (Sweden)

    Md. Inkeyas Uddin

    2016-10-01

    Full Text Available Aim: Worldwide, Mycoplasma synoviae (MS is an important pathogen of poultry, especially for chicken and turkey. It causes respiratory tract infection and infectious sinusitis. The study was conducted to determine the seroprevalence of MS infection with associated risk factors and identification of MS organism in unvaccinated flocks of commercial breeder farms of the Chittagong district, Bangladesh. Materials and Methods: A total of 365 serum samples were collected and tested for MS using serum plate agglutination (SPA test for determination of MS seroprevalence. On the other hand, tracheal swabs were collected from each seropositive flocks for polymerase chain reaction (PCR to determine the presence of MS organism. Results: Among the farms, the highest prevalence was found to be 69% and the lowest prevalence was 28% with the average 60%. The seroprevalence of MS infection in breeder farms was highest 70% with the flock size >10,000 birds, whereas it was lowest 57% in the flocks ranging from 4000 to 7000. According to age group, the prevalence was found highest 70% in >60 weeks age group of birds and lowest 42% in 10-19 weeks group. The seroprevalence of MS in winter season was found as highest as 64%, whereas it was found lowest 60% in the summer season. There was a statistically significant difference (p0.05 difference in the winter, summer, and rainy season. To confirm the presence of MS in the samples, PCR test was applied using specific primers to amplify a 214 bp region of the 16S rRNA gene of the organism. In PCR, all seropositive flocks showed a positive result for MS. Conclusion: As the plate agglutination test result showed 100% similar with PCR result, it can be suggested that agglutination test is better than molecular and culture techniques for MS detection and it is also cheaper and less time-consuming method.

  18. Molecular Identification of Vertebrate and Hemoparasite DNA Within Mosquito Blood Meals From Eastern North Dakota

    Science.gov (United States)

    Vaughan, Jefferson A.

    2013-01-01

    Abstract To understand local transmission of vector-borne diseases, it is important to identify potential vectors, characterize their host feeding patterns, and determine if vector-borne pathogens are circulating within the region. This study simultaneously investigated these aspects of disease transmission by collecting engorged mosquitoes within two rural study sites in the central Red River Valley of North Dakota. Mosquitoes were identified, midguts were excised, and the blood was expelled from the midguts. DNA was extracted from blood meals and subjected to PCR and direct sequencing to identify the vertebrate origin of the blood. Using different primer sets, PCR was used to screen for two types of vector-borne pathogens, filarioid nematodes and hemosporidian parasites. White-tailed deer were the primary source of blood meals for the eight aedine mosquito species collected. None of the 288 deer-derived blood meals contained filarioid or hemosporidian DNA. In contrast, 18 of 32 Culex tarsalis and three of three Cx. pipiens blood meals contained avian blood, representing eight different species of birds. Of 24 avian-derived blood meals examined, 12 contained Plasmodium DNA, three of which also contained Leucocytozoon DNA (i.e., dual infection). Potential confounding effects resulting from parasite acquisition and development from previous blood meals (e.g., oocysts) were eliminated because host blood had been removed from the midguts prior to DNA extraction. Thus, specific parasite lineages/species could be unequivocally linked to specific vertebrate species. By combining mosquito identification with molecular techniques for identifying blood meal source and pathogens, a relatively small sample of engorged mosquitoes yielded important new information about mosquito feeding patterns and hemosporidia infections in birds. Thorough analyses of wild-caught engorged mosquitoes and other arthropods represent a powerful tool in understanding the local transmission of

  19. Molecular identification of vertebrate and hemoparasite DNA within mosquito blood meals from eastern North Dakota.

    Science.gov (United States)

    Mehus, Joseph O; Vaughan, Jefferson A

    2013-11-01

    To understand local transmission of vector-borne diseases, it is important to identify potential vectors, characterize their host feeding patterns, and determine if vector-borne pathogens are circulating within the region. This study simultaneously investigated these aspects of disease transmission by collecting engorged mosquitoes within two rural study sites in the central Red River Valley of North Dakota. Mosquitoes were identified, midguts were excised, and the blood was expelled from the midguts. DNA was extracted from blood meals and subjected to PCR and direct sequencing to identify the vertebrate origin of the blood. Using different primer sets, PCR was used to screen for two types of vector-borne pathogens, filarioid nematodes and hemosporidian parasites. White-tailed deer were the primary source of blood meals for the eight aedine mosquito species collected. None of the 288 deer-derived blood meals contained filarioid or hemosporidian DNA. In contrast, 18 of 32 Culex tarsalis and three of three Cx. pipiens blood meals contained avian blood, representing eight different species of birds. Of 24 avian-derived blood meals examined, 12 contained Plasmodium DNA, three of which also contained Leucocytozoon DNA (i.e., dual infection). Potential confounding effects resulting from parasite acquisition and development from previous blood meals (e.g., oocysts) were eliminated because host blood had been removed from the midguts prior to DNA extraction. Thus, specific parasite lineages/species could be unequivocally linked to specific vertebrate species. By combining mosquito identification with molecular techniques for identifying blood meal source and pathogens, a relatively small sample of engorged mosquitoes yielded important new information about mosquito feeding patterns and hemosporidia infections in birds. Thorough analyses of wild-caught engorged mosquitoes and other arthropods represent a powerful tool in understanding the local transmission of vector

  20. Use of molecular markers in identification and characterization of resistance to rice blast in India.

    Science.gov (United States)

    Yadav, Manoj Kumar; S, Aravindan; Ngangkham, Umakanta; Shubudhi, H N; Bag, Manas Kumar; Adak, Totan; Munda, Sushmita; Samantaray, Sanghamitra; Jena, Mayabini

    2017-01-01

    Rice blast disease caused by Magnaporthe oryzae is one of the most destructive disease causing huge losses to rice yield in different parts of the world. Therefore, an attempt has been made to find out the resistance by screening and studying the genetic diversity of eighty released rice varieties by National Rice Research Institute, Cuttack (NRVs) using molecular markers linked to twelve major blast resistance (R) genes viz Pib, Piz, Piz-t, Pik, Pik-p, Pikm Pik-h, Pita/Pita-2, Pi2, Pi9, Pi1 and Pi5. Out of which, nineteen varieties (23.75%) showed resistance, twenty one were moderately resistant (26.25%) while remaining forty varieties (50%) showed susceptible in uniform blast nursery. Rice varieties possessing blast resistance genes varied from four to twelve and the frequencies of the resistance genes ranged from 0 to 100%. The cluster analysis grouped the eighty NRVs into two major clusters at 63% level of genetic similarity coefficient. The PIC value for seventeen markers varied from 0 to 0.37 at an average of 0.20. Out of seventeen markers, only five markers, 195R-1, Pi9-i, Pita3, YL155/YL87 and 40N23r corresponded to three broad spectrum R genes viz. Pi9, Pita/Pita2 and Pi5 were found to be significantly associated with the blast disease with explaining phenotypic variance from 3.5% to 7.7%. The population structure analysis and PCoA divided the entire 80 NRVs into two sub-groups. The outcome of this study would help to formulate strategies for improving rice blast resistance through genetic studies, plant-pathogen interaction, identification of novel R genes, development of new resistant varieties through marker-assisted breeding for improving rice blast resistance in India and worldwide.

  1. Molecular detection and species identification of Enterocytozoon bieneusi isolated from immunocompetent Orang Asli in Malaysia.

    Science.gov (United States)

    Ashikin, Azah; Al-Mekhlafi, Hesham M; Moktar, Norhayati; Anuar, Tengku Shahrul

    2017-04-01

    Most studies of opportunistic infections focus on immunocompromised patients. However, there is a lack of information on microsporidiosis in healthy people (immunocompetent) worldwide. This study aimed to detect and identify microsporidia species in immunocompetent Orang Asli living in Pahang, Malaysia. Orang Asli is a collective term for a group of indigenous people that usually reside in the interior regions of Peninsular Malaysia. They comprise about 0.7% of the total population in Malaysia and 76% of them lived below the poverty line i.e., poor housing conditions with the lack of access to safe drinking water and adequate sanitation, contaminated environment, high illiteracy rate and unhygienic practices by these people. Stool samples were collected from 209 Orang Asli and analyzed for detecting the presence of Enterocytozoon bieneusi and Encephalitozoon intestinalis by polymerase chain reaction assay targeting small subunit ribosomal RNA gene. E. bieneusi was detected in 8 individuals (3.83%). This infection was commonly found in males than females (5.2% vs. 2.7%). All infected Orang Asli were adults, with a mean age of 44years. Diarrhea and other gastrointestinal symptoms were reported in one case (12.5%) among individuals infected with this species. These findings clearly show that exposure to E. bieneusi may actually be common than reported. The accurate detection and identification of microsporidian species by molecular technique will improve therapy, clinical manifestations and prognosis of this infection, as no antiparasitic therapy has been approved for E. bieneusi. It is hoped that these findings will allow the formulation of better health management and disease prevention advisories, and improvement in the standards of health in similar communities. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Molecular identification and characterization of Fusarium spp. associated with sorghum seeds.

    Science.gov (United States)

    Divakara, Shetty Thimmappa; Santosh, Parthasarathy; Aiyaz, Mohammed; Ramana, Mudili Venkata; Hariprasad, Puttaswamy; Nayaka, Siddaih Chandra; Niranjana, Siddapura Ramachandrappa

    2014-04-01

    Fusarium spp. are not only pathogenic to plants but are also known as toxin producers that negatively affect animal and human health. The identification of Fusarium spp. remains one of the most critical issues in fungal taxonomy. In this study, different strains of Fusarium spp. were isolated from sorghum seed samples and identified at the molecular level by tef-1α gene amplification. A multiplex polymerase chain reaction (mPCR) assay was developed to differentiate toxigenic and non-toxigenic Fusarium spp. by designing a primer for the Fum21 gene along with the Fum1 and Fum8 genes. A competitive direct enzyme-linked immunosorbent assay (CD-ELISA) was employed to assess the fumonisin-producing ability of Fusarium spp. Phylogenetic analyses were performed using partial sequences of tef-1α and inter-simple sequence repeat (ISSR) markers of different Fusarium spp. All 27 isolates of Fusarium spp. were positive for the tef-1α gene and revealed the presence of F. verticillioides, F. thapsina and F. cf. incarnatum-equiseti complex. The standardized mPCR assay distinguished toxigenic and non-toxigenic F. verticillioides. Further, mPCR fumonisin-positive F. verticillioides isolates were also positive by CD-ELISA. The tef-1α gene sequence was found to be useful in revealing intraspecific polymorphism to some extent. ISSR markers revealed a high level of polymorphism among different isolates of Fusarium spp., and the dendrogram of ISSR analyses grouped the 27 isolates into two major clusters. The present method provided rapid and reliable detection of fumonisin-producing Fusarium spp. The mPCR assay could be an alternative strategy to current conventional mycotoxin analytical techniques and a reliable tool for high-throughput monitoring of major mycotoxin-producing fungi during the processing steps of food and feed commodities. © 2013 Society of Chemical Industry.

  3. A molecular genetic approach to roebuck individual identification in the case of poaching in Serbia

    Directory of Open Access Journals (Sweden)

    Dimitrijević Vladimir

    2013-01-01

    Full Text Available Application of the molecular genetic methods in forensic cases dealing with wild animals has significantly increased recently. These techniques are practically used in order to help solving four key problems : determination of kind of the wild animal, geographic origin, kinship ties and individual identification. In this work the first case of introducing the examination of polimorphism of microsatelite genetic markers within forensic analysis in the cases of poaching in Serbia is presented. The objectives of this forensic analysis was to determine if the meat confiscated during house search of the suspect comes from roebuck origin (Capreolus capreolus, which remains had been found by a game warden in the field during closed season, where the suspect denied the offense, claiming that the meat comes from other roebuck that had been shot during the previous hunting season. DNK was isolated from the skin and fur samples taken from the roebuck corpse found in the woods, as well as from the frozen meat found in the suspect’s house. Both amplification and polimorphism examination of the eight microsatelite markers (ROE01, NVHRT21, NVHRT24, NVHRT48, NVHRT73, RT7 AND RT27 were carried out. In all the examined samples, the same pattern of variability of the tested microsatelites was determined, that is it was proved that DNK profiles of the samples taken from roebuck corpse were identical to DNK profile of the meat sample found in the suspect’s house. This result clearly indicates that all the examined biological samples originate from the same animal, and consequently represents forensically valid evidence in the case of roebuck poaching. [Projekat Ministarstva nauke Republike Srbije, br. III46002

  4. Molecular Identification Of Trichoderma Strains Collected To Develop Plant Growth-Promoting And Biocontrol Agents

    Directory of Open Access Journals (Sweden)

    Oskiera Michał

    2015-06-01

    Full Text Available Trichoderma strains that are beneficial to both the growth and health of plants can be used as plant growth-promoting fungi (PGPF or biological control agents (BCA in agricultural and horticultural practices. In order to select PGPF or BCA strains, their biological properties and taxonomy must be carefully studied. In this study, 104 strains of Trichoderma collected at geographically different locations in Poland for selection as PGPF or BCA were identified by DNA barcoding, based on the sequences of internal transcribed spacers 1 and 2 (ITS1 and 2 of the ribosomal RNA gene cluster and on the sequences of translation elongation factor 1 alpha (tef1, chitinase 18-5 (chi18-5, and RNA polymerase II subunit (rpb2 gene fragments. Most of the strains were classified as: T. atroviride (38%, T. harzianum (21%, T. lentiforme (9%, T. virens (9%, and T. simmonsii (6%. Single strains belonging to T. atrobrunneum, T. citrinoviride, T. crassum, T. gamsii, T. hamatum, T. spirale, T. tomentosum, and T. viridescens were identified. Three strains that are potentially pathogenic to cultivated mushrooms belonging to T. pleuroticola and T. aggressivum f. europaeum were also identified. Four strains: TRS4, TRS29, TRS33, and TRS73 were classified to Trichoderma spp. and molecular identification was inconclusive at the species level. Phylogeny analysis showed that three of these strains TRS4, TRS29, and TRS33 belong to Trichoderma species that is not yet taxonomically established and strain TRS73 belongs to the T. harzianum complex, however, the species could not be identified with certainty.

  5. Molecular identification and phylogenetic analysis of Wuchereria bancrofti from human blood samples in Egypt.

    Science.gov (United States)

    Abdel-Shafi, Iman R; Shoieb, Eman Y; Attia, Samar S; Rubio, José M; Ta-Tang, Thuy-Huong; El-Badry, Ayman A

    2017-03-01

    Lymphatic filariasis (LF) is a serious vector-borne health problem, and Wuchereria bancrofti (W.b) is the major cause of LF worldwide and is focally endemic in Egypt. Identification of filarial infection using traditional morphologic and immunological criteria can be difficult and lead to misdiagnosis. The aim of the present study was molecular detection of W.b in residents in endemic areas in Egypt, sequence variance analysis, and phylogenetic analysis of W.b DNA. Collected blood samples from residents in filariasis endemic areas in five governorates were subjected to semi-nested PCR targeting repeated DNA sequence, for detection of W.b DNA. PCR products were sequenced; subsequently, a phylogenetic analysis of the obtained sequences was performed. Out of 300 blood samples, W.b DNA was identified in 48 (16%). Sequencing analysis confirmed PCR results identifying only W.b species. Sequence alignment and phylogenetic analysis indicated genetically distinct clusters of W.b among the study population. Study results demonstrated that the semi-nested PCR proved to be an effective diagnostic tool for accurate and rapid detection of W.b infections in nano-epidemics and is applicable for samples collected in the daytime as well as the night time. PCR products sequencing and phylogenitic analysis revealed three different nucleotide sequences variants. Further genetic studies of W.b in Egypt and other endemic areas are needed to distinguish related strains and the various ecological as well as drug effects exerted on them to support W.b elimination.

  6. Monitoring Spawning Activity in a Southern California Marine Protected Area Using Molecular Identification of Fish Eggs.

    Directory of Open Access Journals (Sweden)

    Alice E Harada

    Full Text Available In order to protect the diverse ecosystems of coastal California, a series of marine protected areas (MPAs have been established. The ability of these MPAs to preserve and potentially enhance marine resources can only be assessed if these habitats are monitored through time. This study establishes a baseline for monitoring the spawning activity of fish in the MPAs adjacent to Scripps Institution of Oceanography (La Jolla, CA, USA by sampling fish eggs from the plankton. Using vertical plankton net tows, 266 collections were made from the Scripps Pier between 23 August 2012 and 28 August 2014; a total of 21,269 eggs were obtained. Eggs were identified using DNA barcoding: the COI or 16S rRNA gene was amplified from individual eggs and sequenced. All eggs that were successfully sequenced could be identified from a database of molecular barcodes of California fish species, resulting in species-level identification of 13,249 eggs. Additionally, a surface transport model of coastal circulation driven by current maps from high frequency radar was used to construct probability maps that estimate spawning locations that gave rise to the collected eggs. These maps indicated that currents usually come from the north but water parcels tend to be retained within the MPA; eggs sampled at the Scripps Pier have a high probability of having been spawned within the MPA. The surface transport model also suggests that although larvae have a high probability of being retained within the MPA, there is also significant spillover into nearby areas outside the MPA. This study provides an important baseline for addressing the extent to which spawning patterns of coastal California species may be affected by future changes in the ocean environment.

  7. Monitoring Spawning Activity in a Southern California Marine Protected Area Using Molecular Identification of Fish Eggs.

    Science.gov (United States)

    Harada, Alice E; Lindgren, Elise A; Hermsmeier, Maiko C; Rogowski, Peter A; Terrill, Eric; Burton, Ronald S

    2015-01-01

    In order to protect the diverse ecosystems of coastal California, a series of marine protected areas (MPAs) have been established. The ability of these MPAs to preserve and potentially enhance marine resources can only be assessed if these habitats are monitored through time. This study establishes a baseline for monitoring the spawning activity of fish in the MPAs adjacent to Scripps Institution of Oceanography (La Jolla, CA, USA) by sampling fish eggs from the plankton. Using vertical plankton net tows, 266 collections were made from the Scripps Pier between 23 August 2012 and 28 August 2014; a total of 21,269 eggs were obtained. Eggs were identified using DNA barcoding: the COI or 16S rRNA gene was amplified from individual eggs and sequenced. All eggs that were successfully sequenced could be identified from a database of molecular barcodes of California fish species, resulting in species-level identification of 13,249 eggs. Additionally, a surface transport model of coastal circulation driven by current maps from high frequency radar was used to construct probability maps that estimate spawning locations that gave rise to the collected eggs. These maps indicated that currents usually come from the north but water parcels tend to be retained within the MPA; eggs sampled at the Scripps Pier have a high probability of having been spawned within the MPA. The surface transport model also suggests that although larvae have a high probability of being retained within the MPA, there is also significant spillover into nearby areas outside the MPA. This study provides an important baseline for addressing the extent to which spawning patterns of coastal California species may be affected by future changes in the ocean environment.

  8. Use of molecular binding pair technology for definitive product marking and identification

    Science.gov (United States)

    Rittenburg, James H.

    1998-04-01

    Counterfeiting and diversion of brand name products is a significant worldwide problem. Loss of revenue to the manufacturers is obviously important, however erosion of consumer confidence, and liability for adverse health effects or performance caused by poor quality product can be of even greater significance. Biocode has developed a novel approach to product marking and identification that utilizes molecular binding pair technologies such as immunoassay. The sensitivity, specificity, and ease of use of immunoassay provides a powerful method for detecting trace levels of intentionally added chemical markers. Using the diversity of the immune response, Biocode has developed a library of binding molecules and highly sensitive immunoassay systems for detection and measurement of a variety of chemical markers. The markers have been selected based on their stability and compatibility within various types of products. For food, beverage, and pharmaceutical applications, common and naturally occurring food ingredients and pharmaceutical excipients provide markers which are safe, readily available, and already approved for use. For other applications such as fuel and lubricant marking. Solubility and chemical stability of the markers are a major consideration. In addition to incorporating markers directly into products, Biocode has also developed invisible inks that can be printed onto the surface of products, packaging, or labels. The trace levels of marker that is printed onto the surface of a product or package can only be revealed by using the complementary binding pair that has been developed by Biocode. This technology provides for simple field tests and very high level of security as it is virtually impossible to copy.

  9. Sex specific molecular responses of quick-to-court protein in Indian malarial vector Anopheles culicifacies: conflict of mating versus blood feeding behaviour

    Directory of Open Access Journals (Sweden)

    Tanwee Das De

    2017-07-01

    Full Text Available Understanding the molecular basis of mosquito behavioural complexity plays a central role in designing novel molecular tools to fight against their vector-borne diseases. Although the olfactory system plays an important role in guiding and managing many behavioural responses including feeding and mating, but the sex-specific regulation of olfactory responses remain poorly investigated. From our ongoing transcriptomic data annotation of olfactory tissue of blood fed adult female An. culicifacies mosquitoes; we have identified a 383 bp long unique transcript encoding a Drosophila homolog of the quick-to-court protein. Previously this was shown to regulate courtship behaviour in adult male Drosophila. A comprehensive in silico analysis of the quick-to-court (qtc gene of An. culicifacies (Ac-qtc predicts a 1536 bp single copy gene encoding 511 amino acid protein, having a high degree of conservation with other insect homologs. The age-dependent increased expression of putative Ac-qtc correlated with the maturation of the olfactory system, necessary to meet the sex-specific conflicting demand of mating (mate finding versus host-seeking behavioural responses. Sixteen to eighteen hours of starvation did not alter Ac-qtc expression in both sexes, however, blood feeding significantly modulated its response in the adult female mosquitoes, confirming that it may not be involved in sugar feeding associated behavioural regulation. Finally, a dual behavioural and molecular assay indicated that natural dysregulation of Ac-qtc in the late evening might promote the mating events for successful insemination. We hypothesize that Ac-qtc may play a unique role to regulate the sex-specific conflicting demand of mosquito courtship behaviour versus blood feeding behaviour in the adult female mosquitoes. Further elucidation of this molecular mechanism may provide further information to evaluate Ac-qtc as a key molecular target for mosquito-borne disease management.

  10. Construction and characterization of HIV type 1 CRF07_BC infectious molecular clone from men who have sex with men.

    Science.gov (United States)

    Jiang, Yan-Ling; Bai, Wen-Wei; Qu, Fan-Wei; Ma, Hua; Jiang, Run-Sheng; Shen, Bao-Sheng

    2016-03-01

    This study aimed to investigate the biological characterization of HIV type 1 (HIV-1) CRF07_BC infection among men who have sex with men (MSM). From November 2011 to November 2013, a total of 66 blood samples were collected from MSM with acute HIV-1 infection with CRF07_BC subgroup strains. Deletion in the gag p6 region was detected by sequence alignment and comparative analysis. Peripheral blood mononuclear cells (PBMCs) of HNXX1301-1307 samples were separated by density gradient centrifugation. Nested polymerase chain reaction (nPCR) was used to amplify the viral DNA. The near full-length HIV-1 DNA products were ligated to the long terminal repeat (LTR) vector plasmid (07BCLTR) to construct a full-length HIV clone. The molecular clone was transfected into HEK-293T cells, TZM-b1 cells and patients' PBMCs. The pregenome of an infectious molecular clone of HIV-1 (pNL4-3) was amplified, and a subclone with CRF07_BC was developed to construct the full-length chimeric molecular clone pNL4-3/07BCLTR. Detection of p24 antigen and luciferase activity was used to measure the in vitro infectivity of pNL4-3/07BCLTR. Among the 66 MSM patients infected with CRF07_BC strains, deletion mutations of the Gag P6 proteins were found in 7 of 18CRF07_BC strains; deletion mutations of 2-13 amino acids in different regions were discovered in 6 strains; and the remaining 42 strains did not show deletions. Seven strains with amino acids deficiency in the P6 protein accounted for 27% of all strains and 75% of all deletion genotype strains. A total of 186 full-length molecular clones of CRF07_BC were constructed. There were 5, 9, 10 and 11 clones of HNXX1302, HNXX1304, HNXX1305 and HNXX1306 that resulted in p24-positive supernatant when transfected into HEK-293T cells. Full-length clones of HNXX1302, HNXX1304, HNXX1305 and HNXX1306 showed slight infection in the transfected TZM-b1 cells, as judged by the fluorescence values of TZM-b1 cells 48h post-transfection. However, we were unable to

  11. Identification and Validation of a New Male Sex-Specific ISSR Marker in Pointed Gourd (Trichosanthes dioica Roxb.

    Directory of Open Access Journals (Sweden)

    Sinchan Adhikari

    2014-01-01

    Full Text Available The aim of the present study was to develop a genetic sex marker for the pointed gourd (Trichosanthes dioica Roxb. to allow gender determination at any stage in the life cycle. Screening of genomic DNA with intersimple sequence repeat (ISSR primers was used to discover sex-specific touch-down polymerase chain reaction (Td-PCR amplification products. Using pooled DNA from male and female genotypes and 42 ISSR primers, a putative male specific marker (~550 bp was identified. DNA marker specific to male is an indication of existence of nonepigenetic factors involved in gender development in pointed gourd. The ISSR technique has proved to be a reliable technique in gender determination of pointed gourd genotypes at the seedling phenophase. The sex marker developed here could also be used as a starting material towards sequence characterization of sex linked genes for better understanding the developmental as well as evolutionary pathways in sexual dimorphism.

  12. Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST

    NARCIS (Netherlands)

    O'Donnell, K.; Humber, R.A.; Geiser, D.M.; Kang, S.; Robert, V.; Park, B.; Crous, P.W.; Johnston, P.; Aoki, T.; Rooney, A.P.; Rehner, S.A.

    2012-01-01

    We constructed several multilocus DNA sequence datasets to assess the phylogenetic diversity of insecticolous fusaria, especially focusing on those housed at the Agricultural Research Service Collection of Entomopathogenic Fungi (ARSEF), and to aid molecular identifications of unknowns via the

  13. Gender and gonadal maturity stage identification of captive Chinese sturgeon, Acipenser sinensis, using ultrasound imagery and sex steroids.

    Science.gov (United States)

    Du, Hao; Zhang, Xiaoyan; Leng, Xiaoqian; Zhang, Shuhuan; Luo, Jiang; Liu, Zhigang; Qiao, Xingmei; Kynard, Boyd; Wei, Qiwei

    2017-05-01

    Long lifespan and late maturation make it difficult to establish gamete maturity and breeding age of captive endangered Chinese sturgeon, Acipenser sinensis. This greatly handicaps timely breeding and future conservation stocking efforts. We used ultrasound imagery and sex steroids to determine the gender and gonadal maturity stage of captive Chinese sturgeon (age, 10-17years old). The echogenicity of the reproductive organs and the respective morphology of the gonads were described and two quantitative parameters p o (proportion of the ovary to the entire reproductive organs) and d (thickness of the reproductive organs) were measured to characterize sex and maturity stage of Chinese sturgeon. Females were accordingly placed fish into several categories: F II (F II - , F II , F II + ), F III (F III , F III + ) and F IV (F IV , F IV + ) and F VI and males as M II , M III , M IV , M V and M VI . The accuracy of gender and maturity stage determination provided by ultrasonographic methods was 72.7% for F II - ovary (n=11) and 76.2% for M II testis (n=42). Accuracy of sex and maturity determination using only serum sex steroid of testosterone (T) and estradiol-17β (E 2 ) was low (58-73%, depending on maturity stage). However, when the two methods were used together, accuracy increased sharply, especially for immature (II stage) females. In summary, of 151 Chinese sturgeon, whose sex and maturity stage were independently confirmed, 88.1% (n=133), 62.9% (n=95), and 96.7% (n=146) were successfully sexed and staged using ultrasound, sex steroids, or both methods, respectively. The results provide reliable non-invasive techniques for determining sex and gonadal maturation of captive Chinese sturgeon. These methods can track individual gonad characteristics over multi-year reproductive cycles, which will assist captive broodstock management, artificial reproduction, and future conservation stocking. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Identification of the pheromone biosynthesis genes from the sex pheromone gland transcriptome of the diamondback moth, Plutella xylostella

    OpenAIRE

    Chen, Da-Song; Dai, Jian-Qing; Han, Shi-Chou

    2017-01-01

    The diamondback moth was estimated to increase costs to the global agricultural economy as the global area increase of Brassica vegetable crops and oilseed rape. Sex pheromones traps are outstanding tools available in Integrated Pest Management for many years and provides an effective approach for DBM population monitoring and control. The ratio of two major sex pheromone compounds shows geographical variations. However, the limitation of our information in the DBM pheromone biosynthesis damp...

  15. Molecular Epidemiology of HIV-1 Infection among Men who Have Sex with Men in Taiwan in 2012.

    Directory of Open Access Journals (Sweden)

    Szu-Wei Huang

    Full Text Available The number of men who have sex with men (MSM infected with HIV-1 in Taiwan has increased rapidly in the past few years. The goal of this study was to conduct a molecular epidemiological study of HIV-1 infection among MSM in Taiwan to identify risk factors for intervention. Voluntary counseling program and anonymous testing were provided to patrons at 1 gay bar, 7 night clubs and 3 gay saunas in Taipei and New Taipei Cities in 2012. HIV-1 subtypes were determined using gag subtype-specific PCR and phylogenetic analysis by env sequences. Recent HIV-1 infection was determined using LAg-Avidity EIA. In-depth interviews and questionnaires were used to identify risk factors. The prevalence and incidence of HIV-1 among MSM in Taiwan were 4.38% (53/1,208 and 3.29 per 100 person-years, respectively. Of 49 cases genotyped, 48 (97.9% were infected with subtype B and 1 with CRF01_AE (2%. Phylogenetic analysis of 46 HIV-1 strains showed that 25 (54.4% subtype B strains formed 9 clusters with each other or with other local strains. The CRF01_AE case clustered with a reference strain from a Thai blood donor with bootstrap value of 99. Multivariate logistic regression analysis showed that risk factors associated with HIV-1 infection included use of oil-based solution as lubricant (vs. saliva or water-based lubricants, OR= 4.23; p <0.001; exclusively receptive role (vs. insertive role, OR= 9.69; p <0.001; versatile role (vs. insertive role, OR= 6.45; p= 0.003; oral sex (vs. insertive role, OR= 11.93; p= 0.044; times of sexual contact per week (2-3 vs. zero per week, OR= 3.41; p= 0.021; illegal drug use (OR= 4.12; p <0.001; and history of sexually transmitted diseases (OR= 3.65; p= 0.002. In conclusion, there was no new HIV-1 subtype or circulating recombinant form responsible for the increase of HIV-1 among MSM in Taiwan in 2012. Misuse of oil-based solution as lubricant is a new risk factor identified among MSM in Taiwan. The Taiwan's Centers for Disease

  16. Identification of a 5-protein biomarker molecular signature for predicting Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Martín Gómez Ravetti

    Full Text Available BACKGROUND: Alzheimer's disease (AD is a progressive brain disease with a huge cost to human lives. The impact of the disease is also a growing concern for the governments of developing countries, in particular due to the increasingly high number of elderly citizens at risk. Alzheimer's is the most common form of dementia, a common term for memory loss and other cognitive impairments. There is no current cure for AD, but there are drug and non-drug based approaches for its treatment. In general the drug-treatments are directed at slowing the progression of symptoms. They have proved to be effective in a large group of patients but success is directly correlated with identifying the disease carriers at its early stages. This justifies the need for timely and accurate forms of diagnosis via molecular means. We report here a 5-protein biomarker molecular signature that achieves, on average, a 96% total accuracy in predicting clinical AD. The signature is composed of the abundances of IL-1alpha, IL-3, EGF, TNF-alpha and G-CSF. METHODOLOGY/PRINCIPAL FINDINGS: Our results are based on a recent molecular dataset that has attracted worldwide attention. Our paper illustrates that improved results can be obtained with the abundance of only five proteins. Our methodology consisted of the application of an integrative data analysis method. This four step process included: a abundance quantization, b feature selection, c literature analysis, d selection of a classifier algorithm which is independent of the feature selection process. These steps were performed without using any sample of the test datasets. For the first two steps, we used the application of Fayyad and Irani's discretization algorithm for selection and quantization, which in turn creates an instance of the (alpha-beta-k-Feature Set problem; a numerical solution of this problem led to the selection of only 10 proteins. CONCLUSIONS/SIGNIFICANCE: the previous study has provided an extremely

  17. Microbial quality and molecular identification of cultivable microorganisms isolated from an urban drinking water distribution system (Limassol, Cyprus).

    Science.gov (United States)

    Botsaris, George; Kanetis, Loukas; Slaný, Michal; Parpouna, Christiana; Makris, Konstantinos C

    2015-12-01

    Microorganisms can survive and multiply in aged urban drinking water distribution systems, leading to potential health risks. The objective of this work was to investigate the microbial quality of tap water and molecularly identify its predominant cultivable microorganisms. Tap water samples collected from 24 different households scattered in the urban area of Limassol, Cyprus, were microbiologically tested following standard protocols for coliforms, E. coli, Pseudomonas spp., Enterococcus spp., and total viable count at 22 and 37 °C. Molecular identification was performed on isolated predominant single colonies using 16SrRNA sequencing. Approximately 85% of the household water samples were contaminated with one or more microorganisms belonging to the genera of Pseudomonas, Corynebacterium, Agrobacterium, Staphylococcus, Bacillus, Delftia, Acinetobacter, Enterococcus, Enterobacter, and Aeromonas. However, all samples tested were free from E. coli. This is the first report in Cyprus molecularly confirming specific genera of relevant microbial communities in tap water.

  18. [Identification of mycobacteria to the species level by molecular methods in the Public Health Laboratory of Bogotá, Colombia].

    Science.gov (United States)

    Hernández-Toloza, Johana Esther; Rincón-Serrano, María de Pilar; Celis-Bustos, Yamile Adriana; Aguillón, Claudia Inés

    2016-01-01

    Global epidemiology of non-tuberculous mycobacteria (NTM) is unknown due to the fact that notification is not required in many countries, however the number of infection reports and outbreaks caused by NTM suggest a significant increase in the last years. Traditionally, mycobacteria identification is made through biochemical profiles which allow to differentiate M. tuberculosis from NTM, and in some cases the mycobacteria species. Nevertheless, these methods are technically cumbersome and time consuming. On the other hand, the introduction of methods based on molecular biology has improved the laboratory diagnosis of NTM. To establish the NTM frequency in positive cultures for acid-fast bacilli (AAFB) which were sent to Laboratorio de Salud Pública de Bogotá over a 12 month period. A total of 100 positive cultures for acid-fast bacilli from public and private hospitals from Bogotá were identified by both biochemical methods and the molecular methods PRA (PCR-restriction enzyme analysis) and multiplex-PCR. Furthermore, low prevalence mycobacteria species and non-interpretable results were confirmed by 16SrDNA sequentiation analysis. Identification using the PRA method showed NMT occurrence in 11% of cultures. In addition, this molecular methodology allowed to detect the occurrence of more than one mycobacteria in 4% of the cultures. Interestingly, a new M. kubicae pattern of PCR-restriction analysis is reported in our study. Using a mycobacteria identification algorithm, which includes the molecular method PRA, improves the diagnostic power of conventional methods and could help to advance both NTM epidemiology knowledge and mycobacteriosis control. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  19. Identification of sex-specific urinary biomarkers for major depressive disorder by combined application of NMR- and GC-MS-based metabonomics.

    Science.gov (United States)

    Zheng, P; Chen, J-J; Zhou, C-J; Zeng, L; Li, K-W; Sun, L; Liu, M-L; Zhu, D; Liang, Z-H; Xie, P

    2016-11-15

    Women are more vulnerable to major depressive disorder (MDD) than men. However, molecular biomarkers of sex differences are limited. Here we combined gas chromatography-mass spectrometry (GC-MS)- and nuclear magnetic resonance (NMR)-based metabonomics to investigate sex differences of urinary metabolite markers in MDD, and further explore their potential of diagnosing MDD. Consequently, the metabolite signatures of women and men MDD subjects were significantly different from of that in their respective healthy controls (HCs). Twenty seven women and 36 men related differentially expressed metabolites were identified in MDD. Fourteen metabolites were changed in both women and men MDD subjects. Significantly, the women-specific (m-Hydroxyphenylacetate, malonate, glycolate, hypoxanthine, isobutyrate and azelaic acid) and men-specific (tyrosine, N-acetyl-d-glucosamine, N-methylnicotinamide, indoxyl sulfate, citrate and succinate) marker panels were further identified, which could differentiate men and women MDD patients from their respective HCs with higher accuracy than previously reported sex-nonspecific marker panels. Our findings demonstrate that men and women MDD patients have distinct metabonomic signatures and sex-specific biomarkers have promising values in diagnosing MDD.

  20. Molecular Epidemiology of HIV-1 Infection among Men who Have Sex with Men in Taiwan in 2012

    Science.gov (United States)

    Huang, Szu-Wei; Wang, Sheng-Fan; Cowó, Ángel E.; Chen, Marcelo; Lin, Yu-Ting; Hung, Chun-Po; Chen, Yi-Hsien; Yang, Jyh-Yuan; Tang, Hung-Jen; Chen, Yi-Ming Arthur

    2015-01-01

    The number of men who have sex with men (MSM) infected with HIV-1 in Taiwan has increased rapidly in the past few years. The goal of this study was to conduct a molecular epidemiological study of HIV-1 infection among MSM in Taiwan to identify risk factors for intervention. Voluntary counseling program and anonymous testing were provided to patrons at 1 gay bar, 7 night clubs and 3 gay saunas in Taipei and New Taipei Cities in 2012. HIV-1 subtypes were determined using gag subtype-specific PCR and phylogenetic analysis by env sequences. Recent HIV-1 infection was determined using LAg-Avidity EIA. In-depth interviews and questionnaires were used to identify risk factors. The prevalence and incidence of HIV-1 among MSM in Taiwan were 4.38% (53/1,208) and 3.29 per 100 person-years, respectively. Of 49 cases genotyped, 48 (97.9%) were infected with subtype B and 1 with CRF01_AE (2%). Phylogenetic analysis of 46 HIV-1 strains showed that 25 (54.4%) subtype B strains formed 9 clusters with each other or with other local strains. The CRF01_AE case clustered with a reference strain from a Thai blood donor with bootstrap value of 99. Multivariate logistic regression analysis showed that risk factors associated with HIV-1 infection included use of oil-based solution as lubricant (vs. saliva or water-based lubricants, OR= 4.23; p Taiwan in 2012. Misuse of oil-based solution as lubricant is a new risk factor identified among MSM in Taiwan. The Taiwan’s Centers for Disease Control has created a video (www.youtube.com/watch?v=BinExvvOTMM&feature=iv&src_vid=BW81-PfmY3E&annotation_id=annotation_2436493705) to correct such misconception in its AIDS prevention campaign. PMID:26039757

  1. Molecular Epidemiology of HIV-1 Infection among Men who Have Sex with Men in Taiwan in 2012.

    Science.gov (United States)

    Huang, Szu-Wei; Wang, Sheng-Fan; Cowó, Ángel E; Chen, Marcelo; Lin, Yu-Ting; Hung, Chun-Po; Chen, Yi-Hsien; Yang, Jyh-Yuan; Tang, Hung-Jen; Chen, Yi-Ming Arthur

    2015-01-01

    The number of men who have sex with men (MSM) infected with HIV-1 in Taiwan has increased rapidly in the past few years. The goal of this study was to conduct a molecular epidemiological study of HIV-1 infection among MSM in Taiwan to identify risk factors for intervention. Voluntary counseling program and anonymous testing were provided to patrons at 1 gay bar, 7 night clubs and 3 gay saunas in Taipei and New Taipei Cities in 2012. HIV-1 subtypes were determined using gag subtype-specific PCR and phylogenetic analysis by env sequences. Recent HIV-1 infection was determined using LAg-Avidity EIA. In-depth interviews and questionnaires were used to identify risk factors. The prevalence and incidence of HIV-1 among MSM in Taiwan were 4.38% (53/1,208) and 3.29 per 100 person-years, respectively. Of 49 cases genotyped, 48 (97.9%) were infected with subtype B and 1 with CRF01_AE (2%). Phylogenetic analysis of 46 HIV-1 strains showed that 25 (54.4%) subtype B strains formed 9 clusters with each other or with other local strains. The CRF01_AE case clustered with a reference strain from a Thai blood donor with bootstrap value of 99. Multivariate logistic regression analysis showed that risk factors associated with HIV-1 infection included use of oil-based solution as lubricant (vs. saliva or water-based lubricants, OR= 4.23; p watch?v=BinExvvOTMM&feature=iv&src_vid=BW81-PfmY3E&annotation_id=annotation_2436493705) to correct such misconception in its AIDS prevention campaign.

  2. Genetic species identification in weatherfish and first molecular confirmation of Oriental Weatherfish Misgurnus anguillicaudatus (Cantor, 1842 in Central Europe

    Directory of Open Access Journals (Sweden)

    Belle Christina C.

    2017-01-01

    Full Text Available The Oriental Weatherfish is considered a globally invasive fish species. In Europe, several reported feral populations of Oriental Weatherfish display an overlapping distribution range with native weatherfish Misgurnus fossilis, a declining species of international conservation and aquatic management concern. Morphologically distinguishing the different weatherfish species can be difficult, as their coloration is highly variable, many species reveal high phenotypic plasticity, and morphological traits like coloration might be not obvious or might be degraded during field sampling and after preservation. Herein, we analysed suspicious weatherfish specimens from southern Germany, demonstrating the usefulness of molecular genetic species identifications in this genus. We present the first molecular genetic species record of Misgurnus anguillicaudatus in Central Europe, and confirm the range expansion of Oriental Weatherfish into the river Inn catchment in southern Germany. As accurate species identification is crucial both in the context of monitoring and conserving native endangered species, and in early detection and prevention of biological invasion, we suggest the standard use of genetic species identification if morphological traits are not obvious.

  3. Molecular Identification and Echinocandin Susceptibility of Candida parapsilosis Complex Bloodstream Isolates in Italy, 2007-2014.

    Directory of Open Access Journals (Sweden)

    Grazia Lovero

    Full Text Available The Candida parapsilosis group encompasses three species: C. parapsilosis, C. orthopsilosis, and C. metapsilosis. Here, we describe the incidence and echinocandin susceptibility profile of bloodstream isolates of these three species collected from patients admitted to an Italian university hospital from 2007 to 2014. Molecular identification of cryptic species of the C. parapsilosis complex was performed using polymerase chain reaction amplification of the gene encoding secondary alcohol dehydrogenase, followed by digestion with the restriction enzyme BanI. Minimum inhibitory concentrations were determined using the broth microdilution method according to European Committee for Antimicrobial Susceptibility Testing (EUCAST EDef 7.2 and Clinical Laboratory Standards Institute (CLSI M27-A3 guidelines, and the results were compared with those obtained using the E-test and Sensititre methods. Of the 163 C. parapsilosis complex isolates, 136 (83.4% were identified as C. parapsilosis, and 27 (16.6% as C. orthopsilosis. The species-specific incidences were 2.9/10,000 admissions for C. parapsilosis and 0.6/10,000 admissions for C. orthopsilosis. No resistance to echinocandins was detected with any of the methods. The percent essential agreement (EA between the EUCAST and E-test/Sensititre methods for anidulafungin, caspofungin, and micafungin susceptibility was, respectively, as follows: C. parapsilosis, 95.6/97.8, 98.5/88.2, and 93.4/96.3; C. orthopsilosis, 92.6/92.6, 96.3/77.8, and 63.0/66.7. The EA between the CLSI and E-test/Sensititre methods was, respectively, as follows: C. parapsilosis, 99.3/100, 98.5/89.0, and 96.3/98.5; C. orthopsilosis, 96.3/92.6, 100/81.5, and 92.6/88.9. Only minor discrepancies, ranging from 16.9% (C. parapsilosis to 11.1% (C. orthopsilosis, were observed between the CLSI and E-test/Sensititre methods. In conclusion, this epidemiologic study shows a typical C. parapsilosis complex species distribution, no echinocandin

  4. Identification and analysis of evolutionary selection pressures acting at the molecular level in five forkhead subfamilies.

    Science.gov (United States)

    Fetterman, Christina D; Rannala, Bruce; Walter, Michael A

    2008-09-24

    Members of the forkhead gene family act as transcription regulators in biological processes including development and metabolism. The evolution of forkhead genes has not been widely examined and selection pressures at the molecular level influencing subfamily evolution and differentiation have not been explored. Here, in silico methods were used to examine selection pressures acting on the coding sequence of five multi-species FOX protein subfamily clusters; FoxA, FoxD, FoxI, FoxO and FoxP. Application of site models, which estimate overall selection pressures on individual codons throughout the phylogeny, showed that the amino acid changes observed were either neutral or under negative selection. Branch-site models, which allow estimated selection pressures along specified lineages to vary as compared to the remaining phylogeny, identified positive selection along branches leading to the FoxA3 and Protostomia clades in the FoxA cluster and the branch leading to the FoxO3 clade in the FoxO cluster. Residues that may differentiate paralogs were identified in the FoxA and FoxO clusters and residues that differentiate orthologs were identified in the FoxA cluster. Neutral amino acid changes were identified in the forkhead domain of the FoxA, FoxD and FoxP clusters while positive selection was identified in the forkhead domain of the Protostomia lineage of the FoxA cluster. A series of residues under strong negative selection adjacent to the N- and C-termini of the forkhead domain were identified in all clusters analyzed suggesting a new method for refinement of domain boundaries. Extrapolation of domains among cluster members in conjunction with selection pressure information allowed prediction of residue function in the FoxA, FoxO and FoxP clusters and exclusion of known domain function in residues of the FoxA and FoxI clusters. Consideration of selection pressures observed in conjunction with known functional information allowed prediction of residue function and

  5. Identification and analysis of evolutionary selection pressures acting at the molecular level in five forkhead subfamilies

    Directory of Open Access Journals (Sweden)

    Rannala Bruce

    2008-09-01

    Full Text Available Abstract Background Members of the forkhead gene family act as transcription regulators in biological processes including development and metabolism. The evolution of forkhead genes has not been widely examined and selection pressures at the molecular level influencing subfamily evolution and differentiation have not been explored. Here, in silico methods were used to examine selection pressures acting on the coding sequence of five multi-species FOX protein subfamily clusters; FoxA, FoxD, FoxI, FoxO and FoxP. Results Application of site models, which estimate overall selection pressures on individual codons throughout the phylogeny, showed that the amino acid changes observed were either neutral or under negative selection. Branch-site models, which allow estimated selection pressures along specified lineages to vary as compared to the remaining phylogeny, identified positive selection along branches leading to the FoxA3 and Protostomia clades in the FoxA cluster and the branch leading to the FoxO3 clade in the FoxO cluster. Residues that may differentiate paralogs were identified in the FoxA and FoxO clusters and residues that differentiate orthologs were identified in the FoxA cluster. Neutral amino acid changes were identified in the forkhead domain of the FoxA, FoxD and FoxP clusters while positive selection was identified in the forkhead domain of the Protostomia lineage of the FoxA cluster. A series of residues under strong negative selection adjacent to the N- and C-termini of the forkhead domain were identified in all clusters analyzed suggesting a new method for refinement of domain boundaries. Extrapolation of domains among cluster members in conjunction with selection pressure information allowed prediction of residue function in the FoxA, FoxO and FoxP clusters and exclusion of known domain function in residues of the FoxA and FoxI clusters. Conclusion Consideration of selection pressures observed in conjunction with known

  6. Identification and characterization of contrasting sunflower genotypes to early leaf senescence process combining molecular and physiological studies (Helianthus annuus L.).

    Science.gov (United States)

    López Gialdi, A I; Moschen, S; Villán, C S; López Fernández, M P; Maldonado, S; Paniego, N; Heinz, R A; Fernandez, P

    2016-09-01

    Leaf senescence is a complex mechanism ruled by multiple genetic and environmental variables that affect crop yields. It is the last stage in leaf development, is characterized by an active decline in photosynthetic rate, nutrients recycling and cell death. The aim of this work was to identify contrasting sunflower inbred lines differing in leaf senescence and to deepen the study of this process in sunflower. Ten sunflower genotypes, previously selected by physiological analysis from 150 inbred genotypes, were evaluated under field conditions through physiological, cytological and molecular analysis. The physiological measurement allowed the identification of two contrasting senescence inbred lines, R453 and B481-6, with an increase in yield in the senescence delayed genotype. These findings were confirmed by cytological and molecular analysis using TUNEL, genomic DNA gel electrophoresis, flow sorting and gene expression analysis by qPCR. These results allowed the selection of the two most promising contrasting genotypes, which enables future studies and the identification of new biomarkers associated to early senescence in sunflower. In addition, they allowed the tuning of cytological techniques for a non-model species and its integration with molecular variables. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. Molecular identification of Taenia serialis coenurosis in a wild Ethiopian gelada (Theropithecus gelada).

    Science.gov (United States)

    Schneider-Crease, India A; Snyder-Mackler, Noah; Jarvey, Julie C; Bergman, Thore J

    2013-11-15

    Since morphological identification of a larval Taeniid in geladas (Theropithecus gelada) has produced inconsistent results, genetic information is pivotal for species identification. Nuclear and mitochondrial DNA from a coenurus in a wild gelada were compared to published sequences from multiple Taeniid species, confirming the identification of this parasite as Taenia serialis. A demographic analysis finds age to be a strong predictor of coenuri. Tapeworms rarely employ primates as intermediate hosts, and the presence of T. serialis in a wild gelada population may indicate a substantial ecological shift in this parasite's life cycle. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Identification of Potential Herbal Inhibitor of Acetylcholinesterase Associated Alzheimer’s Disorders Using Molecular Docking and Molecular Dynamics Simulation

    Directory of Open Access Journals (Sweden)

    Chandrabhan Seniya

    2014-01-01

    Full Text Available Cholinesterase inhibitors (ChE-Is are the standard for the therapy of AD associated disorders and are the only class of approved drugs by the Food and Drug Administration (FDA. Additionally, acetylcholinesterase (AChE is the target for many Alzheimer’s dementia drugs which block the function of AChE but have some side effects. Therefore, in this paper, an attempt was made to elucidate cholinesterase inhibition potential of secondary metabolite from Cannabis plant which has negligible or no side effect. Molecular docking of 500 herbal compounds, against AChE, was performed using Autodock 4.2 as per the standard protocols. Molecular dynamics simulations have also been carried out to check stability of binding complex in water for 1000 ps. Our molecular docking and simulation have predicted high binding affinity of secondary metabolite (C28H34N2O6 to AChE. Further, molecular dynamics simulations for 1000 ps suggest that ligand interaction with the residues Asp72, Tyr70-121-334, and Phe288 of AChE, all of which fall under active site/subsite or binding pocket, might be critical for the inhibitory activity of AChE. This approach might be helpful to understand the selectivity of the given drug molecule in the treatment of Alzheimer's disease. The study provides evidence for consideration of C28H34N2O6 as a valuable small ligand molecule in treatment and prevention of AD associated disorders and further in vitro and in vivo investigations may prove its therapeutic potential.

  9. What Bacteria Are Living in My Food?: An Open-Ended Practical Series Involving Identification of Unknown Foodborne Bacteria Using Molecular Techniques

    Science.gov (United States)

    Prasad, Prascilla; Turner, Mark S.

    2011-01-01

    This open-ended practical series titled "Molecular Identification of Unknown Food Bacteria" which extended over a 6-week period was designed with the aims of giving students an opportunity to gain an understanding of naturally occurring food bacteria and skills in contemporary molecular methods using real food samples. The students first isolated…

  10. Identification of two components of the female sex pheromone of the sugarcane-borer Diatraea flavipennella (Lepidoptera: Crambidae)

    Czech Academy of Sciences Publication Activity Database

    Kalinová, Blanka; do Nascimento, R. R.; Hoskovec, Michal; Mendonca, A. L.; Silva, E. L.; De Freitas, M. R. T.; Cabral Jr, C. R.; Silva, C. E.; Santana, A. E. G.; Svatoš, Aleš

    2012-01-01

    Roč. 136, č. 3 (2012), s. 203-211 ISSN 0931-2048 Institutional research plan: CEZ:AV0Z40550506 Keywords : Diatraea flavipennella * sex pheromone * GCxGC-TOFMS * GC-EAD Subject RIV: CC - Organic Chemistry Impact factor: 1.560, year: 2012

  11. Molecular characterization of the gene feminizer in the stingless bee Melipona interrupta (Hymenoptera: Apidae) reveals association to sex and caste development.

    Science.gov (United States)

    Brito, Diana V; Silva, Carlos Gustavo N; Hasselmann, Martin; Viana, Luciana S; Astolfi-Filho, Spartaco; Carvalho-Zilse, Gislene A

    2015-11-01

    In highly eusocial insects, development of reproductive traits are regulated not only by sex determination pathway, but it also depends on caste fate. The molecular basis of both mechanisms in stingless bees and possible interaction with each other is still obscure. Here, we investigate sex determination in Melipona interrupta, focusing on characterization and expression analysis of the feminizer gene (Mi-fem), and its association to a major component of caste determination, the juvenile hormone (JH). We present evidence that Mi-fem mRNA is sex-specifically spliced in which only the female splice variant encodes the full length protein, following the same principle known for other bee species. We quantified Mi-fem expression among developmental stages, sexes and castes. Mi-fem expression varies considerably throughout development, with higher expression levels in embryos. Also, fem levels in pupae and newly emerged adults were significantly higher in queens than workers and males. Finally, we ectopically applied JH in cocoon spinning larvae, which correspond to the time window where queen/worker phenotypes diverge. We observed a significantly increase in Mi-fem expression compared to control groups. Since up to 100% of females turn into queens when treated with JH (while control groups are composed mainly of workers), we propose that fem might act to regulate queens' development. Our findings provide support for the conserved regulatory function of fem in Melipona bees and demonstrate a significant correlation between key elements of sex and caste determination pathways, opening the avenue to further investigate the molecular basis of these complex traits. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Identification of microorganisms involved in nitrogen removal from wastewater treatment systems by means of molecular biology techniques

    International Nuclear Information System (INIS)

    Figueroa, M.; Alonso-Gutierrez, J.; Campos, J. L.; Mendez, R.; Mosquera-Corral, A.

    2010-01-01

    The identification of the main bacteria populations present in the granular biomass from a biological reactor treating wastewater has been performed by applying two different molecular biology techniques. By means of the DGGE technique five different genera of heterotrophic bacteria (Thiothrix, Thauera, Cloroflexi, Comamonas y Zoogloea) and one of ammonia oxidizing bacteria (Nitrosomanas) were identified. The FISH technique, based on microscopy, allowed the in situ visualization and quantification of those microorganisms. Special attention was paid to filamentous bacteria distribution (Thiothrix and Cloroflexi) which could exert a structural function in aerobic granular sludge. (Author) 26 refs.

  13. Identification of Novel Molecular Targets for Pleckstrin Homology (PH) Domains Found in Oncogenes Implicated in Breast Cancer

    Science.gov (United States)

    2008-03-01

    roles as a positive regulator of IL- 2 gene induction in T cells (Deckert et al, 1998), NK cell-mediated cytotoxicity (Jevremovic et al, 2001), and FcRI...Identification of a gene encoding a human oxysterol-binding protein-homologue: a potential general molecular marker for blood dissemination of solid...Biol. 6(5), 384-385. Scanlan, MJ, Gout , I, Gordon, CM, Williamson, B, Stockert, E, Gure, AO, Jager, D, Chen, YT, Mackay, A, O’Hare, MJ, and Old LJ

  14. Phosphoproteomic analysis for the identification of predictive molecular factors and new molecular targets in breast, colorectal, ovary, and lung cancer

    International Nuclear Information System (INIS)

    Belluco, C.; De Paoli, P.

    2009-01-01

    Neoadjuvant chemotherapy is a standard therapeutic approach for several types of locally advanced and metastatic tumors. Molecular factors predictive of response to therapy are highly needed for exploiting the potential benefit of properative chemotherapy. Moreover, neoadjuvant chemotherapy represents an ideal clinical model for studying predictive factors since it allows to obtain pre-treatment tissue biopsies which can be analyzed and the results compared to clinical and pathological response. Protein kinases represent some of the most important drug targets in medicine today and their aberrant activation are involved in many disease processes including cancer development and progression

  15. Molecular Identification of Atlantic Bluefin Tuna (Thunnus thynnus, Scombridae Larvae and Development of a DNA Character-Based Identification Key for Mediterranean Scombrids.

    Directory of Open Access Journals (Sweden)

    Gregory Neils Puncher

    Full Text Available The Atlantic bluefin tuna, Thunnus thynnus, is a commercially important species that has been severely over-exploited in the recent past. Although the eastern Atlantic and Mediterranean stock is now showing signs of recovery, its current status remains very uncertain and as a consequence their recovery is dependent upon severe management informed by rigorous scientific research. Monitoring of early life history stages can inform decision makers about the health of the species based upon recruitment and survival rates. Misidentification of fish larvae and eggs can lead to inaccurate estimates of stock biomass and productivity which can trigger demands for increased quotas and unsound management conclusions. Herein we used a molecular approach employing mitochondrial and nuclear genes (CO1 and ITS1, respectively to identify larvae (n = 188 collected from three spawning areas in the Mediterranean Sea by different institutions working with a regional fisheries management organization. Several techniques were used to analyze the genetic sequences (sequence alignments using search algorithms, neighbour joining trees, and a genetic character-based identification key and an extensive comparison of the results is presented. During this process various inaccuracies in related publications and online databases were uncovered. Our results reveal important differences in the accuracy of the taxonomic identifications carried out by different ichthyoplanktologists following morphology-based methods. While less than half of larvae provided were bluefin tuna, other dominant taxa were bullet tuna (Auxis rochei, albacore (Thunnus alalunga and little tunny (Euthynnus alletteratus. We advocate an expansion of expertise for a new generation of morphology-based taxonomists, increased dialogue between morphology-based and molecular taxonomists and increased scrutiny of public sequence databases.

  16. The identification of new substrates of human DHRS7 by molecular modeling and in vitro testing

    Czech Academy of Sciences Publication Activity Database

    Zemanová, L.; Palani, Kirubakaran; Pato, I. H.; Štambergová, H.; Vondrášek, Jiří

    2017-01-01

    Roč. 105, č. 1 (2017), s. 171-182 ISSN 0141-8130 R&D Projects: GA MŠk(CZ) LM2015047 Institutional support: RVO:61388963 Keywords : DHRS7 * SDR superfamily * SDR34C1 * homology modeling * molecular modeling Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 3.671, year: 2016

  17. Tick-Pathogen Interactions and Vector Competence: Identification of Molecular Drivers for Tick-Borne Diseases

    Czech Academy of Sciences Publication Activity Database

    de la Fuente, J.; Antunes, S.; Bonnet, S.; Cabezas Cruz, Alejandro; Domingos, A.G.; Estrada-Peňa, A.; Johnson, N.; Kocan, K.M.; Mansfield, K. L.; Nijhof, A.M.; Papa, A.; Rudenko, Natalia; Villar, M.; Alberdi, P.; Torina, A.; Ayllón, N.; Vancová, Marie; Golovchenko, Maryna; Grubhoffer, Libor; Caracappa, S.; Fooks, A. R.; Gortazar, C.; Rego, Ryan O. M.

    2017-01-01

    Roč. 7, APR 7 (2017), č. článku 114. ISSN 2235-2988 EU Projects: European Commission(XE) 278976 - ANTIGONE Institutional support: RVO:60077344 Keywords : tick * Anaplasma * flavivirus * Babesia * Borrelia * Microbiome * immunology * vaccine Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemistry and molecular biology Impact factor: 4.300, year: 2016

  18. Identification of molecular species of acylglycerols of Philippine wild edible mushroom, Ganoderma lucidum

    Science.gov (United States)

    Wild edible mushrooms are widely consumed in many countries. We successfully cultivated four edible, medicinal Philippine mushrooms in liquid culture. Recently, we identified the molecular species of acylglycerols in the lipid extract of mushroom G. lucidum NRRL66208. One hundred and three molecular...

  19. Molecular identification of Entamoeba species in savanna woodland chimpanzees (Pan troglodytes schweinfurthii)

    Czech Academy of Sciences Publication Activity Database

    Jirků-Pomajbíková, Kateřina; Čepička, I.; Kalousová, B.; Jirků, Milan; Stewart, F.; Levecke, B.; Modrý, David; Piel, A. K.; Petrželková, Klára Judita

    2016-01-01

    Roč. 143, č. 6 (2016), s. 741-748 ISSN 0031-1820 R&D Projects: GA ČR GA206/09/0927 Institutional support: RVO:60077344 Keywords : Entamoeba * molecular diversity * great apes * chimpanzee * savannah Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.713, year: 2016

  20. Molecular species identification with rich floristic sampling: DNA barcoding the pteridophyte flora of Japan.

    Directory of Open Access Journals (Sweden)

    Atsushi Ebihara

    Full Text Available BACKGROUND: DNA barcoding is expected to be an effective identification tool for organisms with heteromorphic generations such as pteridophytes, which possess a morphologically simple gametophyte generation. Although a reference data set including complete coverage of the target local flora/fauna is necessary for accurate identification, DNA barcode studies including such rich taxonomic sampling on a countrywide scale are lacking. METHODOLOGY/PRINCIPAL FINDINGS: The Japanese pteridophyte flora (733 taxa including subspecies and varieties was used to test the utility of two plastid DNA barcode regions (rbcL and trnH-psbA with the intention of developing an identification system for native gametophytes. DNA sequences were obtained from each of 689 (94.0% taxa for rbcL and 617 (84.2% taxa for trnH-psbA. Mean interspecific divergence values across all taxon pairs (K2P genetic distances did not reveal a significant difference in rate between trnH-psbA and rbcL, but mean K2P distances of each genus showed significant heterogeneity according to systematic position. The minimum fail rate of taxon discrimination in an identification test using BLAST (12.52% was obtained when rbcL and trnH-psbA were combined, and became lower in datasets excluding infraspecific taxa or apogamous taxa, or including sexual diploids only. CONCLUSIONS/SIGNIFICANCE: This study demonstrates the overall effectiveness of DNA barcodes for species identification in the Japanese pteridophyte flora. Although this flora is characterized by a high occurrence of apogamous taxa that pose a serious challenge to identification using DNA barcodes, such taxa are limited to a small number of genera, and only minimally detract from the overall success rate. In the case that a query sequence is matched to a known apogamous genus, routine species identification may not be possible. Otherwise, DNA barcoding is a practical tool for identification of most Japanese pteridophytes, and is especially

  1. Enzymatic amplification of a Y chromosome repeat in a single blastomere allows identification of the sex of preimplantation mouse embryos

    International Nuclear Information System (INIS)

    Bradbury, M.W.; Isola, L.M.; Gordon, J.W.

    1990-01-01

    The polymerase chain reaction (PCR) technique has been adapted to identify the sex of preimplantation mouse embryos rapidly. PCR was used to amplify a specific repeated DNA sequence on the Y chromosome from a single isolated blastomere in under 12 hr. The remainder of the biopsied embryo was then transferred to a pseudopregnant female and carried to term. Using this technique, 72% of embryos can be classed as potentially either male or female. Transfers of such embryos have produced pregnancies with 8/8 fetuses (100%) being of the predicted sex. Variations of the technique have demonstrated certain limitations to the present procedure as well as indicated possible strategies for improvement of the assay. The PCR technique may have wide application in the genetic analysis of preimplantation embryos

  2. Molecular Identification of Mycobacterium Tuberculosis and Analysis of Its Resistance to Rifampin in Sputa from Tuberculosis Suspected Patients

    International Nuclear Information System (INIS)

    Syaifudin, M.

    2010-01-01

    An accurate identification of different species of Mycobacterium provides to allow appropriate treatment for Mycobacterium tuberculosis infection. Beside that, drug resistance of M. tuberculosis strains to rifampin is not clearly understood in contributing to the spread of tuberculosis in Indonesia. To assess the molecular mechanism of rifampin resistance, a number of clinical specimens of M. tuberculosis were analyzed their molecular nature of a part of the rpoB gene using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) methods. DNA's extracted from sputum samples were amplified and 32 P-labeled by PCR with the specific primers and the product was analyzed their mutation conferring resistance by MDE gel electrophoresis. Of the 70 specimens tested, 57 specimens were positive for M. tuberculosis organism only, three specimens contained a mixture of M. tuberculosis and non tuberculosis mycobacteria (NTM), and 10 specimens were negative approved by Duplex PCR. Of these sixty DNA positive samples (thus the sensitivity of PCR was 85.71%), 5 (8.3%) of them suspected to contain mutations in rpoB which were associated with rifampin resistance. Even though the frequency of mutation was low, the results from our study clearly indicate that the molecular mechanism of rifampin resistance in M. tuberculosis isolates from Indonesia involves alterations in the rpoB gene. Molecular diagnosis by PCR which is fast and easy to perform is useful for early and rapid detection of TB in sputum specimen. (author)

  3. Identification of the pheromone biosynthesis genes from the sex pheromone gland transcriptome of the diamondback moth, Plutella xylostella.

    Science.gov (United States)

    Chen, Da-Song; Dai, Jian-Qing; Han, Shi-Chou

    2017-11-24

    The diamondback moth was estimated to increase costs to the global agricultural economy as the global area increase of Brassica vegetable crops and oilseed rape. Sex pheromones traps are outstanding tools available in Integrated Pest Management for many years and provides an effective approach for DBM population monitoring and control. The ratio of two major sex pheromone compounds shows geographical variations. However, the limitation of our information in the DBM pheromone biosynthesis dampens our understanding of the ratio diversity of pheromone compounds. Here, we constructed a transcriptomic library from the DBM pheromone gland and identified genes putatively involved in the fatty acid biosynthesis, pheromones functional group transfer, and β-oxidation enzymes. In addition, odorant binding protein, chemosensory protein and pheromone binding protein genes encoded in the pheromone gland transcriptome, suggest that female DBM moths may receive odors or pheromone compounds via their pheromone gland and ovipositor system. Tissue expression profiles further revealed that two ALR, three DES and one FAR5 genes were pheromone gland tissue biased, while some chemoreception genes expressed extensively in PG, pupa, antenna and legs tissues. Finally, the candidate genes from large-scale transcriptome information may be useful for characterizing a presumed biosynthetic pathway of the DBM sex pheromone.

  4. Identification of the sex pheromone of Lutzomyia longipalpis (Lutz & Neiva, 1912 (Diptera: Psychodidae from Asunción, Paraguay

    Directory of Open Access Journals (Sweden)

    Caballero Norath

    2009-11-01

    Full Text Available Abstract The sand fly Lutzomyia longipalpis is the main vector of Leishmania (L. infantum (Nicolle, the causative agent of American visceral leishmaniasis (AVL in the New World. Male Lu. longipalpis have secretory glands which produce sex pheromones in either abdominal tergites 4 or 3 and 4. These glands are sites of sex pheromone production and each pheromone type may represent true sibling species. In Latin America, apart from Lu. pseudolongipalpis Arrivillaga and Feliciangeli from Venezuela, populations of Lu. longipalpis s.l. can be identified by their male-produced sex pheromones: (S-9-methylgermacrene-B, 3-methyl-α-himachalene and the two cembrenes, 1 and 2. In this study, we present the results of a coupled gas chromatography - mass spectrometry analysis of the pheromones of males Lu. longipalpis captured in an endemic area of visceral leishmaniasis in Asunción, Paraguay. Our results show that Lu. longipalpis from this site produce (S-9-methylgermacrene-B which has also been found in Lu. longipalpis from different areas of Brazil, Colombia and Central America.

  5. Identification of the sex pheromone of Lutzomyia longipalpis (Lutz & Neiva, 1912) (Diptera: Psychodidae) from Asunción, Paraguay

    Science.gov (United States)

    Brazil, Reginaldo P; Caballero, Norath Natalia; Hamilton, James Gordon C

    2009-01-01

    The sand fly Lutzomyia longipalpis is the main vector of Leishmania (L.) infantum (Nicolle), the causative agent of American visceral leishmaniasis (AVL) in the New World. Male Lu. longipalpis have secretory glands which produce sex pheromones in either abdominal tergites 4 or 3 and 4. These glands are sites of sex pheromone production and each pheromone type may represent true sibling species. In Latin America, apart from Lu. pseudolongipalpis Arrivillaga and Feliciangeli from Venezuela, populations of Lu. longipalpis s.l. can be identified by their male-produced sex pheromones: (S)-9-methylgermacrene-B, 3-methyl-α-himachalene and the two cembrenes, 1 and 2. In this study, we present the results of a coupled gas chromatography - mass spectrometry analysis of the pheromones of males Lu. longipalpis captured in an endemic area of visceral leishmaniasis in Asunción, Paraguay. Our results show that Lu. longipalpis from this site produce (S)-9-methylgermacrene-B which has also been found in Lu. longipalpis from different areas of Brazil, Colombia and Central America. PMID:19883505

  6. Identification of the sex pheromone of Lutzomyia longipalpis (Lutz & Neiva, 1912) (Diptera: Psychodidae) from Asunción, Paraguay.

    Science.gov (United States)

    Brazil, Reginaldo P; Caballero, Norath Natalia; Hamilton, James Gordon C

    2009-11-02

    The sand fly Lutzomyia longipalpis is the main vector of Leishmania (L.) infantum (Nicolle), the causative agent of American visceral leishmaniasis (AVL) in the New World. Male Lu. longipalpis have secretory glands which produce sex pheromones in either abdominal tergites 4 or 3 and 4. These glands are sites of sex pheromone production and each pheromone type may represent true sibling species. In Latin America, apart from Lu. pseudolongipalpis Arrivillaga and Feliciangeli from Venezuela, populations of Lu. longipalpis s.l. can be identified by their male-produced sex pheromones: (S)-9-methylgermacrene-B, 3-methyl-alpha-himachalene and the two cembrenes, 1 and 2.In this study, we present the results of a coupled gas chromatography - mass spectrometry analysis of the pheromones of males Lu. longipalpis captured in an endemic area of visceral leishmaniasis in Asunción, Paraguay. Our results show that Lu. longipalpis from this site produce (S)-9-methylgermacrene-B which has also been found in Lu. longipalpis from different areas of Brazil, Colombia and Central America.

  7. UNITE: a database providing web-based methods for the molecular identification of ectomycorrhizal fungi

    DEFF Research Database (Denmark)

    Köljalg, U.; Larsson, K.H.; Abarenkov, K.

    2005-01-01

    Identification of ectomycorrhizal (ECM) fungi is often achieved through comparisons of ribosomal DNA internal transcribed spacer (ITS) sequences with accessioned sequences deposited in public databases. A major problem encountered is that annotation of the sequences in these databases is not always....... At present UNITE contains 758 ITS sequences from 455 species and 67 genera of ECM fungi. •  UNITE can be searched by taxon name, via sequence similarity using blastn, and via phylogenetic sequence identification using galaxie. Following implementation, galaxie performs a phylogenetic analysis of the query...... sequence after alignment either to pre-existing generic alignments, or to matches retrieved from a blast search on the UNITE data. It should be noted that the current version of UNITE is dedicated to the reliable identification of ECM fungi. •  The UNITE database is accessible through the URL http://unite.zbi.ee...

  8. Molecular cytogenetic analysis of monoecious hemp (Cannabis sativa L.) cultivars reveals its karyotype variations and sex chromosomes constitution.

    Science.gov (United States)

    Razumova, Olga V; Alexandrov, Oleg S; Divashuk, Mikhail G; Sukhorada, Tatiana I; Karlov, Gennady I

    2016-05-01

    Hemp (Cannabis sativa L., 2n = 20) is a dioecious plant. Sex expression is controlled by an X-to-autosome balance system consisting of the heteromorphic sex chromosomes XY for males and XX for females. Genetically monoecious hemp offers several agronomic advantages compared to the dioecious cultivars that are widely used in hemp cultivation. The male or female origin of monoecious maternal plants is unknown. Additionally, the sex chromosome composition of monoecious hemp forms remains unknown. In this study, we examine the sex chromosome makeup in monoecious hemp using a cytogenetic approach. Eight monoecious and two dioecious cultivars were used. The DNA of 210 monoecious plants was used for PCR analysis with the male-associated markers MADC2 and SCAR323. All monoecious plants showed female amplification patterns. Fluorescence in situ hybridization (FISH) with the subtelomeric CS-1 probe to chromosomes plates and karyotyping revealed a lack of Y chromosome and presence of XX sex chromosomes in monoecious cultivars with the chromosome number 2n = 20. There was a high level of intra- and intercultivar karyotype variation detected. The results of this study can be used for further analysis of the genetic basis of sex expression in plants.

  9. MOLECULAR GENETIC MARKERS AND METHODS OF THEIR IDENTIFICATION IN MODERN FISH-FARMING

    Directory of Open Access Journals (Sweden)

    I. Hrytsyniak

    2014-03-01

    Full Text Available Purpose. The application of molecular genetic markers has been widely used in modern experimental fish-farming in recent years. This methodology is currently presented by a differentiated approach with individual mechanisms and clearly defined possibilities. Numerous publications in the scientific literature that are dedicated to molecular genetic markers for the most part offer purely practical data. Thus, the synthesis and analysis of existing information on the general principles of action and the limits of the main methods of using molecular genetic markers is an actual problem. In particular, such a description will make it possible to plan more effectively the experiment and to obtain the desired results with high reliability. Findings. The main types of variable parts of DNA that can be used as molecular genetic markers in determining the level of stock hybridization, conducting genetic inventory of population and solving other problems in modern fish-farming are described in this paper. Also, the article provides an overview of principal modern methods that can be used to identify molecular genetic markers. Originality. This work is a generalization of modern ideas about the mechanisms of experiments with molecular genetic markers in fish-farming. Information is provided in the form of consistent presentation of the principles and purpose of each method, as well as significant advances during their practical application. Practical value. The proposed review of classic and modern literature data on molecular genetic markers can be used for planning, modernization and correction of research activity in modern fish-farming.

  10. A rapid PCR-based approach for molecular identification of filamentous fungi.

    Science.gov (United States)

    Chen, Yuanyuan; Prior, Bernard A; Shi, Guiyang; Wang, Zhengxiang

    2011-08-01

    In this study, a novel rapid and efficient DNA extraction method based on alkaline lysis, which can deal with a large number of filamentous fungal isolates in the same batch, was established. The filamentous fungal genomic DNA required only 20 min to prepare and can be directly used as a template for PCR amplification. The amplified internal transcribed spacer regions were easy to identify by analysis. The extracted DNA also can be used to amplify other protein-coding genes for fungal identification. This method can be used for rapid systematic identification of filamentous fungal isolates.

  11. Morphological and molecular identification of potato cyst nematode populations in Serbia

    Directory of Open Access Journals (Sweden)

    Oro Violeta

    2010-01-01

    Full Text Available Quarantine species such as potato cyst nematodes Globodera rostochiensis and G. pallida are present in Serbia since 1999 and 2005, respectively. These nematodes are sibling species and their morphological identification is complex due to their morphometric overlap. The cysts from the localities of Kladnica, Šanac, Gojna Gora and Milatovići were grown on susceptible potato varieties and their morphological differences have been discussed. To avoid ambiguities in species morphological designation a duplex PCR method was chosen for a rapid and accurate species identification. The whole procedure, from DNA extraction to DNA isolation, can be performed in a single day. .

  12. Molecular Identification of Unusual Pathogenic Yeast Isolates by Large Ribosomal Subunit Gene Sequencing: 2 Years of Experience at the United Kingdom Mycology Reference Laboratory▿

    Science.gov (United States)

    Linton, Christopher J.; Borman, Andrew M.; Cheung, Grace; Holmes, Ann D.; Szekely, Adrien; Palmer, Michael D.; Bridge, Paul D.; Campbell, Colin K.; Johnson, Elizabeth M.

    2007-01-01

    Rapid identification of yeast isolates from clinical samples is particularly important given their innately variable antifungal susceptibility profiles. We present here an analysis of the utility of PCR amplification and sequence analysis of the hypervariable D1/D2 region of the 26S rRNA gene for the identification of yeast species submitted to the United Kingdom Mycology Reference Laboratory over a 2-year period. A total of 3,033 clinical isolates were received from 2004 to 2006 encompassing 50 different yeast species. While more than 90% of the isolates, corresponding to the most common Candida species, could be identified by using the AUXACOLOR2 yeast identification kit, 153 isolates (5%), comprised of 47 species, could not be identified by using this system and were subjected to molecular identification via 26S rRNA gene sequencing. These isolates included some common species that exhibited atypical biochemical and phenotypic profiles and also many rarer yeast species that are infrequently encountered in the clinical setting. All 47 species requiring molecular identification were unambiguously identified on the basis of D1/D2 sequences, and the molecular identities correlated well with the observed biochemical profiles of the various organisms. Together, our data underscore the utility of molecular techniques as a reference adjunct to conventional methods of yeast identification. Further, we show that PCR amplification and sequencing of the D1/D2 region reliably identifies more than 45 species of clinically significant yeasts and can also potentially identify new pathogenic yeast species. PMID:17251397

  13. Toxocara nematodes in stray cats from shiraz, southern iran: intensity of infection and molecular identification of the isolates.

    Directory of Open Access Journals (Sweden)

    Fattaneh Mikaeili

    2013-12-01

    Full Text Available Toxocara is a common nematode of cats in different parts of Iran. Despite the close association of cats with human, no attempt has been done so far for molecular identification of this nematode in the country. Therefore, current study was performed on identification of some isolates of Toxocara from stray cats in Shiraz, Fars Province, Southern Iran, based on morphological and molecular approaches, and also determination of intensity of infection.This cross-sectional study was carried out on 30 stray cats trapped from different geographical areas of Shiraz in 2011. Adult male and female worms were recovered from digestive tract after dissection of cats. Morphological features using existing keys and PCR-sequencing of ITS-rDNA region and pcox1 mitochondrial l gene were applied for the delineating the species of the parasites.Eight out of 30 cats (26.7% were found infected with Toxocara nematodes. All the isolates were confirmed as Toxocara cati based on morphological features and the sequence of ribosomal and mitochondrial targets. Intensity of infection ranged from one to a maximum of 39 worms per cat, with a mean of 10.25±12.36, and higher abundance of female nematodes.The most prevalent ascaridoid nematode of stray cats in the study area was T. cati and female nematodes were more abundant than that of males. This issue has important role in spreading of eggs in the environment and impact on human toxocariasis.

  14. Microbiological and molecular identification of bacterial species isolated from nasal and oropharyngeal mucosa of fuel workers in Riyadh, Saudi Arabia.

    Science.gov (United States)

    AlWakeel, Suaad S

    2017-09-01

    This study aimed to determine the bacterial species colonizing the nasal and oropharyngeal mucosa of fuel workers in Central Riyadh, Saudi Arabia on a microbiological and molecular level. Throat and nasal swab samples were obtained from 29 fuel station attendants in the period of time extending from March to May 2014 in Riyadh, Saudi Arabia. Microbiological identification techniques were utilized to identify the bacterial species isolated. Antibiotic sensitivity was assessed for each of the bacterial isolates. Molecular identification techniques based on PCR analysis of specific genomic sequences was conducted and was the basis on which phylogeny representation was done for 10 randomly selected samples of the isolates. Blood was drawn and a complete blood count was conducted to note the hematological indices for each of the study participants. Nineteen bacterial species were isolated from both the nasal cavity and the oropharynx including Streptococcus thoraltensis , alpha-hemolytic streptococci, Staphylococcus hominis , coagulase-negative staphylococci, Leuconostoc mesenteroides , Erysipelothrix rhusiopathiae and several others. We found 100% sensitivity of the isolates to ciprofloxacin, cefuroxime and gentamicin. Whereas cefotaxime and azithromycin posted sensitivities of 85.7% and 91.4%, respectively. Low sensitivities (fuel products may be a contributing factor to bacterial colonization of the respiratory tract in fuel workers.

  15. Identification of Rice Accessions Associated with K+/Na+ Ratio and Salt Tolerance Based on Physiological and Molecular Responses

    Directory of Open Access Journals (Sweden)

    Inja Naga Bheema Lingeswara Reddy

    2017-11-01

    Full Text Available The key for rice plant survival under NaCl salt stress is maintaining a high K+/Na+ ratio in its cells. Selection for salt tolerance rice genotypes based on phenotypic performance alone will delay in progress in breeding. Use of molecular markers in tandem with physiological studies will help in better identification of salt tolerant rice accessions. Eight rice accessions along with the check Dongjin were screened using 1/2 Yoshida solution with 50 mmol/L NaCl at the seedling stage. The accessions IT001158, IT246674, IT260533 and IT291341 were classified as salt tolerant based on their K+/Na+ ratios. Seventeen SSR markers reported to be associated with K+/Na+ ratio were used to screen the accessions. Five SSR markers (RM8053, RM345, RM318, RM253 and RM7075 could differentiate accessions classified based on their K+/Na+ ratios. Banding pattern of the accessions was scored compared to the banding pattern of Dongjin. The study differentiated accessions based on their association of K+/Na+ ratio with molecular markers which are very reliable. These markers can play a significant role in screening large set of rice germplasms for salt tolerance and also help in identification of high-yielding varieties with better salt tolerance. The salt tolerant accessions can be taken forward into developing better varieties by conventional breeding and exploring genes for salt tolerance.

  16. Morphological and molecular identification of Fusarium tricinctum and Fusarium acuminatum as causal agents of garlic bulbs rot in Serbia

    Directory of Open Access Journals (Sweden)

    Ignjatov Maja V.

    2017-01-01

    Full Text Available Garlic (Allium sativum L. is considered to be one of the oldest crops in the world. During 2016, infected garlic bulbs occurred in storages on several localities of the Province of Vojvodina. Symptomatic cloves showed typical rot symptoms such as softened and spongy areas covered with white fungal growth with deep lesions formed on the cloves which became dry over time. A total of 36 isolates of Fusarium species were obtained from diseased cloves of garlic. Colony morphology and microscopic properties of isolated Fusarium species were recorded from the cultures grown on PDA and CLA, respectively. Identification of two chosen isolates was performed by sequencing the EF-1α gene. The TEF sequence of isolate JBL12 showed 100% similarity with several F. tricinctum sequences and sequence of JBL539 showed 99% identity with several F. acuminatum sequences and they were deposited in the NCBI GenBank. Based on the results of the morphological and molecular identification, isolates JBL12 and JBL539 were identified as F. tricinctum and F. acuminatum, respectively, as new causal agents of garlic bulbs rot in Serbia. Specific primers were designed for the PCR identification of the F. tricinctum. [Project of the Serbian Ministry of Education, Science and Technological Development, Grant no. TR31030

  17. Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers.

    Science.gov (United States)

    Al-Khalifah, Nasser S; Shanavaskhan, A E

    2017-01-01

    Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.

  18. Molecular identification of Nocardia species using the sodA gene: Identificación molecular de especies de Nocardia utilizando el gen sodA.

    Science.gov (United States)

    Sánchez-Herrera, K; Sandoval, H; Mouniee, D; Ramírez-Durán, N; Bergeron, E; Boiron, P; Sánchez-Saucedo, N; Rodríguez-Nava, V

    2017-09-01

    Currently for bacterial identification and classification the rrs gene encoding 16S rRNA is used as a reference method for the analysis of strains of the genus Nocardia. However, it does not have enough polymorphism to differentiate them at the species level. This fact makes it necessary to search for molecular targets that can provide better identification. The sod A gene (encoding the enzyme superoxide dismutase) has had good results in identifying species of other Actinomycetes. In this study the sod A gene is proposed for the identification and differentiation at the species level of the genus Nocardia. We used 41 type species of various collections; a 386 bp fragment of the sod A gene was amplified and sequenced, and a phylogenetic analysis was performed comparing the genes rrs (1171 bp), hsp 65 (401 bp), sec A1 (494 bp), gyr B (1195 bp) and rpo B (401 bp). The sequences were aligned using the Clustal X program. Evolutionary trees according to the neighbour-joining method were created with the programs Phylo_win and MEGA 6. The specific variability of the sod A genus of the genus Nocardia was analysed. A high phylogenetic resolution, significant genetic variability, and specificity and reliability were observed for the differentiation of the isolates at the species level. The polymorphism observed in the sod A gene sequence contains variable regions that allow the discrimination of closely related Nocardia species. The clear specificity, despite its small size, proves to be of great advantage for use in taxonomic studies and clinical diagnosis of the genus Nocardia.

  19. The Impact of Sex Differences on Odor Identification and Facial Affect Recognition in Patients with Schizophrenia Spectrum Disorders

    OpenAIRE

    Mossaheb, Nilufar; Kaufmann, Rainer M.; Schlögelhofer, Monika; Aninilkumparambil, Thushara; Himmelbauer, Claudia; Gold, Anna; Zehetmayer, Sonja; Hoffmann, Holger; Traue, Harald C.; Aschauer, Harald

    2018-01-01

    Background Social interactive functions such as facial emotion recognition and smell identification have been shown to differ between women and men. However, little is known about how these differences are mirrored in patients with schizophrenia and how these abilities interact with each other and with other clinical variables in patients vs. healthy controls. Methods Standardized instruments were used to assess facial emotion recognition [Facially Expressed Emotion Labelling (FEEL)] and smel...

  20. The Impact of Sex Differences on Odor Identification and Facial Affect Recognition in Patients with Schizophrenia Spectrum Disorders

    OpenAIRE

    Nilufar Mossaheb; Rainer M. Kaufmann; Monika Schlögelhofer; Thushara Aninilkumparambil; Claudia Himmelbauer; Anna Gold; Sonja Zehetmayer; Holger Hoffmann; Harald C. Traue; Harald Aschauer

    2018-01-01

    BackgroundSocial interactive functions such as facial emotion recognition and smell identification have been shown to differ between women and men. However, little is known about how these differences are mirrored in patients with schizophrenia and how these abilities interact with each other and with other clinical variables in patients vs. healthy controls.MethodsStandardized instruments were used to assess facial emotion recognition [Facially Expressed Emotion Labelling (FEEL)] and smell i...

  1. Identification and regulation of a molecular module for bleb-based cell motility

    NARCIS (Netherlands)

    Goudarzi, M.; Banisch, T.U.; Mobin, M.B.; Maghelli, N.; Tarbashevich, K.; Strate, I.; ter Berg, J.; Blaser, H.; Bandemer, S.; Paluch, E.; Bakkers, J.; Tolic-Norrelykke, I.M.; Raz, E.

    2012-01-01

    Single-cell migration is a key process in development, homeostasis, and disease. Nevertheless, the control over basic cellular mechanisms directing cells into motile behavior in vivo is largely unknown. Here, we report on the identification of a minimal set of parameters the regulation of which

  2. UNITE: a database providing web-based methods for the molecular identification of ectomycorrhizal fungi.

    Science.gov (United States)

    Kõljalg, Urmas; Larsson, Karl-Henrik; Abarenkov, Kessy; Nilsson, R Henrik; Alexander, Ian J; Eberhardt, Ursula; Erland, Susanne; Høiland, Klaus; Kjøller, Rasmus; Larsson, Ellen; Pennanen, Taina; Sen, Robin; Taylor, Andy F S; Tedersoo, Leho; Vrålstad, Trude; Ursing, Björn M

    2005-06-01

    Identification of ectomycorrhizal (ECM) fungi is often achieved through comparisons of ribosomal DNA internal transcribed spacer (ITS) sequences with accessioned sequences deposited in public databases. A major problem encountered is that annotation of the sequences in these databases is not always complete or trustworthy. In order to overcome this deficiency, we report on UNITE, an open-access database. UNITE comprises well annotated fungal ITS sequences from well defined herbarium specimens that include full herbarium reference identification data, collector/source and ecological data. At present UNITE contains 758 ITS sequences from 455 species and 67 genera of ECM fungi. UNITE can be searched by taxon name, via sequence similarity using blastn, and via phylogenetic sequence identification using galaxie. Following implementation, galaxie performs a phylogenetic analysis of the query sequence after alignment either to pre-existing generic alignments, or to matches retrieved from a blast search on the UNITE data. It should be noted that the current version of UNITE is dedicated to the reliable identification of ECM fungi. The UNITE database is accessible through the URL http://unite.zbi.ee

  3. Molecular DNA identification of medicinal plants used by traditional healers in Malaysia.

    Science.gov (United States)

    Aziz, N A A; Ahmad, M I; Naim, D M

    2015-12-07

    Plants have been used throughout human history for food and medicine. However, many plants are toxic, and cannot easily be morphologically distinguished from non-toxic plants. DNA identification solves this problem and is widely used. Nonetheless, plant DNA barcode identification faces a number of challenges, and many studies have been conducted to find suitable barcodes. The present study was conducted to test the efficiency of commonly used primers, namely ITS2, rpoC1, and trnH-psbA, in order to find the best DNA barcode markers for the identification of medicinal plants in Malaysia. Fresh leaves from 12 medicinal plants that are commonly used by Malay traditional healers were collected from the Tropical Spice Garden, Pulau Pinang, and subjected to polymerase chain reaction amplification using ITS2, rpoC1, and trnH-psbA DNA markers. We found that trnH-psbA is the best DNA marker for the species-level identification of medicinal plants in Malaysia.

  4. Identification of Burkholderia spp. in the Clinical Microbiology Laboratory: Comparison of Conventional and Molecular Methods

    Science.gov (United States)

    van Pelt, Cindy; Verduin, Cees M.; Goessens, Wil H. F.; Vos, Margreet C.; Tümmler, Burkhard; Segonds, Christine; Reubsaet, Frans; Verbrugh, Henri; van Belkum, Alex

    1999-01-01

    Cystic fibrosis (CF) predisposes patients to bacterial colonization and infection of the lower airways. Several species belonging to the genus Burkholderia are potential CF-related pathogens, but microbiological identification may be complicated. This situation is not in the least due to the poorly defined taxonomic status of these bacteria, and further validation of the available diagnostic assays is required. A total of 114 geographically diverse bacterial isolates, previously identified in reference laboratories as Burkholderia cepacia (n = 51), B. gladioli (n = 14), Ralstonia pickettii (n = 6), B. multivorans (n = 2), Stenotrophomonas maltophilia (n = 3), and Pseudomonas aeruginosa (n = 11), were collected from environmental, clinical, and reference sources. In addition, 27 clinical isolates putatively identified as Burkholderia spp. were recovered from the sputum of Dutch CF patients. All isolates were used to evaluate the accuracy of two selective growth media, four systems for biochemical identification (API 20NE, Vitek GNI, Vitek NFC, and MicroScan), and three different PCR-based assays. The PCR assays amplify different parts of the ribosomal DNA operon, either alone or in combination with cleavage by various restriction enzymes (PCR-restriction fragment length polymorphism [RFLP] analysis). The best system for the biochemical identification of B. cepacia appeared to be the API 20NE test. None of the biochemical assays successfully grouped the B. gladioli strains. The PCR-RFLP method appeared to be the optimal method for accurate nucleic acid-mediated identification of the different Burkholderia spp. With this method, B. gladioli was also reliably classified in a separate group. For the laboratory diagnosis of B. cepacia, we recommend parallel cultures on blood agar medium and selective agar plates. Further identification of colonies with a Burkholderia phenotype should be performed with the API 20NE test. For final confirmation of species identities, PCR

  5. DNA Barcoding of Malagasy Rosewoods: Towards a Molecular Identification of CITES-Listed Dalbergia Species.

    Science.gov (United States)

    Hassold, Sonja; Lowry, Porter P; Bauert, Martin R; Razafintsalama, Annick; Ramamonjisoa, Lolona; Widmer, Alex

    2016-01-01

    Illegal selective logging of tropical timber is of increasing concern worldwide. Madagascar is a biodiversity hotspot and home to some of the world's most sought after tropical timber species. Malagasy rosewoods belong to the genus Dalbergia (Fabaceae), which is highly diverse and has a pantropical distribution, but these timber species are among the most threatened as a consequence of intensive illegal selective logging and deforestation. Reliable identification of Dalbergia species from Madagascar is important for law enforcement but is almost impossible without fertile plant material, which is often unavailable during forest inventories or when attempting to identify logged trees of cut wood. DNA barcoding has been promoted as a promising tool for species identification in such cases. In this study we tested whether DNA barcoding with partial sequences of three plastid markers (matK, rbcL and trnL (UAA)) can distinguish between Dalbergia from Madagascar and from other areas of its distributional range, and whether Malagasy species can be distinguished from one another. Phylogenetic analyses revealed that the Malagasy Dalbergia species studied form two monophyletic groups, each containing two subgroups, only one of which corresponds to a single species. We characterized diagnostic polymorphisms in the three DNA barcoding markers that allow rapid discrimination between Dalbergia from Madagascar and from other areas of its distribution range. Species identification success based on individual barcoding markers or combinations was poor, whereas subgroup identification success was much higher (up to 98%), revealing both the value and limitations of a DNA barcoding approach for the identification of closely related Malagasy rosewoods.

  6. Clinical and molecular studies in four patients with SRY-positive 46,XX testicular disorders of sex development: implications for variable sex development and genomic rearrangements.

    Science.gov (United States)

    Nakashima, Shinichi; Ohishi, Akira; Takada, Fumio; Kawamura, Hideki; Igarashi, Maki; Fukami, Maki; Ogata, Tsutomu

    2014-10-01

    We report four patients with SRY-positive 46,XX testicular disorders of sex development (46,XX-TDSD) (cases 1-4). Case 1 exhibited underdeveloped external genitalia with hypospadias, case 2 manifested micropenis and cases 3 and 4 showed normal external genitalia. The Xp;Yp translocations occurred between the X- and the Y-differential regions in case 1, between PRKX and inverted PRKY in case 2 and between the X-chromosomal short arm pseudoautosomal region and the Y-differential regions in cases 3 and 4. The distance of the Yp breakpoint from SRY was ~0.75 Mb in case 1, ~6.5 Mb in case 2, ~2.3 Mb in case 3 and ~72 kb in case 4. The Xp;Yp translocation occurred within an 87-bp homologous segment of PRKX and PRKY in case 2, and between non-homologous regions with addition of an 18-bp sequence of unknown origin in case 4. X-inactivation analysis revealed random inactivation in cases 1-4. The results argue against the notion that undermasculinization in 46,XX-TDSD is prone to occur when translocated Yp materials are small (<100 kb of the Y-differential region), and imply that the Xp;Yp translocations result from several mechanisms including non-allelic homologous recombination and non-homologous end joining.

  7. Whole-genome in-silico subtractive hybridization (WISH - using massive sequencing for the identification of unique and repetitive sex-specific sequences: the example of Schistosoma mansoni

    Directory of Open Access Journals (Sweden)

    Parrinello Hugues

    2010-06-01

    Full Text Available Abstract Background Emerging methods of massive sequencing that allow for rapid re-sequencing of entire genomes at comparably low cost are changing the way biological questions are addressed in many domains. Here we propose a novel method to compare two genomes (genome-to-genome comparison. We used this method to identify sex-specific sequences of the human blood fluke Schistosoma mansoni. Results Genomic DNA was extracted from male and female (heterogametic S. mansoni adults and sequenced with a Genome Analyzer (Illumina. Sequences are available at the NCBI sequence read archive http://www.ncbi.nlm.nih.gov/Traces/sra/ under study accession number SRA012151.6. Sequencing reads were aligned to the genome, and a pseudogenome composed of known repeats. Straightforward comparative bioinformatics analysis was performed to compare male and female schistosome genomes and identify female-specific sequences. We found that the S. mansoni female W chromosome contains only few specific unique sequences (950 Kb i.e. about 0.2% of the genome. The majority of W-specific sequences are repeats (10.5 Mb i.e. about 2.5% of the genome. Arbitrarily selected W-specific sequences were confirmed by PCR. Primers designed for unique and repetitive sequences allowed to reliably identify the sex of both larval and adult stages of the parasite. Conclusion Our genome-to-genome comparison method that we call "whole-genome in-silico subtractive hybridization" (WISH allows for rapid identification of sequences that are specific for a certain genotype (e.g. the heterogametic sex. It can in principle be used for the detection of any sequence differences between isolates (e.g. strains, pathovars or even closely related species.

  8. Safe sex

    Science.gov (United States)

    ... sex; Sexually transmitted - safe sex; GC - safe sex; Gonorrhea - safe sex; Herpes - safe sex; HIV - safe sex; ... contact. STIs include: Chlamydia Genital herpes Genital warts Gonorrhea Hepatitis HIV HPV Syphilis STIs are also called ...

  9. Molecular Sex Determination of Captive Komodo Dragons (Varanus komodoensis at Gembira Loka Zoo, Surabaya Zoo, and Ragunan Zoo, Indonesia

    Directory of Open Access Journals (Sweden)

    SRI SULANDARI

    2014-06-01

    Full Text Available Captive breeding of endangered species is often difficult, and may be hampered by many factors. Sexual monomorphism, in which males and females are not easily distinguishable, is one such factor and is a common problem in captive breeding of many avian and reptile species. Species-specific nuclear DNA markers, recently developed to identify portions of sex chromosomes, were employed in this study for sex determination of Komodo dragons (Varanus Komodoensis. Each animal was uniquely tagged using a passive integrated micro-transponder (TROVAN 100A type transponders of 13 mm in length and 2 mm in diameter. The sex of a total of 81 individual Komodo dragons (44 samples from Ragunan zoo, 26 samples from Surabaya zoo, and 11 samples from Gembira Loka zoo were determined using primers Ksex 1for and Ksex 3rev. A series of preliminary PCR amplifications were conducted using DNA from individuals of known sex. During these preliminary tests, researchers varied the annealing temperatures, number of cycles, and concentrations of reagents, in order to identify the best protocol for sex determination using our sample set. We thus developed our own PCR protocol for this study, which resulted in the amplification of band A in females and band C in males. Results from band B, however, turned out to be non-determinative in our study because, for females, band B was not always visible, and for males sometimes a similar, but lighter band was also amplified, making interpretation difficult. In this study, sex determination was based mainly on the difference in size between the female-specific 812 bp fragment and the homologous, longer fragment amplified for males.

  10. Identification of Paramecium bursaria syngens through molecular markers--comparative analysis of three loci in the nuclear and mitochondrial DNA.

    Science.gov (United States)

    Greczek-Stachura, Magdalena; Potekhin, Alexey; Przyboś, Ewa; Rautian, Maria; Skoblo, Inna; Tarcz, Sebastian

    2012-09-01

    This is the first attempt to resolve the phylogenetic relationship between different syngens of Paramecium bursaria and to investigate at a molecular level the intraspecific differentiation of strains originating from very distant geographical locations. Herein we introduce a new collection of five P. bursaria syngens maintained at St Petersburg State University, as the international collection of syngens was lost in the 1960s. To analyze the degree of speciation within Paramecium bursaria, we examined 26 strains belonging to five different syngens from distant and geographically isolated localities using rDNA (ITS1-5.8S-ITS2-5'LSU) fragments, mitochondrial cytochrome c oxidase subunit I (COI), and H4 gene fragments. It was shown that P. bursaria strains of the same syngens cluster together in all three inferred molecular phylogenies. The genetic diversity among the studied P. bursaria strains based on rDNA sequences was rather low. The COI divergence of Paramecium bursaria was also definitely lower than that observed in the Paramecium aurelia complex. The nucleotide sequences of the H4 gene analyzed in the present study indicate the extent of genetic differences between the syngens of Paramecium bursaria. Our study demonstrates the diagnostic value of molecular markers, which are important tools in the identification of Paramecium bursaria syngens. Copyright © 2011 Elsevier GmbH. All rights reserved.

  11. Molecular identification of Clonorchis sinensis and discrimination with other opisthorchid liver fluke species using Multiple Ligation-dependent Probe Amplification (MLPA).

    OpenAIRE

    Sun, J.; Xu, J.; Liang, P.; Mao, Q.; Huang, Y.; Lu, X.; Deng, C.; Liang, C.; de Hoog, G.S.; Yu, X.

    2011-01-01

    Background Infections with the opisthorchid liver flukes Clonorchis sinensis, Opisthorchis viverrini, and O. felineus cause severe health problems globally, particularly in Southeast Asia. Early identification of the infection is essential to provide timely and appropriate chemotherapy to patients. Results In this study we evaluate a PCR-based molecular identification method, Multiplex Ligation-dependent Probe Amplification (MLPA), which allows rapid and specific detection of single nucleotid...

  12. DNA barcoding for molecular identification of Demodex based on mitochondrial genes.

    Science.gov (United States)

    Hu, Li; Yang, YuanJun; Zhao, YaE; Niu, DongLing; Yang, Rui; Wang, RuiLing; Lu, Zhaohui; Li, XiaoQi

    2017-12-01

    There has been no widely accepted DNA barcode for species identification of Demodex. In this study, we attempted to solve this issue. First, mitochondrial cox1-5' and 12S gene fragments of Demodex folloculorum, D. brevis, D. canis, and D. caprae were amplified, cloned, and sequenced for the first time; intra/interspecific divergences were computed and phylogenetic trees were reconstructed. Then, divergence frequency distribution plots of those two gene fragments were drawn together with mtDNA cox1-middle region and 16S obtained in previous studies. Finally, their identification efficiency was evaluated by comparing barcoding gap. Results indicated that 12S had the higher identification efficiency. Specifically, for cox1-5' region of the four Demodex species, intraspecific divergences were less than 2.0%, and interspecific divergences were 21.1-31.0%; for 12S, intraspecific divergences were less than 1.4%, and interspecific divergences were 20.8-26.9%. The phylogenetic trees demonstrated that the four Demodex species clustered separately, and divergence frequency distribution plot showed that the largest intraspecific divergence of 12S (1.4%) was less than cox1-5' region (2.0%), cox1-middle region (3.1%), and 16S (2.8%). The barcoding gap of 12S was 19.4%, larger than cox1-5' region (19.1%), cox1-middle region (11.3%), and 16S (13.0%); the interspecific divergence span of 12S was 6.2%, smaller than cox1-5' region (10.0%), cox1-middle region (14.1%), and 16S (11.4%). Moreover, 12S has a moderate length (517 bp) for sequencing at once. Therefore, we proposed mtDNA 12S was more suitable than cox1 and 16S to be a DNA barcode for classification and identification of Demodex at lower category level.

  13. Molecular Identification of Microorganisms Associated to the Rhizosphere of Vanilla Plants in Colombia

    OpenAIRE

    Claudia Lucía Álvarez López; Nelson Walter Osorio Vega; Mauricio Alejandro Marín Montoya

    2013-01-01

    The cultivation of vanilla (Vanilla planifolia) is highly promising in Colombia, but more research is needed on its agronomical management and beneficial microorganisms that grow associated to its rhizosphere, on which the plant depends for its nutrition and growth. This study involved the identification of microorganisms associated to the rhizosphere of vanilla plants in a crop located in Sopetrán, Colombia. The microbes were isolated in selective media for functional groups such as cellulol...

  14. Identification of components in High Molecular Weight Products: Their properties and mechanism of formation

    DEFF Research Database (Denmark)

    Hjorth, Christian Fogt

    2015-01-01

    of insulin HMWP is needed. This thesis comprises identification of the primary structure of human insulin HMWP and its biophysical and structural properties. 16 species of HMWP were identified in formulations of human insulin containing zinc and m-cresol. All identified species were covalent dimers...... investigations of insulin self-association in zinc-free environments. The effect on insulin fibrillation could also be investigated further for potentially uncoveing novel mechanisms for prevention of fibrillation in protein formulations....

  15. [Identification of Candida dubliniensis strains using heat tolerance tests, morphological characteristics and molecular methods].

    Science.gov (United States)

    Arikan, Sevtap; Darka, Ozge; Hasçelik, Gülşen; Günalp, Ayfer

    2003-01-01

    Described in 1995, Candida dubliniensis is a novel Candida species closely related to Candida albicans due primarily to its ability to produce germ tube and chlamydospores. Given these phenotypic similarities between the two species, C. dubliniensis cannot be readily distinguished from Candida albicans by routine laboratory work-up. We explored the frequency of isolation of C. dubliniensis among 213 strains previously defined as C. albicans based on their ability to produce germ tube. The test isolates were initially examined for their morphological features on cornmeal tween 80 agar, inability to grow at 45 degrees C, and the biochemical assimilation profile (ID 32C system, bioMerieux, France). Among all, 2 (0.9%) of the isolates were identified as C. dubliniensis based on the production of numerous chlamydospores in chains on cornmeal tween 80 agar and the lack of growth at 45 degrees C. The assimilation profile of these isolates was found to be in accordance with this identification. In an effort to confirm the identification, polymerase chain reaction (PCR) studies were carried out by using the C. dubliniensis specific primer set, DUBF and DUBR. Both of the isolates yielded C. dubliniensis-specific 288 base pair amplification products, confirming the previous identification obtained with the initial screening tests. The isolates were found to be susceptible to fluconazole and itraconazole, and generated amphotericin B minimal inhibitory concentrations of 0.5-1 microgram/ml by NCCLS M27-A2 microdilution method. These data suggest that the isolation rate of C. dubliniensis among our clinical isolates is low. The morphological features on cornmeal tween 80 agar and the lack of ability to grow at 45 degrees C appear as reliable, cheap, and practical screening tests in initial identification of C. dubliniensis among germ tube-producing Candida strains.

  16. Molecular Methods Used for the Identification of Potentially Probiotic Lactobacillus reuteri Strains

    OpenAIRE

    Weiss, Agnes; Lettner, Hans Peter; Kramer, Walter; Mayer, Helmut Karl; Kneifel, Wolfgang

    2005-01-01

    Forty potentially probiotic Lactobacillus strains as well as reference strains of different genera were grown under standardised conditions. Cell masses were harvested and DNA was isolated. For identification, all strains were subjected to genus-specific polymerase chain reaction (PCR), and the affiliation with the genus Lactobacillus was confirmed for all isolates. Using two species-specific primer-pairs for Lactobacillus reuteri, specific amplicons were observed for eight of the forty inves...

  17. Modeling tissue contamination to improve molecular identification of the primary tumor site of metastases

    DEFF Research Database (Denmark)

    Vincent, Martin; Perell, Katharina; Nielsen, Finn Cilius

    2014-01-01

    with any predictor model. The usability of the model is illustrated on primary tumor site identification of liver biopsies, specifically, on a human dataset consisting of microRNA expression measurements of primary tumor samples, benign liver samples and liver metastases. For a predictor trained on primary...... tumor and benign liver samples, the contamination model decreased the test error on biopsies from liver metastases from 77 to 45%. A further reduction to 34% was obtained by including biopsies in the training data....

  18. Identification of BKCa channel openers by molecular field alignment and patent data-driven analysis

    Directory of Open Access Journals (Sweden)

    Yaseen Gigani

    2016-01-01

    Full Text Available In this work, we present the first comprehensive molecular field analysis of patent structures on how the chemical structure of drugs impacts the biological binding. This task was formulated as searching for drug structures to reveal shared effects of substitutions across a common scaffold and the chemical features that may be responsible. We used the SureChEMBL patent database, which provides search of the patent literature using keyword-based functionality, as a query engine. The extraction of data of the BKCa channel openers and aligning them for molecular field similarity with newly designed structures did provide a probable validation method with accurate values. Therefore, in an attempt to increase the true positives, we report a procedure that functions on a multiple analyses modeled on molecular field similarity and common sub-structural search with consensus scoring and high confidence values to obtain greater accuracy during conventional virtual screening.

  19. Clinical and molecular characterization of a Brazilian cohort of campomelic dysplasia patients, and identification of seven new SOX9 mutations

    Directory of Open Access Journals (Sweden)

    Eduardo P. Mattos

    2015-03-01

    Full Text Available Campomelic dysplasia (CD is an autosomal, dominantly inherited, skeletal abnormality belonging to the subgroup of bent bone dysplasias. In addition to bowed lower limbs, CD typically includes the following: disproportionate short stature, flat face, micrognathia, cleft palate, bell-shaped thorax, and club feet. Up to three quarters of 46, XY individuals may be sex-reversed. Radiological signs include scapular and pubic hypoplasia, narrow iliac wings, spaced ischia, and bowed femora and tibiae. Lethal CD is usually due to heterozygous mutations in SOX9, a major regulator of chondrocytic development. We present a detailed clinical and molecular characterization of nine Brazilian CD patients. Infants were either stillborn (n = 2 or died shortly after birth and presented similar phenotypes. Sex-reversal was observed in one of three chromosomally male patients. Sequencing of SOX9 revealed new heterozygous mutations in seven individuals. Six patients had mutations that resulted in premature transcriptional termination, while one infant had a single-nucleotide substitution at the conserved splice-site acceptor of intron 1. No clear genotype-phenotype correlations were observed. This study highlights the diversity of SOX9 mutations leading to lethal CD, and expands the group of known genetic alterations associated with this skeletal dysplasia.

  20. Genetic identification of bucktooth parrotfish Sparisoma radians (Valenciennes, 1840 (Labridae, Scarinae by chromosomal and molecular markers

    Directory of Open Access Journals (Sweden)

    Fabilene Gomes Paim

    2014-12-01

    Full Text Available Parrotfishes (Labridae, Scarinae comprise a large marine fish group of difficult identification, particularly during juvenile phase when the typical morphology and coloration of adults are absent. Therefore, the goal of this study was to test cytogenetic markers and DNA barcoding in the identification of bucktooth parrtotfish Sparisoma radians from the northeastern coast of Brazil. Sequencing of cytochrome c oxidase subunit I (COI confirmed all studied samples as S. radians, and all showed high similarity (99-100% with Caribbean populations. The karyotype of this species was divergent from most marine Perciformes, being composed of 2n = 46 chromosomes. These consisted of a large number of metacentric and submetacentric pairs with small amounts of heterochromatin and GC-rich single nucleolar organizer regions (NORs not syntenic to 5S rDNA clusters. These are the first data about DNA barcoding in parrotfish from the Brazilian province and the first refined chromosomal analysis in Scarinae, providing useful data to a reliable genetic identification of S. radians.

  1. Molecular identification of Indian crocodile species: PCR-RFLP method for forensic authentication*.

    Science.gov (United States)

    Meganathan, P R; Dubey, Bhawna; Haque, Ikramul

    2009-09-01

    South East Asian countries are known for illegal poaching and trade of crocodiles clandestinely, to be used in skin, medicinal, and cosmetic industries. Besides crocodiles being listed in the Convention on International Trade in Endangered Species of Wild Fauna and Flora, India has its Wildlife Protection Act, 1972 for conservation of crocodile species. Hitherto, lack of any rapid and reliable technique for examinations of crocodile-based crime exhibits such as skin, bones, etc. has been a major problem for an effective promulgation of law on illegal trade. DNA-based identification of species using PCR-RFLP technique for an apt identification of all the three Indian crocodile species namely, Crocodylus porosus, Crocodylus palustris and Gavialis gangeticus is presented here. A 628 bp segment of cytochrome b gene was amplified using novel primers followed by restriction digestion with three enzymes i.e., HaeIII, MboI, and MwoI, separately and in combination. The technique has produced a species-specific pattern for identifying the three crocodile species individually, which fulfills the requirement for its forensic application. It is expected that the technique will prove handy in identification of all the three Indian crocodile species and strengthen conservation efforts.

  2. MALDI-TOF MS enables the rapid identification of the major molecular types within the Cryptococcus neoformans/C. gattii species complex.

    Directory of Open Access Journals (Sweden)

    Carolina Firacative

    Full Text Available BACKGROUND: The Cryptococcus neoformans/C. gattii species complex comprises two sibling species that are divided into eight major molecular types, C. neoformans VNI to VNIV and C. gattii VGI to VGIV. These genotypes differ in host range, epidemiology, virulence, antifungal susceptibility and geographic distribution. The currently used phenotypic and molecular identification methods for the species/molecular types are time consuming and expensive. As Matrix-Assisted Laser Desorption Ionization-Time-of-Flight Mass Spectrometry (MALDI-TOF MS offers an effective alternative for the rapid identification of microorganisms, the objective of this study was to examine its potential for the identification of C. neoformans and C. gattii strains at the intra- and inter-species level. METHODOLOGY: Protein extracts obtained via the formic acid extraction method of 164 C. neoformans/C. gattii isolates, including four inter-species hybrids, were studied. RESULTS: The obtained mass spectra correctly identified 100% of all studied isolates, grouped each isolate according to the currently recognized species, C. neoformans and C. gattii, and detected potential hybrids. In addition, all isolates were clearly separated according to their major molecular type, generating greater spectral differences among the C. neoformans molecular types than the C. gattii molecular types, most likely reflecting a closer phylogenetic relationship between the latter. The number of colonies used and the incubation length did not affect the results. No spectra were obtained from intact yeast cells. An extended validated spectral library containing spectra of all eight major molecular types was established. CONCLUSIONS: MALDI-TOF MS is a rapid identification tool for the correct recognition of the two currently recognized human pathogenic Cryptococcus species and offers a simple method for the separation of the eight major molecular types and the detection of hybrid strains within this

  3. Towards an identification of the pyrethroid pharmacophore. A molecular modelling study of some pyrethroid esters

    DEFF Research Database (Denmark)

    Byberg, J R; Jørgensen, Flemming Steen; Klemmensen, P D

    1987-01-01

    A molecular modelling and computer graphics study of a series of pyrethroid insecticides has been carried out. The three-dimensional arrangement of the groups essential for the biological activity (pharmacophore) has been identified for the acid and the alcohol moieties, respectively....... These pharmacophores are based on the relationship between molecular structure and biological activity for a number of pyrethroid esters. The pharmacophores, which describe the relative location in space of the unsaturated systems, the dimethyl groups and the ester moiety, may be useful in the design of novel...... compounds with pyrethroid activity....

  4. Scandalous: Christian identification, sex guilt, and the mediated demonization of the participants in the AshleyMadison scandal.

    Science.gov (United States)

    Ashdown, Brien K; Hackathorn, Jana M; Daniels, Jordan

    2018-04-06

    In 2015, AshleyMadison.com (AshleyMadison) was hacked, leading to the release of site members' personal information. The exposed members faced public scrutiny, judgment, and other negative outcomes. In this study, we examined predictors of the demonization of the AshleyMadison participants (i.e., AshleyMadison members, owners, hackers) to help explain victim derogation. We attempted to discern the role religiosity and sexual guilt played in the demonization of the AshleyMadison hacking participants. We predicted sexual guilt would mediate between religiosity and demonization of the AshleyMadison hacking participants. Our findings indicate that religiosity alone does not predict demonization. Instead, sex guilt was a necessary part of the equation and mediated between participants' religiosity and the amount they demonized the different groups.

  5. The impact of culture collections on molecular identification, taxonomy, and solving real problems

    Science.gov (United States)

    Among the fungi, Fusarium has stood out as a major focus for culture collection resource development over the last century. This has facilitated unprecedented molecular taxonomic advancements, which in turn has led to problem solving in plant pathology, mycotoxicology, medical mycology, and basic re...

  6. Identification of circulating prostate cancer cells: A challenge to the clinical implementation of molecular biology (Review)

    NARCIS (Netherlands)

    Schamhart, Denis H. J.; Maiazza, Ruth; Kurth, Karl-Heinz

    2005-01-01

    Conventional diagnosis of prostate cancer does not appear to be sensitive enough to differentiate pre-operatively between organ-confined and extracapsular disease. New technologies. arising from the field of molecular biology, have been introduced to improve diagnosis and their implementation into

  7. Identification of a Common Binding Mode for Imaging Agents to Amyloid Fibrils from Molecular Dynamics Simulations

    DEFF Research Database (Denmark)

    Skeby, Katrine Kirkeby; Sørensen, Jesper; Schiøtt, Birgit

    2013-01-01

    experimentally due to the insoluble nature of amyloid fibrils. This study uses molecular dynamics simulations to investigate the interactions between 13 aromatic amyloid imaging agents, entailing 4 different organic scaffolds, and a model of an amyloid fibril. Clustering analysis combined with free energy...

  8. Isolation and identification of molecular species of phosphatidylcholine and lysophosphatidylcholine from jojoba seed meal (Simmondsia chinensis).

    Science.gov (United States)

    Léon, Fabian; Van Boven, Maurits; de Witte, Peter; Busson, Roger; Cokelaere, Marnix

    2004-03-10

    A mixture of lysophosphatidylcholine (LPC) and phosphatidylcholine (PC) has been isolated by column chromatography from a jojoba meal (Simmondsia chinensis) extract. The molecular species of both classes could be separated and isolated by C18 reversed phase HPLC. The two major compounds were identified by 1D and 2D (1)H and (13)C NMR, by MS, and by GC-MS as 1-oleoyl-3-lysophosphatidylcholine and 1,2-dioleoyl-3-phosphatidylcholine. Eight other molecular species of LPC and four other molecular species of PC could be assigned by comparison of the mass spectra of the isolated compounds with the spectra of the two major compounds. Complete characterization of the individual molecular species was achieved by GC and GC-MS analysis of the fatty acyl composition from the isolated compounds. The PC/LPC proportion in the phospholipid mixture from three different samples is 1.6 +/- 0.1. LPC is considered to be an important bioactive compound; the results of this study suggest further research for the evaluation of potential health benefits of jojoba meal phospholipids.

  9. Molecular identification of zoonotic hookworm species in dog faeces from Tanzania

    DEFF Research Database (Denmark)

    Merino-Tejedor, A.; Nejsum, P.; Mkupasi, E. M.

    2018-01-01

    The presence and distribution of various species of canine hookworms in Africa are poorly known. The main objective of this study, therefore, was to identify the hookworm species present in canine faecal samples from Morogoro, Tanzania, using molecular techniques. Faecal samples from 160 local do...

  10. Evaluation of molecular markers for Phytophthora ramorum detection and identification using a standardized library of isolates

    Science.gov (United States)

    F.N. Martin; M. Coffey; R. Hamelin; P. Tooley; M. Garbelotto; K. Hughes; T. Kubisiak

    2008-01-01

    A number of molecular diagnostic procedures for detection of Phytophthora ramorum have been reported in the literature. In an effort to evaluate the specificity of 10 of these techniques a standardized DNA library for 317 isolates was assembled that included 60 described species as well as 22 taxonomically unclassified isolates. These were sent blind...

  11. Mass spectrometric identification of molecular species of phosphatidylcholine and lysophosphatidycholine extracted from shark liver

    NARCIS (Netherlands)

    Chen, S.; Li, K.W.

    2007-01-01

    The profile and structural characterization of molecular species of phosphatidylcholine (PC) and lysophosphatidylcholine (LysoPC) from shark liver using liquid chromatographic/electrospray ionization mass spectrometry (LC-ESI/MS) and tandem mass spectrometry (MS/MS) are described for the first time

  12. Molecular double-check strategy for the identification and characterization of European Lyssaviruses

    NARCIS (Netherlands)

    Fischer, M.; Freuling, C.M.; Müller, T.; Wegelt, A.; Kooi, E.A.; Rasmussen, T.B.; Voller, K.; Marston, D.A.; Fooks, A.R.; Beer, M.; Hoffmann, B.

    2014-01-01

    The “gold standard” for post-mortem rabies diagnosis is the direct fluorescent antibody test (FAT). However, in the case of ante-mortem non-neural sample material or decomposed tissues, the FAT reaches its limit, and the use of molecular techniques can be advantageous. In this study, we developed

  13. Molecular identification of Entamoeba species in savanna woodland chimpanzees (Pan troglodytes schweinfurthii)

    Czech Academy of Sciences Publication Activity Database

    Jirků-Pomajbíková, K.; Čepička, I.; Kalousová, B.; Jirků, M.; Stewart, F.; Levecke, B.; Modrý, D.; Piel, A. K.; Petrželková, Klára Judita

    2016-01-01

    Roč. 143, č. 6 (2016), s. 741-748 ISSN 0031-1820 R&D Projects: GA ČR GA206/09/0927 Institutional support: RVO:68081766 Keywords : Entamoeba * molecular diversity * great apes * chimpanzee * savannah Subject RIV: EG - Zoology Impact factor: 2.713, year: 2016

  14. High-Throughput Sequencing and Linkage Mapping of a Clownfish Genome Provide Insights on the Distribution of Molecular Players Involved in Sex Change.

    Science.gov (United States)

    Casas, Laura; Saenz-Agudelo, Pablo; Irigoien, Xabier

    2018-03-06

    Clownfishes are an excellent model system for investigating the genetic mechanism governing hermaphroditism and socially-controlled sex change in their natural environment because they are broadly distributed and strongly site-attached. Genomic tools, such as genetic linkage maps, allow fine-mapping of loci involved in molecular pathways underlying these reproductive processes. In this study, a high-density genetic map of Amphiprion bicinctus was constructed with 3146 RAD markers in a full-sib family organized in 24 robust linkage groups which correspond to the haploid chromosome number of the species. The length of the map was 4294.71 cM, with an average marker interval of 1.38 cM. The clownfish linkage map showed various levels of conserved synteny and collinearity with the genomes of Asian and European seabass, Nile tilapia and stickleback. The map provided a platform to investigate the genomic position of genes with differential expression during sex change in A. bicinctus. This study aims to bridge the gap of genome-scale information for this iconic group of species to facilitate the study of the main gene regulatory networks governing social sex change and gonadal restructuring in protandrous hermaphrodites.

  15. High-Throughput Sequencing and Linkage Mapping of a Clownfish Genome Provide Insights on the Distribution of Molecular Players Involved in Sex Change

    KAUST Repository

    Casas, Laura

    2018-02-28

    Clownfishes are an excellent model system for investigating the genetic mechanism governing hermaphroditism and socially-controlled sex change in their natural environment because they are broadly distributed and strongly site-attached. Genomic tools, such as genetic linkage maps, allow fine-mapping of loci involved in molecular pathways underlying these reproductive processes. In this study, a high-density genetic map of Amphiprion bicinctus was constructed with 3146 RAD markers in a full-sib family organized in 24 robust linkage groups which correspond to the haploid chromosome number of the species. The length of the map was 4294.71 cM, with an average marker interval of 1.38 cM. The clownfish linkage map showed various levels of conserved synteny and collinearity with the genomes of Asian and European seabass, Nile tilapia and stickleback. The map provided a platform to investigate the genomic position of genes with differential expression during sex change in A. bicinctus. This study aims to bridge the gap of genome-scale information for this iconic group of species to facilitate the study of the main gene regulatory networks governing social sex change and gonadal restructuring in protandrous hermaphrodites.

  16. Molecular identification of broomrape species from a single seed by High Resolution Melting analysis

    Directory of Open Access Journals (Sweden)

    Mathieu Rolland

    2016-12-01

    Full Text Available Broomrapes are holoparasitic plants spreading through seeds. Each plant produces hundreds of thousands of seeds which remain viable in the soils for decades. To limit their spread, drastic measures are being taken and the contamination of a commercial seed lot by a single broomrape seed can lead to its rejection. Considering that broomrapes species identification from a single seed is extremely difficult even for trained botanists and that among all the described species, only a few are really noxious for the crops, numerous seed lots are rejected because of the contamination by seeds of non-noxious broomrape species. The aim of this study was to develop and evaluate a High Resolution Melting assay identifying the eight most noxious and common broomrape species (P. aegyptiaca, O. cernua, O. crenata, O. cumana, O. foetida, O. hederae, O. minor, and P. ramosa from a single seed. Based on trnL and rbcL plastidial genes amplification, the designed assay successfully identifies O. cumana, O. cernua, O. crenata, O. minor, O. hederae, and O. foetida; P. ramosa and P. aegyptiaca can be differentiated from other species but not from each other. Tested on 50 seed lots, obtained results perfectly matched identifications performed by sequencing. Through the analysis of common seed lots by different analysts, the reproducibility of the assay was evaluated at 90 %. Despite an original sample preparation process it was not possible to extract enough DNA from some seeds (10% of the samples. The described assay fulfils its objectives and allows an accurate identification of the targeted broomrape species. It can be used to identify contaminants in commercial seed lots or for any other purpose. The assay might be extended to vegetative material.

  17. Identification of sweet chesnut pollen in bee pollen pellet using using molecular analysis.

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská

    2015-10-01

    Full Text Available Castanea sativa posses many characteristics that are used by human for different purposes, not only as a part of the food. One of them is the utilization of the sweet chesnut pollen for its pharmacological benefits. Actually, no information about the DNA based identification of the sweet chesnut exist. Here, an identification of Castanea sativa based on the specific DNA fragment amplification is described for the first time. Sweet chesnut identification was performed in the very complex sample of bee pollen pellets that were identified as to contain sweet chesnut pollen grains by morphological analysis. First, bioinformatic analysis was performed to find a Castanea sativa conservative part of galactol synthase gene. BLAST alignment of the CDS of GolS1 gene was performed by BLASTtn against plants nucleotide sequences in the NCBI database to ensure for the specifity or existing nucleotide differences. Then, specific primers were subsequently designed and PCR amplification was performed. All the PCRs have run in duplicates for pollen pellet sample and two independent samples of Castanea sativa pure pollen. Restriction cleavage of the PCR amplified fragment was performed to confirm the specifity of the obtained PCR product with the positive confirmation as the predicted three restriction fragments were obtained that fully correspond by the length to those from virtual clevage. Restriction endonuclease Hpy166II was used in restriction cleavage analysis. Castanea sativa pollen grains were confirmed reliable in multifloral pollen pellet by PCR and this approach has the potential to be used effectively for the authentication purposes of sweet chesnut.

  18. Molecular Identification of Paramecium bursaria Syngens and Studies on Geographic Distribution using Mitochondrial Cytochrome C Oxidase Subunit I (COI).

    Science.gov (United States)

    Zagata, Patrycja; Greczek-Stachura, Magdalena; Tarcz, Sebastian; Rautian, Maria

    2015-01-01

    Paramecium bursaria is composed of five syngens that are morphologically indistinguishable but sexually isolated. The aim of the present study was to confirm by molecular methods (analyses of mitochondrial COI) the identification of P. bursaria syngens originating from different geographical locations. Phylograms constructed using both the neighbor-joining and maximum-likelihood methods based on a comparison of 34 sequences of P. bursaria strains and P. multimicronucleatum, P. caudatum and P.calkinsi strains used as outgroups revealed five clusters which correspond to results obtained previously by mating reaction. Our analysis shows the existence of 24 haplotypes for the COI gene sequence in the studied strains. The interspecies haplotype diversity was Hd = 0.967. We confirmed genetic differentiation between strains of P. bursaria and the occurrence of a correlation between geographical distribution and the correspondent syngen.

  19. Molecular identification of a myosuppressin receptor from the malaria mosquito Anopheles gambiae

    DEFF Research Database (Denmark)

    Schöller, Susanne; Belmont, Martin; Cazzamali, Giuseppe

    2005-01-01

    The insect myosuppressins (X1DVX2HX3FLRFamide) are neuropeptides that generally block insect muscle activities. We have used the genomic sequence information from the malaria mosquito Anopheles gambiae Genome Project to clone a G protein-coupled receptor that was closely related to the two...... previously cloned and characterized myosuppressin receptors from Drosophila [Proc. Natl. Acad. Sci. USA 100 (2003) 9808]. The mosquito receptor cDNA was expressed in Chinese hamster ovary cells and was found to be activated by low concentrations of Anopheles myosuppressin (TDVDHVFLRFamide; EC50, 1.6 x 10...... identification of a mosquito neuropeptide receptor....

  20. Identification of a current hot spot of HIV type 1 transmission in Mongolia by molecular epidemiological analysis.

    Science.gov (United States)

    Davaalkham, Jagdagsuren; Unenchimeg, Puntsag; Baigalmaa, Chultem; Erdenetuya, Gombo; Nyamkhuu, Dulmaa; Shiino, Teiichiro; Tsuchiya, Kiyoto; Hayashida, Tsunefusa; Gatanaga, Hiroyuki; Oka, Shinichi

    2011-10-01

    We investigated the current molecular epidemiological status of HIV-1 in Mongolia, a country with very low incidence of HIV-1 though with rapid expansion in recent years. HIV-1 pol (1065 nt) and env (447 nt) genes were sequenced to construct phylogenetic trees. The evolutionary rates, molecular clock phylogenies, and other evolutionary parameters were estimated from heterochronous genomic sequences of HIV-1 subtype B by the Bayesian Markov chain Monte Carlo method. We obtained 41 sera from 56 reported HIV-1-positive cases as of May 2009. The main route of infection was men who have sex with men (MSM). Dominant subtypes were subtype B in 32 cases (78%) followed by subtype CRF02_AG (9.8%). The phylogenetic analysis of the pol gene identified two clusters in subtype B sequences. Cluster 1 consisted of 21 cases including MSM and other routes of infection, and cluster 2 consisted of eight MSM cases. The tree analyses demonstrated very short branch lengths in cluster 1, suggesting a surprisingly active expansion of HIV-1 transmission during a short period with the same ancestor virus. Evolutionary analysis indicated that the outbreak started around the early 2000s. This study identified a current hot spot of HIV-1 transmission and potential seed of the epidemic in Mongolia. Comprehensive preventive measures targeting this group are urgently needed.

  1. Microbiological and molecular identification of bacterial species isolated from nasal and oropharyngeal mucosa of fuel workers in Riyadh,

    Directory of Open Access Journals (Sweden)

    Suaad S. AlWakeel

    2017-09-01

    Full Text Available This study aimed to determine the bacterial species colonizing the nasal and oropharyngeal mucosa of fuel workers in Central Riyadh, Saudi Arabia on a microbiological and molecular level. Throat and nasal swab samples were obtained from 29 fuel station attendants in the period of time extending from March to May 2014 in Riyadh, Saudi Arabia. Microbiological identification techniques were utilized to identify the bacterial species isolated. Antibiotic sensitivity was assessed for each of the bacterial isolates. Molecular identification techniques based on PCR analysis of specific genomic sequences was conducted and was the basis on which phylogeny representation was done for 10 randomly selected samples of the isolates. Blood was drawn and a complete blood count was conducted to note the hematological indices for each of the study participants. Nineteen bacterial species were isolated from both the nasal cavity and the oropharynx including Streptococcus thoraltensis, alpha-hemolytic streptococci, Staphylococcus hominis, coagulase-negative staphylococci, Leuconostoc mesenteroides, Erysipelothrix rhusiopathiae and several others. We found 100% sensitivity of the isolates to ciprofloxacin, cefuroxime and gentamicin. Whereas cefotaxime and azithromycin posted sensitivities of 85.7% and 91.4%, respectively. Low sensitivities (<60% sensitivity to the antibiotics ampicillin, erythromycin, clarithromycin and norfloxacin were observed. Ninety-seven percent similarity to the microbial bank species was noted when the isolates were compared to it. Most hematological indices recorded were within the normal range. In conclusion, exposure to toxic fumes and compounds within fuel products may be a contributing factor to bacterial colonization of the respiratory tract in fuel workers.

  2. Zoonotic onchocerciasis in Hiroshima, Japan, and molecular analysis of a paraffin section of the agent for a reliable identification

    Directory of Open Access Journals (Sweden)

    Fukuda M.

    2011-05-01

    Full Text Available Japan is a country of high specific diversity of Onchocerca with eight species, the adults of two not yet known. Onchocerca dewittei japonica, a common filarial parasite of wild boar, had been proved to be the agent of five zoonotic onchocerciasis in Kyushu island with morphological and molecular studies. The sixth case, at Hiroshima in the main island, was identified to the same Onchocerca species, based on adult characters observed on histological sections. To consolidate the identification, mitochondrial cytochrome c oxidase subunit 1 (CO1 gene analysis was attempted with the formalin-fixed, paraffin-embedded parasite specimen. The sequence (196 bp of a CO1 gene fragment of the parasite successfully PCR-amplified agreed well with those of O. dewittei japonica registered in GenBank, confirming the morphological identification. Moreover a comparison with the CO1 gene sequences of six other Onchocerca species in GenBank excluded the possibility that Onchocerca sp. from wild boar and Onchocerca sp. type A from cattle in Japan, were the causative agents in this case. Mitochondrial DNA analysis proved to be a valuable tool to support the morphological method for the discrimination of zoonotic Onchocerca species in a histological specimen.

  3. Orange rust in sugarcane: molecular identification in Rio de Janeiro State

    Directory of Open Access Journals (Sweden)

    Carla Vanessa Borges Castro

    2013-09-01

    Full Text Available Sugarcane (Saccharum spp. cultivation is one of the major agricultural activities in the Brazilian states. This study aimed to molecularly identify the pathogen associated with rust in sugarcane cultivars in the state of Rio de Janeiro and to suggest a control strategy. Among the 14 PCR-tested cultivars, Puccinia kuehnii infection was identified for RB947520, RB92606, RB835486, RB72454, SP89-11I5, SP83-2847, both from infected leaf sample and from urediniospores. Puccinia kuehnii was not detected by PCR for the cultivars RB955971, RB951541, RB92579, RB867515, RB855536, SP91-1049, SP80-3280, SP80-1816. This is the first molecular detection of this fungus in the state of Rio de Janeiro for six of the 14 analyzed cultivars.

  4. Detection and identification of microbes in prosthetic joint infections by culture and molecular methods

    DEFF Research Database (Denmark)

    Xu, Yijuan; Schønheyder, Henrik Carl; Ehrlich, Garth

    , indicating biofilm formation. In conclusion, this study indicated that to improve the microbiological diagnosis of prosthetic joint infections molecular methods may be useful supplements to routine cultures, and the current intraoperative sampling strategy needs to be optimized.......Bacterial biofilms have been observed in many device-related infections including orthopedic implants. This mode of growth makes the infection difficult to treat and constitutes a challenge to current sampling procedures and culture practices to obtain a reliable diagnosis. The aim of the study...... uncovered many more species including known pathogens and species not previously reported in orthopedic infections, and polymicrobial communities were commonly observed. Additionally the molecular findings suggested the bacterial composition and yield varied depending on the position and type of samples...

  5. Towards a molecular identification and classification system of lepidopteran-specific baculoviruses

    International Nuclear Information System (INIS)

    Lange, Martin; Wang Hualin; Hu Zhihong; Jehle, Johannes A.

    2004-01-01

    Virus genomics provides novel approaches for virus identification and classification. Based on the comparative analyses of sequenced lepidopteran-specific baculovirus genomes, degenerate oligonucleotides were developed that allow the specific amplification of several regions of the genome using polymerase chain reaction (PCR) followed by DNA sequencing. The DNA sequences within the coding regions of three highly conserved genes, namely polyhedrin/granulin (polh/gran), late expression factor 8 (lef-8), and late expression factor 9 (lef-9), were targeted for amplification. The oligonucleotides were tested on viral DNAs isolated from historical field samples, and amplification products were generated from 12 isolated nucleopolyhedrovirus (NPV) and 8 granulovirus (GV) DNAs. The PCR products were cloned or directly sequenced, and phylogenetic trees were inferred from individual and combined data sets of these three genes and compared to a phylogeny, which includes 22 baculoviruses using a combined data set of 30 core genes. This method allows a fast and reliable detection and identification of lepidopteran-specific NPVs and GVs. Furthermore, a strong correlation of the base composition of these three genome areas with that of the complete virus genome was observed and used to predict the base composition of uncharacterized baculovirus genomes. These analyses suggested that GVs have a significantly higher AT content than NPVs

  6. Molecular-Based Identification and Detection of Salmonella in Food Production Systems: Current Perspectives.

    Science.gov (United States)

    Ricke, Steven C; Kim, Sun Ae; Shi, Zhaohao; Park, Si Hong

    2018-04-19

    Salmonella remains a prominent cause of foodborne illnesses and can originate from a wide range of food products. Given the continued presence of pathogenic Salmonella in food production systems, there is a consistent need to improve identification and detection methods that can identify this pathogen at all stages in food systems. Methods for subtyping have evolved over the years, and the introduction of whole genome sequencing and advancements in PCR technologies has greatly improved the resolution for differentiating strains within a particular serovar. This, in turn, has led to the continued improvement in Salmonella detection technologies for utilization in food production systems. In this review, the focus will be on recent advancements in these technologies, as well as potential issues associated with the application of these tools in food production. In addition, the recent and emerging research developments on Salmonella detection and identification methodologies and their potential application in food production systems will be discussed. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  7. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  8. Molecular-based mycobacterial identification in a clinical laboratory setting: a comparison of two methods.

    LENUS (Irish Health Repository)

    O'Donnell, N

    2012-01-01

    Many mycobacterial species are pathogenic to humans, with infection occurring worldwide. Infection with Mycobacterium tuberculosis is a well-described global phenomenon, but other mycobacterial species are increasingly shown to be the cause of both pulmonary and extrapulmonary infection and are managed differently from M. tuberculosis infection. Rapid and accurate differentiation of mycobacterial species is, therefore, critical to guide timely and appropriate therapeutic and public health management. This study evaluates two commercially available DNA strip assays, the Genotype Common Mycobacteria (CM) assay (Hain Lifescience, Nehren, Germany) and the Speed-oligo Mycobacteria assay (Vircell, Spain) for their usefulness in a clinical laboratory setting. Both assays were evaluated on 71 clinical mycobacterial isolates, previously identified using Gen-Probe AccuProbe and through a UK mycobacteriology reference laboratory, as well as 29 non-mycobacterial isolates. Concordant results were obtained for 98% of isolates using both assays. The sensitivity was 97% (95% confidence interval [CI]: 93.3-100%) for the CM assay and 98.6% (95% CI: 95.9-100%) for the Speed-oligo assay. Overall, both assays proved to be useful tools for rapid and sensitive mycobacterial species identification, although interpretation of results was easier with the CM assay. Finally, results were available within one day, compared to current identification times which range between seven days and four weeks.

  9. Molecular identification of Hepatozoon canis in dogs from Campo Grande, Mato Grosso do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Alberto do Nascimento Ramos

    Full Text Available The aim of this study was to investigate the occurrence of Hepatozoon species infecting dogs in the municipality of Campo Grande, Mato Grosso do Sul (MS, Brazil, using blood samples (n = 165 drawn from dogs. The species Hepatozoon caniswas identified in 3.63% of the tested animals using molecular tools. Further studies are needed to determine the clinical relevance of this infection and the main arthropod vectors involved in its transmission.

  10. Molecular identification of Hepatozoon canis in dogs from Campo Grande, Mato Grosso do Sul, Brazil

    OpenAIRE

    Ramos,Carlos Alberto do Nascimento; Babo-Terra,Verônica Jorge; Pedroso,Thatianna Camillo; Souza Filho,Antônio Francisco; Ribeiro de Araújo,Flábio; Cleveland,Herbert Patric Kellermann

    2015-01-01

    The aim of this study was to investigate the occurrence of Hepatozoon species infecting dogs in the municipality of Campo Grande, Mato Grosso do Sul (MS), Brazil, using blood samples (n = 165) drawn from dogs. The species Hepatozoon caniswas identified in 3.63% of the tested animals using molecular tools. Further studies are needed to determine the clinical relevance of this infection and the main arthropod vectors involved in its transmission.

  11. Molecular identification of Hepatozoon canis in dogs from Campo Grande, Mato Grosso do Sul, Brazil.

    Science.gov (United States)

    Ramos, Carlos Alberto do Nascimento; Babo-Terra, Verônica Jorge; Pedroso, Thatianna Camillo; Souza Filho, Antônio Francisco; de Araújo, Flábio Ribeiro; Cleveland, Herbert Patric Kellermann

    2015-01-01

    The aim of this study was to investigate the occurrence of Hepatozoon species infecting dogs in the municipality of Campo Grande, Mato Grosso do Sul (MS), Brazil, using blood samples (n = 165) drawn from dogs. The species Hepatozoon canis was identified in 3.63% of the tested animals using molecular tools. Further studies are needed to determine the clinical relevance of this infection and the main arthropod vectors involved in its transmission.

  12. Molecular techniques for detection and identification of pathogens in food: advantages and limitations

    OpenAIRE

    Palomino-Camargo, Carolina; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Magíster en Ciencia y Tecnología de los Alimentos licenciada en Biología; González-Muñoz, Yuniesky; Instituto de Ciencia y Tecnología de Alimentos, Facultad de Ciencias, Universidad Central de Venezuela. Caracas, Venezuela. Ministerio del Poder Popular para la Alimentación. Caracas, Venezuela. licenciado en Ciencias de los Alimentos.

    2014-01-01

    Foodborne diseases, caused by pathogenic microorganisms, are a major public health problem worldwide. Microbiological methods commonly used in the detection of these foodborne pathogens are laborious and time consuming. This situation, coupled with the demand for immediate results and with technological advances, has led to the development of a wide range of rapid methods in recent decades. On this basis, this review describes the advantages and limitations of the main molecular methods used ...

  13. Application of molecular genetic methods for identification of wood-decaying fungi in wood constructions

    OpenAIRE

    Elena Bobeková; Michal Tomšovský; Petr Horáček

    2008-01-01

    The aim of the paper is to evaluate the utilization of molecular biology methods for detection of wood decaying fungi directly from decomposed wood using a commercial DNA extraction kit developed for soil substrates (PowerSoil™ DNA isolation kit). The experiment based on dry rot fungus (Serpula lacrymans) detection from inoculated wooden pieces under laboratory conditions was followed by field detection of wood-decaying fungi from wood structures on building constructions. Fungal DNA was ide...

  14. Molecular Genetic Methods Implementation for Phytopathogen Identification in Forest Stands and Nurseries of the Russian Federation

    Directory of Open Access Journals (Sweden)

    T. S. Alimova

    2014-08-01

    Full Text Available The results of the application of molecular genetics methods for the analysis of the plant pathogens present in forest plantations and nurseries of the Russian Federation, including doughnut fungus and annosum root rot are presented. The prospects and benefits of using DNA analysis for early diagnosis of plant diseases without isolation of the pathogen in pure culture, shortening time of analysis, and the possibility of mass screening are discussed.

  15. Molecular identification of three crested newt species (Triturus cristatus superspecies) by RAPD markers

    Czech Academy of Sciences Publication Activity Database

    Mikulíček, P.; Piálek, Jaroslav

    2003-01-01

    Roč. 24, č. 2 (2003), s. 201-207 ISSN 0173-5373 R&D Projects: GA ČR GA206/98/0115; GA ČR GA206/01/0695; GA AV ČR KSK6005114 Institutional research plan: CEZ:AV0Z6093917; CEZ:MSM 113100004 Keywords : Triturus cristatus * genetic variation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.417, year: 2003

  16. Species identification of Aspergillus section Flavi isolates from Portuguese almonds using phenotypic, including MALDI-TOF ICMS, and molecular approaches.

    Science.gov (United States)

    Rodrigues, P; Santos, C; Venâncio, A; Lima, N

    2011-10-01

    Section Flavi is one of the most significant sections in the genus Aspergillus. Taxonomy of this section currently depends on multivariate approaches, entailing phenotypic and molecular traits. This work aimed to identify isolates from section Flavi by combining various classic phenotypic and genotypic methods as well as the novel approach based on spectral analysis by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF ICMS) and to evaluate the discriminatory power of the various approaches in species identification.   Aspergillus section Flavi isolates obtained from Portuguese almonds were characterized in terms of macro- and micromorphology, mycotoxin pattern, calmodulin gene sequence and MALDI-TOF protein fingerprint spectra. For each approach, dendrograms were created and results were compared. All data sets divided the isolates into three groups, corresponding to taxa closely related to Aspergillus flavus, Aspergillus parasiticus and Aspergillus tamarii. In the A. flavus clade, molecular and spectral analyses were not able to resolve between aflatoxigenic and nonaflatoxigenic isolates. In the A. parasiticus cluster, two well-resolved clades corresponded to unidentified taxa, corresponding to those isolates with mycotoxin profile different from that expected for A. parasiticus. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  17. Molecular subtyping of breast cancer improves identification of both high and low risk patients

    DEFF Research Database (Denmark)

    Rossing, Maria; Østrup, Olga; Majewski, Wiktor W.

    2018-01-01

    classification and final reports were available prior to the multidisciplinary conference. Using a prognostic standard mortality rate index (PSMRi) developed by the Danish Breast Cancer Group (DBCG) 39 patients were assigned with an intermediate risk and among these 16 (41%) were furthermore diagnosed...... by the multi-gene signature assigned with a luminal A tumor and consequently spared adjuvant chemotherapy. There was overall agreement between mRNA derived and IHC hormone receptor status, whereas IHC Ki67 protein proliferative index proved inaccurate, compared to the mRNA derived index. Forty-one patients...... with basal-like (basL) subtypes were screened for predisposing mutations regardless of clinical predisposition. Of those 17% carried pathogenic mutations. Conclusion: Transcriptome based subtyping of breast tumors evidently reduces the need for adjuvant chemotherapy and improves identification of women...

  18. Molecular identification of species of Taenia causing bovine cysticercosis in Ethiopia.

    Science.gov (United States)

    Hailemariam, Z; Nakao, M; Menkir, S; Lavikainen, A; Iwaki, T; Yanagida, T; Okamoto, M; Ito, A

    2014-09-01

    Bovine cysticercosis causing damage to the beef industry is closely linked to human taeniasis due to Taenia saginata. In African countries, Taenia spp. from wildlife are also involved as possible sources of infections in livestock. To identify the aetiological agents of bovine cysticercosis in Ethiopia, cysticerci were collected from 41 cattle slaughtered in the eastern and central areas during 2010-2012. A single cysticercus per animal was subjected to the polymerase chain reaction (PCR)-based DNA sequencing of mitochondrial cytochrome c oxidase subunit 1 gene, and the resultant sequence was compared with those of members of the genus Taenia. Although 38 out of 41 cysticerci (92.7%) were identified as T. saginata, three samples (7.3%) showed the hitherto unknown sequences of Taenia sp., which is distantly related to Taenia solium, Taenia arctos and Taenia ovis. Old literatures suggest it to be Taenia hyaenae, but morphological identification of species could not be completed by observing only the larval samples.

  19. Molecular identification of Aspergillus and Eurotium species isolated from rice and their toxin-producing ability.

    Science.gov (United States)

    Yazdani, D; Zainal Abidin, M A; Tan, Y H; Kamaruzaman, S

    2011-01-01

    Thirty milled rice samples were collected from retailers in 4 provinces of Malaysia. These samples were evaluated for Aspergillus spp. infection by direct plating on malt extract salt agar (MESA). All Aspergillus holomorphs were isolated and identified using nucleotide sequences of ITS 1 and ITS 2 of rDNA. Five anamorphs (Aspergillus flavus, A. oryzae, A. tamarii, A. fumigatus and A. niger) and 5 teleomorphs (Eurotium rubrum, E. amstelodami, E. chevalieri, E. cristatum and E. tonophilum) were identified. The PCR-sequencing based technique for sequences of ITS 1 and ITS 2 is a fast technique for identification of Aspergillus and Eurotium species, although it doesn't work flawlessly for differentiation of Eurotium species. All Aspergillus and Eurotium isolates were screened for their ability to produce aflatoxin and ochratoxin A (OTA) by HPLC and TLC techniques. Only A. flavus isolate UPM 89 was able to produce aflatoxins B1 and B2.

  20. Molecular Identification of Leishmania spp. in Sand Flies (Diptera: Psychodidae, Phlebotominae) From Ecuador

    Science.gov (United States)

    Cevallos, Varsovia; Morales, Diego; Baldeón, Manuel E; Cárdenas, Paúl; Rojas-Silva, Patricio; Ponce, Patricio

    2017-01-01

    Abstract The detection and identification of natural infections in sand flies by Leishmania protozoan species in endemic areas is a key factor in assessing the risk of leishmaniasis and in designing prevention and control measures for this infectious disease. In this study, we analyzed the Leishmania DNA using nuclear ribosomal internal transcript spacer (ITS) sequences. Parasite DNA was extracted from naturally infected, blood-fed sand flies collected in nine localities considered leishmaniasis-endemic foci in Ecuador. The species of parasites identified in sand flies were Leishmania major-like, Leishmania naiffi, Leishmania mexicana, Leishmania lainsoni, and “Leishmania sp. siamensis”. Sand fly specimens of Brumptomyia leopoldoi, Mycropigomyia cayennensis, Nyssomyia yuilli yuilli, Nyssomyia trapidoi, Pressatia triacantha, Pressatia dysponeta, Psychodopygus carrerai carrerai, Psychodopygus panamensis, and Trichophoromyia ubiquitalis were found positive for Leishmania parasite. These findings contribute to a better understanding of the epidemiology and transmission dynamics of the disease in high-risk areas of Ecuador. PMID:28981860

  1. Molecular Methods Used for the Identification of Potentially Probiotic Lactobacillus reuteri Strains

    Directory of Open Access Journals (Sweden)

    Agnes Weiss

    2005-01-01

    Full Text Available Forty potentially probiotic Lactobacillus strains as well as reference strains of different genera were grown under standardised conditions. Cell masses were harvested and DNA was isolated. For identification, all strains were subjected to genus-specific polymerase chain reaction (PCR, and the affiliation with the genus Lactobacillus was confirmed for all isolates. Using two species-specific primer-pairs for Lactobacillus reuteri, specific amplicons were observed for eight of the forty investigated strains. For differentiation, these eight strains as well as the reference strains of the species L. reuteri and closely related species were subjected to randomly amplified polymorphic DNA (RAPD-PCR using fourteen arbitrary primers. Two selected strains as well as probiotic and common reference strains were further investigated applying pulsed field gel electrophoresis (PFGE. With the latter two methods, individual profiles were found for most strains, but no difference between probiotic and common strains could be made out.

  2. Molecular identification and pathogenicity of Citrobacter and Serratia species isolated from cultured Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Manal I. El-Barbary

    2017-09-01

    Full Text Available This study aimed to isolate and characterize some pathogenic bacterial strains belonging to the family Enterobacteriaceae. They had been isolated from gills, liver, kidney and skin of naturally infected Oreochromis niloticus and had been identified by biochemical test and 16S rRNA gene using four universal primers. Additionally, the isolates were tested for antimicrobial susceptibility, histopathological alterations of liver, kidney and gills and the pathogenicity of the identified isolates for O. niloticus. The results of phylogenetic analysis placed the isolates in the family Enterobacteriaceae (genera Serratia and Citrobacter based on 99% homology. The primer pair (17F and 1390R is the most appropriate pair of universal primers employed for the identification of 16S rRNA gene as it covers as much as possible of the variable regions (Vs. V1 and V2 regions of 16S rRNA gene presented weak evidence of the diversity of the genera Serratia. The mortality rate was 40–60% after challenging O. niloticus by identified isolates, which revealed its sensitivity to ciprofloxacin and norfloxacin. Histological changes showed dilation in sinusoids with severe vacuolar degeneration in the liver, tubular degeneration and hemorrhage between renal tubules with pyknotic nuclei in the kidney, epithelial hyperplasia, aneurism and evident epithelium interstitial edema in gills of O. niloticus. This study concluded that these isolates should be considered as an opportunistic pathogen of O. niloticus. The study also states that the sequencing of 16S rRNA is an important tool for the identification of unknown bacterial species of fish pathogen. Keywords: Citrobacter sp., Serratia sp., Phylogenetic analysis, Histology, Antibiotic sensitivity, Oreochromis niloticus

  3. Morpho-molecular identification of a novel aspergillus spp. and its cultural optimization for lipases production

    International Nuclear Information System (INIS)

    Iftikhar, T.; Niaz, M.; Haider, M.Z.; Sidra, A.

    2014-01-01

    Different lipid rich products were used to obtain oil degrading fungal isolates. The isolates were codified for referral to our culture bank and compared for their lipolytic potential. Amongst the isolates, MBL-1412 isolated from the cooked sliced cicer arietinum (Channa Daal) was found to be a potent hyper-producer and was optimized for lipase production under solid state fermentation. Initial systematic treatment based upon micrometric data and consultation with the standard monographs and fungus ended up with its identification as Aspergillus sp. The identification confirmed that the fungus belongs to genus Aspergillus, by DNA barcoding marker like 18S RNA gene sequence.Later, the sequence was registered with accession no. KM924434 in the public nucleotide library (genbank) of NCBI. Fungal culture was maintained on 2% potato dextrose agar (PDA) during the study. Diverse substrates of agricultural byproducts under varied incubation temperature, time interval, inoculum level and different pH of diluent were used as parameters of optimization for hyper-production of lipases. Different carbon and nitrogen sources as additives of culture medium were applied for enhancement of lipase production. Almond meal (10g) with inoculum level at 1.5 mL after 48 h of time course at 50 degree C and 6 pH were selected to be the best eco-cultural conditions for optimal lipases production by Aspergillus sp. MBL-1412. Supplementary additives of nitrogen and carbon sources to the basal substrate improved lipases production appreciably. Ammonium chloride (1%) as inorganic nitrogen source, nutrient broth (0.8%) as organic nitrogen source and starch (0.8%) as carbon source were found as best media additives for enhanced extracellular lipases yield. (author)

  4. Identification and transcriptional modulation of the largemouth bass, Micropterus salmoides, vitellogenin receptor during oocyte development by insulin and sex steroids.

    Science.gov (United States)

    Dominguez, Gustavo A; Quattro, Joseph M; Denslow, Nancy D; Kroll, Kevin J; Prucha, Melinda S; Porak, Wesley F; Grier, Harry J; Sabo-Attwood, Tara L

    2012-09-01

    Fish vitellogenin synthesized and released from the liver of oviparous animals is taken up into oocytes by the vitellogenin receptor. This is an essential process in providing nutrient yolk to developing embryos to ensure successful reproduction. Here we disclose the full length vtgr cDNA sequence for largemouth bass (LMB) that reveals greater than 90% sequence homology with other fish vtgr sequences. We classify LMB Vtgr as a member of the low density lipoprotein receptor superfamily based on conserved domains and categorize as the short variant that is devoid of the O-glycan segment. Phylogenetic analysis places LMB Vtgr sequence into a well-supported monophyletic group of fish Vtgr. Real-time PCR showed that the greatest levels of LMB vtgr mRNA expression occurred in previtellogenic ovarian tissues. In addition, we reveal the effects of insulin, 17beta-estradiol (E(2)), and 11-ketotestosterone (11-KT) in modulation of vtgr, esr, and ar mRNAs in previtellogenic oocytes. Insulin increased vtgr expression levels in follicles ex vivo while exposure to E(2) or 11-KT did not result in modulation of expression. However, both steroids were able to repress insulin-induced vtgr transcript levels. Coexposure with insulin and E(2) or of insulin and 11-KT increased ovarian esr2b and ar mRNA levels, respectively, which suggest a role for these nuclear receptors in insulin-mediated signaling pathways. These data provide the first evidence for the ordered stage-specific expression of LMB vtgr during the normal reproductive process and the hormonal influence of insulin and sex steroids on controlling vtgr transcript levels in ovarian tissues.

  5. Molecular Identification of Weed hosts of Tomato yellow leaf curl virus in southeast of Kerman Province

    Directory of Open Access Journals (Sweden)

    Kh. Salari

    2016-02-01

    Full Text Available Introduction Tomato yellow leaf curl virus, TYLCV belongs to the family Geminiviridae and Begomovirus genus (27. In recent years, extensive damage to tomatoes and cucurbits plants in the south and the southeast of Iran has arrived (23. This virus family have circular, and single-stranded DNA genome and are widespread in tropical and subtropical areas (30. They are infected several plant species with economic importance. Begomoviruses are dicot-infecting, whitefly-transmitted viruses with a genome comprised of one or two molecules DNA (5. Up to now, studies have been performed to evaluate the status of distribution, and identification of natural host and assess the genetic diversity, but there is not a comprehensive review about its weed hosts yet. Materials and Methods In this research, The weeds from margins and inside greenhouses and farms of tomato and cucurbit in severely infected areas including Manoojan, Kahnooj, Faryab, Anbrabad and Jiroft to identify weed hosts of the virus in nature, were collected. Identification of collected samples were conducted by botanical specialists. Total DNAs were extracted from leaves according to the method of zhang et al. (1998 and stored at -20 oC. Identification of infected samples were carried out by PCR using degenerate primer pairs PCRv 181/Bc that direct the amplification of˷ 550 bp fragment of mono – and bipartite begomoviruses genome comprising the C-terminal portion of the intergenic region (IR N-terminal portion of the CPgene. PCR were performed in 25 µl reaction volumes containing 1 µl of template DNA, o.5 µl of Taq DNA polymerase Sinaclon (IRAN, 1.2 µl MgCl2, 0.5 µl dNTPs. 1 µM of each forward and reverse primers, 4.3 µl of 10× reaction buffer and 15.5 distilled water. The amplification were performed using a peqSTAR 96x Termal Cycler (Peqlabe, Germany. PCR conditions consisted of initial denaturing 94 oC for 3 min followed by 30 cycles of denaturation at 94 oC for 50s, annealing at

  6. The identification of carbapenemase types in Enterobacteriaceae by using molecular assay and phenotyping confirmation tests.

    Science.gov (United States)

    Genc, Ozlem; Aksu, Evrim; Gulcan, Aynur

    2016-06-01

    In this study, we aimed to identify the molecular carbapenemase types of the Enterobacteriaceae isolates and to evaluate the performance of manually prepared and commercially available combination disc methods and the modified Hodge test. One hundred and forty carbapenemase producing isolates and 45 isolates as control group were included in our study. The Xpert CARBA-R test was used as the molecular method. Antibiotic susceptibility tests were performed using combined discs, manually prepared with APBA (3-aminophenyl boronic acid), DPA (dipicolinic acid), EDTA (Ethylene diamine tetra acetic acid), cloxacillin supplements and Mastdiscs Combi-D70C that includes four antibiotic discs with specific inhibitors and temocillin discs. The modified Hodge test was performed on all isolates. OXA-48 gene was identified in 129 isolates , the NDM gene was identified in 10 isolates and VIM in one isolate. Thirty inaccurate results (30/185, 16%) were detected by using the manually prepared confirmation test. The sensitivity and specificity of this test were identified respectively 85% and 73%. Also, the sensitivity and specificity of the Mastdiscs Combi-D70C were identified as 100%. Negative results were detected in 3 NDM isolates with the use of a modified Hodge test. Sensitivity and specificity were calculated for the modified Hodge test respectively 97% and 100%. Finally, molecular methods provide results rapidly but they are not always easily accessible. The modified Hodge test can be used only for screening as a first step test and is not one of the tests that can identify the type of the carbapenemase. When carbapenem-resistant Enterobacteriaceae are detected, a commercial kit like Mastdiscs Combi-D70 may be preferred instead of the manually prepared phenotypic verification tests. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Identification of key genes and molecular mechanisms associated with dedifferentiated liposarcoma based on bioinformatic methods

    Directory of Open Access Journals (Sweden)

    Yu H

    2017-06-01

    Full Text Available Hongliang Yu,1 Dong Pei,2 Longyun Chen,2 Xiaoxiang Zhou,2 Haiwen Zhu2 1Department of Radiation Oncology, Jiangsu Cancer Hospital and Jiangsu Institute of Cancer Research, The Affiliated Cancer Hospital of Nanjing Medical University, Nanjing, 2Department of Radiation Oncology, Yancheng Third People’s Hospital, Yancheng, Jiangsu, People’s Republic of China Background: Dedifferentiated liposarcoma (DDLPS is one of the most deadly types of soft tissue sarcoma. To date, there have been few studies dedicated to elucidating the molecular mechanisms behind the disease; therefore, the molecular mechanisms behind this malignancy remain largely unknown.Materials and methods: Microarray profiles of 46 DDLPS samples and nine normal fat controls were extracted from Gene Expression Omnibus (GEO. Quality control for these microarray profiles was performed before analysis. Hierarchical clustering and principal component analysis were used to distinguish the general differences in gene expression between DDLPS samples and the normal fat controls. Differentially expressed genes (DEGs were identified using the Limma package in R. Next, the enriched Gene Ontology (GO terms and Kyoto Encyclopedia of Genes and Genomes (KEGG pathways were obtained using the online tool DAVID (http://david.abcc.ncifcrf.gov/. A protein–protein interaction (PPI network was constructed using the STRING database and Cytoscape software. Furthermore, the hub genes within the PPI network were identified.Results: All 55 microarray profiles were confirmed to be of high quality. The gene expression pattern of DDLPS samples was significantly different from that of normal fat controls. In total, 700 DEGs were identified, and 83 enriched GO terms and three KEGG pathways were obtained. Specifically, within the DEGs of DDLPS samples, several pathways were identified as being significantly enriched, including the PPAR signaling pathway, cell cycle pathway, and pyruvate metabolism pathway

  8. Mass spectrometric identification of Au68(SR)34 molecular gold nanoclusters with 34-electron shell closing.

    Science.gov (United States)

    Dass, Amala

    2009-08-26

    The molecular formula Au(68)(SCH(2)CH(2)Ph)(34) has been assigned to the 14 kDa nanocluster using MALDI-TOF mass spectrometry. The 34-electron shell closing in a macroscopically obtained thiolated gold nanocluster is demonstrated. The Au(68) nanocluster is predicted to have a 49 atom Marks decahedral core with 19 inner core atoms and 30 outer atoms chelating with the staple motifs. The nanoclusters' predicted formulation is [Au](19+30) [Au(SR)(2)](11) [Au(2)(SR)(3)](4).

  9. Molecular double check strategy for the identification and characterization of European Lyssaviruses

    DEFF Research Database (Denmark)

    Fischer, Melina; Freuling, Conrad; Mueller, Thomas

    2013-01-01

    Lyssaviruses (order Mononegavirales, family Rhabdoviridae), the causative agents of rabies, represent a remarkable public health threat in developing countries. Among human exposures RABV is transmitted predominantly by dog bite; however bat lyssaviruses have also caused human cases. The “gold...... standard” for post-mortem rabies diagnosis is the fluorescence antibody test (FAT). However, in the case of ante-mortem non-neural sample material (e.g. saliva, cerebral spinal fluid, skin biopsies) or badly decomposed tissues the FAT reaches its limit and the use of molecular methods like reverse...

  10. Molecular double-check strategy for the identification and characterization of European Lyssaviruses

    DEFF Research Database (Denmark)

    Fischer, Melina; Freuling, Conrad M.; Müller, Thomas

    2014-01-01

    The “gold standard” for post-mortem rabies diagnosis is the direct fluorescent antibody test (FAT). However, in the case of ante-mortem non-neural sample material or decomposed tissues, the FAT reaches its limit, and the use of molecular techniques can be advantageous. In this study, we developed......-systems for Rabies virus, European bat lyssavirus type 1 and 2 as well as Bokeloh bat lyssavirus. All assays were validated successfully with a comprehensive panel of lyssavirus positive samples, as well as negative material from various host species. This double-check strategy allows for both safe and sensitive...

  11. Isolation, enumeration, molecular identification and probiotic potential evaluation of lactic acid bacteria isolated from sheep milk

    OpenAIRE

    Acurcio, L.B.; Souza, M.R.; Nunes, A.C.; Oliveira, D.L.S.; Sandes, S.H.C.; Alvim, L.B.

    2014-01-01

    Lactic acid bacteria species were molecularly identified in milk from Lacaune, Santa Inês and crossbred sheep breeds and their in vitro probiotic potential was evaluated. The species identified were Enterococcus faecium (56.25%), E. durans (31.25%) and E. casseliflavus (12.5%). No other lactic acid bacteria species, such as lactobacilli, was identified. Most of the isolated enterococci were resistant to gastric pH (2.0) and to 0.3% oxgall. All tested enterococci were resistant to ceftazidime,...

  12. Application of molecular genetic methods for identification of wood-decaying fungi in wood constructions

    Directory of Open Access Journals (Sweden)

    Elena Bobeková

    2008-01-01

    Full Text Available The aim of the paper is to evaluate the utilization of molecular biology methods for detection of wood decaying fungi directly from decomposed wood using a commercial DNA extraction kit developed for soil substrates (PowerSoil™ DNA isolation kit. The experiment based on dry rot fungus (Serpula lacrymans detection from inoculated wooden pieces under laboratory conditions was followed by field detection of wood-decaying fungi from wood structures on building constructions. Fungal DNA was identified using the PCR–based methods including species-specific PCR and sequencing of amplified ITS region of ribosomal DNA.

  13. Identification of light absorbing oligomers from glyoxal and methylglyoxal aqueous processing: a comparative study at the molecular level

    Science.gov (United States)

    Finessi, Emanuela; Hamilton, Jacqueline; Rickard, Andrew; Baeza-Romero, Maria; Healy, Robert; Peppe, Salvatore; Adams, Tom; Daniels, Mark; Ball, Stephen; Goodall, Iain; Monks, Paul; Borras, Esther; Munoz, Amalia

    2014-05-01

    Numerous studies point to the reactive uptake of gaseous low molecular weight carbonyls onto atmospheric waters (clouds/fog droplets and wet aerosols) as an important SOA formation route not yet included in current models. However, the evaluation of these processes is challenging because water provides a medium for a complex array of reactions to take place such as self-oligomerization, aldol condensation and Maillard-type browning reactions in the presence of ammonium salts. In addition to adding to SOA mass, aqueous chemistry products have been shown to include light absorbing, surface-active and high molecular weight oligomeric species, and can therefore affect climatically relevant aerosol properties such as light absorption and hygroscopicity. Glyoxal (GLY) and methylglyoxal (MGLY) are the gaseous carbonyls that have perhaps received the most attention to date owing to their ubiquity, abundance and reactivity in water, with the majority of studies focussing on bulk physical properties. However, very little is known at the molecular level, in particular for MGLY, and the relative potential of these species as aqueous SOA precursors in ambient air is still unclear. We have conducted experiments with both laboratory solutions and chamber-generated particles to simulate the aqueous processing of GLY and MGLY with ammonium sulphate (AS) under typical atmospheric conditions and investigated their respective aging products. Both high performance liquid chromatography coupled with UV-Vis detection and ion trap mass spectrometry (HPLC-DAD-MSn) and high resolution mass spectrometry (FTICRMS) have been used for molecular identification purposes. Comprehensive gas chromatography with nitrogen chemiluminescence detection (GCxGC-NCD) has been applied for the first time to these systems, revealing a surprisingly high number of nitrogen-containing organics (ONs), with a large extent of polarities. GCxGC-NCD proved to be a valuable tool to determine overall amount and rates of

  14. Molecular identification of Lactobacillus spp. associated with puba, a Brazilian fermented cassava food

    Directory of Open Access Journals (Sweden)

    S.M. Crispim

    2013-01-01

    Full Text Available Puba or carimã is a Brazilian staple food obtained by spontaneous submerged fermentation of cassava roots. A total of 116 lactobacilli and three cocci isolates from 20 commercial puba samples were recovered on de Man, Rogosa and Sharpe agar (MRS; they were characterized for their antagonistic activity against foodborne pathogens and identified taxonomically by classical and molecular methods. In all samples, lactic acid bacteria were recovered as the dominant microbiota (7.86 ± 0.41 log10 CFU/g. 16S-23S rRNA ARDRA pattern assigned 116 isolates to the Lactobacillus genus, represented by the species Lactobacillus fermentum (59 isolates, Lactobacillus delbrueckii (18 isolates, Lactobacillus casei (9 isolates, Lactobacillus reuteri (6 isolates, Lactobacillus brevis (3 isolates, Lactobacillus gasseri (2 isolates, Lactobacillus nagelii (1 isolate, and Lactobacillus plantarum group (18 isolates. recA gene-multiplex PCR analysis revealed that L. plantarum group isolates belonged to Lactobacillus plantarum (15 isolates and Lactobacillus paraplantarum (3 isolates. Genomic diversity was investigated by molecular typing with rep (repetitive sequence-based PCR using the primer ERIC2 (enterobacterial repetitive intergenic consensus. The Lactobacillus isolates exhibited genetic heterogeneity and species-specific fingerprint patterns. All the isolates showed antagonistic activity against the foodborne pathogenic bacteria tested. This antibacterial effect was attributed to acid production, except in the cases of three isolates that apparently produced bacteriocin-like inhibitory substances. This study provides the first insight into the genetic diversity of Lactobacillus spp. of puba.

  15. Molecular identification of Echinococcus granulosus on the Tibetan Plateau using mitochondrial DNA markers.

    Science.gov (United States)

    Hu, D; Song, X; Wang, N; Zhong, X; Wang, J; Liu, T; Jiang, Z; Dawa, T; Gu, X; Peng, X; Yang, G

    2015-10-30

    Cystic echinococcosis (CE) is an important worldwide zoonotic disease that causes large economic losses and human suffering. Echinococcus granulosus, the causative agent of CE, exhibits different genotypes in different locations. In order to identify its genotypes and analyze its genetic structure on the Tibetan Plateau, we collected 72 hydatid cysts from different intermediate hosts and amplified and sequenced their mitochondrial cytochrome c oxidase subunit 2 (cox2) genes. Seventy isolates were identified as the E. granulosus G1 genotype, while two isolates belonged to the G6 genotype. There were 18 haplotypes among the 70 E. granulosus isolates, which exhibited a star-like network pattern and shared a common haplotype (H1). There was little difference between geographical sub-populations. Our results suggest that a recent E. granulosus population expansion occurred on the Tibetan Plateau, suggesting that E. granulosus was introduced into China. This study increases the basic molecular data needed for the molecular diagnosis, epidemiology, prevention, and control of Echinococcus diseases.

  16. Genotyping and Molecular Identification of Date Palm Cultivars Using Inter-Simple Sequence Repeat (ISSR) Markers.

    Science.gov (United States)

    Ayesh, Basim M

    2017-01-01

    Molecular markers are credible for the discrimination of genotypes and estimation of the extent of genetic diversity and relatedness in a set of genotypes. Inter-simple sequence repeat (ISSR) markers rapidly reveal high polymorphic fingerprints and have been used frequently to determine the genetic diversity among date palm cultivars. This chapter describes the application of ISSR markers for genotyping of date palm cultivars. The application involves extraction of genomic DNA from the target cultivars with reliable quality and quantity. Subsequently the extracted DNA serves as a template for amplification of genomic regions flanked by inverted simple sequence repeats using a single primer. The similarity of each pair of samples is measured by calculating the number of mono- and polymorphic bands revealed by gel electrophoresis. Matrices constructed for similarity and genetic distance are used to build a phylogenetic tree and cluster analysis, to determine the molecular relatedness of cultivars. The protocol describes 3 out of 9 tested primers consistently amplified 31 loci in 6 date palm cultivars, with 28 polymorphic loci.

  17. Molecular identification of fungal isolates and hatching success of green turtle (Chelonia mydas) nests.

    Science.gov (United States)

    Candan, Esra Deniz

    2018-02-26

    The aim of this study is to investigate the fungal diversity of green turtle nests and to examine phylogenetic relationships among these isolates. During the nesting season, samples of intra-nest sand and failed eggs were collected from 25% of the surviving nests in Sugözü Beaches, which are amongst the most important nesting beaches for endangered green turtles in the Mediterranean. Twenty-three fungi were identified by molecular techniques. Fungal isolates belonged to genera Aspergillus, Emericella, Rhizopus, Actinomucor and Apophysomyces with two undescribed species. Aspergillus variecolor, Aspergillus quadrilinieatus, Aspergillus tubingensis, Rhizopus oryzae, Actinomucor elegans and Apophysomyces variabilis were firstly detected in all sea turtle nests within this study. Our results demonstrate that 36.4% of the nests had fungal contamination. Also hatching success of the nests contaminated by fungi were significantly lower than the uncontaminated nests (P = 0.029). Also, this may represent a threat to marine turtles and a risk for the health of conservation workers. This study is the first molecular phylogenetic study associated with sea turtle nests in the eastern Mediterranean coast and contributes to the wider body of literature on fungal invasion of sea turtle nests with firstly isolated species. These findings are important for improving potential conservation measures for the nest sites.

  18. Identification and characterization of new molecular partners for the protein arginine methyltransferase 6 (PRMT6.

    Directory of Open Access Journals (Sweden)

    Alessandra Lo Sardo

    Full Text Available PRMT6 is a protein arginine methyltransferase that has been implicated in transcriptional regulation, DNA repair, and human immunodeficiency virus pathogenesis. Only few substrates of this enzyme are known and therefore its cellular role is not well understood. To identify in an unbiased manner substrates and potential regulators of PRMT6 we have used a yeast two-hybrid approach. We identified 36 new putative partners for PRMT6 and we validated the interaction in vivo for 7 of them. In addition, using invitro methylation assay we identified 4 new substrates for PRMT6, extending the involvement of this enzyme to other cellular processes beyond its well-established role in gene expression regulation. Holistic approaches create molecular connections that allow to test functional hypotheses. The assembly of PRMT6 protein network allowed us to formulate functional hypotheses which led to the discovery of new molecular partners for the architectural transcription factor HMGA1a, a known substrate for PRMT6, and to provide evidences for a modulatory role of HMGA1a on the methyltransferase activity of PRMT6.

  19. Molecular markers based identification of diversity for drought tolerance in bread wheat varieties and synthetic hexaploids.

    Science.gov (United States)

    Shah, Zahid Hussain; Munir, Muhammad; Kazi, Abdul Mujeeb; Mujtaba, Tahir; Ahmed, Zaheer

    2009-01-01

    The complexity of the wheat genome has delayed the development and application of molecular markers to this species and wheat now lies behind barley, maize and rice in marker development. However, improvements in marker detection systems and in the techniques used to identify markers linked to useful traits has allowed considerable advances to be made in recent years. To evaluate the genetic diversity 53 genotypes of Richard's selection, were studied at National Agriculture Reseach Center (NARC) Islamabad. The present study found that RAPD analysis is a valuable diagnostic tool. Different sets of RAPD primers were used to study the polymorphism at molecular level. Highest number of amplifications was shown by primer OpG-2 in Richard's material. Coefficient of similarity as well as genetic distances among these three sets of materials was calculated by using Unweighted Pair Group of Arithamatic Means (UPGMA) function (Nei and Li, 1979). The SHs derived genotypes of Richard's selection were highly polymorphic with a polymorphism percentage of 69.70 as compared to NUYT (rainfed) and elite Pakistani bread wheat varieties with a polymorphism of 44.44% and 61.11% respectively. Cluster analysis was done in which grouping of genotypes was done on the basis of genetic distances. Cluster analysis revealed that genotypes of Richard's genotypes are showing high level of among cultivar variation as compared to NUYT (Rainfed) and elite Pakistani drought tolerant bread wheat varieties. These genotypes were also phenotypically evaluated.

  20. Neuroprotection of Sex Steroids

    Science.gov (United States)

    Liu, Mingyue; Kelley, Melissa H.; Herson, Paco S.; Hurn, Patricia D.

    2011-01-01

    Sex steroids are essential for reproduction and development in animals and humans, and sex steroids also play an important role in neuroprotection following brain injury. New data indicate that sex-specific responses to brain injury occur at the cellular and molecular levels. This review summarizes the current understanding of neuroprotection by sex steroids, particularly estrogen, androgen, and progesterone, based on both in vitro and in vivo studies. Better understanding of the role of sex steroids under physiological and pathological conditions will help us to develop novel effective therapeutic strategies for brain injury. PMID:20595940

  1. Molecular Dynamics simulations of Inhibitor of Apoptosis Proteins and identification of potential small molecule inhibitors.

    Science.gov (United States)

    Jayakumar, Jayanthi; Anishetty, Sharmila

    2014-05-01

    Chemotherapeutic resistance due to over expression of Inhibitor of Apoptosis Proteins (IAPs) XIAP, survivin and livin has been observed in various cancers. In the current study, Molecular Dynamics (MD) simulations were carried out for all three IAPs and a common ligand binding scaffold was identified. Further, a novel sequence based motif specific to these IAPs was designed. SMAC is an endogenous inhibitor of IAPs. Screening of ChemBank for compounds similar to lead SMAC-non-peptidomimetics yielded a cemadotin related compound NCIMech_000654. Cemadotin is a derivative of natural anti-tumor peptide dolastatin-15; hence these compounds were docked against all three IAPs. Based on our analysis, we propose that NCIMech_000654/dolastatin-15/cemadotin derivatives may be investigated for their potential in inhibiting XIAP, survivin and livin. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Identification of differentiation-stage specific molecular markers for the osteoblastic phenotype

    DEFF Research Database (Denmark)

    Twine, Natalie; Chen, Li; Wilkins, Marc

    to age-matched control (n=4). Using RNA-seq and cluster analysis, we identified a set of stage-specific molecular markers that define the progression of OB phenotype during ex vivo culture of hMSC, predict in vivo bone formation capacity of hMSC and can be employed to study the mechanisms of impaired......The phenotype of osteoblastic (OB) cells in culture is currently defined using a limited number of markers of low sensitivity and specificity which belong mostly to extracellular matrix proteins. Also, for clinical use of human skeletal (mesenchymal) stem cells (hMSC) in bone regeneration......, there is a need to identify predictive markers for in vivo bone forming capacity. Thus, we employed Illumina RNA sequencing (RNASeq) to examine changes in gene expression across 8 time points between 0-12 days of ex vivo OB differentiation of hMSC. We identified a subset of expressed genes as potentially...

  3. Prevalence and molecular identification of Cryptosporidium isolates from pet lizards and snakes in Italy

    Directory of Open Access Journals (Sweden)

    Rinaldi L.

    2012-11-01

    Full Text Available In order to acquire prevalence and genetic data on Cryptosporidium infections in captive lizards and snakes kept as pets, a survey was conducted on 150 individual reptiles from southern Italy. Fecal samples were preserved in 5% formalin and analyzed using a commercial immunofluorescence assay (IFA for the detection of Cryptosporidium oocysts and Giardia cysts. IFA revealed the presence of Cryptosporidium oocysts in nine of the 150 samples examined (6.0%, precisely in 6/125 snakes (4.8% and in 3/25 lizards (12.0%; all fecal samples tested negative for the presence of Giardia cysts. Molecular characterization based on nested PCR amplification and sequencing of the SSU-rRNA gene, revealed the presence of Cryptosporidium serpentis in three samples from snakes (Boa constrictor constrictor, Elapheguttata guttata guttata and Python molurus.

  4. Identification of the Schistosoma mansoni Molecular Target for the Antimalarial Drug Artemether

    KAUST Repository

    Lepore, Rosalba

    2011-11-28

    Plasmodium falciparum and Schistosoma mansonii are the parasites responsible for most of the malaria and schistosomiasis cases in the world. Notwithstanding their many differences, the two agents have striking similarities in that they both are blood feeders and are targets of an overlapping set of drugs, including the well-known artemether molecule. Here we explore the possibility of using the known information about the mode of action of artemether in Plasmodium to identify the molecular target of the drug in Schistosoma and provide evidence that artemether binds to SmSERCA, a putative Ca2+-ATPase of Schistosoma. We also predict the putative binding mode of the molecule for both its Plasmodium and Schistosoma targets. Our analysis of the mode of binding of artemether to Ca2+-ATPases also provides an explanation for the apparent paradox that, although the molecule has no side effect in humans, it has been shown to possess antitumoral activity. © 2011 American Chemical Society.

  5. First Identification and Molecular Characterization of Avian metapneumovirus Subtype B from Chickens in Greece.

    Science.gov (United States)

    Tucciarone, Claudia Maria; Andreopoulou, Marianna; Franzo, Giovanni; Prentza, Zoi; Chaligiannis, Ilias; Cecchinato, Mattia

    2017-09-01

    Avian metapneumovirus (aMPV) is considered a major pathogen for turkeys but its impact on chicken production is still partially neglected, even though it is fully acknowledged as a primary pathogen in chickens as well. The lack of structured diagnostic surveys does not allow a pervasive understanding of aMPV epidemiology. Being that aMPV is almost an everyday challenge for farmers and veterinarians, a more accurate report of its presence should be detailed, posing the basis for a deep and global epidemiologic analysis. With these premises, the present work aims to report the first detection and molecular characterization of aMPV subtype B field strains from unvaccinated chickens in Greece. The Greek strains appear to be phylogenetically related among each other and with other recent Mediterranean strains while being distant from the currently applied vaccines, thus stressing once more the necessity to evaluate aMPV diffusion and evolution.

  6. Molecular cytogenetics and characterization of a ZZ/ZW sex chromosome system in Triportheus nematurus (Characiformes, Characidae).

    Science.gov (United States)

    Diniz, Débora; Moreira-Filho, Orlando; Bertollo, Luiz Antonio Carlos

    2008-05-01

    Chromosomes of Triportheus nematurus, a fish species from family Characidae, were analyzed in order to establish the conventional karyotype, location of C-band positive heterochromatin, Ag-NORs, GC- and AT-rich sites, and mapping of 18S and 5S rDNA with fluorescence in situ hybridization (FISH). The diploid number found was 2n = 52 chromosomes in both males and females. However, the females presented a pair of differentiated heteromorphic chromosomes, characterizing a ZZ/ZW sex chromosome system. The Z chromosome was metacentric and the largest one in the karyotype, bearing C-positive heterochromatin at pericentromeric and telomeric regions. The W chromosome was middle-sized submetacentric, appearing mostly heterochromatic after C-banding and presenting heterogeneous heterochromatin composed of GC- and AT-rich regions revealed by fluorochrome staining. Ag-NORs were also GC-rich and surrounded by heterochromatic regions, being located at the secondary constriction on the short arms of the second chromosome pair, in agreement with 18S rDNA sites detected with FISH. The 18S and 5S rDNA were aligned in tandem, representing an uncommon situation in fishes. The results obtained reinforce the basal condition of the ZZ/ZW sex system in the genus Triportheus, probably arisen prior to speciation in the group.

  7. Molecular approach to the identification of fish in the South China Sea.

    Directory of Open Access Journals (Sweden)

    Junbin Zhang

    Full Text Available BACKGROUND: DNA barcoding is one means of establishing a rapid, accurate, and cost-effective system for the identification of species. It involves the use of short, standard gene targets to create sequence profiles of known species against sequences of unknowns that can be matched and subsequently identified. The Fish Barcode of Life (FISH-BOL campaign has the primary goal of gathering DNA barcode records for all the world's fish species. As a contribution to FISH-BOL, we examined the degree to which DNA barcoding can discriminate marine fishes from the South China Sea. METHODOLOGY/PRINCIPAL FINDINGS: DNA barcodes of cytochrome oxidase subunit I (COI were characterized using 1336 specimens that belong to 242 species fishes from the South China Sea. All specimen provenance data (including digital specimen images and geospatial coordinates of collection localities and collateral sequence information were assembled using Barcode of Life Data System (BOLD; www.barcodinglife.org. Small intraspecific and large interspecific differences create distinct genetic boundaries among most species. In addition, the efficiency of two mitochondrial genes, 16S rRNA (16S and cytochrome b (cytb, and one nuclear ribosomal gene, 18S rRNA (18S, was also evaluated for a few select groups of species. CONCLUSIONS/SIGNIFICANCE: The present study provides evidence for the effectiveness of DNA barcoding as a tool for monitoring marine biodiversity. Open access data of fishes from the South China Sea can benefit relative applications in ecology and taxonomy.

  8. Genetic diversity, identification, and certification of Chilean rice varieties using molecular markers

    Directory of Open Access Journals (Sweden)

    Viviana Becerra

    2015-09-01

    Full Text Available It takes approximately 14 yr to produce a new rice (Oryza sativa L. variety, that is, from initial hybridization to its commercial release. Currently, new varieties are identified based on morphological descriptors, which have been efficient over time. However, due to the main constraints on seed type impose to other breeding objectives and the pressure of continuous release of varieties, high degree of parentage, and genetic and morphological uniformity has been observed in the breeding populations. The objectives of this study were: to determine the genetic variability of Chilean and foreign commercial rice varieties, and determine, identify, and certify the genetic relationships among varieties, using simple sequence repeat (SSR markers. A total of 16 commercial varieties, some of them closely related, were included in the study, which were genétically analyzed using 54 microsatellites. The 54 microsatellite loci allowed the discrimination among the 16 varieties. The number of alleles ranged between 2 and 8 with a mean of 3.54 alleles per locus, while the polymorphism information content (PIC presented a mean of 0.44. The genetic distance and diversity parameters between pairs of varieties indicate a limited diversity among these genotypes. The cluster analysis indicated that varieties were grouped according to their grain type and pedigree. Results demonstrate that the identification and certification of varieties using microsatellite markers could be a good complement to existing agro-morphological data when varieties are closed related.

  9. Screening and Molecular Identification of New Microbial Strains for Production of Enzymes of Biotechnological Interest

    Directory of Open Access Journals (Sweden)

    Imen Ghazala

    Full Text Available ABSTRACT: This research focused on isolation, identification and characterization of new strains of fungi and bacteria, which were able to produce extracellular xylanase, mannanase, pectinase and α-amylase. Fungi isolates were identified on the basis of analyses of 18S gene sequencing and internal transcribed spacer region. The closest phylogenetic neighbors according to 18S gene sequence and ITS region data for the two isolates M1 and SE were Aspergillus fumigatus and Aspergillus sydowii, respectively. I4 was identified as Bacillus mojavensis on the basis of the 16S rRNA gene sequencing and biochemical properties. The enzyme production was evaluated by cultivating the isolated microorganisms in liquid-state bioprocess using wheat bran as carbon source. Two fungi (M1, and SE and one bacterium (I4 strains were found to be xylanase producer, and several were proven to be outstanding producers of microbial xylanase. The strains producing xylanase secreted variable amounts of starch-debranching enzymes and produced low level β-mannan-degrading enzyme systems. The bacterium strain was found to be capable of producing pectinolytic enzymes on wheat bran at high level. Some of the strains have good potential for use as sources of important industrial enzymes.

  10. Molecular Identification of Eimeria Species in Broiler Chickens in Trinidad, West Indies

    Directory of Open Access Journals (Sweden)

    Arianne Brown Jordan

    2018-01-01

    Full Text Available Coccidiosis is an intestinal disease of chickens of major economic importance to broiler industries worldwide. Species of coccidia found in chickens include Eimeria acervulina, Eimeria brunetti, Eimeria maxima, Eimeria mitis, Eimeria necatrix, Eimeria praecox, and Eimeria tenella. In recent years, polymerase chain reaction (PCR has been developed to provide accurate and rapid identification of the seven known Eimeria species of chickens. The aim of this study was to use species-specific real-time PCR (qPCR to identify which of the seven Eimeria species are present in Trinidad poultry. Seventeen pooled fecal samples were collected from 6 broiler farms (2–5 pens per farm across Trinidad. Feces were also collected from birds showing clinical signs of coccidiosis in two live bird markets (pluck shops. qPCR revealed the presence of five species of Eimeria (E. acervulina, E. maxima, E. mitis, E. necatrix, and E. tenella, but not E. brunetti or E. praecox. Mixed infections were detected on all broiler farms, and DNA of two highly pathogenic Eimeria species (E. tenella and E. necatrix was detected in feces taken from clinically sick birds sampled from the two pluck shops.

  11. Molecular Identification and Quantification of Tetracycline and Erythromycin Resistance Genes in Spanish and Italian Retail Cheeses

    Directory of Open Access Journals (Sweden)

    Ana Belén Flórez

    2014-01-01

    Full Text Available Large antibiotic resistance gene pools in the microbiota of foods may ultimately pose a risk for human health. This study reports the identification and quantification of tetracycline- and erythromycin-resistant populations, resistance genes, and gene diversity in traditional Spanish and Italian cheeses, via culturing, conventional PCR, real-time quantitative PCR (qPCR, and denaturing gradient gel electrophoresis (DGGE. The numbers of resistant bacteria varied widely among the antibiotics and the different cheese varieties; in some cheeses, all the bacterial populations seemed to be resistant. Up to eight antibiotic resistance genes were sought by gene-specific PCR, six with respect to tetracycline, that is, tet(K, tet(L, tet(M, tet(O, tet(S, and tet(W, and two with respect to erythromycin, that is, erm(B and erm(F. The most common resistance genes in the analysed cheeses were tet(S, tet(W, tet(M, and erm(B. The copy numbers of these genes, as quantified by qPCR, ranged widely between cheeses (from 4.94 to 10.18log⁡10/g. DGGE analysis revealed distinct banding profiles and two polymorphic nucleotide positions for tet(W-carrying cheeses, though the similarity of the sequences suggests this tet(W to have a monophyletic origin. Traditional cheeses would therefore appear to act as reservoirs for large numbers of many types of antibiotic resistance determinants.

  12. Molecular and morphological identification of fungal species isolated from bealmijang meju.

    Science.gov (United States)

    Kim, Ji Yeun; Yeo, Soo-Hwan; Baek, Sung Yeol; Choi, Hye Sun

    2011-12-01

    Bealmijang is a short-term aged paste made from meju, which is a brick of fermented soybeans and other ingredients. Different types of bealmijang are available depending on the geographic region or ingredients used. However, no study has clarified the microbial diversity of these types. We identified 17 and 14 fungal species from black soybean meju (BSM) and buckwheat meju (BWM), respectively, on the basis of morphology, culture characteristics, and internal transcribed spacer and beta-tubulin gene sequencing. In both meju, Aspergillus oryzae, Rhizopus oryzae, Penicillium polonicum, P. steckii, Cladosporium tenuissimum, C. cladosporioides, C. uredinicola, and yeast species Pichia burtonii were commonly found. Moreover, A. flavus, A. niger, P. crustosum, P. citrinum, Eurotium niveoglaucum, Absidia corymbifera, Setomelanomma holmii, Cladosporium spp. and unclassified species were identified from BSM. A. clavatus, Mucor circinelloides, M. racemosus, P. brevicompactum, Davidiella tassiana, and Cladosporium spp. were isolated from BWM. Fast growing Zygomycetous fungi is considered important for the early stage of meju fermentation, and A. oryae and A. niger might play a pivotal role in meju fermentation owing to their excellent enzyme productive activities. It is supposed that Penicillium sp. and Pichia burtonii could contribute to the flavor of the final food products. Identification of this fungal diversity will be useful for understanding the microbiota that participate in meju fermentation, and these fungal isolates can be utilized in the fermented foods and biotechnology industries.

  13. Toxicity and Molecular Identification of Green Toadfish Lagocephalus lunaris Collected from Kyushu Coast, Japan

    Directory of Open Access Journals (Sweden)

    Yuji Nagashima

    2011-01-01

    Full Text Available Green toadfish Lagocephalus lunaris inhabits tropical and subtropical seas and contains high tetrodotoxin (TTX levels in the muscle as well as liver and gonad. In 2008 to 2009, food poisoning due to ingesting L. lunais occurred in Western Japan. Five specimens of green toadfish caught in Kyushu coast, Japan, were analyzed for toxicity, toxins, and species identification. All five specimens were toxic by bioassay. Comparing the maximum toxicity in tissues, ovary contained the most toxin (1810 mouse unit [MU]/g, followed by liver (341 MU/g, muscle (135 MU/g, skin (79 MU/g, and intestine (72 MU/g. Liquid chromatography/mass spectrometry analysis revealed that TTX was the major toxin. Nucleotide sequence analysis of the 16S rRNA gene fragment of muscle mitochondrial DNA indicated that partial sequences of PCR products of four specimens were identical with that of L. lunaris. The sequence of one specimen was indistinguishable from that of the brown-backed toadfish Lagocephalus wheeleri, a nontoxic species.

  14. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  15. Molecular Identification of Leishmania spp. in Sand Flies (Diptera: Psychodidae, Phlebotominae) From Ecuador.

    Science.gov (United States)

    Quiroga, Cristina; Cevallos, Varsovia; Morales, Diego; Baldeón, Manuel E; Cárdenas, Paúl; Rojas-Silva, Patricio; Ponce, Patricio

    2017-11-07

    The detection and identification of natural infections in sand flies by Leishmania protozoan species in endemic areas is a key factor in assessing the risk of leishmaniasis and in designing prevention and control measures for this infectious disease. In this study, we analyzed the Leishmania DNA using nuclear ribosomal internal transcript spacer (ITS) sequences. Parasite DNA was extracted from naturally infected, blood-fed sand flies collected in nine localities considered leishmaniasis-endemic foci in Ecuador.The species of parasites identified in sand flies were Leishmania major-like, Leishmania naiffi, Leishmania mexicana, Leishmania lainsoni, and "Leishmania sp. siamensis". Sand fly specimens of Brumptomyia leopoldoi, Mycropigomyia cayennensis, Nyssomyia yuilli yuilli, Nyssomyia trapidoi, Pressatia triacantha, Pressatia dysponeta, Psychodopygus carrerai carrerai, Psychodopygus panamensis, and Trichophoromyia ubiquitalis were found positive for Leishmania parasite. These findings contribute to a better understanding of the epidemiology and transmission dynamics of the disease in high-risk areas of Ecuador. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  16. A general SNP-based molecular barcode for Plasmodium falciparum identification and tracking

    Directory of Open Access Journals (Sweden)

    Rosen David

    2008-10-01

    Full Text Available Abstract Background Single nucleotide polymorphism (SNP genotyping provides the means to develop a practical, rapid, inexpensive assay that will uniquely identify any Plasmodium falciparum parasite using a small amount of DNA. Such an assay could be used to distinguish recrudescence from re-infection in drug trials, to monitor the frequency and distribution of specific parasites in a patient population undergoing drug treatment or vaccine challenge, or for tracking samples and determining purity of isolates in the laboratory during culture adaptation and sub-cloning, as well as routine passage. Methods A panel of twenty-four SNP markers has been identified that exhibit a high minor allele frequency (average MAF > 35%, for which robust TaqMan genotyping assays were constructed. All SNPs were identified through whole genome sequencing and MAF was estimated through Affymetrix array-based genotyping of a worldwide collection of parasites. These assays create a "molecular barcode" to uniquely identify a parasite genome. Results Using 24 such markers no two parasites known to be of independent origin have yet been found to have the same allele signature. The TaqMan genotyping assays can be performed on a variety of samples including cultured parasites, frozen whole blood, or whole blood spotted onto filter paper with a success rate > 99%. Less than 5 ng of parasite DNA is needed to complete a panel of 24 markers. The ability of this SNP panel to detect and identify parasites was compared to the standard molecular methods, MSP-1 and MSP-2 typing. Conclusion This work provides a facile field-deployable genotyping tool that can be used without special skills with standard lab equipment, and at reasonable cost that will unambiguously identify and track P. falciparum parasites both from patient samples and in the laboratory.

  17. Identification of QS-21 as an Inflammasome-activating Molecular Component of Saponin Adjuvants.

    Science.gov (United States)

    Marty-Roix, Robyn; Vladimer, Gregory I; Pouliot, Kimberly; Weng, Dan; Buglione-Corbett, Rachel; West, Kim; MacMicking, John D; Chee, Jonathan D; Wang, Shixia; Lu, Shan; Lien, Egil

    2016-01-15

    Many immunostimulants act as vaccine adjuvants via activation of the innate immune system, although in many cases it is unclear which specific molecules contribute to the stimulatory activity. QS-21 is a defined, highly purified, and soluble saponin adjuvant currently used in licensed and exploratory vaccines, including vaccines against malaria, cancer, and HIV-1. However, little is known about the mechanisms of cellular activation induced by QS-21. We observed QS-21 to elicit caspase-1-dependent IL-1β and IL-18 release in antigen-presenting cells such as macrophages and dendritic cells when co-stimulated with the TLR4-agonist adjuvant monophosphoryl lipid A. Furthermore, our data suggest that the ASC-NLRP3 inflammasome is responsible for QS-21-induced IL-1β/IL-18 release. At higher concentrations, QS-21 induced macrophage and dendritic cell death in a caspase-1-, ASC-, and NLRP3-independent manner, whereas the presence of cholesterol rescued cell viability. A nanoparticulate adjuvant that contains QS-21 as part of a heterogeneous mixture of saponins also induced IL-1β in an NLRP3-dependent manner. Interestingly, despite the role NLRP3 plays for cellular activation in vitro, NLRP3-deficient mice immunized with HIV-1 gp120 and QS-21 showed significantly higher levels of Th1 and Th2 antigen-specific T cell responses and increased IgG1 and IgG2c compared with wild type controls. Thus, we have identified QS-21 as a nonparticulate single molecular saponin that activates the NLRP3 inflammasome, but this signaling pathway may contribute to decreased antigen-specific responses in vivo. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Identification and molecular epidemiology of dermatophyte isolates by repetitive-sequence-PCR-based DNA fingerprinting using the DiversiLab system in Turkey.

    Science.gov (United States)

    Koc, A Nedret; Atalay, Mustafa A; Inci, Melek; Sariguzel, Fatma M; Sav, Hafize

    2017-05-01

    Dermatophyte species, isolation and identification in clinical samples are still difficult and take a long time. The identification and molecular epidemiology of dermatophytes commonly isolated in a clinical laboratory in Turkey by repetitive sequence-based PCR (rep-PCR) were assessed by comparing the results with those of reference identification. A total of 44 dermatophytes isolated from various clinical specimens of 20 patients with superficial mycoses in Kayseri and 24 patients in Hatay were studied. The identification of dermatophyte isolates was based on the reference identification and rep-PCR using the DiversiLab System (BioMerieux). The genotyping of dermatophyte isolates from different patients was determined by rep-PCR. In the identification of dermatophyte isolates, agreement between rep-PCR and conventional methods was 87.8 % ( 36 of 41). The dermatophyte strains belonged to four clones (A -D) which were determined by the use of rep-PCR. The dermatophyte strains in Clone B, D showed identical patterns with respect to the region. In conclusion, rep-PCR appears to be useful for evaluation of the identification and clonal relationships between Trichophyton rubrum species complex and Trichophyton mentagrophytes species complex isolates. The similarity and diversity of these isolates may be assessed according to different regions by rep-PCR. © 2017 Blackwell Verlag GmbH.

  19. Molecular formula and METLIN Personal Metabolite Database matching applied to the identification of compounds generated by LC/TOF-MS.

    Science.gov (United States)

    Sana, Theodore R; Roark, Joseph C; Li, Xiangdong; Waddell, Keith; Fischer, Steven M

    2008-09-01

    In an effort to simplify and streamline compound identification from metabolomics data generated by liquid chromatography time-of-flight mass spectrometry, we have created software for constructing Personalized Metabolite Databases with content from over 15,000 compounds pulled from the public METLIN database (http://metlin.scripps.edu/). Moreover, we have added extra functionalities to the database that (a) permit the addition of user-defined retention times as an orthogonal searchable parameter to complement accurate mass data; and (b) allow interfacing to separate software, a Molecular Formula Generator (MFG), that facilitates reliable interpretation of any database matches from the accurate mass spectral data. To test the utility of this identification strategy, we added retention times to a subset of masses in this database, representing a mixture of 78 synthetic urine standards. The synthetic mixture was analyzed and screened against this METLIN urine database, resulting in 46 accurate mass and retention time matches. Human urine samples were subsequently analyzed under the same analytical conditions and screened against this database. A total of 1387 ions were detected in human urine; 16 of these ions matched both accurate mass and retention time parameters for the 78 urine standards in the database. Another 374 had only an accurate mass match to the database, with 163 of those masses also having the highest MFG score. Furthermore, MFG calculated a formula for a further 849 ions that had no match to the database. Taken together, these results suggest that the METLIN Personal Metabolite database and MFG software offer a robust strategy for confirming the formula of database matches. In the event of no database match, it also suggests possible formulas that may be helpful in interpreting the experimental results.

  20. Elimination and molecular identification of endophytic bacterial contaminants during in vitro propagation of Bambusa balcooa.

    Science.gov (United States)

    Ray, Syandan Sinha; Ali, Md Nasim; Mukherjee, Shibasis; Chatterjee, Gautam; Banerjee, Maitreyi

    2017-02-01

    Bambusa balcooa is an economically important, multipurpose bamboo species, decidedly used in construction industry. Availability of natural bamboo is depleting very rapidly due to accelerated deforestation and its unrestrained use. The large number and timely supply of saplings are the need of the hour for the restoration of bamboo stands. Micropropagation, being the potent alternative for season independent rapid regeneration, is restricted in bamboo because of endophytic contamination. An in vitro attempt has been taken to overcome the endophytic contamination by using broad spectrum antibiotics as surface sterilant as well as a media component. Ampicillin sodium salt (5 mg/ml for 30 min) as a surface sterilant was found as the best treatment for high bud breaking (80%) coupled with high branching and low contamination (20%) but it was found ineffective to control the contamination during multiplication stage. Then, two endophytes were isolated and minimum inhibitory concentration was determined through antibiotic susceptibility test for successful eradication at multiplication stage. Finally, contamination free cultures were obtained when streptocycline (100 μg/ml) and gentamicin sulphate (75 μg/ml) were added into the medium. The two isolated endophytes, BB1 and BB2, were identified through 16S rDNA techniques and NCBI-BLAST algorithm with 99% sequence similarity with those of Janibacter sp. (KX423734) and Serratia marcescens strain (KX423735). To our knowledge, this is the first report for B. balcooa where antibiotics were used as surface sterilant as well as medium component, to control endophytic bacterial contaminants, followed by their identification.

  1. Molecular identification and distribution profile of Candida species isolated from Iranian patients.

    Science.gov (United States)

    Mohammadi, Rasoul; Mirhendi, Hossein; Rezaei-Matehkolaei, Ali; Ghahri, Mohammad; Shidfar, Mohammad Reza; Jalalizand, Nilufar; Makimura, Koichi

    2013-08-01

    A total of 855 yeast strains isolated from different clinical specimens, mainly nail (42%) and vulva-vagina (25%) were identified by a set of polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLP). Genomic DNA was extracted from fresh colonies using Whatman FTA Card technology. PCR assays were performed on the complete ribosomal DNA internal transcribed spacer (rDNA-ITS) region for all isolates and species identification was carried out through their specific electrophoretic profiles after digestion with the enzyme MspI. Those isolates suspected as Candida parapsilosis group were then subjected to amplification of the secondary alcohol dehydrogenase (SADH) gene and restriction digestion with NlaIII enzyme. In total, 71.1% of the strains were obtained from females and 28.9% from males. The age group of 31-40 years consisted of the highest frequency of patients with candidiasis. Candida albicans was the predominant species (58.6%) followed by C. parapsilosis (11.0%), C. glabrata (8.3%), C. tropicalis (7.0%), C. kefyr (5.8%), C. krusei (4.4%), C. orthopsilosis (2.1%), and C. guilliermondii (0.6%). A few strains of C. lusitaniae, C. rugosa, C. intermedia, C. inconspicua, C. neoformans and S. cerevisiae were isolated. We could not identify 8 (0.9%) isolates. Candida albicans remains the most frequently species isolated from Iranian patients; however, the number of non-C. albicans Candida species looks to be increasing. The simple and reliable PCR-RFLP system used in the study has the potential to identify most clinically isolated yeasts.

  2. Molecular identification of two Culex (Culex species of the neotropical region (Diptera: Culicidae.

    Directory of Open Access Journals (Sweden)

    Magdalena Laurito

    Full Text Available Culex bidens and C. interfor, implicated in arbovirus transmission in Argentina, are sister species, only distinguishable by feature of the male genitalia; however, intermediate specimens of the species in sympatry have been found. Fourth-instar larvae and females of both species share apomorphic features, and this lack of clear distinction creates problems for specific identification. Geometric morphometric traits of these life stages also do not distinguish the species. The aim of the present study was to assess the taxonomic status of C. bidens and C. interfor using two mitochondrial genes and to determine the degree of their reproductive isolation using microsatellite loci. Sequences of the ND4 and COI genes were concatenated in a matrix of 993 nucleotides and used for phylogenetic and distance analyses. Bayesian and maximum parsimony inferences showed a well resolved and supported topology, enclosing sequences of individuals of C. bidens (0.83 BPP, 73 BSV and C. interfor (0.98 BPP, 97 BSV in a strong sister relationship. The mean K2P distance within C. bidens and C. interfor was 0.3% and 0.2%, respectively, and the interspecific variation was 2.3%. Bayesian clustering also showed two distinct mitochondrial lineages. All sequenced mosquitoes were successfully identified in accordance with the best close match algorithm. The low genetic distance values obtained indicate that the species diverged quite recently. Most morphologically intermediate specimens of C. bidens from Córdoba were heterozygous for the microsatellite locus GT51; the significant heterozygote excess observed suggests incomplete reproductive isolation. However, C. bidens and C. interfor should be considered good species: the ventral arm of the phallosome of the male genitalia and the ND4 and COI sequences are diagnostic characters.

  3. Identification, characterization and molecular epidemiology of Escherichia coli isolated from lamb and goat kids with diarrhoea

    Directory of Open Access Journals (Sweden)

    Süheyla Türkyılmaz

    2013-01-01

    Full Text Available Neonatal diarrhoea is a serious health problem on commercial farms. Enterovirulent Escherichia coli is a significant aetiological agent of neonatal diarrhoea. In this work, identification and classification of E. coli isolates obtained from lambs and goat kids with diarrhoea were studied along with antibiotic resistance and clonal relationships of enterovirulent strains. A total of 107 E. coli strains isolated from animals on 43 farms were investigated. Specific virulence genes were determined by multiplex and uniplex polymerase chain reaction. Testing of antibiotic susceptibility was carried out by the Vitek II compact system. The relationship of E. coli isolates was determined by enterobacterial repetitive intergenic consensus polymerase chain reaction. A total of 39 (36.4% enterovirulent E. coli strains were identified and of this 19 (48.7% were shiga toxigenic, 12 (30.8% enterotoxigenic and 8 (20.5% enteropathogenic. Three isolates (7.7% were found to be positive for extended spectrum beta lactamase; 10 (25.6% isolates showed multi-drug resistance to antimicrobials. A total of 28 types were detected by enterobacterial repetitive intergenic consensus polymerase chain reaction. Twenty strains had distinct types while 5 types were common for 2 strains and 3 types were common for 3 strains. This is the first current determination of types, clonality and antibiotic resistance of enterovirulent E. coli isolated from small ruminants with diarrhoea. The results of this study showed that the rates of shiga toxigenic, enterotoxigenic and enteropathogenic isolates of E. coli are high in the western part of Turkey. Although these isolates were not clonal, presence of multidrug resistant isolates may cause public health problems.

  4. Identification of molecular mechanisms of radiation-induced vascular damage in normal tissues using microarray analyses

    International Nuclear Information System (INIS)

    Kruse, J.J.C.M.; Te Poele, J.A.M.; Russell, N.S.; Boersma, L.J.; Stewart, F.A.

    2003-01-01

    Radiation-induced telangiectasia, characterized by thin-walled dilated blood vessels, can be a serious late complication in patients that have been previously treated for cancer. It might cause cosmetic problems when occurring in the skin, and excessive bleeding requiring surgery when occurring in rectal mucosa. The mechanisms underlying the development of radiation-induced telangiectasia are unclear. The aim of the present study is to determine whether microarrays are useful for studying mechanisms of radiation-induced telangiectasia. The second aim is to test the hypotheses that telangiectasia is characterized by a final common pathway in different tissues. Microarray experiments were performed using amplified RNA from (sham)irradiated mouse tissues (kidney, rectum) at different intervals (1-30 weeks) after irradiation. After normalization procedures, the differentially expressed genes were identified. Control/repeat experiments were done to confirm that the observations were not artifacts of the array procedure. The mouse kidney experiments showed significant upregulation of 31 and 42 genes and downregulation of 9 and 4 genes at 10 and 20 weeks after irradiation, respectively. Irradiated mouse rectum has 278 upregulated and 537 downregulated genes at 10 weeks and 86 upregulated and 29 downregulated genes at 20 weeks. During the development of telangiectasia, 19 upregulated genes and 5 downregulated genes were common to both tissues. Upregulation of Jagged-1, known to play a role in angiogenesis, is particularly interesting in the context of radiation-induced telangiectasia. Microarrays are affective discovery tools to identify novel genes of interest, which may be involved in radiation-induced normal tissue injury. Using information from control arrays (particularly straight color, color reverse and self-self experiments) allowed for a more accurate and reproducible identification of differentially expressed genes than the selection of an arbitrary 2-fold change

  5. Sexing young snowy owls

    Science.gov (United States)

    Seidensticker, M.T.; Holt, D.W.; Detienne, J.; Talbot, S.; Gray, K.

    2011-01-01

    We predicted sex of 140 Snowy Owl (Bubo scandiacus) nestlings out of 34 nests at our Barrow, Alaska, study area to develop a technique for sexing these owls in the field. We primarily sexed young, flightless owls (3844 d old) by quantifying plumage markings on the remiges and tail, predicting sex, and collecting blood samples to test our field predictions using molecular sexing techniques. We categorized and quantified three different plumage markings: two types of bars (defined as markings that touch the rachis) and spots (defined as markings that do not touch the rachis). We predicted sex in the field assuming that males had more spots than bars and females more bars than spots on the remiges and rectrices. Molecular data indicated that we correctly sexed 100% of the nestlings. We modeled the data using random forests and classification trees. Both models indicated that the number and type of markings on the secondary feathers were the most important in classifying nestling sex. The statistical models verified our initial qualitative prediction that males have more spots than bars and females more bars than spots on flight feathers P6P10 for both wings and tail feathers T1 and T2. This study provides researchers with an easily replicable and highly accurate method for sexing young Snowy Owls in the field, which should aid further studies of sex-ratios and sex-related variation in behavior and growth of this circumpolar owl species. ?? 2011 The Raptor Research Foundation, Inc.

  6. Accuracy of identification of tissue types in endoscopic esophageal mucosal biopsies used for molecular biology studies

    Directory of Open Access Journals (Sweden)

    Plauto Beck

    2009-02-01

    Full Text Available Plauto Beck1, George C Mayne1, David Astill2, Tanya Irvine1, David I Watson1, Willem A Dijckmeester1, Bas PL Wijnhoven1, Damian J Hussey11Department of Surgery, 2Department of Anatomical Pathology, Flinders University, Flinders Medical Centre, Bedford Park, South Australia, AustraliaObjectives: To determine if histopathologic assessment of esophageal biopsies harvested for research study is justified due to the heterogeneity of tissues in the esophagus, and the consequent histopathologic mis-matches with the clinical histopathology of biopsies taken at the same level.Methods: Since 2004, patients undergoing upper endoscopy for a variety of clinical conditions were invited to provide additional esophageal biopsies; those were collected for research purpose at the same level as biopsies collected for clinical histopathology. Research biopsies were cut in two parts: one part was submitted to research histopathology and the other stored for molecular analysis. Results of clinical histopathology for each patient were summarized per biopsy level and compared to results obtained from research biopsies at the corresponding level.Results: A total of 377 level summaries were obtained from 137 patients. Clinical histopathology summaries classified 123 levels (32.6% as squamous epithelium, 84 levels (22.3% as metaplastic columnar-lined epithelium, 135 levels (35.8% as columnar-lined epithelium with intestinal metaplasia, 30 levels (8% as dysplasia, and 5 levels (1.3% as adenocarcinoma. Research histopathology matched to clinical summaries on 120 of 123 (97.5% levels for squamous epithelium, 52 of 84 (61.9% for metaplastic columnar-lined epithelium, and 94 of 135 (69.5% for columnar-lined epithelium with intestinal metaplasia. There were no matches for dysplasia between the groups; however, they agreed on all five cases of AC. On 59 (70.2% metaplastic columnar-lined epithelium levels and on 62 (46% columnar-lined epithelium with intestinal metaplasia levels

  7. Search and molecular identification of two pathogenic bacteria (Salmonella and Listeria) in different food matrices

    International Nuclear Information System (INIS)

    Wislati, Mohamed Amine

    2010-01-01

    A food is a substance consumed in the natural state or after a cooking. The essential role of food is the apport of essential elements in the growth and in the energy needs as well as in the reserves of the body. Foodstuffs may be contaminated by microorganisms such as the viruses, the parasites, the bacteria at the different steps of production, transformation, transport and manipulation being able to engender food collective toxi-infections (T.I.A.C), infections. This study contains a research directed by two pathogenic germs; Listeria and Salmonella as food contaminants, ending at the man's respectively in two diseases: the Listeriosis and the Salmonellosis and the enumeration of the fecal coliform as indicators of lack of hygiene and a contamination of fecal origin. 90 samples of various types and origins are analyzed in the laboratory of biology and molecular microbiology of the (CNSTN) and are identified by Api (Listeria, 20E) and by PCR. Three origins of Listeria and four origins of Salmonella were isolated. Then, the healthiness of various lots was estimated (dairy products, produced meat-based and produced ready to be eaten) according to the plan of interpretation of the result (plan 2 classes) and (plan 3 classes).The obtained results confirm the contamination of our products taken from the market of public consumption. So the strengthen measures of prevention and health control are very important in the food industry.

  8. Identification of molecular performance from oil palm clones based on SSR markers

    Science.gov (United States)

    Putri, Lollie Agustina P.; Basyuni, M.; Bayu, Eva S.; Arvita, D.; Arifiyanto, D.; Syahputra, I.

    2018-03-01

    In Indonesia, the oil palms are an important economic crop, producing food and raw materials for the food, confectionary, cosmetics and oleo-chemical industrial demands of oil palm products. Clonal oil palm offers the potential for greater productivity because it is possible to establish uniform tree stands comprising identical copies (clones) of a limited number of highly productive oil palms. Unfortunately, tissue culture sometimes accentuates the expression of detects in oil palm, particularly when embryogenesis is induced in particullar callus for prolonged periods. This research is conducted by taking individual tree sample of clone germplasm two years old. The purpose of this research is to molecular performance analysis of some oil palm clones based on SSR markers. A total of 30 trees oil palm clones were used for analysis. In this experiment, the DNA profile diversity was assessed using five loci of oil palm’s specific SSR markers. The results of the experiment indicated out of 3 SSR markers (FR-0779, FR-3663 and FR-0782) showed monomorphic of PCR product and 2 SSR markers (FR-0783 and FR- 3745) showed polymorphic of PCR product. There are 10 total number of PCR product. These preliminary results demonstrated SSR marker can be used to evaluate genetic relatedness among trees of oil palm clones.

  9. Automatic identification of mobile and rigid substructures in molecular dynamics simulations and fractional structural fluctuation analysis.

    Directory of Open Access Journals (Sweden)

    Leandro Martínez

    Full Text Available The analysis of structural mobility in molecular dynamics plays a key role in data interpretation, particularly in the simulation of biomolecules. The most common mobility measures computed from simulations are the Root Mean Square Deviation (RMSD and Root Mean Square Fluctuations (RMSF of the structures. These are computed after the alignment of atomic coordinates in each trajectory step to a reference structure. This rigid-body alignment is not robust, in the sense that if a small portion of the structure is highly mobile, the RMSD and RMSF increase for all atoms, resulting possibly in poor quantification of the structural fluctuations and, often, to overlooking important fluctuations associated to biological function. The motivation of this work is to provide a robust measure of structural mobility that is practical, and easy to interpret. We propose a Low-Order-Value-Optimization (LOVO strategy for the robust alignment of the least mobile substructures in a simulation. These substructures are automatically identified by the method. The algorithm consists of the iterative superposition of the fraction of structure displaying the smallest displacements. Therefore, the least mobile substructures are identified, providing a clearer picture of the overall structural fluctuations. Examples are given to illustrate the interpretative advantages of this strategy. The software for performing the alignments was named MDLovoFit and it is available as free-software at: http://leandro.iqm.unicamp.br/mdlovofit.

  10. Identification of Viable Helicobacter pylori in Drinking Water Supplies by Cultural and Molecular Techniques.

    Science.gov (United States)

    Santiago, Paula; Moreno, Yolanda; Ferrús, M Antonía

    2015-08-01

    Helicobacter pylori is one of the most common causes of chronic bacterial infection in humans, directly related to peptic ulcer and gastric cancer. It has been suggested that H. pylori can be acquired through different transmission routes, including water. In this study, culture and qPCR were used to detect and identify the presence of H. pylori in drinking water. Furthermore, the combined techniques PMA-qPCR and DVC-FISH were applied for detection of viable cells of H. pylori. Among 24 drinking water samples, 16 samples were positive for the presence of H. pylori, but viable cells were only detected in six samples. Characteristic colonies, covered by a mass of bacterial unspecific growth, were observed on selective agar plates from an only sample, after enrichment. The mixed culture was submitted to DVC-FISH and qPCR analysis, followed by sequencing of the amplicons. Molecular techniques confirmed the growth of H. pylori on the agar plate. Our results demonstrate for the first time that H. pylori can survive and be potentially infective in drinking water, showing that water distribution systems could be a potential route for H. pylori transmission. © 2015 John Wiley & Sons Ltd.

  11. Identification of molecular markers linked to rice bacterial blight resistance genes from Oryza meyeriana

    Directory of Open Access Journals (Sweden)

    Jing WANG,Chen CHENG,Yanru ZHOU,Yong YANG,Qiong MEI,Junmin LI,Ye CHENG,Chengqi YAN,Jianping CHEN

    2015-09-01

    Full Text Available Y73 is a progeny of asymmetric somatic hybridization between Oryza sativa cv. Dalixiang and the wild rice species Oryza meyeriana. Inoculation with a range of strains of Xanthomonas oryzae pv. oryzae showed that Y73 had inherited a high level of resistance to rice bacterial blight (BB from its wild parent. An F2 population of 7125 individuals was constructed from the cross between Y73 and a BB-susceptible cultivar IR24. After testing 615 SSR and STS markers covering the 12 rice chromosomes, 186 markers were selected that showed polymorphism between Y73 and IR24. Molecular markers linked to the BB resistance genes in Y73 were scanned using the F2 population and the polymorphic markers. The SSR marker RM128 on chromosome 1, the STS marker R03D159 on chromosome 3 and the STS marker R05D104 on chromosome 5 were found to be linked to the rice BB resistance genes in Y73.

  12. Molecular tissue changes in early myocardial ischemia: from pathophysiology to the identification of new diagnostic markers.

    Science.gov (United States)

    Aljakna, Aleksandra; Fracasso, Tony; Sabatasso, Sara

    2018-03-01

    Diagnosing early myocardial ischemia (the initial 4 to 6 h after interruption of blood flow to part of the myocardium) remains a challenge for clinical and forensic pathologists. Several immunohistochemical markers have been proposed for improving postmortem detection of early myocardial ischemia; however, no single marker appears to be both sufficiently specific as well as sensitive. This review summarizes the diverse categories of molecular tissue markers that have been investigated in human autopsy samples with acute myocardial infarction as well as in the well-established and widely used in vivo animal model of early myocardial ischemia (permanent ligation of the coronary artery). Recently identified markers appearing during the initial 2 h of myocardial ischemia are highlighted. Among them, only six were tested for specificity (C5b-9, hypoxia-inducible factor 1-alpha, vascular endothelial growth factor, heart fatty acid binding protein, connexin 43, and JunB). Despite the discovery of several potentially promising markers (in terms of early expression and specificity), many of them remain to be tested and validated for application in routine diagnostics in clinical and forensic pathology. In particular, research investigating the postmortem stability of these markers is required before any might be implemented into routine diagnostics. Establishing a standardized panel of immunohistochemical markers may be more useful for improving sensitivity and specificity than searching for a single marker.

  13. Crystal structure and putative substrate identification for the Entamoeba histolytica low molecular weight tyrosine phosphatase.

    Science.gov (United States)

    Linford, Alicia S; Jiang, Nona M; Edwards, Thomas E; Sherman, Nicholas E; Van Voorhis, Wesley C; Stewart, Lance J; Myler, Peter J; Staker, Bart L; Petri, William A

    2014-01-01

    Entamoeba histolytica is a eukaryotic intestinal parasite of humans, and is endemic in developing countries. We have characterized the E. histolytica putative low molecular weight protein tyrosine phosphatase (LMW-PTP). The structure for this amebic tyrosine phosphatase was solved, showing the ligand-induced conformational changes necessary for binding of substrate. In amebae, it was expressed at low but detectable levels as detected by immunoprecipitation followed by immunoblotting. A mutant LMW-PTP protein in which the catalytic cysteine in the active site was replaced with a serine lacked phosphatase activity, and was used to identify a number of trapped putative substrate proteins via mass spectrometry analysis. Seven of these putative substrate protein genes were cloned with an epitope tag and overexpressed in amebae. Five of these seven putative substrate proteins were demonstrated to interact specifically with the mutant LMW-PTP. This is the first biochemical study of a small tyrosine phosphatase in Entamoeba, and sets the stage for understanding its role in amebic biology and pathogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. [Esophageal papilloma: case report, molecular identification of human papillomavirus and literature review].

    Science.gov (United States)

    Barbaglia, Yanina; Jiménez, Félix; Tedeschi, Fabián; Zalazar, Fabián

    2013-09-01

    sophageal squamous papilloma is an uncommon, usually asymptomatic, benign tumor of the squamous epithelium consisting of a raised, sessile, small and round (smooth or rough) lesion. The prevalence is between 0.01 and 0.45% of cases, with a male/female ratio of 3:1. The etiology and pathogenesis appear to be a mechanical or chemical irritation of the mucosa in addition to the presence of human papillomavirus (HPV), important agent in the evolution to a squamous carcinoma, especially HPV types 16 and 18. In this paper, we describe a case of esophageal papilloma whose diagnosis involved endoscopic images, pathological studies and detection of viral DNA by polymerase chain reaction. By using molecular techniques (PCR-RFLP) a profile consistent with HPV type 16 has been obtained. The patient underwent polypectomy and currently, after 3 years of diagnosis, he remains asymptomatic. This work is one of the first national reports of a patient with esophageal papilloma in which one of the most frequently HPV genotypes associated with esophageal carcinoma (HPV 16) has been detected.

  15. Isolation, enumeration, molecular identification and probiotic potential evaluation of lactic acid bacteria isolated from sheep milk

    Directory of Open Access Journals (Sweden)

    L.B. Acurcio

    2014-06-01

    Full Text Available Lactic acid bacteria species were molecularly identified in milk from Lacaune, Santa Inês and crossbred sheep breeds and their in vitro probiotic potential was evaluated. The species identified were Enterococcus faecium (56.25%, E. durans (31.25% and E. casseliflavus (12.5%. No other lactic acid bacteria species, such as lactobacilli, was identified. Most of the isolated enterococci were resistant to gastric pH (2.0 and to 0.3% oxgall. All tested enterococci were resistant to ceftazidime, oxacillin and streptomycin and sensible to clindamycin, erythromycin and penicillin. The resistance to ciprofloxacin, gentamicin, tetracycline and vancomycin varied among tested species. All tested enterococci strongly inhibited (P<0.05 Escherichia coli and Listeria monocytogenes, moderately inhibited E. faecalis and Staphylococcus aureus and did not inhibit Pseudomonas aeruginosa, Salmonella enterica var. Typhimurium and also one E. durans sample isolated from sheep milk. Four samples of E. faecium, one of E. durans and one of E. casseliflavus presented the best probiotic potential.

  16. Molecular identification of fungi isolated from bean tissues with anthracnose symptoms

    International Nuclear Information System (INIS)

    Vanegas Berrouet, Katherin M; Gutierrez Sanchez, Pablo A; Marin Montoya, Mauricio A

    2014-01-01

    In this work, endophytic fungi from leaves and pods of bean presenting anthracnose symptoms were isolated from plants collected at different municipalities in the province of Antioquia (Colombia). Isolates were identified by sequencing the RDNA its regions together with the examination of reproductive structures during sporulation in culture media. Colletotrichum lindemuthianum, the causal agent of anthracnose was isolated in all samples showing symptoms of this disease. These results were confirmed by duplex PCR using the specific primers CD1/CD2 and CY1/CY2. Additionally, 17 endophytic fungi were obtained. Fourteen isolates did not sporulate in culture media (Mycelia sterilia) but were identified by phylogenetic analysis of the regions as the Ascomycetes: Leptosphaerulina (3), Diaporthe (3), Gibberella (1), Plectosphaerella (1) and Biscogniauxia (1) and the Mitosporic genera phoma (2), Alternaria (2) and Stemphylium (1) Three isolates were identified combining morphological and molecular analysis as Fusarium (2) and Curvularia lunata (1). This work increases our knowledge of the mycobiota of legume plants and will serve as support of future studies aimed at determining the effect of these fungi on the development of anthracnose as well as other problems affecting the bean crop.

  17. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    Science.gov (United States)

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Identification and molecular characterization of Chryseobacterium vrystaatense ST1 isolated from oligomineral water of southeast Serbia

    Directory of Open Access Journals (Sweden)

    Kojić M.

    2012-01-01

    Full Text Available The isolation and molecular characterization of bacterial strains isolated from water sources in the Vlasina Mountain in southeast Serbia, confirmed the presence of a new species Chryseobacterium vrystaatense ST1. This Gram- negative species showed an extremely low level of biochemical reactivity in biochemical tests. The gene for 16S rRNA was amplified by PCR using universal primers and sequenced. Comparison of 16S rRNA gene sequence and phenotypic features indicated that the isolate ST belonged to Chryseobacterium vrystaatense. A BLAST search of sequenced 1088 nucleotides of the 16S rRNA gene with all sequences deposited in the NCBI collection showed the highest similarity (98% with the strain Chryseobacterium vrystaatense sp. nov., designated as strain R-23533. The very high homology of these two strains allowed classification of our strain at the species level, but some differences indicate, and indirectly confirm, that the isolate ST is an authentic representative. On the basis of these results, we could conclude that Chryseobacterium vrystaatense ST was for first time isolated in Serbia, which is particularly important when one bears in mind that there are only three sequences of this species deposited in the NCBI collection.

  19. Molecular identification of the microbiota of French sourdough using temporal temperature gradient gel electrophoresis.

    Science.gov (United States)

    Ferchichi, Mounir; Valcheva, Rosica; Prévost, Hervé; Onno, Bernard; Dousset, Xavier

    2007-01-01

    The microbiota of four industrial French sourdoughs (BF, GO, VB and RF) was characterized by PCR temporal temperature gel electrophoresis (TTGE). The TTGE technique reveals differences in the 16S rDNA V6-V8 regions of these bacteria. DNA was extracted directly from sourdough samples. A specific TTGE fingerprint was determined for 30 bacterial species, including members of the genera Lactobacillus, Leuconostoc and Weissella, all known to be present in sourdough. These sourdoughs contain different species of lactic acid bacteria (LAB) depending on ecological conditions prevailing in the different sourdough fermentations. Only a few LAB species were found to be competitive and became dominant. Lactobacillus sanfranciscensis was observed as the most frequently found species. In sourdough GO, L. sanfranciscensis, Lactobacillus panis and two new species, Lactobacillus nantensis and Lactobacillus hammesii, were detected. Sourdough BF contain L. sanfranciscensis, Lactobacillus spicheri and Lactobacillus pontis. In sourdough VB, which differed in the process temperature, we identified exclusively L. sanfranciscensis and Leuconostoc mesenteroïdes subsp. mesenteroïdes. Lactobacillus frumenti, L. hammesii and Lacobacillus paralimentarius became the predominant species in sourdough RF. Compared with conventional bacteriological methods, the use of this new molecular approach to analyze the sourdough ecosystem should therefore allow a more complete and rapid assessment of its specific microbiota.

  20. Identification of Mucorales isolates from soil using morphological and molecular methods.

    Science.gov (United States)

    Ziaee, A; Zia, M; Bayat, M; Hashemi, J

    2016-03-01

    Soil is the main habitat of saprophytic and pathogenic fungi. Mucoromycotina constitutes a large group of soil fungi, with certain opportunistic members causing systemic infections in immunocompromised hosts. The majority of human and animal infections are caused by the members of the genera Rhizopus , Mucor , Rhizomucor , Lichtheimia ( Absidia) , Cunninghamella, and Mortierella . Accordingly, in the present study, we aimed to isolate and identify the main genera of the order Mucorales, using molecular assays and morphological features . In total, 340 soil samples were collected from seven public parks throughout the city and sidewalk gardens in 14 municipal districts in Isfahan, Iran. All the samples were cultured on the appropriate media, incubated at 27°C for 2- 4 days, and examined daily for visible fungal growth. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was applied and macroscopic, microscopic, and physiological characteristics were assessed to identify fungal colonies. 400 pure colonies, belonging to the orders Mucorales and Mortierellales, including the genera Lichtheimia , Rhizopus, Rhizomucor, Mucor, Cunninghamella, and Mortierella, were identified . The genus Rhizopus (35.5%) was the most frequent isolate, followed by Mucor (32.25%) and Rhizomucor (27.5%). The results emphasize the importance of opportunistic fungi in public areas and indicate the risk of exposure for immunocompromised individuals.

  1. Identification of Mucorales isolates from soil using morphological and molecular methods

    Directory of Open Access Journals (Sweden)

    Ardeshir Ziaee

    2016-03-01

    Full Text Available Background and Purpose: Soil is the main habitat of saprophytic and pathogenic fungi. Mucormycetes are one of the most parts of soil fungi and certain members are among opportunistic fungi and can cause systemic fungal infections in immunocompromised patients. The majority of human and animal infections are caused by members of the genera Rhizopus, Mucor, Rhizomucor, Lichtheimia (Absidia, Cunninghamella and Mortierella. The objective of this research was to isolate and identify the main genera of Zygomycetes, using molecular assay and morphological features. Materials and Methods: A total of 340 soil samples were collected from different sites of seven public parks and 14 municipality districts in Isfahan. All samples were cultured on appropriate media and incubated at 27° C for 2 to 4 days, and then examined daily for visible fungal growth. PCR-RFLP method and macroscopic, microscopic and physiological characteristics were applied to identify fungal colonies. Results: Four hundred pure colonies belonging to six genera of Zygomycetes including Lichtheimia, Rhizopus, Rhizomucor, Mucor, Cunninghamella and Mortierella were identified. The genus Rhizopus (35.5% was the most frequent isolate, followed by Mucor (32.25% and Rhizomucor (27.5%. Conclusion: These finding may help us to understand about the importance of opportunistic fungi in public areas and the risk of exposure with immunocompromised persons.

  2. Molecular Identification of Hemoprotozoan Parasites in Camels (Camelus dromedarius of Iran

    Directory of Open Access Journals (Sweden)

    Alireza SAZMAND

    2016-12-01

    Full Text Available Background: Although camels represent a valuable source of food, wool and hide in many countries, in-depth information about their vector-borne pathogens is scarce compared to other animals. The aim of the current study was to characterize vector-borne protozoa in the blood of dromedaries from Iran by molecular tools.Methods: From June to July 2014, 200 peripheral blood samples were collected from asymptomatic one-humped camels in two provinces of Kerman and Sistan- va-Baloochestan in central and southeastern Iran. Microscopic examination was performed on Giemsa-stained blood smears, and drops of blood were spotted on Whatman FTA® cards for further analyses. Genomic DNA was extracted from the cards, and PCR was carried out for the detection of piroplasms and trypanosomes, followed by sequence analysis of positive samples.Results: One sample was positive Trypanosoma spp. trypomastigotes in light microscopy. PCR results revealed one positive sample each with Theileria annulata and Trypanosoma evansi.Conclusion: Camels were identified as hosts for bovine Mediterranean theileriosis in the investigated area. The presence of Tr. evansi, the causative agent of surra disease, was also confirmed in camels of Iran. Further studies are recommended in order to investigate their impact on the health and productivity of camels and other livestock in this region.

  3. Molecular identification of chronic bee paralysis virus infection in Apis mellifera colonies in Japan.

    Science.gov (United States)

    Morimoto, Tomomi; Kojima, Yuriko; Yoshiyama, Mikio; Kimura, Kiyoshi; Yang, Bu; Kadowaki, Tatsuhiko

    2012-07-01

    Chronic bee paralysis virus (CBPV) infection causes chronic paralysis and loss of workers in honey bee colonies around the world. Although CBPV shows a worldwide distribution, it had not been molecularly detected in Japan. Our investigation of Apis mellifera and Apis cerana japonica colonies with RT-PCR has revealed CBPV infection in A. mellifera but not A. c. japonica colonies in Japan. The prevalence of CBPV is low compared with that of other viruses: deformed wing virus (DWV), black queen cell virus (BQCV), Israel acute paralysis virus (IAPV), and sac brood virus (SBV), previously reported in Japan. Because of its low prevalence (5.6%) in A. mellifera colonies, the incidence of colony losses by CBPV infection must be sporadic in Japan. The presence of the (-) strand RNA in dying workers suggests that CBPV infection and replication may contribute to their symptoms. Phylogenetic analysis demonstrates a geographic separation of Japanese isolates from European, Uruguayan, and mainland US isolates. The lack of major exchange of honey bees between Europe/mainland US and Japan for the recent 26 years (1985-2010) may have resulted in the geographic separation of Japanese CBPV isolates.

  4. Molecular Identification of Hemoprotozoan Parasites in Camels (Camelus dromedarius) of Iran.

    Science.gov (United States)

    Sazmand, Alireza; Eigner, Barbara; Mirzaei, Mohammad; Hekmatimoghaddam, Seyed Hossein; Harl, Josef; Duscher, Georg Gerhard; Fuehrer, Hans-Peter; Joachim, Anja

    2016-01-01

    Although camels represent a valuable source of food, wool and hide in many countries, in-depth information about their vector-borne pathogens is scarce compared to other animals. The aim of the current study was to characterize vector-borne protozoa in the blood of dromedaries from Iran by molecular tools. From June to July 2014, 200 peripheral blood samples were collected from asymptomatic one-humped camels in two provinces of Kerman and Sistan- va-Baloochestan in central and southeastern Iran. Microscopic examination was performed on Giemsa-stained blood smears, and drops of blood were spotted on Whatman FTA ® cards for further analyses. Genomic DNA was extracted from the cards, and PCR was carried out for the detection of piroplasms and trypanosomes, followed by sequence analysis of positive samples. One sample was positive Trypanosoma spp. trypomastigotes in light microscopy. PCR results revealed one positive sample each with Theileria annulata and Trypanosoma evansi . Camels were identified as hosts for bovine Mediterranean theileriosis in the investigated area. The presence of Tr. evansi , the causative agent of surra disease, was also confirmed in camels of Iran. Further studies are recommended in order to investigate their impact on the health and productivity of camels and other livestock in this region.

  5. Molecularly Imprinted Polymers for the Identification and Separation of Chiral Drugs and Biomolecules

    Directory of Open Access Journals (Sweden)

    Sha Yang

    2016-06-01

    Full Text Available Molecularly imprinting polymers (MIPs have been extensively applied in chromatography for the separation of chiral drugs. In this review, we mainly summarize recent developments of various MIPs used as chiral stationary phases (CSPs in high performance liquid chromatography (HPLC, capillary electrochromatography (CEC, and supercritical fluid chromatography (SFC. Among them, HPLC has the advantages of straightforward operation and high selectivity. However, the low separation efficiency, due to slow interaction kinetics and heavy peak broadening, is the main challenge for the application of MIPs in HPLC. On the other hand, CEC possesses both the high selectivity of HPLC and the high efficiency of capillary electrophoresis. In CEC, electroosmotic flow is formed across the entire column and reduces the heavy peak broadening observed in HPLC mode. SFC can modify the low interaction kinetics in HPLC when supercritical fluids are utilized as mobile phases. If SFC and MIP-based CSPs can be well combined, better separation performance can be achieved. Particles, monoliths and membrane are typical formats of MIPs. Traditional MIP particles produced by bulk polymerization have been replaced by MIP particles by surface imprinting technology, which are highly consistent in size and shape. Monolithic MIPs are prepared by in situ method in a column, greatly shortening the pre-preparation time. Some novel materials, such as magnetic nanoparticles, are integrated into the MIPs to enhance the controllability and efficiency of the polymerization. This review will be helpful to guide the preparation, development, and application of MIPs in chromatographic and electrophoretic enantioseparation.

  6. Detection and Identification of Salmonella spp. in Surface Water by Molecular Technology in Taiwan

    Science.gov (United States)

    Tseng, S. F.; Hsu, B. M.; Huang, K. H.; Hsiao, H. Y.; Kao, P. M.; Shen, S. M.; Tsai, H. F.; Chen, J. S.

    2012-04-01

    Salmonella spp. is classified to gram-negative bacterium and is one of the most important causal agents of waterborne diseases. The genus of Salmonella comprises more than 2,500 serotypes and its taxonomy is also very complicated. In tradition, the detection of Salmonella in environmental water samples by routines culture methods using selective media and characterization of suspicious colonies based on biochemical tests and serological assay are generally time and labor consuming. To overcome this disadvantage, it is desirable to use effective method which provides a higher discrimination and more rapid identification about Salmonella in environmental water. The aim of this study is to investigate the occurrence of Salmonella using novel procedures of detection method and to identify the serovars of Salmonella isolates from 157 surface water samples in Taiwan. The procedures include membrane filtration, non-selective pre-enrichment, selective enrichment of Salmonella, and then isolation of Salmonella strains by selective culture plates. The selective enrichment and culture plates were both detected by PCR. Finally, we used biochemical tests and serological assay to confirm the serovars of Salmonella and also used Pulsed-field gel electrophoresis (PFGE) to identify their sarovar catagories by the genetic pattern. In this study, 44 water samples (28%) were indentified as Salmonella. The 44 positive water samples by culture method were further identified as S. Agona(1/44), S. Albany (10/44), S. Bareilly (13/44),S. Choleraesuis (2/44),S. Derby (4/44),S. Isangi (3/44),S.Kedougou(3/44),S. Mbandaka(1/44),S.Newport (3/44), S. Oranienburg(1/44), S. Potsdam (1/44),S. Typhimurium (1/44), andS. Weltevreden(1/44) by PFGE. The presence of Salmonella in surface water indicates the possibility of waterborne transmission in drinking watershed if water is not adequately treated. Therefore, the authorities need to have operating systems that currently provide adequate source

  7. Morphological and molecular identification of four Brazilian commercial isolates of Pleurotus spp. and cultivation on corncob

    Directory of Open Access Journals (Sweden)

    Nelson Menolli Junior

    2010-04-01

    Full Text Available The species of Pleurotus have great commercial importance and adaptability for growth and fructification within a wide variety of agro-industrial lignocellulosic wastes. In this study, two substrates prepared from ground corncobs supplemented with rice bran and charcoal were tested for mycelium growth kinetics in test tubes and for the cultivation of four Pleurotus commercial isolates in polypropylene bags. The identification of the isolates was based on the morphology of the basidiomata obtained and on sequencing of the LSU rDNA gene. Three isolates were identified as P. ostreatus, and one was identified as P. djamor. All isolates had better in-depth mycelium development in the charcoal-supplemented substrate. In the cultivation experiment, the isolates reacted differently to the two substrates. One isolate showed particularly high growth on the substrate containing charcoal.Espécies de Pleurotus têm grande importância comercial e adaptabilidade para crescimento e frutificação em uma ampla variedade de resíduos agro-industriais lignocelulósicos. Neste trabalho foram testados dois substratos à base de sabugo de milho triturado, suplementados com farelo de arroz e carvão vegetal, para avaliação da cinética de crescimento micelial em tubos de ensaio e produção em sacos de polipropileno, utilizando quatro isolados comerciais. O estudo taxonômico foi realizado com a análise da morfologia dos basidiomas obtidos em cultivo e pelo seqüenciamento do gene nLSU do DNAr, para certificar a identificação taxonômica. Os isolados tiveram melhor desenvolvimento micelial em profundidade no substrato suplementado com carvão vegetal. Em relação à produção, os isolados reagiram de formas distintas em função dos substratos, sendo significativamente melhor o substrato contendo carvão. Três isolados foram identificados como P. ostreatus e o outro foi identificado como P. djamor.

  8. Molecular characterization of the llama FGF5 gene and identification of putative loss of function mutations.

    Science.gov (United States)

    Daverio, M S; Vidal-Rioja, L; Frank, E N; Di Rocco, F

    2017-12-01

    Llama, the most numerous domestic camelid in Argentina, has good fiber-production ability. Although a few genes related to other productive traits have been characterized, the molecular genetic basis of fiber growth control in camelids is still poorly understood. Fibroblast growth factor 5 (FGF5) is a secreted signaling protein that controls hair growth in humans and other mammals. Mutations in the FGF5 gene have been associated with long-hair phenotypes in several species. Here, we sequenced the llama FGF5 gene, which consists of three exons encoding 813 bp. cDNA analysis from hair follicles revealed the expression of two FGF5 alternative spliced transcripts, in one of which exon 2 is absent. DNA variation analysis showed four polymorphisms in the coding region: a synonymous SNP (c.210A>G), a single base deletion (c.348delA), a 12-bp insertion (c.351_352insCATATAACATAG) and a non-sense mutation (c.499C>T). The deletion was always found together with the insertion forming a haplotype and producing a putative truncated protein of 123 amino acids. The c.499C>T mutation also leads to a premature stop codon at position 168. In both cases, critical functional domains of FGF5, including one heparin binding site, are lost. All animals analyzed were homozygous for one of the deleterious mutations or compound heterozygous for both (i.e. c.348delA, c.351_352insCATATAACATAG/c.499T). Sequencing of guanaco samples showed that the FGF5 gene encodes a full-length 270-amino acid protein. These results suggest that FGF5 is likely functional in short-haired wild species and non-functional in the domestic fiber-producing species, the llama. © 2017 Stichting International Foundation for Animal Genetics.

  9. Hookworm infections among migrant workers in Malaysia: Molecular identification of Necator americanus and Ancylostoma duodenale.

    Science.gov (United States)

    Sahimin, Norhidayu; Lim, Yvonne Ai Lian; Douadi, Benacer; Mohd Khalid, Mohd Khairul Nizam; Wilson, John-James; Behnke, Jerzy M; Mohd Zain, Siti Nursheena

    2017-09-01

    Ongoing urbanisation of the working population as well as cross-border migration of workers particularly into large cities has contributed to the development and growth of urban slums. These deprived areas are conducive for the transmission of intestinal pathogens including hookworm. The aim of this study was to determine both the prevalence and species identity of hookworm infections among the migrant worker community in Malaysia. A total of 388 faecal samples were collected from migrant workers between September 2014 and August 2015, representing workers from five employment sectors: construction, manufacturing, agriculture and plantations, food services and domestic services. Faecal samples were examined by microscopy and positive samples were subjected to molecular analysis. A total of 51 samples (13.1%) were positive by microscopy for hookworm infections. A two-step PCR based method amplifying a fragment of the 28S rRNA-ITS2 region was used to identify infections by Necator americanus and Ancylostoma spp. PCR products positive for Ancylostoma spp. were sequenced bidirectionally, and sequences analysed through BLAST and phylogenetic analysis. Samples containing Ancylostoma duodenale were further characterized by amplification and sequencing a fragment of cytochrome c oxidase subunit 1 (cox1) gene. PCR amplicons were successfully obtained from 42 (82.4%) of 51 samples, with 81.0% (34 of 42) identified as Necator americanus, 16.7% (7 of 42) as Ancylostoma spp. and 2.4% (1 of 42) as mixed infections of both species. All eight Ancylostoma spp. were confirmed to be Ancylostoma duodenale and this is the first time A. duodenale was reported in Malaysia. Samples containing A. duodenale from Nepalese and Indonesian workers shared high-similarity and were distinct compared to sequences from other countries. This study highlights the prevalence of hookworm infections among migrant workers living in Malaysia. Our findings underscore the necessity of screening migrant

  10. Molecular identification of erythrocytic necrosis virus (ENV) from the blood of Pacific herring (Clupea pallasii)

    Science.gov (United States)

    Emmenegger, Eveline J.; Glenn, Jolene A.; Winton, James R.; Batts, William N.; Gregg, Jacob L.; Hershberger, Paul K.

    2014-01-01

    Viral erythrocytic necrosis (VEN) is a condition affecting the red blood cells of more than 20 species of marine and anadromous fishes in the North Atlantic and North Pacific Oceans. Among populations of Pacific herring (Clupea pallasii) on the west coast of North America the disease causes anemia and elevated mortality in periodic epizootics. Presently, VEN is diagnosed by observation of typical cytoplasmic inclusion bodies in stained blood smears from infected fish. The causative agent, erythrocytic necrosis virus (ENV), is unculturable and a presumed iridovirus by electron microscopy. In vivo amplification of the virus in pathogen-free laboratory stocks of Pacific herring with subsequent virus concentration, purification, DNA extraction, and high-throughput sequencing were used to obtain genomic ENV sequences. Fragments with the highest sequence identity to the family Iridoviridae were used to design four sets of ENV-specific polymerase chain reaction (PCR) primers. Testing of blood and tissue samples from experimentally and wild infected Pacific herring as well as DNA extracted from other amphibian and piscine iridoviruses verified the assays were specific to ENV with a limit of detection of 0.0003 ng. Preliminary phylogenetic analyses of a 1448 bp fragment of the putative DNA polymerase gene supported inclusion of ENV in a proposed sixth genus of the family Iridoviridae that contains other erythrocytic viruses from ectothermic hosts. This study provides the first molecular evidence of ENV's inclusion within the Iridoviridae family and offers conventional PCR assays as a means of rapidly surveying the ENV-status of wild and propagated Pacific herring stocks.

  11. Molecular identification and characterization of Colletotrichum spp isolates from tahiti lime, tamarillo, and mango

    Directory of Open Access Journals (Sweden)

    Adriana Sanabria

    2010-12-01

    Full Text Available Anthracnose is a very limiting disease affecting production, as well as postharvest quality of numerous fruit crops in Colombia. The current management practices for this disease are partially effective due to limited information about the etiology, the inoculum sources, population structure and variation of the pathogen. A total of 293 Colletotrichum isolates were obtained from symptomatic tissues collected from Tahiti lime, tamarillo and mango orchards. To determine the Colletotrichum species causing the symptoms, amplification, and PCR product analysis for intergenic regions of the ribosomal DNA were conducted. Genetic diversity of the fungal population was assessed with Random Amplified Microsatellites (RAMS. Results of this study indicated that anthracnose in Tahiti lime and tamarillo are caused by Colletotrichun acutatum whereas symptoms on mango were induced by the species Colletotrichum gloeosporioides, which was also fund in few citrus samples. RAMS data analysis indicated the existence of two distinct species groups, with a low similarity index (35%. RAM profiles also showed a clear host differentiation of isolates. The C. acutatum population originated from tamarillo exhibited a narrow and homogeneous genetic base, while the C. acutatum population from Tahiti lime was more heterogeneous and genetically complex, as determined by the analysis of molecular variance (AMOVA and of Ni-Li coefficient. The C. gloeosporioides population originated from mango and Tahiti lime was heterogeneous and highly diverse, with clear host differentiation according to RAM profiles. Collectively, the results from this study provide new insight into the general characteristics of Colletotrichum populations on various hosts; this type of knowledge will prove useful in designing more effective management practices.

  12. Targeting acetylcholinesterase: identification of chemical leads by high throughput screening, structure determination and molecular modeling.

    Directory of Open Access Journals (Sweden)

    Lotta Berg

    Full Text Available Acetylcholinesterase (AChE is an essential enzyme that terminates cholinergic transmission by rapid hydrolysis of the neurotransmitter acetylcholine. Compounds inhibiting this enzyme can be used (inter alia to treat cholinergic deficiencies (e.g. in Alzheimer's disease, but may also act as dangerous toxins (e.g. nerve agents such as sarin. Treatment of nerve agent poisoning involves use of antidotes, small molecules capable of reactivating AChE. We have screened a collection of organic molecules to assess their ability to inhibit the enzymatic activity of AChE, aiming to find lead compounds for further optimization leading to drugs with increased efficacy and/or decreased side effects. 124 inhibitors were discovered, with considerable chemical diversity regarding size, polarity, flexibility and charge distribution. An extensive structure determination campaign resulted in a set of crystal structures of protein-ligand complexes. Overall, the ligands have substantial interactions with the peripheral anionic site of AChE, and the majority form additional interactions with the catalytic site (CAS. Reproduction of the bioactive conformation of six of the ligands using molecular docking simulations required modification of the default parameter settings of the docking software. The results show that docking-assisted structure-based design of AChE inhibitors is challenging and requires crystallographic support to obtain reliable results, at least with currently available software. The complex formed between C5685 and Mus musculus AChE (C5685•mAChE is a representative structure for the general binding mode of the determined structures. The CAS binding part of C5685 could not be structurally determined due to a disordered electron density map and the developed docking protocol was used to predict the binding modes of this part of the molecule. We believe that chemical modifications of our discovered inhibitors, biochemical and biophysical

  13. Identification of QS-21 as an Inflammasome-activating Molecular Component of Saponin Adjuvants*

    Science.gov (United States)

    Marty-Roix, Robyn; Vladimer, Gregory I.; Pouliot, Kimberly; Weng, Dan; Buglione-Corbett, Rachel; West, Kim; MacMicking, John D.; Chee, Jonathan D.; Wang, Shixia; Lu, Shan; Lien, Egil

    2016-01-01

    Many immunostimulants act as vaccine adjuvants via activation of the innate immune system, although in many cases it is unclear which specific molecules contribute to the stimulatory activity. QS-21 is a defined, highly purified, and soluble saponin adjuvant currently used in licensed and exploratory vaccines, including vaccines against malaria, cancer, and HIV-1. However, little is known about the mechanisms of cellular activation induced by QS-21. We observed QS-21 to elicit caspase-1-dependent IL-1β and IL-18 release in antigen-presenting cells such as macrophages and dendritic cells when co-stimulated with the TLR4-agonist adjuvant monophosphoryl lipid A. Furthermore, our data suggest that the ASC-NLRP3 inflammasome is responsible for QS-21-induced IL-1β/IL-18 release. At higher concentrations, QS-21 induced macrophage and dendritic cell death in a caspase-1-, ASC-, and NLRP3-independent manner, whereas the presence of cholesterol rescued cell viability. A nanoparticulate adjuvant that contains QS-21 as part of a heterogeneous mixture of saponins also induced IL-1β in an NLRP3-dependent manner. Interestingly, despite the role NLRP3 plays for cellular activation in vitro, NLRP3-deficient mice immunized with HIV-1 gp120 and QS-21 showed significantly higher levels of Th1 and Th2 antigen-specific T cell responses and increased IgG1 and IgG2c compared with wild type controls. Thus, we have identified QS-21 as a nonparticulate single molecular saponin that activates the NLRP3 inflammasome, but this signaling pathway may contribute to decreased antigen-specific responses in vivo. PMID:26555265

  14. Culture and molecular identification of fungal contaminants in edible bird nests.

    Science.gov (United States)

    Chen, Jennifer Xiao Jing; Wong, Shew Fung; Lim, Patricia Kim Chooi; Mak, Joon Wah

    2015-01-01

    Widespread food poisoning due to microbial contamination has been a major concern for the food industry, consumers and governing authorities. This study is designed to determine the levels of fungal contamination in edible bird nests (EBNs) using culture and molecular techniques. Raw EBNs were collected from five house farms, and commercial EBNs were purchased from five Chinese traditional medicine shops (companies A-E) in Peninsular Malaysia. The fungal contents in the raw and commercial EBNs, and boiled and unboiled EBNs were determined. Culturable fungi were isolated and identified. In this study, the use of these methods revealed that all EBNs had fungal colony-forming units (CFUs) that exceeded the limit set by Standards and Industrial Research Institute of Malaysia (SIRIM) for yeast and moulds in EBNs. There was a significant difference (p 0.05). The types of fungi isolated from the unboiled raw EBNs were mainly soil, plant and environmental fungi, while the types of fungi isolated from the boiled raw EBNs, unboiled and boiled commercial EBNs were mainly environmental fungi. Aspergillus sp., Candida sp., Cladosporium sp., Neurospora sp. and Penicillum sp. were the most common fungi isolated from the unboiled and boiled raw and commercial EBNs. Some of these fungi are mycotoxin producers and cause opportunistic infections in humans. Further studies to determine the mycotoxin levels and methods to prevent or remove these contaminations from EBNs for safe consumption are necessary. The establishment and implementation of stringent regulations for the standards of EBNs should be regularly updated and monitored to improve the quality of the EBNs and consumer safety.

  15. Molecular cloning, structural analysis and mass spectrometric identification of native dioscorins of various yam species.

    Science.gov (United States)

    Tsai, Wei-Yi; Jheng, Yi-Jyun; Chen, Kuo-Hsuan; Lin, Kuo-Wei; Ho, Yen-Pen; Yang, Ching-Chi; Lin, Kuo-Chih

    2013-03-15

    Dioscorins are the major storage proteins of yam tubers. However, the molecular nature of their heterogeneity in tubers has not been fully elucidated. In this study the authors isolated the dioscorin gene families of Dioscorea japonica and Dioscorea pseudojaponica, performed matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF-MS) and elucidated which dioscorin isoforms are the major constituents in tubers. The dioscorin gene families of D. japonica (Dj-dioA1-Dj-dioA4, Dj-dioB1 and Dj-dioB2) and D. pseudojaponica (Dp-dioA1-Dp-dioA5 and Dp-dioB1) were cloned from cDNA libraries of yam tubers. The dioscorins isolated from Dioscorea alata (Da-dioscorins), D. japonica (Dj-dioscorins) and D. pseudojaponica (Dp-dioscorins) were mainly monomers, with a few dimers. The monomers contained one intramolecular disulfide bond (Cys(28)-Cys(187)) and belonged to Class A dioscorins with two cysteine residues. The dimers consisted of Class B dioscorins with one intermolecular disulfide bond (Cys(40)-Cys(40)). Results of MALDI-TOF-MS revealed that the Da-dioscorins were mainly encoded by Da-dioA2, Da-dioA3 and Da-dioA4. The majority of the Dj-dioscorins were encoded by Dj-dioA1, Dj-dioA2, Dj-dioA3 and Dj-dioB2. The Dp-dioscorins mainly comprised proteins encoded by Dp-dioA1, Dp-dioA3, Dp-dioA4, Dp-dioB1 and Dp-dioB2. Determination of the constituents of dioscorin isoforms in yam tubers provides a basis for future studies of their physiological and biomedical functions. © 2012 Society of Chemical Industry.

  16. Identification Of Some Strains Of Dinoflagellates Based On Morphology And Molecular Analysis

    Directory of Open Access Journals (Sweden)

    Hikmah Thoha

    2008-11-01

    Full Text Available Dinoflagellates are the important primary producers in aquatic environments. In oceans, they play interesting role in ecological functions such as red tide forming organisms, symbiont of coral reef or sea anemone and DSP (Diarrhetic Shellfish Poisoning or PSP (Paralytic Shellfish Poisoning producing organisms. Morphology and molecular analysis of dinoflagellates were conducted on November 2002 to March 2003. The phylogenetic studies based on 18S rDNA analyses, sequence have begun to appear more frequently in the literature, as attention has turned to relationships within the major eukaryotic lineages, particular importance for the taxonomy of the armored and unarmored genera of dinoflagellates (Gyrodinium sp., Cachonina sp., Gymnodinium sp., Amphidinium sp., because many of the genera cause extensive plankton blooms, fish kills and other harmful events, were studied used to amplify 18S rDNA, present in the total DNA extracted from algal pellet. The amplify approximately 1400 bp of the nuclear-encoded LSU rDNA gene using terminal primeirs DIR, products were cheked by 1.0 % agarose gel electrophoresis, then cloning with TA cloning KIT. Sequencing were analyzed by the GENETIX Mac Software, Homology search by Blast and Phylogenetic analysis. Results of hylogenetic analysis of 18S rDNA are: Strain no. 10893 (un identified from the genera, it is belonging Gymnodinium or Polarella. Strain no. 10795 is closely related other species Cachonina hallii. We tentatively named strain no 11151 and 11160 similar to Gyrodinium or Gymnodinium based on morphology, but these strain indepently position in this tree and is not a real of Gymnodinium sensu stricto. It is possible, we can establish the new genera for strain no. 11151; 11160 because this not cluster any other unarmored species.

  17. Na(+)-D-glucose cotransporter in the kidney of Squalus acanthias: molecular identification and intrarenal distribution.

    Science.gov (United States)

    Althoff, Thorsten; Hentschel, Hartmut; Luig, Jutta; Schütz, Hendrike; Kasch, Myriam; Kinne, Rolf K-H

    2006-04-01

    Using primers against cons