WorldWideScience

Sample records for molecular diversity analysis

  1. Genetic diversity analysis of common beans based on molecular markers

    Directory of Open Access Journals (Sweden)

    Homar R. Gill-Langarica

    Full Text Available A core collection of the common bean (Phaseolus vulgaris L., representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each, as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP +3/+3 primer combinations and seven simple sequence repeats (SSR loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA and molecular variance (AMOVA analyses. AFLP analysis produced 530 bands (88.5% polymorphic while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus. AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  2. Genetic diversity analysis of common beans based on molecular markers

    Directory of Open Access Journals (Sweden)

    Homar R. Gill-Langarica

    2011-01-01

    Full Text Available A core collection of the common bean (Phaseolus vulgaris L., representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each, as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP +3/+3 primer combinations and seven simple sequence repeats (SSR loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA and molecular variance (AMOVA analyses. AFLP analysis produced 530 bands (88.5% polymorphic while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus. AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  3. Genetic diversity analysis of common beans based on molecular markers.

    Science.gov (United States)

    Gill-Langarica, Homar R; Muruaga-Martínez, José S; Vargas-Vázquez, M L Patricia; Rosales-Serna, Rigoberto; Mayek-Pérez, Netzahualcoyotl

    2011-10-01

    A core collection of the common bean (Phaseolus vulgaris L.), representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico) Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions) was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each), as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP) +3/+3 primer combinations and seven simple sequence repeats (SSR) loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA) and molecular variance (AMOVA) analyses. AFLP analysis produced 530 bands (88.5% polymorphic) while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus). AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  4. Molecular characterization and diversity analysis in chilli pepper ...

    African Journals Online (AJOL)

    India is considered to be the secondary center of diversity of chilli pepper, especially of Capsicum annuum. Simple sequence repeats (SSRs) are the most widely used marker system for plant variety characterization and diversity analysis especially in cultivated species which have low levels of polymorphism. The diversity ...

  5. Molecular analysis of genetic diversity in elite II synthetic hexaploid ...

    African Journals Online (AJOL)

    The present study was conducted to assess the genetic diversity of Elite-II synthetic hexaploid (SH) wheat by genome DNA fingerprinting as revealed by random amplified polymorphic DNA (RAPD) analysis. Ten decamer RAPD primers (OPG-1, OPG-2, OPG-3, OPG-4, OPG-5, OPA-3, OPA-4, OPA-5, OPA-8, and OPA-15) ...

  6. Molecular analysis of the bacterial diversity in uranium mill tailings

    International Nuclear Information System (INIS)

    Geissler, A.

    2003-04-01

    A culture-independent molecular approach has been applied to investigate the bacterial diversity in three uranium contaminated sites. The three analysed soil samples have been collected from the uranium waste pile Haberland near Johanngeorgenstadt (Germany), from the uranium mill tailings in Gunnison, Colorado (USA) and from the uranium mill tailings in Shiprock, New Mexico (USA). The 16S rDNA fragments which has been isolated through direct lysis of the whole-DNA were amplified by the use of the universal primers 16S 43f and 16S 1404r and cloned. With restriction fragment length polymorphismus (RFLP) were the clones screened and one representative of all RFLP types that occurred more than once in the clone library was sequenced and analysed. In spite of the contamination a considerable diversity and significant differences in the composition of the natural bacterial communities in these three sites have been found. In the sample collected from the waste pile Haberland near Johanngeorgenstadt α-Proteobacteria and representatives of the Holophaga/Acidobacterium were numerically predominant. The distribution of bacteria in the sample collected from uranium mill tailings Gunnison was very similar to those found in the Haberland waste pile, but there were found besides α-Proteobacteria and representatives of Holophaga/Acidobacterium a lot of γ-Proteobacteria. The structure of the bacterial community in the sample collected from the uranium mill tailings Shiprock was significantly different. Only some representatives of the Holophaga/Acidobacterium and α-Proteobacteria were represented. Large populations of Bacilli, γ-Proteobacteria and green non sulfur bacteria were dominant in this sample. (orig.)

  7. Molecular analysis of microbial diversity in advanced caries.

    Science.gov (United States)

    Chhour, Kim-Ly; Nadkarni, Mangala A; Byun, Roy; Martin, F Elizabeth; Jacques, Nicholas A; Hunter, Neil

    2005-02-01

    Real-time PCR analysis of the total bacterial load in advanced carious lesions has shown that the total load exceeds the number of cultivable bacteria. This suggests that an unresolved complexity exists in bacteria associated with advanced caries. In this report, the profile of the microflora of carious dentine was explored by using DNA extracted from 10 lesions selected on the basis of comparable total microbial load and on the relative abundance of Prevotella spp. Using universal primers for the 16S rRNA gene, PCR amplicons were cloned, and approximately 100 transformants were processed for each lesion. Phylogenetic analysis of 942 edited sequences demonstrated the presence of 75 species or phylotypes in the 10 carious lesions. Up to 31 taxa were represented in each sample. A diverse array of lactobacilli were found to comprise 50% of the species, with prevotellae also abundant, comprising 15% of the species. Other taxa present in a number of lesions or occurring with high abundance included Selenomonas spp., Dialister spp., Fusobacterium nucleatum, Eubacterium spp., members of the Lachnospiraceae family, Olsenella spp., Bifidobacterium spp., Propionibacterium sp., and Pseudoramibacter alactolyticus. The mechanisms by which such diverse patterns of bacteria extend carious lesions, including the aspect of infection of the vital dental pulp, remain unclear.

  8. Genetic diversity of popcorn genotypes using molecular analysis.

    Science.gov (United States)

    Resh, F S; Scapim, C A; Mangolin, C A; Machado, M F P S; do Amaral, A T; Ramos, H C C; Vivas, M

    2015-08-19

    In this study, we analyzed dominant molecular markers to estimate the genetic divergence of 26 popcorn genotypes and evaluate whether using various dissimilarity coefficients with these dominant markers influences the results of cluster analysis. Fifteen random amplification of polymorphic DNA primers produced 157 amplified fragments, of which 65 were monomorphic and 92 were polymorphic. To calculate the genetic distances among the 26 genotypes, the complements of the Jaccard, Dice, and Rogers and Tanimoto similarity coefficients were used. A matrix of Dij values (dissimilarity matrix) was constructed, from which the genetic distances among genotypes were represented in a more simplified manner as a dendrogram generated using the unweighted pair-group method with arithmetic average. Clusters determined by molecular analysis generally did not group material from the same parental origin together. The largest genetic distance was between varieties 17 (UNB-2) and 18 (PA-091). In the identification of genotypes with the smallest genetic distance, the 3 coefficients showed no agreement. The 3 dissimilarity coefficients showed no major differences among their grouping patterns because agreement in determining the genotypes with large, medium, and small genetic distances was high. The largest genetic distances were observed for the Rogers and Tanimoto dissimilarity coefficient (0.74), followed by the Jaccard coefficient (0.65) and the Dice coefficient (0.48). The 3 coefficients showed similar estimations for the cophenetic correlation coefficient. Correlations among the matrices generated using the 3 coefficients were positive and had high magnitudes, reflecting strong agreement among the results obtained using the 3 evaluated dissimilarity coefficients.

  9. Molecular analysis of genetic diversity in elite II synthetic hexaploid ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-07-20

    Jul 20, 2009 ... The presence of sufficient genetic diversity in the germplam is an important ..... Figure 1. PCR amplification profile of Elite-II SH Wheat using the primer OPG-2. .... genetic relationships among cowpea breeding lines and local.

  10. How diverse are diversity assessment methods? A comparative analysis and benchmarking of molecular descriptor space.

    Science.gov (United States)

    Koutsoukas, Alexios; Paricharak, Shardul; Galloway, Warren R J D; Spring, David R; Ijzerman, Adriaan P; Glen, Robert C; Marcus, David; Bender, Andreas

    2014-01-27

    Chemical diversity is a widely applied approach to select structurally diverse subsets of molecules, often with the objective of maximizing the number of hits in biological screening. While many methods exist in the area, few systematic comparisons using current descriptors in particular with the objective of assessing diversity in bioactivity space have been published, and this shortage is what the current study is aiming to address. In this work, 13 widely used molecular descriptors were compared, including fingerprint-based descriptors (ECFP4, FCFP4, MACCS keys), pharmacophore-based descriptors (TAT, TAD, TGT, TGD, GpiDAPH3), shape-based descriptors (rapid overlay of chemical structures (ROCS) and principal moments of inertia (PMI)), a connectivity-matrix-based descriptor (BCUT), physicochemical-property-based descriptors (prop2D), and a more recently introduced molecular descriptor type (namely, "Bayes Affinity Fingerprints"). We assessed both the similar behavior of the descriptors in assessing the diversity of chemical libraries, and their ability to select compounds from libraries that are diverse in bioactivity space, which is a property of much practical relevance in screening library design. This is particularly evident, given that many future targets to be screened are not known in advance, but that the library should still maximize the likelihood of containing bioactive matter also for future screening campaigns. Overall, our results showed that descriptors based on atom topology (i.e., fingerprint-based descriptors and pharmacophore-based descriptors) correlate well in rank-ordering compounds, both within and between descriptor types. On the other hand, shape-based descriptors such as ROCS and PMI showed weak correlation with the other descriptors utilized in this study, demonstrating significantly different behavior. We then applied eight of the molecular descriptors compared in this study to sample a diverse subset of sample compounds (4%) from an

  11. Preliminary molecular analysis of the genetic diversity of some ...

    African Journals Online (AJOL)

    In the arid and semi arid areas, salt bush (Atriplex) represents an important forage resource. The characterization of the genetic diversity of these species is useful for their classification, their conservation and their improvement. In this context, we used the random amplified polymorphic DNA-polymerase chain reaction ...

  12. Genetic diversity in cultivated carioca common beans based on molecular marker analysis

    Directory of Open Access Journals (Sweden)

    Juliana Morini Küpper Cardoso Perseguini

    2011-01-01

    Full Text Available A wide array of molecular markers has been used to investigate the genetic diversity among common bean species. However, the best combination of markers for studying such diversity among common bean cultivars has yet to be determined. Few reports have examined the genetic diversity of the carioca bean, commercially one of the most important common beans in Brazil. In this study, we examined the usefulness of two molecular marker systems (simple sequence repeats - SSRs and amplified fragment length polymorphisms - AFLPs for assessing the genetic diversity of carioca beans. The amount of information provided by Roger's modified genetic distance was used to analyze SSR data and Jaccards similarity coefficient was used for AFLP data. Seventy SSRs were polymorphic and 20 AFLP primer combinations produced 635 polymorphic bands. Molecular analysis showed that carioca genotypes were quite diverse. AFLPs revealed greater genetic differentiation and variation within the carioca genotypes (Gst = 98% and Fst = 0.83, respectively than SSRs and provided better resolution for clustering the carioca genotypes. SSRs and AFLPs were both suitable for assessing the genetic diversity of Brazilian carioca genotypes since the number of markers used in each system provided a low coefficient of variation. However, fingerprint profiles were generated faster with AFLPs, making them a better choice for assessing genetic diversity in the carioca germplasm.

  13. Molecular Analysis of Microbial Diversity in Advanced Caries

    OpenAIRE

    Chhour, Kim-Ly; Nadkarni, Mangala A.; Byun, Roy; Martin, F. Elizabeth; Jacques, Nicholas A.; Hunter, Neil

    2005-01-01

    Real-time PCR analysis of the total bacterial load in advanced carious lesions has shown that the total load exceeds the number of cultivable bacteria. This suggests that an unresolved complexity exists in bacteria associated with advanced caries. In this report, the profile of the microflora of carious dentine was explored by using DNA extracted from 10 lesions selected on the basis of comparable total microbial load and on the relative abundance of Prevotella spp. Using universal primers fo...

  14. Analysis of genetic diversity among rapeseed cultivars and breeding lines by srap and ssr molecular markers

    International Nuclear Information System (INIS)

    Channa, S.A.; Tian, H.

    2016-01-01

    The knowledge of genetic diversity is very important for developing new rapeseed (Brassica napus L.) cultivars. The genetic diversity among 77 rapeseed accessions, including 22 varieties and 55 advanced breeding lines were analyzed by 47 sequence-related amplified polymorphism (SRAP) and 56 simple sequence repeat (SSR) primers. A total of 270 SRAP and 194 SSR polymorphic fragments were detected with an average of 5.74 and 3.46 for SRAP and SSR primer, respectively. The cluster analysis grouped the 77 accessions into five major clusters. Cluster I contained spring and winter type varieties from Czech Republic and semi-winter varieties and their respective breeding lines from China. The 16 elite breeding lines discovered in Cluster II, III, IV and V indicated higher genetic distance than accessions in Cluster I. The principal component analysis and structure analysis exhibited similar results to the cluster analysis. Analysis of molecular variance revealed that genetic diversity of the selected breeding lines was comparable to the rapeseed varieties, and variation among varieties and lines was significant. The diverse and unique group of 16 elite breeding lines detected in this study can be utilized in the future breeding program as a source for development of commercial varieties with more desirable characters. (author)

  15. Phylodynamic analysis and molecular diversity of the avian infectious bronchitis virus of chickens in Brazil.

    Science.gov (United States)

    Fraga, Aline Padilha de; Gräf, Tiago; Pereira, Cleiton Schneider; Ikuta, Nilo; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

    2018-03-21

    Avian infectious bronchitis virus (IBV) is the etiological agent of a highly contagious disease, which results in severe economic losses to the poultry industry. The spike protein (S1 subunit) is responsible for the molecular diversity of the virus and many sero/genotypes are described around the world. Recently a new standardized classification of the IBV molecular diversity was conducted, based on phylogenetic analysis of the S1 gene sequences sampled worldwide. Brazil is one of the biggest poultry producers in the world and the present study aimed to review the molecular diversity and reconstruct the evolutionary history of IBV in the country. All IBV S1 gene sequences, with local and year of collection information available on GenBank, were retrieved. Phylogenetic analyses were carried out based on a maximum likelihood method for the classification of genotypes occurring in Brazil, according to the new classification. Bayesian phylogenetic analyses were performed with the Brazilian clade and related international sequences to determine the evolutionary history of IBV in Brazil. A total of 143 Brazilian sequences were classified as GI-11 and 46 as GI-1 (Mass). Within the GI-11 clade, we have identified a potential recombinant strain circulating in Brazil. Phylodynamic analysis demonstrated that IBV GI-11 lineage was introduced in Brazil in the 1950s (1951, 1917-1975 95% HPD) and population dynamics was mostly constant throughout the time. Despite the national vaccination protocols, our results show the widespread dissemination and maintenance of the IBV GI-11 lineage in Brazil and highlight the importance of continuous surveillance to evaluate the impact of currently used vaccine strains on the observed viral diversity of the country. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Molecular analysis and genetic diversity of Aedes albopictus (Diptera, Culicidae) from China.

    Science.gov (United States)

    Ruiling, Zhang; Peien, Leng; Xuejun, Wang; Zhong, Zhang

    2018-05-01

    Aedes albopictus is one of the most invasive species, which can carry Dengue virus, Yellow fever virus and more than twenty arboviruses. Based on mitochondrial gene cytochrome c oxidase I (COI) and samples collected from 17 populations, we investigated the molecular character and genetic diversity of Ae. albopictus from China. Altogether, 25 haplotypes were detected, including 10 shared haplotypes and 15 private haplotypes. H1 was the dominant haplotype, which is widely distributed in 13 populations. Tajima'D value of most populations was significantly negative, demonstrating that populations experienced rapid range expansion recently. Most haplotypes clustered together both in phylogenetic and median-joining network analysis without clear phylogeographic patterns. However, neutrality tests revealed shallow divergences among Hainan and Guangxi with other populations (0.15599 ≤ F ST ≤ 0.75858), which probably due to interrupted gene flow, caused by geographical isolations. In conclusion, Ae. albopictus populations showed low genetic diversity in China.

  17. Genetic Diversity Analysis in 27 Tomato Accessions Using Morphological and Molecular Markers

    Directory of Open Access Journals (Sweden)

    Catur Herison

    2018-02-01

    Full Text Available Genetic diversity is the most important aspect in tomato breeding activities. Better assessment on the diversity of the collected accessions will come up with better result of the cultivar development. This study aimed at analyzing the genetic diversity of 27 tomato accessions by morphological and molecular markers. Twenty seven accessions collected from various regions of Indonesia were planted in the field and evaluated for their morphological traits, and RAPD analyzed for their molecular markers. The UPGMA clustering analyzes, elaborating the combination of morphological and molecular data, indicated that the tomato accessions could be grouped into 5 major groups with 70 % genetic similarity levels. Current study indicated that although many accessions came from different locations, they congregated into the same group. Cherry, Kudamati 1 and Lombok 3 were the farthest genetic distant accessions to the others. Those three genotypes will be the most valuable accessions, when they were crossed with other accessions, for designing a prospective breeding program in the future.

  18. Genetic Diversity Analysis of Tagetes Species Using PCR Based Molecular Markers

    International Nuclear Information System (INIS)

    Shahzadi, I.; Ahmad, R.; Waheed, U.; Shah, M. F.

    2016-01-01

    Tagetes is a genus of medicinally important wild and cultivated plants containing several chemical compounds. Lack of information on variation at molecular level present in Tagetes species is paramount to understand the genetic basis of medicinally important compounds. Current study aims at finding genetic variability in Tagetes species using random and specific molecular markers. Two primer systems including 25 RAPD and 3 STS (limonene gene) were used to ascertain genetic diversity of 15 Tagetes genotypes belonging to different species. We found that 20 of the 25 tested RAPD primers generated stable band patterns with 167 loci of amplification products. The proportion of polymorphic bands was 95.21 percent for RAPD primers. Three STS primers generated a total of 29 amplification products, of which 96.55 percent were polymorphic. Homology of genotypes was 53.18 percent and 51.11 percent with RAPD and STS primers respectively. The dendrogram obtained revealed that the range of overall genetic distances estimated was 22 percent to 100 percent through RAPD and 9 percent to 100 percent through STS markers. The findings help to establish that PCR-based assay such as RAPD and STS could be used successfully for estimation of genetic diversity of different genotypes of Tagetes that can be used for selection of parents for improvement of the species. (author)

  19. Molecular analysis of the bacterial diversity in a specialized consortium for diesel oil degradation

    Energy Technology Data Exchange (ETDEWEB)

    Paixao, Douglas Antonio Alvaredo; Accorsini, Fabio Raphael; Vidotti, Maria Benincasa; Lemos, Eliana Gertrudes de Macedo [Universidade Estadual Paulista (FCAV/UNESP), Jaboticabal, SP (Brazil). Fac. de Ciencias Agrarias e Veterinarias], Emails: douglas_unespfcav@yahoo.com.br, vidotti@netsite.com.bregerle@fcav.unesp.br; Dimitrov, Mauricio Rocha [Universidade de Sao Paulo (USP), SP (Brazil)], Email: mau_dimitrov@yahoo.com.br; Pereira, Rodrigo Matheus [EMBRAPARA Soybean - Empresa Brasileira de Pesquisa Agropecuaria (EMBRAPA - Soja), Londrina, PR (Brazil)], Email: poetbr@gmail.com

    2010-05-15

    Diesel oil is a compound derived from petroleum, consisting primarily of hydrocarbons. Poor conditions in transportation and storage of this product can contribute significantly to accidental spills causing serious ecological problems in soil and water and affecting the diversity of the microbial environment. The cloning and sequencing of the 16S rRNA gene is one of the molecular techniques that allows estimation and comparison of the microbial diversity in different environmental samples. The aim of this work was to estimate the diversity of microorganisms from the Bacteria domain in a consortium specialized in diesel oil degradation through partial sequencing of the 16S rRNA gene. After the extraction of DNA metagenomics, the material was amplified by PCR reaction using specific oligonucleotide primers for the 16S rRNA gene. The PCR products were cloned into a pGEM-T-Easy vector (Promega), and Escherichia coli was used as the host cell for recombinant DNAs. The partial clone sequencing was obtained using universal oligonucleotide primers from the vector. The genetic library obtained generated 431 clones. All the sequenced clones presented similarity to phylum Proteobacteria, with Gammaproteobacteria the most present group (49.8 % of the clones), followed by Alphaproteobacteira (44.8 %) and Betaproteobacteria (5.4 %). The Pseudomonas genus was the most abundant in the metagenomics library, followed by the Parvibaculum and the Sphingobium genus, respectively. After partial sequencing of the 16S rRNA, the diversity of the bacterial consortium was estimated using DOTUR software. When comparing these sequences to the database from the National Center for Biotechnology Information (NCBI), a strong correlation was found between the data generated by the software used and the data deposited in NCBI. (author)

  20. Genetic Diversity Analysis of Iranian Jujube Ecotypes (Ziziphus spp. Using RAPD Molecular Marker

    Directory of Open Access Journals (Sweden)

    S Abbasi

    2012-12-01

    Full Text Available Jujube (Ziziphus jujuba Mill. is a valuable medicinal plant which is important in Iranian traditional medicines. Although the regional plants such as jujube play an important role in our economy, but they are forgotten in research and technology. Considering the economic and medicinal importance of jujube, the first step in breeding programs is determination of the genetic diversity among the individuals. 34 ecotypes of jujube, which have been collected from eight provinces of Iran, were used in this study. The genetic relationships of Iranian jujube ecotypes were analyzed using Random Amplified Polymorphic DNA (RAPD marker. Six out of 15 random decamer primers applied for RAPD analysis, showed an informative polymorphism. According to clustering analysis using UPGMA's methods, the ecotypes were classified into two major groups at the 0.81 level of genetic similarity. The highest value of similarity coefficient (0.92 was detected between Mazandaran and Golestan ecotypes and the most genetic diversity was observed in ecotypes of Khorasan-Jonoubi. The affinity of Khorasan-Jonoubi and Esfahan ecotypes indicated a possible common origin for the variation in these areas. Results indicated that RAPD analysis could be successfully used for the estimation of genetic diversity among Ziziphus ecotypes and it can be useful for further investigations.

  1. Genetic diversity analysis of Chrysopidae family (Insecta, Neuroptera) via molecular markers.

    Science.gov (United States)

    Yari, Kheirollah; Mirmoayedi, Alinaghi; Marami, Marzieh; Kazemi, Elham; Kahrizi, Danial

    2014-09-01

    In entomology, improvement of molecular methods would be beneficial tools for accurate identification and detecting the genetic diversity of insect species to discover a corroborative evidence for the traditional classification based on morphology. The aim of this study was focused on RAPD-PCR method for distinguishing the genetic diversity between eight species of Chrysopidae family. In current research, many specimens were collected in different locations of Tehran province (Iran), between them 24 specimens were identified. The wing venation, male genitalia and other morphological characters were used for identification and also the sexing of species was recognized with study of external genitalia. Then, the DNA was extracted with CTAB method. The RAPD-PCR method was carried out with twenty random primers. The agarose gel electrophoresis was used for separation of the PCR products. Based on electrophoresis results, 133 bands were amplified and between them, 126 bands were poly-morph and others were mono-morph. Also, among the applied primers, the primers OPA02 with 19 bands and OPA03 with 8 bands were amplified the maximum and minimum of bands, respectively. The results showed that 80.35 and 73.21 % of genetic similarity existed between Chrysopa pallens-Chrysopa dubitans, and between the Chrysoperla kolthoffi and Chrysoperla carnea, respectively. The minimum (45.53 %) of genetic similarity was observed between C. kolthoffi and C. dubitans, and the maximum (0.80 %) was seen between C. pallens and C. dubitans.

  2. Population Structure, Genetic Diversity and Molecular Marker-Trait Association Analysis for High Temperature Stress Tolerance in Rice.

    Directory of Open Access Journals (Sweden)

    Sharat Kumar Pradhan

    Full Text Available Rice exhibits enormous genetic diversity, population structure and molecular marker-traits associated with abiotic stress tolerance to high temperature stress. A set of breeding lines and landraces representing 240 germplasm lines were studied. Based on spikelet fertility percent under high temperature, tolerant genotypes were broadly classified into four classes. Genetic diversity indicated a moderate level of genetic base of the population for the trait studied. Wright's F statistic estimates showed a deviation of Hardy-Weinberg expectation in the population. The analysis of molecular variance revealed 25 percent variation between population, 61 percent among individuals and 14 percent within individuals in the set. The STRUCTURE analysis categorized the entire population into three sub-populations and suggested that most of the landraces in each sub-population had a common primary ancestor with few admix individuals. The composition of materials in the panel showed the presence of many QTLs representing the entire genome for the expression of tolerance. The strongly associated marker RM547 tagged with spikelet fertility under stress and the markers like RM228, RM205, RM247, RM242, INDEL3 and RM314 indirectly controlling the high temperature stress tolerance were detected through both mixed linear model and general linear model TASSEL analysis. These markers can be deployed as a resource for marker-assisted breeding program of high temperature stress tolerance.

  3. Population Structure, Genetic Diversity and Molecular Marker-Trait Association Analysis for High Temperature Stress Tolerance in Rice.

    Science.gov (United States)

    Pradhan, Sharat Kumar; Barik, Saumya Ranjan; Sahoo, Ambika; Mohapatra, Sudipti; Nayak, Deepak Kumar; Mahender, Anumalla; Meher, Jitandriya; Anandan, Annamalai; Pandit, Elssa

    2016-01-01

    Rice exhibits enormous genetic diversity, population structure and molecular marker-traits associated with abiotic stress tolerance to high temperature stress. A set of breeding lines and landraces representing 240 germplasm lines were studied. Based on spikelet fertility percent under high temperature, tolerant genotypes were broadly classified into four classes. Genetic diversity indicated a moderate level of genetic base of the population for the trait studied. Wright's F statistic estimates showed a deviation of Hardy-Weinberg expectation in the population. The analysis of molecular variance revealed 25 percent variation between population, 61 percent among individuals and 14 percent within individuals in the set. The STRUCTURE analysis categorized the entire population into three sub-populations and suggested that most of the landraces in each sub-population had a common primary ancestor with few admix individuals. The composition of materials in the panel showed the presence of many QTLs representing the entire genome for the expression of tolerance. The strongly associated marker RM547 tagged with spikelet fertility under stress and the markers like RM228, RM205, RM247, RM242, INDEL3 and RM314 indirectly controlling the high temperature stress tolerance were detected through both mixed linear model and general linear model TASSEL analysis. These markers can be deployed as a resource for marker-assisted breeding program of high temperature stress tolerance.

  4. Investigation and Analysis of Genetic Diversity of Diospyros Germplasms Using SCoT Molecular Markers in Guangxi.

    Science.gov (United States)

    Deng, Libao; Liang, Qingzhi; He, Xinhua; Luo, Cong; Chen, Hu; Qin, Zhenshi

    2015-01-01

    Knowledge about genetic diversity and relationships among germplasms could be an invaluable aid in diospyros improvement strategies. This study was designed to analyze the genetic diversity and relationship of local and natural varieties in Guangxi Zhuang Autonomous Region of China using start codon targeted polymorphism (SCoT) markers. The accessions of 95 diospyros germplasms belonging to four species Diospyros kaki Thunb, D. oleifera Cheng, D. kaki var. silverstris Mak, and D. lotus Linn were collected from different eco-climatic zones in Guangxi and were analyzed using SCoT markers. Results indicated that the accessions of 95 diospyros germplasms could be distinguished using SCoT markers, and were divided into three groups at similarity coefficient of 0.608; these germplasms that belong to the same species were clustered together; of these, the degree of genetic diversity of the natural D. kaki var. silverstris Mak population was richest among the four species; the geographical distance showed that the 12 natural populations of D. kaki var. silverstris Mak were divided into two groups at similarity coefficient of 0.19. Meanwhile, in order to further verify the stable and useful of SCoT markers in diospyros germplasms, SSR markers were also used in current research to analyze the genetic diversity and relationship in the same diospyros germplasms. Once again, majority of germplasms that belong to the same species were clustered together. Thus SCoT markers were stable and especially useful for analysis of the genetic diversity and relationship in diospyros germplasms. The molecular characterization and diversity assessment of diospyros were very important for conservation of diospyros germplasm resources, meanwhile for diospyros improvement.

  5. Analysis of molecular diversity, population structure and linkage disequilibrium in a worldwide survey of cultivated barley germplasm (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    Ganal Martin W

    2006-01-01

    Full Text Available Abstract Background The goal of our study was a systematic survey of the molecular diversity in barley genetic resources. To this end 953 cultivated barley accessions originating from all inhabited continents except Australia were genotyped with 48 SSR markers. Molecular diversity was evaluated with routine statistics (allelic richness, gene diversity, allele frequency, heterozygosity and unique alleles, Principal Coordinate Analysis (PCoA, and analysis of genome-wide linkage disequilibrium. Results A genotyping database for 953 cultivated barley accessions profiled with 48 SSR markers was established. The PCoA revealed structuring of the barley population with regard to (i geographical regions and (ii agronomic traits. Geographic origin contributed most to the observed molecular diversity. Genome-wide linkage disequilibrium (LD was estimated as squared correlation of allele frequencies (r2. The values of LD for barley were comparable to other plant species (conifers, poplar, maize. The pattern of intrachromosomal LD with distances between the genomic loci ranging from 1 to 150 cM revealed that in barley LD extended up to distances as long as 50 cM with r2 > 0.05, or up to 10 cM with r2 > 0.2. Few loci mapping to different chromosomes showed significant LD with r2 > 0.05. The number of loci in significant LD as well as the pattern of LD were clearly dependent on the population structure. The LD in the homogenous group of 207 European 2-rowed spring barleys compared to the highly structured worldwide barley population was increased in the number of loci pairs with r2 > 0.05 and had higher values of r2, although the percentage of intrachromosomal loci pairs in significant LD based on P 0.80 provided higher LD values as compared to 19 low polymorphic loci (PIC Conclusion A global population of cultivated barley accessions was highly structured. Clustering highlighted the accessions with the same geographic origin, as well as accessions possessing

  6. Molecular Diversity Analysis and Genetic Mapping of Pod Shatter Resistance Loci in Brassica carinata L.

    Directory of Open Access Journals (Sweden)

    Rosy Raman

    2017-11-01

    Full Text Available Seed lost due to easy pod dehiscence at maturity (pod shatter is a major problem in several members of Brassicaceae family. We investigated the level of pod shatter resistance in Ethiopian mustard (Brassica carinata and identified quantitative trait loci (QTL for targeted introgression of this trait in Ethiopian mustard and its close relatives of the genus Brassica. A set of 83 accessions of B. carinata, collected from the Australian Grains Genebank, was evaluated for pod shatter resistance based on pod rupture energy (RE. In comparison to B. napus (RE = 2.16 mJ, B. carinata accessions had higher RE values (2.53 to 20.82 mJ. A genetic linkage map of an F2 population from two contrasting B. carinata selections, BC73526 (shatter resistant with high RE and BC73524 (shatter prone with low RE comprising 300 individuals, was constructed using a set of 6,464 high quality DArTseq markers and subsequently used for QTL analysis. Genetic analysis of the F2 and F2:3 derived lines revealed five statistically significant QTL (LOD ≥ 3 that are linked with pod shatter resistance on chromosomes B1, B3, B8, and C5. Herein, we report for the first time, identification of genetic loci associated with pod shatter resistance in B. carinata. These characterized accessions would be useful in Brassica breeding programs for introgression of pod shatter resistance alleles in to elite breeding lines. Molecular markers would assist marker-assisted selection for tracing the introgression of resistant alleles. Our results suggest that the value of the germplasm collections can be harnessed through genetic and genomics tools.

  7. Analysis of genetic diversity of certain species of Piper using RAPD-based molecular markers.

    Science.gov (United States)

    Chowdhury, Utpal; Tanti, Bhaben; Rethy, Parakkal; Gajurel, Padma Raj

    2014-09-01

    The utility of RAPD markers in assessing genetic diversity and phenetic relationships of six different species of Piper from Northeast India was investigated. Polymerase chain reaction (PCR) with four arbitrary 10-mer oligonucleotide primers applied to the six species produced a total of 195 marker bands, of which, 159 were polymorphic. On average, six RAPD fragments were amplified per reaction. In the UPGMA phenetic dendrogram based on Jaccard's coefficient, the different accessions of Piper showed a high level of genetic variation. This study may be useful in identifying diverse genetic stocks of Piper, which may then be conserved on a priority basis.

  8. Molecular analysis reveals hidden diversity in Zungaro (Siluriformes: Pimelodidade): a genus of giant South American catfish.

    Science.gov (United States)

    Pires, Antonio A; Ramirez, Jorge L; Galetti, Pedro M; Troy, Waldo P; Freitas, Patricia D

    2017-06-01

    The genus Zungaro contains some of the largest catfish in South America. Two valid species are currently recognized: Zungaro jahu, inhabiting the Paraná and Paraguay basins, and Zungaro zungaro, occurring in the Amazonas and Orinoco basins. Analysing Zungaro specimens from the Amazonas, Orinoco, Paraguay and Paraná basins, based on the sequencing of COI and D-loop, we found at least three MOTUs, indicating the existence of hidden diversity within this fish group. Considering the ecological and economic values of this fish, our results are surely welcomed for its conservation, disclosing new findings on its diversity and pointing out the necessity for a detailed taxonomic revision.

  9. Molecular diversity and population structure of Chinese green foxtail [Setaria viridis (L.) Beauv.] revealed by microsatellite analysis.

    Science.gov (United States)

    Jia, Guanqing; Shi, Shenkui; Wang, Chunfang; Niu, Zhengang; Chai, Yang; Zhi, Hui; Diao, Xianmin

    2013-09-01

    Green foxtail (Setaria viridis) is a new model plant for the genomic investigation of C4 photosynthesis biology. As the ancestor of foxtail millet (Setaria italica), an ancient cereal of great importance in arid regions of the world, green foxtail is crucial for the study of domestication and evolution of this ancient crop. In the present study, 288 green foxtail accessions, which were collected from all geographical regions of China, were analysed using 77 simple sequence repeats (SSRs) that cover the whole genome. A high degree of molecular diversity was detected in these accessions, with an average of 33.5 alleles per locus. Two clusters, which were inconsistent with the distribution of eco-geographical regions in China, were inferred from STRUCTURE, Neighbor-Joining, and principal component analysis, indicating a partially mixed distribution of Chinese green foxtails. The higher subpopulation diversity was from accessions mainly collected from North China. A low level of linkage disequilibrium was observed in the green foxtail genome. Furthermore, a combined analysis of green foxtail and foxtail millet landraces was conducted, and the origin and domestication of foxtail millet was inferred in North China.

  10. Molecular analysis for genetic diversity and distance of introduced Grus antigone sharpii L. to Thailand.

    Science.gov (United States)

    Tanee, T; Chaveerach, A; Anuniwat, A; Tanomtong, A; Pinthong, K; Sudmoon, R; Mokkamul, P

    2009-01-15

    The genetic relationship was examined in a population of Grus antigone sharpii L. using DNA markers from the ISSR technique for applying towards breeding purposes for conservation of species. Since their extinction from Thailand, sixteen eastern sarus cranes: Grus antigone sharpii L. provided from Cambodia were fed and bred to sixty individuals at Nakhonratchasima Zoo, Northeastern Thailand to re-exist in Thai natural sites. Their genetic diversity and distance were examined to test their possibility to adapt to environmental variation. Blood samples from 27 individuals of Grus antigone sharpii L. were collected and DNA was extracted. These DNA samples were amplified using the successful fifteen from twenty four primers inter simple sequences repeat markers. A dendrogram was constructed and shows distance values of the species between 12.1 and 53.5. The samples produced 63.96% polymorphic banding profiles. The genetic diversity (H') in this population was estimated using Shannon's index. The high H' value of 0.501 reflected the somewhat wide range of distribution sites, which would adapt to environmental variations. Genetic evenness is 0.152. This value supports that all the studied samples have a small equal genetic abundance.

  11. Joint analysis of phenotypic and molecular diversity provides new insights on the genetic variability of the Brazilian physic nut germplasm bank.

    Science.gov (United States)

    Alves, Alexandre Alonso; Bhering, Leonardo Lopes; Rosado, Tatiana Barbosa; Laviola, Bruno Galvêas; Formighieri, Eduardo Fernandes; Cruz, Cosme Damião

    2013-09-01

    The genetic variability of the Brazilian physic nut (Jatropha curcas) germplasm bank (117 accessions) was assessed using a combination of phenotypic and molecular data. The joint dissimilarity matrix showed moderate correlation with the original matrices of phenotypic and molecular data. However, the correlation between the phenotypic dissimilarity matrix and the genotypic dissimilarity matrix was low. This finding indicated that molecular markers (RAPD and SSR) did not adequately sample the genomic regions that were relevant for phenotypic differentiation of the accessions. The dissimilarity values of the joint dissimilarity matrix were used to measure phenotypic + molecular diversity. This diversity varied from 0 to 1.29 among the 117 accessions, with an average dissimilarity among genotypes of 0.51. Joint analysis of phenotypic and molecular diversity indicated that the genetic diversity of the physic nut germplasm was 156% and 64% higher than the diversity estimated from phenotypic and molecular data, respectively. These results show that Jatropha genetic variability in Brazil is not as limited as previously thought.

  12. Retrotransposon-Based Molecular Markers for Analysis of Genetic Diversity within the Genus Linum

    Science.gov (United States)

    Melnikova, Nataliya V.; Kudryavtseva, Anna V.; Zelenin, Alexander V.; Lakunina, Valentina A.; Yurkevich, Olga Yu.; Speranskaya, Anna S.; Dmitriev, Alexey A.; Krinitsina, Anastasia A.; Belenikin, Maxim S.; Uroshlev, Leonid A.; Snezhkina, Anastasiya V.; Sadritdinova, Asiya F.; Koroban, Nadezda V.; Amosova, Alexandra V.; Samatadze, Tatiana E.; Guzenko, Elena V.; Lemesh, Valentina A.; Savilova, Anastasya M.; Rachinskaia, Olga A.; Kishlyan, Natalya V.; Rozhmina, Tatiana A.; Bolsheva, Nadezhda L.; Muravenko, Olga V.

    2014-01-01

    SSAP method was used to study the genetic diversity of 22 Linum species from sections Linum, Adenolinum, Dasylinum, Stellerolinum, and 46 flax cultivars. All the studied flax varieties were distinguished using SSAP for retrotransposons FL9 and FL11. Thus, the validity of SSAP method was demonstrated for flax marking, identification of accessions in genebank collections, and control during propagation of flax varieties. Polymorphism of Fl1a, Fl1b, and Cassandra insertions were very low in flax varieties, but these retrotransposons were successfully used for the investigation of Linum species. Species clusterization based on SSAP markers was in concordance with their taxonomic division into sections Dasylinum, Stellerolinum, Adenolinum, and Linum. All species of sect. Adenolinum clustered apart from species of sect. Linum. The data confirmed the accuracy of the separation in these sections. Members of section Linum are not as closely related as members of other sections, so taxonomic revision of this section is desirable. L. usitatissimum accessions genetically distant from modern flax cultivars were revealed in our work. These accessions are of utmost interest for flax breeding and introduction of new useful traits into flax cultivars. The chromosome localization of Cassandra retrotransposon in Linum species was determined. PMID:25243121

  13. Molecular analysis of diverse elements mediating VanA glycopeptide resistance in enterococci

    DEFF Research Database (Denmark)

    Palepou, M.F.I.; Adebiyi, A.M.A.; Tremlett, C.H.

    1998-01-01

    Differences were examined among 24 distinct elements mediating VanA-type glycopeptide resistance in enterococci isolated from hospital patients and non-human sources in the UK. The methods used included long-PCR restriction fragment length polymorphism (L-PCR RFLP) analysis and DNA hybridization...... characterized by the presence of an IS1216V/IS3-like/orf1 complex and a point mutation in vanX, both of which were absent from the other 23 groups of VanA elements. This finding is consistent with the dissemination of a stable resistance element. We conclude that L-PCR RFLP analysis, combined with DNA...

  14. Molecular Technique to Understand Deep Microbial Diversity

    Science.gov (United States)

    Vaishampayan, Parag A.; Venkateswaran, Kasthuri J.

    2012-01-01

    Current sequencing-based and DNA microarray techniques to study microbial diversity are based on an initial PCR (polymerase chain reaction) amplification step. However, a number of factors are known to bias PCR amplification and jeopardize the true representation of bacterial diversity. PCR amplification of the minor template appears to be suppressed by the exponential amplification of the more abundant template. It is widely acknowledged among environmental molecular microbiologists that genetic biosignatures identified from an environment only represent the most dominant populations. The technological bottleneck has overlooked the presence of the less abundant minority population, and underestimated their role in the ecosystem maintenance. To generate PCR amplicons for subsequent diversity analysis, bacterial l6S rRNA genes are amplified by PCR using universal primers. Two distinct PCR regimes are employed in parallel: one using normal and the other using biotinlabeled universal primers. PCR products obtained with biotin-labeled primers are mixed with streptavidin-labeled magnetic beads and selectively captured in the presence of a magnetic field. Less-abundant DNA templates that fail to amplify in this first round of PCR amplification are subjected to a second round of PCR using normal universal primers. These PCR products are then subjected to downstream diversity analyses such as conventional cloning and sequencing. A second round of PCR amplified the minority population and completed the deep diversity picture of the environmental sample.

  15. Molecular characterization and assessment of genetic diversity of ...

    African Journals Online (AJOL)

    R Madhusudhana

    genetic diversity available at molecular level among a set of phenotypically different ... allele matching and cluster analysis based on unweighted neighbor- joining (Gascuel, 1997) ..... on isozyme data-a simulation study. Theor. Appl. Genet.

  16. Molecular diversity and genetic relationships in Secale

    Indian Academy of Sciences (India)

    2001); and molecular methods such as amplified fragment length polymorphism ... to the maintenance and rational use of germplasm resources in the improvement of ... study of diversity of ScMATE1 gene in different species of. Secale genus.

  17. Congruence between morphological and molecular markers inferred from the analysis of the intra-morphotype genetic diversity and the spatial structure of Oxalis tuberosa Mol.

    Science.gov (United States)

    Pissard, Audrey; Arbizu, Carlos; Ghislain, Marc; Faux, Anne-Michèle; Paulet, Sébastien; Bertin, Pierre

    2008-01-01

    Oxalis tuberosa is an important crop cultivated in the highest Andean zones. A germplasm collection is maintained ex situ by CIP, which has developed a morphological markers system to classify the accessions into morphotypes, i.e. groups of morphologically identical accessions. However, their genetic uniformity is currently unknown. The ISSR technique was used in two experiments to determine the relationships between both morphological and molecular markers systems. The intra-morphotype genetic diversity, the spatial structures of the diversity and the congruence between both markers systems were determined. In the first experience, 44 accessions representing five morphotypes, clearly distinct from each other, were analyzed. At the molecular level, the accessions exactly clustered according to their morphotypes. However, a genetic variability was observed inside each morphotype. In the second experiment, 34 accessions gradually differing from each other on morphological base were analyzed. The morphological clustering showed no geographical structure. On the opposite, the molecular analysis showed that the genetic structure was slightly related to the collection site. The correlation between both markers systems was weak but significant. The lack of perfect congruence between morphological and molecular data suggests that the morphological system may be useful for the morphotypes management but is not appropriate to study the genetic structure of the oca. The spatial structure of the genetic diversity can be related to the evolution of the species and the discordance between the morphological and molecular structures may result from similar selection pressures at different places leading to similar forms with a different genetic background.

  18. Cultivation Versus Molecular Analysis of Banana (Musa sp.) Shoot-Tip Tissue Reveals Enormous Diversity of Normally Uncultivable Endophytic Bacteria.

    Science.gov (United States)

    Thomas, Pious; Sekhar, Aparna Chandra

    2017-05-01

    The interior of plants constitutes a unique environment for microorganisms with various organisms inhabiting as endophytes. Unlike subterranean plant parts, aboveground parts are relatively less explored for endophytic microbial diversity. We employed a combination of cultivation and molecular approaches to study the endophytic bacterial diversity in banana shoot-tips. Cultivable bacteria from 20 sucker shoot-tips of cv. Grand Naine included 37 strains under 16 genera and three phyla (Proteobacteria, Actinobacteria, Firmicutes). 16S rRNA gene-ribotyping approach on 799f and 1492r PCR-amplicons to avoid plant organelle sequences was ineffective showing limited bacterial diversity. 16S rRNA metagene profiling targeting the V3-V4 hypervariable region after filtering out the chloroplast (74.2 %), mitochondrial (22.9 %), and unknown sequences (1.1 %) revealed enormous bacterial diversity. Proteobacteria formed the predominant phylum (64 %) succeeded by Firmicutes (12.1 %), Actinobacteria (9.5 %), Bacteroidetes (6.4 %), Planctomycetes, Cyanobacteria, and minor shares (banana shoot-tips (20 phyla, 46 classes) with about 2.6 % of the deciphered 269 genera and 1.5 % of the 656 observed species from the same source of shoot-tips attained through cultivation. The predominant genera included several agriculturally important bacteria. The study reveals an immense ecosystem of endophytic bacteria in banana shoot tissues endorsing the earlier documentation of intracellular "Cytobacts" and "Peribacts" with possible roles in plant holobiome and hologenome.

  19. Identification of single-copy orthologous genes between Physalis and Solanum lycopersicum and analysis of genetic diversity in Physalis using molecular markers.

    Science.gov (United States)

    Wei, Jingli; Hu, Xiaorong; Yang, Jingjing; Yang, Wencai

    2012-01-01

    The genus Physalis includes a number of commercially important edible and ornamental species. Its high nutritional value and potential medicinal properties leads to the increased commercial interest in the products of this genus worldwide. However, lack of molecular markers prevents the detailed study of genetics and phylogeny in Physalis, which limits the progress of breeding. In the present study, we compared the DNA sequences between Physalis and tomato, and attempted to analyze genetic diversity in Physalis using tomato markers. Blasting 23180 DNA sequences derived from Physalis against the International Tomato Annotation Group (ITAG) Release2.3 Predicted CDS (SL2.40) discovered 3356 single-copy orthologous genes between them. A total of 38 accessions from at least six species of Physalis were subjected to genetic diversity analysis using 97 tomato markers and 25 SSR markers derived from P. peruviana. Majority (73.2%) of tomato markers could amplify DNA fragments from at least one accession of Physalis. Diversity in Physalis at molecular level was also detected. The average Nei's genetic distance between accessions was 0.3806 with a range of 0.2865 to 0.7091. These results indicated Physalis and tomato had similarity at both molecular marker and DNA sequence levels. Therefore, the molecular markers developed in tomato can be used in genetic study in Physalis.

  20. Identification of single-copy orthologous genes between Physalis and Solanum lycopersicum and analysis of genetic diversity in Physalis using molecular markers.

    Directory of Open Access Journals (Sweden)

    Jingli Wei

    Full Text Available The genus Physalis includes a number of commercially important edible and ornamental species. Its high nutritional value and potential medicinal properties leads to the increased commercial interest in the products of this genus worldwide. However, lack of molecular markers prevents the detailed study of genetics and phylogeny in Physalis, which limits the progress of breeding. In the present study, we compared the DNA sequences between Physalis and tomato, and attempted to analyze genetic diversity in Physalis using tomato markers. Blasting 23180 DNA sequences derived from Physalis against the International Tomato Annotation Group (ITAG Release2.3 Predicted CDS (SL2.40 discovered 3356 single-copy orthologous genes between them. A total of 38 accessions from at least six species of Physalis were subjected to genetic diversity analysis using 97 tomato markers and 25 SSR markers derived from P. peruviana. Majority (73.2% of tomato markers could amplify DNA fragments from at least one accession of Physalis. Diversity in Physalis at molecular level was also detected. The average Nei's genetic distance between accessions was 0.3806 with a range of 0.2865 to 0.7091. These results indicated Physalis and tomato had similarity at both molecular marker and DNA sequence levels. Therefore, the molecular markers developed in tomato can be used in genetic study in Physalis.

  1. Genetic diversity in intraspecific hybrid populations of Eucommia ulmoides Oliver evaluated from ISSR and SRAP molecular marker analysis.

    Science.gov (United States)

    Yu, J; Wang, Y; Ru, M; Peng, L; Liang, Z S

    2015-07-03

    Eucommia ulmoides Oliver, the only extant species of Eucommiaceae, is a second-category state-protected endangered plant in China. Evaluation of genetic diversity among some intraspecific hybrid populations of E. ulmoides Oliver is vital for breeding programs and further conservation of this rare species. We studied the genetic diversity of 130 accessions from 13 E. ulmoides intraspecific hybrid populations using inter-simple sequence related (ISSR) and sequence-related amplified polymorphism (SRAP) markers. Of the 100 ISSR primers and 100 SRAP primer combinations screened, eight ISSRs and eight SRAPs were used to evaluate the level of polymorphism and discriminating capacity. A total number of 65 bands were amplified using eight ISSR primers, in which 50 bands (76.9%) were polymorphic, with an average of 8.1 polymorphic fragments per primer. Alternatively, another 244 bands were observed using eight SRAP primer combinations, and 163 (66.8%) of them were polymorphic, with an average of 30.5 polymorphic fragments per primer. The unweighted pair-group method (UPGMA) analysis showed that these 13 populations could be classified into three groups by the ISSR marker and two groups by the SRAP marker. Principal coordinate analysis using SRAP was completely identical to the UPGMA-based clustering, although this was partly confirmed by the results of UPGMA cluster analysis using the ISSR marker. This study provides insights into the genetic background of E. ulmoides intraspecific hybrids. The progenies of the variations "Huazhong-3", "big fruit", "Yanci", and "smooth bark" present high genetic diversity and offer great potential for E. ulmoides breeding and conservation.

  2. Molecular diversity and genetic relationships in Secale

    Indian Academy of Sciences (India)

    Molecular diversity and genetic relationships in Secale. E. Santos, M. Matos, P. Silva, A. M. Figueiras, C. Benito and O. Pinto-Carnide. J. Genet. 95, 273–281. Table 1. RAPD and ISSR primers used in this study. Primer. 5 –3. Primer. 5 –3. RAPDs (Operon). A1. CAGGCCCTTC. C5. CATGACCGCC. A4. AATCGGGCTG. C6.

  3. Molecular diversity and genetic relationships in Secale

    Indian Academy of Sciences (India)

    The objective of this study was to quantify the molecular diversity and to determine the genetic relationships amongSecalespp. and among cultivars ofSecale ... Faculty of Sciences, Campo Grande, Lisboa, Portugal; Departamento de Genética, Facultad de Biologia, Universidad Complutense, C/ José Antonio Novais, 12, ...

  4. Phylogeography and molecular diversity analysis of Jatropha curcas L. and the dispersal route revealed by RAPD, AFLP and nrDNA-ITS analysis.

    Science.gov (United States)

    Sudheer Pamidimarri, D V N; Reddy, Muppala P

    2014-05-01

    Jatropha curcas L. (Euphorbiaceae) has acquired a great importance as a renewable source of energy with a number of environmental benefits. Very few attempts were made to understand the extent of genetic diversity and its distribution. This study was aimed to study the diversity and deduce the phylogeography of Jatropha curcas L. which is said to be the most primitive species of the genus Jatropha. Here we studied the intraspecific genetic diversity of the species distributed in different parts of the globe. The study also focused to understand the molecular diversity at reported probable center of origin (Mexico), and to reveal the dispersal route to other regions based on random amplified polymorphic DNA, amplified fragment length polymorphism and nrDNA-ITS sequences data. The overall genetic diversity of J. curcas found in the present study was narrow. The highest genetic diversity was observed in the germplasm collected from Mexico and supports the earlier hypothesis based on morphological data and natural distribution, it is the center for origin of the species. Least genetic diversity found in the Indian germplasm and clustering results revealed that the species was introduced simultaneously by two distinct germplasm and subsequently distributed in different parts of India. The present molecular data further revealed that J. curcas might have spread from the center of the origin to Cape Verde, than to Spain, Portuguese to other neighboring countries and simultaneously to Africa. The molecular evidence supports the Burkill et al. (A dictionary of the economic products of the Malay Peninsula, Governments of Malaysia and Singapore by the Ministry of Agriculture and Co-operatives. Kuala Lumpur, Malaysia, 1966) view of Portuguese might have introduced the species to India. The clustering pattern suggests that the distribution was interfered by human activity.

  5. Phylogeography and molecular diversity analysis of Jatropha curcas L. and the dispersal route revealed by RAPD, AFLP and nrDNA-ITS analysis

    KAUST Repository

    Sudheer Pamidimarri, D. V N

    2014-01-29

    Jatropha curcas L. (Euphorbiaceae) has acquired a great importance as a renewable source of energy with a number of environmental benefits. Very few attempts were made to understand the extent of genetic diversity and its distribution. This study was aimed to study the diversity and deduce the phylogeography of Jatropha curcas L. which is said to be the most primitive species of the genus Jatropha. Here we studied the intraspecific genetic diversity of the species distributed in different parts of the globe. The study also focused to understand the molecular diversity at reported probable center of origin (Mexico), and to reveal the dispersal route to other regions based on random amplified polymorphic DNA, amplified fragment length polymorphism and nrDNA-ITS sequences data. The overall genetic diversity of J. curcas found in the present study was narrow. The highest genetic diversity was observed in the germplasm collected from Mexico and supports the earlier hypothesis based on morphological data and natural distribution, it is the center for origin of the species. Least genetic diversity found in the Indian germplasm and clustering results revealed that the species was introduced simultaneously by two distinct germplasm and subsequently distributed in different parts of India. The present molecular data further revealed that J. curcas might have spread from the center of the origin to Cape Verde, than to Spain, Portuguese to other neighboring countries and simultaneously to Africa. The molecular evidence supports the Burkill et al. (A dictionary of the economic products of the Malay Peninsula, Governments of Malaysia and Singapore by the Ministry of Agriculture and Co-operatives. Kuala Lumpur, Malaysia, 1966) view of Portuguese might have introduced the species to India. The clustering pattern suggests that the distribution was interfered by human activity. © Springer Science+Business Media 2014.

  6. Molecular diversity analysis and bacterial population dynamics of an adapted seawater microbiota during the degradation of Tunisian zarzatine oil.

    Science.gov (United States)

    Zrafi-Nouira, Ines; Guermazi, Sonda; Chouari, Rakia; Safi, Nimer M D; Pelletier, Eric; Bakhrouf, Amina; Saidane-Mosbahi, Dalila; Sghir, Abdelghani

    2009-07-01

    The indigenous microbiota of polluted coastal seawater in Tunisia was enriched by increasing the concentration of zarzatine crude oil. The resulting adapted microbiota was incubated with zarzatine crude oil as the only carbon and energy source. Crude oil biodegradation capacity and bacterial population dynamics of the microbiota were evaluated every week for 28 days (day 7, day 14, day 21, and day 28). Results show that the percentage of petroleum degradation was 23.9, 32.1, 65.3, and 77.8%, respectively. At day 28, non-aromatic and aromatic hydrocarbon degradation rates reached 92.6 and 68.7%, respectively. Bacterial composition of the adapted microflora was analysed by 16S rRNA gene cloning and sequencing, using total genomic DNA extracted from the adapted microflora at days 0, 7, 14, 21, and 28. Five clone libraries were constructed and a total of 430 sequences were generated and grouped into OTUs using the ARB software package. Phylogenetic analysis of the adapted microbiota shows the presence of four phylogenetic groups: Proteobacteria, Firmicutes, Actinobacteria and Bacteroidetes. Diversity indices show a clear decrease in bacterial diversity of the adapted microflora according to the incubation time. The Proteobacteria are the most predominant (>80%) at day 7, day 14 and day 21 but not at day 28 for which the microbiota was reduced to only one OTU affiliated with the genus Kocuria of the Actinobacteria. This study shows that the degradation of zarzatine crude oil components depends on the activity of a specialized and dynamic seawater consortium composed of different phylogenetic taxa depending on the substrate complexity.

  7. [Analysis of diversity of Russian and Ukrainian bread wheat (Triticum aestivum L.) cultivars for high-molecular-weight glutenin subunits].

    Science.gov (United States)

    Dobrotvorskaia, T V; Martynov, S P

    2011-07-01

    The allelic diversity of high-moleculat-weght glutenin subunits (H WIGS) in Russian and Ukrainian bread wheat cultivars was analyzed. The diversity of spring wheat cultivars for alleles of the Glu-1 loci is characterized by medium values of the polymorphism index (polymorphism information content, PlC), and in winter wheats it varies from high at the Glu-A1 locus to low at the Glu-D1 locus. The spring and winter cultivars differ significantly in the frequencies of alleles of the glutenin loci. The combination of the Glu-A1b, Glu-B1c, and Glu-D1a alleles prevails among the spring cultivars, and the combination of the Glu-A1a, Glu-B1c, and Glu-D1d alleles prevails among the winter cultivars. The distribution of the Glu-1 alleles significantly depends on the moisture and heat supply in the region of origin of the cultivars. Drought resistance is associated with the Glu-D1a allele in the spring wheat and with the Glu-B1b allele in the winter wheat. The sources of the Glu-1 alleles were identified in the spring and wheat cultivars. The analysis of independence of the distribution of the spring and winter cultivars by the market classes and by the alleles of the HMWGS loci showed a highly significant association of the alleles of three Glu-1 loci with the market classes in foreign cultivars and independence or a weak association in the Russian and Ukrainian cultivars. This seems to be due to the absence of a statistically substantiated system of classification of the domestic cultivars on the basis of their quality.

  8. Extraction of inhibitor-free metagenomic DNA from polluted sediments, compatible with molecular diversity analysis using adsorption and ion-exchange treatments.

    Science.gov (United States)

    Desai, Chirayu; Madamwar, Datta

    2007-03-01

    PCR inhibitor-free metagenomic DNA of high quality and high yield was extracted from highly polluted sediments using a simple remediation strategy of adsorption and ion-exchange chromatography. Extraction procedure was optimized with series of steps, which involved gentle mechanical lysis, treatment with powdered activated charcoal (PAC) and ion-exchange chromatography with amberlite resin. Quality of the extracted DNA for molecular diversity analysis was tested by amplifying bacterial 16S rDNA (16S rRNA gene) with eubacterial specific universal primers (8f and 1492r), cloning of the amplified 16S rDNA and ARDRA (amplified rDNA restriction analysis) of the 16S rDNA clones. The presence of discrete differences in ARDRA banding profiles provided evidence for expediency of the DNA extraction protocol in molecular diversity studies. A comparison of the optimized protocol with commercial Ultraclean Soil DNA isolation kit suggested that method described in this report would be more efficient in removing metallic and organic inhibitors, from polluted sediment samples.

  9. New Eocene Coleoid (Cephalopoda Diversity from Statolith Remains: Taxonomic Assignation, Fossil Record Analysis, and New Data for Calibrating Molecular Phylogenies.

    Directory of Open Access Journals (Sweden)

    Pascal Neige

    Full Text Available New coleoid cephalopods are described from statolith remains from the Middle Eocene (Middle Lutetian of the Paris Basin. Fifteen fossil statoliths are identified and assigned to the Sepiidae (Sepia boletzkyi sp. nov.,? Sepia pira sp. nov., Loliginidae (Loligo clarkei sp. nov., and Ommastrephidae (genus indet. families. The sediments containing these fossils indicate permanent aquatic settings in the infralittoral domain. These sediments range in age from 46 Mya to 43 Mya. Analysis of the fossil record of statoliths (from findings described here, together with a review of previously published data indicates marked biases in our knowledge. Fossil statoliths are known from as far back as the Early Jurassic (199.3 to 190.8 Mya but surprisingly, to the best of our knowledge, no record occurs in the Cretaceous. This is a "knowledge bias" and clearly calls for further studies. Finally, we attempt to compare findings described here with fossils previously used to constrain divergence and/or diversification ages of some coleoid subclades in molecular phylogenies. This comparison clearly indicates that the new records detailed here will challenge some estimated divergence times of coleoid cephalopod subclades.

  10. New Eocene Coleoid (Cephalopoda) Diversity from Statolith Remains: Taxonomic Assignation, Fossil Record Analysis, and New Data for Calibrating Molecular Phylogenies.

    Science.gov (United States)

    Neige, Pascal; Lapierre, Hervé; Merle, Didier

    2016-01-01

    New coleoid cephalopods are described from statolith remains from the Middle Eocene (Middle Lutetian) of the Paris Basin. Fifteen fossil statoliths are identified and assigned to the Sepiidae (Sepia boletzkyi sp. nov.,? Sepia pira sp. nov.), Loliginidae (Loligo clarkei sp. nov.), and Ommastrephidae (genus indet.) families. The sediments containing these fossils indicate permanent aquatic settings in the infralittoral domain. These sediments range in age from 46 Mya to 43 Mya. Analysis of the fossil record of statoliths (from findings described here, together with a review of previously published data) indicates marked biases in our knowledge. Fossil statoliths are known from as far back as the Early Jurassic (199.3 to 190.8 Mya) but surprisingly, to the best of our knowledge, no record occurs in the Cretaceous. This is a "knowledge bias" and clearly calls for further studies. Finally, we attempt to compare findings described here with fossils previously used to constrain divergence and/or diversification ages of some coleoid subclades in molecular phylogenies. This comparison clearly indicates that the new records detailed here will challenge some estimated divergence times of coleoid cephalopod subclades.

  11. Molecular Analysis of the Diversity of Sulfate-Reducing and Sulfur-Oxidizing Prokaryotes in the Environment, Using aprA as Functional Marker Gene▿ †

    Science.gov (United States)

    Meyer, Birte; Kuever, Jan

    2007-01-01

    The dissimilatory adenosine-5′-phosposulfate reductase is a key enzyme of the microbial sulfate reduction and sulfur oxidation processes. Because the alpha- and beta-subunit-encoding genes, aprBA, are highly conserved among sulfate-reducing and sulfur-oxidizing prokaryotes, they are most suitable for molecular profiling of the microbial community structure of the sulfur cycle in environment. In this study, a new aprA gene-targeting assay using a combination of PCR and denaturing gradient gel electrophoresis is presented. The screening of sulfate-reducing and sulfur-oxidizing reference strains as well as the analyses of environmental DNA from diverse habitats (e.g., microbial mats, invertebrate tissue, marine and estuarine sediments, and filtered hydrothermal water) by the new primer pair revealed an improved microbial diversity coverage and less-pronounced template-to-PCR product bias in direct comparison to those of the previously published primer set (B. Deplancke, K. R. Hristova, H. A. Oakley, V. J. McCracken, R. Aminov, R. I. Mackie, and H. R. Gaskins, Appl. Environ. Microbiol. 66:2166-2174, 2000). The concomitant molecular detection of sulfate-reducing and sulfur-oxidizing prokaryotes was confirmed. The new assay was applied in comparison with the 16S rRNA gene-based analysis to investigate the microbial diversity of the sulfur cycle in sediment, seawater, and manganese crust samples from four study sites in the area of the Lesser Antilles volcanic arc, Caribbean Sea (Caribflux project). The aprA gene-based approach revealed putative sulfur-oxidizing Alphaproteobacteria of chemolithoheterotrophic lifestyle to have been abundant in the nonhydrothermal sediment and water column. In contrast, the sulfur-based microbial community that inhabited the surface of the volcanic manganese crust was more complex, consisting predominantly of putative chemolithoautotrophic sulfur oxidizers of the Betaproteobacteria and Gammaproteobacteria. PMID:17921272

  12. Molecular analysis of the diversity of sulfate-reducing and sulfur-oxidizing prokaryotes in the environment, using aprA as functional marker gene.

    Science.gov (United States)

    Meyer, Birte; Kuever, Jan

    2007-12-01

    The dissimilatory adenosine-5'-phosphosulfate reductase is a key enzyme of the microbial sulfate reduction and sulfur oxidation processes. Because the alpha- and beta-subunit-encoding genes, aprBA, are highly conserved among sulfate-reducing and sulfur-oxidizing prokaryotes, they are most suitable for molecular profiling of the microbial community structure of the sulfur cycle in environment. In this study, a new aprA gene-targeting assay using a combination of PCR and denaturing gradient gel electrophoresis is presented. The screening of sulfate-reducing and sulfur-oxidizing reference strains as well as the analyses of environmental DNA from diverse habitats (e.g., microbial mats, invertebrate tissue, marine and estuarine sediments, and filtered hydrothermal water) by the new primer pair revealed an improved microbial diversity coverage and less-pronounced template-to-PCR product bias in direct comparison to those of the previously published primer set (B. Deplancke, K. R. Hristova, H. A. Oakley, V. J. McCracken, R. Aminov, R. I. Mackie, and H. R. Gaskins, Appl. Environ. Microbiol. 66:2166-2174, 2000). The concomitant molecular detection of sulfate-reducing and sulfur-oxidizing prokaryotes was confirmed. The new assay was applied in comparison with the 16S rRNA gene-based analysis to investigate the microbial diversity of the sulfur cycle in sediment, seawater, and manganese crust samples from four study sites in the area of the Lesser Antilles volcanic arc, Caribbean Sea (Caribflux project). The aprA gene-based approach revealed putative sulfur-oxidizing Alphaproteobacteria of chemolithoheterotrophic lifestyle to have been abundant in the nonhydrothermal sediment and water column. In contrast, the sulfur-based microbial community that inhabited the surface of the volcanic manganese crust was more complex, consisting predominantly of putative chemolithoautotrophic sulfur oxidizers of the Betaproteobacteria and Gammaproteobacteria.

  13. Assessing Date Palm Genetic Diversity Using Different Molecular Markers.

    Science.gov (United States)

    Atia, Mohamed A M; Sakr, Mahmoud M; Adawy, Sami S

    2017-01-01

    Molecular marker technologies which rely on DNA analysis provide powerful tools to assess biodiversity at different levels, i.e., among and within species. A range of different molecular marker techniques have been developed and extensively applied for detecting variability in date palm at the DNA level. Recently, the employment of gene-targeting molecular marker approaches to study biodiversity and genetic variations in many plant species has increased the attention of researchers interested in date palm to carry out phylogenetic studies using these novel marker systems. Molecular markers are good indicators of genetic distances among accessions, because DNA-based markers are neutral in the face of selection. Here we describe the employment of multidisciplinary molecular marker approaches: amplified fragment length polymorphism (AFLP), start codon targeted (SCoT) polymorphism, conserved DNA-derived polymorphism (CDDP), intron-targeted amplified polymorphism (ITAP), simple sequence repeats (SSR), and random amplified polymorphic DNA (RAPD) to assess genetic diversity in date palm.

  14. Phylogenetic analysis, genetic diversity and relationships between the recently segregated species of Corynandra and Cleoserrata from the genus Cleome using DNA barcoding and molecular markers.

    Science.gov (United States)

    Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Gholave, Avinash Ramchandra; Kadam, Suhas Kishor; Kotibhaskar, Shreya Vijaykumar; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

    2016-01-01

    Cleome is the largest genus in the family Cleomaceae and it is known for its various medicinal properties. Recently, some species from the Cleome genus (Cleome viscosa, Cleome chelidonii, Cleome felina and Cleome speciosa) are split into genera Corynandra (Corynandra viscosa, Corynandra chelidonii, Corynandra felina), and Cleoserrata (Cleoserrata speciosa). The objective of this study was to obtain DNA barcodes for these species for their accurate identification and determining phylogenetic relationships. Out of 10 screened barcoding regions, rbcL, matK and ITS1 regions showed higher PCR efficiency and sequencing success. This study added matK, rbcL and ITS1 barcodes for the identification of Corynandra chelidonii, Corynandra felina, Cleome simplicifolia and Cleome aspera species in existing barcode data. Corynandra chelidonii and Corynandra felina species belong to the Corynandra genus, but they are not grouped with the Corynandra viscosa species, however clustered with the Cleome species. Molecular marker analysis showed 100% polymorphism among the studied plant samples. Diversity indices for molecular markers were ranged from He=0.1115-0.1714 and I=0.2268-0.2700, which indicates a significant amount of genetic diversity among studied species. Discrimination of the Cleome and Corynandra species from Cleoserrata speciosa was obtained by two RAPD primers (OPA-4 and RAPD-17) and two ISSR primers (ISSR-1 and ISSR-2). RAPD and ISSR markers are useful for the genetic characterization of these studied species. The present investigation will be helpful to understand the relationships of Cleome lineages with Corynandra and Cleoserrata species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  15. Molecular and morphological analysis of the critically endangered Fijian iguanas reveals cryptic diversity and a complex biogeographic history.

    Science.gov (United States)

    Keogh, J Scott; Edwards, Danielle L; Fisher, Robert N; Harlow, Peter S

    2008-10-27

    The Pacific iguanas of the Fijian and Tongan archipelagos are a biogeographic enigma in that their closest relatives are found only in the New World. They currently comprise two genera and four species of extinct and extant taxa. The two extant species, Brachylophus fasciatus from Fiji, Tonga, and Vanuatu and Brachylophus vitiensis from western Fiji, are of considerable conservation concern with B. vitiensis listed as critically endangered. A recent molecular study has shown that Brachylophus comprised three evolutionarily significant units. To test these conclusions and to reevaluate the phylogenetic and biogeographic relationships within Brachylophus, we generated an mtDNA dataset consisting of 1462 base pairs for 61 individuals from 13 islands, representing both Brachylophus species. Unweighted parsimony analyses and Bayesian analyses produced a well-resolved phylogenetic hypothesis supported by high bootstrap values and posterior probabilities within Brachylophus. Our data reject the monophyly of specimens previously believed to comprise B. fasciatus. Instead, our data demonstrate that living Brachylophus comprise three robust and well-supported clades that do not correspond to current taxonomy. One of these clades comprises B. fasciatus from the Lau group of Fiji and Tonga (type locality for B. fasciatus), while a second comprises putative B. fasciatus from the central regions of Fiji, which we refer to here as B. n. sp. Animals in this clade form the sister group to B. vitiensis rather than other B. fasciatus. We herein describe this clade as a new species of Brachylophus based on molecular and morphological data. With only one exception, every island is home to one or more unique haplotypes. We discuss alternative biogeographic hypotheses to explain their distribution in the Pacific and the difficulties of distinguishing these. Together, our molecular and taxonomic results have important implications for future conservation initiatives for the Pacific

  16. Molecular and morphological analysis of the critically endangered Fijian iguanas reveals cryptic diversity and a complex biogeographic history

    Science.gov (United States)

    Keogh, J.S.; Edwards, D.L.; Fisher, R.N.; Harlow, P.S.

    2008-01-01

    The Pacific iguanas of the Fijian and Tongan archipelagos are a biogeographic enigma in that their closest relatives are found only in the New World. They currently comprise two genera and four species of extinct and extant taxa. The two extant species, Brachylophus fasciatus from Fiji, Tonga, and Vanuatu and Brachylophus vitiensis from western Fiji, are of considerable conservation concern with B. vitiensis listed as critically endangered. A recent molecular study has shown that Brachylophus comprised three evolutionarily significant units. To test these conclusions and to reevaluate the phylogenetic and biogeographic relationships within Brachylophus, we generated an mtDNA dataset consisting of 1462 base pairs for 61 individuals from 13 islands, representing both Brachylophus species. Unweighted parsimony analyses and Bayesian analyses produced a well-resolved phylogenetic hypothesis supported by high bootstrap values and posterior probabilities within Brachylophus. Our data reject the monophyly of specimens previously believed to comprise B. fasciatus. Instead, our data demonstrate that living Brachylophus comprise three robust and well-supported clades that do not correspond to current taxonomy. One of these clades comprises B. fasciatus from the Lau group of Fiji and Tonga (type locality for B. fasciatus), while a second comprises putative B. fasciatus from the central regions of Fiji, which we refer to here as B. n. sp. Animals in this clade form the sister group to B. vitiensis rather than other B. fasciatus. We herein describe this clade as a new species of Brachylophus based on molecular and morphological data. With only one exception, every island is home to one or more unique haplotypes. We discuss alternative biogeographic hypotheses to explain their distribution in the Pacific and the difficulties of distinguishing these. Together, our molecular and taxonomic results have important implications for future conservation initiatives for the Pacific

  17. Molecular and morphological diversity of pezizalean ectomycorrhiza

    DEFF Research Database (Denmark)

    Tedersoo, Leho; Hansen, Karen; Perry, Brian A

    2006-01-01

    A growing body of molecular research is discovering a high diversity of pezizalean ectomycorrhiza (EcM), yet most remain unidentified at the genus or species level. This study describes EcM-forming taxa within the Pezizales. EcM-forming Pezizales were revealed by morphotyping and sequencing of EcM...... root tips from forests in Estonia and Denmark. The taxa on EcM root tips were identified using phylogenetic analyses of large-subunit rDNA sequences derived from sporocarps of 301 pezizalean species, and comparisons with internal transcribed spacer rDNA sequences. Thirty-three species are suggested...... as EcM symbionts, representing all three major clades of Pezizales, the genera Genea, Geopora, Humaria, Tarzetta, Trichophaea, Wilcoxina, Helvella, Hydnotrya, Tuber, Pachyphloeus, Peziza and Sarcosphaera, and two Pezizaceae anamorphs. EcM of Pezizales species are easily distinguished by their anatomy...

  18. Molecular analysis reveals the diversity of Hepatozoon species naturally infecting domestic dogs in a northern region of Brazil.

    Science.gov (United States)

    Gomes, Laise de Azevedo; Moraes, Pablo Henrique Gonçalves; do Nascimento, Luciana de Cássia Silva; O'Dwyer, Lucia Helena; Nunes, Márcio Roberto Teixeira; Rossi, Adriana Dos Reis Ponce; Aguiar, Délia Cristina Figueira; Gonçalves, Evonnildo Costa

    2016-10-01

    This study aimed to optimize molecular methods for detecting DNA of Hepatozoon spp. as well as identify the phylogenetic relationships of Hepatozoon strains naturally infecting domestic dogs in Belém, Pará, northern Brazil. Blood samples were collected from 138 dogs, and screened for Hepatozoon spp. using a new nested PCR assay. Positive samples were subjected to genetic characterization based on amplification and sequencing of approximately 670bp of the Hepatozoon spp. 18S rRNA. Of the positive dogs, four shared the haplotype Belém 01, one dog presented the haplotype Belém 02 and two dogs shared the haplotype Belém 03. A Bayesian inference indicates that haplotypes Belém 01 and Belém 02 are phylogenetically related to H. canis, while Belém 03 is related to H. americanum. Overall, based on the first molecular evidence of H. americanum in Brazilian domestic dogs, the proposed protocol may improve the epidemiological investigation of canine hepatozoonosis. Copyright © 2016 Elsevier GmbH. All rights reserved.

  19. Molecular research on the genetic diversity of Tunisian date palm ...

    African Journals Online (AJOL)

    Molecular research on the genetic diversity of Tunisian date palm ( Phoenix dactylifera L.) using the random amplified microsatellite polymorphism (RAMPO) and amplified fragment length polymorphism (AFLP) methods.

  20. Molecular Diversity Analysis of Two in vitro and Irradiated Potato Varieties Expressed by Random Amplified Polymorphic DNA

    Directory of Open Access Journals (Sweden)

    Ayman El-FIKI

    2018-03-01

    Full Text Available Potato buds cvs. ҅Valor’ and ‘Spunta’ were cultured in vitro on MS solid medium with 0.2 mg -1 BAP. The resulting plantlets were irradiated with gamma radiation doses 10, 20, 30, 40 and 50 Gy. Irradiated segments were transferred onto fresh MS with BAP and plantlets survival percentage was calculated after eight weeks. Gamma radiation caused the death of 3.8% to 81% in cv. ҅Spunta’ and 2.9% to 83.9% in cv. ҅Valor’. Microtubers produced from irradiated plantlets were decreased with increasing gamma radiation doses, with notable changes in shape, size and numbers. The proline contents in irradiated plantlets were steady increase with gamma radiation doses. The genomic DNA of the two cultivars and ten radiation treatments was amplified with 10 RAPD primers that generated 53 polymorphic bands. The highest number of genetic identity was 0.9672 showed between irradiated plantlets with 20 and 30 Gy in cv. ҅Valor’. However, the highest genetic distance was 0.3995 observed between irradiated plantlets with dose 20 Gy in cv. ҅Valor’ and 30 Gy in cv. ҅Spunta’. The dendrogram generated by cluster analysis distinguished the irradiated plantlets genetically.

  1. A Brief Review of Molecular Techniques to Assess Plant Diversity

    Directory of Open Access Journals (Sweden)

    Ibrahim A. Arif

    2010-05-01

    Full Text Available Massive loss of valuable plant species in the past centuries and its adverse impact on environmental and socioeconomic values has triggered the conservation of plant resources. Appropriate identification and characterization of plant materials is essential for the successful conservation of plant resources and to ensure their sustainable use. Molecular tools developed in the past few years provide easy, less laborious means for assigning known and unknown plant taxa. These techniques answer many new evolutionary and taxonomic questions, which were not previously possible with only phenotypic methods. Molecular techniques such as DNA barcoding, random amplified polymorphic DNA (RAPD, amplified fragment length polymorphism (AFLP, microsatellites and single nucleotide polymorphisms (SNP have recently been used for plant diversity studies. Each technique has its own advantages and limitations. These techniques differ in their resolving power to detect genetic differences, type of data they generate and their applicability to particular taxonomic levels. This review presents a basic description of different molecular techniques that can be utilized for DNA fingerprinting and molecular diversity analysis of plant species.

  2. A Brief Review of Molecular Techniques to Assess Plant Diversity

    Science.gov (United States)

    Arif, Ibrahim A.; Bakir, Mohammad A.; Khan, Haseeb A.; Al Farhan, Ahmad H.; Al Homaidan, Ali A.; Bahkali, Ali H.; Sadoon, Mohammad Al; Shobrak, Mohammad

    2010-01-01

    Massive loss of valuable plant species in the past centuries and its adverse impact on environmental and socioeconomic values has triggered the conservation of plant resources. Appropriate identification and characterization of plant materials is essential for the successful conservation of plant resources and to ensure their sustainable use. Molecular tools developed in the past few years provide easy, less laborious means for assigning known and unknown plant taxa. These techniques answer many new evolutionary and taxonomic questions, which were not previously possible with only phenotypic methods. Molecular techniques such as DNA barcoding, random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), microsatellites and single nucleotide polymorphisms (SNP) have recently been used for plant diversity studies. Each technique has its own advantages and limitations. These techniques differ in their resolving power to detect genetic differences, type of data they generate and their applicability to particular taxonomic levels. This review presents a basic description of different molecular techniques that can be utilized for DNA fingerprinting and molecular diversity analysis of plant species. PMID:20559503

  3. Molecular diversity among seven Solanum (eggplant and relatives ...

    African Journals Online (AJOL)

    Admin

    2012-11-08

    Nov 8, 2012 ... Seven Solanum species (eggplants) were investigated for molecular diversity. Besides its ... Eggplant comprises three closely related cultivated species .... generated with SSR data was submitted to 2-way Mantel test (Man-.

  4. Molecular characterization of genetic diversity in some durum wheat ...

    African Journals Online (AJOL)

    Molecular characterization of genetic diversity in some durum wheat ... African Journal of Biotechnology ... Thus, RAPD offer a potentially simple, rapid and reliable method to evaluate genetic variation and relatedness among ten wheat ...

  5. integrating phenotypic evaluations with a molecular diversity ...

    African Journals Online (AJOL)

    JS TENYWA

    2018-05-25

    May 25, 2018 ... 7Department of Plant Sciences / MS1, 1 Shields Avenue, University of California, Davis, USA. Corresponding ... secondary centers of diversity of this species. Hence, this ... Mesoamerican gene pools after introduction of common bean germplasm in Ethiopia. ..... the two gene pools of origin, as evidenced by.

  6. Phylogeography and molecular diversity analysis of Jatropha curcas L. and the dispersal route revealed by RAPD, AFLP and nrDNA-ITS analysis

    KAUST Repository

    Sudheer Pamidimarri, D. V N; Reddy, Muppala P.

    2014-01-01

    . The molecular evidence supports the Burkill et al. (A dictionary of the economic products of the Malay Peninsula, Governments of Malaysia and Singapore by the Ministry of Agriculture and Co-operatives. Kuala Lumpur, Malaysia, 1966) view of Portuguese might have

  7. Molecular and pomological diversity among pomegranate (Punica ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-02

    May 2, 2008 ... and wine (Poyrazoğlu et al., 2002). Although the ... a* and b* values were used to compute values for hue angle (a = tan-1b*/a*) and ... at –80°C. High molecular weight genomic DNA was extracted from the leaf samples ...

  8. Practicality of diversion path analysis

    International Nuclear Information System (INIS)

    Murphey, W.M.; Schleter, J.C.

    1974-07-01

    One can define the safeguards system for nuclear material as the set of all protective actions taken to prevent or to deter attempts to divert nuclear material to unauthorized use. Maintenance of effective safeguards requires a program for routine assessment of plant safeguards systems in terms of their capabilities to satisfy safeguards aims. Plant internal control systems provide capabilities for detection of unprevented diversion and can provide assurance that diversion has not occurred. A procedure called Diversion Path Analysis (DPA) enables routine assessment of the capabilities of internal control systems in this regard and identification of safeguards problem areas in a plant. A framework for safeguards system design is also provided which will allow flexibility to accommodate individual plant circumstances while maintaining acceptable diversion detection capability. The steps of the procedure are described and the practicality of the analytical method is shown by referring to a demonstration test for a high throughput process where plant personnel were major participants. The boundary conditions for the demonstration case are given, along with some conclusions about the general procedure. (U.S.)

  9. Convergent molecular defects underpin diverse neurodegenerative diseases.

    Science.gov (United States)

    Tofaris, George K; Buckley, Noel J

    2018-02-19

    In our ageing population, neurodegenerative disorders carry an enormous personal, societal and economic burden. Although neurodegenerative diseases are often thought of as clinicopathological entities, increasing evidence suggests a considerable overlap in the molecular underpinnings of their pathogenesis. Such overlapping biological processes include the handling of misfolded proteins, defective organelle trafficking, RNA processing, synaptic health and neuroinflammation. Collectively but in different proportions, these biological processes in neurons or non-neuronal cells lead to regionally distinct patterns of neuronal vulnerability and progression of pathology that could explain the disease symptomology. With the advent of patient-derived cellular models and novel genetic manipulation tools, we are now able to interrogate this commonality despite the cellular complexity of the brain in order to develop novel therapeutic strategies to prevent or arrest neurodegeneration. Here, we describe broadly these concepts and their relevance across neurodegenerative diseases. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  10. Molecular markers: a potential resource for ginger genetic diversity studies.

    Science.gov (United States)

    Ismail, Nor Asiah; Rafii, M Y; Mahmud, T M M; Hanafi, M M; Miah, Gous

    2016-12-01

    Ginger is an economically important and valuable plant around the world. Ginger is used as a food, spice, condiment, medicine and ornament. There is available information on biochemical aspects of ginger, but few studies have been reported on its molecular aspects. The main objective of this review is to accumulate the available molecular marker information and its application in diverse ginger studies. This review article was prepared by combing material from published articles and our own research. Molecular markers allow the identification and characterization of plant genotypes through direct access to hereditary material. In crop species, molecular markers are applied in different aspects and are useful in breeding programs. In ginger, molecular markers are commonly used to identify genetic variation and classify the relatedness among varieties, accessions, and species. Consequently, it provides important input in determining resourceful management strategies for ginger improvement programs. Alternatively, a molecular marker could function as a harmonizing tool for documenting species. This review highlights the application of molecular markers (isozyme, RAPD, AFLP, SSR, ISSR and others such as RFLP, SCAR, NBS and SNP) in genetic diversity studies of ginger species. Some insights on the advantages of the markers are discussed. The detection of genetic variation among promising cultivars of ginger has significance for ginger improvement programs. This update of recent literature will help researchers and students select the appropriate molecular markers for ginger-related research.

  11. Supplementary data: Molecular assessment of genetic diversity in ...

    Indian Academy of Sciences (India)

    Molecular assessment of genetic diversity in cluster bean. (Cyamopsis tetragonoloba) genotypes. Rakesh Pathak, S. K. Singh, Manjit Singh and A. Henry. J. Genet. 89, 243–246. Figure 1. RAPD profile of 1–16 Cyamopsis tetragonoloba genotypes amplified with arbitrary primer OPA-16. Figure 2. RAPD profile of 17–32 ...

  12. Molecular evaluation of genetic diversity and association studies in ...

    Indian Academy of Sciences (India)

    Molecular evaluation of genetic diversity and association studies in rice. (Oryza sativa L.) C. Vanniarajan, K. K. Vinod and Andy Pereira. J. Genet. 91, 9–19. Table 1. Chromosome-wise distribution of SSR alleles and their number (k), polymorphic information content (PIC) and allele discrimination index (Dm). Chromosome.

  13. Molecular diversity among wild relatives of Cajanus cajan (L.) Millsp ...

    African Journals Online (AJOL)

    In the present study, four wild relatives of pigeonpea were evaluated using 24 simple sequence repeat (SSR) markers to assess their genetic diversity at molecular level. Each marker, on average, amplified 3.3 alleles with polymorphic information content (PIC) value of 0.53. The dendrogram pattern revealed two distinct ...

  14. Prospects of molecular markers in Fusarium species diversity

    DEFF Research Database (Denmark)

    Nayaka, S. Chandra; Wulff, Ednar Gadelha; Udayashankar, A.C.

    2011-01-01

    focuses of various molecular-based techniques employed to study the diversity of Fusarium species causing diseases in major food crops. An introduction of fusarial diseases and their mycotoxins and molecular-marker-based methods for detection introduce the concept of marker application. Various well...... for generation of probes and their use in phylogeny of Fusarium spp. are also presented. The concluding part emphasizes the value of molecular markers for assessing genetic variability and reveals that molecular tools are indispensable for providing information not only of one Fusarium species but on whole......-known molecular techniques such as random amplified polymorphic DNA, amplification fragment length polymorphism, etc. to more modern ones such as DNA microarrays, DNA barcoding, and pyrosequencing and their application form the core of the review. Target regions in the genome which can be potential candidates...

  15. Molecular analysis of thymoma.

    Directory of Open Access Journals (Sweden)

    Sunil Badve

    Full Text Available Histologic classification of thymomas has significant limitations with respect to both subtype definitions and consistency. In order to better understand the biology of the disease processes, we performed whole genome gene expression analysis. RNA was extracted from fresh frozen tumors from 34 patients with thymomas and followup data was available. Using the Illumina BeadStudio® platform and Human Ref-8 Beadchip, gene expression data was analyzed with Partek Genomics Suite®, and Ingenuity Pathways Analysis (IPA. Unsupervised clustering of gene expression data, representing one of the largest series in literature, resulted in identification of four molecular clusters of tumors (C1-C4, which correlated with histology (P = 0.002. However, neither histology nor clusters correlated with clinical outcomes. Correlation of gene expression data with clinical data showed that a number of genes were associated with either advanced stage at diagnosis or development of recurrence or metastases. The top pathways associated with metastases were amino acid metabolisms, biosynthesis of steroids and glycosphingolipids, cell cycle checkpoint proteins and Notch signaling. The differential expression of some of the top genes related to both metastases and stage was confirmed by RT-PCR in all cases of metastases and matched nonmetastatic cases. A number of potential candidates for therapeutics were also identified.

  16. Molecular diversity and tools for deciphering the methanogen community structure and diversity in freshwater sediments.

    Science.gov (United States)

    Chaudhary, Prem Prashant; Brablcová, Lenka; Buriánková, Iva; Rulík, Martin

    2013-09-01

    Methanogenic archaeal communities existing in freshwater sediments are responsible for approximately 50 % of the total global emission of methane. This process contributes significantly to global warming and, hence, necessitates interventional control measures to limit its emission. Unfortunately, the diversity and functional interactions of methanogenic populations occurring in these habitats are yet to be fully characterized. Considering several disadvantages of conventional culture-based methodologies, in recent years, impetus is given to molecular biology approaches to determine the community structure of freshwater sedimentary methanogenic archaea. 16S rRNA and methyl coenzyme M reductase (mcrA) gene-based cloning techniques are the first choice for this purpose. In addition, electrophoresis-based (denaturing gradient gel electrophoresis, temperature gradient gel electrophoresis, and terminal restriction fragment length polymorphism) and quantitative real-time polymerase chain reaction techniques have also found extensive applications. These techniques are highly sensitive, rapid, and reliable as compared to traditional culture-dependent approaches. Molecular diversity studies revealed the dominance of the orders Methanomicrobiales and Methanosarcinales of methanogens in freshwater sediments. The present review discusses in detail the status of the diversity of methanogens and the molecular approaches applied in this area of research.

  17. Molecular analysis of the bacterial diversity in a specialized consortium for diesel oil degradation Análise molecular da diversidade bacteriana de um consórcio degradador de óleo diesel

    Directory of Open Access Journals (Sweden)

    Douglas Antonio Alvaredo Paixão

    2010-06-01

    Full Text Available Diesel oil is a compound derived from petroleum, consisting primarily of hydrocarbons. Poor conditions in transportation and storage of this product can contribute significantly to accidental spills causing serious ecological problems in soil and water and affecting the diversity of the microbial environment. The cloning and sequencing of the 16S rRNA gene is one of the molecular techniques that allows estimation and comparison of the microbial diversity in different environmental samples. The aim of this work was to estimate the diversity of microorganisms from the Bacteria domain in a consortium specialized in diesel oil degradation through partial sequencing of the 16S rRNA gene. After the extraction of DNA metagenomics, the material was amplified by PCR reaction using specific oligonucleotide primers for the 16S rRNA gene. The PCR products were cloned into a pGEM-T-Easy vector (Promega, and Escherichia coli was used as the host cell for recombinant DNAs. The partial clone sequencing was obtained using universal oligonucleotide primers from the vector. The genetic library obtained generated 431 clones. All the sequenced clones presented similarity to phylum Proteobacteria, with Gammaproteobacteria the most present group (49.8 % of the clones, followed by Alphaproteobacteira (44.8 % and Betaproteobacteria (5.4 %. The Pseudomonas genus was the most abundant in the metagenomic library, followed by the Parvibaculum and the Sphingobium genus, respectively. After partial sequencing of the 16S rRNA, the diversity of the bacterial consortium was estimated using DOTUR software. When comparing these sequences to the database from the National Center for Biotechnology Information (NCBI, a strong correlation was found between the data generated by the software used and the data deposited in NCBI.O óleo diesel é um composto derivado do petróleo, constituído basicamente por hidrocarbonetos. Condições precárias no processo de transporte e armazenagem

  18. Molecular genetic diversity study of Lepidium sativum population ...

    African Journals Online (AJOL)

    Vostro 2520

    Generally, Tigray and Amhara regions showed moderate to high diversity in ISSR analysis. ... other crops. The main purpose of its cultivation in. Ethiopia is to use it as a medicinal plant. It is used for human abdominal ache and diarrhea. Moreover, L. ... of 10 primers were obtained from the Genetic Research Laboratory.

  19. Fusarium diversity in soil using a specific molecular approach and a cultural approach.

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Mounier, Arnaud; Steinberg, Christian

    2015-04-01

    Fusarium species are ubiquitous in soil. They cause plant and human diseases and can produce mycotoxins. Surveys of Fusarium species diversity in environmental samples usually rely on laborious culture-based methods. In the present study, we have developed a molecular method to analyze Fusarium diversity directly from soil DNA. We designed primers targeting the translation elongation factor 1-alpha (EF-1α) gene and demonstrated their specificity toward Fusarium using a large collection of fungi. We used the specific primers to construct a clone library from three contrasting soils. Sequence analysis confirmed the specificity of the assay, with 750 clones identified as Fusarium and distributed among eight species or species complexes. The Fusarium oxysporum species complex (FOSC) was the most abundant one in the three soils, followed by the Fusarium solani species complex (FSSC). We then compared our molecular approach results with those obtained by isolating Fusarium colonies on two culture media and identifying species by sequencing part of the EF-1α gene. The 750 isolates were distributed into eight species or species complexes, with the same dominant species as with the cloning method. Sequence diversity was much higher in the clone library than in the isolate collection. The molecular approach proved to be a valuable tool to assess Fusarium diversity in environmental samples. Combined with high throughput sequencing, it will allow for in-depth analysis of large numbers of samples. Published by Elsevier B.V.

  20. Phenotypic and molecular evaluation of genetic diversity of rapeseed

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-05

    Oct 5, 2009 ... seed yield per plant, 1000-seed weight, oil content and protein content) were analyzed in a three-year ... regard to many characters of value for breeding process. (Cowling ..... tances determined by molecular markers and heterosis ..... Comparative analysis of cultivated melon groups (Cucumis melo L.).

  1. Diversion Path Analysis Handbook. Volume 1. Methodology

    International Nuclear Information System (INIS)

    Goodwin, K.E.; Schleter, J.C.; Maltese, M.D.K.

    1978-11-01

    Diversion Path Analysis (DPA) is a safeguards evaluation tool which is used to determine the vulnerability of the Material Control and Material Accounting (MC and MA) Subsystems to the threat of theft of Special Nuclear Material (SNM) by a knowledgeable Insider. The DPA team should consist of two individuals who have technical backgrounds. The implementation of DPA is divided into five basic steps: Information and Data Gathering, Process Characterization, Analysis of Diversion Paths, Results and Findings, and Documentation

  2. Antipathy of Trichoderma against Sclerotium rolfsii Sacc.: Evaluation of Cell Wall-Degrading Enzymatic Activities and Molecular Diversity Analysis of Antagonists.

    Science.gov (United States)

    Hirpara, Darshna G; Gajera, Harsukh P; Hirpara, Hitesh Z; Golakiya, Balubhai A

    2017-01-01

    The fungus Trichoderma is a teleomorph of the Hypocrea genus and associated with biological control of plant diseases. The microscopic, biochemical, and molecular characterization of Trichoderma was carried out and evaluated for in vitro antagonistic activity against the fungal pathogen Sclerotium rolfsii causing stem rot disease in groundnut. In total, 11 isolates of Trichoderma were examined for antagonism at 6 and 12 days after inoculation (DAI). Out of 11, T. virens NBAII Tvs12 evidenced the highest (87.91%) growth inhibition of the test pathogen followed by T. koningii MTCC 796 (67.03%), T. viride NBAII Tv23 (63.74%), and T. harzianum NBAII Th1 (60.44%). Strong mycoparasitism was observed in the best antagonist Tvs12 strain during 6-12 DAI. The specific activity of cell wall-degrading enzymes - chitinase and β-1,3-glucanase - was positively correlated with growth inhibition of the test pathogen. In total, 18 simple sequence repeat (SSR) polymorphisms were reported to amplify 202 alleles across 11 Trichoderma isolates. The average polymorphism information content for SSR markers was found to be 0.80. The best antagonist Tvs 12 was identified with 7 unique SSR alleles amplified by 5 SSR markers. Clustering patterns of 11 Trichoderma strains showed the best antagonist T. virens NBAII Tvs 12 outgrouped with a minimum 3% similarity from the rest of Trichoderma. © 2017 S. Karger AG, Basel.

  3. DiversePathsJ: diverse shortest paths for bioimage analysis.

    Science.gov (United States)

    Uhlmann, Virginie; Haubold, Carsten; Hamprecht, Fred A; Unser, Michael

    2018-02-01

    We introduce a formulation for the general task of finding diverse shortest paths between two end-points. Our approach is not linked to a specific biological problem and can be applied to a large variety of images thanks to its generic implementation as a user-friendly ImageJ/Fiji plugin. It relies on the introduction of additional layers in a Viterbi path graph, which requires slight modifications to the standard Viterbi algorithm rules. This layered graph construction allows for the specification of various constraints imposing diversity between solutions. The software allows obtaining a collection of diverse shortest paths under some user-defined constraints through a convenient and user-friendly interface. It can be used alone or be integrated into larger image analysis pipelines. http://bigwww.epfl.ch/algorithms/diversepathsj. michael.unser@epfl.ch or fred.hamprecht@iwr.uni-heidelberg.de. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  4. Transcriptional profiling at whole population and single cell levels reveals somatosensory neuron molecular diversity

    Science.gov (United States)

    Chiu, Isaac M; Barrett, Lee B; Williams, Erika K; Strochlic, David E; Lee, Seungkyu; Weyer, Andy D; Lou, Shan; Bryman, Gregory S; Roberson, David P; Ghasemlou, Nader; Piccoli, Cara; Ahat, Ezgi; Wang, Victor; Cobos, Enrique J; Stucky, Cheryl L; Ma, Qiufu; Liberles, Stephen D; Woolf, Clifford J

    2014-01-01

    The somatosensory nervous system is critical for the organism's ability to respond to mechanical, thermal, and nociceptive stimuli. Somatosensory neurons are functionally and anatomically diverse but their molecular profiles are not well-defined. Here, we used transcriptional profiling to analyze the detailed molecular signatures of dorsal root ganglion (DRG) sensory neurons. We used two mouse reporter lines and surface IB4 labeling to purify three major non-overlapping classes of neurons: 1) IB4+SNS-Cre/TdTomato+, 2) IB4−SNS-Cre/TdTomato+, and 3) Parv-Cre/TdTomato+ cells, encompassing the majority of nociceptive, pruriceptive, and proprioceptive neurons. These neurons displayed distinct expression patterns of ion channels, transcription factors, and GPCRs. Highly parallel qRT-PCR analysis of 334 single neurons selected by membership of the three populations demonstrated further diversity, with unbiased clustering analysis identifying six distinct subgroups. These data significantly increase our knowledge of the molecular identities of known DRG populations and uncover potentially novel subsets, revealing the complexity and diversity of those neurons underlying somatosensation. DOI: http://dx.doi.org/10.7554/eLife.04660.001 PMID:25525749

  5. Functional Molecular Diversity of Marine Dissolved Organic Matter Is Reduced during Degradation

    Directory of Open Access Journals (Sweden)

    Andrea Mentges

    2017-06-01

    Full Text Available Dissolved organic matter (DOM is a highly diverse mixture of compounds, accounting for one of the world's largest active carbon pools. The surprising recalcitrance of some DOM compounds to bacterial degradation has recently been associated with its diversity. However, little is known about large-scale patterns of marine DOM diversity and its change through degradation, in particular considering the functional diversity of DOM. Here, we analyze the development of marine DOM diversity during degradation in two data sets comprising DOM of very different ages: a three-year mesocosm experiment and highly-resolved field samples from the Atlantic and Southern Ocean. The DOM molecular composition was determined using ultra-high resolution mass spectrometry. We quantify DOM diversity using three conceptually different diversity measures, namely richness of molecular formulas, abundance-based diversity, and functional molecular diversity. Using these measures we find stable molecular richness of DOM with age >1 year, systematic changes in the molecules' abundance distribution with degradation state, and increasing homogeneity with respect to chemical properties for more degraded DOM. Coinciding with differences in sea water density, the spatial field data separated clearly into regions of high and low diversity. The joint application of different diversity measures yields a comprehensive overview on temporal and spatial patterns of molecular diversity, valuable for general conclusions on drivers and consequences of marine DOM diversity.

  6. Historical distribution and molecular diversity of Bacillus anthracis, Kazakhstan.

    Science.gov (United States)

    Aikembayev, Alim M; Lukhnova, Larissa; Temiraliyeva, Gulnara; Meka-Mechenko, Tatyana; Pazylov, Yerlan; Zakaryan, Sarkis; Denissov, Georgiy; Easterday, W Ryan; Van Ert, Matthew N; Keim, Paul; Francesconi, Stephen C; Blackburn, Jason K; Hugh-Jones, Martin; Hadfield, Ted

    2010-05-01

    To map the distribution of anthrax outbreaks and strain subtypes in Kazakhstan during 1937-2005, we combined geographic information system technology and genetic analysis by using archived cultures and data. Biochemical and genetic tests confirmed the identity of 93 archived cultures in the Kazakhstan National Culture Collection as Bacillus anthracis. Multilocus variable number tandem repeat analysis genotyping identified 12 genotypes. Cluster analysis comparing these genotypes with previously published genotypes indicated that most (n = 78) isolates belonged to the previously described A1.a genetic cluster, 6 isolates belonged to the A3.b cluster, and 2 belonged to the A4 cluster. Two genotypes in the collection appeared to represent novel genetic sublineages; 1 of these isolates was from Krygystan. Our data provide a description of the historical, geographic, and genetic diversity of B. anthracis in this Central Asian region.

  7. Genetic diversity of dog breeds: within-breed diversity comparing genealogical and molecular data.

    Science.gov (United States)

    Leroy, G; Verrier, E; Meriaux, J C; Rognon, X

    2009-06-01

    The genetic diversity of 61 dog breeds raised in France was investigated. Genealogical analyses were performed on the pedigree file of the French kennel club. A total of 1514 dogs were also genotyped using 21 microsatellite markers. For animals born from 2001 to 2005, the average coefficient of inbreeding ranged from 0.2% to 8.8% and the effective number of ancestors ranged from 9 to 209, according to the breed. The mean value of heterozygosity was 0.62 over all breeds (range 0.37-0.77). At the breed level, few correlations were found between genealogical and molecular parameters. Kinship coefficients and individual similarity estimators were, however, significantly correlated, with the best mean correlation being found for the Lynch & Ritland estimator (r = 0.43). According to both approaches, it was concluded that special efforts should be made to maintain diversity for three breeds, namely the Berger des Pyrénées, Braque Saint-Germain and Bull Terrier.

  8. Molecular diversity of bovine viral diarrhea virus in uruguay.

    Science.gov (United States)

    Maya, L; Puentes, R; Reolón, E; Acuña, P; Riet, F; Rivero, R; Cristina, J; Colina, R

    2016-03-01

    Bovine viral diarrhea (BVD) affects bovine production and reproduction causing significant economic losses all over the world. Two viral species has been recognized: BVDV-1 and BVDV-2, both distributed worldwide. Recently, novel specie of BVDV named HoBi-like pestivirus was discovered. The presence of BVDV was confirmed in 1996 in Uruguay, however, does not exist until today a schedule of compulsory vaccination along the country. Serological studies with samples from all Uruguayan herds were performed during 2000 and 2001 demonstrating that all of them were seropositive to BVDV with a mean prevalence of 69%. In addition, there have been no new studies done since those previously described and it is important to mention that the genetic diversity of BVD has never been described in Uruguay. Nowadays, there is strongly suspect that BVDV is one of the most important causes of reproductive failures in our herds. The aim of this study was to describe for the first time in Uruguay the genetic diversity of BVDV with samples collected from different regions along the country. Serological status of 390 non-vaccinated animals against BVDV with reproductive problems from farms of Rivera, Tacuarembó and Florida departments of Uruguay were studied. All herds were seropositive to BVDV and high proportion of animals were positive (298/390), while 4.1% (16/390) of the animals were positive to Antigen Capture ELISA test and Real Time PCR. Phylogenetic analysis performed with concatenated sequences from the 5'UTR and Npro genomic regions revealed that BVDV-1 and BVDV-2 are infecting our herds, being BVDV-1 the most frequently found. The major subtype was BVDV-1a, followed by BVDV-1i and BVDV-2b. This is the first study that describes the genetic diversity of BVDV in Uruguay and it will contribute to the elaboration of sanitization programs.

  9. Molecular Insights into the Genetic Diversity of Garcinia cambogia Germplasm Accessions

    Directory of Open Access Journals (Sweden)

    C Tharachand

    2015-10-01

    Full Text Available ABSTRACTIn this work, the genetic relationship among twelveGarcinia cambogia (Gaertn. Desr. accessions were evaluated using Random Amplified Polymorphic DNA markers. The samples were part of the germplasm collected and maintained at NBPGR Regional station, Thrissur, India. Out of thirty RAPD primers used for screening, seven primers produced a total of 128 polymorphic markers in twelve accessions. The Polymorphic Information Content (PIC ranged from 0.28 (OPA18 to 0.37 (OPA9 and Marker Index (MI ranged between 3.61 (OPA12 and 5.93 (OPA3 among the primers used. Jaccard's coefficient of genetic similarity ranged between 0.07 and 0.64. The dendrogram constructed based on the similarity matrix generated from the molecular and morphological data showed the genetic relationship among the sampled accessions. Mantel matrix test showed a positive correlation (r = 0.49 between the cluster analysis of RAPD data and morphological data. The clustering pattern in the molecular dendrogram and Principle Coordinate Analysis (PCoA showed that the genotypes were diverse, which was in congruence with the similarity index values and morphological dendrogram. High frequency of similarity values in the range of 0.11 to 0.17 suggested the existence of high genetic diversity among the accessions. The high level of genetic diversity among the studied accessions ofG.cambogia was also supported by the large variation in the morphological characters observed in the flowers, leaves, fruits and seeds of these sampled accessions. This is the first report for the molecular based genetic diversity studies for these accessions.

  10. Microsatellite analysis of intracultivar diversity in 'Chinnarasam ...

    African Journals Online (AJOL)

    Their leaves were sampled to study intracultivar diversity following microsatellite analysis. The dendrogram generated based on unweighted pair group mean with arithmetic average, showed three major groups of accessions, which followed geographical separation. Twenty out of 109 mango-specific micro satellites ...

  11. SSR Analysis of Genetic Diversity Among 192 Diploid Potato Cultivars

    Directory of Open Access Journals (Sweden)

    Xiaoyan Song

    2016-05-01

    Full Text Available In potato breeding, it is difficult to improve the traits of interest at the tetraploid level due to the tetrasomic inheritance. A promising alternative is diploid breeding. Thus it is necessary to assess the genetic diversity of diploid potato germplasm for efficient exploration and deployment of desirable traits. In this study, we used SSR markers to evaluate the genetic diversity of diploid potato cultivars. To screen polymorphic SSR markers, 55 pairs of SSR primers were employed to amplify 39 cultivars with relatively distant genetic relationships. Among them, 12 SSR markers with high polymorphism located at 12 chromosomes were chosen to evaluate the genetic diversity of 192 diploid potato cultivars. The primers produced 6 to 18 bands with an average of 8.2 bands per primer. In total, 98 bands were amplified from 192 cultivars, and 97 of them were polymorphic. Cluster analysis using UPGMA showed the genetic relationships of all accessions tested: 186 of the 192 accessions could be distinguished by only 12 pairs of SSR primers, and the 192 diploid cultivars were divided into 11 groups, and 83.3% constituted the first group. Clustering results showed relatively low genetic diversity among 192 diploid cultivars, with closer relationship at the molecular level. The results can provide molecular basis for diploid potato breeding.

  12. Biogeography and molecular diversity of coral symbionts in the genus Symbiodinium around the Arabian Peninsula

    KAUST Repository

    Ziegler, Maren; Arif, Chatchanit; Burt, John A.; Dobretsov, Sergey; Roder, Cornelia; Lajeunesse, Todd C.; Voolstra, Christian R.

    2017-01-01

    Aim: Coral reefs rely on the symbiosis between scleractinian corals and intracellular, photosynthetic dinoflagellates of the genus Symbiodinium making the assessment of symbiont diversity critical to our understanding of ecological resilience of these ecosystems. This study characterizes Symbiodinium diversity around the Arabian Peninsula, which contains some of the most thermally diverse and understudied reefs on Earth. Location: Shallow water coral reefs throughout the Red Sea (RS), Sea of Oman (SO), and Persian/Arabian Gulf (PAG). Methods: Next-generation sequencing of the ITS2 marker gene was used to assess Symbiodinium community composition and diversity comprising 892 samples from 46 hard and soft coral genera. Results: Corals were associated with a large diversity of Symbiodinium, which usually consisted of one or two prevalent symbiont types and many types at low abundance. Symbiodinium communities were strongly structured according to geographical region and to a lesser extent by coral host identity. Overall symbiont communities were composed primarily of species from clade A and C in the RS, clade A, C, and D in the SO, and clade C and D in the PAG, representing a gradual shift from C- to D-dominated coral hosts. The analysis of symbiont diversity in an Operational Taxonomic Unit (OTU)-based framework allowed the identification of differences in symbiont taxon richness over geographical regions and host genera. Main conclusions: Our study represents a comprehensive overview over biogeography and molecular diversity of Symbiodinium in the Arabian Seas, where coral reefs thrive in one of the most extreme environmental settings on the planet. As such our data will serve as a baseline for further exploration into the effects of environmental change on host-symbiont pairings and the identification and ecological significance of Symbiodinium types from regions already experiencing 'Future Ocean' conditions.

  13. Biogeography and molecular diversity of coral symbionts in the genus Symbiodinium around the Arabian Peninsula

    KAUST Repository

    Ziegler, Maren

    2017-01-02

    Aim: Coral reefs rely on the symbiosis between scleractinian corals and intracellular, photosynthetic dinoflagellates of the genus Symbiodinium making the assessment of symbiont diversity critical to our understanding of ecological resilience of these ecosystems. This study characterizes Symbiodinium diversity around the Arabian Peninsula, which contains some of the most thermally diverse and understudied reefs on Earth. Location: Shallow water coral reefs throughout the Red Sea (RS), Sea of Oman (SO), and Persian/Arabian Gulf (PAG). Methods: Next-generation sequencing of the ITS2 marker gene was used to assess Symbiodinium community composition and diversity comprising 892 samples from 46 hard and soft coral genera. Results: Corals were associated with a large diversity of Symbiodinium, which usually consisted of one or two prevalent symbiont types and many types at low abundance. Symbiodinium communities were strongly structured according to geographical region and to a lesser extent by coral host identity. Overall symbiont communities were composed primarily of species from clade A and C in the RS, clade A, C, and D in the SO, and clade C and D in the PAG, representing a gradual shift from C- to D-dominated coral hosts. The analysis of symbiont diversity in an Operational Taxonomic Unit (OTU)-based framework allowed the identification of differences in symbiont taxon richness over geographical regions and host genera. Main conclusions: Our study represents a comprehensive overview over biogeography and molecular diversity of Symbiodinium in the Arabian Seas, where coral reefs thrive in one of the most extreme environmental settings on the planet. As such our data will serve as a baseline for further exploration into the effects of environmental change on host-symbiont pairings and the identification and ecological significance of Symbiodinium types from regions already experiencing \\'Future Ocean\\' conditions.

  14. Microsatellite analysis of Saccharomyces uvarum diversity.

    Science.gov (United States)

    Masneuf-Pomarede, Isabelle; Salin, Franck; Börlin, Marine; Coton, Emmanuel; Coton, Monika; Jeune, Christine Le; Legras, Jean-Luc

    2016-03-01

    Considered as a sister species of Saccharomyces cerevisiae, S. uvarum is, to a lesser extent, an interesting species for fundamental and applied research studies. Despite its potential interest as a new gene pool for fermenting agents, the intraspecific molecular genetic diversity of this species is still poorly investigated. In this study, we report the use of nine microsatellite markers to describe S. uvarum genetic diversity and population structure among 108 isolates from various geographical and substrate origins (wine, cider and natural sources). Our combined microsatellite markers set allowed differentiating 89 genotypes. In contrast to S. cerevisiae genetic diversity, wild and human origin isolates were intertwined. A total of 75% of strains were proven to be homozygotes and estimated heterozygosity suggests a selfing rate above 0.95 for the different population tested here. From this point of view, the S. uvarum life cycle appears to be more closely related to S. paradoxus or S. cerevisiae of natural resources than S. cerevisiae wine isolates. Population structure could not be correlated to distinct geographic or technological origins, suggesting lower differentiation that may result from a large exchange between human and natural populations mediated by insects or human activities. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Conformation analysis of trehalose. Molecular dynamics simulation and molecular mechanics

    International Nuclear Information System (INIS)

    Donnamaira, M.C.; Howard, E.I.; Grigera, J.R.

    1992-09-01

    Conformational analysis of the disaccharide trehalose is done by molecular dynamics and molecular mechanics. In spite of the different force fields used in each case, comparison between the molecular dynamics trajectories of the torsional angles of glycosidic linkage and energy conformational map shows a good agreement between both methods. By molecular dynamics it is observed a moderate mobility of the glycosidic linkage. The demands of computer time is comparable in both cases. (author). 6 refs, 4 figs

  16. Molecular markers to assess genetic diversity and mutant identifications in Jatropha curcas

    International Nuclear Information System (INIS)

    Azhar Mohamad; Yie Min Kwan; Fatin Mastura Derani; Abdul Rahim Harun

    2010-01-01

    Jatropha curcas (Linnaeus) belongs to the Euphorbiaceae family, is a multipurpose use, drought resistant and perennial plant. It is an economic important crop, which generates wide interest in understanding the genetic diversity of the species towards selection and breeding of superior genotypes. Jatropha accessions are closely related family species. Thus, better understanding of the effectiveness of the different DNA-based markers is an important step towards plant germplasm characterization and evaluation. It is becoming a prerequisite for more effective application of marker techniques in breeding programs. Inter-simple sequence repeats (ISSRs) has shown rapid, simple, reproducible and inexpensive means in molecular taxonomy, conservation breeding and genetic diversity analysis. These markers were used to understand diversity and differentiate amongst accessions of Jatropha population and mutant lines generated by acute gamma radiation. The ISSR for marker applications are essential to facilitate management, conservation and genetic improvement programs towards improvement of bio-diesel production and medication substances. A total of 62 ISSR primers were optimized for polymorphism evaluations on five foreign accessions (Africa, India, Myanmar, Indonesia, Thailand), nine local accessions and two mutants of Jatropha. Optimization was resulted 54 ISSR primers affirmative for the polymorphism evaluation study, which encountered 12 ISSR primers, showed significance polymorphism amongst the accessions and mutants. Marker derived from ISSR profiling is a powerful method for identification and molecular classification of Jatropha from accession to generated mutant varieties. (author)

  17. Molecular genetic diversity in populations of the stingless bee Plebeia remota: A case study

    Directory of Open Access Journals (Sweden)

    Flávio de Oliveira Francisco

    2013-01-01

    Full Text Available Genetic diversity is a major component of the biological diversity of an ecosystem. The survival of a population may be seriously threatened if its genetic diversity values are low. In this work, we measured the genetic diversity of the stingless bee Plebeia remota based on molecular data obtained by analyzing 15 microsatellite loci and sequencing two mitochondrial genes. Population structure and genetic diversity differed depending on the molecular marker analyzed: microsatellites showed low population structure and moderate to high genetic diversity, while mitochondrial DNA (mtDNA showed high population structure and low diversity in three populations. Queen philopatry and male dispersal behavior are discussed as the main reasons for these findings.

  18. Molecular Insights into the Genetic Diversity of Hemarthria compressa Germplasm Collections Native to Southwest China

    Directory of Open Access Journals (Sweden)

    Zhi-Hui Guo

    2014-12-01

    Full Text Available Start codon targeted polymorphism (SCoT analysis was employed to distinguish 37 whipgrass (Hemarthria compressa L. clones and assess the genetic diversity and population structure among these genotypes. The informativeness of markers was also estimated using various parameters. Using 25 highly reproducible primer sets, 368 discernible fragments were generated. Of these, 282 (77.21% were polymorphic. The number of alleles per locus ranged from five to 21, and the genetic variation indices varied. The polymorphism information content (PIC was 0.358, the Shannon diversity index (H was 0.534, the marker index (MI was 4.040, the resolving power (RP was 6.108, and the genotype index (GI was 0.782. Genetic similarity coefficients (GS between the accessions ranged from 0.563 to 0.872, with a mean of 0.685. Their patterns observed in a dendrogram constructed using the unweighted pair group method with arithmetic mean analysis (UPGMA based on GS largely confirmed the results of principal coordinate analysis (PCoA. PCoA was further confirmed by Bayesian model-based STRUCTURE analysis, which revealed no direct association between genetic relationship and geographical origins as validated by Mantel’s test (r = 0.2268, p = 0.9999. In addition, high-level genetic variation within geographical groups was significantly greater than that between groups, as determined by Shannon diversity analysis, analysis of molecular variance (AMOVA and Bayesian analysis. Overall, SCoT analysis is a simple, effective and reliable technique for characterizing and maintaining germplasm collections of whipgrass and related species.

  19. Fragrance analysis using molecular and biochemical methods in ...

    African Journals Online (AJOL)

    For molecular and biochemical analysis of aroma, a mapping population comprising 208 recombinant inbred lines (RILs) derived from a diverse cross between CSR10 and Taraori Basmati through Single seed descent (SSD) method was used. RILs are among the best mapping populations, which provide a novel material ...

  20. Novel molecular markers of Chlamydia pecorum genetic diversity in the koala (Phascolarctos cinereus)

    Science.gov (United States)

    2011-01-01

    Background Chlamydia pecorum is an obligate intracellular bacterium and the causative agent of reproductive and ocular disease in several animal hosts including koalas, sheep, cattle and goats. C. pecorum strains detected in koalas are genetically diverse, raising interesting questions about the origin and transmission of this species within koala hosts. While the ompA gene remains the most widely-used target in C. pecorum typing studies, it is generally recognised that surface protein encoding genes are not suited for phylogenetic analysis and it is becoming increasingly apparent that the ompA gene locus is not congruent with the phylogeny of the C. pecorum genome. Using the recently sequenced C. pecorum genome sequence (E58), we analysed 10 genes, including ompA, to evaluate the use of ompA as a molecular marker in the study of koala C. pecorum genetic diversity. Results Three genes (incA, ORF663, tarP) were found to contain sufficient nucleotide diversity and discriminatory power for detailed analysis and were used, with ompA, to genotype 24 C. pecorum PCR-positive koala samples from four populations. The most robust representation of the phylogeny of these samples was achieved through concatenation of all four gene sequences, enabling the recreation of a "true" phylogenetic signal. OmpA and incA were of limited value as fine-detailed genetic markers as they were unable to confer accurate phylogenetic distinctions between samples. On the other hand, the tarP and ORF663 genes were identified as useful "neutral" and "contingency" markers respectively, to represent the broad evolutionary history and intra-species genetic diversity of koala C. pecorum. Furthermore, the concatenation of ompA, incA and ORF663 sequences highlighted the monophyletic nature of koala C. pecorum infections by demonstrating a single evolutionary trajectory for koala hosts that is distinct from that seen in non-koala hosts. Conclusions While the continued use of ompA as a fine

  1. Novel molecular markers of Chlamydia pecorum genetic diversity in the koala (Phascolarctos cinereus

    Directory of Open Access Journals (Sweden)

    Timms Peter

    2011-04-01

    Full Text Available Abstract Background Chlamydia pecorum is an obligate intracellular bacterium and the causative agent of reproductive and ocular disease in several animal hosts including koalas, sheep, cattle and goats. C. pecorum strains detected in koalas are genetically diverse, raising interesting questions about the origin and transmission of this species within koala hosts. While the ompA gene remains the most widely-used target in C. pecorum typing studies, it is generally recognised that surface protein encoding genes are not suited for phylogenetic analysis and it is becoming increasingly apparent that the ompA gene locus is not congruent with the phylogeny of the C. pecorum genome. Using the recently sequenced C. pecorum genome sequence (E58, we analysed 10 genes, including ompA, to evaluate the use of ompA as a molecular marker in the study of koala C. pecorum genetic diversity. Results Three genes (incA, ORF663, tarP were found to contain sufficient nucleotide diversity and discriminatory power for detailed analysis and were used, with ompA, to genotype 24 C. pecorum PCR-positive koala samples from four populations. The most robust representation of the phylogeny of these samples was achieved through concatenation of all four gene sequences, enabling the recreation of a "true" phylogenetic signal. OmpA and incA were of limited value as fine-detailed genetic markers as they were unable to confer accurate phylogenetic distinctions between samples. On the other hand, the tarP and ORF663 genes were identified as useful "neutral" and "contingency" markers respectively, to represent the broad evolutionary history and intra-species genetic diversity of koala C. pecorum. Furthermore, the concatenation of ompA, incA and ORF663 sequences highlighted the monophyletic nature of koala C. pecorum infections by demonstrating a single evolutionary trajectory for koala hosts that is distinct from that seen in non-koala hosts. Conclusions While the continued use of

  2. Genetic diversity analysis among male and female Jojoba genotypes employing gene targeted molecular markers, start codon targeted (SCoT) polymorphism and CAAT box-derived polymorphism (CBDP) markers.

    Science.gov (United States)

    Heikrujam, Monika; Kumar, Jatin; Agrawal, Veena

    2015-09-01

    To detect genetic variations among different Simmondsia chinensis genotypes, two gene targeted markers, start codon targeted (SCoT) polymorphism and CAAT box-derived polymorphism (CBDP) were employed in terms of their informativeness and efficiency in analyzing genetic relationships among different genotypes. A total of 15 SCoT and 17 CBDP primers detected genetic polymorphism among 39 Jojoba genotypes (22 females and 17 males). Comparatively, CBDP markers proved to be more effective than SCoT markers in terms of percentage polymorphism as the former detecting an average of 53.4% and the latter as 49.4%. The Polymorphic information content (PIC) value and marker index (MI) of CBPD were 0.43 and 1.10, respectively which were higher than those of SCoT where the respective values of PIC and MI were 0.38 and 1.09. While comparing male and female genotype populations, the former showed higher variation in respect of polymorphic percentage and PIC, MI and Rp values over female populations. Nei's diversity (h) and Shannon index (I) were calculated for each genotype and found that the genotype "MS F" (in both markers) was highly diverse and genotypes "Q104 F" (SCoT) and "82-18 F" (CBDP) were least diverse among the female genotype populations. Among male genotypes, "32 M" (CBDP) and "MS M" (SCoT) revealed highest h and I values while "58-5 M" (both markers) was the least diverse. Jaccard's similarity co-efficient of SCoT markers ranged from 0.733 to 0.922 in female genotypes and 0.941 to 0.746 in male genotype population. Likewise, CBDP data analysis also revealed similarity ranging from 0.751 to 0.958 within female genotypes and 0.754 to 0.976 within male genotype populations thereby, indicating genetically diverse Jojoba population. Employing the NTSYS (Numerical taxonomy and multivariate analysis system) Version 2.1 software, both the markers generated dendrograms which revealed that all the Jojoba genotypes were clustered into two major groups, one group consisting of

  3. Diversion path analysis handbook. Volume I. Methodology

    International Nuclear Information System (INIS)

    Maltese, M.D.K.; Goodwin, K.E.; Schleter, J.C.

    1976-10-01

    Diversion Path Analysis (DPA) is a procedure for analyzing internal controls of a facility in order to identify vulnerabilities to successful diversion of material by an adversary. The internal covert threat is addressed but the results are also applicable to the external overt threat. The diversion paths are identified. Complexity parameters include records alteration or falsification, multiple removals of sub-threshold quantities, collusion, and access authorization of the individual. Indicators, or data elements and information of significance to detection of unprevented theft, are identified by means of DPA. Indicator sensitivity is developed in terms of the threshold quantity, the elapsed time between removal and indication and the degree of localization of facility area and personnel given by the indicator. Evaluation of facility internal controls in light of these sensitivities defines the capability of interrupting identified adversary action sequences related to acquisition of material at fixed sites associated with the identified potential vulnerabilities. Corrective measures can, in many cases, also be prescribed for management consideration and action. DPA theory and concepts have been developing over the last several years, and initial field testing proved both the feasibility and practicality of the procedure. Follow-on implementation testing verified the ability of facility personnel to perform DPA

  4. Diversity in parasitic helminths of Australasian marsupials and monotremes: a molecular perspective.

    Science.gov (United States)

    Beveridge, Ian; Gasser, Robin B

    2014-10-15

    Marsupials and monotremes are a prominent part of the mammalian fauna in Australia, and harbour an extremely diverse and highly distinctive array of helminth parasites. Their study has been relatively neglected, likely because they have no direct, adverse socioeconomic impact. As the body plans of helminths generally are very simple and morphological characterisation likely underestimates true diversity, molecular tools have been employed to assess genetic diversity. Using biochemical and/or molecular methods, recent studies show extensive diversity in helminths of marsupials, with cryptic species being commonly encountered. The purpose of this article is to review current knowledge about the diversity of parasitic helminths of marsupials and monotremes, to raise questions as to whether current molecular data can be used to estimate diversity, what mechanisms lead to such diversity, to critically appraise the molecular tools that have been employed thus far to explore diversity and to discuss the directions which might be taken in the future employing improved techniques. Copyright © 2014 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  5. Molecular diversity among Turkish oaks (QUERCUS) using random ...

    African Journals Online (AJOL)

    aykut

    2013-11-06

    Nov 6, 2013 ... using random amplified polymorphic DNA (RAPD) ... 1Department of Molecular Biology and Genetics, Faculty of Science and Arts, Uşak University, 64200 Uşak, Turkey. ..... University Directorate of Scientific Research Projects.

  6. Molecular diversity analysis of Tetradium ruticarpum (WuZhuYu) in China based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers.

    Science.gov (United States)

    Xu, Jing-Yuan; Zhu, Yan; Yi, Ze; Wu, Gang; Xie, Guo-Yong; Qin, Min-Jian

    2018-01-01

    "Wu zhu yu", which is obtained from the dried unripe fruits of Tetradium ruticarpum (A. Jussieu) T. G. Hartley, has been used as a traditional Chinese medicine for treatment of headaches, abdominal colic, and hypertension for thousands of years. The present study was designed to assess the molecular genetic diversity among 25 collected accessions of T. ruticarpum (Wu zhu yu in Chinese) from different areas of China, based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers. Thirteen ISSR primers generated 151 amplification bands, of which 130 were polymorphic. Out of 165 bands that were amplified using 10 iPBS primers, 152 were polymorphic. The iPBS markers displayed a higher proportion of polymorphic loci (PPL = 92.5%) than the ISSR markers (PPL = 84.9%). The results showed that T. ruticarpum possessed high loci polymorphism and genetic differentiation occurred in this plant. The combined data of iPBS and ISSR markers scored on 25 accessions produced five clusters that approximately matched the geographic distribution of the species. The results indicated that both iPBS and ISSR markers were reliable and effective tools for analyzing the genetic diversity in T. ruticarpum. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  7. Genetic diversity and molecular characterization of physic nut ...

    African Journals Online (AJOL)

    ajl

    2013-02-27

    Feb 27, 2013 ... 2Department of Plant Science, Federal University of Viçosa, Viçosa, Minas Gerais, Brazil. ... primers were used to characterize toxicity alleles, and none of the accessions presented patterns ... accessions from India (Gupta et al., 2008; Gohil and. Pandya .... ISSR primers, generally low genetic diversity was.

  8. Molecular and functional diversity in Capsicum landraces of ...

    African Journals Online (AJOL)

    shrawan

    2013-09-25

    Sep 25, 2013 ... of diversity in the local germplasm was much needed to recognize the genetic .... reducing sugar and multiplying with a conversion factor (0.95). The absorbance for ..... Except SPG-3 which was outlier with 54% intra-cluster ...

  9. Molecular and functional diversity in Capsicum landraces of ...

    African Journals Online (AJOL)

    The present study analyzed the diversity in 26 landraces of Capsicum from Andaman Islands using 20 morphological, 16 biochemical and 10 DNA markers. Significant differences were observed in tested landraces and 16 reference genotypes from mainland India. Biochemical markers grouped all the genotypes into eight ...

  10. Molecular evaluation of genetic diversity and association studies in ...

    Indian Academy of Sciences (India)

    In the present study, we tested rice genotypes that included un(der)exploited landraces of Tamil Nadu along with indica and japonica test cultivars to ascertain their genetic diversity structure. Highly polymorphic microsatellite markers were used for generating marker segregation data. A novel measure, allele discrimination ...

  11. Morphological and molecular based diversity studies of some ...

    African Journals Online (AJOL)

    Cassava (Manihot esculenta Crantz) is an important food crop in many tropical countries in Africa, South America and Asia. However, yields are below the productivity of the crop. This requires breeding and selection for improved varieties. The current study therefore investigated genetic diversity among some Ghanaian ...

  12. Morphological and molecular genetic diversity of Syrian indigenous ...

    African Journals Online (AJOL)

    Domestic goats in Syria may provide an interesting source of genetic variability due to its proximity to the centers of domestication. This study aimed to assess the morphological variation, genetic diversity and population substructure of the Syrian goat populations. Commonly, three goat genotypes are distinguished in Syria, ...

  13. Molecular based assessment of genetic diversity of xoconostle ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-08

    Jan 8, 2014 ... Xoconostle or acidic prickly pear is an important fruit in Mexico; it is produced by a ... study, we report for the first time the estimation of genetic diversity within a set ... demonstrates the high genetic variation among genotypes of .... O. leucotricha Salm-Dyck × O. joconostle F.A.C Weber Zacatecas Wild Stock.

  14. Molecular characterization and genetic diversity of different genotypes of Oryza sativa and Oryza glaberrima

    Directory of Open Access Journals (Sweden)

    Caijin Chen

    2017-11-01

    Conclusions: Genetic diversity studies revealed that 50 rice types were clustered into different subpopulations whereas three genotypes were admixtures. Molecular fingerprinting and 10 specific markers were obtained to identify the 53 rice genotypes. These results can facilitate the potential utilization of sibling species in rice breeding and molecular classification of O. sativa and O. glaberrima germplasms.

  15. Molecular diversity of neurotoxins from Clostridium botulinum type D strains.

    OpenAIRE

    Moriishi, K; Syuto, B; Kubo, S; Oguma, K

    1989-01-01

    The molecular properties of Clostridium botulinum type D South African (D-SA) were compared with those of neurotoxins from type D strain 1873 (D-1873) and type C strains Stockholm and 6813. D-SA toxin, purified 610-fold from the culture supernatant in an overall yield of 30%, consisted of an intact peptide chain with a molecular weight of 140,000. Limited proteolysis of the toxin by trypsin formed a dichain structure consisting of a light chain (Mr, 50,000) and a heavy chain (Mr, 90,000) link...

  16. Molecular diversity patterns among various phytoplankton size-fractions in West Greenland in late summer

    Science.gov (United States)

    Elferink, Stephanie; Neuhaus, Stefan; Wohlrab, Sylke; Toebe, Kerstin; Voß, Daniela; Gottschling, Marc; Lundholm, Nina; Krock, Bernd; Koch, Boris P.; Zielinski, Oliver; Cembella, Allan; John, Uwe

    2017-03-01

    Arctic regions have experienced pronounced biological and biophysical transformations as a result of global change processes over the last several decades. Current hypotheses propose an elevated impact of those environmental changes on the biodiversity, community composition and metabolic processes of species. The effects on ecosystem function and services, particularly when invasive or toxigenic harmful species become dominant, can be expressed over a wide range of temporal and spatial scales in plankton communities. Our study focused on the comparison of molecular biodiversity of three size-fractions (micro-, nano-, picoplankton) in the coastal pelagic zone of West Greenland and their association with environmental parameters. Molecular diversity was assessed via parallel amplicon sequencing the 28S rRNA hypervariable D1/D2 region. We showed that biodiversity distribution within the area of Uummannaq Fjord, Vaigat Strait and Disko Bay differed markedly within and among size-fractions. In general, we observed a higher diversity within the picoplankton size fraction compared to the nano- and microplankton. In multidimensional scaling analysis, community composition of all three size fractions correlated with cell size, silicate and phosphate, chlorophyll a (chl a) and dinophysistoxin (DTX). Individually, each size fraction community composition also correlated with other different environmental parameters, i.e. temperature and nitrate. We observed a more homogeneous community of the picoplankton across all stations compared to the larger size classes, despite different prevailing environmental conditions of the sampling areas. This suggests that habitat niche occupation for larger-celled species may lead to higher functional trait plasticity expressed as an enhanced range of phenotypes, whereas smaller organisms may compensate for lower potential plasticity with higher diversity. The presence of recently identified toxigenic harmful algal bloom (HAB) species (such

  17. Importance and pitfalls of molecular analysis to parasite epidemiology.

    Science.gov (United States)

    Constantine, Clare C

    2003-08-01

    Molecular tools are increasingly being used to address questions about parasite epidemiology. Parasites represent a diverse group and they might not fit traditional population genetic models. Testing hypotheses depends equally on correct sampling, appropriate tool and/or marker choice, appropriate analysis and careful interpretation. All methods of analysis make assumptions which, if violated, make the results invalid. Some guidelines to avoid common pitfalls are offered here.

  18. Molecular markers to study competition and diversity of Rhizobium

    NARCIS (Netherlands)

    Sessitsch, A.

    1997-01-01

    The research described in this thesis was directed to the development of molecular identification and detection techniques for studying the ecology of Rhizobium, a nitrogen- fixing bacterium of agricultural importance. Competition of inoculant strains with indigenous

  19. Molecular markers for genetic diversity and phylogeny research of ...

    African Journals Online (AJOL)

    Brazilian sheep descended from several breeds brought to the New World by Portuguese and Spanish colonists, and they have evolved and adapted to local climatic variations and acquired tolerance or resistance to many diseases. Molecular markers are widely used in analyzing genetic variability, and markers such as ...

  20. Molecular diversity of avian schistosomes in Danish freshwater snails

    DEFF Research Database (Denmark)

    Christiansen, Anne Ø.; Olsen, Annette; Buchmann, Kurt

    2016-01-01

    Avian schistosomes are widespread parasites of snails and waterfowl and may cause cercarial dermatitis (swimmer's itch) in humans, a disease that is frequently reported in European countries. These parasites are known to occur in Denmark, but here, we applied a new approach using molecular tools ...

  1. Molecular diversity of the rumen microbiome of Norwegian reindeer on natural summer pasture.

    Science.gov (United States)

    Sundset, Monica A; Edwards, Joan E; Cheng, Yan Fen; Senosiain, Roberto S; Fraile, Maria N; Northwood, Korinne S; Praesteng, Kirsti E; Glad, Trine; Mathiesen, Svein D; Wright, André-Denis G

    2009-02-01

    The molecular diversity of the rumen microbiome was investigated in five semi-domesticated adult female Norwegian reindeer (Rangifer tarandus tarandus) grazing on natural summer pastures on the coast of northern Norway (71.00 degrees N, 25.30 degrees E). Mean population densities (numbers per gram wet weight) of methanogenic archaea, rumen bacteria and ciliate protozoa, estimated using quantitative real-time polymerase chain reaction (PCR), were 3.17x10(9), 5.17x10(11) and 4.02x10(7), respectively. Molecular diversity of rumen methanogens was revealed using a 16S rRNA gene library (54 clones) constructed using pooled PCR products from the whole rumen contents of the five individual reindeer. Based upon a similarity criterion of rumen exhibited a high degree of sequence similarity to methanogens affiliated with the families Methanobacteriaceae (14 OTUs) and Methanosarcinaceae (one OTU). Four of the OTUs detected belonged to a group of uncultivated archaea previously found in domestic ruminants and thought to be dominant in the rumen together with Methanobrevibacter spp. Denaturing gradient gel electrophoresis profiling of the rumen bacterial 16S rRNA gene and the protozoal 18S rRNA gene indicated a high degree of animal variation, although some bands were common to all individuals. Automated ribosomal intergenic spacer analysis (ARISA) profiling of the ruminal Neocallimastigales population indicated that the reindeer are likely to contain more than one type of anaerobic fungus. The ARISA profile from one animal was distinct from the other four. This is the first molecular investigation of the ruminal methanogenic archaea in reindeer, revealing higher numbers than expected based on methane emission data available. Also, many of the reindeer archaeal 16S rRNA gene sequences were similar to those reported in domesticated ruminants in Australia, Canada, China, New Zealand and Venezuela, supporting previous findings that there seems to be no host type or geographical

  2. Molecular diversity of Rice grassy stunt virus in Vietnam.

    Science.gov (United States)

    Ta, Hoang-Anh; Nguyen, Doan-Phuong; Causse, Sandrine; Nguyen, Thanh-Duc; Ngo, Vinh-Vien; Hébrard, Eugénie

    2013-04-01

    Rice grassy stunt virus (RGSV, Tenuivirus) recently emerged on rice in Vietnam, causing high yield losses during 2006-2009. The genetic diversity of RGSV is poorly documented. In this study, the two genes encoded by each ambisense segment RNA3 and RNA5 of RGSV isolates from six provinces of South Vietnam were sequenced. P3 and Pc3 (RNA3) have unknown function, P5 (RNA5) encodes the putative silencing suppressor, and Pc5 (RNA5) encodes the nucleocapsid protein (N). The sequences of 17 Vietnamese isolates were compared with reference isolates from North and South Philippines. The average nucleotide diversity among the isolates was low. We confirmed a higher variability of RNA3 than RNA5 and Pc3 than P3. No relationships between the genetic diversity and the geographic distribution of RGSV isolates could be ascertained, likely because of the long-distance migration of the insect vector. This data will contribute to a better understanding on the RGSV epidemiology in South Vietnam, a prerequisite for further management of the disease and rice breeding for resistance.

  3. Molecular markers based identification of diversity for drought tolerance in bread wheat varieties and synthetic hexaploids.

    Science.gov (United States)

    Shah, Zahid Hussain; Munir, Muhammad; Kazi, Abdul Mujeeb; Mujtaba, Tahir; Ahmed, Zaheer

    2009-01-01

    The complexity of the wheat genome has delayed the development and application of molecular markers to this species and wheat now lies behind barley, maize and rice in marker development. However, improvements in marker detection systems and in the techniques used to identify markers linked to useful traits has allowed considerable advances to be made in recent years. To evaluate the genetic diversity 53 genotypes of Richard's selection, were studied at National Agriculture Reseach Center (NARC) Islamabad. The present study found that RAPD analysis is a valuable diagnostic tool. Different sets of RAPD primers were used to study the polymorphism at molecular level. Highest number of amplifications was shown by primer OpG-2 in Richard's material. Coefficient of similarity as well as genetic distances among these three sets of materials was calculated by using Unweighted Pair Group of Arithamatic Means (UPGMA) function (Nei and Li, 1979). The SHs derived genotypes of Richard's selection were highly polymorphic with a polymorphism percentage of 69.70 as compared to NUYT (rainfed) and elite Pakistani bread wheat varieties with a polymorphism of 44.44% and 61.11% respectively. Cluster analysis was done in which grouping of genotypes was done on the basis of genetic distances. Cluster analysis revealed that genotypes of Richard's genotypes are showing high level of among cultivar variation as compared to NUYT (Rainfed) and elite Pakistani drought tolerant bread wheat varieties. These genotypes were also phenotypically evaluated.

  4. Diversity Performance Analysis on Multiple HAP Networks

    Science.gov (United States)

    Dong, Feihong; Li, Min; Gong, Xiangwu; Li, Hongjun; Gao, Fengyue

    2015-01-01

    One of the main design challenges in wireless sensor networks (WSNs) is achieving a high-data-rate transmission for individual sensor devices. The high altitude platform (HAP) is an important communication relay platform for WSNs and next-generation wireless networks. Multiple-input multiple-output (MIMO) techniques provide the diversity and multiplexing gain, which can improve the network performance effectively. In this paper, a virtual MIMO (V-MIMO) model is proposed by networking multiple HAPs with the concept of multiple assets in view (MAV). In a shadowed Rician fading channel, the diversity performance is investigated. The probability density function (PDF) and cumulative distribution function (CDF) of the received signal-to-noise ratio (SNR) are derived. In addition, the average symbol error rate (ASER) with BPSK and QPSK is given for the V-MIMO model. The system capacity is studied for both perfect channel state information (CSI) and unknown CSI individually. The ergodic capacity with various SNR and Rician factors for different network configurations is also analyzed. The simulation results validate the effectiveness of the performance analysis. It is shown that the performance of the HAPs network in WSNs can be significantly improved by utilizing the MAV to achieve overlapping coverage, with the help of the V-MIMO techniques. PMID:26134102

  5. Diversity Performance Analysis on Multiple HAP Networks

    Directory of Open Access Journals (Sweden)

    Feihong Dong

    2015-06-01

    Full Text Available One of the main design challenges in wireless sensor networks (WSNs is achieving a high-data-rate transmission for individual sensor devices. The high altitude platform (HAP is an important communication relay platform for WSNs and next-generation wireless networks. Multiple-input multiple-output (MIMO techniques provide the diversity and multiplexing gain, which can improve the network performance effectively. In this paper, a virtual MIMO (V-MIMO model is proposed by networking multiple HAPs with the concept of multiple assets in view (MAV. In a shadowed Rician fading channel, the diversity performance is investigated. The probability density function (PDF and cumulative distribution function (CDF of the received signal-to-noise ratio (SNR are derived. In addition, the average symbol error rate (ASER with BPSK and QPSK is given for the V-MIMO model. The system capacity is studied for both perfect channel state information (CSI and unknown CSI individually. The ergodic capacity with various SNR and Rician factors for different network configurations is also analyzed. The simulation results validate the effectiveness of the performance analysis. It is shown that the performance of the HAPs network in WSNs can be significantly improved by utilizing the MAV to achieve overlapping coverage, with the help of the V-MIMO techniques.

  6. Polyploidy creates higher diversity among Cynodon accessions as assessed by molecular markers.

    Science.gov (United States)

    Gulsen, Osman; Sever-Mutlu, Songul; Mutlu, Nedim; Tuna, Metin; Karaguzel, Osman; Shearman, Robert C; Riordan, Terrance P; Heng-Moss, Tiffany M

    2009-05-01

    Developing a better understanding of associations among ploidy level, geographic distribution, and genetic diversity of Cynodon accessions could be beneficial to bermudagrass breeding programs, and would enhance our understanding of the evolutionary biology of this warm season grass species. This study was initiated to: (1) determine ploidy analysis of Cynodon accessions collected from Turkey, (2) investigate associations between ploidy level and diversity, (3) determine whether geographic and ploidy distribution are related to nuclear genome variation, and (4) correlate among four nuclear molecular marker systems for Cynodon accessions' genetic analyses. One hundred and eighty-two Cynodon accessions collected in Turkey from an area south of the Taurus Mountains along the Mediterranean cost and ten known genotypes were genotyped using sequence related amplified polymorphism (SRAP), peroxidase gene polymorphism (POGP), inter-simple sequence repeat (ISSR), and random amplified polymorphic DNA (RAPD). The diploids, triploids, tetraploids, pentaploids, and hexaploids revealed by flow cytometry had a linear present band frequency of 0.36, 0.47, 0.49, 0.52, and 0.54, respectively. Regression analysis explained that quadratic relationship between ploidy level and band frequency was the most explanatory (r = 0.62, P Cynodon accessions' genetic structure can aid to enhance breeding programs and broaden genetic base of commercial cultivars.

  7. Genetic diversity among Korean bermudagrass (Cynodon spp.) ecotypes characterized by morphological, cytological and molecular approaches.

    Science.gov (United States)

    Kang, Si-Yong; Lee, Geung-Joo; Lim, Ki Byung; Lee, Hye Jung; Park, In Sook; Chung, Sung Jin; Kim, Jin-Baek; Kim, Dong Sub; Rhee, Hye Kyung

    2008-04-30

    The genus Cynodon comprises ten species. The objective of this study was to evaluate the genetic diversity of Korean bermudagrasses at the morphological, cytological and molecular levels. Morphological parameters, the nuclear DNA content and ploidy levels were observed in 43 bermudagrass ecotypes. AFLP markers were evaluated to define the genetic diversity, and chromosome counts were made to confirm the inferred cytotypes. Nuclear DNA contents were in the ranges 1.42-1.56, 1.94-2.19, 2.54, and 2.77-2.85 pg/2C for the triploid, tetraploid, pentaploid, and hexaploid accessions, respectively. The inferred cytotypes were triploid (2n = 3x = 27), tetraploid (2n = 4x = 36), pentaploid (2n = 5x = 45), and hexaploid (2n = 6x = 54), but the majority of the collections were tetraploid (81%). Mitotic chromosome counts verified the corresponding ploidy levels. The fast growing fine-textured ecotypes had lower ploidy levels, while the pentaploids and hexaploids were coarse types. The genetic similarity ranged from 0.42 to 0.94 with an average of 0.64. UPGMA cluster analysis and principle coordinate analysis separated the ecotypes into 6 distinct groups. The genetic similarity suggests natural hybridization between the different cytotypes, which could be useful resources for future breeding and genetic studies.

  8. Molecular markers shared by diverse apomictic Pennisetum species.

    Science.gov (United States)

    Lubbers, E L; Arthur, L; Hanna, W W; Ozias-Akins, P

    1994-11-01

    Two molecular markers, a RAPD (randomly amplified polymorphic DNA) and a RFLP/STS (restriction fragment length polymorphism/sequence-tagged site), previously were found associated with apomictic reproductive behavior in a backcross population produced to transfer apomixis from Pennisetum squamulatum to pearl millet. The occurrence of these molecular markers in a range of 29 accessions of Pennisetum comprising 11 apomictic and 8 sexual species was investigated. Both markers were specific for apomictic species in Pennisetum. The RFLP/STS marker, UGT 197, was found to be associated with all taxa that displayed apomictic reproductive behavior except those in section Brevivalvula. Neither UGT197 nor the cloned RAPD fragment OPC-04600 hybridized with any sexually reproducing representatives of the genus. The cloned C04600 was associated with 3 of the 11 apomictic species, P. ciliare, P. massaicum, and P. squamulatum. UGT197 was more consistently associated with apomictic reproductive behavior than OPC04600 or cloned C04600, thus it could be inferred that UGT197 is more closely linked to the gene(s) for apomixis than the cloned C04600. The successful use of these probes to survey other Pennisetum species indicates that apomixis is a trait that can be followed across species by using molecular means. This technique of surveying species within a genus will be useful in determining the relative importance of newly isolated markers and may facilitate the identification of the apomixis gene(s).

  9. Molecular evidence and high genetic diversity of shrew-borne Seewis virus in Slovenia.

    Science.gov (United States)

    Resman, Katarina; Korva, Miša; Fajs, Luka; Zidarič, Tanja; Trilar, Tomi; Zupanc, Tatjana Avšič

    2013-10-01

    Seewis virus, the shrew-borne hantavirus from Sorex araneus, has been molecularly detected in reservoir hosts in many different central European countries and Russia. Slovenia is a known endemic country for rodent-borne hantaviruses, therefore the aim of the study was to investigate the presence of shrew-borne hantaviruses in insectivores. Viral L, S and M segment have been recovered only from tissue samples of 7 S. araneus, despite several shrew species were tested. Phylogenetic analysis showed high genetic diversity of SWSV in Slovenia, ranging from 3 to 19.4% for different viral segments. The most divergent were M segment sequences, with 19.4% nucleotide divergence among Slovenian strains. Above that, different SWSV strains from Slovenia do not group into separate geographic clusters. While three separate genetic clades were determined, two of them were simultaneously present in one location at the same time. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. RESEARCH NOTE Molecular genetic analysis of consanguineous ...

    Indian Academy of Sciences (India)

    Navya

    Molecular genetic analysis of consanguineous families with primary microcephaly ... Translational Research Institute, Academic Health System, Hamad Medical ..... bridging the gap between homozygosity mapping and deep sequencing.

  11. A diversity oriented synthesis of natural product inspired molecular libraries.

    Science.gov (United States)

    Chauhan, Jyoti; Luthra, Tania; Gundla, Rambabu; Ferraro, Antonio; Holzgrabe, Ulrike; Sen, Subhabrata

    2017-11-07

    Natural products are the source of innumerable pharmaceutical drug candidates and also form an important aspect of herbal remedies. They are also a source of various bioactive compounds. Herein we have leveraged the structural attributes of several natural products in building a library of architecturally diverse chiral molecules by harnessing R-tryptophan as the chiral auxiliary. It is converted to its corresponding methyl ester 1 which in turn provided a bevy of 1-aryl-tetrahydro-β-carbolines 2a-d, which were then converted to chiral compounds via a diversity oriented synthetic strategy (DOS). In general, intermolecular and intramolecular ring rearrangements facilitated the formation of the final compounds. Four different classes of molecules with distinct architectures were generated, adding up to nearly twenty-two individual molecules. Phenotypic screening of a representative section of the library revealed two molecules that selectively inhibit MCF7 breast cancer cells with IC 50 of ∼5 μg mL -1 potency.

  12. Molecular bacterial diversity and bioburden of commercial airliner cabin air

    Energy Technology Data Exchange (ETDEWEB)

    La Duc, M.T.; Stuecker, T.; Venkateswaran, K. [California Inst. of Technology, Pasadena, CA (United States). Jet Propulsion Laboratory, Biotechnology and Planetary Protection Group

    2007-11-15

    Microorganisms that exist in aircraft air systems are considered to be the primary source of microbial contamination that can lead to illness shortly after flying. More than 600 million passengers board commercial airline flights annually in the United States alone. In this study, culture-independent, biomarker-targeted bacterial enumeration and identification strategies were used to estimate total bacterial burden and diversity within the cabin air of commercial airliners. Air-impingement was used to collect samples of microorganisms from 4 flights on 2 commercial carriers. The total viable microbial population ranged from below detection limits to 4.1 x 10{sup 6} cells/m{sup 3} of air. Microbes were found to gradually accumulate from the time of passenger boarding through mid-flight. A sharp decline in bacterial abundance was then observed. Representatives of the {alpha}, {beta} and {gamma} Proteobacteria, as well as Gram-positive bacteria, were isolated in varying abundance. Airline A had large abundances of Neisseria meningitidis rRNA gene sequences and Streptococcus oralis/mitis sequences. Airline B was dominated by pseudomonas synxantha sequences as well as N. meningitidis and S. oralis/mitis. The cabin air samples housed low bacterial diversity and were typically dominated by a particular subset of bacteria, notably opportunistic pathogenic inhabitants of the human respiratory tract and oral cavity. The microbes were found largely around the ventilation ducts and gasper conduits that supply cabin air. 45 refs., 4 tabs., 3 figs.

  13. Transferability of molecular markers from major legumes to Lathyrus spp. for their application in mapping and diversity studies.

    Science.gov (United States)

    Almeida, Nuno Felipe; Trindade Leitão, Susana; Caminero, Constantino; Torres, Ana Maria; Rubiales, Diego; Vaz Patto, Maria Carlota

    2014-01-01

    Lathyrus cicera L. (chickling pea) and L. sativus L. (grass pea) have great potential among grain legumes due to their adaptability to inauspicious environments, high protein content and resistance to serious diseases. Nevertheless, due to its past underused, further activities are required to exploit this potential and to capitalise on the advances in molecular biology that enable improved Lathyrus spp. breeding programmes. In this study we evaluated the transferability of molecular markers developed for closely related legume species to Lathyrus spp. (Medicago truncatula, pea, lentil, faba bean and lupin) and tested the application of those new molecular tools on Lathyrus mapping and diversity studies. Genomic and expressed sequence tag microsatellite, intron-targeted amplified polymorphic, resistance gene analogue and defence-related gene markers were tested. In total 128 (27.7 %) and 132 (28.6 %) molecular markers were successfully cross-amplified, respectively in L. cicera and L. sativus. In total, the efficiency of transferability from genomic microsatellites was 5 %, and from gene-based markers, 55 %. For L. cicera, three cleaved amplified polymorphic sequence markers and one derived cleaved amplified polymorphic sequence marker based on the cross-amplified markers were also developed. Nine of those molecular markers were suitable for mapping in a L. cicera recombinant inbred line population. From the 17 molecular markers tested for diversity analysis, six (35 %) in L. cicera and seven (41 %) in L. sativus were polymorphic and discriminate well all the L. sativus accessions. Additionally, L. cicera accessions were clearly distinguished from L. sativus accessions. This work revealed a high number of transferable molecular markers to be used in current genomic studies in Lathyrus spp. Although their usefulness was higher on diversity studies, they represent the first steps for future comparative mapping involving these species.

  14. Molecular diversity of arbuscular mycorrhizal fungi in relation to soil chemical properties and heavy metal contamination

    International Nuclear Information System (INIS)

    Zarei, Mehdi; Hempel, Stefan; Wubet, Tesfaye; Schaefer, Tina; Savaghebi, Gholamreza; Jouzani, Gholamreza Salehi; Nekouei, Mojtaba Khayam; Buscot, Francois

    2010-01-01

    Abundance and diversity of arbuscular mycorrhizal fungi (AMF) associated with dominant plant species were studied along a transect from highly lead (Pb) and zinc (Zn) polluted to non-polluted soil at the Anguran open pit mine in Iran. Using an established primer set for AMF in the internal transcribed spacer (ITS) region of rDNA, nine different AMF sequence types were distinguished after phylogenetic analyses, showing remarkable differences in their distribution patterns along the transect. With decreasing Pb and Zn concentration, the number of AMF sequence types increased, however one sequence type was only found in the highly contaminated area. Multivariate statistical analysis revealed that further factors than HM soil concentration affect the AMF community at contaminated sites. Specifically, the soils' calcium carbonate equivalent and available P proved to be of importance, which illustrates that field studies on AMF distribution should also consider important environmental factors and their possible interactions. - The molecular diversity of AMF was found to be influenced by a combination of soil heavy metal and other soil chemical parameters.

  15. Molecular diversity of arbuscular mycorrhizal fungi in relation to soil chemical properties and heavy metal contamination

    Energy Technology Data Exchange (ETDEWEB)

    Zarei, Mehdi [Department of Soil Science, College of Agriculture, University of Shiraz, Shiraz (Iran, Islamic Republic of); Hempel, Stefan, E-mail: hempel.stefan@googlemail.co [UFZ Helmholtz Centre for Environmental Research Leipzig-Halle, Department of Soil Ecology, Theodor-Lieser-Strasse 4, 06120 Halle (Germany); Freie Universitaet Berlin, Institut fuer Biologie, Okologie der Pflanzen, Altensteinstrasse 6, 14195 Berlin (Germany); Wubet, Tesfaye; Schaefer, Tina [UFZ Helmholtz Centre for Environmental Research Leipzig-Halle, Department of Soil Ecology, Theodor-Lieser-Strasse 4, 06120 Halle (Germany); Savaghebi, Gholamreza [Department of Soil Science Engineering, University College of Agriculture and Natural Resources, University of Tehran, Karaj (Iran, Islamic Republic of); Jouzani, Gholamreza Salehi; Nekouei, Mojtaba Khayam [Agricultural Biotechnology Research Institute of Iran (ABRII), P.O. Box 31535-1897, Karaj (Iran, Islamic Republic of); Buscot, Francois [UFZ Helmholtz Centre for Environmental Research Leipzig-Halle, Department of Soil Ecology, Theodor-Lieser-Strasse 4, 06120 Halle (Germany)

    2010-08-15

    Abundance and diversity of arbuscular mycorrhizal fungi (AMF) associated with dominant plant species were studied along a transect from highly lead (Pb) and zinc (Zn) polluted to non-polluted soil at the Anguran open pit mine in Iran. Using an established primer set for AMF in the internal transcribed spacer (ITS) region of rDNA, nine different AMF sequence types were distinguished after phylogenetic analyses, showing remarkable differences in their distribution patterns along the transect. With decreasing Pb and Zn concentration, the number of AMF sequence types increased, however one sequence type was only found in the highly contaminated area. Multivariate statistical analysis revealed that further factors than HM soil concentration affect the AMF community at contaminated sites. Specifically, the soils' calcium carbonate equivalent and available P proved to be of importance, which illustrates that field studies on AMF distribution should also consider important environmental factors and their possible interactions. - The molecular diversity of AMF was found to be influenced by a combination of soil heavy metal and other soil chemical parameters.

  16. Design of a multi-purpose fragment screening library using molecular complexity and orthogonal diversity metrics

    Science.gov (United States)

    Lau, Wan F.; Withka, Jane M.; Hepworth, David; Magee, Thomas V.; Du, Yuhua J.; Bakken, Gregory A.; Miller, Michael D.; Hendsch, Zachary S.; Thanabal, Venkataraman; Kolodziej, Steve A.; Xing, Li; Hu, Qiyue; Narasimhan, Lakshmi S.; Love, Robert; Charlton, Maura E.; Hughes, Samantha; van Hoorn, Willem P.; Mills, James E.

    2011-07-01

    Fragment Based Drug Discovery (FBDD) continues to advance as an efficient and alternative screening paradigm for the identification and optimization of novel chemical matter. To enable FBDD across a wide range of pharmaceutical targets, a fragment screening library is required to be chemically diverse and synthetically expandable to enable critical decision making for chemical follow-up and assessing new target druggability. In this manuscript, the Pfizer fragment library design strategy which utilized multiple and orthogonal metrics to incorporate structure, pharmacophore and pharmacological space diversity is described. Appropriate measures of molecular complexity were also employed to maximize the probability of detection of fragment hits using a variety of biophysical and biochemical screening methods. In addition, structural integrity, purity, solubility, fragment and analog availability as well as cost were important considerations in the selection process. Preliminary analysis of primary screening results for 13 targets using NMR Saturation Transfer Difference (STD) indicates the identification of uM-mM hits and the uniqueness of hits at weak binding affinities for these targets.

  17. Microbial diversity in an Armenian geothermal spring assessed by molecular and culture-based methods.

    Science.gov (United States)

    Panosyan, Hovik; Birkeland, Nils-Kåre

    2014-11-01

    The phylogenetic diversity of the prokaryotic community thriving in the Arzakan hot spring in Armenia was studied using molecular and culture-based methods. A sequence analysis of 16S rRNA gene clone libraries demonstrated the presence of a diversity of microorganisms belonging to the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Epsilonproteobacteria, Firmicutes, Bacteroidetes phyla, and Cyanobacteria. Proteobacteria was the dominant group, representing 52% of the bacterial clones. Denaturing gradient gel electrophoresis profiles of the bacterial 16S rRNA gene fragments also indicated the abundance of Proteobacteria, Bacteroidetes, and Cyanobacteria populations. Most of the sequences were most closely related to uncultivated microorganisms and shared less than 96% similarity with their closest matches in GenBank, indicating that this spring harbors a unique community of novel microbial species or genera. The majority of the sequences of an archaeal 16S rRNA gene library, generated from a methanogenic enrichment, were close relatives of members of the genus Methanoculleus. Aerobic endospore-forming bacteria mainly belonging to Bacillus and Geobacillus were detected only by culture-dependent methods. Three isolates were successfully obtained having 99, 96, and 96% 16S rRNA gene sequence similarities to Arcobacter sp., Methylocaldum sp., and Methanoculleus sp., respectively. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Chemical Space: Big Data Challenge for Molecular Diversity.

    Science.gov (United States)

    Awale, Mahendra; Visini, Ricardo; Probst, Daniel; Arús-Pous, Josep; Reymond, Jean-Louis

    2017-10-25

    Chemical space describes all possible molecules as well as multi-dimensional conceptual spaces representing the structural diversity of these molecules. Part of this chemical space is available in public databases ranging from thousands to billions of compounds. Exploiting these databases for drug discovery represents a typical big data problem limited by computational power, data storage and data access capacity. Here we review recent developments of our laboratory, including progress in the chemical universe databases (GDB) and the fragment subset FDB-17, tools for ligand-based virtual screening by nearest neighbor searches, such as our multi-fingerprint browser for the ZINC database to select purchasable screening compounds, and their application to discover potent and selective inhibitors for calcium channel TRPV6 and Aurora A kinase, the polypharmacology browser (PPB) for predicting off-target effects, and finally interactive 3D-chemical space visualization using our online tools WebDrugCS and WebMolCS. All resources described in this paper are available for public use at www.gdb.unibe.ch.

  19. Phenotypic and molecular evaluation of genetic diversity of rapeseed

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-05

    Oct 5, 2009 ... basis of elite oilseed rape breeding material has been narrowed by an intensive .... breeding programs was the basic reason for detailed genetic analysis. ...... A periodical of Scientific Research on Field and. Vegetable Crops ...

  20. Assessing diversity among traditional Greek and foreign eggplant cultivars using molecular markers and morphometrical descriptors

    Energy Technology Data Exchange (ETDEWEB)

    Augustinos, A.A.; Petropoulos, C.; Karasoulou, V.; Bletsos, F.; Papasotiropoulos, V.

    2016-07-01

    Eggplant is a widely cultivated vegetable crop of great economic importance. Its long lasting history of domestication, selection and breeding has led to the development of numerous cultivars with variable traits. In the present study, we assessed the diversity levels within and among eleven Greek and foreign cultivars, using 22 morphological descriptors and two different classes of molecular markers (retrotransposon microsatellite amplified polymorphism-REMAP markers and nuclear microsatellites). Our results, in accordance with other studies in the field showed: a) the limited levels of genetic polymorphism within the cultivars; b) the high morphological and genetic divergence existing among them as indicated by the genetic distance values calculated, which could be attributed to selection, inbreeding and bottleneck effects; and c) the lack of concordance among morphological descriptors and molecular markers. Despite these, our analysis showed that the utilization of combinations of markers is an effective method for the characterization of plant material providing also useful diagnostic tools for the identification and authentication of the selected Greek cultivars.

  1. Assessing diversity among traditional Greek and foreign eggplant cultivars using molecular markers and morphometrical descriptors

    International Nuclear Information System (INIS)

    Augustinos, A.A.; Petropoulos, C.; Karasoulou, V.; Bletsos, F.; Papasotiropoulos, V.

    2016-01-01

    Eggplant is a widely cultivated vegetable crop of great economic importance. Its long lasting history of domestication, selection and breeding has led to the development of numerous cultivars with variable traits. In the present study, we assessed the diversity levels within and among eleven Greek and foreign cultivars, using 22 morphological descriptors and two different classes of molecular markers (retrotransposon microsatellite amplified polymorphism-REMAP markers and nuclear microsatellites). Our results, in accordance with other studies in the field showed: a) the limited levels of genetic polymorphism within the cultivars; b) the high morphological and genetic divergence existing among them as indicated by the genetic distance values calculated, which could be attributed to selection, inbreeding and bottleneck effects; and c) the lack of concordance among morphological descriptors and molecular markers. Despite these, our analysis showed that the utilization of combinations of markers is an effective method for the characterization of plant material providing also useful diagnostic tools for the identification and authentication of the selected Greek cultivars.

  2. Genetic diversity and molecular characterization of Saccharomyces cerevisiae strains from winemaking environments

    OpenAIRE

    Schuller, Dorit Elisabeth

    2004-01-01

    Tese de doutoramento em Ciências The principal aim of the present work is to assess the genetic diversity of fermenting Saccharomyces cerevisiae strains found in vineyards belonging to the Vinho Verde Region in order to create a strain collection representing the region’s biodiversity wealth as a basis for future strain selection and improvement programs. Validation of molecular techniques for accurate genotyping is an indispensable prerequisite for biogeographical surveys. Molecular ty...

  3. Seroepidemiology and molecular diversity of Leishmania donovani complex in Georgia.

    Science.gov (United States)

    Babuadze, Giorgi; Farlow, Jason; de Koning, Harry P; Carrillo, Eugenia; Chakhunashvili, Giorgi; Murskvaladze, Mari; Kekelidze, Merab; Karseladze, Irakli; Kokaia, Nora; Kalandadze, Irine; Tsereteli, David; Markhvashvili, Ivane; Sidamonidze, Ketevan; Chanturia, Gvantsa; Adeishvili, Ekaterine; Imnadze, Paata

    2016-05-13

    Leishmaniasis includes multiple clinical syndromes, most notably visceral, cutaneous, and mucosal forms. Visceral leishmaniasis (VL), also known as kala-azar, is a potentially fatal disease endemic to large parts of Africa and Asia, and in South-Eastern Europe (Greece, Turkey, Georgia). Visceral leishmaniasis is a parasitic zoonosis caused by species of the L. donovani complex. In the classical epidemiological model the main reservoir for VL are canines. The study included a cohort of 513 individuals of both genders (190 males and 323 females) from the ages of 1 to 70 years that were screened in ten villages across two districts in Kakheti using the Kalazar Detect™ rK39 rapid diagnostic test. The phylogenetic diversity patterns of local strains, based on the rDNA internal transcribed spacer (ITS) sequences, were assessed for samples obtained from patients with suspected L. donovani infection, from canine reservoirs and from Phlebotomus sand flies obtained from different geographical areas of Georgia and from Azerbaijan. Out of a total of 600 domestic dog blood samples 95 (15.8 %) were positive by rK39 rapid diagnostic tests. For symptomatic domestic dogs, the testing of conjunctival swabs or bone marrow aspirates revealed a higher VL incidence in Kvareli District (Kvareli; 19.4 %, n = 329) compared with that observed for Sagarejo District (Sagarejo; 11.4 %, n = 271). A total of 231 sand flies of both genders were collected during the 2-month period; of the 114 females, 1.75 % were PCR positive for the presence of Leishmania spp. VL infection rates remain high in both canines and humans in Georgia, with disease in several known natural foci. The genetic relationships derived from rDNA internal transcribed spacer (ITS) sequence comparisons identified genetic subgroups, revealing preliminary insights into the genetic structure of L. donovani complex members currently circulating in the South Caucasus and demonstrates the utility of ITS-based genotyping

  4. Molecular genetic diversity and population structure of Ethiopian white lupin landraces: Implications for breeding and conservation

    Science.gov (United States)

    Yao, Nasser; Martina, Kyalo; Dagne, Kifle; Wegary, Dagne; Tesfaye, Kassahun

    2017-01-01

    White lupin is one of the four economically important species of the Lupinus genus and is an important grain legume in the Ethiopian farming system. However, there has been limited research effort to characterize the Ethiopian white lupin landraces. Fifteen polymorphic simple sequence repeat (SSR) markers were used to assess the genetic diversity and population structure of 212 Ethiopian white lupin (Lupinus albus) landraces and two genotypes from different species (Lupinus angustifolius and Lupinus mutabilis) were used as out-group. The SSR markers revealed 108 different alleles, 98 of them from 212 landraces and 10 from out-group genotypes, with an average of 6.5 alleles per locus. The average gene diversity was 0.31. Twenty eight landraces harbored one or more private alleles from the total of 28 private alleles identified in the 212 white lupin accessions. Seventy-seven rare alleles with a frequency of less than 5% were identified and accounted for 78.6% of the total alleles detected. Analysis of molecular variance (AMOVA) showed that 92% of allelic diversity was attributed to individual accessions within populations while only 8% was distributed among populations. At 70% similarity level, the UPGMA dendrogram resulted in the formation of 13 clusters comprised of 2 to 136 landraces, with the out-group genotypes and five landraces remaining distinct and ungrouped. Population differentiation and genetic distance were relatively high between Gondar and Ethiopian white lupin populations collected by Australians. A model-based population structure analysis divided the white lupin landraces into two populations. All Ethiopian white lupin landrace populations, except most of the landraces collected by Australians (77%) and about 44% from Awi, were grouped together with significant admixtures. The study also suggested that 34 accessions, as core collections, were sufficient to retain 100% of SSR diversity. These accessions (core G-34) represent 16% of the whole 212

  5. Molecular diversity among viroids infecting chrysanthemum in India.

    Science.gov (United States)

    Adkar-Purushothama, C R; Chennappa, G; Poornachandra Rao, K; Sreenivasa, M Y; Maheshwar, P K; Nagendra Prasad, M N; Sano, T

    2017-08-01

    Association of Chrysanthemum stunt viroid (CSVd) and Chrysanthemum chlorotic mottle viroid (CChMVd) with the Chrysanthemum plants exhibiting severe stunting, distinct yellow leaf mottling, and chlorosis was detected in the main chrysanthemum-growing regions of India. Sequence analysis of 90 cDNA clones obtained for CSVd and CChMVd, representing the chrysanthemum-growing regions of India, revealed the high degree of sequence variation throughout the genome under natural conditions. Additionally, all the analyzed CChMVd clones revealed the presence of UUUC in the tetraloop, a signature of symptomatic variants in susceptible cultivars. Phylogenetic analysis revealed that Indian CSVd is closely related to European isolates from ornamentals, whereas CChMVd clustered along with the isolates reported from the East Asian countries.

  6. Diverse Soil Carbon Dynamics Expressed at the Molecular Level

    Science.gov (United States)

    van der Voort, T. S.; Zell, C. I.; Hagedorn, F.; Feng, X.; McIntyre, C. P.; Haghipour, N.; Graf Pannatier, E.; Eglinton, T. I.

    2017-12-01

    The stability and potential vulnerability of soil organic matter (SOM) to global change remain incompletely understood due to the complex processes involved in its formation and turnover. Here we combine compound-specific radiocarbon analysis with fraction-specific and bulk-level radiocarbon measurements in order to further elucidate controls on SOM dynamics in a temperate and subalpine forested ecosystem. Radiocarbon contents of individual organic compounds isolated from the same soil interval generally exhibit greater variation than those among corresponding operationally defined fractions. Notably, markedly older ages of long-chain plant leaf wax lipids (n-alkanoic acids) imply that they reflect a highly stable carbon pool. Furthermore, marked 14C variations among shorter- and longer-chain n-alkanoic acid homologues suggest that they track different SOM pools. Extremes in SOM dynamics thus manifest themselves within a single compound class. This exploratory study highlights the potential of compound-specific radiocarbon analysis for understanding SOM dynamics in ecosystems potentially vulnerable to global change.

  7. Molecular diversity and population structure of the forage grass Hemarthria compressa (Poaceae) in south China based on SRAP markers.

    Science.gov (United States)

    Huang, L-K; Zhang, X-Q; Xie, W-G; Zhang, J; Cheng, L; Yan, H D

    2012-08-16

    Hemarthria compressa is one of the most important and widely utilized forage crops in south China, owing to its high forage yield and capability of adaptation to hot and humid conditions. We examined the population structure and genetic variation within and among 12 populations of H. compressa in south China using sequence-related amplified polymorphism (SRAP) markers. High genetic diversity was found in these samples [percentage polymorphic bands (PPB) = 82.21%, Shannon's diversity index (I) = 0.352]. However, there was relatively low level of genetic diversity at the population level (PPB = 29.17%, I = 0.155). A high degree of genetic differentiation among populations was detected based on other measures and molecular markers (Nei's genetic diversity analysis: G(ST) = 54.19%; AMOVA analysis: F(ST) = 53.35%). The SRAP markers were found to be more efficient than ISSR markers for evaluating population diversity. Based on these findings, we propose changes in sampling strategies for appraising and utilizing the genetic resources of this species.

  8. Molecular diversity of Clostridium botulinum and phenotypically similar strains.

    Science.gov (United States)

    Grenda, T; Kukier, E; Sieradzki, Z; Goldsztejn, M; Kwiatek, K

    2016-12-01

    This study was undertaken to examine phenotypic and genetic features of strains preliminary classified as Clostridium botulinum species. The phenotypic characteristics were assessed with different culture media and biochemical tests. The genetic characterization included detection of botulinum toxin genes by PCR and macrorestriction analysis with SmaI, XhoI and SacII by PFGE (Pulsed-field Gel Electrophoresis). Despite similar biochemical properties of all analysed strains, only 47% of them contained genes determining toxicity specific to C. botulinum species. The most valuable differentiation of C. botulinum and C. botulinum-like strains was obtained after SmaI digestion. The highest affinity was observed among C. botulinum type B profiles which was even up to 100%. It was found 100% of affinity between C. botulinum and C. botulinum-like strains, however, the similarity among C. botulinum and C. botulinum-like was generally lower than 80%.

  9. Molecular and clinical diversity in paraneoplastic immunity to Ma proteins.

    Science.gov (United States)

    Rosenfeld, M R; Eichen, J G; Wade, D F; Posner, J B; Dalmau, J

    2001-09-01

    Antibodies to Ma1 and Ma2 proteins identify a paraneoplastic disorder that affects the limbic system, brain stem, and cerebellum. Preliminary studies suggested the existence of other Ma proteins and different patterns of immune response associated with distinct neurologic symptoms and cancers. In this study, our aim was to isolate the full-length sequence of Ma2 and new family members, identify the major autoantigen of the disorder, and extend the dinical-immunological analysis to 29 patients. Sera from selected patients were used to probe a brainstem cDNA library and isolate the entire Ma2 gene and a new family member, Ma3. Ma3 mRNA is ubiquitously expressed in brain, testis, and several systemic tissues. The variable cellular expression of Ma proteins and analysis of protein motifs suggest that these proteins play roles in the biogenesis of mRNA. Immunoblot studies identify Ma2 as the major autoantigen with unique epitopes recognized by all patients' sera. Eighteen patients had antibodies limited to Ma2: they developed limbic, hypothalamic, and brainstem encephalitis, and 78% had germ-cell tumors of the testis. Eleven patients had antibodies to Ma2 and additional antibodies to Ma1 and/or Ma3; they usually developed additional cerebellar symptoms and more intense brainstem dysfunction, and 82% of these patients had tumors other than germ-cell neoplasms. Overall, 17 of 24 patients (71%) with brain magnetic resonance imaging studies had abnormalities within or outside the temporal lobes, some as contrast-enhancing nodular lesions. A remarkable finding of immunity to Ma proteins is that neurologic symptoms may improve or resolve. This improvement segregated to a group of patients with antibodies limited to Ma2.

  10. Genetic diversity assessment of sesame core collection in China by phenotype and molecular markers and extraction of a mini-core collection

    Science.gov (United States)

    2012-01-01

    Background Sesame (Sesamum indicum L.) is one of the four major oil crops in China. A sesame core collection (CC) was established in China in 2000, but no complete study on its genetic diversity has been carried out at either the phenotypic or molecular level. To provide technical guidance, a theoretical basis for further collection, effective protection, reasonable application, and a complete analysis of sesame genetic resources, a genetic diversity assessment of the sesame CC in China was conducted using phenotypic and molecular data and by extracting a sesame mini-core collection (MC). Results Results from a genetic diversity assessment of sesame CC in China were significantly inconsistent at the phenotypic and molecular levels. A Mantel test revealed the insignificant correlation between phenotype and molecular marker information (r = 0.0043, t = 0.1320, P = 0.5525). The Shannon-Weaver diversity index (I) and Nei genetic diversity index (h) were higher (I = 0.9537, h = 0.5490) when calculated using phenotypic data from the CC than when using molecular data (I = 0.3467, h = 0.2218). A mini-core collection (MC) containing 184 accessions was extracted based on both phenotypic and molecular data, with a low mean difference percentage (MD, 1.64%), low variance difference percentage (VD, 22.58%), large variable rate of coefficient of variance (VR, 114.86%), and large coincidence rate of range (CR, 95.76%). For molecular data, the diversity indices and the polymorphism information content (PIC) for the MC were significantly higher than for the CC. Compared to an alternative random sampling strategy, the advantages of capturing genetic diversity and validation by extracting a MC using an advanced maximization strategy were proven. Conclusions This study provides a comprehensive characterization of the phenotypic and molecular genetic diversities of the sesame CC in China. A MC was extracted using both phenotypic and molecular data. Low MD% and VD%, and large VR% and CR

  11. Genetic diversity assessment of sesame core collection in China by phenotype and molecular markers and extraction of a mini-core collection

    Directory of Open Access Journals (Sweden)

    Zhang Yanxin

    2012-11-01

    Full Text Available Abstract Background Sesame (Sesamum indicum L. is one of the four major oil crops in China. A sesame core collection (CC was established in China in 2000, but no complete study on its genetic diversity has been carried out at either the phenotypic or molecular level. To provide technical guidance, a theoretical basis for further collection, effective protection, reasonable application, and a complete analysis of sesame genetic resources, a genetic diversity assessment of the sesame CC in China was conducted using phenotypic and molecular data and by extracting a sesame mini-core collection (MC. Results Results from a genetic diversity assessment of sesame CC in China were significantly inconsistent at the phenotypic and molecular levels. A Mantel test revealed the insignificant correlation between phenotype and molecular marker information (r = 0.0043, t = 0.1320, P = 0.5525. The Shannon-Weaver diversity index (I and Nei genetic diversity index (h were higher (I = 0.9537, h = 0.5490 when calculated using phenotypic data from the CC than when using molecular data (I = 0.3467, h = 0.2218. A mini-core collection (MC containing 184 accessions was extracted based on both phenotypic and molecular data, with a low mean difference percentage (MD, 1.64%, low variance difference percentage (VD, 22.58%, large variable rate of coefficient of variance (VR, 114.86%, and large coincidence rate of range (CR, 95.76%. For molecular data, the diversity indices and the polymorphism information content (PIC for the MC were significantly higher than for the CC. Compared to an alternative random sampling strategy, the advantages of capturing genetic diversity and validation by extracting a MC using an advanced maximization strategy were proven. Conclusions This study provides a comprehensive characterization of the phenotypic and molecular genetic diversities of the sesame CC in China. A MC was extracted using both phenotypic and molecular data. Low MD% and VD%, and

  12. Wavelet Analysis for Molecular Dynamics

    Science.gov (United States)

    2015-06-01

    Our method takes as input the topology and sparsity of the bonding structure of a molecular system, and returns a hierarchical set of system-specific...problems, such as modeling crack initiation and propagation, or interfacial phenomena. In the present work, we introduce a wavelet-based approach to extend...Several functional forms are common for angle poten- tials complicating not only implementation but also choice of approximation. In all cases, the

  13. 'Ogura'-based 'CMS' lines with different nuclear backgrounds of cabbage revealed substantial diversity at morphological and molecular levels.

    Science.gov (United States)

    Parkash, Chander; Kumar, Sandeep; Singh, Rajender; Kumar, Ajay; Kumar, Satish; Dey, Shyam Sundar; Bhatia, Reeta; Kumar, Raj

    2018-01-01

    A comprehensive study on characterization and genetic diversity analysis was carried out in 16 'Ogura'-based 'CMS' lines of cabbage using 14 agro-morphological traits and 29 SSR markers. Agro-morphological characterization depicted considerable variations for different horticultural traits studied. The genotype, ZHA-2, performed better for most of the economically important quantitative traits. Further, gross head weight (0.76), head length (0.60) and head width (0.83) revealed significant positive correlation with net head weight. Dendrogram based on 10 quantitative traits exhibited considerable diversity among different CMS lines and principle component analysis (PCA) indicated that net and gross head weight, and head length and width are the main components of divergence between 16 CMS lines of cabbage. In molecular study, a total of 58 alleles were amplified by 29 SSR primers, averaging to 2.0 alleles in each locus. High mean values of Shannon's Information index (0.62), expected (0.45) and observed (0.32) heterozygosity and polymorphic information content (0.35) depicted substantial polymorphism. Dendrogram based on Jaccard's similarity coefficient constructed two major groups and eight sub-groups, which revealed substantial diversity among different CMS lines. In overall, based on agro-morphological and molecular studies genotype RRMA, ZHA-2 and RCA were found most divergent. Hence, they have immense potential in future breeding programs for the high-yielding hybrid development in cabbage.

  14. Benchmark Evaluation of True Single Molecular Sequencing to Determine Cystic Fibrosis Airway Microbiome Diversity

    Directory of Open Access Journals (Sweden)

    Andrea Hahn

    2018-05-01

    Full Text Available Cystic fibrosis (CF is an autosomal recessive disease associated with recurrent lung infections that can lead to morbidity and mortality. The impact of antibiotics for treatment of acute pulmonary exacerbations on the CF airway microbiome remains unclear with prior studies giving conflicting results and being limited by their use of 16S ribosomal RNA sequencing. Our primary objective was to validate the use of true single molecular sequencing (tSMS and PathoScope in the analysis of the CF airway microbiome. Three control samples were created with differing amounts of Burkholderia cepacia, Pseudomonas aeruginosa, and Prevotella melaninogenica, three common bacteria found in cystic fibrosis lungs. Paired sputa were also obtained from three study participants with CF before and >6 days after initiation of antibiotics. Antibiotic resistant B. cepacia and P. aeruginosa were identified in concurrently obtained respiratory cultures. Direct sequencing was performed using tSMS, and filtered reads were aligned to reference genomes from NCBI using PathoScope and Kraken and unique clade-specific marker genes using MetaPhlAn. A total of 180–518 K of 6–12 million filtered reads were aligned for each sample. Detection of known pathogens in control samples was most successful using PathoScope. In the CF sputa, alpha diversity measures varied based on the alignment method used, but similar trends were found between pre- and post-antibiotic samples. PathoScope outperformed Kraken and MetaPhlAn in our validation study of artificial bacterial community controls and also has advantages over Kraken and MetaPhlAn of being able to determine bacterial strains and the presence of fungal organisms. PathoScope can be confidently used when evaluating metagenomic data to determine CF airway microbiome diversity.

  15. Seasonality in molecular and cytometric diversity of marine bacterioplankton: the reshuffling of bacterial taxa by vertical mixing

    KAUST Repository

    García, Francisca C.

    2015-07-17

    The ’cytometric diversity’ of phytoplankton communities has been studied based on single-cell properties, but the applicability of this method to characterize bacterioplankton has been unexplored. Here, we analysed seasonal changes in cytometric diversity of marine bacterioplankton along a decadal time-series at three coastal stations in the Southern Bay of Biscay. Shannon-Weaver diversity estimates and Bray-Curtis similarities obtained by cytometric and molecular (16S rRNA tag sequencing) methods were significantly correlated in samples from a 3.5-year monthly time-series. Both methods showed a consistent cyclical pattern in the diversity of surface bacterial communities with maximal values in winter. The analysis of the highly resolved flow cytometry time-series across the vertical profile showed that water column mixing was a key factor explaining the seasonal changes in bacterial composition and the winter increase in bacterial diversity in coastal surface waters. Due to its low cost and short processing time as compared to genetic methods, the cytometric diversity approach represents a useful complementary tool in the macroecology of aquatic microbes.

  16. Molecular analysis of ancient caries

    Science.gov (United States)

    Simón, Marc; Montiel, Rafael; Smerling, Andrea; Solórzano, Eduvigis; Díaz, Nancy; Álvarez-Sandoval, Brenda A.; Jiménez-Marín, Andrea R.; Malgosa, Assumpció

    2014-01-01

    An 84 base pair sequence of the Streptococcus mutans virulence factor, known as dextranase, has been obtained from 10 individuals from the Bronze Age to the Modern Era in Europe and from before and after the colonization in America. Modern samples show four polymorphic sites that have not been found in the ancient samples studied so far. The nucleotide and haplotype diversity of this region have increased over time, which could be reflecting the footprint of a population expansion. While this segment has apparently evolved according to neutral evolution, we have been able to detect one site that is under positive selection pressure both in present and past populations. This study is a first step to study the evolution of this microorganism, analysed using direct evidence obtained from ancient remains. PMID:25056622

  17. Experimental analysis of specification language diversity impact on NPP software diversity

    International Nuclear Information System (INIS)

    Yoo, Chang Sik

    1999-02-01

    In order to increase computer system reliability, software fault tolerance methods have been adopted to some safety critical systems including NPP. Prevention of software common mode failure is very crucial problem in software fault tolerance, but the effective method for this problem is not found yet. In our research, to find out an effective method for prevention of software common mode failure, the impact of specification language diversity on NPP software diversity was examined experimentally. Three specification languages were used to compose three requirements specifications, and programmers made twelve product codes from the specifications. From the product codes analysis, using fault diversity criteria, we concluded that diverse specification language method would enhance program diversity through diversification of requirements specification imperfections

  18. Genetic Diversity of Some Tunisian Botrytis cinerea Isolates Using Molecular Markers

    Directory of Open Access Journals (Sweden)

    D. ben Ahmed

    2005-12-01

    Full Text Available The genetic diversity of Botrytis cinerea in Tunisia was studied using molecular markers, and the level of resistance to the fungicide fenhexamid was shown. Isolates from different plants (grape, tomato, cucumber, onion, strawberry, gerbera and rose and different parts of the country were analysed in order to determine whether the two groups, transposa and vacuma, that were detected in French vineyards, are also present in Tunisia. A combined PCR and Dot Blot method was developed to identify the transposable elements Boty and Flipper that distinguish between these two B. cinerea groups. Both the transposa and vacuma groups, and isolates containing the transposable element Boty, were found in Tunisia. Moreover, analysis of the Bc-hch locus by PCR and restriction enzyme digestion identified only the B. cinerea group corresponding to one allelic type. Finally, by using the level of resistance shown by B. cinerea to the fungicide fenhexamid as a marker, it was confirmed that this was the only group of B. cinerea in the Tunisian population.

  19. Molecular systematics and undescribed diversity of Madagascan scolecophidian snakes (Squamata: Serpentes).

    Science.gov (United States)

    Nagy, Zoltán T; Marion, Angela B; Glaw, Frank; Miralles, Aurélien; Nopper, Joachim; Vences, Miguel; Hedges, S Blair

    2015-11-10

    We provide an updated molecular phylogenetic analysis of global diversity of typhlopid and xenotyphlopid blindsnakes, adding a set of Madagascan samples and sequences of an additional mitochondrial gene to an existing supermatrix of nuclear and mitochondrial gene segments. Our data suggest monophyly of Madagascan typhlopids, exclusive of introduced Indotyphlops braminus. The Madagascar-endemic typhlopid clade includes two species previously assigned to the genus Lemuriatyphlops (in the subfamily Asiatyphlopinae), which were not each others closest relatives. This contradicts a previous study that described Lemuriatyphlops based on a sequence of the cytochrome oxidase subunit 1 gene from a single species and found this species not forming a clade with the other Malagasy species included. Based on our novel phylogenetic assessment we include all species in this endemic typhlopid clade in the genus Madatyphlops and in the subfamily Madatyphlopinae and consider Lemuriatyphlops as junior synonym. Within Madatyphlops, we identify several candidate species. For some of these (those in the M. arenarius complex), our preliminary data suggest sympatric occurrence and morphological differentiation, thus the existence of undescribed species. We also comment on the genus-level classification of several non-Madagascan typhlopids. We suggest that African species included in Madatyphlops (Afrotyphlops calabresii, A. cuneirostris, A. platyrhynchus, and Rhinotyphlops leucocephalus) should not be included in this genus. We furthermore argue that recent claims of Sundatyphlops, Antillotyphlops, and Cubatyphlops being "undiagnosable" or "not monophyletic" were based on errors in tree reconstruction and failure to notice diagnostic characters, and thus regard these three genera as valid.

  20. Molecular Diversity of Sea Spray Aerosol Particles: Impact of Ocean Biology on Particle Composition and Hygroscopicity

    Energy Technology Data Exchange (ETDEWEB)

    Cochran, Richard E.; Laskina, Olga; Trueblood, Jonathan; Estillore, Armando D.; Morris, Holly S.; Jayarathne, Thilina; Sultana, Camile M.; Lee, Christopher; Lin, Peng; Laskin, Julia; Laskin, Alexander; Dowling, Jackie; Qin, Zhen; Cappa, Christopher; Bertram, Timothy; Tivanski, Alexei V.; Stone, Elizabeth; Prather, Kimberly; Grassian, Vicki H.

    2017-05-01

    The impact of sea spray aerosol (SSA) on climate depends on the size and chemical composition of individual particles that make-up the total SSA ensemble. While the organic fraction of SSA has been characterized from a bulk perspective, there remains a lack of understanding as to the composition of individual particles within the SSA ensemble. To better understand the molecular components within SSA particles and how SSA composition changes with ocean biology, simultaneous measurements of seawater and SSA were made during a month-long mesocosm experiment performed in an ocean-atmosphere facility. Herein, we deconvolute the composition of freshly emitted SSA devoid of anthropogenic and terrestrial influences by characterizing classes of organic compounds as well as specific molecules within individual SSA particles. Analysis of SSA particles show that the diversity of molecules within the organic fraction varies between two size fractions (submicron and supermicron) with contributions from fatty acids, monosaccharides, polysaccharides and siliceous material. Significant changes in the distribution of these compounds within individual particles are observed to coincide with the rise and fall of phytoplankton and bacterial populations within the seawater. Furthermore, water uptake is impacted as shown by hygroscopicity measurements of model systems composed of representative organic compounds. Thus, the how changes in the hygroscopic growth of SSA evolves with composition can be elucidated. Overall, this study provides an important connection between biological processes that control the composition of seawater and changes in single particle composition which will enhances our ability to predict the impact of SSA on climate.

  1. Effects of solar ultraviolet radiation (UVR) on molecular diversity of plankton from the Chubut rivers estuary

    International Nuclear Information System (INIS)

    Manrique, J.M.; Halac, S.; Calvo, A.Y.; Villafane, V.; Jones, L.R.; Helbling, W.E.

    2010-01-01

    Within the framework of a project designed to evaluate the impact of UVR upon estuarine plankton, we present here a molecular analysis of plankton diversity. Water samples were exposed to three radiation treatments (PAR, PAR + UV-A and PAR + UV-A + UV-B) in microcosms for ca 10 days during the Austral summer. At the beginning (t 0 ) and at the end of the experiment samples were filtered 0 through 20, 10, 5 and 0.22 μm pore sizes. The DNA amount retained in each filter indicated that most of the plankton biomass was in the 0.22-5 μm fraction at t0. In contrast, at the end of the experiment this proportion changed according to the radiation treatment and big cells (> 20 μm) dominated. An rDNA library was obtained from the DNA corresponding to the 0.22-5 μm fraction. There was no relationship between treatments and the number and frequency of restriction genotypes. Analyses of 27 clones fraction from t 0 indicated the presence of three genera of Rhodobacteraceae, one genus of Rhodospirillaceae, one SAR11 genus, one genus of Bacillaceae, an unclassified sequences of Alphaproteobacteria, Actinobacteria and Rhodospirillaceae. Also, there were six sequences similar to Ostreococcus tauri (Mamiellales). Even though the sequence analyses are still ongoing, our initial data suggest a big impact of UV-B radiation in the amount and composition of the plankton community towards big cells. (authors)

  2. Diversity

    Science.gov (United States)

    Portraits In Courage Vol. VIII Portraits In Courage Vol. IX Portraits In Courage Vol. X AF Sites Social -Wide Initiative to Promote Diversity and Inclusion in the Federal Workforce Executive Order 13548 : Virtual Diversity Conference Air Force Diversity & Inclusion Air Force Diversity Graphic There is no

  3. Molecular and cytological characterization of the global Musa germplasm collection provides insights into the treasure of banana diversity

    Czech Academy of Sciences Publication Activity Database

    Christelová, Pavla; De Langhe, E.; Hřibová, Eva; Čížková, Jana; Sardos, J.; Hušáková, Markéta; Van den Houwe, I.; Sutanto, A.; Kepler, A.K.; Swennen, R.; Roux, N.; Doležel, Jaroslav

    2017-01-01

    Roč. 26, č. 4 (2017), s. 801-824 ISSN 0960-3115 R&D Projects: GA MŠk(CZ) LO1204; GA MŠk(CZ) LG12021; GA MŠk LG15017 Institutional support: RVO:61389030 Keywords : genetic-linkage map * aab group * balbisiana colla * acuminata colla * black sigatoka * population-structure * marker analysis * flow-cytometry * plantain musa * aflp markers * Classification * Gene bank * Genetic diversity * ITC collection * Microsatellites * Musa Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Plant sciences, botany Impact factor: 2.265, year: 2016

  4. Processes underpinning development and maintenance of diversity in rice in West Africa: evidence from combining morphological and molecular markers.

    Directory of Open Access Journals (Sweden)

    Alfred Mokuwa

    Full Text Available We assessed the interplay of artificial and natural selection in rice adaptation in low-input farming systems in West Africa. Using 20 morphological traits and 176 molecular markers, 182 farmer varieties of rice (Oryza spp. from 6 West African countries were characterized. Principal component analysis showed that the four botanical groups (Oryza sativa ssp. indica, O. sativa ssp. japonica, O. glaberrima, and interspecific farmer hybrids exhibited different patterns of morphological diversity. Regarding O. glaberrima, morphological and molecular data were in greater conformity than for the other botanical groups. A clear difference in morphological features was observed between O. glaberrima rices from the Togo hills and those from the Upper Guinea Coast, and among O. glaberrima rices from the Upper Guinea Coast. For the other three groups such clear patterns were not observed. We argue that this is because genetic diversity is shaped by different environmental and socio-cultural selection pressures. For O. glaberrima, recent socio-cultural selection pressures seemed to restrict genetic diversity while this was not observed for the other botanical groups. We also show that O. glaberrima still plays an important role in the selection practices of farmers and resulting variety development pathways. This is particularly apparent in the case of interspecific farmer hybrids where a relationship was found between pericarp colour, panicle attitude and genetic diversity. Farmer varieties are the product of long and complex trajectories of selection governed by local human agency. In effect, rice varieties have emerged that are adapted to West African farming conditions through genotype × environment × society interactions. The diversity farmers maintain in their rice varieties is understood to be part of a risk-spreading strategy that also facilitates successful and often serendipitous variety innovations. We advocate, therefore, that farmers and

  5. Processes underpinning development and maintenance of diversity in rice in West Africa: evidence from combining morphological and molecular markers.

    Science.gov (United States)

    Mokuwa, Alfred; Nuijten, Edwin; Okry, Florent; Teeken, Béla; Maat, Harro; Richards, Paul; Struik, Paul C

    2014-01-01

    We assessed the interplay of artificial and natural selection in rice adaptation in low-input farming systems in West Africa. Using 20 morphological traits and 176 molecular markers, 182 farmer varieties of rice (Oryza spp.) from 6 West African countries were characterized. Principal component analysis showed that the four botanical groups (Oryza sativa ssp. indica, O. sativa ssp. japonica, O. glaberrima, and interspecific farmer hybrids) exhibited different patterns of morphological diversity. Regarding O. glaberrima, morphological and molecular data were in greater conformity than for the other botanical groups. A clear difference in morphological features was observed between O. glaberrima rices from the Togo hills and those from the Upper Guinea Coast, and among O. glaberrima rices from the Upper Guinea Coast. For the other three groups such clear patterns were not observed. We argue that this is because genetic diversity is shaped by different environmental and socio-cultural selection pressures. For O. glaberrima, recent socio-cultural selection pressures seemed to restrict genetic diversity while this was not observed for the other botanical groups. We also show that O. glaberrima still plays an important role in the selection practices of farmers and resulting variety development pathways. This is particularly apparent in the case of interspecific farmer hybrids where a relationship was found between pericarp colour, panicle attitude and genetic diversity. Farmer varieties are the product of long and complex trajectories of selection governed by local human agency. In effect, rice varieties have emerged that are adapted to West African farming conditions through genotype × environment × society interactions. The diversity farmers maintain in their rice varieties is understood to be part of a risk-spreading strategy that also facilitates successful and often serendipitous variety innovations. We advocate, therefore, that farmers and farmer varieties should

  6. Molecular diversity of Epstein-Barr virus IgG and IgA antibody responses in nasopharyngeal carcinoma: a comparison of Indonesian, Chinese, and European subjects.

    NARCIS (Netherlands)

    Fachiroh, J.; Schouten, T; Hariwiyanto, B; Paramita, D.K.; Harijadi, A; Haryana, SM; Ng, MH; Middeldorp, J.M.

    2004-01-01

    Epstein-Barr virus (EBV)-specific immunoblot analysis was used to reveal the molecular diversity of immunoglobulin (Ig) G and IgA antibody responses against Epstein-Barr nuclear antigen (EBNA), early antigen (EA), and viral capsid antigen (VCA) in serum samples from patients with nasopharyngeal

  7. Evolution of species diversity in the genus Chamaecostus (Costaceae): molecular phylogenetics and morphometric approaches

    OpenAIRE

    Andre, Thiago; Specht, Chelsea; Salzman, Shayla; Palma-Silva, Clarisse [UNESP; Wendt, Tania

    2015-01-01

    While most species within the genus Chamaecostus (Costaceae) are well defined, the broad geographic range and long list of synonyms associated with Chamaecostus subsessilis led us to believe there may be some cryptic species within the complex. We thus investigate the phylogenetic relationships of species in the Chamaecostus lineage and specifically test the monophyly and diversity of the Chamaecostus subsessilis species complex from a population perspective by analyzing molecular sequence da...

  8. United in Diversity : A Physiological and Molecular Characterization of Subpopulations in the Basal Ganglia Circuitry

    OpenAIRE

    Viereckel, Thomas

    2017-01-01

    The Basal Ganglia consist of a number of different nuclei that form a diverse circuitry of GABAergic, dopaminergic and glutamatergic neurons. This complex network is further organized in subcircuits that govern limbic and motor functions in humans and other vertebrates. Due to the interconnection of the individual structures, dysfunction in one area or cell population can affect the entire network, leading to synaptic and molecular alterations in the circuitry as a whole. The studies in this ...

  9. Molecular diversity of fungi from marine oxygen-deficient environments (ODEs)

    Digital Repository Service at National Institute of Oceanography (India)

    Manohar, C.S.; Forster, D.; Kauff, F.; Stoeck, T.

    . Sparrow Jr F K (1936) Biological observations of the marine fungi of woods hole waters. Biol Bull 70: 236-263. States JS & Christensen M (2001) Fungi Associated with Biological Soil Crusts in Desert Grasslands of Utah and Wyoming. Mycologia 93: 432... version: Biology of marine fungi. Ed. by: Raghukumar, C. (Prog. Mol. Subcellular Biol). Springer, vol.53 (Chap 10); 2012; 189-208 Chapter # 10 Molecular diversity of fungi from marine oxygen-deficient environments (ODEs) Cathrine S. Jebaraj 1...

  10. Hidden diversity and evolutionary trends in malacosporean parasites (Cnidaria: Myxozoa) identified using molecular phylogenetics

    Czech Academy of Sciences Publication Activity Database

    Bartošová, Pavla; Hrabcová, M.; Pecková, Hana; Patra, Sneha; Kodádková, Alena; Jurajda, Pavel; Tyml, Tomáš; Holzer, Astrid S.

    2014-01-01

    Roč. 44, č. 8 (2014), s. 565-577 ISSN 0020-7519 R&D Projects: GA ČR(CZ) GPP506/11/P724; GA ČR GBP505/12/G112; GA AV ČR(CZ) M200961205 Institutional support: RVO:60077344 ; RVO:68081766 Keywords : Buddenbrockia * Tetracapsuloides * diversity * phylogeny * Bryozoa * fish * cryptic * worm Subject RIV: EB - Genetics ; Molecular Biology; EG - Zoology (UBO-W) Impact factor: 3.872, year: 2014

  11. Morphological and molecular diversity in a collection of the Andean tree tomato (Solanum betaceum Cav.)

    OpenAIRE

    Acosta-Quezada, P.G.; Martinez-Laborde, J.B.; Vilanova Navarro, Santiago; Prohens Tomás, Jaime

    2011-01-01

    Instituto Nacional de Investigaciones Agrarias y Agroalimentarias (RF2008-00008-00-00) Acosta-Quezada, P.; Martinez-Laborde, J.; Vilanova Navarro, S.; Prohens Tomás, J. (2011). Morphological and molecular diversity in a collection of the Andean tree tomato (Solanum betaceum Cav.). Bulletin of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca : Horticulture. 68(1):500-501. http://hdl.handle.net/10251/63083 Senia 500 501 68 1

  12. Molecular analyses reveal high species diversity of trematodes in a sub-Arctic lake

    Science.gov (United States)

    Soldánová, Miroslava; Georgieva, Simona; Roháčováa, Jana; Knudsen, Rune; Kuhn, Jesper A.; Henriksen, Eirik H.; Siwertsson, Anna; Shaw, Jenny C.; Kuris, Armand M.; Amundsen, Per-Arne; Scholz, Tomáš; Lafferty, Kevin D.; Kostadinova, Aneta

    2017-01-01

    To identify trematode diversity and life-cycles in the sub-Arctic Lake Takvatn, Norway, we characterised 120 trematode isolates from mollusc first intermediate hosts, metacercariae from second intermediate host fishes and invertebrates, and adults from fish and invertebrate definitive hosts, using molecular techniques. Phylogenies based on nuclear and/or mtDNA revealed high species richness (24 species or species-level genetic lineages), and uncovered trematode diversity (16 putative new species) from five families typical in lake ecosystems (Allocreadiidae, Diplostomidae, Plagiorchiidae, Schistosomatidae and Strigeidae). Sampling potential invertebrate hosts allowed matching of sequence data for different stages, thus achieving molecular elucidation of trematode life-cycles and exploration of host-parasite interactions. Phylogenetic analyses also helped identify three major mollusc intermediate hosts (Radix balthica, Pisidium casertanum and Sphaerium sp.) in the lake. Our findings increase the known trematode diversity at the sub-Arctic Lake Takvatn, showing that digenean diversity is high in this otherwise depauperate sub-Arctic freshwater ecosystem, and indicating that sub-Arctic and Arctic ecosystems may be characterised by unique trematode assemblages.

  13. Analysis of genetic diversity in mango ( Mangifera indica L.) using ...

    African Journals Online (AJOL)

    Analysis of genetic diversity in mango ( Mangifera indica L.) using isozymetic polymorphism. ... All the isozymes, used in the present study showed polymorphism for mango. A total of 25 different electrophoretic ... HOW TO USE AJOL.

  14. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

    Science.gov (United States)

    Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

    2016-02-01

    Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.

  15. COMPARITIVE GENETIC DIVERSITY ANALYSIS OF OAT (Avena ...

    African Journals Online (AJOL)

    knsccf

    protein and 30 to 35% dry matter. ... environment interaction, hence not much dependable but ... Principal coordinate (3D) analysis was .... Relationships among 20 genotypes of oat visualized by principal component analysis (PCoA) of rainfed ...

  16. Molecular Characterization and Genetic Diversity of the Macaw Palm Ex Situ Germplasm Collection Revealed by Microsatellite Markers

    Directory of Open Access Journals (Sweden)

    Fekadu G. Mengistu

    2016-10-01

    Full Text Available Macaw palm (Acrocomia aculeata is native to tropical forests in South America and highly abundant in Brazil. It is cited as a highly productive oleaginous palm tree presenting high potential for biodiesel production. The aim of this work was to characterize and study the genetic diversity of A. aculeata ex situ collections from different geographical states in Brazil using microsatellite (Simple Sequence Repeats, SSR markers. A total of 192 accessions from 10 provenances were analyzed with 10 SSR, and variations were detected in allelic diversity, polymorphism, and heterozygosity in the collections. Three major groups of accessions were formed using PCoA—principal coordinate analysis, UPGMA—unweighted pair-group method with arithmetic mean, and Tocher. The Mantel test revealed a weak correlation (r = 0.07 between genetic and geographic distances among the provenances reaffirming the result of the grouping. Reduced average heterozygosity (Ho < 50% per locus (or provenance confirmed the predominance of endogamy (or inbreeding in the germplasm collections as evidenced by positive inbreeding coefficient (F > 0 per locus (or per provenance. AMOVA—Analysis of Molecular Variance revealed higher (48.2% genetic variation within population than among populations (36.5%. SSR are useful molecular markers in characterizing A. aculeata germplasm and could facilitate the process of identifying, grouping, and selecting genotypes. Present results could be used to formulate appropriate conservation strategies in the genebank.

  17. Molecular phylogeny of mangroves IV. nature and extent of intra-specific genetic variation and species diversity in mangroves

    International Nuclear Information System (INIS)

    Parida, A.; Parani, M.; Lakshmi, M.; Elango, S.; Ram, N.; Anuratha, C.S.

    1998-01-01

    Mangroves occupy estuarine ecosystems in the tropical regions of the world. Despite their highly productive nature and the protective roles they play in the coastal region, the ecosystem as a whole is under severe threat due to various climatic and anthropogenic factors. Therefore, the need for conservation of mangroves is widely emphasised. However, information on existing genetic diversity based on which a strategy for genetic conservation is to be drawn is not available for mangroves. This is primarily because conventional genetic analysis is difficult in these species for various reasons. Therefore, as an aid to our on-going conservation programme, efforts were made to assess the nature and extent of diversity in a number of mangrove species of the Indian coast using molecular markers. The nature and extent of intra-population diversity in sixteen mangrove species and detailed analysis of inter-population genetic polymorphism in four species, Acanthus ilicifolius, Excoecaria agallocha, Avicennia spp and Rhizophora (species and hybrid), is reported in the present communication. (author)

  18. Molecular phylogeny of mangroves IV. nature and extent of intra-specific genetic variation and species diversity in mangroves

    Energy Technology Data Exchange (ETDEWEB)

    Parida, A; Parani, M; Lakshmi, M; Elango, S; Ram, N; Anuratha, C S [M.S. Swaminathan Research Foundation, Taramani, Madras (India)

    1998-10-01

    Mangroves occupy estuarine ecosystems in the tropical regions of the world. Despite their highly productive nature and the protective roles they play in the coastal region, the ecosystem as a whole is under severe threat due to various climatic and anthropogenic factors. Therefore, the need for conservation of mangroves is widely emphasised. However, information on existing genetic diversity based on which a strategy for genetic conservation is to be drawn is not available for mangroves. This is primarily because conventional genetic analysis is difficult in these species for various reasons. Therefore, as an aid to our on-going conservation programme, efforts were made to assess the nature and extent of diversity in a number of mangrove species of the Indian coast using molecular markers. The nature and extent of intra-population diversity in sixteen mangrove species and detailed analysis of inter-population genetic polymorphism in four species, Acanthus ilicifolius, Excoecaria agallocha, Avicennia spp and Rhizophora (species and hybrid), is reported in the present communication. (author) 25 refs, 2 figs, 2 tabs

  19. Outage analysis of blind cooperative diversity

    KAUST Repository

    Tourki, Kamel; Alouini, Mohamed-Slim

    2011-01-01

    Mobile users with single antennas can still take advantage of spatial diversity through cooperative space-time-encoded transmission. In this paper, we considered a scheme in which a relay chooses to cooperate only if its source-relay channel is of an acceptable quality, and we evaluate the usefulness of relaying when the source acts blindly and ignores the decision of the relays whether they may cooperate or not. In our study, we consider the regenerative relays in which the decisions to cooperate are based on a targeted end-to-end data rate R. We derived the end-to-end outage probability for a transmission rate R and a code rate ρ and look at a power allocation strategy between the source and the relays in order to minimize the end-to-end outage probability at the destination for high signal-to-noise ratio, by using the golden section search method. Performance results show that the computer simulations-based results coincide with our analytical results. Copyright © 2011 John Wiley & Sons, Ltd.

  20. Outage analysis of blind cooperative diversity

    KAUST Repository

    Tourki, Kamel

    2011-06-06

    Mobile users with single antennas can still take advantage of spatial diversity through cooperative space-time-encoded transmission. In this paper, we considered a scheme in which a relay chooses to cooperate only if its source-relay channel is of an acceptable quality, and we evaluate the usefulness of relaying when the source acts blindly and ignores the decision of the relays whether they may cooperate or not. In our study, we consider the regenerative relays in which the decisions to cooperate are based on a targeted end-to-end data rate R. We derived the end-to-end outage probability for a transmission rate R and a code rate ρ and look at a power allocation strategy between the source and the relays in order to minimize the end-to-end outage probability at the destination for high signal-to-noise ratio, by using the golden section search method. Performance results show that the computer simulations-based results coincide with our analytical results. Copyright © 2011 John Wiley & Sons, Ltd.

  1. Detailed Molecular Epidemiologic Characterization of HIV-1 Infection in Bulgaria Reveals Broad Diversity and Evolving Phylodynamics

    Science.gov (United States)

    Ivanov, Ivailo Alexiev; Beshkov, Danail; Shankar, Anupama; Hanson, Debra L.; Paraskevis, Dimitrios; Georgieva, Viara; Karamacheva, Lyudmila; Taskov, Hristo; Varleva, Tonka; Elenkov, Ivaylo; Stoicheva, Mariana; Nikolova, Daniela; Switzer, William M.

    2013-01-01

    Limited information is available to describe the molecular epidemiology of HIV-1 in Bulgaria. To better understand the genetic diversity and the epidemiologic dynamics of HIV-1 we analyzed 125 new polymerase (pol) sequences from Bulgarians diagnosed through 2009 and 77 pol sequences available from our previous study from persons infected prior to 2007. Epidemiologic and demographic information was obtained from each participant and phylogenetic analysis was used to infer HIV-1 evolutionary histories. 120 (59.5%) persons were infected with one of five different HIV-1 subtypes (A1, B, C, F1 and H) and 63 (31.2%) persons were infected with one of six different circulating recombinant forms (CRFs; 01_AE, 02_AG, 04_cpx, 05_DF, 14_BG, and 36_cpx). We also for the first time identified infection with two different clusters of unique A-like and F-like sub-subtype variants in 12 persons (5.9%) and seven unique recombinant forms (3.5%), including a novel J/C recombinant. While subtype B was the major genotype identified and was more prevalent in MSM and increased between 2000–2005, most non-B subtypes were present in persons ≥45 years old. CRF01_AE was the most common non-B subtype and was higher in women and IDUs relative to other risk groups combined. Our results show that HIV-1 infection in Bulgaria reflects the shifting distribution of genotypes coincident with the changing epidemiology of the HIV-1 epidemic among different risk groups. Our data support increased public health interventions targeting IDUs and MSM. Furthermore, the substantial and increasing HIV-1 genetic heterogeneity, combined with fluctuating infection dynamics, highlights the importance of sustained and expanded surveillance to prevent and control HIV-1 infection in Bulgaria. PMID:23527245

  2. Distribution and molecular diversity of three cucurbit-infecting poleroviruses in China.

    Science.gov (United States)

    Shang, Qiao-xia; Xiang, Hai-ying; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

    2009-11-01

    Cucurbit aphid-borne yellows virus (CABYV) and Melon aphid-borne yellows virus (MABYV) have been found to be associated with cucurbit yellowing disease in China. Our report identifies for the first time a third distinct polerovirus, tentatively named Suakwa aphid-borne yellows virus (SABYV), infecting Suakwa vegetable sponge. To better understand the distribution and molecular diversity of these three poleroviruses infecting cucurbits, a total of 214 cucurbitaceous crop samples were collected from 25 provinces in China, and were investigated by RT-PCR and sequencing. Of these, 108 samples tested positive for CABYV, while 40 samples from five provinces were positive for MABYV, and SABYV was detected in only 4 samples which were collected in the southern part of China. Forty-one PCR-amplified fragments containing a portion of the RdRp gene, intergenic NCR and CP gene were cloned and sequenced. Sequence comparisons showed that CABYV isolates shared 78.0-79.2% nucleotide sequence identity with MABYV isolates, and 69.7-70.8% with SABYV. Sequence identity between MABYV and SABYV was 73.3-76.5%. In contrast, the nucleotide identities within each species were 93.2-98.7% (CABYV), 98.1-99.9% (MABYV), and 96.1-98.6% (SABYV). Phylogenetic analyses revealed that the polerovirus isolates fit into three distinct groups, corresponding to the three species. The CABYV group could be further divided into two subgroups: the Asia subgroup and the Mediterranean subgroup, based on CP gene and partial RdRp gene sequences. Recombination analysis suggested that MABYV may be a recombinant virus.

  3. Analysis of genetic diversity inpigeonpeagermplasm using ...

    Indian Academy of Sciences (India)

    Navya

    2016-11-25

    Nov 25, 2016 ... accessions from Orissa (105) and AP (15) do not group with any Indian accessions. ... In the present work, comparison between SSAP and REMAP revealed ... (sequence-specific amplified polymorphism) for genetic analysis of sweet potato. ... Sharma,V.and Nandinemi, M.R. 2014 Assessment of genetic ...

  4. Protein change in plant evolution: tracing one thread connecting molecular and phenotypic diversity

    Directory of Open Access Journals (Sweden)

    Madelaine eBartlett

    2013-10-01

    Full Text Available Proteins change over the course of evolutionary time. New protein-coding genes and gene families emerge and diversify, ultimately affecting an organism’s phenotype and interactions with its environment. Here we survey the range of structural protein change observed in plants and review the role these changes have had in the evolution of plant form and function. Verified examples tying evolutionary change in protein structure to phenotypic change remain scarce. We will review the existing examples, as well as draw from investigations into domestication, and quantitative trait locus (QTL cloning studies searching for the molecular underpinnings of natural variation. The evolutionary significance of many cloned QTL has not been assessed, but all the examples identified so far have begun to reveal the extent of protein structural diversity tolerated in natural systems. This molecular (and phenotypic diversity could come to represent part of natural selection’s source material in the adaptive evolution of novel traits. Protein structure and function can change in many distinct ways, but the changes we identified in studies of natural diversity and protein evolution were predicted to fall primarily into one of six categories: altered active and binding sites; hypomorphic and hypermorphic alleles; altered protein-protein interactions; altered domain content; altered protein stability; and altered activity as an activator or repressor. Variability was also observed in the evolutionary scale at which particular changes were observed. Some changes were detected at both micro- and macroevolutionary timescales, while others were observed primarily at deep or shallow phylogenetic levels. This variation might be used to determine the trajectory of future investigations in structural molecular evolution.

  5. Efficiency of Floristic and Molecular Markers to Determine Diversity in Iranian Populations of T. boeoticum

    OpenAIRE

    M. R. Naghavi; M. Maleki; S. F. Tabatabaei

    2009-01-01

    In order to study floristic and molecular classification of common wild wheat (Triticum boeoticum Boiss.), an analysis was conducted on populations of the Triticum boeoticum collected from different regions of Iran. Considering all floristic compositions of habitats, six floristic groups (syntaxa) within the populations were identified. A high level of variation of T. boeoticum also detected using SSR markers. Our results showed that molecular method confirmed the groupin...

  6. Linguistic measures of chemical diversity and the "keywords" of molecular collections.

    Science.gov (United States)

    Woźniak, Michał; Wołos, Agnieszka; Modrzyk, Urszula; Górski, Rafał L; Winkowski, Jan; Bajczyk, Michał; Szymkuć, Sara; Grzybowski, Bartosz A; Eder, Maciej

    2018-05-15

    Computerized linguistic analyses have proven of immense value in comparing and searching through large text collections ("corpora"), including those deposited on the Internet - indeed, it would nowadays be hard to imagine browsing the Web without, for instance, search algorithms extracting most appropriate keywords from documents. This paper describes how such corpus-linguistic concepts can be extended to chemistry based on characteristic "chemical words" that span more than traditional functional groups and, instead, look at common structural fragments molecules share. Using these words, it is possible to quantify the diversity of chemical collections/databases in new ways and to define molecular "keywords" by which such collections are best characterized and annotated.

  7. Incidence, Diversity, and Molecular Epidemiology of Sapoviruses in Swine across Europe

    DEFF Research Database (Denmark)

    Reuter, G.; Zimsek-Mijovski, J.; Poljsak-Prijatelj, M.

    2010-01-01

    report on the incidence, genetic diversity and molecular epidemiology of sapoviruses detected in domestic pigs in a comprehensive study conducted in six European countries (Denmark, Finland, Hungary, Italy, Slovenia and Spain) between 2004 and 2007. A total of 1,050 swine fecal samples from 88 pig farms......) to human sapovirus strains. Sapoviruses are commonly circulating and endemic agents in swine herds throughout Europe. Highly heterogenous and potential new genogroups of sapoviruses were found in pigs; however, no "human-like" sapoviruses were detected....

  8. Molecular Markers for Genetic Diversity Studies of European Hare (Lepus europaeus Pallas, 1778 Populations

    Directory of Open Access Journals (Sweden)

    Noémi Soós

    2015-05-01

    Full Text Available The purpose of this article is to give an overview of different molecular techniques which have been used in studies concerning population genetic issues of Lepus species and specifically of L. europaeus. The importance of these researches is ever-growing as the European populations of the brown hare have suffered several falloffs as a consequent upon both natural and anthropogenic effects. With developing tools and techniques molecular genetics have become the centrepiece of population genetics and conservation biology. Nucleic acid methods based on both bi- and uniparentally inherited DNA (allozymes, microsatellites, Y chromosome, mtDNA are often used to study genetic structure, diversity and phylogeography of different species’ populations due to their effectiveness in identifying genetic variability

  9. Molecular diversity, population structure, and linkage disequilibrium in a worldwide collection of tobacco (Nicotiana tabacum L. germplasm

    Directory of Open Access Journals (Sweden)

    Fricano Agostino

    2012-03-01

    Full Text Available Abstract Background The goals of our study were to assess the phylogeny and the population structure of tobacco accessions representing a wide range of genetic diversity; identify a subset of accessions as a core collection capturing most of the existing genetic diversity; and estimate, in the tobacco core collection, the extent of linkage disequilibrium (LD in seven genomic regions using simple sequence repeat (SSR markers. To this end, a collection of accessions were genotyped with SSR markers. Molecular diversity was evaluated and LD was analyzed across seven regions of the genome. Results A genotyping database for 312 tobacco accessions was profiled with 49 SSR markers. Principal Coordinate Analysis (PCoA and Bayesian cluster analysis revealed structuring of the tobacco population with regard to commercial classes and six main clades were identified, which correspond to "Oriental", Flue-Cured", "Burley", "Dark", "Primitive", and "Other" classes. Pairwise kinship was calculated between accessions, and an overall low level of co-ancestry was observed. A set of 89 genotypes was identified that captured the whole genetic diversity detected at the 49 loci. LD was evaluated on these genotypes, using 422 SSR markers mapping on seven linkage groups. LD was estimated as squared correlation of allele frequencies (r2. The pattern of intrachromosomal LD revealed that in tobacco LD extended up to distances as great as 75 cM with r2 > 0.05 or up to 1 cM with r2 > 0.2. The pattern of LD was clearly dependent on the population structure. Conclusions A global population of tobacco is highly structured. Clustering highlights the accessions with the same market class. LD in tobacco extends up to 75 cM and is strongly dependent on the population structure.

  10. Molecular diversity and phylogeny of Triticum-Aegilops species possessing D genome revealed by SSR and ISSR markers

    Directory of Open Access Journals (Sweden)

    Moradkhani Hoda

    2015-12-01

    Full Text Available The aim of this study is investigation the applicability of SSR and ISSR markers in evaluating the genetic relationships in twenty accessions of Aegilops and Triticum species with D genome in different ploidy levels. Totally, 119 bands and 46 alleles were detected using ten primers for ISSR and SSR markers, respectively. Polymorphism Information Content values for all primers ranged from 0.345 to 0.375 with an average of 0.367 for SSR, and varied from 0.29 to 0.44 with the average 0.37 for ISSR marker. Analysis of molecular variance (AMOVA revealed that 81% (ISSR and 84% (SSR of variability was partitioned among individuals within populations. Comparing the genetic diversity of Aegilops and Triticum accessions, based on genetic parameters, shows that genetic variation of Ae. crassa and Ae. tauschii species are higher than other species, especially in terms of Nei’s gene diversity. Cluster analysis, based on both markers, separated total accessions in three groups. However, classification based on SSR marker data was not conformed to classification according to ISSR marker data. Principal co-ordinate analysis (PCoA for SSR and ISSR data showed that, the first two components clarified 53.48% and 49.91% of the total variation, respectively. This analysis (PCoA, also, indicated consistent patterns of genetic relationships for ISSR data sets, however, the grouping of accessions was not completely accorded to their own geographical origins. Consequently, a high level of genetic diversity was revealed from the accessions sampled from different eco-geographical regions of Iran.

  11. 16S/18S ribosomal DNA clone library analysis of rumen microbial diversity

    International Nuclear Information System (INIS)

    Wright, A.G.; Kiyoshi Tajima; Aminov, R.I.

    2005-01-01

    diversity. Furthermore, the retrieved SSU-rDNA sequence-information lays a background for the development of other molecular detection techniques such as FISH, FISH-FC, DNA microarrays and quantitative real-time PCR techniques. The application of molecular techniques has already revealed the enormous wealth of microbial diversity and putative novel species in the rumen. In this Chapter, the main steps of SSU-rDNA library generation and analysis will be presented and discussed in detail

  12. Morphophysiology, Phenotypic and Molecular Diversity of Auxin-induced Passiflora mucronata Lam. (Passifloraceae).

    Science.gov (United States)

    França, Juliany M; Venial, Lucimara R; Costa, Eloá B; Schmildt, Edilson R; Schmildt, Omar; Bernardes, Paula M; Tatagiba, Sandro D; Lopes, José C; Ferreira, Marcia F S; Alexandre, Rodrigo S

    2018-01-01

    Genetic diversity allows identification of potential intraspecific genotypes in the genus Passiflora. The objective of this study was to examine the morphological and genetic diversity of auxin-induced Passiflora mucronata. The experiments were arranged in a complete randomized block design, with a 9 x 2 factorial arrangement (nine genotypes x presence and absence of auxin, indole-3-butyric acid (IBA)), with four replicates of 16 cuttings. The rooting and vegetative growth responses were variable. Genotype 5 was more responsive in the absence of IBA and genotypes 3, 8 and 9 were more responsive in the presence of IBA. Auxin increased rooting rate and percentage, reducing the average time of root protrusion in eight days. IBA also contributed to increase photosynthesis and dry root and shoot mass in 55.55 and 44.44% of the genotypes, respectively. The highest relative contribution to phenotypic diversity in the absence of auxin was rate (38.75%) and percentage (20.27%) of rooting, whereas in the presence of auxin was stomatal conductance (23.19%) and root dry mass (20.91%). Similarity was found for phenotypic and molecular divergence in the presence of IBA, in which genotypes 1 and 6; genotypes 5, 8 and 9; and genotype 3 were clustered in distinct groups.

  13. Molecular systematics reveals increased diversity within the South African Laurencia complex (Rhodomelaceae, Rhodophyta).

    Science.gov (United States)

    Francis, Caitlynne; Bolton, John J; Mattio, Lydiane; Mandiwana-Neudani, Tshifhiwa G; Anderson, Robert J

    2017-08-01

    Previous publications list ten species in the Laurencia complex from South Africa with all ascribed to the genus Laurencia sensu stricto. However, the diversity of the complex in South Africa has not yet been re-assessed following the numerous recent taxonomic changes. This study investigated the phylogenetic relationships and taxonomy of this group in South Africa using recent collections. Methods included molecular phylogenetic analyses of plastid rbcL gene sequences (a total of 146; including eleven outgroup taxa) using Maximum Likelihood and Bayesian Inference, and the examination of morphological and anatomical characters, including the number of corps en cerise when present. The seven genera of the Laurencia complex formed monophyletic clades with high posterior probabilities. Seventeen morphotypes were identified: 14 in the genus Laurencia sensu stricto, among which eight corresponded to Laurencia species currently recognized from South Africa and one each to species of Palisada, Chondrophycus, and Laurenciella. The six remaining morphotypes in Laurencia sensu stricto did not match any descriptions and are described here as five new species: Laurencia alfredensis sp. nov., Laurencia dichotoma sp. nov., Laurencia digitata sp. nov., Laurencia multiclavata sp. nov. and Laurencia sodwaniensis sp. nov. and a new variety: Laurencia pumila var. dehoopiensis var. nov. Laurencia stegengae nom. nov. is established to replace Laurencia peninsularis Stegenga, Bolton and Anderson nom. illeg. The diversity is likely greater, with six additional unidentified specimens found in this molecular investigation. These findings place South Africa alongside Australia in having one of the most diverse floras of this group in the world. © 2017 Phycological Society of America.

  14. Genetic diversity and relationship analysis of Gossypium arboreum accessions.

    Science.gov (United States)

    Liu, F; Zhou, Z L; Wang, C Y; Wang, Y H; Cai, X Y; Wang, X X; Zhang, Z S; Wang, K B

    2015-11-19

    Simple sequence repeat techniques were used to identify the genetic diversity of 101 Gossypium arboreum accessions collected from India, Vietnam, and the southwest of China (Guizhou, Guangxi, and Yunnan provinces). Twenty-six pairs of SSR primers produced a total of 103 polymorphic loci with an average of 3.96 polymorphic loci per primer. The average of the effective number of alleles, Nei's gene diversity, and Shannon's information index were 0.59, 0.2835, and 0.4361, respectively. The diversity varied among different geographic regions. The result of principal component analysis was consistent with that of unweighted pair group method with arithmetic mean clustering analysis. The 101 G. arboreum accessions were clustered into 2 groups.

  15. Genetic Diversity of Rose germplasm based on RAPD analysis

    African Journals Online (AJOL)

    AHSAN IQBAL

    2012-06-12

    Jun 12, 2012 ... identification and analysis of genetic variation within a collection of 4 species and 30 accessions of rose using RAPD analysis technique. The results showed the molecular distinctions among the ... that range in colour from white and yellow to many shades of pink and red have been developed. Since.

  16. Molecular activation analysis for chemical species studies

    International Nuclear Information System (INIS)

    Chai Zhifang; Mao Xueying; Wang Yuqi; Sun Jingxin; Qian Qingfang; Hou Xiaolin; Zhang Peiqun; Chen Chunying; Feng Weiyu; Ding Wenjun; Li Xiaolin; Li Chunsheng; Dai Xiongxin

    2001-01-01

    The Molecular Activation Analysis (MAA) mainly refers to an activation analysis method that is able to provide information about the chemical species of elements in systems of interest, though its exact definition has remained to be assigned. Its development is strongly stimulated by the urgent need to know the chemical species of elements, because the bulk contents or concentrations are often insignificant for judging biological, environmental or geochemical effects of elements. In this paper, the features, methodology and limitation of MAA were outlined. Further, the up-to-date MAA progress made in our laboratory was introduced as well. (author)

  17. An analysis of the genetic diversity and genetic structure of ...

    African Journals Online (AJOL)

    Scientific approaches to conservation of threatened species depend on a good understanding of the genetic information of wild and artificial population. The genetic diversity and structure analysis of 10 Eucommia ulmoides population was analyzed using inter-simple sequence repeat (ISSR) markers in this paper.

  18. Metagenomic analysis of bacterial diversity of Siloam hot water ...

    African Journals Online (AJOL)

    The bacterial diversity of Siloam hot water spring was determined using 454 pyrosequencing of two 16S rRNA variable regions V1-3 and V4-7. Analysis of the community DNA revealed that the phyla Proteobacteria, Cyanobacteria, Bacteriodetes, Planctomycetes, Firmicutes, Chloroflexi and Verrucomicrobia were the most ...

  19. Analysis of Primary School Teachers' Opinions on Family Diversity

    Science.gov (United States)

    Bosch, Alvaro Capano; Massonnier, Natalie; González Tornaría, Maria del L.

    2016-01-01

    This article aims to do an analysis based on the opinion of primary school teachers on family models that are different from the traditional nuclear family. We worked with 60 teachers from Montevideo and the metropolitan area. They answered the Questionnaire: Teachers' Opinion on Family Diversity (CIDF for its Spanish acronym) (Morgado,…

  20. Genetic diversity and structure analysis based on hordein protein polymorphism in barley landrace populations from jordan

    International Nuclear Information System (INIS)

    Baloch, A.W.; Ali, M.; Baloch, A.M.; Mangan, B.U.N.; Song, W

    2014-01-01

    Jordan is unanimously considered to be one of the centers of genetic diversity for barley, where wild and landraces of barley has been grown under different climatic conditions. The genetic diversity and genetic structure based on hordein polymorphism was assessed in 90 different accessions collected from four different sites of Jordan. A-PAGE was used to reveal hordein polymorphism among the genotypes. A total of 29 distinct bands were identified, out of them 9 bands were distinguished for D, 11 for C, and 9 for the B hordein regions. The observed genetic similarity was an exceptionally high between the populations than expected, which is probably due to high gene flow estimated between them. The genetic diversity parameters were not differ largely among the populations, indicating that local selection of a particular site did not play a key role in shaping genetic diversity. Analysis of molecular variance (AMOVA) revealed significant population structure when accessions were structured according to population site. There was 94% of hordein variation resided within the populations and only 8% present among the populations. Both Bayesian and Principale Coordinate Analysis (PCoA) concordantly demonstrated admixture genotypes of the landraces barley populations. Consequently, none of the population found to be clustered separately according to its population site. It is concluded that this approach can be useful to explore the germplasm for genetic diversity but perhaps is not suitable for determining phylogenic relations in barley. (author)

  1. Genetic Diversity Analysis of the Natural Populations of Mediterra­nean Mussels [Mytilus galloprovincialis (Lmk.] in Agadir Bay: Assess­ment of the Molecular Polymorphism and Environmental Impact

    Directory of Open Access Journals (Sweden)

    Amal Korrida

    2010-07-01

    Full Text Available Mediterranean mussel (Mytilus galloprovincialis Lmk has a great environmental and economic importance for Morocco. This work studies the genetic structure and impact of chemical pollution on three different marine populations of Mytilus galloprovincialis that live within Agadir bay. Three collections were made at two clean sites (Cape Ghir and Cape Aglou and at an impacted site exposed to intense boating and industrial activities (Anza. A 300-bp portion of the mitochondrial DNA coding-region Cytochrome C Oxidase subunit 1 (COI was studied by polymerase chain reaction (PCR and DNA sequencing reactions to assess and evaluate amounts of polymorphism in each site. Genetic analysis using COI for 64 individuals showed no significant differentiation between the three subpopulations. AMOVA demonstrated that only 2.83% of variation exists between populations. Besides the genetic evidence presented herein, mussel’s adaptation mechanisms and strategies to marine pollution are also discussed.

  2. Zoanthid diversity (Anthozoa: Hexacorallia) in the Galapagos Islands: a molecular examination

    Science.gov (United States)

    Reimer, J. D.; Sinniger, F.; Hickman, C. P.

    2008-09-01

    Although the Galapagos are famous for their unique biodiversity, many groups of marine invertebrates from this isolated archipelago remain understudied or not investigated. One such group is the zoanthids (Order Zoantharia, =Zoanthidea, =Zoanthiniaria), anthozoans (Cnidaria) found in marine ecosystems worldwide. Zoanthid taxonomy has been in a state of disorganization and neglect due in large part to the morphological plasticity within species and questions about the accuracy of traditionally used morphological and ecological characteristics. However, recent studies utilizing molecular methodology combined with morphology have proven to be very useful in understanding zoanthid diversity. The results of a survey of zoanthids from the Galapagos and the east Pacific are reported in this study. Shallow water (zoanthid specimens were identified using the molecular markers mitochondrial 16S ribosomal DNA (mt 16S rDNA), cytochrome oxidase subunit I (COI) gene, and the internal transcribed spacer of ribosomal DNA (ITS-rDNA). From the collected specimens seven putative zoanthid species-level clades from three known genera ( Zoanthus, Palythoa, Parazoanthus) were identified at the molecular level. These identifications were further supported by morphological and ecological data. While almost all specimens belonged to known zoanthid genera, based on unique molecular and ecological data one group of specimens (designated unknown zoanthid sp. “03-103”) is potentially a novel undescribed genus. Additionally, the remaining three azooxanthellate Parazoanthus clades may also be undescribed new species, but due to the overall lack of zoanthid research and descriptions from neighboring areas (East Pacific, west coast of South America) further research is needed to clearly ascertain this. Additionally, notes on the four observed nominal azooxanthellate zoanthid species and a key to all eight nominal (seven from known genera, one from a potentially new genus) shallow water zoanthid

  3. Assessment of genetic diversity in indigenous turmeric (Curcuma longa) germplasm from India using molecular markers.

    Science.gov (United States)

    Verma, Sushma; Singh, Shweta; Sharma, Suresh; Tewari, S K; Roy, R K; Goel, A K; Rana, T S

    2015-04-01

    Curcuma longa L., commonly known as turmeric, is one of the economically and medicinally important plant species. It is predominantly cultivated in the tropical and sub tropical countries. India is the largest producer, and exporter of turmeric in the world, followed by China, Indonesia, Bangladesh and Thailand. In the present study, Directed Amplification of Minisatellite DNA (DAMD) and Inter Simple Sequence Repeats (ISSR), methods were used to estimate the genetic variability in indigenous turmeric germplasm. Cumulative data analysis for DAMD (15) and ISSR (13) markers resulted into 478 fragments, out of which 392 fragments were polymorphic, revealing 82 % polymorphism across the turmeric genotypes. Wide range of pairwise genetic distances (0.03-0.59) across the genotypes revealed that these genotypes are genetically quite diverse. The UPGMA dendrogram generated using cumulative data showed significant relationships amongst the genotypes. All 29 genotypes studied grouped into two clusters irrespective of their geographical affiliations with 100 % bootstrap value except few genotypes, suggesting considerable diversity amongst the genotypes. These results suggested that the current collection of turmeric genotypes preserve the vast majority of natural variations. The results further demonstrate the efficiency and reliability of DAMD and ISSR markers in determining the genetic diversity and relationships among the indigenous turmeric germplasm. DAMD and ISSR profiling have identified diverse turmeric genotypes, which could be further utilized in various genetic improvement programmes including conventional as well as marker assisted breeding towards development of new and desirable turmeric genotypes.

  4. Diversity Analysis in Selected Non-basmati Scented Rice Collection

    Directory of Open Access Journals (Sweden)

    Sarika MATHURE

    2010-03-01

    Full Text Available Diversity analysis among 23 rice varieties including 16 non-basmati scented accessions, 5 basmati accessions and 2 non-scented accessions was performed by random amplified polymorphic DNA (RAPD and inter-simple sequence repeat (ISSR marker systems. The varieties analyzed by 11 RAPD and 8 ISSR primers yielded an average of 65% and 80% polymorphism, respectively. The average number of polymorphic bands generated per RAPD primer was 6 and per ISSR primer was 5.87. RAPD and ISSR data analysis individually could not segregate basmati and non-basmati scented rice accessions. However, the analysis using a combined data could group basmati and non-basmati scented rice accessions separately. The bands present specifically among three accessions of non-basmati scented rice were also identified. The study revealed a high genetic diversity among non-basmati scented rice accessions.

  5. Diversion path analysis handbook. Volume 2 (of 4 volumes). Example

    International Nuclear Information System (INIS)

    Goodwin, K.E.; Schleter, J.C.; Maltese, M.D.K.

    1978-11-01

    Volume 2 of the Handbook is divided into two parts, the workpaper documentation and the summary documentation. The former sets forth, in terms of the hypothetical process, the analysis guidelines, the information gathered, the characterization of the process, the specific diversion paths related to the process, and, finally, the results and findings of the Diversion Path Analysis (DPA). The summary documentation, made up of portions of sections already prepared for the workpapers, is a concise statement of results and recommendations for management use. Most of the details available in the workpapers are not used, or are held to a minimum, in this report. Also, some rearrangement of the excerpted sections has been made in order to permit rapid comprehension by a manager having only limited time to devote to study and review of the analysis

  6. The Hidden Diversity of Zanclea Associated with Scleractinians Revealed by Molecular Data.

    Directory of Open Access Journals (Sweden)

    Simone Montano

    Full Text Available Scleractinian reef corals have recently been acknowledged as the most numerous host group found in association with hydroids belonging to the Zanclea genus. However, knowledge of the molecular phylogenetic relationships among Zanclea species associated with scleractinians is just beginning. This study, using the nuclear 28S rDNA region and the fast-evolving mitochondrial 16S rRNA and COI genes, provides the most comprehensive phylogenetic reconstruction of the genus Zanclea with a particular focus on the genetic diversity among Zanclea specimens associated with 13 scleractinian genera. The monophyly of Zanclea associated with scleractinians was strongly supported in all nuclear and mitochondrial phylogenetic reconstructions. Furthermore, a combined mitochondrial 16S and COI phylogenetic tree revealed a multitude of hidden molecular lineages within this group (Clades I, II, III, V, VI, VII, and VIII, suggesting the existence of both host-generalist and genus-specific lineages of Zanclea associated with scleractinians. In addition to Z. gallii living in association with the genus Acropora, we discovered four well-supported lineages (Clades I, II, III, and VII, each one forming a strict association with a single scleractinian genus, including sequences of Zanclea associated with Montipora from two geographically separated areas (Maldives and Taiwan. Two host-generalist Zanclea lineages were also observed, and one of them was formed by Zanclea specimens symbiotic with seven scleractinian genera (Clade VIII. We also found that the COI gene allows the recognition of separated hidden lineages in agreement with the commonly recommended mitochondrial 16S as a DNA barcoding gene for Hydrozoa and shows reasonable potential for phylogenetic and evolutionary analyses in the genus Zanclea. Finally, as no DNA sequences are available for the majority of the nominal Zanclea species known, we note that they will be necessary to elucidate the diversity of the

  7. The Hidden Diversity of Zanclea Associated with Scleractinians Revealed by Molecular Data

    KAUST Repository

    Montano, Simone

    2015-07-24

    Scleractinian reef corals have recently been acknowledged as the most numerous host group found in association with hydroids belonging to the Zanclea genus. However, knowledge of the molecular phylogenetic relationships among Zanclea species associated with scleractinians is just beginning. This study, using the nuclear 28S rDNA region and the fast-evolving mitochondrial 16S rRNA and COI genes, provides the most comprehensive phylogenetic reconstruction of the genus Zanclea with a particular focus on the genetic diversity among Zanclea specimens associated with 13 scleractinian genera. The monophyly of Zanclea associated with scleractinians was strongly supported in all nuclear and mitochondrial phylogenetic reconstructions. Furthermore, a combined mitochondrial 16S and COI phylogenetic tree revealed a multitude of hidden molecular lineages within this group (Clades I, II, III, V, VI, VII, and VIII), suggesting the existence of both host-generalist and genus-specific lineages of Zanclea associated with scleractinians. In addition to Z. gallii living in association with the genus Acropora, we discovered four well-supported lineages (Clades I, II, III, and VII), each one forming a strict association with a single scleractinian genus, including sequences of Zanclea associated with Montipora from two geographically separated areas (Maldives and Taiwan). Two host-generalist Zanclea lineages were also observed, and one of them was formed by Zanclea specimens symbiotic with seven scleractinian genera (Clade VIII). We also found that the COI gene allows the recognition of separated hidden lineages in agreement with the commonly recommended mitochondrial 16S as a DNA barcoding gene for Hydrozoa and shows reasonable potential for phylogenetic and evolutionary analyses in the genus Zanclea. Finally, as no DNA sequences are available for the majority of the nominal Zanclea species known, we note that they will be necessary to elucidate the diversity of the Zanclea

  8. Molecular phylogeny and larval morphological diversity of the lanternfish genus Hygophum (Teleostei: Myctophidae).

    Science.gov (United States)

    Yamaguchi, M; Miya, M; Okiyama, M; Nishida, M

    2000-04-01

    Larvae of the deep-sea lanternfish genus Hygophum (Myctophidae) exhibit a remarkable morphological diversity that is quite unexpected, considering their homogeneous adult morphology. In an attempt to elucidate the evolutionary patterns of such larval morphological diversity, nucleotide sequences of a portion of the mitochondrially encoded 16S ribosomal RNA gene were determined for seven Hygophum species and three outgroup taxa. Secondary structure-based alignment resulted in a character matrix consisting of 1172 bp of unambiguously aligned sequences, which were subjected to phylogenetic analyses using maximum-parsimony, maximum-likelihood, and neighbor-joining methods. The resultant tree topologies from the three methods were congruent, with most nodes, including that of the genus Hygophum, being strongly supported by various tree statistics. The most parsimonious reconstruction of the three previously recognized, distinct larval morphs onto the molecular phylogeny revealed that one of the morphs had originated as the common ancestor of the genus, the other two having diversified separately in two subsequent major clades. The patterns of such diversification are discussed in terms of the unusual larval eye morphology and geographic distribution. Copyright 2000 Academic Press.

  9. Molecular characterization and genetic diversity of Jatropha curcas L. in Costa Rica

    Science.gov (United States)

    Vásquez-Mayorga, Marcela; Fuchs, Eric J.; Hernández, Eduardo J.; Herrera, Franklin; Hernández, Jesús; Moreira, Ileana; Arnáez, Elizabeth

    2017-01-01

    We estimated the genetic diversity of 50 Jatropha curcas samples from the Costa Rican germplasm bank using 18 EST-SSR, one G-SSR and nrDNA-ITS markers. We also evaluated the phylogenetic relationships among samples using nuclear ribosomal ITS markers. Non-toxicity was evaluated using G-SSRs and SCARs markers. A Neighbor-Joining (NJ) tree and a Maximum Likelihood (ML) tree were constructed using SSR markers and ITS sequences, respectively. Heterozygosity was moderate (He = 0.346), but considerable compared to worldwide values for J. curcas. The PIC (PIC = 0.274) and inbreeding coefficient (f =  − 0.102) were both low. Clustering was not related to the geographical origin of accessions. International accessions clustered independently of collection sites, suggesting a lack of genetic structure, probably due to the wide distribution of this crop and ample gene flow. Molecular markers identified only one non-toxic accession (JCCR-24) from Mexico. This work is part of a countrywide effort to characterize the genetic diversity of the Jatropha curcas germplasm bank in Costa Rica. PMID:28289556

  10. Molecular characterization and genetic diversity of Jatropha curcas L. in Costa Rica

    Directory of Open Access Journals (Sweden)

    Marcela Vásquez-Mayorga

    2017-02-01

    Full Text Available We estimated the genetic diversity of 50 Jatropha curcas samples from the Costa Rican germplasm bank using 18 EST-SSR, one G-SSR and nrDNA-ITS markers. We also evaluated the phylogenetic relationships among samples using nuclear ribosomal ITS markers. Non-toxicity was evaluated using G-SSRs and SCARs markers. A Neighbor-Joining (NJ tree and a Maximum Likelihood (ML tree were constructed using SSR markers and ITS sequences, respectively. Heterozygosity was moderate (He = 0.346, but considerable compared to worldwide values for J. curcas. The PIC (PIC = 0.274 and inbreeding coefficient (f =  − 0.102 were both low. Clustering was not related to the geographical origin of accessions. International accessions clustered independently of collection sites, suggesting a lack of genetic structure, probably due to the wide distribution of this crop and ample gene flow. Molecular markers identified only one non-toxic accession (JCCR-24 from Mexico. This work is part of a countrywide effort to characterize the genetic diversity of the Jatropha curcas germplasm bank in Costa Rica.

  11. Molecular Epidemiology Reveals Genetic Diversity amongst Isolates of the Cryptococcus neoformans/C. gattii Species Complex in Thailand

    Science.gov (United States)

    Kaocharoen, Sirada; Ngamskulrungroj, Popchai; Firacative, Carolina; Trilles, Luciana; Piyabongkarn, Dumrongdej; Banlunara, Wijit; Poonwan, Natteewan; Chaiprasert, Angkana; Meyer, Wieland; Chindamporn, Ariya

    2013-01-01

    To gain a more detailed picture of cryptococcosis in Thailand, a retrospective study of 498 C. neoformans and C. gattii isolates has been conducted. Among these, 386, 83 and 29 strains were from clinical, environmental and veterinary sources, respectively. A total of 485 C. neoformans and 13 C. gattii strains were studied. The majority of the strains (68.9%) were isolated from males (mean age of 37.97 years), 88.5% of C. neoformans and only 37.5% of C. gattii strains were from HIV patients. URA5-RFLP and/or M13 PCR-fingerprinting analysis revealed that the majority of the isolates were C. neoformans molecular type VNI regardless of their sources (94.8%; 94.6% of the clinical, 98.8% of the environmental and 86.2% of the veterinary isolates). In addition, the molecular types VNII (2.4%; 66.7% of the clinical and 33.3% of the veterinary isolates), VNIV (0.2%; 100% environmental isolate), VGI (0.2%; 100% clinical isolate) and VGII (2.4%; 100% clinical isolates) were found less frequently. Multilocus Sequence Type (MLST) analysis using the ISHAM consensus MLST scheme for the C. neoformans/C. gattii species complex identified a total of 20 sequence types (ST) in Thailand combining current and previous data. The Thai isolates are an integrated part of the global cryptococcal population genetic structure, with ST30 for C. gattii and ST82, ST83, ST137, ST141, ST172 and ST173 for C. neoformans being unique to Thailand. Most of the C. gattii isolates were ST7 = VGIIb, which is identical to the less virulent minor Vancouver island outbreak genotype, indicating Thailand as a stepping stone in the global spread of this outbreak strain. The current study revealed a greater genetic diversity and a wider range of major molecular types being present amongst Thai cryptococcal isolates than previously reported. PMID:23861989

  12. Genetic Diversity and Molecular Evolution of a Violaxanthin De-epoxidase Gene in Maize.

    Science.gov (United States)

    Xu, Jing; Li, Zhigang; Yang, Haorui; Yang, Xiaohong; Chen, Cuixia; Li, Hui

    2016-01-01

    Violaxanthin de-epoxidase (VDE) has a critical role in the carotenoid biosynthesis pathway, which is involved in protecting the photosynthesis apparatus from damage caused by excessive light. Here, a VDE gene in maize, ZmVDE1, was cloned and shown to have functional domains in common with the gramineous VDE protein. Candidate gene association analysis indicated that no polymorphic sites in ZmVDE1 were significant association with any of the examined carotenoid-related traits at P = 0.05 in an association panel containing 155 maize inbred lines. Nucleotide diversity analysis of VDE1 in maize and teosinte indicated that its exon had less genetic variation, consistent with the conserved function of VDE1 in plants. In addition, dramatically reduced nucleotide diversity, fewer haplotypes and a significantly negative parameter deviation for Tajima's D test of ZmVDE1 in maize and teosinte suggested that a potential selective force had acted across the ZmVDE1 locus. We further identified a 4.2 Mb selective sweep with low recombination surrounding the ZmVDE1 locus that resulted in severely reduced nucleotide diversity on chromosome 2. Collectively, natural selection and the conserved domains of ZmVDE1 might show an important role in the xanthophyll cycle of the carotenoid biosynthesis pathway.

  13. Genetic Diversity and Molecular Evolution of a Violaxanthin De-Epoxidase Gene in Maize

    Directory of Open Access Journals (Sweden)

    Jing Xu

    2016-07-01

    Full Text Available Violaxanthin de-epoxidase (VDE has a critical role in the carotenoid biosynthesis pathway, which is involved in protecting the photosynthesis apparatus from damage caused by excessive light. Here, a VDE gene in maize, ZmVDE1, was cloned and shown to have functional domains in common with the gramineous VDE protein. Candidate gene association analysis indicated that no polymorphic sites in ZmVDE1 were significant association with any of the examined carotenoid-related traits at P = 0.05 in an association panel containing 155 maize inbred lines. Nucleotide diversity analysis of VDE1 in maize and teosinte indicated that its exon had less genetic variation, consistent with the conserved function of VDE1 in plants. In addition, dramatically reduced nucleotide diversity, fewer haplotypes and a significantly negative parameter deviation for Tajima’s D test of ZmVDE1 in maize and teosinte suggested that a potential selective force had acted across the ZmVDE1 locus. We further identified a 4.2 Mb selective sweep with low recombination surrounding the ZmVDE1 locus that resulted in severely reduced nucleotide diversity on chromosome 2. Collectively, natural selection and the conserved domains of ZmVDE1 might show an important role in the xanthophyll cycle of the carotenoid biosynthesis pathway.

  14. New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.).

    Science.gov (United States)

    Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav

    2007-01-01

    Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop.

  15. AFLP analysis of Genetic Diversity Among Different Jatropha curcas L. Genotypes from Africa and Ecuador

    Directory of Open Access Journals (Sweden)

    Konan, NO.

    2018-01-01

    Full Text Available Six populations amounting to a total number of seventy genotypes of Jatropha curcas L. originating from Africa (Senegal, Mali, Burkina Faso and Madagascar and Ecuador were investigated for genetic diversity using two AFLP primer combinations. The results revealed a high genetic diversity in the populations studied. The population with greatest genetic diversity was Madagascar (He = 0.2638 and I = 0.4066 and the least diverse was Senegal-Tamba (He = 0.1962 and I = 0.3079. AMOVA (analysis of molecular variance detected the highest proportion of variation within populations (81% of the total molecular variation. This may be attributed to the high level of allogamy observed in this species. The Nei's standard unbiased genetic distance (D between the populations ranged from 0.010 (Senegal-Tamba and Burkina Faso to 0.131 (Mali and Ecuador; the average was 0.063. Analysis of the genetic relationships among the 6 populations using both neighbor-joining cluster analysis and principal component analysis (PCoA showed five clusters with globally, groupings of i most of Burkina Faso and Senegal-Tamba genotypes, ii most of Mali and Senegal-Diobass genotypes , iii most of Madagascar and Ecuador genotypes, and iv some mixings of genotypes with different origins. Considering the distance existing between the different origins there are prospects to develop F1 hybrids. The greatest heterosis might be expected from crossing involving genotypes of cluster I and cluster V which group the more distant genotypes. Such crossing schemes might produce greater success in the production of genetic variability and might maximize the exploitation of heterosis and segregation.

  16. Molecular sequence data of hepatitis B virus and genetic diversity after vaccination.

    Science.gov (United States)

    van Ballegooijen, W Marijn; van Houdt, Robin; Bruisten, Sylvia M; Boot, Hein J; Coutinho, Roel A; Wallinga, Jacco

    2009-12-15

    The effect of vaccination programs on transmission of infectious disease is usually assessed by monitoring programs that rely on notifications of symptomatic illness. For monitoring of infectious diseases with a high proportion of asymptomatic cases or a low reporting rate, molecular sequence data combined with modern coalescent-based techniques offer a complementary tool to assess transmission. Here, the authors investigate the added value of using viral sequence data to monitor a vaccination program that was started in 1998 and was targeted against hepatitis B virus in men who have sex with men in Amsterdam, the Netherlands. The incidence in this target group, as estimated from the notifications of acute infections with hepatitis B virus, was low; therefore, there was insufficient power to show a significant change in incidence. In contrast, the genetic diversity, as estimated from the viral sequence collected from the target group, revealed a marked decrease after vaccination was introduced. Taken together, the findings suggest that introduction of vaccination coincided with a change in the target group toward behavior with a higher risk of infection. The authors argue that molecular sequence data provide a powerful additional monitoring instrument, next to conventional case registration, for assessing the impact of vaccination.

  17. A preliminary molecular phylogeny of shield-bearer moths (Lepidoptera: Adeloidea: Heliozelidae) highlights rich undescribed diversity.

    Science.gov (United States)

    Milla, Liz; van Nieukerken, Erik J; Vijverberg, Ruben; Doorenweerd, Camiel; Wilcox, Stephen A; Halsey, Mike; Young, David A; Jones, Therésa M; Kallies, Axel; Hilton, Douglas J

    2018-03-01

    Heliozelidae are a widespread, evolutionarily early diverging family of small, day-flying monotrysian moths, for which a comprehensive phylogeny is lacking. We generated the first molecular phylogeny of the family using DNA sequences of two mitochondrial genes (COI and COII) and two nuclear genes (H3 and 28S) from 130 Heliozelidae specimens, including eight of the twelve known genera: Antispila, Antispilina, Coptodisca, Heliozela, Holocacista, Hoplophanes, Pseliastis, and Tyriozela. Our results provide strong support for five major Heliozelidae clades: (i) a large widespread clade containing the leaf-mining genera Antispilina, Coptodisca and Holocacista and some species of Antispila, (ii) a clade containing most of the described Antispila, (iii) a clade containing the leaf-mining genus Heliozela and the monotypic genus Tyriozela, (iv) an Australian clade containing Pseliastis and (v) an Australian clade containing Hoplophanes. Each clade includes several new species and potentially new genera. Collectively, our data uncover a rich and undescribed diversity that appears to be especially prevalent in Australia. Our work highlights the need for a major taxonomic revision of the family and for generating a robust molecular phylogeny using multi-gene approaches in order to resolve the relationships among clades. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Application of molecular techniques for the assessment of microorganism diversity on cultural heritage objects.

    Science.gov (United States)

    Otlewska, Anna; Adamiak, Justyna; Gutarowska, Beata

    2014-01-01

    As a result of their unpredictable ability to adapt to varying environmental conditions, microorganisms inhabit different types of biological niches on Earth. Owing to the key role of microorganisms in many biogeochemical processes, trends in modern microbiology emphasize the need to know and understand the structure and function of complex microbial communities. This is particularly important if the strategy relates to microbial communities that cause biodeterioration of materials that constitute our cultural heritage. Until recently, the detection and identification of microorganisms inhabiting objects of cultural value was based only on cultivation-dependent methods. In spite of many advantages, these methods provide limited information because they identify only viable organisms capable of growth under standard laboratory conditions. However, in order to carry out proper conservation and renovation, it is necessary to know the complete composition of microbial communities and their activity. This paper presents and characterizes modern techniques such as genetic fingerprinting and clone library construction for the assessment of microbial diversity based on molecular biology. Molecular methods represent a favourable alternative to culture-dependent methods and make it possible to assess the biodiversity of microorganisms inhabiting technical materials and cultural heritage objects.

  19. Molecular DNA Analysis in Forensic Identification.

    Science.gov (United States)

    Dumache, Raluca; Ciocan, Veronica; Muresan, Camelia; Enache, Alexandra

    2016-01-01

    Serological and biochemical identification methods used in forensics have several major disadvantages, such as: long time in processing biological sample and lack of sensitivity and specificity. In the last 30 years, DNA molecular analysis has become an important tool in forensic investigations. DNA profiling is based on the short tandem repeats (STR) and aids in human identification from biological samples. Forensic genetics, can provide information on the events which occurred at the crime scene or to supplement other methods of forensic identification. Currently, the methods used in identification are based on polymerase chain reaction (PCR) analyses. This method analyses the autosomal STRs, the Y-chromosome, and the mitochondrial DNA. Correlation of biological samples present at the crime scene with identification, selection, and the probative value factor is therefore the first aspect to be taken into consideration in the forensic genetic analysis. In the last decade, because of the advances in the field of molecular biology, new biomarkers such as: microRNAs (miR), messenger RNA (mRNA), and DNA methylation have been studied and proposed to be used in the forensic identifications of body fluids.

  20. Molecular diversity analysis in selected fodder and dual purpose oat ...

    African Journals Online (AJOL)

    Genetic variability among 15 oat genotypes comprising fodder and dual purpose oat varieties from different geographical regions was analyzed by random amplified polymorphic DNA (RAPD) marker method in Department of Genetics and Plant Breeding, College of Agriculture, Pant University of Agriculture and Technology ...

  1. Geographically diverse Australian isolates of Melissococcus pluton exhibit minimal genotypic diversity by restriction endonuclease analysis.

    Science.gov (United States)

    Djordjevic, S P; Smith, L A; Forbes, W A; Hornitzky, M A

    1999-04-15

    Melissococcus pluton, the causative agent of European foulbrood is an economically significant disease of honey bees (Apis mellifera) across most regions of the world and is prevalent throughout most states of Australia. 49 Isolates of M. pluton recovered from diseased colonies or honey samples in New South Wales, Queensland, South Australia, Tasmania and Victoria were compared using SDS-PAGE, Western immunoblotting and restriction endonuclease analyses. DNA profiles of all 49 geographically diverse isolates showed remarkably similar AluI profiles although four isolates (one each from Queensland, South Australia, New South Wales and Victoria) displayed minor profile variations compared to AluI patterns of all other isolates. DNA from a subset of the 49 Australian and three isolates from the United Kingdom were digested separately with the restriction endonucleases CfoI, RsaI and DraI. Restriction endonuclease fragment patterns generated using these enzymes were also similar although minor variations were noted. SDS-PAGE of whole cell proteins from 13 of the 49 isolates from different states of Australia, including the four isolates which displayed minor profile variations (AluI) produced indistinguishable patterns. Major immunoreactive proteins of approximate molecular masses of 21, 24, 28, 30, 36, 40, 44, 56, 60, 71, 79 and 95 kDa were observed in immunoblots of whole cell lysates of 22 of the 49 isolates and reacted with rabbit hyperimmune antibodies raised against M. pluton whole cells. Neither SDS-PAGE or immunoblotting was capable of distinguishing differences between geographically diverse isolates of M. pluton. Collectively these data confirm that Australian isolates of M. pluton are genetically homogeneous and that this species may be clonal. Plasmid DNA was not detected in whole cell DNA profiles of any isolate resolved using agarose gel electrophoresis.

  2. Genetic diversity and population structure analysis to construct a core collection from a large Capsicum germplasm.

    Science.gov (United States)

    Lee, Hea-Young; Ro, Na-Young; Jeong, Hee-Jin; Kwon, Jin-Kyung; Jo, Jinkwan; Ha, Yeaseong; Jung, Ayoung; Han, Ji-Woong; Venkatesh, Jelli; Kang, Byoung-Cheorl

    2016-11-14

    Conservation of genetic diversity is an essential prerequisite for developing new cultivars with desirable agronomic traits. Although a large number of germplasm collections have been established worldwide, many of them face major difficulties due to large size and a lack of adequate information about population structure and genetic diversity. Core collection with a minimum number of accessions and maximum genetic diversity of pepper species and its wild relatives will facilitate easy access to genetic material as well as the use of hidden genetic diversity in Capsicum. To explore genetic diversity and population structure, we investigated patterns of molecular diversity using a transcriptome-based 48 single nucleotide polymorphisms (SNPs) in a large germplasm collection comprising 3,821 accessions. Among the 11 species examined, Capsicum annuum showed the highest genetic diversity (H E  = 0.44, I = 0.69), whereas the wild species C. galapagoense showed the lowest genetic diversity (H E  = 0.06, I = 0.07). The Capsicum germplasm collection was divided into 10 clusters (cluster 1 to 10) based on population structure analysis, and five groups (group A to E) based on phylogenetic analysis. Capsicum accessions from the five distinct groups in an unrooted phylogenetic tree showed taxonomic distinctness and reflected their geographic origins. Most of the accessions from European countries are distributed in the A and B groups, whereas the accessions from Asian countries are mainly distributed in C and D groups. Five different sampling strategies with diverse genetic clustering methods were used to select the optimal method for constructing the core collection. Using a number of allelic variations based on 48 SNP markers and 32 different phenotypic/morphological traits, a core collection 'CC240' with a total of 240 accessions (5.2 %) was selected from within the entire Capsicum germplasm. Compared to the other core collections, CC240 displayed higher

  3. Genetic diversity and structure of tea plant in Qinba area in China by three types of molecular markers.

    Science.gov (United States)

    Zhang, Yu; Zhang, Xiaojuan; Chen, Xi; Sun, Wang; Li, Jiao

    2018-01-01

    Qinba area has a long history of tea planting and is a northernmost region in China where Camellia sinensis L. is grown. In order to provide basic data for selection and optimization of molecular markers of tea plants. 118 markers, including 40 EST-SSR, 40 SRAP and 38 SCoT markers were used to evaluate the genetic diversity of 50 tea plant ( Camellia sinensis. ) samples collected from Qinb. tea germplasm, assess population structure. In this study, a total of 414 alleles were obtained using 38 pairs of SCoT primers, with an average of 10.89 alleles per primer. The percentage of polymorphic bands (PPB), polymorphism information content (PIC), resolving power (Rp), effective multiplex ratio (EMR), average band informativeness (Ib av ), and marker index (MI) were 96.14%, 0.79, 6.71, 10.47, 0.58, and 6.07 respectively. 338 alleles were amplified via 40 pairs of SRAP (8.45 per primer), with PPB, PIC, Rp, EMR, Ib av, and MI values of 89.35%, 0.77, 5.11, 7.55, 0.61, and 4.61, respectively. Furthermore, 320 alleles have been detected using 40 EST-SSR primers (8.00 per primer), with PPB, PIC, Rp, EMR, Ib av , and MI values of 94.06%, 0.85, 4.48, 7.53, 0.56, and 4.22 respectively. These results indicated that SCoT markers had higher efficiency.Mantel test was used to analyze the genetic distance matrix generated by EST-SSRs, SRAPs and SCoTs. The results showed that the correlation between the genetic distance matrix based on EST-SSR and that based on SRAP was very small ( r  = 0.01), followed by SCoT and SRAP ( r  = 0.17), then by SCoT and EST-SSR ( r  = 0.19).The 50 tea samples were divided into two sub-populations using STRUCTURE, Neighbor-joining (NJ) method and principal component analyses (PCA). The results produced by STRUCTURE were completely consistent with the PCA analysis. Furthermore, there is no obvious relationship between the results produced using sub-populational and geographical data. Among the three types of markers, SCoT markers has many

  4. Molecular Composition Analysis of Distant Targets

    Science.gov (United States)

    Hughes, Gary B.; Lubin, Philip

    2017-01-01

    This document is the Final Report for NASA Innovative Advanced Concepts (NIAC) Phase I Grant 15-NIAC16A-0145, titled Molecular Composition Analysis of Distant Targets. The research was focused on developing a system concept for probing the molecular composition of cold solar system targets, such as Asteroids, Comets, Planets and Moons from a distant vantage, for example from a spacecraft that is orbiting the target (Hughes et al., 2015). The orbiting spacecraft is equipped with a high-power laser, which is run by electricity from photovoltaic panels. The laser is directed at a spot on the target. Materials on the surface of the target are heated by the laser beam, and begin to melt and then evaporate, forming a plume of asteroid molecules in front of the heated spot. The heated spot glows, producing blackbody illumination that is visible from the spacecraft, via a path through the evaporated plume. As the blackbody radiation from the heated spot passes through the plume of evaporated material, molecules in the plume absorb radiation in a manner that is specific to the rotational and vibrational characteristics of the specific molecules. A spectrometer aboard the spacecraft is used to observe absorption lines in the blackbody signal. The pattern of absorption can be used to estimate the molecular composition of materials in the plume, which originated on the target. Focusing on a single spot produces a borehole, and shallow subsurface profiling of the targets bulk composition is possible. At the beginning of the Phase I research, the estimated Technology Readiness Level (TRL) of the system was TRL-1. During the Phase I research, an end-to-end theoretical model of the sensor system was developed from first principles. The model includes laser energy and optical propagation, target heating, melting and evaporation of target material, plume density, thermal radiation from the heated spot, molecular cross section of likely asteroid materials, and estimation of the

  5. Molecular genetic diversity and maternal origin of Chinese black-bone chicken breeds.

    Science.gov (United States)

    Zhu, W Q; Li, H F; Wang, J Y; Shu, J T; Zhu, C H; Song, W T; Song, C; Ji, G G; Liu, H X

    2014-04-29

    Chinese black-bone chickens are valued for the medicinal properties of their meat in traditional Chinese medicine. We investigated the genetic diversity and systematic evolution of Chinese black-bone chicken breeds. We sequenced the DNA of 520 bp of the mitochondrial cyt b gene of nine Chinese black-bone chicken breeds, including Silky chicken, Jinhu black-bone chicken, Jiangshan black-bone chicken, Yugan black-bone chicken, Wumeng black-bone chicken, Muchuan black-bone chicken, Xingwen black-bone chicken, Dehua black-bone chicken, and Yanjin black-bone chicken. We found 13 haplotypes. Haplotype and nucleotide diversity of the nine black-bone chicken breeds ranged from 0 to 0.78571 and 0.00081 to 0.00399, respectively. Genetic diversity was the richest in Jinhu black-bone chickens and the lowest in Yanjin black-bone chickens. Analysis of phylogenetic trees for all birds constructed based on hyplotypes indicated that the maternal origin of black-bone chickens is predominantly from three subspecies of red jungle fowl. These results provide basic data useful for protection of black-bone chickens and help determine the origin of domestic chickens.

  6. Assessment of Genetic Diversity in Opuntia spp. Portuguese Populations Using SSR Molecular Markers

    Directory of Open Access Journals (Sweden)

    Carlos M. G. Reis

    2018-04-01

    Full Text Available The Opuntia spp., most likely few individuals, were introduced in the Iberian Peninsula in the beginning of the 16th century, after the discovery of America, spreading afterwards throughout the Mediterranean basin. We analysed, for the first time, the genetic diversity in a set of 19 Portuguese Opuntia spp. populations from the species O. ficus-indica, O. elata, O. dillenii and O. robusta using nuclear microsatellite (nuSSR markers. The Italian cultivars ‘Bianca’, ‘Gialla’ and ‘Rossa’ were included in the study for comparison purposes. The nuSSR amplifications produced from five to 16 alleles, with an average of 9.2 alleles per primer pair, and average polymorphism information content of 0.71. The estimated Dice coefficient among populations varied from 0.26 to 1.0, indicating high interspecific genetic diversity but low genetic diversity at the intraspecific level. The hierarchical clustering analysis revealed four major groups that clearly separated the four Opuntia species. Among the O. ficus-indica populations, two sub-clusters were found, one including the white pulp fruits (with cv. Bianca and the other with the orange pulp ones and including the cv. Gialla, the cv. Rossa, and one pale yellow pulp population. No genetic differences were found between the inermis form, O. ficus-indica f. ficus-indica, and the rewilded spiny one, O. ficus-indica f. amyclaea. The dendrogram indicated that the clustering pattern was unrelated to geographical origin. The results revealed a low level of genetic diversity among the Portuguese populations of O. ficus-indica.

  7. Molecular characterization of ruminal bacterial diversity in vitro = Caracterização molecular da diversidade bacteriana ruminal in vitro

    Directory of Open Access Journals (Sweden)

    Humberto Maciel França Madeira

    2008-04-01

    Full Text Available PCR analysis is a sensitive and specific tool to detect and monitormicroorganisms in complex environmental samples. The amplification of 16S ribosomal DNA sequences followed by gel electrophoresis under denaturing gradient (DGGE has been a powerful technique to genetically evaluate microbial ecosystems. Changes in rumenmicrobial populations were investigated in vitro using a basal diet with different lipid sources. PCRs were performed with two different sets of primers in order to amplify 16S rRNA sequences, and the amplified fragments were submitted to DGGE analysis. The findings presented in this study show that distinct microbial communities were present in each treatment. The presence of soybean oil seems to maximize growth of bacterial population, whereas fish oil appears to reduce growth. We demonstrated the successful application of molecular ecological techniques to analyze the structure and composition of bacterial communities in rumen ecosystems.A análise por PCR fornece um meio sensível e específico para detectar e monitorar microrganismos em amostras ambientais complexas. Desde sua aplicação inicial, o DNA ribossomal 16S (rRNA em eletroforese com gel com gradiente desnaturante (DGGE, tem sido uma técnica atrativa para a ecologia molecular microbiana. Foram investigadas mudanças na população microbiana no rúmen, a partir de alterações da dieta com tratamentos in vitro de diferentes fontes de lipídeos. ODGGE foi testado com dois pares de primers para o rRNA 16S. O uso do fragmento de 200 pb gerou um perfil de bandas mais discriminatório, mostrando que diferentes comunidades microbianas estavam presentes entre os tratamentos in vitro analisados. A presença de óleo de sojapotencializou o crescimento da população bacteriana, enquanto que óleo de peixe parece ter reduzido esse crescimento. Foi possível demonstrar o sucesso da aplicação de técnicas moleculares para analisar a estrutura e a composição de comunidades

  8. Molecular genetic diversity assessment of Citrus species grown in Iran revealed by SSR, ISSR and CAPS molecular markers

    Directory of Open Access Journals (Sweden)

    Ata Allah Sharafi

    2017-12-01

    Full Text Available In this study, genetic diversity in 19 citrus cultivars was analyzed using Simple Sequence Repeat (SSR, Inter-simple Sequence Repeat (ISSR and cleaved amplified polymorphic sequence (CAPS markers. Nine primers for SSR, nine ISSR primers and two primers for CAPS were used for allele scoring. One chloroplast DNA region (rbcL-ORF106 and one mitochondrial DNA region (18S-5S were analyzed using cleaved amplified polymorphic sequence (CAPS marker in 19 citrus accessions grown in Iran. In total, 45 SSR and 131 ISSR polymorphic alleles and tree organelle genome types were detected. Cluster analysis of SSR and ISSR data was performed using UPGMA method and based on Jaccard's coefficient. The result of this investigation showed that the SSR and ISSR primers were highly informative and efficient in detecting genetic variability and relationships of the citrus accessions. And CAPS marker analysis Results showed that Bakraee and one of off type Mexican lime had banding pattern similar to Clementine Mandarin, while Pummelo regarded as maternal parent of other studied genotypes Citron regarded as father parent showed definite banding pattern among 19 studied genotypes which it confirmed Cytoplasmic inheritance from mother cellular organelles.

  9. Analysis of hydraulic characteristics for stream diversion in small stream

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, Sang-Jin; Jun, Kye-Won [Chungbuk National University, Cheongju(Korea)

    2001-10-31

    This study is the analysis of hydraulic characteristics for stream diversion reach by numerical model test. Through it we can provide the basis data in flood, and in grasping stream flow characteristics. Analysis of hydraulic characteristics in Seoknam stream were implemented by using computer model HEC-RAS(one-dimensional model) and RMA2(two-dimensional finite element model). As a result we became to know that RMA2 to simulate left, main channel, right in stream is more effective method in analysing flow in channel bends, steep slope, complex bed form effect stream flow characteristics, than HEC-RAS. (author). 13 refs., 3 tabs., 5 figs.

  10. Reconsideration for conservation units of wild Primula sieboldii in Japan based on adaptive diversity and molecular genetic diversity.

    Science.gov (United States)

    Yoshida, Yasuko; Honjo, Masanori; Kitamoto, Naoko; Ohsawa, Ryo

    2009-08-01

    Primula sieboldii E. Morren is a perennial clonal herb that is widely distributed in Japan, but in danger of extinction in the wild. In a previous study, we revealed the genetic diversity of the species using chloroplast and nuclear DNA and used this information to define conservation units. However, we lacked information on adaptive genetic diversity, which is important for long-term survival and, thus, for the definition of conservation units. In order to identify adaptive traits that showed adaptive differentiation among populations, we studied the genetic variation in six quantitative traits within and among populations for 3 years in a common garden using 110 genets from five natural populations from three regions of Japan. The number of days to bud initiation was adaptive quantitative trait for which the degree of genetic differentiation among populations (QST) was considerably larger than that in eight microsatellite markers (FST). The relationship between this trait and environmental factors revealed that the number of days to bud initiation was negatively correlated, with the mean temperature during the growing period at each habitat. This suggests that adaptive differentiation in the delay before bud initiation was caused by selective pressure resulting from temperature differences among habitats. Our results suggest that based on adaptive diversity and neutral genetic diversity, the Saitama population represents a new conservation unit.

  11. Multicomponent domino processes based on the organocatalytic generation of conjugated acetylides: efficient synthetic manifolds for diversity-oriented molecular construction.

    Science.gov (United States)

    Tejedor, David; González-Cruz, David; Santos-Expósito, Alicia; Marrero-Tellado, Jose Juan; de Armas, Pedro; García-Tellado, Fernando

    2005-06-06

    The organocatalytic generation of a strong base by the action of a good nucleophile is the base for the in situ catalytic generation of conjugated acetylides in the presence of aldehydes or activated ketones. The method is affordable in a multicomponent, domino format able to generate a chemically diverse set of multifunctionalized adducts that are very well suited for diversity-oriented molecular construction. The domino process involves a nucleophile as catalyst and a terminal conjugated alkyne (H-C[triple chemical bond]C-Z) and an aldehyde or activated ketone as building blocks. The chemical outcome of this process changes dramatically as a function of the nucleophile (tertiary amine or phosphine), temperature, stoichiometry, and solvent. These multicomponent domino processes achieve molecular construction with good atom economy and, very importantly, with an exquisite chemo-differentiating incorporation of identical starting units into the products (nondegenerated chemical output). These properties convert the H-C[triple chemical bond]C-Z unit into a specific building block for diversity-oriented molecular construction. Applications to the modular and diversity-oriented synthesis of relevant heterocycles are discussed. A protocol involving two coupled domino processes linked in a one-pot manner will be discussed as an efficient synthetic manifold for the modular and diversity-oriented construction of multisubstituted nitrogen-containing heterocycles.

  12. New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.)

    Czech Academy of Sciences Publication Activity Database

    Patzak, J.; Vrba, Lukáš; Matoušek, Jaroslav

    2007-01-01

    Roč. 50, č. 1 (2007), s. 15-25 ISSN 0831-2796 R&D Projects: GA ČR GA521/03/0072 Institutional research plan: CEZ:AV0Z50510513 Keywords : hop (Humulus lupulus L.) * genetic diversity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.785, year: 2007

  13. Molecular markers for analyses of intraspecific genetic diversity in the Asian Tiger mosquito, Aedes albopictus.

    Science.gov (United States)

    Manni, Mosè; Gomulski, Ludvik M; Aketarawong, Nidchaya; Tait, Gabriella; Scolari, Francesca; Somboon, Pradya; Guglielmino, Carmela R; Malacrida, Anna R; Gasperi, Giuliano

    2015-03-28

    The dramatic worldwide expansion of Aedes albopictus (the Asian tiger mosquito) and its vector competence for numerous arboviruses represent a growing threat to public health security. Molecular markers are crucially needed for tracking the rapid spread of this mosquito and to obtain a deeper knowledge of population structure. This is a fundamental requirement for the development of strict monitoring protocols and for the improvement of sustainable control measures. Wild population samples from putative source areas and from newly colonised regions were analysed for variability at the ribosomal DNA internal transcribed spacer 2 (ITS2). Moreover, a new set of 23 microsatellite markers (SSR) was developed. Sixteen of these SSRs were tested in an ancestral (Thailand) and two adventive Italian populations. Seventy-six ITS2 sequences representing 52 unique haplotypes were identified, and AMOVA indicated that most of their variation occurred within individuals (74.36%), while only about 8% was detected among populations. Spatial analyses of molecular variance revealed that haplotype genetic similarity was not related to the geographic proximity of populations and the haplotype phylogeny clearly indicated that highly related sequences were distributed across populations from different geographical regions. The SSR markers displayed a high level of polymorphism both in the ancestral and in adventive populations, and F ST estimates suggested the absence of great differentiation. The ancestral nature of the Thai population was corroborated by its higher level of variability. The two types of genetic markers here implemented revealed the distribution of genetic diversity within and between populations and provide clues on the dispersion dynamics of this species. It appears that the diffusion of this mosquito does not conform to a progressive expansion from the native Asian source area, but to a relatively recent and chaotic propagule distribution mediated by human activities

  14. A Comparative Analysis of Classification Algorithms on Diverse Datasets

    Directory of Open Access Journals (Sweden)

    M. Alghobiri

    2018-04-01

    Full Text Available Data mining involves the computational process to find patterns from large data sets. Classification, one of the main domains of data mining, involves known structure generalizing to apply to a new dataset and predict its class. There are various classification algorithms being used to classify various data sets. They are based on different methods such as probability, decision tree, neural network, nearest neighbor, boolean and fuzzy logic, kernel-based etc. In this paper, we apply three diverse classification algorithms on ten datasets. The datasets have been selected based on their size and/or number and nature of attributes. Results have been discussed using some performance evaluation measures like precision, accuracy, F-measure, Kappa statistics, mean absolute error, relative absolute error, ROC Area etc. Comparative analysis has been carried out using the performance evaluation measures of accuracy, precision, and F-measure. We specify features and limitations of the classification algorithms for the diverse nature datasets.

  15. Genetic Diversity and Geographic Population Structure of Bovine Neospora caninum Determined by Microsatellite Genotyping Analysis

    Science.gov (United States)

    Regidor-Cerrillo, Javier; Díez-Fuertes, Francisco; García-Culebras, Alicia; Moore, Dadín P.; González-Warleta, Marta; Cuevas, Carmen; Schares, Gereon; Katzer, Frank; Pedraza-Díaz, Susana; Mezo, Mercedes; Ortega-Mora, Luis M.

    2013-01-01

    The cyst-forming protozoan parasite Neospora caninum is one of the main causes of bovine abortion worldwide and is of great economic importance in the cattle industry. Recent studies have revealed extensive genetic variation among N . caninum isolates based on microsatellite sequences (MSs). MSs may be suitable molecular markers for inferring the diversity of parasite populations, molecular epidemiology and the basis for phenotypic variations in N . caninum , which have been poorly defined. In this study, we evaluated nine MS markers using a panel of 11 N . caninum -derived reference isolates from around the world and 96 N . caninum bovine clinical samples and one ovine clinical sample collected from four countries on two continents, including Spain, Argentina, Germany and Scotland, over a 10-year period. These markers were used as molecular tools to investigate the genetic diversity, geographic distribution and population structure of N . caninum . Multilocus microsatellite genotyping based on 7 loci demonstrated high levels of genetic diversity in the samples from all of the different countries, with 96 microsatellite multilocus genotypes (MLGs) identified from 108 N . caninum samples. Geographic sub-structuring was present in the country populations according to pairwise F ST. Principal component analysis (PCA) and Neighbor Joining tree topologies also suggested MLG segregation partially associated with geographical origin. An analysis of the MLG relationships, using eBURST, confirmed that the close genetic relationship observed between the Spanish and Argentinean populations may be the result of parasite migration (i.e., the introduction of novel MLGs from Spain to South America) due to cattle movement. The eBURST relationships also revealed genetically different clusters associated with the abortion. The presence of linkage disequilibrium, the co-existence of specific MLGs to individual farms and eBURST MLG relationships suggest a predominant clonal

  16. Molecular activation analysis for chemical speciation studies

    International Nuclear Information System (INIS)

    Chai-Chifang

    1998-01-01

    The term of Molecular Activation Analysis (MAA) refers to an activation analysis method that is able to provide information about the chemical species of elements in system of interests, though its definition has remained to be assigned. Its development is strongly stimulated by the urgent need to know the chemical species of elements, because the total concentrations are often without any meaning when assessing health or environmental risks of trace elements.In practice, the MAA is a combination of conventional instrumental or radiochemical activation analysis and physical, chemical or biochemical separation techniques. The MAA is able to play a particular role in speciation studies. However, the critical point in the MAA is that it is not permitted to change the primitive chemical species of elements in systems, or the change has to be under control; in the meantime it is not allowed to form the 'new artifact' originally not present in systems. Some practical examples of MAA for chemical species research performed recently in our laboratory will be presented as follows: Chemical species of platinum group elements in sediment; Chemical species of iodine in marine algae; Chemical species of mercury in human tissues; Chemical species of selenium in corn; Chemical species of rare earth elements in natural plant, etc. The merits and limitations of MAA will be described as well. (author)

  17. Molecular diversity and body distribution of saponins in the sea star Asterias rubens by mass spectrometry.

    Science.gov (United States)

    Demeyer, Marie; De Winter, Julien; Caulier, Guillaume; Eeckhaut, Igor; Flammang, Patrick; Gerbaux, Pascal

    2014-02-01

    Saponins are natural molecules that the common sea star Asterias rubens produces in the form of steroid glycosides bearing a sulfate group attached on the aglycone part. In order to highlight the inter-organ and inter-individual variability, the saponin contents of five distinct body components, namely the aboral body wall, the oral body wall, the stomach, the pyloric caeca and the gonads, from different individuals were separately analyzed by mass spectrometry. MALDI-ToF experiments were selected as the primary tool for a rapid screening of the saponin mixtures, whereas LC-MS and LC-MS/MS techniques were used to achieve chromatographic separation of isomers. First of all, our analyses demonstrated that the diversity of saponins is higher than previously reported. Indeed, nine new congeners were observed in addition to the 17 saponins already described in this species. On the basis of all the collected MS/MS data, we also identified collision-induced key-fragmentations that could be used to reconstruct the molecular structure of both known and unknown saponin ions. Secondly, the comparison of the saponin contents from the five different body components revealed that each organ is characterized by a specific mixture of saponins and that between animals there are also qualitative and quantitative variability of the saponin contents which could be linked to the sex or to the collecting season. Therefore, the observed high variability unambiguously confirms that saponins probably fulfill several biological functions in A. rubens. The current results will pave the way for our future studies that will be devoted to the clarification of the biological roles of saponins in A. rubens at a molecular level. © 2013.

  18. Molecular diversity of legume root-nodule bacteria in Kakadu National Park, Northern Territory, Australia.

    Directory of Open Access Journals (Sweden)

    Bénédicte Lafay

    2007-03-01

    Full Text Available Symbiotic relationships between leguminous plants (family Fabaceae and nodule-forming bacteria in Australia native ecosystems remain poorly characterized despite their importance. Most studies have focused on temperate parts of the country, where the use of molecular approaches have already revealed the presence of Bradyrhizobium, Ensifer (formerly Sinorhizobium, Mesorhizobium and Rhizobium genera of legume root-nodule bacteria. We here provide the first molecular characterization of nodulating bacteria from tropical Australia.45 nodule-forming bacterial strains, isolated from eight native legume hosts at eight locations in Kakadu National Park, Northern Territory, Australia, were examined for their genetic diversity and phylogenetic position. Using SSU rDNA PCR-RFLPs and phylogenetic analyses, our survey identified nine genospecies, two of which, Bradyrhizobium genospp. B and P, had been previously identified in south-eastern Australia and one, Mesorhizobium genospecies AA, in southern France. Three of the five newly characterized Bradyrhizobium genospecies were more closely related to B. japonicum USDA110, whereas the other two belonged to the B. elkanii group. All five were each more closely related to strains sampled in various tropical areas outside Australia than to strains known to occur in Australia. We also characterized an entirely novel nodule-forming lineage, phylogenetically distant from any previously described rhizobial and non-rhizobial legume-nodulating lineage within the Rhizobiales.Overall, the present results support the hypothesis of tropical areas being centres of biodiversity and diversification for legume root-nodule bacteria and confirm the widespread occurrence of Bradyrhizobium genosp. B in continental Australia.

  19. Study Of Genetic Diversity Between Grasspea Landraces Using Morphological And Molecular Marker

    Science.gov (United States)

    Sedehi, Abbasali Vahabi; Lotfi, Asefeh; Solooki, Mahmood

    2008-01-01

    Grass pea is a beneficial crop to Iran since it has some major advantageous such as high grain and forage quality, high drought tolerance and medium level of salinity tolerance and a good native germplasm variation which accessible for breeding programs. This study was carried out to evaluate morphological traits of the grass pea landraces using a randomized complete block design with 3 replications at Research Farm of Isfahan University of Technology. To evaluate genetic diversity of 14 grass pea landraces from various locations in Iran were investigated using 32 RAPD & ISJ primers at Biocenter of University of Zabol. Analysis of variance indicated a highly significant differences among 14 grass pea landrace for the morphological traits. Average of polymorphism percentage of RAPD primer was 73.9%. Among used primer, 12 random primers showed polymorphism and a total of 56 different bands were observed in the genotypes. Jafar-abad and Sar-chahan genotypes with similarity coefficient of 66% and Khoram-abad 2 and Khoram-abad 7 genotypes with similarity coefficient of 3% were the most related and the most distinct genotypes, respectively. Fourteen primers out of 17 semi random primers produced 70 polymorphic bands which included 56% of the total 126 produced bands. Genetic relatedness among population was investigated using Jacard coefficient and unweighted pair group mean analysis (UPGMA) algorithm. The result of this research verified possibility of use of RAPD & ISJ markers for estimation of genetic diversity, management of genetic resources and determination of repetitive accessions in grass pea.

  20. Genetic diversity analysis among collected purslane (Portulaca oleracea L.) accessions using ISSR markers.

    Science.gov (United States)

    Alam, M Amirul; Juraimi, Abdul Shukor; Rafii, Mohd Yusop; Hamid, Azizah Abdul; Arolu, Ibrahim Wasiu; Abdul Latif, M

    2015-01-01

    Genetic diversity and relationships among 45 collected purslane accessions were evaluated using ISSR markers. The 28 primers gave a total of 167 bands, among which 163 were polymorphic (97.6%). The genetic diversity as estimated by Shannon's information index was 0.513, revealing a quite high level of genetic diversity in the germplasm. The average number of observed allele, effective allele, expected heterozygosity, polymorphic information content (PIC) and Nei's index were 5.96, 1.59, 0.43, 0.35 and 0.35, respectively. The UPGMA dendrogram based on Nei's genetic distance grouped the whole germplasm into 7 distinct clusters. The analysis of molecular variance (AMOVA) revealed that 89% of total variation occurred within population, while 11% were found among populations. Based on the constructed dendrogram using ISSR markers those accessions that are far from each other by virtue of genetic origin and diversity index (like Ac1 and Ac42; Ac19 and Ac45; Ac9 and Ac23; Ac18 and A25; Ac24 and Ac18) are strongly recommended to select as parent for future breeding program to develop high yielding and stress tolerant purslane variety in contribution to global food security. Copyright © 2014 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  1. [Evaluation of Molecular Genetic Diversity of Wild Apple Malus sieversii Populations from Zailiysky Alatau by Microsatellite Markers].

    Science.gov (United States)

    Omasheva, M E; Chekalin, S V; Galiakparov, N N

    2015-07-01

    The territory of Kazakhstan is part of the distribution range of Malus sieversii, which is one of the ancestors of cultivated apple tree varieties. The collected samples of Sievers apple leaves from five populations growing in the Zailiysky Alatau region served as a source not only for the creation of a bank of genomic DNA but also for determination ofthe wild apple genetic polymorphism. The seven microsatellite markers used in this study revealed 86 alleles with different frequencies, as well as the characteristic pools of rare alleles for each of the populations. Molecular genetic analysis showed a high level of genetic diversity (H(o) = 0.704; PIC = 0.752; I = 1.617). Moreover, interpopulation variability accounted only for 7.5% of total variability, confirming the genetic closeness of the populations examined. Based on phylogenetic analysis, it was demonstrated that the Bel'bulak and Almaty Reserve populations were closest to each other, while the most distant were the Ketmen and Great Almaty gorge populations, which suggests the dependence of genetic distance on the geographical.

  2. Microbial colonisation in diverse surface soil types in Surtsey and diversity analysis of its subsurface microbiota

    Science.gov (United States)

    Marteinsson, V.; Klonowski, A.; Reynisson, E.; Vannier, P.; Sigurdsson, B. D.; Ólafsson, M.

    2014-09-01

    Colonisation of life on Surtsey has been observed systematically since the formation of the island 50 years ago. Although the first colonisers were prokaryotes, such as bacteria and blue-green algae, most studies have been focusing on settlement of plants and animals but less on microbial succession. To explore microbial colonization in diverse soils and the influence of associate vegetation and birds on numbers of environmental bacteria, we collected 45 samples from different soils types on the surface of the island. Total viable bacterial counts were performed with plate count at 22, 30 and 37 °C for all soils samples and the amount of organic matter and nitrogen (N) was measured. Selected samples were also tested for coliforms, faecal coliforms aerobic and anaerobic bacteria. The deep subsurface biosphere was investigated by collecting liquid subsurface samples from a 182 m borehole with a special sampler. Diversity analysis of uncultivated biota in samples was performed by 16S rRNA gene sequences analysis and cultivation. Correlation was observed between N deficits and the number of microorganisms in surface soils samples. The lowest number of bacteria (1 × 104-1 × 105 g-1) was detected in almost pure pumice but the count was significant higher (1 × 106-1 × 109 g-1) in vegetated soil or pumice with bird droppings. The number of faecal bacteria correlated also to the total number of bacteria and type of soil. Bacteria belonging to Enterobacteriaceae were only detected in vegetated and samples containing bird droppings. The human pathogens Salmonella, Campylobacter and Listeria were not in any sample. Both thermophilic bacteria and archaea 16S rDNA sequences were found in the subsurface samples collected at 145 m and 172 m depth at 80 °C and 54 °C, respectively, but no growth was observed in enrichments. The microbiota sequences generally showed low affiliation to any known 16S rRNA gene sequences.

  3. Microbial colonization in diverse surface soil types in Surtsey and diversity analysis of its subsurface microbiota

    Science.gov (United States)

    Marteinsson, V.; Klonowski, A.; Reynisson, E.; Vannier, P.; Sigurdsson, B. D.; Ólafsson, M.

    2015-02-01

    Colonization of life on Surtsey has been observed systematically since the formation of the island 50 years ago. Although the first colonisers were prokaryotes, such as bacteria and blue-green algae, most studies have been focused on the settlement of plants and animals but less on microbial succession. To explore microbial colonization in diverse soils and the influence of associated vegetation and birds on numbers of environmental bacteria, we collected 45 samples from different soil types on the surface of the island. Total viable bacterial counts were performed with the plate count method at 22, 30 and 37 °C for all soil samples, and the amount of organic matter and nitrogen (N) was measured. Selected samples were also tested for coliforms, faecal coliforms and aerobic and anaerobic bacteria. The subsurface biosphere was investigated by collecting liquid subsurface samples from a 181 m borehole with a special sampler. Diversity analysis of uncultivated biota in samples was performed by 16S rRNA gene sequences analysis and cultivation. Correlation was observed between nutrient deficits and the number of microorganisms in surface soil samples. The lowest number of bacteria (1 × 104-1 × 105 cells g-1) was detected in almost pure pumice but the count was significantly higher (1 × 106-1 × 109 cells g-1) in vegetated soil or pumice with bird droppings. The number of faecal bacteria correlated also to the total number of bacteria and type of soil. Bacteria belonging to Enterobacteriaceae were only detected in vegetated samples and samples containing bird droppings. The human pathogens Salmonella, Campylobacter and Listeria were not in any sample. Both thermophilic bacteria and archaea 16S rDNA sequences were found in the subsurface samples collected at 145 and 172 m depth at 80 and 54 °C, respectively, but no growth was observed in enrichments. The microbiota sequences generally showed low affiliation to any known 16S rRNA gene sequences.

  4. Endohedral Metallofullerene as Molecular High Spin Qubit: Diverse Rabi Cycles in Gd2@C79N.

    Science.gov (United States)

    Hu, Ziqi; Dong, Bo-Wei; Liu, Zheng; Liu, Jun-Jie; Su, Jie; Yu, Changcheng; Xiong, Jin; Shi, Di-Er; Wang, Yuanyuan; Wang, Bing-Wu; Ardavan, Arzhang; Shi, Zujin; Jiang, Shang-Da; Gao, Song

    2018-01-24

    An anisotropic high-spin qubit with long coherence time could scale the quantum system up. It has been proposed that Grover's algorithm can be implemented in such systems. Dimetallic aza[80]fullerenes M 2 @C 79 N (M = Y or Gd) possess an unpaired electron located between two metal ions, offering an opportunity to manipulate spin(s) protected in the cage for quantum information processing. Herein, we report the crystallographic determination of Gd 2 @C 79 N for the first time. This molecular magnet with a collective high-spin ground state (S = 15/2) generated by strong magnetic coupling (J Gd-Rad = 350 ± 20 cm -1 ) has been unambiguously validated by magnetic susceptibility experiments. Gd 2 @C 79 N has quantum coherence and diverse Rabi cycles, allowing arbitrary superposition state manipulation between each adjacent level. The phase memory time reaches 5 μs at 5 K by dynamic decoupling. This molecule fulfills the requirements of Grover's searching algorithm proposed by Leuenberger and Loss.

  5. Molecular analysis of waxy mutants in rice

    International Nuclear Information System (INIS)

    Yatou, O.; Amano, E.

    1990-01-01

    Full text: The 'waxy' gene is a structural gene coding a glycosyl transferase which synthesises amylose in the endosperm tissue. 'Non-waxy' rice cultivars have an active gene and their amylose content is 18-25% depending upon gene performance and modifier genes. In 'waxy' rice, no amylose is found because the enzyme is absent. In mutants induced by gamma rays, neutrons, EI or EMS, amylose content ranged from 0 to 20%, i.e. there are intermediate phenotypes as well. Some of them had the same amount of the enzyme as a 'non-waxy' cultivar, even fully 'waxy' mutants showed a certain amount of the enzyme. This suggests that in mutants there may be no structural change in the enzyme gene but the enzyme produced might be less active. By molecular analysis of the mutants' genes it was found that only two mutants induced by thermal neutrons show structural alterations, the changes in other mutants are either too small to be detected by Southern analysis or are outside the structural gene in question. (author)

  6. The centroidal algorithm in molecular similarity and diversity calculations on confidential datasets

    Science.gov (United States)

    Trepalin, Sergey; Osadchiy, Nikolay

    2005-09-01

    Chemical structure provides exhaustive description of a compound, but it is often proprietary and thus an impediment in the exchange of information. For example, structure disclosure is often needed for the selection of most similar or dissimilar compounds. Authors propose a centroidal algorithm based on structural fragments (screens) that can be efficiently used for the similarity and diversity selections without disclosing structures from the reference set. For an increased security purposes, authors recommend that such set contains at least some tens of structures. Analysis of reverse engineering feasibility showed that the problem difficulty grows with decrease of the screen's radius. The algorithm is illustrated with concrete calculations on known steroidal, quinoline, and quinazoline drugs. We also investigate a problem of scaffold identification in combinatorial library dataset. The results show that relatively small screens of radius equal to 2 bond lengths perform well in the similarity sorting, while radius 4 screens yield better results in diversity sorting. The software implementation of the algorithm taking SDF file with a reference set generates screens of various radii which are subsequently used for the similarity and diversity sorting of external SDFs. Since the reverse engineering of the reference set molecules from their screens has the same difficulty as the RSA asymmetric encryption algorithm, generated screens can be stored openly without further encryption. This approach ensures an end user transfers only a set of structural fragments and no other data. Like other algorithms of encryption, the centroid algorithm cannot give 100% guarantee of protecting a chemical structure from dataset, but probability of initial structure identification is very small-order of 10-40 in typical cases.

  7. Polymer Molecular Weight Analysis by [Superscript 1]H NMR Spectroscopy

    Science.gov (United States)

    Izunobi, Josephat U.; Higginbotham, Clement L.

    2011-01-01

    The measurement and analysis of molecular weight and molecular weight distribution remain matters of fundamental importance for the characterization and physical properties of polymers. Gel permeation chromatography (GPC) is the most routinely used method for the molecular weight determination of polymers whereas matrix-assisted laser…

  8. VNTR analysis reveals unexpected genetic diversity within Mycoplasma agalactiae, the main causative agent of contagious agalactia

    Directory of Open Access Journals (Sweden)

    Ayling Roger D

    2008-11-01

    Full Text Available Abstract Background Mycoplasma agalactiae is the main cause of contagious agalactia, a serious disease of sheep and goats, which has major clinical and economic impacts. Previous studies of M. agalactiae have shown it to be unusually homogeneous and there are currently no available epidemiological techniques which enable a high degree of strain differentiation. Results We have developed variable number tandem repeat (VNTR analysis using the sequenced genome of the M. agalactiae type strain PG2. The PG2 genome was found to be replete with tandem repeat sequences and 4 were chosen for further analysis. VNTR 5 was located within the hypothetical protein MAG6170 a predicted lipoprotein. VNTR 14 was intergenic between the hypothetical protein MAG3350 and the hypothetical protein MAG3340. VNTR 17 was intergenic between the hypothetical protein MAG4060 and the hypothetical protein MAG4070 and VNTR 19 spanned the 5' end of the pseudogene for a lipoprotein MAG4310 and the 3' end of the hypothetical lipoprotein MAG4320. We have investigated the genetic diversity of 88 M. agalactiae isolates of wide geographic origin using VNTR analysis and compared it with pulsed field gel electrophoresis (PFGE and random amplified polymorphic DNA (RAPD analysis. Simpson's index of diversity was calculated to be 0.324 for PFGE and 0.574 for VNTR analysis. VNTR analysis revealed unexpected diversity within M. agalactiae with 9 different VNTR types discovered. Some correlation was found between geographical origin and the VNTR type of the isolates. Conclusion VNTR analysis represents a useful, rapid first-line test for use in molecular epidemiological analysis of M. agalactiae for outbreak tracing and control.

  9. Molecular analysis of deep subsurface bacteria

    International Nuclear Information System (INIS)

    Jimenez Baez, L.E.

    1989-09-01

    Deep sediments samples from site C10a, in Appleton, and sites, P24, P28, and P29, at the Savannah River Site (SRS), near Aiken, South Carolina were studied to determine their microbial community composition, DNA homology and mol %G+C. Different geological formations with great variability in hydrogeological parameters were found across the depth profile. Phenotypic identification of deep subsurface bacteria underestimated the bacterial diversity at the three SRS sites, since bacteria with the same phenotype have different DNA composition and less than 70% DNA homology. Total DNA hybridization and mol %G+C analysis of deep sediment bacterial isolates suggested that each formation is comprised of different microbial communities. Depositional environment was more important than site and geological formation on the DNA relatedness between deep subsurface bacteria, since more 70% of bacteria with 20% or more of DNA homology came from the same depositional environments. Based on phenotypic and genotypic tests Pseudomonas spp. and Acinetobacter spp.-like bacteria were identified in 85 million years old sediments. This suggests that these microbial communities might have been adapted during a long period of time to the environmental conditions of the deep subsurface

  10. Genetic diversity, identification, and certification of Chilean rice varieties using molecular markers

    Directory of Open Access Journals (Sweden)

    Viviana Becerra

    2015-09-01

    Full Text Available It takes approximately 14 yr to produce a new rice (Oryza sativa L. variety, that is, from initial hybridization to its commercial release. Currently, new varieties are identified based on morphological descriptors, which have been efficient over time. However, due to the main constraints on seed type impose to other breeding objectives and the pressure of continuous release of varieties, high degree of parentage, and genetic and morphological uniformity has been observed in the breeding populations. The objectives of this study were: to determine the genetic variability of Chilean and foreign commercial rice varieties, and determine, identify, and certify the genetic relationships among varieties, using simple sequence repeat (SSR markers. A total of 16 commercial varieties, some of them closely related, were included in the study, which were genétically analyzed using 54 microsatellites. The 54 microsatellite loci allowed the discrimination among the 16 varieties. The number of alleles ranged between 2 and 8 with a mean of 3.54 alleles per locus, while the polymorphism information content (PIC presented a mean of 0.44. The genetic distance and diversity parameters between pairs of varieties indicate a limited diversity among these genotypes. The cluster analysis indicated that varieties were grouped according to their grain type and pedigree. Results demonstrate that the identification and certification of varieties using microsatellite markers could be a good complement to existing agro-morphological data when varieties are closed related.

  11. A molecular study of genetic diversity in shisham (Dalbergia Sissoo) plantation of NWFP, Pakistan

    Energy Technology Data Exchange (ETDEWEB)

    Ashraf, M; Tabassum, S [Nation al Univ. of Science and Technology, Islamabad (Pakistan). Dept. of Plant Sciences; Mumtaz, S; Riasat, R [Quaid-i-Azam Univ., Islamabad (Pakistan)

    2010-02-15

    Genetic diversity of 22 accessions of Dalbergia sissoo that were collected from the canal, road and farmer's field and forest sites of N.W.F.P, Pakistan has been studied, by using a finger printing technique 'RAPD' (Random Amplified Polymorphism DNA). Out of 20 primers OPA-2 was the primer that allows distinguishing the diseased and healthy accessions. The selected primer was used for identification and for establishing a profiling system to estimate genetic relationships and to evaluate the genetic variability among the accessions. A total of 126 DNA bands or fragments were amplified by using the primers. The UPGMA cluster analysis revealed 2 main clusters among 22 accessions of Dalbergia sissoo based on coefficient of similarity and dissimilarity. Overall 72% similarity and 98% dissimilarity were observed. Low level of genetic variation and high level of genetic relatedness occurred among the canal, road, farmer's field and forest sites. The accessions were closely related with each other and showed mix pattern of genetic diversity. Thus RAPD markers have the potential to characterize and establish genetic relationships among the accessions of Dalbergia sissoo. (author)

  12. A molecular study of genetic diversity in shisham (Dalbergia Sissoo) plantation of NWFP, Pakistan

    International Nuclear Information System (INIS)

    Ashraf, M.; Tabassum, S.

    2010-01-01

    Genetic diversity of 22 accessions of Dalbergia sissoo that were collected from the canal, road and farmer's field and forest sites of N.W.F.P, Pakistan has been studied, by using a finger printing technique 'RAPD' (Random Amplified Polymorphism DNA). Out of 20 primers OPA-2 was the primer that allows distinguishing the diseased and healthy accessions. The selected primer was used for identification and for establishing a profiling system to estimate genetic relationships and to evaluate the genetic variability among the accessions. A total of 126 DNA bands or fragments were amplified by using the primers. The UPGMA cluster analysis revealed 2 main clusters among 22 accessions of Dalbergia sissoo based on coefficient of similarity and dissimilarity. Overall 72% similarity and 98% dissimilarity were observed. Low level of genetic variation and high level of genetic relatedness occurred among the canal, road, farmer's field and forest sites. The accessions were closely related with each other and showed mix pattern of genetic diversity. Thus RAPD markers have the potential to characterize and establish genetic relationships among the accessions of Dalbergia sissoo. (author)

  13. Molecular diversity of human parvovirus B19 during two outbreaks of erythema infectiosum in Brazil

    Directory of Open Access Journals (Sweden)

    Rita de Cássia Nasser Cubel Garcia

    2017-01-01

    Full Text Available This study was conducted to provide information on the genetic diversity of human parvovirus B19 (B19V circulating in the municipality of Niterói, Rio de Janeiro, Southeast Brazil during 1996–2006, a period with two distinct outbreaks of B19V infection: 1999–2000 and 2004–2005. A total of 27 sera from patients with erythema infectiosum and five sera from HIV-infected patients that tested positive for B19V DNA during the study period were analyzed. To genotype B19V strains, a semi-nested PCR for partial amplification of the capsid gene was performed and sequence analysis revealed that 31 sequences belonged to subgenotype 1a (G1a of the main genotype 1 and one sequence was characterized as subgenotype 3b (G3b. The phylogenetic tree supported the division of the G1a into two well-defined clades with 1.3% of divergence. The low diversity of the G1a strains may be explained by the fact that all patients had acute B19V infection and 30/32 sera were collected during two distinct outbreaks. The G3b strain was from an HIV-infected patient who seroconverted to anti-B19 IgG antibodies in September/2005. This is the first report of G3b in the state of Rio de Janeiro.

  14. Genetic diversity analyses of Lasiodiplodia theobromae on Morus alba and Agave sisalana based on RAPD and ISSR molecular markers

    Directory of Open Access Journals (Sweden)

    Hong-hui Xie

    2016-10-01

    Full Text Available Genetic diversity of 23 Lasiodiplodia theobromae isolates on Morus alba and 6 isolates on Agave sisalana in Guangxi province, China, was studied by using random amplified polymorphic DNA and inter-simple sequence repeat molecular markers. Results of two molecular markers showed that the average percentage of polymorphic loci of all isolates was more than 93%. Both dendrograms of two molecular markers showed obvious relationship between groups and the geographical locations where those strains were collected, among which, the 23 isolates on M. alba were divided into 4 populations and the 6 isolates on A. sisalana were separated as a independent population. The average genetic identity and genetic distance of 5 populations were 0.7215, 0.3284 and 0.7915, 0.2347, respectively, which indicated that the genetic identity was high and the genetic distance was short in the 5 populations. Average value of the gene diversity index (H and the Shannon’s information index (I of 29 isolates were significantly higher than 5 populations which showed that genetic diversity of those isolates was richer than the populations and the degree of genetic differentiation of the isolates was higher. The Gst and Nm of 29 isolates were 0.4411, 0.6335 and 0.4756, 0.5513, respectively, which showed that the genetic diversity was rich in those isolates.

  15. Analysis of Molecular Variance Inferred from Metric Distances among DNA Haplotypes: Application to Human Mitochondrial DNA Restriction Data

    OpenAIRE

    Excoffier, L.; Smouse, P. E.; Quattro, J. M.

    1992-01-01

    We present here a framework for the study of molecular variation within a single species. Information on DNA haplotype divergence is incorporated into an analysis of variance format, derived from a matrix of squared-distances among all pairs of haplotypes. This analysis of molecular variance (AMOVA) produces estimates of variance components and F-statistic analogs, designated here as φ-statistics, reflecting the correlation of haplotypic diversity at different levels of hierarchical subdivisi...

  16. Genetic diversity analysis of Capparis spinosa L. populations by using ISSR markers.

    Science.gov (United States)

    Liu, C; Xue, G P; Cheng, B; Wang, X; He, J; Liu, G H; Yang, W J

    2015-12-09

    Capparis spinosa L. is an important medicinal species in the Xinjiang Province of China. Ten natural populations of C. spinosa from 3 locations in North, Central, and South Xinjiang were studied using morphological trait inter simple sequence repeat (ISSR) molecular markers to assess the genetic diversity and population structure. In this study, the 10 ISSR primers produced 313 amplified DNA fragments, with 52% of fragments being polymorphic. Unweighted pair-group method with arithmetic average (UPGMA) cluster analysis indicated that 10 C. spinosa populations were clustered into 3 geographically distinct groups. The Nei gene of C. spinosa populations in different regions had Diversity and Shannon's information index ranges of 0.1312-0.2001 and 0.1004-0.1875, respectively. The 362 markers were used to construct the dendrogram based on the UPGMA cluster analysis. The dendrogram indicated that 10 populations of C. spinosa were clustered into 3 geographically distinct groups. The results showed these genotypes have high genetic diversity, and can be used for an alternative breeding program.

  17. Diversity analysis of gut microbiota in osteoporosis and osteopenia patients

    Directory of Open Access Journals (Sweden)

    Jihan Wang

    2017-06-01

    Full Text Available Some evidence suggests that bone health can be regulated by gut microbiota. To better understand this, we performed 16S ribosomal RNA sequencing to analyze the intestinal microbial diversity in primary osteoporosis (OP patients, osteopenia (ON patients and normal controls (NC. We observed an inverse correlation between the number of bacterial taxa and the value of bone mineral density. The diversity estimators in the OP and ON groups were increased compared with those in the NC group. Beta diversity analyses based on hierarchical clustering and principal coordinate analysis (PCoA could discriminate the NC samples from OP and ON samples. Firmicutes, Bacteroidetes, Proteobacteria and Actinobacteria constituted the four dominant phyla in all samples. Proportion of Firmicutes was significantly higher and Bacteroidetes was significantly lower in OP samples than that in NC samples (p < 0.05, Gemmatimonadetes and Chloroflexi were significantly different between OP and NC group as well as between ON and NC group (p < 0.01. A total of 21 genera with proportions above 1% were detected and Bacteroides accounted for the largest proportion in all samples. The Blautia, Parabacteroides and Ruminococcaceae genera differed significantly between the OP and NC group (p < 0.05. Linear discriminant analysis (LDA results showed one phylum community and seven phylum communities were enriched in ON and OP, respectively. Thirty-five genus communities, five genus communities and two genus communities were enriched in OP, ON and NC, respectively. The results of this study indicate that gut microbiota may be a critical factor in osteoporosis development, which can further help us search for novel biomarkers of gut microbiota in OP and understand the interaction between gut microbiota and bone health.

  18. Diversity analysis of gut microbiota in osteoporosis and osteopenia patients.

    Science.gov (United States)

    Wang, Jihan; Wang, Yangyang; Gao, Wenjie; Wang, Biao; Zhao, Heping; Zeng, Yuhong; Ji, Yanhong; Hao, Dingjun

    2017-01-01

    Some evidence suggests that bone health can be regulated by gut microbiota. To better understand this, we performed 16S ribosomal RNA sequencing to analyze the intestinal microbial diversity in primary osteoporosis (OP) patients, osteopenia (ON) patients and normal controls (NC). We observed an inverse correlation between the number of bacterial taxa and the value of bone mineral density. The diversity estimators in the OP and ON groups were increased compared with those in the NC group. Beta diversity analyses based on hierarchical clustering and principal coordinate analysis (PCoA) could discriminate the NC samples from OP and ON samples. Firmicutes, Bacteroidetes, Proteobacteria and Actinobacteria constituted the four dominant phyla in all samples. Proportion of Firmicutes was significantly higher and Bacteroidetes was significantly lower in OP samples than that in NC samples ( p  < 0.05), Gemmatimonadetes and Chloroflexi were significantly different between OP and NC group as well as between ON and NC group ( p  < 0.01). A total of 21 genera with proportions above 1% were detected and Bacteroides accounted for the largest proportion in all samples. The Blautia, Parabacteroides and Ruminococcaceae genera differed significantly between the OP and NC group ( p  < 0.05). Linear discriminant analysis (LDA) results showed one phylum community and seven phylum communities were enriched in ON and OP, respectively. Thirty-five genus communities, five genus communities and two genus communities were enriched in OP, ON and NC, respectively. The results of this study indicate that gut microbiota may be a critical factor in osteoporosis development, which can further help us search for novel biomarkers of gut microbiota in OP and understand the interaction between gut microbiota and bone health.

  19. Analysis of genetic diversity in Bolivian llama populations using microsatellites.

    Science.gov (United States)

    Barreta, J; Gutiérrez-Gil, B; Iñiguez, V; Romero, F; Saavedra, V; Chiri, R; Rodríguez, T; Arranz, J J

    2013-08-01

    South American camelids (SACs) have a major role in the maintenance and potential future of rural Andean human populations. More than 60% of the 3.7 million llamas living worldwide are found in Bolivia. Due to the lack of studies focusing on genetic diversity in Bolivian llamas, this analysis investigates both the genetic diversity and structure of 12 regional groups of llamas that span the greater part of the range of distribution for this species in Bolivia. The analysis of 42 microsatellite markers in the considered regional groups showed that, in general, there were high levels of polymorphism (a total of 506 detected alleles; average PIC across per marker: 0.66), which are comparable with those reported for other populations of domestic SACs. The estimated diversity parameters indicated that there was high intrapopulational genetic variation (average number of alleles and average expected heterozygosity per marker: 12.04 and 0.68, respectively) and weak genetic differentiation among populations (FST range: 0.003-0.052). In agreement with these estimates, Bolivian llamas showed a weak genetic structure and an intense gene flow between all the studied regional groups, which is due to the exchange of reproductive males between the different flocks. Interestingly, the groups for which the largest pairwise FST estimates were observed, Sud Lípez and Nor Lípez, showed a certain level of genetic differentiation that is probably due to the pattern of geographic isolation and limited communication infrastructures of these southern localities. Overall, the population parameters reported here may serve as a reference when establishing conservation policies that address Bolivian llama populations. © 2012 Blackwell Verlag GmbH.

  20. Molecular diversity of arbuscular mycorrhizal fungi in relation to soil chemical properties and heavy metal contamination.

    Science.gov (United States)

    Zarei, Mehdi; Hempel, Stefan; Wubet, Tesfaye; Schäfer, Tina; Savaghebi, Gholamreza; Jouzani, Gholamreza Salehi; Nekouei, Mojtaba Khayam; Buscot, François

    2010-08-01

    Abundance and diversity of arbuscular mycorrhizal fungi (AMF) associated with dominant plant species were studied along a transect from highly lead (Pb) and zinc (Zn) polluted to non-polluted soil at the Anguran open pit mine in Iran. Using an established primer set for AMF in the internal transcribed spacer (ITS) region of rDNA, nine different AMF sequence types were distinguished after phylogenetic analyses, showing remarkable differences in their distribution patterns along the transect. With decreasing Pb and Zn concentration, the number of AMF sequence types increased, however one sequence type was only found in the highly contaminated area. Multivariate statistical analysis revealed that further factors than HM soil concentration affect the AMF community at contaminated sites. Specifically, the soils' calcium carbonate equivalent and available P proved to be of importance, which illustrates that field studies on AMF distribution should also consider important environmental factors and their possible interactions. Copyright 2010 Elsevier Ltd. All rights reserved.

  1. Molecular Diversity of Trypanosoma cruzi Detected in the Vector Triatoma protracta from California, USA.

    Directory of Open Access Journals (Sweden)

    Lisa A Shender

    2016-01-01

    Full Text Available Trypanosoma cruzi, causative agent of Chagas disease in humans and dogs, is a vector-borne zoonotic protozoan parasite that can cause fatal cardiac disease. While recognized as the most economically important parasitic infection in Latin America, the incidence of Chagas disease in the United States of America (US may be underreported and even increasing. The extensive genetic diversity of T. cruzi in Latin America is well-documented and likely influences disease progression, severity and treatment efficacy; however, little is known regarding T. cruzi strains endemic to the US. It is therefore important to expand our knowledge on US T. cruzi strains, to improve upon the recognition of and response to locally acquired infections.We conducted a study of T. cruzi molecular diversity in California, augmenting sparse genetic data from southern California and for the first time investigating genetic sequences from northern California. The vector Triatoma protracta was collected from southern (Escondido and Los Angeles and northern (Vallecito California regions. Samples were initially screened via sensitive nuclear repetitive DNA and kinetoplast minicircle DNA PCR assays, yielding an overall prevalence of approximately 28% and 55% for southern and northern California regions, respectively. Positive samples were further processed to identify discrete typing units (DTUs, revealing both TcI and TcIV lineages in southern California, but only TcI in northern California. Phylogenetic analyses (targeting COII-ND1, TR and RB19 genes were performed on a subset of positive samples to compare Californian T. cruzi samples to strains from other US regions and Latin America. Results indicated that within the TcI DTU, California sequences were similar to those from the southeastern US, as well as to several isolates from Latin America responsible for causing Chagas disease in humans.Triatoma protracta populations in California are frequently infected with T. cruzi

  2. Molecular Genetic Diversity of Date (Phoenix dactylifera) Germplasm in Qatar based on Microsatellite Markers

    KAUST Repository

    Ahmed, Talaat

    2016-01-25

    Depending on morphological traits alone, studying the genetic diversity of date palm is a very difficult task since morphological characteristics are highly affected by the environment. DNA markers are excellent option that can help and enhance the discriminatory power of morphological characteristics. To study the genetic diversity among date palm cultivars grown in Qatar, fifteen Date palm samples were collected from Qatar University Experimental Farm. DNAs were extracted from fresh leaves by using commercial DNeasy Plant System Kit (Qiagen, Inc., Valencia, CA). Total of 18 (Inter Simple Sequence Repeat) ISSR single primers were used to amplify DNA fragments using genomic DNA of the 15 samples. First screening was done to test the ability of these primers to amplify clear bands using Date palm genomic DNA. All 18 ISSR primers successfully produced clear bands in the first screening. Then, each primer was used separately to genotype the whole set of 15 Date palm samples. Total of 4794 bands were generated using 18 ISSR primers for the 15 Date palm samples. On average, each primer generated 400 bands. The Number of amplified bands varied from cultivar to cultivar. The highest number of bands was obtained using Primers 2, 5 and 12 for the 15 (470 bands), while the lowest number of bands were obtained by Primers 1, 7 and 8 where they produced only 329 bands. Markers were scored for the presence and absence of the corresponding band among the different cultivars. Data were subjected to cluster analysis. A similarity matrix was constructed and the similarity values were used for cluster analysis.

  3. Diversion path analysis for the Swedish geological repository

    International Nuclear Information System (INIS)

    Fritzell, Anni; Meer, Klaas Van Der

    2008-02-01

    The Swedish strategy to handle the spent fuel from the nuclear power plants is direct disposal in a geological repository. The safeguards regime covering all nuclear material in the state will be expanded to cover the new repository, which will require a novel safeguards approach due mainly to the inaccessibility of the fuel after disposal. The safeguards approach must be able to provide a high level of assurance that the fuel in the repository not diverted, but must also be resource efficient. An attractive approach with regards to use of resources is to monitor only the access points to the repository, i.e. the openings. The implementation of such an approach can only be allowed if it is shown to be sufficiently secure. With the purpose of determining the applicability of this 'black box' approach, a diversion path analysis for the Swedish geological repository has been carried out. The result from the analysis shows that all credible diversion paths could be covered by the black-box safeguards approach provided that the identified boundary conditions can be met

  4. Diversion path analysis for the Swedish geological repository

    Energy Technology Data Exchange (ETDEWEB)

    Fritzell, Anni (Dept. of Physics and Astronomy, Uppsala Univ., Uppsala (Sweden)); Meer, Klaas Van Der (Belgian Nuclear Research Center SCK.CEN (BG))

    2008-02-15

    The Swedish strategy to handle the spent fuel from the nuclear power plants is direct disposal in a geological repository. The safeguards regime covering all nuclear material in the state will be expanded to cover the new repository, which will require a novel safeguards approach due mainly to the inaccessibility of the fuel after disposal. The safeguards approach must be able to provide a high level of assurance that the fuel in the repository not diverted, but must also be resource efficient. An attractive approach with regards to use of resources is to monitor only the access points to the repository, i.e. the openings. The implementation of such an approach can only be allowed if it is shown to be sufficiently secure. With the purpose of determining the applicability of this 'black box' approach, a diversion path analysis for the Swedish geological repository has been carried out. The result from the analysis shows that all credible diversion paths could be covered by the black-box safeguards approach provided that the identified boundary conditions can be met

  5. The impact of phenotypic and molecular data on the inference of Colletotrichum diversity associated with Musa.

    Science.gov (United States)

    Vieira, Willie A S; Lima, Waléria G; Nascimento, Eduardo S; Michereff, Sami J; Câmara, Marcos P S; Doyle, Vinson P

    2017-01-01

    Developing a comprehensive and reliable taxonomy for the Colletotrichum gloeosporioides species complex will require adopting data standards on the basis of an understanding of how methodological choices impact morphological evaluations and phylogenetic inference. We explored the impact of methodological choices in a morphological and molecular evaluation of Colletotrichum species associated with banana in Brazil. The choice of alignment filtering algorithm has a significant impact on topological inference and the retention of phylogenetically informative sites. Similarly, the choice of phylogenetic marker affects the delimitation of species boundaries, particularly if low phylogenetic signal is confounded with strong discordance, and inference of the species tree from multiple-gene trees. According to both phylogenetic informativeness profiling and Bayesian concordance analyses, the most informative loci are DNA lyase (APN2), intergenic spacer (IGS) between DNA lyase and the mating-type locus MAT1-2-1 (APN2/MAT-IGS), calmodulin (CAL), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), glutamine synthetase (GS), β-tubulin (TUB2), and a new marker, the intergenic spacer between GAPDH and an hypothetical protein (GAP2-IGS). Cornmeal agar minimizes the variance in conidial dimensions compared with potato dextrose agar and synthetic nutrient-poor agar, such that species are more readily distinguishable based on phenotypic differences. We apply these insights to investigate the diversity of Colletotrichum species associated with banana anthracnose in Brazil and report C. musae, C. tropicale, C. theobromicola, and C. siamense in association with banana anthracnose. One lineage did not cluster with any previously described species and is described here as C. chrysophilum.

  6. The bladed Bangiales (Rhodophyta) of the South Eastern Pacific: Molecular species delimitation reveals extensive diversity.

    Science.gov (United States)

    Guillemin, Marie-Laure; Contreras-Porcia, Loretto; Ramírez, María Eliana; Macaya, Erasmo C; Contador, Cristian Bulboa; Woods, Helen; Wyatt, Christopher; Brodie, Juliet

    2016-01-01

    A molecular taxonomic study of the bladed Bangiales of the South Eastern Pacific (coast of Chile) was undertaken based on sequence data of the mitochondrial COI and chloroplast rbcL for 193 specimens collected from Arica (18°S) in the north to South Patagonia (53°S) in the south. The results revealed for the first time that four genera, Porphyra, Pyropia, Fuscifolium and Wildemania were present in the region. Species delimitation was determined based on a combination of a General Mixed Yule Coalescence model (GMYC) and Automatic Barcode Gap Discovery (ABGD) coupled with detection of monophyly in tree reconstruction. The overall incongruence between the species delimitation methods within each gene was 29%. The GMYC method led to over-splitting groups, whereas the ABGD method had a tendency to lump groups. Taking a conservative approach to the number of putative species, at least 18 were recognized and, with the exception of the recently described Pyropia orbicularis, all were new to the Chilean flora. Porphyra and Pyropia were the most diverse genera with eight 'species' each, whereas only a 'single' species each was found for Fuscifolium and Wildemania. There was also evidence of recently diverging groups: Wildemania sp. was distinct but very closely related to W. amplissima from the Northern Hemisphere and raises questions in relation to such disjunct distributions. Pyropia orbicularis was very closely related to two other species, making species delimitation very difficult but provides evidence of an incipient speciation. The difference between the 'species' discovered and those previously reported for the region is discussed in relation to the difficulty of distinguishing species based on morphological identification. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Molecular diversity of Mycobacterium tuberculosis isolates from patients with tuberculosis in Honduras

    Directory of Open Access Journals (Sweden)

    Ghebremichael Solomon

    2010-08-01

    Full Text Available Abstract Background Tuberculosis persists as a public health problem in Honduras. A better knowledge of the molecular characteristics of Mycobacterium tuberculosis strains will contribute to understand the transmission dynamics of the disease within the country. The aim of this study was to provide an insight of the genetic biodiversity of M. tuberculosis clinical isolates collected in Honduras between 1994 and 2002. Genotyping was performed using spoligotyping and RFLP. The spoligotypes obtained were compared with the SITVIT2 proprietary database of the Pasteur Institute of Guadeloupe. Results Spoligotyping grouped 84% of the isolates into 27 clusters (2 to 43 strains per cluster. Of the 44 shared international types (SITs identified among the Honduran stains, 8 SITs were newly identified either within the present study or after match with an orphan type previously identified in the SITVIT2 database. In addition, 16 patterns corresponded to orphan, previously unreported isolates. The Latin American Mediterranean (LAM lineage was the most common in this study; 55% of the strains belonged to this family. Other genotypes found were Haarlem (16%, T (16%, X-clade (6%, Unknown signature (5% and S (1%. Only one Beijing strain was identified (0.5%. We observed a high degree of diversity after characterizing the 43 isolates belonging to the main spoligotyping cluster (SIT 33, LAM3 with IS6110-RFLP. A total of 35 different RFLP-fingerprints were detected, of which 6 patterns corresponded to the same number of clusters comprising 14 strains. Conclusions The findings obtained in this study show that tuberculosis transmission in Honduras is due to modern M. tuberculosis lineages with high level of biodiversity.

  8. Molecular diversity of Mycobacterium tuberculosis isolates from patients with tuberculosis in Honduras

    Science.gov (United States)

    2010-01-01

    Background Tuberculosis persists as a public health problem in Honduras. A better knowledge of the molecular characteristics of Mycobacterium tuberculosis strains will contribute to understand the transmission dynamics of the disease within the country. The aim of this study was to provide an insight of the genetic biodiversity of M. tuberculosis clinical isolates collected in Honduras between 1994 and 2002. Genotyping was performed using spoligotyping and RFLP. The spoligotypes obtained were compared with the SITVIT2 proprietary database of the Pasteur Institute of Guadeloupe. Results Spoligotyping grouped 84% of the isolates into 27 clusters (2 to 43 strains per cluster). Of the 44 shared international types (SITs) identified among the Honduran stains, 8 SITs were newly identified either within the present study or after match with an orphan type previously identified in the SITVIT2 database. In addition, 16 patterns corresponded to orphan, previously unreported isolates. The Latin American Mediterranean (LAM) lineage was the most common in this study; 55% of the strains belonged to this family. Other genotypes found were Haarlem (16%), T (16%), X-clade (6%), Unknown signature (5%) and S (1%). Only one Beijing strain was identified (0.5%). We observed a high degree of diversity after characterizing the 43 isolates belonging to the main spoligotyping cluster (SIT 33, LAM3) with IS6110-RFLP. A total of 35 different RFLP-fingerprints were detected, of which 6 patterns corresponded to the same number of clusters comprising 14 strains. Conclusions The findings obtained in this study show that tuberculosis transmission in Honduras is due to modern M. tuberculosis lineages with high level of biodiversity. PMID:20678242

  9. Molecular structure and diversity of PBAN/Pyrokinin family peptides in ants

    Directory of Open Access Journals (Sweden)

    Man-Yeon eChoi

    2012-02-01

    Full Text Available Neuropeptides are the largest group of insect hormones. They are produced in the central and peripheral nervous systems and affect insect development, reproduction, feeding and behavior. A variety of neuropeptide families have been identified in insects. One of these families is the PBAN/pyrokinin family defined by a common FXPRLamide or similar amino acid fragment at the C-terminal end. These peptides, found in all insects studied thus far, have been conserved throughout evolution. The most well studied physiological function is regulation of moth sex pheromone biosynthesis through the Pheromone Biosynthesis Activating Neurohormone (PBAN, although several developmental functions have also been reported. Over the past years we have extended knowledge of the PBAN/pyrokinin family of peptides to ants, focusing mainly on the fire ant, Solenopsis invicta. The fire ant is one of the most studied social insects and over the last 60 years a great deal has been learned about many aspects of this ant, including the behaviors and chemistry of pheromone communication. However, virtually nothing is known about the regulation of these pheromone systems. Recently, we demonstrated the presence of PBAN/pyrokinin immunoreactive neurons in the fire ant, and identified and characterized PBAN and additional neuropeptides. We have mapped the fire ant PBAN gene structure and determined the tissue expression level in the central nervous system of the ant. We review here our research to date on the molecular structure and diversity of ant PBAN/pyrokinin peptides in preparation for determining the function of the neuropeptides in ants and other social insects.

  10. Molecular phylogeny analysis and species identification of Dendrobium (Orchidaceae) in China.

    Science.gov (United States)

    Feng, Shang-Guo; Lu, Jiang-Jie; Gao, Ling; Liu, Jun-Jun; Wang, Hui-Zhong

    2014-04-01

    Dendrobium plants are important commercial herbs in China, widely used in traditional medicine and ornamental horticulture. In this study, sequence-related amplified polymorphism (SRAP) markers were applied to molecular phylogeny analysis and species identification of 31 Chinese Dendrobium species. Fourteen SRAP primer pairs produced 727 loci, 97% of which (706) showed polymorphism. Average polymorphism information content of the SRAP pairs was 0.987 (0.982-0.991), showing that plenty of genetic diversity exists at the interspecies level of Chinese Dendrobium. The molecular phylogeny analysis (UPGMA) grouped the 31 Dendrobium species into six clusters. We obtained 18 species-specific markers, which can be used to identify 10 of the 31 species. Our results indicate the SRAP marker system is informative and would facilitate further application in germplasm appraisal, evolution, and genetic diversity studies in the genus Dendrobium.

  11. Genetic diversity and molecular evolution of Ornithogalum mosaic virus based on the coat protein gene sequence

    Directory of Open Access Journals (Sweden)

    Fangluan Gao

    2018-03-01

    Full Text Available Ornithogalum mosaic virus (OrMV has a wide host range and affects the production of a variety of ornamentals. In this study, the coat protein (CP gene of OrMVwas used to investigate the molecular mechanisms underlying the evolution of this virus. The 36 OrMV isolates fell into two groups which have significant subpopulation differentiation with an FST value of 0.470. One isolate was identified as a recombinant and the other 35 recombination-free isolates could be divided into two major clades under different evolutionary constraints with dN/dS values of 0.055 and 0.028, respectively, indicating a role of purifying selection in the differentiation of OrMV. In addition, the results from analysis of molecular variance (AMOVA indicated that the effect of host species on the genetic divergence of OrMV is greater than that of geography. Furthermore, OrMV isolates from the genera Ornithogalum, Lachenalia and Diuri tended to group together, indicating that OrMV diversification was maintained, in part, by host-driven adaptation.

  12. Molecular Analysis Research at Community College of Philadelphia

    Science.gov (United States)

    2015-09-21

    YOUR FORM TO THE ABOVE ADDRESS. Community College of Philadelphia Community College of Philadelphia 1700 Spring Garden Street Philadelphia, PA 19130...Approved for Public Release; Distribution Unlimited Final Report: Molecular Analysis Research at Community College of Philadelphia The views, opinions...Molecular Analysis Research at Community College of Philadelphia Report Title AXIMA Assurance mass spectrometer, Leica DMI-8 fluorescent microscope

  13. H2B ubiquitination: Conserved molecular mechanism, diverse physiologic functions of the E3 ligase during meiosis.

    Science.gov (United States)

    Wang, Liying; Cao, Chunwei; Wang, Fang; Zhao, Jianguo; Li, Wei

    2017-09-03

    RNF20/Bre1 mediated H2B ubiquitination (H2Bub) has various physiologic functions. Recently, we found that H2Bub participates in meiotic recombination by promoting chromatin relaxation during meiosis. We then analyzed the phylogenetic relationships among the E3 ligase for H2Bub, its E2 Rad6 and their partner WW domain-containing adaptor with a coiled-coil (WAC) or Lge1, and found that the molecular mechanism underlying H2Bub is evolutionarily conserved from yeast to mammals. However, RNF20 has diverse physiologic functions in different organisms, which might be caused by the evolutionary divergency of their domain/motif architectures. In the current extra view, we not only elucidate the evolutionarily conserved molecular mechanism underlying H2Bub, but also discuss the diverse physiologic functions of RNF20 during meiosis.

  14. Assessment of genetic diversity within the Merodon ruficornis species group (Diptera: Syrphidae by RAPD analysis

    Directory of Open Access Journals (Sweden)

    Andrić Andrijana

    2017-01-01

    Full Text Available As one of the most distinct groups in the hoverfly genus Merodon, the monophyletic ruficornis species group has been the focus of several studies using different approaches. Molecular methods have shown incongruences between morphological and molecular data. In the present study, we investigated four species of the Merodon ruficornis group (i.e. M. loewi, M. armipes, M. papillus and M. hoplitis with the aim of detecting intra- and interspecific genetic diversity, and we examined the usefulness of random amplified polymorphic DNA (RAPD in an integrative taxonomic approach to species delimitation. Analysis of Nei’s genetic variation over all loci showed that genetic diversity for the analyzed Merodon species was h=0.24. Based on UPGMA, PCoA and Bayesian clustering analyses, our results clearly differentiated four groups that correspond to the four morphologically-defined Merodon species. Among the analyzed species, M. armipes and M. hoplitis showed the lowest level of genetic divergence; M. loewi was clearly separated from both M. armipes and M. papillus. Based on our data, we propose the use of RAPD-PCR as an additional tool for resolving taxonomic problems within Merodon. [Project of the Serbian Ministry of Education, Science and Technological Development, Grant no.173002

  15. Multilocus sequence analysis of Treponema denticola strains of diverse origin

    Directory of Open Access Journals (Sweden)

    Mo Sisu

    2013-02-01

    Full Text Available Abstract Background The oral spirochete bacterium Treponema denticola is associated with both the incidence and severity of periodontal disease. Although the biological or phenotypic properties of a significant number of T. denticola isolates have been reported in the literature, their genetic diversity or phylogeny has never been systematically investigated. Here, we describe a multilocus sequence analysis (MLSA of 20 of the most highly studied reference strains and clinical isolates of T. denticola; which were originally isolated from subgingival plaque samples taken from subjects from China, Japan, the Netherlands, Canada and the USA. Results The sequences of the 16S ribosomal RNA gene, and 7 conserved protein-encoding genes (flaA, recA, pyrH, ppnK, dnaN, era and radC were successfully determined for each strain. Sequence data was analyzed using a variety of bioinformatic and phylogenetic software tools. We found no evidence of positive selection or DNA recombination within the protein-encoding genes, where levels of intraspecific sequence polymorphism varied from 18.8% (flaA to 8.9% (dnaN. Phylogenetic analysis of the concatenated protein-encoding gene sequence data (ca. 6,513 nucleotides for each strain using Bayesian and maximum likelihood approaches indicated that the T. denticola strains were monophyletic, and formed 6 well-defined clades. All analyzed T. denticola strains appeared to have a genetic origin distinct from that of ‘Treponema vincentii’ or Treponema pallidum. No specific geographical relationships could be established; but several strains isolated from different continents appear to be closely related at the genetic level. Conclusions Our analyses indicate that previous biological and biophysical investigations have predominantly focused on a subset of T. denticola strains with a relatively narrow range of genetic diversity. Our methodology and results establish a genetic framework for the discrimination and phylogenetic

  16. Comparative Molecular Analysis of Gastrointestinal Adenocarcinomas

    NARCIS (Netherlands)

    Liu, Yang; Sethi, Nilay S; Hinoue, Toshinori; Schneider, Barbara G; Cherniack, Andrew D; Sanchez-Vega, Francisco; Seoane, Jose A; Farshidfar, Farshad; Bowlby, Reanne; Islam, Mirazul; Kim, Jaegil; Chatila, Walid; Akbani, Rehan; Kanchi, Rupa S; Rabkin, Charles S; Willis, Joseph E; Wang, Kenneth K; McCall, Shannon J; Mishra, Lopa; Ojesina, Akinyemi I; Bullman, Susan; Pedamallu, Chandra Sekhar; Lazar, Alexander J; Sakai, Ryo; Thorsson, Vésteinn; Bass, Adam J; Laird, Peter W; de Krijger, RR

    2018-01-01

    We analyzed 921 adenocarcinomas of the esophagus, stomach, colon, and rectum to examine shared and distinguishing molecular characteristics of gastrointestinal tract adenocarcinomas (GIACs). Hypermutated tumors were distinct regardless of cancer type and comprised those enriched for

  17. Molecular Composition Analysis of Distant Targets

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose a system capable of probing the molecular composition of cold solar system targets such as asteroids, comets, planets and moons from a distant vantage....

  18. Optimisation of automated ribosomal intergenic spacer analysis for the estimation of microbial diversity in fynbos soil

    Directory of Open Access Journals (Sweden)

    Karin Jacobs

    2010-07-01

    Full Text Available Automated ribosomal intergenic spacer analysis (ARISA has become a commonly used molecular technique for the study of microbial populations in environmental samples. The reproducibility and accuracy of ARISA, with and without the polymerase chain reaction (PCR are important aspects that influence the results and effectiveness of these techniques. We used the primer set ITS4/ITS5 for ARISA to assess the fungal community composition of two sites situated in the Sand Fynbos. The primer set proved to deliver reproducible ARISA profiles of the fungal community composition with little variation observed between ARISA-PCRs. Variation that occurred in a sample due to repeated DNA extraction is expected for ecological studies. This reproducibility made ARISA a useful tool for the assessment and comparison of diversity in ecological samples. In this paper, we also offered particular suggestions concerning the binning strategy for the analysis of ARISA profiles.

  19. Analysis of genetic diversity and construction of core collection of ...

    African Journals Online (AJOL)

    Jane

    2011-06-03

    Jun 3, 2011 ... Genetic diversity of 73 local mulberry varieties from Shanxi Province were screened using ISSR ... number effective of alleles, Nei's genetic diversity index and Shannon's ...... resources conservation program of the Agriculture.

  20. Virtual analysis of structurally diverse synthetic analogs as inhibitors of snake venom secretory phospholipase A2.

    Science.gov (United States)

    Sivaramakrishnan, V; Ilamathi, M; Ghosh, K S; Sathish, S; Gowda, T V; Vishwanath, B S; Rangappa, K S; Dhananjaya, B L

    2016-01-01

    Due to the toxic pathophysiological role of snake venom phospholipase A2 (PLA2 ), its compelling limitations to anti-venom therapy in humans and the need for alternative therapy foster considerable pharmacological interest towards search of PLA2 specific inhibitors. In this study, an integrated approach involving homology modeling, molecular dynamics and molecular docking studies on VRV-PL-V (Vipera russellii venom phospholipase A2 fraction-V) belonging to Group II-B secretory PLA2 from Daboia russelli pulchella is carried out in order to study the structure-based inhibitor design. The accuracy of the model was validated using multiple computational approaches. The molecular docking study of this protein was undertaken using different classes of experimentally proven, structurally diverse synthetic inhibitors of secretory PLA2 whose selection is based on IC50 value that ranges from 25 μM to 100 μM. Estimation of protein-ligand contacts by docking analysis sheds light on the importance of His 47 and Asp 48 within the VRV-PL-V binding pocket as key residue for hydrogen bond interaction with ligands. Our virtual analysis revealed that compounds with different scaffold binds to the same active site region. ADME analysis was also further performed to filter and identify the best potential specific inhibitor against VRV-PL-V. Additionally, the e-pharmacophore was generated for the best potential specific inhibitor against VRV-PL-V and reported here. The present study should therefore play a guiding role in the experimental design of VRV-PL-V inhibitors that may provide better therapeutic molecular models for PLA2 recognition and anti-ophidian activity. Copyright © 2015 John Wiley & Sons, Ltd.

  1. Molecular analysis of pancreatic cyst fluid changes clinical management.

    Science.gov (United States)

    Arner, David M; Corning, Brooke E; Ahmed, Ali M; Ho, Henry C; Weinbaum, Bradley J; Siddiqui, Uzma; Aslanian, Harry; Adams, Reid B; Bauer, Todd W; Wang, Andrew Y; Shami, Vanessa M; Sauer, Bryan G

    2018-01-01

    DNA molecular analysis has been suggested as a tool to evaluate pancreatic cysts. This study assesses whether the addition of DNA molecular analysis alters clinical management. This is a retrospective review of 46 consecutive patients who underwent EUS-FNA of pancreatic cysts with DNA molecular analysis at two major academic institutions. Cases were presented to two pancreaticobiliary surgeons first without and then with DNA molecular analysis data. The primary outcome was the frequency with which clinical management was altered with the addition of DNA molecular analysis. Forty-six patients with a mean age of 62.0 (±13.4) years and mean cyst size of 3.2 (±2.3) cm were included in the study. Cyst carcinoembryonic antigen (CEA) was available in 30 patients and ranged from 0.4 to 15,927 ng/mL. DNA molecular analysis was described as benign in 23 (50%), statistically indolent in 13 (28%), statistically higher risk in 9 (20%), and indeterminate in 1 (2%). Surgeon #1 changed the management in 13/46 cases (28%) and surgeon #2 changed the management in 12/46 cases (26%) with the addition of DNA molecular analysis. When organized by CEA concentration, those with an intermediate CEA (45-800 ng/mL) or without a CEA concentration had a management changed more frequently (40%) compared to all others (P molecular analysis alters the clinical management of pancreatic cystic lesions most often when CEA levels are intermediate (45-800 ng/mL) or when no CEA concentration is available. Use of DNA molecular analysis can be considered in this cohort. Further study of molecular markers in pancreatic cystic lesions is recommended.

  2. Identification, molecular characterization and analysis of the ...

    Indian Academy of Sciences (India)

    Tingting Liang

    2018-03-05

    Mar 5, 2018 ... hypomethylation and its interaction with other environ- mental and genetic .... performed on a C1000 Touch apparatus (Bio-Rad, Her- cules, USA), in a 25 μL ...... Multi-character variation-a response to the diverse methods.

  3. Unravelling the Molecular Epidemiology and Genetic Diversity among Burkholderia pseudomallei Isolates from South India Using Multi-Locus Sequence Typing.

    Science.gov (United States)

    Tellapragada, Chaitanya; Kamthan, Aayushi; Shaw, Tushar; Ke, Vandana; Kumar, Subodh; Bhat, Vinod; Mukhopadhyay, Chiranjay

    2016-01-01

    There is a slow but steady rise in the case detection rates of melioidosis from various parts of the Indian sub-continent in the past two decades. However, the epidemiology of the disease in India and the surrounding South Asian countries remains far from well elucidated. Multi-locus sequence typing (MLST) is a useful epidemiological tool to study the genetic relatedness of bacterial isolates both with-in and across the countries. With this background, we studied the molecular epidemiology of 32 Burkholderia pseudomallei isolates (31 clinical and 1 soil isolate) obtained during 2006-2015 from various parts of south India using multi-locus sequencing typing and analysis. Of the 32 isolates included in the analysis, 30 (93.7%) had novel allelic profiles that were not reported previously. Sequence type (ST) 1368 (n = 15, 46.8%) with allelic profile (1, 4, 6, 4, 1, 1, 3) was the most common genotype observed. We did not observe a genotypic association of STs with geographical location, type of infection and year of isolation in the present study. Measure of genetic differentiation (FST) between Indian and the rest of world isolates was 0.14413. Occurrence of the same ST across three adjacent states of south India suggest the dispersion of B.pseudomallei across the south western coastal part of India with limited geographical clustering. However, majority of the STs reported from the present study remained as "outliers" on the eBURST "Population snapshot", suggesting the genetic diversity of Indian isolates from the Australasian and Southeast Asian isolates.

  4. Unravelling the Molecular Epidemiology and Genetic Diversity among Burkholderia pseudomallei Isolates from South India Using Multi-Locus Sequence Typing.

    Directory of Open Access Journals (Sweden)

    Chaitanya Tellapragada

    Full Text Available There is a slow but steady rise in the case detection rates of melioidosis from various parts of the Indian sub-continent in the past two decades. However, the epidemiology of the disease in India and the surrounding South Asian countries remains far from well elucidated. Multi-locus sequence typing (MLST is a useful epidemiological tool to study the genetic relatedness of bacterial isolates both with-in and across the countries. With this background, we studied the molecular epidemiology of 32 Burkholderia pseudomallei isolates (31 clinical and 1 soil isolate obtained during 2006-2015 from various parts of south India using multi-locus sequencing typing and analysis. Of the 32 isolates included in the analysis, 30 (93.7% had novel allelic profiles that were not reported previously. Sequence type (ST 1368 (n = 15, 46.8% with allelic profile (1, 4, 6, 4, 1, 1, 3 was the most common genotype observed. We did not observe a genotypic association of STs with geographical location, type of infection and year of isolation in the present study. Measure of genetic differentiation (FST between Indian and the rest of world isolates was 0.14413. Occurrence of the same ST across three adjacent states of south India suggest the dispersion of B.pseudomallei across the south western coastal part of India with limited geographical clustering. However, majority of the STs reported from the present study remained as "outliers" on the eBURST "Population snapshot", suggesting the genetic diversity of Indian isolates from the Australasian and Southeast Asian isolates.

  5. Molecular detection and genetic diversity of Babesia gibsoni in dogs in Bangladesh.

    Science.gov (United States)

    Terao, Masashi; Akter, Shirin; Yasin, Md Golam; Nakao, Ryo; Kato, Hirotomo; Alam, Mohammad Zahangir; Katakura, Ken

    2015-04-01

    Babesia gibsoni is a tick-borne hemoprotozoan parasite of dogs that often causes fever and hemolytic illness. Detection of B. gibsoni has been predominantly reported in Asian countries, including Japan, Korea, Taiwan, Malaysia, Bangladesh and India. The present study shows the first molecular characterization of B. gibsoni detected from dogs in Bangladesh. Blood samples were collected on FTA® Elute cards from 50 stray dogs in Mymensingh District in Bangladesh. DNA eluted from the cards was subjected to nested PCR for the 18S rRNA gene of Babesia species. Approximately 800bp PCR products were detected in 15 of 50 dogs (30%). Based on restriction fragment length polymorphism (RFLP) and direct sequencing of the PCR products, all parasite isolates were identified as B. gibsoni. Furthermore, the BgTRAP (B. gibsoni thrombospondin-related adhesive protein) gene fragments were detected in 13 of 15 18S rRNA gene PCR positive blood samples. Phylogenetic analysis of the BgTRAP gene revealed that B. gibsoni parasites in Bangladesh formed a cluster, which was genetically different from other Asian B. gibsoni isolates. In addition, tandem repeat analysis of the BgTRAP gene clearly showed considerable genetic variation among Bangladeshi isolates. These results suggested that B. gibsoni parasites in a different genetic clade are endemic in dogs in Bangladesh. Further studies are required to elucidate the origin, distribution, vector and pathogenesis of B. gibsoni parasites circulating in dogs in Bangladesh. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Molecular Diversity of Lactic Acid Bacteria on Ileum and Coecum Broiler Chicken Fed by Chrysonilia crassa Fermentation

    Science.gov (United States)

    Nur Jannah, Siti; Khotimah, Husnul; Siti Ferniah, Rejeki; Sugiharto

    2018-05-01

    The Lactid Acid Bakteria (LAB) are microflora in the digestive tract which has positive roles in poultry’s health. One of the factors diversity of LAB in the gatrointestinal tract are influenced by feeding factor. The purpose of this study was to analyze the LAB diversity in ileum and coecum after being fed on fermented Chrysonilia crassa molecularly. LAB species diversity was analysed to provide a baseline profile of the microbial community database on the ileum and coecum digestive tract of broiler chicken of control (commercial feed) and treatment (feed with Chrysonilia crassa fermentation) by the method of Terminal Restriction Fragment Lenght Polymorphism The calculated values werethe number of phylotypes, relative abundace, Shannon-Wiener diversity index (H’), evennes index (E’), and similarity. Group of LAB detected in the control group were Lactobacillus delbrueckii (180 bp), Lactobacillus sp. (187 bp), Lactobacillus plantarum (572 bp), uncultured bacterium (87 bp) and unidentified (50 bp, 582bp). The result of this study showed that by feeding on the fermented Chrysonilia crassa feed had resulted in the decreasing of LAB diversity, i.e. ileum (0.66), coecum (0.48) compared with commercial feed (control) that was ileum (0.84), coecum (1.05).

  7. National survey of molecular bacterial diversity of New Zealand groundwater: relationships between biodiversity, groundwater chemistry and aquifer characteristics.

    Science.gov (United States)

    Sirisena, Kosala A; Daughney, Christopher J; Moreau-Fournier, Magali; Ryan, Ken G; Chambers, Geoffrey K

    2013-12-01

    Groundwater is a vital component of rural and urban water supplies in New Zealand. Although extensive monitoring of chemical and physical properties is conducted due to the high demand for this valuable resource, current information on its bacterial content is limited. However, bacteria provide an immense contribution to drive the biogeochemical processes in the groundwater ecosystem as in any other ecosystem. Therefore, a proper understanding of bacterial diversity is crucial to assess the effectiveness of groundwater management policies. In this study, we investigated the bacterial community structure in NZ groundwater at a national scale using the terminal restriction fragment length polymorphism (T-RFLP) molecular profiling tool and determined the relationships between bacterial diversity and groundwater chemistry, geological parameters and human impact. Considerable bacterial diversity was present and the community structures were strongly related to groundwater chemistry, and in particular to redox potential and human impact, reflecting their potential influence on determination of bacterial diversity. Further, the mean residence time of groundwater also showed relationships with bacterial community structure. These novel findings pertaining to community composition and its relationships with environmental parameters will provide a strong foundation for qualitative exploration of the bacterial diversity in NZ groundwater in relation to sustainable management of this valuable resource. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  8. Genetic diversity analysis of brassica napus/brassica campestris progenies using microsatellite markers

    International Nuclear Information System (INIS)

    Fayyaz, L.; Farhatullah, A.; Iqbal, S.; Kanwal, M.; Nawaz, I.

    2014-01-01

    Genetic diversity and relationship of F2 segregating progenies of interspecific crosses between B. napus N-501/B. campestris C-118 were studied. A set of 90 genotypes (2 parental lines and their 88 F2 progenies) was characterized separately using 24 microsatellite or SSR markers to cover the diversity as broadly as possibly present in them. In initial screening only 12 out of 24 SSR primers combination amplified DNA fragments, while the remaining 12 SSR primers did not amplify DNA fragment therefore those 12 SSR molecular markers were not used for further analysis. The 12 SSR primer combinations generated a total of 33 alleles, of that 32 were polymorphic loci, whereas only one was monomorphic locus. Primers BRMS-19 and BRMS-40 were highly polymorphic producing 4 bands each. Primer Ra2-D04 was less polymorphic and it produced only one band. The proportion of polymorphic loci was 95.83% which indicates high genetic diversity among the progenies. The average number of polymorphic alleles per locus was 2.66. The PIC values ranged from 0.395 for primer Ra2-E03 to 0.726 for primer BRMS-019 with an average genetic diversity (PIC value) of 0.584 per locus. Seven primers showed PIC values above 0.5 (50%) indicating high genetic diversity in the studied plant materials. Pair-wise similarity indices among 90 genotypes ranged from 0.3 to 0.95. Dendrogram obtained through UPGMA clustering of F2 progenies depicted eight main groups using similarity coefficient of 0.70. The progenies could be similar to their parents if they have the same banding patterns as that of the parents and could be distinguished from each other by the combination of fragments which are repeatedly present in one progeny and absent in the other. Considerable genetic diversity has been found among the F2 segregating progenies and their parents using SSR markers thus, SSR analysis proved to be a useful tool. (author)

  9. Molecular marker analysis of 'Shatangju' and 'Wuzishatangju ...

    African Journals Online (AJOL)

    'Wuzishatangju'(Citrus reticulata Blanco) is an excellent cultivar derived from a bud sport of a seedy 'Shatangju' cultivar found in Guangdong Province in the 1980s. In this study, six molecular markers including random amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR), simple sequence repeat (SSR) ...

  10. Prevalence and molecular diversity of invasive Streptococcus dysgalactiae and Streptococcus pyogenes in a German tertiary care medical centre.

    Science.gov (United States)

    Rößler, S; Berner, R; Jacobs, E; Toepfner, N

    2018-05-03

    Prevalence of invasive ß-haemolytic streptococci (BHS) at a tertiary care hospital and molecular diversity of S. pyogenes and S. dysgalactiae was studied. Between 2012 and 2016, all blood culture sets (n = 55,839), CSF (n = 8413) and soft tissue (n = 20,926) samples were analysed for BHS positivity using HYBASE software. Molecular profiles of 99 S. pyogenes and S. dysgalactiae were identified by sequencing of M protein genes (emm types) and multiplex PCR typing of 20 other virulence determinants. Streptococci contributed to 6.2% of blood, 10.7% of CSF and 14.5% of soft tissue isolates, being among the most common invasive isolates. The overall rates of invasive S. pyogenes, S. agalactiae, S. dysgalactiae and S. pneumoniae were 2.4, 4.4, 2.1, and 5.3%. Whereas S. pneumoniae was 1.5% more common in CSF samples, BHS isolates were 2-fold and 11-fold higher in bacteraemia and invasive soft tissue infections. Genetic BHS typing revealed wide molecular diversity of invasive and noninvasive group A and group G BHS, whereas one emm-type (stG62647.0) and no other virulence determinants except scpA were detected in invasive group C BHS. BHS were important invasive pathogens, outpacing S. pneumoniae in bacteraemia and invasive soft tissue infections. The incidence of S. dysgalactiae infections was comparable to that of S. pyogenes even with less diversity of molecular virulence. The results of this study emphasise the need for awareness of BHS invasiveness in humans and the need to develop BHS prevention strategies.

  11. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  12. Equilibrium transuranic management scheme for diverse fuel cycle analysis

    International Nuclear Information System (INIS)

    Haas, Jason; Lee, John C.

    2008-01-01

    A key issue cited in the U.S. Department of Energy's report to Congress (2003) on the research path for the Advanced Fuel Cycle Initiative (AFCI) is an accurate estimation of life cycle costs for the construction, operation, decontamination and decommissioning of all fuel cycle facilities. In this report we discuss the methodology and validation of a fuel cycle model based on equilibrium operation. We apply our model to a diverse set of advanced reactors and fuel types in order to determine the most effective transmuting system while simultaneously minimizing fuel cycle costs. Our analysis shows that a nearly instant equilibrium modeling of fuel cycle scenarios can accurately approximate the detailed complex dynamic models developed by national laboratories. Our analysis also shows that the cost of transmuting Spent Nuclear Fuel (SNF) from a UO 2 fueled Pressurized Water Reactor (PWR) is minimized by utilizing the thorium cycle in sodium cooled fast reactors and is near the cost for long term repository storage of SNF at Yucca Mountain. (authors)

  13. The Hidden Diversity of Zanclea Associated with Scleractinians Revealed by Molecular Data

    KAUST Repository

    Montano, Simone; Maggioni, Davide; Arrigoni, Roberto; Seveso, Davide; Puce, Stefania; Galli, Paolo

    2015-01-01

    focus on the genetic diversity among Zanclea specimens associated with 13 scleractinian genera. The monophyly of Zanclea associated with scleractinians was strongly supported in all nuclear and mitochondrial phylogenetic reconstructions. Furthermore, a

  14. Molecular Genetic Diversity of Date (Phoenix dactylifera) Germplasm in Qatar based on Microsatellite Markers

    KAUST Repository

    Ahmed, Talaat

    2016-01-01

    Depending on morphological traits alone, studying the genetic diversity of date palm is a very difficult task since morphological characteristics are highly affected by the environment. DNA markers are excellent option that can help and enhance

  15. Experimental analysis of specification language impact on NPP software diversity

    International Nuclear Information System (INIS)

    Yoo, Chang Sik; Seong, Poong Hyun

    1998-01-01

    When redundancy and diversity is applied in NPP digital computer system, diversification of system software may be a critical point for the entire system dependability. As the means of enhancing software diversity, specification language diversity is suggested in this study. We set up a simple hypothesis for the specification language impact on common errors, and an experiment based on NPP protection system application was performed. Experiment result showed that this hypothesis could be justified and specification language diversity is effective in overcoming software common mode failure problem

  16. A molecular phylogenetic analysis of the Scarabaeinae (dung beetles).

    Science.gov (United States)

    Monaghan, Michael T; Inward, Daegan J G; Hunt, Toby; Vogler, Alfried P

    2007-11-01

    The dung beetles (Scarabaeinae) include ca. 5000 species and exhibit a diverse array of morphologies and behaviors. This variation presumably reflects the adaptation to a diversity of food types and the different strategies used to avoid competition for vertebrate dung, which is the primary breeding environment for most species. The current classification gives great weight to the major behavioral types, separating the ball rollers and the tunnelers, but existing phylogenetic studies have been based on limited taxonomic or biogeographic sampling and have been contradictory. Here, we present a molecular phylogenetic analysis of 214 species of Scarabaeinae, representing all 12 traditionally recognized tribes and six biogeographical regions, using partial gene sequences from one nuclear (28S) and two mitochondrial (cox1, rrnL) genes. Length variation in 28S (588-621 bp) and rrnL (514-523 bp) was subjected to a thorough evaluation of alternative alignments, gap-coding methods, and tree searches using model-based (Bayesian and likelihood), maximum parsimony, and direct optimization analyses. The small-bodied, non-dung-feeding Sarophorus+Coptorhina were basal in all reconstructions. These were closely related to rolling Odontoloma+Dicranocara, suggesting an early acquisition of rolling behavior. Smaller tribes and most genera were monophyletic, while Canthonini and Dichotomiini each consisted of multiple paraphyletic lineages at hierarchical levels equivalent to the smaller tribes. Plasticity of rolling and tunneling was evidenced by a lack of monophyly (S-H test, p > 0.05) and several reversals within clades. The majority of previously unrecognized clades were geographical, including the well-supported Neotropical Phanaeini+Eucraniini, and a large Australian clade of rollers as well as tunneling Coptodactyla and Demarziella. Only three lineages, Gymnopleurini, Copris+Microcopris and Onthophagus, were widespread and therefore appear to be dispersive at a global scale. A

  17. Molecular diversity of lactic acid bacteria on ileum broiler chicken fed by bran and bran fermentation

    Science.gov (United States)

    Baniyah, Laelatul; Nur Jannah, Siti; Rukmi, Isworo; Sugiharto

    2018-05-01

    Lactic Acid Bacteria (LAB) is a digestive tract microflora that have a positive role in poultry health. The number and diversity of LAB in the digestive tract affected by several factors, among them was the kind of feed. The purpose of this research was to know diversity of Lactic Acid Bacteria (LAB) ileum broiler’s after feeding with prebiotic bran and Rhizopus oryzae fermented bran which was added to commercial feed. As much as 15 broilers were used to determine the diversity of LAB. All broilers were fed using commercial feed. The control used commercial feed no addition of bran or fermented bran, and commercial feed with fermented bran and nonfermented bran were as a treatment. To determine the diversity of LAB, T-RFLP method was applied. The Hae III and Msp I were used as restriction enzymes. The number of phylotype, relative abundance, Shannon diversity index (H '), evenness (E), and Dominance (D) were examined. The results indicated that the addition of prebiotic bran on commercial feed showed a higher diversity of lactic acid bacteria on broiler’s ileum, compared with control and addition of Rhizopus oryzae fermented bran. LAB group that dominates in the ileum is Lactobacillus sp. and L. delbruecii subs bulgaricus.

  18. Chromosomal diversity and molecular divergence among three undescribed species of Neacomys (Rodentia, Sigmodontinae separated by Amazonian rivers.

    Directory of Open Access Journals (Sweden)

    Willam Oliveira Da Silva

    Full Text Available The Neacomys genus (Rodentia, Sigmodontinae is distributed in the Amazon region, with some species limited to a single endemic area, while others may occur more widely. The number of species within the genus and their geographical boundaries are not known accurately, due to their high genetic diversity and difficulties in taxonomic identification. In this work we collected Neacomys specimens from both banks of the Tapajós River in eastern Amazon, and studied them using chromosome painting with whole chromosome probes of Hylaeamys megacephalus (HME; Rodentia, Sigmodontinae, and molecular analysis using haplotypes of mitochondrial genes COI and Cytb. Chromosome painting shows that Neacomys sp. A (NSP-A, 2n = 58/FN = 68 and Neacomys sp. B (NSP-B, 2n = 54/FN = 66 differ by 11 fusion/fission events, one translocation, four pericentric inversions and four heterochromatin amplification events. Using haplotypes of the concatenated mitochondrial genes COI and Cyt b, Neacomys sp. (2n = 58/FN = 64 and 70 shows a mean divergence of 6.2% for Neacomys sp. A and 9.1% for Neacomys sp. B, while Neacomys sp. A and Neacomys sp. B presents a medium nucleotide divergence of 7.4%. Comparisons were made with other published Neacomys data. The Tapajós and Xingu Rivers act as geographic barriers that define the distribution of these Neacomys species. Furthermore, our HME probes reveal four synapomorphies for the Neacomys genus (associations HME 20/[13,22]/4, 6a/21, [9,10]/7b/[9,10] and 12/[16,17] and demonstrate ancestral traits of the Oryzomyini tribe (HME 8a and 8b, 18 and 25 and Sigmodontinae subfamily (HME 15 and 24, which can be used as taxonomic markers for these groups.

  19. Chromosomal diversity and molecular divergence among three undescribed species of Neacomys (Rodentia, Sigmodontinae) separated by Amazonian rivers.

    Science.gov (United States)

    Oliveira Da Silva, Willam; Pieczarka, Julio Cesar; Ferguson-Smith, Malcolm Andrew; O'Brien, Patricia Caroline Mary; Mendes-Oliveira, Ana Cristina; Sampaio, Iracilda; Carneiro, Jeferson; Nagamachi, Cleusa Yoshiko

    2017-01-01

    The Neacomys genus (Rodentia, Sigmodontinae) is distributed in the Amazon region, with some species limited to a single endemic area, while others may occur more widely. The number of species within the genus and their geographical boundaries are not known accurately, due to their high genetic diversity and difficulties in taxonomic identification. In this work we collected Neacomys specimens from both banks of the Tapajós River in eastern Amazon, and studied them using chromosome painting with whole chromosome probes of Hylaeamys megacephalus (HME; Rodentia, Sigmodontinae), and molecular analysis using haplotypes of mitochondrial genes COI and Cytb. Chromosome painting shows that Neacomys sp. A (NSP-A, 2n = 58/FN = 68) and Neacomys sp. B (NSP-B, 2n = 54/FN = 66) differ by 11 fusion/fission events, one translocation, four pericentric inversions and four heterochromatin amplification events. Using haplotypes of the concatenated mitochondrial genes COI and Cyt b, Neacomys sp. (2n = 58/FN = 64 and 70) shows a mean divergence of 6.2% for Neacomys sp. A and 9.1% for Neacomys sp. B, while Neacomys sp. A and Neacomys sp. B presents a medium nucleotide divergence of 7.4%. Comparisons were made with other published Neacomys data. The Tapajós and Xingu Rivers act as geographic barriers that define the distribution of these Neacomys species. Furthermore, our HME probes reveal four synapomorphies for the Neacomys genus (associations HME 20/[13,22]/4, 6a/21, [9,10]/7b/[9,10] and 12/[16,17]) and demonstrate ancestral traits of the Oryzomyini tribe (HME 8a and 8b, 18 and 25) and Sigmodontinae subfamily (HME 15 and 24), which can be used as taxonomic markers for these groups.

  20. Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST

    NARCIS (Netherlands)

    O'Donnell, K.; Humber, R.A.; Geiser, D.M.; Kang, S.; Robert, V.; Park, B.; Crous, P.W.; Johnston, P.; Aoki, T.; Rooney, A.P.; Rehner, S.A.

    2012-01-01

    We constructed several multilocus DNA sequence datasets to assess the phylogenetic diversity of insecticolous fusaria, especially focusing on those housed at the Agricultural Research Service Collection of Entomopathogenic Fungi (ARSEF), and to aid molecular identifications of unknowns via the

  1. Molecular characterization of norovirus variants and genetic diversity of noroviruses and sapoviruses in Thailand.

    Science.gov (United States)

    Chaimongkol, Natthawan; Khamrin, Pattara; Malasao, Rungnapa; Thongprachum, Aksara; Kongsricharoern, Tipachan; Ukarapol, Nuthapong; Ushijima, Hiroshi; Maneekarn, Niwat

    2014-07-01

    Norovirus (NoV) and Sapovirus (SaV) have been reported as a common cause of acute gastroenteritis worldwide. For a decade, surveillances of NoV and SaV have been conducted continually in Thailand. To monitor the epidemiological situation and to determine the genetic variation of NoV and SaV in Chiang Mai, Thailand, 567 samples collected from pediatric patients hospitalized with acute gastroenteritis were examined during 2007, and 2010-2011 by semi-nested RT-PCR and nucleotide sequencing methods. NoV was detected at 15.9%. Phylogenetic analysis revealed multiple NoV genotypes, GI/14 (1.1%), GII/1 (1.1%), GII/2 (1.1%), GII/3 (4.4%), GII/4 (65.6%), GII/6 (10.0%), GII/7 (2.2%), GII/12 (4.4%), GII/13 (3.3%), GII/16 (5.7%), and unclassified genotype (1.1%), circulating in this area. Among these, NoV GII/4 was the most prevalent genotype with a predominance of GII/4 2009 over other variants, 1996, 2006a, and 2006b. For SaV, the prevalence was 1.2% which was much lower than those of NoV and only SaV GI/1 was detected. This study highlights the epidemiology of NoV and SaV and genetic diversity of viruses circulating in pediatric patients hospitalized with acute gastroenteritis in Chiang Mai, Thailand. © 2013 Wiley Periodicals, Inc.

  2. Genotyping-by-Sequencing Analysis for Determining Population Structure of Finger Millet Germplasm of Diverse Origins

    Directory of Open Access Journals (Sweden)

    Anil Kumar

    2016-07-01

    Full Text Available Finger millet [ (L. Gaertn.] is grown mainly by subsistence farmers in arid and semiarid regions of the world. To broaden its genetic base and to boost its production, it is of paramount importance to characterize and genotype the diverse gene pool of this important food and nutritional security crop. However, as a result of nonavailability of the genome sequence of finger millet, the progress could not be made in realizing the molecular basis of unique qualities of the crop. In the present investigation, attempts have been made to characterize the genetically diverse collection of 113 finger millet accessions through whole-genome genotyping-by-sequencing (GBS, which resulted in a genome-wide set of 23,000 single-nucleotide polymorphisms (SNPs segregating across the entire collection and several thousand SNPs segregating within every accession. A model-based population structure analysis reveals the presence of three subpopulations among the finger millet accessions, which are in parallel with the results of phylogenetic analysis. The observed population structure is consistent with the hypothesis that finger millet was domesticated first in Africa, and from there it was introduced to India some 3000 yr ago. A total of 1128 gene ontology (GO terms were assigned to SNP-carrying genes for three main categories: biological process, cellular component, and molecular function. Facilitated access to high-throughput genotyping and sequencing technologies are likely to improve the breeding process in developing countries, and as such, this data will be very useful to breeders who are working for the genetic improvement of finger millet.

  3. Genotyping-by-Sequencing Analysis for Determining Population Structure of Finger Millet Germplasm of Diverse Origins.

    Science.gov (United States)

    Kumar, Anil; Sharma, Divya; Tiwari, Apoorv; Jaiswal, J P; Singh, N K; Sood, Salej

    2016-07-01

    Finger millet [ (L.) Gaertn.] is grown mainly by subsistence farmers in arid and semiarid regions of the world. To broaden its genetic base and to boost its production, it is of paramount importance to characterize and genotype the diverse gene pool of this important food and nutritional security crop. However, as a result of nonavailability of the genome sequence of finger millet, the progress could not be made in realizing the molecular basis of unique qualities of the crop. In the present investigation, attempts have been made to characterize the genetically diverse collection of 113 finger millet accessions through whole-genome genotyping-by-sequencing (GBS), which resulted in a genome-wide set of 23,000 single-nucleotide polymorphisms (SNPs) segregating across the entire collection and several thousand SNPs segregating within every accession. A model-based population structure analysis reveals the presence of three subpopulations among the finger millet accessions, which are in parallel with the results of phylogenetic analysis. The observed population structure is consistent with the hypothesis that finger millet was domesticated first in Africa, and from there it was introduced to India some 3000 yr ago. A total of 1128 gene ontology (GO) terms were assigned to SNP-carrying genes for three main categories: biological process, cellular component, and molecular function. Facilitated access to high-throughput genotyping and sequencing technologies are likely to improve the breeding process in developing countries, and as such, this data will be very useful to breeders who are working for the genetic improvement of finger millet. Copyright © 2016 Crop Science Society of America.

  4. A genetic analysis of segregation distortion revealed by molecular ...

    Indian Academy of Sciences (India)

    Journal of Genetics, Vol. 90, No. ... Segregation analysis was based on 64 molecular markers, including 26 .... FHB of RIL populations was controlled by quantitative trait ... The authors acknowledge financial support by the National Basic.

  5. Phenotypic and molecular genetic analysis of Pyruvate Kinase ...

    African Journals Online (AJOL)

    Phenotypic and molecular genetic analysis of Pyruvate Kinase deficiency in a Tunisian family. Jaouani Mouna, Hamdi Nadia, Chaouch Leila, Kalai Miniar, Mellouli Fethi, Darragi Imen, Boudriga Imen, Chaouachi Dorra, Bejaoui Mohamed, Abbes Salem ...

  6. MOLECULAR ANALYSIS OF HUMAN SPERMATOZOA: POTENTIAL FOR INFERTILITY RESEARCH

    Science.gov (United States)

    Gordon Research Conference: Mammalian Gametogenesis and Embryogenesis New London, CT, July 1-6, 2000Molecular Analysis of Human Spermatozoa: Potential for Infertility ResearchDavid Miller 1, David Dix2, Robert Reid 3, Stephen A Krawetz 3 1Reproductive ...

  7. High gene flow and genetic diversity in three economically important Zanthoxylum Spp. of Upper Brahmaputra Valley Zone of NE India using molecular markers.

    Science.gov (United States)

    Medhi, K; Sarmah, D K; Deka, M; Bhau, B S

    2014-12-01

    The genetic diversity in Zanthoxylum species viz.  Zanthoxylum nitidum, Zanthoxylum oxyphyllum and Zanthoxylum rhesta collected from the Upper Brahmaputra Valley Zone of Assam (NE India) was amplified using 13 random amplified polymorphic DNA (RAPD) markers and 9 inter-simple sequence repeat (ISSR) markers. RAPD markers were able to detect 81.82% polymorphism whereas ISSR detected 98.02% polymorphism. The genetic similarities were analyzed from the dendrogram constructed by RAPD and ISSR fingerprinting methods which divided the 3 species of Zanthoxylum into 3 clear different clusters. The principle component analysis (PCA) was carried out to confirm the clustering pattern of RAPD and ISSR analysis. Analysis of molecular variance (AMOVA) revealed the presence of significant variability between different Zanthoxylum species and within the species by both RAPD and ISSR markers. Z. nitidum was found to be sharing a high degree of variation with the other two Zanthoxylum species under study. The Nei's gene diversity (h), Shannon's information index (I), observed number of alleles (na) and effective number of alleles (ne) were also found to be higher in ISSR markers (0.3526, 0.5230, 1.9802 and 1.6145) than in RAPD markers (0.3144, 0.4610, 1.8182 and 1.5571). The values for total genotype diversity for among population (HT), within population diversity (Hs) and gene flow (Nm) were more in ISSR (0.3491, 0.2644 and 1.5610) than RAPD (0.3128, 0.2264 and 1.3087) but the mean coefficient of gene differentiation (GST) was more in RAPD (0.2764) than ISSR (0.2426). A comparison of this two finger printing methods was done by calculating MR, EMI and MI. The correlation coefficient between data matrices of RAPD and ISSR based on Mantel test was found to be significant (r = 0.65612).

  8. Genetic diversity analysis of mustard (Brassica spp.) germplasm ...

    African Journals Online (AJOL)

    sunny t

    successfully cultivated between Aman and Boro rice rotation without affecting this popular cropping pattern. So, it is urgent to analyze the genetic diversity and its response for the selection of short duration mustard genotypes for increasing our cropping intensity. Diversity at marker loci is currently the most feasible strategy ...

  9. Functional diversity in plant communities: Theory and analysis ...

    African Journals Online (AJOL)

    Plant functional diversity in community has become a key point in ecology studies recently. The development of species functional diversity was reviewed in the present work. Based on the former original research papers and reviews, we discussed the concept and connotation and put forward a new definition of functional ...

  10. Institutional Diversity in Ontario's University Sector: A Policy Debate Analysis

    Science.gov (United States)

    Piché, Pierre G.; Jones, Glen A.

    2016-01-01

    In order to meet the demands in a cost-effective manner of an emerging knowledge society that is global in scope, structural higher education policy changes have been introduced in many countries with a focus on systemic and programmatic diversity. There has been an ongoing debate about institutional diversity in Ontario higher education,…

  11. Structural Analysis of the Resident Assistant Cultural Diversity Questionnaire

    Science.gov (United States)

    Johnson, Vanessa D.; Kang, Young-Shin; Thompson, George F.

    2011-01-01

    This study investigated the five-factor structure of the Resident Assistant Cultural Diversity (RACD) instrument, which assesses resident assistant (RA) confidence in addressing issues of cultural diversity in college and university residence halls. The instrument has five components that explore RA confidence: (1) belief in the need for cultural…

  12. Genetic diversity analysis of rice cultivars from various origins using ...

    African Journals Online (AJOL)

    Genetic diversity is of paramount importance for the success of any plant breeding program. An experiment was conducted to assess the extent of genetic diversity and similarity of 24 rice cultivars from various origins using 29 simple sequence repeat (SSR) markers. A total of 144 alleles were detected at the 29 SSR primer ...

  13. 1 Hierarchical Approaches to the Analysis of Genetic Diversity in ...

    African Journals Online (AJOL)

    2015-04-14

    Apr 14, 2015 ... Study of genetic diversity is the process by which variation ... diversity tree is available, a core collection can be selected by .... are numerous natural factors, such as hybridization and clinical .... to develop a deeper understanding of the topic .... This can be detected by southern hybridization after running ...

  14. Novel cancer gene variants and gene fusions of triple-negative breast cancers (TNBCs) reveal their molecular diversity conserved in the patient-derived xenograft (PDX) model.

    Science.gov (United States)

    Jung, Jaeyun; Jang, Kiwon; Ju, Jung Min; Lee, Eunji; Lee, Jong Won; Kim, Hee Jung; Kim, Jisun; Lee, Sae Byul; Ko, Beom Seok; Son, Byung Ho; Lee, Hee Jin; Gong, Gyungyup; Ahn, Sei Yeon; Choi, Jung Kyoon; Singh, Shree Ram; Chang, Suhwan

    2018-04-20

    Despite the improved 5-year survival rate of breast cancer, triple-negative breast cancer (TNBC) remains a challenge due to lack of effective targeted therapy and higher recurrence and metastasis than other subtypes. To identify novel druggable targets and to understand its unique biology, we tried to implement 24 patient-derived xenografts (PDXs) of TNBC. The overall success rate of PDX implantation was 45%, much higher than estrogen receptor (ER)-positive cases. Immunohistochemical analysis revealed conserved ER/PR/Her2 negativity (with two exceptions) between the original and PDX tumors. Genomic analysis of 10 primary tumor-PDX pairs with Ion AmpliSeq CCP revealed high degree of variant conservation (85.0% to 96.9%) between primary and PDXs. Further analysis showed 44 rare variants with a predicted high impact in 36 genes including Trp53, Pten, Notch1, and Col1a1. Among them, we confirmed frequent Notch1 variant. Furthermore, RNA-seq analysis of 24 PDXs revealed 594 gene fusions, of which 163 were in-frame, including AZGP1-GJC3 and NF1-AARSD1. Finally, western blot analysis of oncogenic signaling proteins supporting molecular diversity of TNBC PDXs. Overall, our report provides a molecular basis for the usefulness of the TNBC PDX model in preclinical study. Copyright © 2018. Published by Elsevier B.V.

  15. Identification of three new isolates of Tomato spotted wilt virus from different hosts in China: molecular diversity, phylogenetic and recombination analyses.

    Science.gov (United States)

    Zhang, Zhenjia; Wang, Deya; Yu, Chengming; Wang, Zenghui; Dong, Jiahong; Shi, Kerong; Yuan, Xuefeng

    2016-01-14

    Destructive diseases caused by Tomato spotted wilt virus (TSWV) have been reported associated with many important plants worldwide. Recently, TSWV was reported to infect different hosts in China. It is of value to clone TSWV isolates from different hosts and examine diversity and evolution among different TSWV isolates in China as well as worldwide. RT-PCR was used to clone the full-length genome (L, M and S segments) of three new isolates of TSWV that infected different hosts (tobacco, red pepper and green pepper) in China. Identity of nucleotide and amino acid sequences among TSWV isolates were analyzed by DNAMAN. MEGA 5.0 was used to construct phylogenetic trees. RDP4 was used to detect recombination events during evolution of these isolates. Whole-genome sequences of three new TSWV isolates in China were determined. Together with other available isolates, 29 RNA L, 62 RNA M and 66 RNA S of TSWV isolates were analyzed for molecular diversity, phylogenetic and recombination events. This analysis revealed that the entire TSWV genome, especially the M and S RNAs, had major variations in genomic size that mainly involve the A-U rich intergenic region (IGR). Phylogenetic analyses on TSWV isolates worldwide revealed evidence for frequent reassortments in the evolution of tripartite negative-sense RNA genome. Significant numbers of recombination events with apparent 5' regional preference were detected among TSWV isolates worldwide. Moreover, TSWV isolates with similar recombination events usually had closer relationships in phylogenetic trees. All five Chinese TSWV isolates including three TSWV isolates of this study and previously reported two isolates can be divided into two groups with different origins based on molecular diversity and phylogenetic analysis. During their evolution, both reassortment and recombination played roles. These results suggest that recombination could be an important mechanism in the evolution of multipartite RNA viruses, even negative

  16. Diversity, Mutation and Recombination Analysis of Cotton Leaf Curl Geminiviruses.

    Directory of Open Access Journals (Sweden)

    Huma Saleem

    Full Text Available The spread of cotton leaf curl disease in China, India and Pakistan is a recent phenomenon. Analysis of available sequence data determined that there is a substantial diversity of cotton-infecting geminiviruses in Pakistan. Phylogenetic analyses indicated that recombination between two major groups of viruses, cotton leaf curl Multan virus (CLCuMuV and cotton leaf curl Kokhran virus (CLCuKoV, led to the emergence of several new viruses. Recombination detection programs and phylogenetic analyses showed that CLCuMuV and CLCuKoV are highly recombinant viruses. Indeed, CLCuKoV appeared to be a major donor virus for the coat protein (CP gene, while CLCuMuV donated the Rep gene in the majority of recombination events. Using recombination free nucleotide datasets the substitution rates for CP and Rep genes were determined. We inferred similar nucleotide substitution rates for the CLCuMuV-Rep gene (4.96X10-4 and CLCuKoV-CP gene (2.706X10-4, whereas relatively higher substitution rates were observed for CLCuMuV-CP and CLCuKoV-Rep genes. The combination of sequences with equal and relatively low substitution rates, seemed to result in the emergence of viral isolates that caused epidemics in Pakistan and India. Our findings also suggest that CLCuMuV is spreading at an alarming rate, which can potentially be a threat to cotton production in the Indian subcontinent.

  17. Development of ESTs from chickpea roots and their use in diversity analysis of the Cicer genus

    Directory of Open Access Journals (Sweden)

    Eshwar K

    2005-08-01

    Full Text Available Abstract Background Chickpea is a major crop in many drier regions of the world where it is an important protein-rich food and an increasingly valuable traded commodity. The wild annual Cicer species are known to possess unique sources of resistance to pests and diseases, and tolerance to environmental stresses. However, there has been limited utilization of these wild species by chickpea breeding programs due to interspecific crossing barriers and deleterious linkage drag. Molecular genetic diversity analysis may help predict which accessions are most likely to produce fertile progeny when crossed with chickpea cultivars. While, trait-markers may provide an effective tool for breaking linkage drag. Although SSR markers are the assay of choice for marker-assisted selection of specific traits in conventional breeding populations, they may not provide reliable estimates of interspecific diversity, and may lose selective power in backcross programs based on interspecific introgressions. Thus, we have pursued the development of gene-based markers to resolve these problems and to provide candidate gene markers for QTL mapping of important agronomic traits. Results An EST library was constructed after subtractive suppressive hybridization (SSH of root tissue from two very closely related chickpea genotypes (Cicer arietinum. A total of 106 EST-based markers were designed from 477 sequences with functional annotations and these were tested on C. arietinum. Forty-four EST markers were polymorphic when screened across nine Cicer species (including the cultigen. Parsimony and PCoA analysis of the resultant EST-marker dataset indicated that most accessions cluster in accordance with the previously defined classification of primary (C. arietinum, C. echinospermum and C. reticulatum, secondary (C. pinnatifidum, C. bijugum and C. judaicum, and tertiary (C. yamashitae, C. chrossanicum and C. cuneatum gene-pools. A large proportion of EST alleles (45% were only

  18. Formalizing the definition of meta-analysis in Molecular Ecology.

    Science.gov (United States)

    ArchMiller, Althea A; Bauer, Eric F; Koch, Rebecca E; Wijayawardena, Bhagya K; Anil, Ammu; Kottwitz, Jack J; Munsterman, Amelia S; Wilson, Alan E

    2015-08-01

    Meta-analysis, the statistical synthesis of pertinent literature to develop evidence-based conclusions, is relatively new to the field of molecular ecology, with the first meta-analysis published in the journal Molecular Ecology in 2003 (Slate & Phua 2003). The goal of this article is to formalize the definition of meta-analysis for the authors, editors, reviewers and readers of Molecular Ecology by completing a review of the meta-analyses previously published in this journal. We also provide a brief overview of the many components required for meta-analysis with a more specific discussion of the issues related to the field of molecular ecology, including the use and statistical considerations of Wright's FST and its related analogues as effect sizes in meta-analysis. We performed a literature review to identify articles published as 'meta-analyses' in Molecular Ecology, which were then evaluated by at least two reviewers. We specifically targeted Molecular Ecology publications because as a flagship journal in this field, meta-analyses published in Molecular Ecology have the potential to set the standard for meta-analyses in other journals. We found that while many of these reviewed articles were strong meta-analyses, others failed to follow standard meta-analytical techniques. One of these unsatisfactory meta-analyses was in fact a secondary analysis. Other studies attempted meta-analyses but lacked the fundamental statistics that are considered necessary for an effective and powerful meta-analysis. By drawing attention to the inconsistency of studies labelled as meta-analyses, we emphasize the importance of understanding the components of traditional meta-analyses to fully embrace the strengths of quantitative data synthesis in the field of molecular ecology. © 2015 John Wiley & Sons Ltd.

  19. Manipulation of arthropod sex determination by endosymbionts : Diversity and molecular mechanisms

    NARCIS (Netherlands)

    Ma, W. -J.; Vavre, F.; Beukeboom, L. W.

    2014-01-01

    Arthropods exhibit a large variety of sex determination systems both at the chromosomal and molecular level. Male heterogamety, female heterogamety, and haplodiploidy occur frequently, but partially different genes are involved. Endosymbionts, such as Wolbachia, Cardinium, Rickettsia, and

  20. Molecular Identification and Genetic Diversity of Acropora hyacinthus from Boo and Deer Island, Raja Ampat, West Papua

    Science.gov (United States)

    Wijayanti, DP; Indrayanti, E.; Nuryadi, H.; Dewi, RA; Sabdono, A.

    2018-02-01

    Indonesia lies at the centre of biodiversity for corals. However, the reefs suffered from extensive human exploitation. Marine Protected Areas is thought to be best solution to protect coral reefs ecosystem. Understanding genetic diversity is crucial for effective management of the MPAs, however genetic diversity is rarely been corporate in designing an MPA. Moreover, many MPAs are uneffectively manage due to poor designated and demarcated.Raja Ampat which is located in western tip of West Papua, was designated as a park to mitigatethreatsand protect the valuable marine resources.Scleractinian corals in the genus Acropora are among the most dominant distributed in Raja Ampat waters, including the species of Acroporahyacinthus. The research aimed to analyze genetic diversity and to describe the kinship relationship of Acroporahyacinthus between 2 populations: Boo Island and Deer Island, Raja Ampat. Genetic marker Cytochrome Oxidase I (CO I) of the mitochondrial genome DNA (mtDNA) was used to analyze genetic diversity. Reconstruction of phylogenetic tree and genetic diversity were made by usingsoftware MEGA 5.05 (Moleculer Evolutionary Genetics Analysis). The results of this research indicatecorals A. hyacinthus from Boo Island and Deer Island Raja Ampat are in the low category of genetic diversity and overall had a close genetic relationship of kinship. This is likely due to the small size of the population and few numbers of samples that may not represent the population.

  1. Endocrine-disrupting Chemicals: Review of Toxicological Mechanisms Using Molecular Pathway Analysis

    Science.gov (United States)

    Yang, Oneyeol; Kim, Hye Lim; Weon, Jong-Il; Seo, Young Rok

    2015-01-01

    Endocrine disruptors are known to cause harmful effects to human through various exposure routes. These chemicals mainly appear to interfere with the endocrine or hormone systems. As importantly, numerous studies have demonstrated that the accumulation of endocrine disruptors can induce fatal disorders including obesity and cancer. Using diverse biological tools, the potential molecular mechanisms related with these diseases by exposure of endocrine disruptors. Recently, pathway analysis, a bioinformatics tool, is being widely used to predict the potential mechanism or biological network of certain chemicals. In this review, we initially summarize the major molecular mechanisms involved in the induction of the above mentioned diseases by endocrine disruptors. Additionally, we provide the potential markers and signaling mechanisms discovered via pathway analysis under exposure to representative endocrine disruptors, bisphenol, diethylhexylphthalate, and nonylphenol. The review emphasizes the importance of pathway analysis using bioinformatics to finding the specific mechanisms of toxic chemicals, including endocrine disruptors. PMID:25853100

  2. Diversity of radioprobes targeted to tumor angiogenesis on molecular functional imaging

    International Nuclear Information System (INIS)

    Lu Xia; Zhang Huabei

    2013-01-01

    Molecular functional imaging could visualize, characterize, and measure the bio- logical processes including tumor angiogenesis at the molecular and cellular levels in humans and other living systems. The molecular probes labeled by a variety of radionuclide used in the field of the nuclear medicine play pivotal roles in molecular imaging of tumor angiogenesis. However, the regulatory role of different probes in tumor angiogenesis has not been systematically illustrated. The current status of tumor angiogenesis imaging with radiolabeled probes of peptide, monoclonal antibody as well as its fragment, especially nanoparticle-based probes to gain insights into the robust tumor angiogenesis development were summarized. It was recognized that only the probes such as nanoparticle-based probes, which truly target the tumor vasculature rather than tumor cells because of poor extravasation, are really tumor angiogenesis imaging agent. The research of molecular probe targeted to angiogenesis would meet its flourish just after the outstanding improvements in the in vivo stability and biocompatibility, tumor-targeting efficacy, and pharmacokinetics of tumor angiogenesis imaging probes are made. Translation to clinical applications will also be critical for the maximize benefits of these novel agents. The future of tumor angiogenesis imaging lies in liable imaging probes and multiple imaging modalities, imaging of protein-protein interactions, and quantitative molecular imaging. (authors)

  3. Microbial Diversity of Browning Peninsula, Eastern Antarctica Revealed Using Molecular and Cultivation Methods.

    Science.gov (United States)

    Pudasaini, Sarita; Wilson, John; Ji, Mukan; van Dorst, Josie; Snape, Ian; Palmer, Anne S; Burns, Brendan P; Ferrari, Belinda C

    2017-01-01

    Browning Peninsula is an ice-free polar desert situated in the Windmill Islands, Eastern Antarctica. The entire site is described as a barren landscape, comprised of frost boils with soils dominated by microbial life. In this study, we explored the microbial diversity and edaphic drivers of community structure across this site using traditional cultivation methods, a novel approach the soil substrate membrane system (SSMS), and culture-independent 454-tag pyrosequencing. The measured soil environmental and microphysical factors of chlorine, phosphate, aspect and elevation were found to be significant drivers of the bacterial community, while none of the soil parameters analyzed were significantly correlated to the fungal community. Overall, Browning Peninsula soil harbored a distinctive microbial community in comparison to other Antarctic soils comprised of a unique bacterial diversity and extremely limited fungal diversity. Tag pyrosequencing data revealed the bacterial community to be dominated by Actinobacteria (36%), followed by Chloroflexi (18%), Cyanobacteria (14%), and Proteobacteria (10%). For fungi, Ascomycota (97%) dominated the soil microbiome, followed by Basidiomycota. As expected the diversity recovered from culture-based techniques was lower than that detected using tag sequencing. However, in the SSMS enrichments, that mimic the natural conditions for cultivating oligophilic "k-selected" bacteria, a larger proportion of rare bacterial taxa (15%), such as Blastococcus, Devosia, Herbaspirillum, Propionibacterium and Methylocella and fungal (11%) taxa, such as Nigrospora, Exophiala, Hortaea , and Penidiella were recovered at the genus level. At phylum level, a comparison of OTU's showed that the SSMS shared 21% of Acidobacteria, 11% of Actinobacteria and 10% of Proteobacteria OTU's with soil. For fungi, the shared OTUs was 4% (Basidiomycota) and <0.5% (Ascomycota). This was the first known attempt to culture microfungi using the SSMS which resulted in

  4. Seasonality in molecular and cytometric diversity of marine bacterioplankton: the reshuffling of bacterial taxa by vertical mixing

    KAUST Repository

    Garcí a, Francisca C.; Alonso-Sá ez, Laura; Moran, Xose Anxelu G.; Ló pez-Urrutia, Á ngel

    2015-01-01

    were significantly correlated in samples from a 3.5-year monthly time-series. Both methods showed a consistent cyclical pattern in the diversity of surface bacterial communities with maximal values in winter. The analysis of the highly resolved flow

  5. Dynamical analysis of highly excited molecular spectra

    Energy Technology Data Exchange (ETDEWEB)

    Kellman, M.E. [Univ. of Oregon, Eugene (United States)

    1993-12-01

    The goal of this program is new methods for analysis of spectra and dynamics of highly excited vibrational states of molecules. In these systems, strong mode coupling and anharmonicity give rise to complicated classical dynamics, and make the simple normal modes analysis unsatisfactory. New methods of spectral analysis, pattern recognition, and assignment are sought using techniques of nonlinear dynamics including bifurcation theory, phase space classification, and quantization of phase space structures. The emphasis is chaotic systems and systems with many degrees of freedom.

  6. Development of the Northern European Ribes core collection based on a microsatellite (SSR) marker diversity analysis

    DEFF Research Database (Denmark)

    Antonius, Kristiina; Karhu, S.; Kaldmäe, H.

    2012-01-01

    The purpose of the study was to support the selection process of the most valuable currant and gooseberry accessions cultivated in Northern Europe, in order to establish a decentralized core collection and, following the selection, to ensure sufficient genetic diversity in the selected collection....... Molecular analyses of the material from nine project partners were run at seven different laboratories. The results were first analysed for each partner separately, and then combined to ensure sufficient genetic diversity in the core collection....

  7. Comparative Analysis of Glycoside Hydrolases Activities from Phylogenetically Diverse Marine Bacteria of the Genus Arenibacter

    Directory of Open Access Journals (Sweden)

    Valery Mikhailov

    2013-06-01

    Full Text Available A total of 16 marine strains belonging to the genus Arenibacter, recovered from diverse microbial communities associated with various marine habitats and collected from different locations, were evaluated in degradation of natural polysaccharides and chromogenic glycosides. Most strains were affiliated with five recognized species, and some presented three new species within the genus Arenibacter. No strains contained enzymes depolymerizing polysaccharides, but synthesized a wide spectrum of glycosidases. Highly active β-N-acetylglucosaminidases and α-N-acetylgalactosaminidases were the main glycosidases for all Arenibacter. The genes, encoding two new members of glycoside hydrolyses (GH families, 20 and 109, were isolated and characterized from the genomes of Arenibacter latericius. Molecular genetic analysis using glycosidase-specific primers shows the absence of GH27 and GH36 genes. A sequence comparison with functionally-characterized GH20 and GH109 enzymes shows that both sequences are closest to the enzymes of chitinolytic bacteria Vibrio furnissii and Cellulomonas fimi of marine and terrestrial origin, as well as human pathogen Elisabethkingia meningoseptica and simbionts Akkermansia muciniphila, gut and non-gut Bacteroides, respectively. These results revealed that the genus Arenibacter is a highly taxonomic diverse group of microorganisms, which can participate in degradation of natural polymers in marine environments depending on their niche and habitat adaptations. They are new prospective candidates for biotechnological applications due to their production of unique glycosidases.

  8. Molecular recognition in a diverse set of protein-ligand interactions studied with molecular dynamics simulations and end-point free energy calculations.

    Science.gov (United States)

    Wang, Bo; Li, Liwei; Hurley, Thomas D; Meroueh, Samy O

    2013-10-28

    End-point free energy calculations using MM-GBSA and MM-PBSA provide a detailed understanding of molecular recognition in protein-ligand interactions. The binding free energy can be used to rank-order protein-ligand structures in virtual screening for compound or target identification. Here, we carry out free energy calculations for a diverse set of 11 proteins bound to 14 small molecules using extensive explicit-solvent MD simulations. The structure of these complexes was previously solved by crystallography and their binding studied with isothermal titration calorimetry (ITC) data enabling direct comparison to the MM-GBSA and MM-PBSA calculations. Four MM-GBSA and three MM-PBSA calculations reproduced the ITC free energy within 1 kcal·mol(-1) highlighting the challenges in reproducing the absolute free energy from end-point free energy calculations. MM-GBSA exhibited better rank-ordering with a Spearman ρ of 0.68 compared to 0.40 for MM-PBSA with dielectric constant (ε = 1). An increase in ε resulted in significantly better rank-ordering for MM-PBSA (ρ = 0.91 for ε = 10), but larger ε significantly reduced the contributions of electrostatics, suggesting that the improvement is due to the nonpolar and entropy components, rather than a better representation of the electrostatics. The SVRKB scoring function applied to MD snapshots resulted in excellent rank-ordering (ρ = 0.81). Calculations of the configurational entropy using normal-mode analysis led to free energies that correlated significantly better to the ITC free energy than the MD-based quasi-harmonic approach, but the computed entropies showed no correlation with the ITC entropy. When the adaptation energy is taken into consideration by running separate simulations for complex, apo, and ligand (MM-PBSAADAPT), there is less agreement with the ITC data for the individual free energies, but remarkably good rank-ordering is observed (ρ = 0.89). Interestingly, filtering MD snapshots by prescoring

  9. First insight into dead wood protistan diversity: a molecular sampling of bright-spored Myxomycetes (Amoebozoa, slime-moulds) in decaying beech logs.

    Science.gov (United States)

    Clissmann, Fionn; Fiore-Donno, Anna Maria; Hoppe, Björn; Krüger, Dirk; Kahl, Tiemo; Unterseher, Martin; Schnittler, Martin

    2015-06-01

    Decaying wood hosts a large diversity of seldom investigated protists. Environmental sequencing offers novel insights into communities, but has rarely been applied to saproxylic protists. We investigated the diversity of bright-spored wood-inhabiting Myxomycetes by environmental sequencing. Myxomycetes have a complex life cycle culminating in the formation of mainly macroscopic fruiting bodies, highly variable in shape and colour that are often found on decaying logs. Our hypothesis was that diversity of bright-spored Myxomycetes would increase with decay. DNA was extracted from wood chips collected from 17 beech logs of varying decay stages from the Hainich-Dün region in Central Germany. We obtained 260 partial small subunit ribosomal RNA gene sequences of bright-spored Myxomycetes that were assembled into 29 OTUs, of which 65% were less than 98% similar to those in the existing database. The OTU richness revealed by molecular analysis surpassed that of a parallel inventory of fruiting bodies. We tested several environmental variables and identified pH, rather than decay stage, as the main structuring factor of myxomycete distribution. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Map-based molecular diversity, linkage disequilibrium and association mapping of fruit traits in melon

    Science.gov (United States)

    The wide phenotypic diversity, in melon fruits, is the result of consumer preferences combined with genotype fitness to the different agro-climatic zones. There is no sufficient information with respect to the extent of genetic divergence, population structure and linkage disequilibrium (LD) in mel...

  11. Molecular identification of hybrids from a former hot spot of Potamogeton hybrid diversity

    Czech Academy of Sciences Publication Activity Database

    Kaplan, Zdeněk; Fehrer, Judith

    2013-01-01

    Roč. 105, Feb 2013 (2013), s. 34-40 ISSN 0304-3770 R&D Projects: GA ČR GA206/09/0291 Institutional support: RVO:67985939 Keywords : hybridization * taxonomy * diversity Subject RIV: EF - Botanics Impact factor: 1.471, year: 2013

  12. Molecular genetic diversity and genetic structure of Vietnamese indigenous pig populations

    DEFF Research Database (Denmark)

    Pham, L. D.; Do, Duy Ngoc; Nam, L. Q.

    2014-01-01

    The study characterized genetic diversity and genetic structure of five indigenous pig populations (Ha Lang, Muong Te, Mong Cai, Lung and Lung Pu), two wild pig populations (Vietnamese and Thai wild pigs) and an exotic pig breed (Yorkshire) using FAO/ISAG recommended 16 microsatellite markers...

  13. Molecular method to assess the diversity of Burkholderia species in environmental samples

    NARCIS (Netherlands)

    Salles, J.; Souza, de F.A.; Elsas, van J.D.

    2002-01-01

    In spite of the importance of many members of the genus Burkholderia in the soil microbial community, no direct method to assess the diversity of this genus has been developed so far. The aim of this work was the development of soil DNA-based PCR-denaturing gradient gel electrophoresis (DGGE), a

  14. Molecular method to assess the diversity of Burkholderia species in environmental samples

    NARCIS (Netherlands)

    Salles, Joanna; De Souza, F.A.; Van Elsas, J.D.

    2002-01-01

    In spite of the importance of many members of the genus Burkholderia in the soil microbial community, no direct method to assess the diversity of this genus has been developed so far. The aim of this work was the development of soil DNA-based PCR-denaturing gradient get electrophoresis (DGGE), a

  15. Molecular diversity of Theileria parva : a case study of Kilosa district ...

    African Journals Online (AJOL)

    Theileria parva is an apicomplexan protozoan parasite which causes East Coast fever (ECF) in Eastern and Central Africa. A study was conducted between February and May 2012 in Morogoro region to determine the diversity of the T. Parva parasite circulating in cattle in Kilosa district. Also ECF cases reported between ...

  16. Analysis of genetic diversity and population structure in upland ...

    Indian Academy of Sciences (India)

    Mulugeta Seyoum

    2018-06-09

    Jun 9, 2018 ... diversity and population structure at DNA level, 302 elite upland cotton germplasm accessions ...... conservation of cotton germplasm in China (English abstract). ... and Alishah O. 2011 Inter simple sequence repeats (ISSR).

  17. Diversity analysis of sweet potato (Ipomoea batatas [L.] Lam ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-02-05

    Feb 5, 2014 ... for genetic diversity assessment on sweet potato germplasm (Jarret et al., 1992; ..... method using arithmetic average (UPGMA) algorithm of. DARwin5.0.158 ..... McKnight Foundation for the additional support. REFERENCES.

  18. Analysis of genetic diversity in Arrhenatherum elatius Germplasm ...

    African Journals Online (AJOL)

    Jane

    2011-07-25

    Jul 25, 2011 ... The genetic diversity of 19 Arrhenatherum elatius accessions was analyzed ... can be used as novel DNA markers for genomic .... phylogenies and evolutionary biology. .... struction Project of the Beijing Academy of Agriculture.

  19. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  20. RAPD analysis for genetic diversity of two populations of Mystus ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-09-01

    Sep 1, 2009 ... and other aquatic ecosystem and the ecological complexes. ... is a property at the population level while the functional diversity concept ... warm water fish species, which are distributed all over the world. ..... Phylogenetic.

  1. Analysis of genetic diversity in chickpea ( Cicer arietinum L ...

    African Journals Online (AJOL)

    Genetic diversity of seven chickpea (Cicer arietinum L.) cultivars of Pakistani origin ... effective method to determine the variations among the chickpea cultivars. ... to broaden the germplasm base in the future for chickpea breeding programs.

  2. Analysis of genetic diversity and estimation of inbreeding coefficient ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-18

    Jan 18, 2010 ... Key words: Genetic diversity, microsatellite markers, Caspian horse breed. INTRODUCTION ... heterozygosity, observed and effective number of alleles at each ... computer program version 1.31 (Yeh et al., 1999). Based on ...

  3. An analysis of the genetic diversity and genetic structure of ...

    African Journals Online (AJOL)

    ajl yemi

    2011-12-26

    Dec 26, 2011 ... relief, diuresis, blood pressure and lipid metabolism. (Kawasaki et al., 2000). ... Habitat. Longitude(N),. Latitude(E). Population size. Sample size. LY. Luoyang, Henan ..... Compared with the high genetic diversity at the species.

  4. High-throughput molecular binding analysis on open-microfluidic platform

    OpenAIRE

    Pan, Yuchen

    2016-01-01

    Biomolecular binding interactions underpin life sciences tools that are essential to fields as diverse as molecular biology and clinical chemistry. Merging needs in life science research entail fast, robust and quantitative binding reaction characterization, such as antibody selection, gene regulation screening and drug screening. Identification, characterization, and optimization of these diverse molecular binding reactions demands the availability of powerful, quantitative analytical tools....

  5. A comparative analysis of genetic diversity in Portuguese grape germplasm from ampelographic collections fit for quality wine production

    International Nuclear Information System (INIS)

    Castro, I.; Pinto-Carnide, I.; Ortiz, J.M.; Ferreira, V.; Martín, J.P.

    2016-01-01

    Grapevine cultivars diversity is vast and full of synonyms and homonyms. Up to few decades ago characterization of grapevine was based on morphological characters. In the last decades, molecular markers were developed and have been used as tools to study genetic diversity in a range of different plant species. Fifty-six Portuguese accessions representative of ‘Vinhos Verdes’ and ‘Douro’ Controlled Designations of Origin (DOC) were analysed through DNA fingerprints generated by Random Amplified Polymorphic DNA (RAPD) and Inter Simple Sequence Repeat (ISSR). The study aimed to compare the effectiveness of RAPD and ISSR molecular techniques in the detection of synonyms, homonyms and misnames. RAPD and ISSR analysis enabled the detection of 36 different band patterns, reducing in about 36% the initial material. Several accessions grown under different names, between and within collections, were confirmed as the same genotype, namely Gouveio/Verdelho, Sousão Douro/Vinhão and Arinto Oeste/Pedernã. Similarly, some homonyms/misnames were also identified, namely within Azal Tinto and Rabigato accessions. RAPD and ISSR markers revealed to be adequate molecular techniques for grapevine varieties fingerprinting with advantages over other molecular procedures, contributing for a good management of grapevine collections.

  6. A comparative analysis of genetic diversity in Portuguese grape germplasm from ampelographic collections fit for quality wine production

    Energy Technology Data Exchange (ETDEWEB)

    Castro, I.; Pinto-Carnide, I.; Ortiz, J.M.; Ferreira, V.; Martín, J.P.

    2016-07-01

    Grapevine cultivars diversity is vast and full of synonyms and homonyms. Up to few decades ago characterization of grapevine was based on morphological characters. In the last decades, molecular markers were developed and have been used as tools to study genetic diversity in a range of different plant species. Fifty-six Portuguese accessions representative of ‘Vinhos Verdes’ and ‘Douro’ Controlled Designations of Origin (DOC) were analysed through DNA fingerprints generated by Random Amplified Polymorphic DNA (RAPD) and Inter Simple Sequence Repeat (ISSR). The study aimed to compare the effectiveness of RAPD and ISSR molecular techniques in the detection of synonyms, homonyms and misnames. RAPD and ISSR analysis enabled the detection of 36 different band patterns, reducing in about 36% the initial material. Several accessions grown under different names, between and within collections, were confirmed as the same genotype, namely Gouveio/Verdelho, Sousão Douro/Vinhão and Arinto Oeste/Pedernã. Similarly, some homonyms/misnames were also identified, namely within Azal Tinto and Rabigato accessions. RAPD and ISSR markers revealed to be adequate molecular techniques for grapevine varieties fingerprinting with advantages over other molecular procedures, contributing for a good management of grapevine collections.

  7. Cellular and Axonal Diversity in Molecular Layer Heterotopia of the Rat Cerebellar Vermis

    Directory of Open Access Journals (Sweden)

    Sarah E. Van Dine

    2013-01-01

    Full Text Available Molecular layer heterotopia of the cerebellar primary fissure are a characteristic of many rat strains and are hypothesized to result from defect of granule cells exiting the external granule cell layer during cerebellar development. However, the cellular and axonal constituents of these malformations remain poorly understood. In the present report, we use histochemistry and immunocytochemistry to identify neuronal, glial, and axonal classes in molecular layer heterotopia. In particular, we identify parvalbumin-expressing molecular layer interneurons in heterotopia as well as three glial cell types including Bergmann glia, Olig2-expressing oligodendrocytes, and Iba1-expressing microglia. In addition, we document the presence of myelinated, serotonergic, catecholaminergic, and cholinergic axons in heterotopia indicating possible spinal and brainstem afferent projections to heterotopic cells. These findings are relevant toward understanding the mechanisms of normal and abnormal cerebellar development.

  8. Genetic Breeding and Diversity of the Genus Passiflora: Progress and Perspectives in Molecular and Genetic Studies

    Directory of Open Access Journals (Sweden)

    Carlos Bernard M. Cerqueira-Silva

    2014-08-01

    Full Text Available Despite the ecological and economic importance of passion fruit (Passiflora spp., molecular markers have only recently been utilized in genetic studies of this genus. In addition, both basic genetic researches related to population studies and pre-breeding programs of passion fruit remain scarce for most Passiflora species. Considering the number of Passiflora species and the increasing use of these species as a resource for ornamental, medicinal, and food purposes, the aims of this review are the following: (i to present the current condition of the passion fruit crop; (ii to quantify the applications and effects of using molecular markers in studies of Passiflora; (iii to present the contributions of genetic engineering for passion fruit culture; and (iv to discuss the progress and perspectives of this research. Thus, the present review aims to summarize and discuss the relationship between historical and current progress on the culture, breeding, and molecular genetics of passion fruit.

  9. Development of Pineapple Microsatellite Markers and Germplasm Genetic Diversity Analysis

    Directory of Open Access Journals (Sweden)

    Suping Feng

    2013-01-01

    Full Text Available Two methods were used to develop pineapple microsatellite markers. Genomic library-based SSR development: using selectively amplified microsatellite assay, 86 sequences were generated from pineapple genomic library. 91 (96.8% of the 94 Simple Sequence Repeat (SSR loci were dinucleotide repeats (39 AC/GT repeats and 52 GA/TC repeats, accounting for 42.9% and 57.1%, resp., and the other three were mononucleotide repeats. Thirty-six pairs of SSR primers were designed; 24 of them generated clear bands of expected sizes, and 13 of them showed polymorphism. EST-based SSR development: 5659 pineapple EST sequences obtained from NCBI were analyzed; among 1397 nonredundant EST sequences, 843 were found containing 1110 SSR loci (217 of them contained more than one SSR locus. Frequency of SSRs in pineapple EST sequences is 1SSR/3.73 kb, and 44 types were found. Mononucleotide, dinucleotide, and trinucleotide repeats dominate, accounting for 95.6% in total. AG/CT and AGC/GCT were the dominant type of dinucleotide and trinucleotide repeats, accounting for 83.5% and 24.1%, respectively. Thirty pairs of primers were designed for each of randomly selected 30 sequences; 26 of them generated clear and reproducible bands, and 22 of them showed polymorphism. Eighteen pairs of primers obtained by the one or the other of the two methods above that showed polymorphism were selected to carry out germplasm genetic diversity analysis for 48 breeds of pineapple; similarity coefficients of these breeds were between 0.59 and 1.00, and they can be divided into four groups accordingly. Amplification products of five SSR markers were extracted and sequenced, corresponding repeat loci were found and locus mutations are mainly in copy number of repeats and base mutations in the flanking region.

  10. Development of Pineapple Microsatellite Markers and Germplasm Genetic Diversity Analysis

    Science.gov (United States)

    Tong, Helin; Chen, You; Wang, Jingyi; Chen, Yeyuan; Sun, Guangming; He, Junhu; Wu, Yaoting

    2013-01-01

    Two methods were used to develop pineapple microsatellite markers. Genomic library-based SSR development: using selectively amplified microsatellite assay, 86 sequences were generated from pineapple genomic library. 91 (96.8%) of the 94 Simple Sequence Repeat (SSR) loci were dinucleotide repeats (39 AC/GT repeats and 52 GA/TC repeats, accounting for 42.9% and 57.1%, resp.), and the other three were mononucleotide repeats. Thirty-six pairs of SSR primers were designed; 24 of them generated clear bands of expected sizes, and 13 of them showed polymorphism. EST-based SSR development: 5659 pineapple EST sequences obtained from NCBI were analyzed; among 1397 nonredundant EST sequences, 843 were found containing 1110 SSR loci (217 of them contained more than one SSR locus). Frequency of SSRs in pineapple EST sequences is 1SSR/3.73 kb, and 44 types were found. Mononucleotide, dinucleotide, and trinucleotide repeats dominate, accounting for 95.6% in total. AG/CT and AGC/GCT were the dominant type of dinucleotide and trinucleotide repeats, accounting for 83.5% and 24.1%, respectively. Thirty pairs of primers were designed for each of randomly selected 30 sequences; 26 of them generated clear and reproducible bands, and 22 of them showed polymorphism. Eighteen pairs of primers obtained by the one or the other of the two methods above that showed polymorphism were selected to carry out germplasm genetic diversity analysis for 48 breeds of pineapple; similarity coefficients of these breeds were between 0.59 and 1.00, and they can be divided into four groups accordingly. Amplification products of five SSR markers were extracted and sequenced, corresponding repeat loci were found and locus mutations are mainly in copy number of repeats and base mutations in the flanking region. PMID:24024187

  11. Molecular Differentiation of Fasciola Species and Characterization of Genetic Diversity of F. gigantica Using NADH Dehydrogenase I (ND1 Gene in the Endemic Areas of Iran.

    Directory of Open Access Journals (Sweden)

    Shabnam Tadayon

    2015-03-01

    Full Text Available Fasciola hepatica and F. gigantica are the causative agents of fasciolosis in domestic animals and humans. Based on the morphometric criteria, differential diagnosis between them is problematic. In addition, intermediate forms of Fasciola have been found in Iran, which makes the differentiation more difficult. The aim of the present study was to provide molecular evidence for the existence of F. gigantica in Iran using sequencing analysis of ND1 and PCR-RFLP analysis of ITS2 regions and to study the intraspecies variations of F. gigantica based on mitochondrial ND1 gene polymorphism.Forty Fasciola spp. samples collected from four distinct provinces (Fars, Khuzestan, Gilan, Khorasan Razavi in Iran were collected for morphological and molecular characterization. In molecular method, PCR-RFLP analysis of ITS2 using pagI restriction enzyme was used as a screening approach for F. gigantica differentiation. Then mitochondrial DNA sequence variations in the ND1 gene were used for phylogenetic analysis.Based on the morphometric criteria and RFLP analysis, 14 parasitic samples were initially identified to be F. gigantica. Phylogenetic results showed that there are at least 10 different genotypes of F. gigantica in Iran, which are different from those existing in the GenBank. Twenty-six points out of 410 base pairs of sequenced ND1 gene in 10 varieties of F. gigantica were diagnosed to be polymorphic. From 26 points of polymorphism, only eight resulted in the post-translational amino acid changes in ND1 gene product structure.Data revealed noticeable genetic diversity (up to 4.63% between different varieties of F. gigantica in Iran.

  12. Genetic relationship and diversity among coconut (Cocos nucifera L.) accessions revealed through SCoT analysis.

    Science.gov (United States)

    Rajesh, M K; Sabana, A A; Rachana, K E; Rahman, Shafeeq; Jerard, B A; Karun, Anitha

    2015-12-01

    Coconut (Cocos nucifera L.) is one of the important palms grown both as a homestead and plantation crop in countries and most island territories of tropical regions. Different DNA-based marker systems have been utilized to assess the extent of genetic diversity in coconut. Advances in genomics research have resulted in the development of novel gene-targeted markers. In the present study, we have used a simple and novel marker system, start codon targeted polymorphism (SCoT), for its evaluation as a potential marker system in coconut. SCoT markers were utilized for assessment of genetic diversity in 23 coconut accessions (10 talls and 13 dwarfs), representing different geographical regions. Out of 25 SCoT primers screened, 15 primers were selected for this study based on their consistent amplification patterns. A total of 102 scorable bands were produced by the 15 primers, 88 % of which were polymorphic. The scored data were used to construct a similarity matrix. The similarity coefficient values ranged between 0.37 and 0.91. These coefficients were utilized to construct a dendrogram using the unweighted pair group of arithmetic means (UPGMA). The extent of genetic diversity observed based on SCoT analysis of coconut accessions was comparable to earlier findings using other marker systems. Tall and dwarf coconut accessions were clearly demarcated, and in general, coconut accessions from the same geographical region clustered together. The results indicate the potential of SCoT markers to be utilized as molecular markers to detect DNA polymorphism in coconut accessions.

  13. Correlation analysis of the Taurus molecular cloud complex

    International Nuclear Information System (INIS)

    Kleiner, S.C.

    1985-01-01

    Autocorrelation and power spectrum methods were applied to the analysis of the density and velocity structure of the Taurus Complex and Heiles Cloud 2 as traced out by 13 CO J = 1 → 0 molecular line observations obtained with the 14m antenna of the Five College Radio Astronomy Observatory. Statistically significant correlations in the spacing of density fluctuations within the Taurus Complex and Heiles 2 were uncovered. The length scales of the observed correlations correspond in magnitude to the Jeans wavelengths characterizing gravitational instabilities with (i) interstellar atomic hydrogen gas for the case of the Taurus complex, and (ii) molecular hydrogen for Heiles 2. The observed correlations may be the signatures of past and current gravitational instabilities frozen into the structure of the molecular gas. The appendices provide a comprehensive description of the analytical and numerical methods developed for the correlation analysis of molecular clouds

  14. Genetic diversity in the oral pathogen Porphyromonas gingivalis: molecular mechanisms and biological consequences

    Science.gov (United States)

    Tribble, Gena D; Kerr, Jennifer E; Wang, Bing-Yan

    2013-01-01

    Porphyromonas gingivalis is a Gram-negative anaerobic bacterium that colonizes the human oral cavity. It is implicated in the development of periodontitis, a chronic periodontal disease affecting half of the adult population in the USA. To survive in the oral cavity, these bacteria must colonize dental plaque biofilms in competition with other bacterial species. Long-term survival requires P. gingivalis to evade host immune responses, while simultaneously adapting to the changing physiology of the host and to alterations in the plaque biofilm. In reflection of this highly variable niche, P. gingivalis is a genetically diverse species and in this review the authors summarize genetic diversity as it relates to pathogenicity in P. gingivalis. Recent studies revealing a variety of mechanisms by which adaptive changes in genetic content can occur are also reviewed. Understanding the genetic plasticity of P. gingivalis will provide a better framework for understanding the host–microbe interactions associated with periodontal disease. PMID:23642116

  15. Analysis of Genetic Diversity and Population Structure of Sesame Accessions from Africa and Asia as Major Centers of Its Cultivation

    Directory of Open Access Journals (Sweden)

    Komivi Dossa

    2016-04-01

    Full Text Available Sesame is an important oil crop widely cultivated in Africa and Asia. Understanding the genetic diversity of accessions from these continents is critical to designing breeding methods and for additional collection of sesame germplasm. To determine the genetic diversity in relation to geographical regions, 96 sesame accessions collected from 22 countries distributed over six geographic regions in Africa and Asia were genotyped using 33 polymorphic SSR markers. Large genetic variability was found within the germplasm collection. The total number of alleles was 137, averaging 4.15 alleles per locus. The accessions from Asia displayed more diversity than those from Africa. Accessions from Southern Asia (SAs, Eastern Asia (EAs, and Western Africa (WAf were highly diversified, while those from Western Asia (WAs, Northern Africa (NAf, and Southeastern Africa (SAf had the lowest diversity. The analysis of molecular variance revealed that more than 44% of the genetic variance was due to diversity among geographic regions. Five subpopulations, including three in Asia and two in Africa, were cross-identified through phylogenetic, PCA, and STRUCTURE analyses. Most accessions clustered in the same population based on their geographical origins. Our results provide technical guidance for efficient management of sesame genetic resources in breeding programs and further collection of sesame germplasm from these different regions.

  16. Molecular sequence data of hepatitis B virus and genetic diversity after vaccination

    NARCIS (Netherlands)

    van Ballegooijen, W. Marijn; van Houdt, Robin; Bruisten, Sylvia M.; Boot, Hein J.; Coutinho, Roel A.; Wallinga, Jacco

    2009-01-01

    The effect of vaccination programs on transmission of infectious disease is usually assessed by monitoring programs that rely on notifications of symptomatic illness. For monitoring of infectious diseases with a high proportion of asymptomatic cases or a low reporting rate, molecular sequence data

  17. Molecular genetic diversity of Punica granatum L. (pomegranate) as revealed by microsatellite DNA markers

    Science.gov (United States)

    Pomegranate (Punica granatum L.) is one of the oldest known edible fruits and more and more it arouse interest of scientific community given its numerous biological activities. However, information about its genetic resources and characterization using reliable molecular markers are still scarce. In...

  18. Detection of microbial diversity in endocarditis using cultivation-independent molecular techniques

    DEFF Research Database (Denmark)

    Wolff, Tine Y; Moser, Claus Ernst; Bundgaard, Henning

    2011-01-01

    Background: The aim of this study was to investigate whether the diagnosis of infective endocarditis (IE) could be improved using molecular tools in addition to standard microscopy and cultivation methods. Methods: Cultivation was performed on blood or tissue samples as recommended in the modified...

  19. Fragrance analysis using molecular and biochemical methods in ...

    African Journals Online (AJOL)

    admin

    Biochemical analysis of aroma was performed with the 1.7% KOH solution and molecular analysis of aroma was carried out with microsatellite markers present on chromosome 8 (BAD2, BADEX7-5, SCUSSR1) to determine the extent of association between trait, marker and chromosome 8. Among these markers, BAD2 ...

  20. Molecular responses and expression analysis of genes in a ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... Molecular responses and expression analysis of genes in a xerophytic desert shrub Haloxylon ammodendron .... physiological determination and cDNA-AFLP analysis, three groups of seeds were sowed in pots with sand and .... HaDR27. U. 234. PDR-like ABC transporter. AT1G59870. HaDR28. U. 135.

  1. Molecular analyses reveal high species diversity of trematodes in a sub-Arctic lake

    Czech Academy of Sciences Publication Activity Database

    Soldánová, Miroslava; Georgieva, Simona; Roháčová, Jana; Knudsen, R.; Kuhn, J. A.; Henriksen, E. H.; Siwertsson, A.; Shaw, J. C.; Kuris, A. M.; Amundsen, P.-A.; Scholz, Tomáš; Lafferty, K. D.; Kostadinova, Aneta

    2017-01-01

    Roč. 47, č. 6 (2017), s. 327-345 ISSN 0020-7519 R&D Projects: GA ČR GA15-14198S; GA ČR GAP505/10/1562 Institutional support: RVO:60077344 Keywords : Trematode diversity * intermediate hosts * phylogeny * mitochondrial DNA * nuclear DNA * Lake Takvatn * Norway * Sub-Arctic Subject RIV: EG - Zoology OBOR OECD: Zoology Impact factor: 3.730, year: 2016

  2. A molecular epidemiological study of var gene diversity to characterize the reservoir of Plasmodium falciparum in humans in Africa.

    Directory of Open Access Journals (Sweden)

    Donald S Chen

    2011-02-01

    Full Text Available The reservoir of Plasmodium infection in humans has traditionally been defined by blood slide positivity. This study was designed to characterize the local reservoir of infection in relation to the diverse var genes that encode the major surface antigen of Plasmodium falciparum blood stages and underlie the parasite's ability to establish chronic infection and transmit from human to mosquito.We investigated the molecular epidemiology of the var multigene family at local sites in Gabon, Senegal and Kenya which differ in parasite prevalence and transmission intensity. 1839 distinct var gene types were defined by sequencing DBLα domains in the three sites. Only 76 (4.1% var types were found in more than one population indicating spatial heterogeneity in var types across the African continent. The majority of var types appeared only once in the population sample. Non-parametric statistical estimators predict in each population at minimum five to seven thousand distinct var types. Similar diversity of var types was seen in sites with different parasite prevalences.Var population genomics provides new insights into the epidemiology of P. falciparum in Africa where malaria has never been conquered. In particular, we have described the extensive reservoir of infection in local African sites and discovered a unique var population structure that can facilitate superinfection through minimal overlap in var repertoires among parasite genomes. Our findings show that var typing as a molecular surveillance system defines the extent of genetic complexity in the reservoir of infection to complement measures of malaria prevalence. The observed small scale spatial diversity of var genes suggests that var genetics could greatly inform current malaria mapping approaches and predict complex malaria population dynamics due to the import of var types to areas where no widespread pre-existing immunity in the population exists.

  3. A Molecular Epidemiological Study of var Gene Diversity to Characterize the Reservoir of Plasmodium falciparum in Humans in Africa

    Science.gov (United States)

    Leliwa-Sytek, Aleksandra; Smith, Terry-Ann; Peterson, Ingrid; Brown, Stuart M.; Migot-Nabias, Florence; Deloron, Philippe; Kortok, Moses M.; Marsh, Kevin; Daily, Johanna P.; Ndiaye, Daouda; Sarr, Ousmane; Mboup, Souleymane; Day, Karen P.

    2011-01-01

    Background The reservoir of Plasmodium infection in humans has traditionally been defined by blood slide positivity. This study was designed to characterize the local reservoir of infection in relation to the diverse var genes that encode the major surface antigen of Plasmodium falciparum blood stages and underlie the parasite's ability to establish chronic infection and transmit from human to mosquito. Methodology/Principal Findings We investigated the molecular epidemiology of the var multigene family at local sites in Gabon, Senegal and Kenya which differ in parasite prevalence and transmission intensity. 1839 distinct var gene types were defined by sequencing DBLα domains in the three sites. Only 76 (4.1%) var types were found in more than one population indicating spatial heterogeneity in var types across the African continent. The majority of var types appeared only once in the population sample. Non-parametric statistical estimators predict in each population at minimum five to seven thousand distinct var types. Similar diversity of var types was seen in sites with different parasite prevalences. Conclusions/Significance Var population genomics provides new insights into the epidemiology of P. falciparum in Africa where malaria has never been conquered. In particular, we have described the extensive reservoir of infection in local African sites and discovered a unique var population structure that can facilitate superinfection through minimal overlap in var repertoires among parasite genomes. Our findings show that var typing as a molecular surveillance system defines the extent of genetic complexity in the reservoir of infection to complement measures of malaria prevalence. The observed small scale spatial diversity of var genes suggests that var genetics could greatly inform current malaria mapping approaches and predict complex malaria population dynamics due to the import of var types to areas where no widespread pre-existing immunity in the population

  4. Interactive analysis of systems biology molecular expression data

    Directory of Open Access Journals (Sweden)

    Prabhakar Sunil

    2008-02-01

    Full Text Available Abstract Background Systems biology aims to understand biological systems on a comprehensive scale, such that the components that make up the whole are connected to one another and work through dependent interactions. Molecular correlations and comparative studies of molecular expression are crucial to establishing interdependent connections in systems biology. The existing software packages provide limited data mining capability. The user must first generate visualization data with a preferred data mining algorithm and then upload the resulting data into the visualization package for graphic visualization of molecular relations. Results Presented is a novel interactive visual data mining application, SysNet that provides an interactive environment for the analysis of high data volume molecular expression information of most any type from biological systems. It integrates interactive graphic visualization and statistical data mining into a single package. SysNet interactively presents intermolecular correlation information with circular and heatmap layouts. It is also applicable to comparative analysis of molecular expression data, such as time course data. Conclusion The SysNet program has been utilized to analyze elemental profile changes in response to an increasing concentration of iron (Fe in growth media (an ionomics dataset. This study case demonstrates that the SysNet software is an effective platform for interactive analysis of molecular expression information in systems biology.

  5. AFLP analysis of genetic diversity in leafy kale (Brassica oleracea L. convar. acephala (DC.) Alef.) landraces, cultivars and wild populations in Europe

    DEFF Research Database (Denmark)

    Christensen, Stina; von Bothmer, Roland; Poulsen, G.

    2011-01-01

    AFLP markers were used to characterize diversity and asses the genetic structure among 17 accessions of kale landraces, cultivars and wild populations from Europe. The range of average gene diversity in accessions was 0.11–0.27. Several landraces showed higher levels of diversity than the wild...... populations and one cultivar had the lowest diversity measures. The landraces that were most genetically diverse were from areas where kales are known to be extensively grown, suggesting in situ conservation in these areas as a supplement to storage of seeds in gene banks. An analysis of molecular variance...... the relationship among them is due to seed dispersal through human interactions. Our results indicate that a kale population found in a natural habitat in Denmark was probably not truly wild but most likely an escape from a cultivated Danish kale that had subsequently become naturalized....

  6. Investigating Genetic Diversity Among Cotton Genotypes Available in the Iranian Gene Bank (Gossypium sp. Using ISSR Molecular Marker

    Directory of Open Access Journals (Sweden)

    F Shahriari Ahmadi

    2013-04-01

    Full Text Available Cotton is one of the most important world crops and is considered as a major cash crop in the North East of Iran. All selections in plant breeding are based on diversity and an increase in genetic diversity determines the range of selection. In the present study, 24 cultivars of cotton available at the research station for cotton in the East of Iran -Kashmar- were studied using the ISSR marker. A total number of 13 primers, with repeated simple sequences, were used for the amplification of genomic DNA. Overall, 128 bands were obtained, 109 of which showed polymorphism. To evaluate genetic similarity between cultivars, cluster analysis accompanied by the similarity coefficient developed by Jaccard and Nee (1972, were applied using the UPGMA method. Dendrogram analysis showed a high diversity in the cotton cultivars and two main groups with 70 percent genetic similarity dividing the cotton cultivars into two main groups; namely, tetraploid and diploid. The highest polymorphism percentage was related to 5' (CT8RC3' (100% and the lowest belonged to 5' (AG8YA3' and 5' (TC8G3' (25% primers. Based on the similarity matrix, the highest genetic similarity was found in Varamin and Khordad and the lowest in Avangard and Bakhtegan cultivars. Based on the obtained results, ISSR markers can be efficiently used for the investigation of genetic diversity among cotton cultivars.

  7. Genetic diversity in a Poincianella pyramidalis (Tul.) L.P. Queiroz population assessed by RAPD molecular markers.

    Science.gov (United States)

    Belarmino, K S; Rêgo, M M; Bruno, R L A; Medeiros, G D A; Andrade, A P; Rêgo, E R

    2017-08-31

    Poincianella pyramidalis (Tul.) L.P. Queiroz is an endemic Caatinga (Brazilian savannah biome) species that has been exploited for different purposes, although information is necessary about still existing natural populations. The objective of this study was to evaluate the genetic diversity among 20 P. pyramidalis individuals occurring in a population localized in the Caatinga biome of Paraíba State, aiming at seed collection, using RAPD markers. For the DNA extraction, young shoots of the individuals were used, and amplification was carried out using 20 primers. The obtained markers were converted to a binary matrix, from which a genetic dissimilarity matrix was built using the arithmetic complement of Jaccard's coefficient, and the dendrogram was built by the UPGMA analysis. No amplified fragment was monomorphic, resulting in 100% polymorphism of the analyzed population. The mean genetic diversity among the matrices was 63.28%, ranging from 30.9 to 97.7%. Individuals 09 and 17 showed relevant genetic proximity, and thus planting their seedlings at close sites would not be indicated. The population evaluated in this study showed high genetic diversity, originating twelve groups from the UPGMA hierarchical cluster analysis. Based on the results, individuals 09 and 17 can provide plant material for the evaluation of the physiological performance of P. pyramidalis seeds, and the set of individuals of this population has a high genetic diversity that characterizes them as adequate matrices for projects of restoration and conservation of the seed species.

  8. Analysis of Population Diversity of Dynamic Probabilistic Particle Swarm Optimization Algorithms

    Directory of Open Access Journals (Sweden)

    Qingjian Ni

    2014-01-01

    Full Text Available In evolutionary algorithm, population diversity is an important factor for solving performance. In this paper, combined with some population diversity analysis methods in other evolutionary algorithms, three indicators are introduced to be measures of population diversity in PSO algorithms, which are standard deviation of population fitness values, population entropy, and Manhattan norm of standard deviation in population positions. The three measures are used to analyze the population diversity in a relatively new PSO variant—Dynamic Probabilistic Particle Swarm Optimization (DPPSO. The results show that the three measure methods can fully reflect the evolution of population diversity in DPPSO algorithms from different angles, and we also discuss the impact of population diversity on the DPPSO variants. The relevant conclusions of the population diversity on DPPSO can be used to analyze, design, and improve the DPPSO algorithms, thus improving optimization performance, which could also be beneficial to understand the working mechanism of DPPSO theoretically.

  9. Automated Analysis and Classification of Histological Tissue Features by Multi-Dimensional Microscopic Molecular Profiling.

    Directory of Open Access Journals (Sweden)

    Daniel P Riordan

    Full Text Available Characterization of the molecular attributes and spatial arrangements of cells and features within complex human tissues provides a critical basis for understanding processes involved in development and disease. Moreover, the ability to automate steps in the analysis and interpretation of histological images that currently require manual inspection by pathologists could revolutionize medical diagnostics. Toward this end, we developed a new imaging approach called multidimensional microscopic molecular profiling (MMMP that can measure several independent molecular properties in situ at subcellular resolution for the same tissue specimen. MMMP involves repeated cycles of antibody or histochemical staining, imaging, and signal removal, which ultimately can generate information analogous to a multidimensional flow cytometry analysis on intact tissue sections. We performed a MMMP analysis on a tissue microarray containing a diverse set of 102 human tissues using a panel of 15 informative antibody and 5 histochemical stains plus DAPI. Large-scale unsupervised analysis of MMMP data, and visualization of the resulting classifications, identified molecular profiles that were associated with functional tissue features. We then directly annotated H&E images from this MMMP series such that canonical histological features of interest (e.g. blood vessels, epithelium, red blood cells were individually labeled. By integrating image annotation data, we identified molecular signatures that were associated with specific histological annotations and we developed statistical models for automatically classifying these features. The classification accuracy for automated histology labeling was objectively evaluated using a cross-validation strategy, and significant accuracy (with a median per-pixel rate of 77% per feature from 15 annotated samples for de novo feature prediction was obtained. These results suggest that high-dimensional profiling may advance the

  10. Exploring the diversity and distribution of neotropical avian malaria parasites--a molecular survey from Southeast Brazil.

    Directory of Open Access Journals (Sweden)

    Gustavo A Lacorte

    Full Text Available Southeast Brazil is a neotropical region composed of a mosaic of different tropical habitats and mountain chains, which allowed for the formation of bird-rich communities with distinct ecological niches. Although this region has the potential to harbor a remarkable variety of avian parasites, there is a lack of information about the diversity of malarial parasites. We used molecular approaches to characterize the lineage diversity of Plasmodium and Haemoproteus in bird communities from three different habitats in southeast Brazil based on the prevalence, richness and composition of lineages. We observed an overall prevalence of 35.3%, with a local prevalence ranging from 17.2% to 54.8%. Moreover, no significant association between prevalence and habitat type could be verified (p>0.05. We identified 89 Plasmodium and 22 Haemoproteus lineages, with 86% of them described for the first time here, including an unusual infection of a non-columbiform host by a Haemoproteus (Haemoproteus parasite. The composition analyses of the parasite communities showed that the lineage composition from Brazilian savannah and tropical dry forest was similar, but it was different from the lineage composition of Atlantic rainforest, reflecting the greater likeness of the former habitats with respect to seasonality and forest density. No significant effects of habitat type on lineage richness were observed based on GLM analyses. We also found that sites whose samples had a greater diversity of bird species showed a greater diversity of parasite lineages, providing evidence that areas with high bird richness also have high parasite richness. Our findings point to the importance of the neotropical region (southeast Brazil as a major reservoir of new haemosporidian lineages.

  11. The diverse and expanding role of mass spectrometry in structural and molecular biology.

    Science.gov (United States)

    Lössl, Philip; van de Waterbeemd, Michiel; Heck, Albert Jr

    2016-12-15

    The emergence of proteomics has led to major technological advances in mass spectrometry (MS). These advancements not only benefitted MS-based high-throughput proteomics but also increased the impact of mass spectrometry on the field of structural and molecular biology. Here, we review how state-of-the-art MS methods, including native MS, top-down protein sequencing, cross-linking-MS, and hydrogen-deuterium exchange-MS, nowadays enable the characterization of biomolecular structures, functions, and interactions. In particular, we focus on the role of mass spectrometry in integrated structural and molecular biology investigations of biological macromolecular complexes and cellular machineries, highlighting work on CRISPR-Cas systems and eukaryotic transcription complexes. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  12. Genetic diversity analysis of the durum wheat Graziella Ra, Triticum turgidum L. subsp. durum (Desf. Husn. (Poales, Poaceae

    Directory of Open Access Journals (Sweden)

    M. Stella Colomba

    2011-06-01

    Full Text Available For the first time, the durum wheat Graziella Ra was compared to four Italian durum wheat varieties (Cappelli,Grazia, Flaminio and Svevo and to Kamut in order to preliminary characterize its genome and to investigategenetic diversity among and within the accessions by Amplified Fragment Length Polymorphisms (AFLPs,Simple Sequence Repeats (SSRs and α-gliadin gene sequence analysis. The main aim of the study was anattempt to determine the relationship between the historic accession Graziella Ra and Kamut which isconsidered an ancient relative of the durum subspecies. In addition, nutritional factors of Graziella Ra werereported. Obtained results showed that (i both AFLP and SSR molecular markers detected highly congruentpatterns of genetic diversity among the accessions showing nearly similar efficiency; (ii for AFLPs,percentage of polymorphic loci within accession ranged from 6.57% to 19.71% (mean 12.77% and, for SSRs,from 0% to 57.14% (mean 28.57%; (iii principal component analysis (PCA of genetic distance amongaccessions showed the first two axes accounting for 58.03% (for AFLPs and 61.60% (for SSRs of the totalvariability; (iv for AFLPs, molecular variance was partitioned into 80% (variance among accessions and 20%(within accession and, for SSRs, into 73% (variance among accessions and 27% (within accession; (vcluster analysis of AFLP and SSR datasets displayed Graziella Ra and Kamut into the same cluster; and (vimolecular comparison of α-gliadin gene sequences showed Graziella Ra and Kamut in separate clusters. Allthese findings indicate that Graziella Ra, although being very similar to Kamut, at least in the little part of thegenome herein investigated by molecular markers, may be considered a distinct accession showing appreciablelevels of genetic diversity and medium-high nutritional qualities.

  13. Study of inter species diversity and population structure by molecular genetic method in Iranian Artemia

    OpenAIRE

    Hajirostamloo, Mahbobeh

    2005-01-01

    Artemia is a small crustacean that adapted to live in brine water and has been seen in different brine water sources in Iran. Considering the importance of genetic studies manifest inter population differences in species, to estimate genetic structure, detect difference at molecular level and separate different Artemia populations of Iran, also study of phylogenic relationships among them, samples of Artemia were collected from nine region: Urmia lake in West Azerbaijan, Sh...

  14. Molecular diversity of thermophilic bacteria isolated from Pasinler hot spring (Erzurum, Turkey)

    OpenAIRE

    ADIGÜZEL, Ahmet; İNAN, Kadriye; ŞAHİN, Fikrettin; ARASOĞLU, Tulin; GÜLLÜCE, Medine

    2011-01-01

    The present study was conducted to determine the phenotypic and genotypic characterization of thermophilic bacteria isolated from Pasinler hot spring, Erzurum, Turkey. Fatty acid profiles, BOX PCR fingerprints, and 16S rDNA sequence data were used for the phenotypic and genotypic characterization of thermophilic bacteria. Totally 9 different bacterial strains were selected based on morphological, physiological, and biochemical tests. These strains were characterized by molecular tests includi...

  15. Analysis of genetic diversity in female, male and half sibs willow ...

    African Journals Online (AJOL)

    The genetic diversity among genotypes of Salix sp. was found to be high, suggesting the importance and feasibility of introducing elite genotypes from different origins for Salix germplasm conservation and breeding programs. Keywords: Salix sp., half sibs, molecular markers, genomic DNA fingerprinting. African Journal of ...

  16. Genetic diversity analysis of nine chewing cane varieties (lines) and construction of their DNA fingerprints

    Science.gov (United States)

    In order to provide theoretical basis for variety identification and parental selection during sugarcane breeding process, the present study was conducted to analyze genetic diversity of nine chewing cane varieties (lines) and construct their DNA fingerprints. Combining twenty-one SSR molecular mark...

  17. Molecular detection and sequence characterization of diverse rhabdoviruses in bats, China.

    Science.gov (United States)

    Xu, Lin; Wu, Jianmin; Jiang, Tinglei; Qin, Shaomin; Xia, Lele; Li, Xingyu; He, Biao; Tu, Changchun

    2018-01-15

    The Rhabdoviridae is among the most diverse families of RNA viruses and currently classified into 18 genera with some rhabdoviruses lethal to humans and other animals. Herein, we describe genetic characterization of three novel rhabdoviruses from bats in China. Of these, two viruses (Jinghong bat virus and Benxi bat virus) found in Rhinolophus bats showed a phylogenetic relationship with vesiculoviruses, and sequence analyses indicate that they represent two new species within the genus Vesiculovirus. The remaining Yangjiang bat virus found in Hipposideros larvatus bats were only distantly related to currently known rhabdoviruses. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Genetic diversity analysis and conservation of the Chinese herb ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-05

    Oct 5, 2009 ... Salvia miltiorrhiza is an economically important floral herb. However, little work has been conducted to further our understanding of the genetics of this herb. In this study, a representative set of germplasm of. S. miltiorrhiza populations was used to analyze genetic diversity using amplified fragment length.

  19. Analysis of the genetic diversity of four rabbit genotypes using ...

    African Journals Online (AJOL)

    Dr.Ola

    2013-05-15

    May 15, 2013 ... diseases or market conditions. A considerable number of genetic diversity studies for several livestock species have been carried out during recent years by research. *Corresponding author. E-mail: ola.galal@agr.kfs.edu.eg or olagalal2002@yahoo.com , Tel/Fax: +2-0479102930. Abbreviations: APRI ...

  20. DNA methylation and genetic diversity analysis of genus Cycas in ...

    African Journals Online (AJOL)

    mallory

    2012-01-12

    Jan 12, 2012 ... elucidate the role of epigenetics in the genetic diversity of these plants. MATERIALS AND METHODS. Plant materials and DNA extraction. 66 Cycas samples consisting of 10 species and one subspecies were collected from the Nong Nooch Tropical Garden, Chonburi province, Thailand. For each species ...

  1. Social Diversity, Institutions and Trust: A Cross-National Analysis

    Science.gov (United States)

    Tsai, Ming-Chang; Laczko, Leslie; Bjornskov, Christian

    2011-01-01

    This cross-national investigation examines hypotheses derived from two major alternative perspectives on the determinants of trust in contemporary societies. Is a society's level of generalized trust a function of its ethnic composition, or of its type of governance and political system? The argument that social diversity (ethnic, linguistic, and…

  2. Genetic diversity analysis in the Hypericum perforatum populations ...

    African Journals Online (AJOL)

    Assessment of genetic variability among the Hypericum perforatum populations is critical to the development of effective conservation strategies in the Kashmir valley. To obtain accurate estimates of genetic diversity among and within populations of H. perforatum, inter-simple sequence repeats (ISSR) markers were used.

  3. Genetic diversity analysis and conservation of the Chinese herb ...

    African Journals Online (AJOL)

    Salvia miltiorrhiza is an economically important floral herb. However, little work has been conducted to further our understanding of the genetics of this herb. In this study, a representative set of germplasm of. S. miltiorrhiza populations was used to analyze genetic diversity using amplified fragment length polymorphism ...

  4. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    Caligula japonica (Lepidoptera: Saturniidae), an endemic species in Eastern Asia, is not only an economically important pest to be controlled, but also a producer of expensive silk. We have demonstrated previously the presence of a higher genetic diversity and a certain degree of genetic differentiation related to ...

  5. Analysis of Genetic diversity and reltionships in local Tunisian barley ...

    African Journals Online (AJOL)

    Yomi

    tools in the characterization and evaluation of genetic diversity within and between species and populations. It has been shown that different markers might reveal different classes of variation (Powell et al., 1996; Russell et al., 1997). It is correlated with the genome fraction surveyed by each kind of marker, their distribution ...

  6. Analysis of genetic diversity and construction of core collection of ...

    African Journals Online (AJOL)

    Jane

    2011-06-03

    Jun 3, 2011 ... Genetic diversity of 73 local mulberry varieties from Shanxi Province were screened using ISSR markers, with l5 primers combinations selected for their reproducibility and polymorphism. 129 bands were amplified, of which 115 bands showed polymorphism and the ratio of polymorphism bands was.

  7. Analysis of genetic diversity in pigeon pea germplasm using ...

    Indian Academy of Sciences (India)

    MANEESHA

    2017-08-16

    Aug 16, 2017 ... fied polymorphic DNA (RAPD), simple sequence repeats. (SSR), amplified fragment length polymorphism (AFLP), single-nucleotide polymorphisms (SNPs), diversity array technology (DArT), genic-simple sequence repeats (genic-. SSR) etc. (see review by Varshney et al. 2013). Since retrotransposons are ...

  8. (SSR) markers for analysis of genetic diversity in African rice ...

    African Journals Online (AJOL)

    Bonny Oloka

    2015-05-06

    May 6, 2015 ... and conservation. To address this knowledge gap, 10 highly polymorphic rice simple sequence repeat. (SSR) markers were used to characterize 99 rice genotypes to determine their diversity and place them in their different population groups. The SSR markers were multiplexed in 3 panels to increase their.

  9. Molecular Eigensolution Symmetry Analysis and Fine Structure

    Directory of Open Access Journals (Sweden)

    William G. Harter

    2013-01-01

    Full Text Available Spectra of high-symmetry molecules contain fine and superfine level cluster structure related to J-tunneling between hills and valleys on rovibronic energy surfaces (RES. Such graphic visualizations help disentangle multi-level dynamics, selection rules, and state mixing effects including widespread violation of nuclear spin symmetry species. A review of RES analysis compares it to that of potential energy surfaces (PES used in Born-Oppenheimer approximations. Both take advantage of adiabatic coupling in order to visualize Hamiltonian eigensolutions. RES of symmetric and D2 asymmetric top rank-2-tensor Hamiltonians are compared with Oh spherical top rank-4-tensor fine-structure clusters of 6-fold and 8-fold tunneling multiplets. Then extreme 12-fold and 24-fold multiplets are analyzed by RES plots of higher rank tensor Hamiltonians. Such extreme clustering is rare in fundamental bands but prevalent in hot bands, and analysis of its superfine structure requires more efficient labeling and a more powerful group theory. This is introduced using elementary examples involving two groups of order-6 (C6 and D3~C3v, then applied to families of Oh clusters in SF6 spectra and to extreme clusters.

  10. Identifying Genetic Hotspots by Mapping Molecular Diversity of Widespread Trees: When Commonness Matters.

    Science.gov (United States)

    Souto, Cintia P; Mathiasen, Paula; Acosta, María Cristina; Quiroga, María Paula; Vidal-Russell, Romina; Echeverría, Cristian; Premoli, Andrea C

    2015-01-01

    Conservation planning requires setting priorities at the same spatial scale at which decision-making processes are undertaken considering all levels of biodiversity, but current methods for identifying biodiversity hotspots ignore its genetic component. We developed a fine-scale approach based on the definition of genetic hotspots, which have high genetic diversity and unique variants that represent their evolutionary potential and evolutionary novelties. Our hypothesis is that wide-ranging taxa with similar ecological tolerances, yet of phylogenetically independent lineages, have been and currently are shaped by ecological and evolutionary forces that result in geographically concordant genetic patterns. We mapped previously published genetic diversity and unique variants of biparentally inherited markers and chloroplast sequences for 9 species from 188 and 275 populations, respectively, of the 4 woody dominant families of the austral temperate forest, an area considered a biodiversity hotspot. Spatial distribution patterns of genetic polymorphisms differed among taxa according to their ecological tolerances. Eight genetic hotspots were detected and we recommend conservation actions for some in the southern Coastal Range in Chile. Existing spatially explicit genetic data from multiple populations and species can help to identify biodiversity hotspots and guide conservation actions to establish science-based protected areas that will preserve the evolutionary potential of key habitats and species. © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. The Analysis of Working Environment in terms of Diversity Management in Corporate Practice.

    OpenAIRE

    Indruchová, Zuzana

    2014-01-01

    Charles University in Prague Faculty of Arts Department of Adult Education Program: Pedagogy Zuzana Krištofová The Analysis of Working Environment in terms of Diversity Management and its Implementation in Corporate Practice Abstract thesis supervisor: Doc. PaedDr. Ludvík Eger, CSc. 2012 ABSTRACT The present doctoral thesis deals with diversity management and clarifies its concepts. The objectives of the thesis include comprehensive characterisation of diversity management as an element of co...

  12. Molecular thermal transistor: Dimension analysis and mechanism

    Science.gov (United States)

    Behnia, S.; Panahinia, R.

    2018-04-01

    Recently, large challenge has been spent to realize high efficient thermal transistors. Outstanding properties of DNA make it as an excellent nano material in future technologies. In this paper, we introduced a high efficient DNA based thermal transistor. The thermal transistor operates when the system shows an increase in the thermal flux despite of decreasing temperature gradient. This is what called as negative differential thermal resistance (NDTR). Based on multifractal analysis, we could distinguish regions with NDTR state from non-NDTR state. Moreover, Based on dimension spectrum of the system, it is detected that NDTR state is accompanied by ballistic transport regime. The generalized correlation sum (analogous to specific heat) shows that an irregular decrease in the specific heat induces an increase in the mean free path (mfp) of phonons. This leads to the occurrence of NDTR.

  13. Molecular genetic diversity of the Saccharomyces yeasts in Taiwan: Saccharomyces arboricola, Saccharomyces cerevisiae and Saccharomyces kudriavzevii.

    Science.gov (United States)

    Naumov, Gennadi I; Lee, Ching-Fu; Naumova, Elena S

    2013-01-01

    Genetic hybridization, sequence and karyotypic analyses of natural Saccharomyces yeasts isolated in different regions of Taiwan revealed three biological species: Saccharomyces arboricola, Saccharomyces cerevisiae and Saccharomyces kudriavzevii. Intraspecies variability of the D1/D2 and ITS1 rDNA sequences was detected among S. cerevisiae and S. kudriavzevii isolates. According to molecular and genetic analyses, the cosmopolitan species S. cerevisiae and S. kudriavzevii contain local divergent populations in Taiwan, Malaysia and Japan. Six of the seven known Saccharomyces species are documented in East Asia: S. arboricola, S. bayanus, S. cerevisiae, S. kudriavzevii, S. mikatae, and S. paradoxus.

  14. Data supporting a molecular phylogeny of the hyper-diverse genus Brueelia

    Directory of Open Access Journals (Sweden)

    Sarah E. Bush

    2015-12-01

    Full Text Available Data is presented in support of a phylogenetic reconstruction of one of the largest, and most poorly understood, groups of lice: the Brueelia-complex (Bush et al., 2015 [1]. Presented data include the voucher information and molecular data (GenBank accession numbers of 333 ingroup taxa within the Brueelia-complex and 30 outgroup taxa selected from across the order Phthiraptera. Also included are phylogenetic reconstructions based on Bayesian inference analyses of combined COI and EF-1α sequences for Brueelia-complex species and outgroup taxa.

  15. PRO_LIGAND: an approach to de novo molecular design. 2. Design of novel molecules from molecular field analysis (MFA) models and pharmacophores.

    Science.gov (United States)

    Waszkowycz, B; Clark, D E; Frenkel, D; Li, J; Murray, C W; Robson, B; Westhead, D R

    1994-11-11

    A computational approach for molecular design, PRO_LIGAND, has been developed within the PROMETHEUS molecular design and simulation system in order to provide a unified framework for the de novo generation of diverse molecules which are either similar or complementary to a specified target. In this instance, the target is a pharmacophore derived from a series of active structures either by a novel interpretation of molecular field analysis data or by a pharmacophore-mapping procedure based on clique detection. After a brief introduction to PRO_LIGAND, a detailed description is given of the two pharmacophore generation procedures and their abilities are demonstrated by the elucidation of pharmacophores for steroid binding and ACE inhibition, respectively. As a further indication of its efficacy in aiding the rational drug design process, PRO_LIGAND is then employed to build novel organic molecules to satisfy the physicochemical constraints implied by the pharmacophores.

  16. Proteomic analysis reveals the diversity and complexity of membrane proteins in chickpea (Cicer arietinum L.

    Directory of Open Access Journals (Sweden)

    Jaiswal Dinesh Kumar

    2012-10-01

    Full Text Available Abstract Background Compartmentalization is a unique feature of eukaryotes that helps in maintaining cellular homeostasis not only in intra- and inter-organellar context, but also between the cells and the external environment. Plant cells are highly compartmentalized with a complex metabolic network governing various cellular events. The membranes are the most important constituents in such compartmentalization, and membrane-associated proteins play diverse roles in many cellular processes besides being part of integral component of many signaling cascades. Results To obtain valuable insight into the dynamic repertoire of membrane proteins, we have developed a proteome reference map of a grain legume, chickpea, using two-dimensional gel electrophoresis. MALDI-TOF/TOF and LC-ESI-MS/MS analysis led to the identification of 91 proteins involved in a variety of cellular functions viz., bioenergy, stress-responsive and signal transduction, metabolism, protein synthesis and degradation, among others. Significantly, 70% of the identified proteins are putative integral membrane proteins, possessing transmembrane domains. Conclusions The proteomic analysis revealed many resident integral membrane proteins as well as membrane-associated proteins including those not reported earlier. To our knowledge, this is the first report of membrane proteome from aerial tissues of a crop plant. The findings may provide a better understanding of the biochemical machinery of the plant membranes at the molecular level that might help in functional genomics studies of different developmental pathways and stress-responses.

  17. Molecular diversity of Pakistani mango (Mangifera indica L.) varieties based on microsatellite markers.

    Science.gov (United States)

    Nazish, T; Shabbir, G; Ali, A; Sami-Ul-Allah, S; Naeem, M; Javed, M; Batool, S; Arshad, H; Hussain, S B; Aslam, K; Seher, R; Tahir, M; Baber, M

    2017-04-05

    Understanding the genetic diversity of different Pakistani mango varieties is important for germplasm management and varietal characterization. Microsatellites are efficient and highly polymorphic markers for comparative genome mapping, and were used in the present study to determine the genetic relatedness and variability among 15 indigenous mango cultivars (Mangifera indica L.). Overall, 181 bands were produced using 12 simple sequence repeat (SSR) primers. Out of the 12 primers used, 10 were polymorphic and two were monomorphic. Genetic relatedness among cultivars was assessed by constructing a dendrogram using the unweighted pair group method of arithmetic means. The accessions exhibited coefficients of similarity ranging from 75 to 100%, indicating the frequent use of only a few parent cultivars and the presence of inbreeding. The primers used in the present study were found to be valuable for identifying genetic relationships among mango cultivars.

  18. Asymmetric Hardware Distortions in Receive Diversity Systems: Outage Performance Analysis

    KAUST Repository

    Javed, Sidrah; Amin, Osama; Ikki, Salama S.; Alouini, Mohamed-Slim

    2017-01-01

    This paper studies the impact of asymmetric hardware distortion (HWD) on the performance of receive diversity systems using linear and switched combining receivers. The asymmetric attribute of the proposed model motivates the employment of improper Gaussian signaling (IGS) scheme rather than the traditional proper Gaussian signaling (PGS) scheme. The achievable rate performance is analyzed for the ideal and non-ideal hardware scenarios using PGS and IGS transmission schemes for different combining receivers. In addition, the IGS statistical characteristics are optimized to maximize the achievable rate performance. Moreover, the outage probability performance of the receive diversity systems is analyzed yielding closed form expressions for both PGS and IGS based transmission schemes. HWD systems that employ IGS is proven to efficiently combat the self interference caused by the HWD. Furthermore, the obtained analytic expressions are validated through Monte-Carlo simulations. Eventually, non-ideal hardware transceivers degradation and IGS scheme acquired compensation are quantified through suitable numerical results.

  19. Asymmetric Hardware Distortions in Receive Diversity Systems: Outage Performance Analysis

    KAUST Repository

    Javed, Sidrah

    2017-02-22

    This paper studies the impact of asymmetric hardware distortion (HWD) on the performance of receive diversity systems using linear and switched combining receivers. The asymmetric attribute of the proposed model motivates the employment of improper Gaussian signaling (IGS) scheme rather than the traditional proper Gaussian signaling (PGS) scheme. The achievable rate performance is analyzed for the ideal and non-ideal hardware scenarios using PGS and IGS transmission schemes for different combining receivers. In addition, the IGS statistical characteristics are optimized to maximize the achievable rate performance. Moreover, the outage probability performance of the receive diversity systems is analyzed yielding closed form expressions for both PGS and IGS based transmission schemes. HWD systems that employ IGS is proven to efficiently combat the self interference caused by the HWD. Furthermore, the obtained analytic expressions are validated through Monte-Carlo simulations. Eventually, non-ideal hardware transceivers degradation and IGS scheme acquired compensation are quantified through suitable numerical results.

  20. Diversity and molecular phylogeny of mitochondrial DNA of rhesus macaques (Macaca mulatta) in Bangladesh.

    Science.gov (United States)

    Hasan, M Kamrul; Feeroz, M Mostafa; Jones-Engel, Lisa; Engel, Gregory A; Kanthaswamy, Sree; Smith, David Glenn

    2014-11-01

    While studies of rhesus macaques (Macaca mulatta) in the eastern (e.g., China) and western (e.g., India) parts of their geographic range have revealed major genetic differences that warrant the recognition of two different subspecies, little is known about genetic characteristics of rhesus macaques in the transitional zone extending from eastern India and Bangladesh through the northern part of Indo-China, the probable original homeland of the species. We analyzed genetic variation of 762 base pairs of mitochondrial DNA from 86 fecal swab samples and 19 blood samples from 25 local populations of rhesus macaque in Bangladesh collected from January 2010 to August 2012. These sequences were compared with those of rhesus macaques from India, China, and Myanmar. Forty-six haplotypes defined by 200 (26%) polymorphic nucleotide sites were detected. Estimates of gene diversity, expected heterozygosity, and nucleotide diversity for the total population were 0.9599 ± 0.0097, 0.0193 ± 0.0582, and 0.0196 ± 0.0098, respectively. A mismatch distribution of paired nucleotide differences yielded a statistically significantly negative value of Tajima's D, reflecting a population that rapidly expanded after the terminal Pleistocene. Most haplotypes throughout regions of Bangladesh, including an isolated region in the southwestern area (Sundarbans), clustered with haplotypes assigned to the minor haplogroup Ind-2 from India reflecting an east to west dispersal of rhesus macaques to India. Haplotypes from the southeast region of Bangladesh formed a cluster with those from Myanmar, and represent the oldest rhesus macaque haplotypes of Bangladesh. These results are consistent with the hypothesis that rhesus macaques first entered Bangladesh from the southeast, probably from Indo-China, then dispersed westward throughout eastern and central India. © 2014 Wiley Periodicals, Inc.

  1. Genetic diversity analysis of mustard ( Brassica spp.) germplasm ...

    African Journals Online (AJOL)

    Molecular characterization of 16 mustard (Brassica spp.) genotypes by using 12 RAPD markers revealed that three primers GLA-11, OPB-04 and OPD-02 showed good technical resolution and sufficient variations among different genotypes. A total of 40 RAPD bands were scored of which 38 (94.87%) polymorphic ...

  2. Analysis of genetic diversity in Eucalyptus grandis (Hill ex Maiden ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-07-04

    Jul 4, 2008 ... repeats (ISSR) molecular markers ... significant genetic variation between seed sources with 26.4%, (Gst = 0.264) of the total variation attributed to ... 20 μl consisting of 10 mM Tris-HCL pH 9.0, 50 mM KCl, 0.1% Triton. X-100 ...

  3. Place of Diversity in the Current Ethiopian Education and Training Policy: Analysis of Cardinal Dimensions

    Science.gov (United States)

    Sime, Tariku; Latchanna, Gara

    2016-01-01

    The purpose of this paper was to investigate to what extent the diversity dimensions are addressed in the current Education and Training Policy. To that end, document analysis was employed. The major diversity dimensions were analyzed based on their cardinal features. The study demonstrated that there is an ambitious need to address issues of…

  4. Molecular analysis of Ku redox regulation

    Directory of Open Access Journals (Sweden)

    Shatilla Andrea

    2009-08-01

    Full Text Available Abstract Background DNA double-strand breaks (DSBs can occur in response to ionizing radiation (IR, radiomimetic agents and from endogenous DNA-damaging reactive oxygen metabolites. Unrepaired or improperly repaired DSBs are potentially the most lethal form of DNA damage and can result in chromosomal translocations and contribute to the development of cancer. The principal mechanism for the repair of DSBs in humans is non-homologous end-joining (NHEJ. Ku is a key member of the NHEJ pathway and plays an important role in the recognition step when it binds to free DNA termini. Ku then stimulates the assembly and activation of other NHEJ components. DNA binding of Ku is regulated by redox conditions and evidence from our laboratory has demonstrated that Ku undergoes structural changes when oxidized that results in a reduction in DNA binding activity. The C-terminal domain and cysteine 493 of Ku80 were investigated for their contribution to redox regulation of Ku. Results We effectively removed the C-terminal domain of Ku80 generating a truncation mutant and co-expressed this variant with wild type Ku70 in an insect cell system to create a Ku70/80ΔC heterodimer. We also generated two single amino acid variants of Cys493, replacing this amino acid with either an alanine (C493A or a serine (C493S, and over-expressed the variant proteins in SF9 insect cells in complex with wild type Ku70. Neither the truncation nor the amino acid substitutions alters protein expression or stability as determined by SDS-PAGE and Western blot analysis. We show that the C493 mutations do not alter the ability of Ku to bind duplex DNA in vitro under reduced conditions while truncation of the Ku80 C-terminus slightly reduced DNA binding affinity. Diamide oxidation of cysteines was shown to inhibit DNA binding similarly for both the wild-type and all variant proteins. Interestingly, differential DNA binding activity following re-reduction was observed for the Ku70/80

  5. Analysis of the normal optical, Michel and molecular potentials on ...

    Indian Academy of Sciences (India)

    6. — journal of. June 2016 physics pp. 1275–1286. Analysis of the normal ... the levels are obtained for the three optical potentials to estimate the quality ... The experimental angular distribution data for the 40Ca(6Li, d)44Ti reaction .... analysed using the normal optical, Michel and molecular potentials within the framework.

  6. Molecular characterization and expression analysis of fat mass and ...

    Indian Academy of Sciences (India)

    Keywords. fat mass and obesity-associated gene (FTO); rabbit; mRNA expression patterns; sequence analysis; Oryctolagus cuniculus. ... In this work, the molecular characterization and expression features of rabbit (Oryctolagus cuniculus) FTO cDNA were analysed. The rabbit FTO cDNA with a size of 2158 bp was cloned, ...

  7. A Molecular Iodine Spectral Data Set for Rovibronic Analysis

    Science.gov (United States)

    Williamson, J. Charles; Kuntzleman, Thomas S.; Kafader, Rachael A.

    2013-01-01

    A data set of 7,381 molecular iodine vapor rovibronic transitions between the X and B electronic states has been prepared for an advanced undergraduate spectroscopic analysis project. Students apply standard theoretical techniques to these data and determine the values of three X-state constants (image omitted) and four B-state constants (image…

  8. Genetic diversity of pigeon pea (Cajanus cajan (l.) Millsp.) based on molecular characterization using randomly amplified polymorphic DNA (RAPD) markers

    Science.gov (United States)

    Khoiriyah, N.; Yuniastuti, E.; Purnomo, D.

    2018-03-01

    Pigeon pea (Cajanus cajan (L.) Millsp.) is an annual leguminous crop (perennial) which has advantages over other local leguminous crops as drought resistant, hold collapsed and strong pods. The research on drought resistance plant is very important to adapt to climate change adverse impact to support food security. The potential of pigeon pie has not been supported by accurate data. To explore the potential of pigeon pea, it is necessary to record the important properties by characterization, one of which is molecular. Increasing genetic diversity can be done through mutation which widely used gamma ray for the induction. The purpose of this study was to identify the genetic diversity of pigeon pea of black, white and brown seeds type resulted by gamma-ray irradiation with a wavelength of 100, 200 and 300 grays by using RAPD method. The experiment resulted 14 bands, 12 of them are polymorphic bands and 2 of them are monomorphic with size varied from 300 bp to 1.3 kbp. The dendrogram showed from 30 accessions are divided into two main clusters, B shows clear genetical divergence from other clusters and some others split randomly. The range of similarity coefficient is from 0.43 to 1.00

  9. Analysis of genetic diversity of Tunisian pistachio (Pistacia vera L.) using sequence-related amplified polymorphism (SRAP) markers.

    Science.gov (United States)

    Guenni, K; Aouadi, M; Chatti, K; Salhi-Hannachi, A

    2016-10-17

    Sequence-related amplified polymorphism (SRAP) markers preferentially amplify open reading frames and were used to study the genetic diversity of Tunisian pistachio. In the present study, 43 Pistacia vera accessions were screened using seven SRAP primer pairs. A total of 78 markers was revealed (95.12%) with an average polymorphic information content of 0.850. The results suggest that there is strong genetic differentiation, which characterizes the local resources (G ST = 0.307). High gene flow (N m = 1.127) among groups was explained by the exchange of plant material among regions. Analysis of molecular variance revealed significant differences within groups and showed that 73.88% of the total genetic diversity occurred within groups, whereas the remaining 26.12% occurred among groups. Bayesian clustering and principal component analysis identified three pools, El Guettar, Pollenizers, and the rest of the pistachios belonging to the Gabès, Kasserine, and Sfax localities. Bayesian analysis revealed that El Guettar and male genotypes were assigned with more than 80% probability. The BayeScan method proposed that locus 59 (F13-R9) could be used in the development of sex-linked SCAR markers from SRAP since it is a commonly detected locus in comparisons involving the Pollenizers group. This is the first application of SRAP markers for the assessment of genetic diversity in Tunisian germplasm of P. vera. Such information will be useful to define conservation strategies and improvement programs for this species.

  10. Genetic diversity and structure analysis in wild and landraces of barley from Jordan by using ISJ markers

    International Nuclear Information System (INIS)

    Baloch, A. W.; Balogh, M. J.; Baloch, M.; Baloch, I. A.

    2016-01-01

    The present experiment was carried out to estimate genetic diversity and genetic structure in cultivated and wild barley populations collected from Jordan which is considered as primary gene pool of barley. In a total, 94 cultivated barley accessions composed of 4 populations and 52 wild barley accessions consisted of 3 populations were used for genetic analysis using 7 Intron Splice Junction (ISJ) markers. The genetic diversity index (He) of cultivated barley ranged between 0.049 and 0.060; whereas that of wild barley populations ranged between 0.084 and 0.146, suggesting that wild resources of barley harbored greater genetic diversity than its domesticated counterpart, reflecting that barley domestication occurred with genetic bottleneck. Analysis of molecular variance showed high genetic variations among rather than within populations, referring that high genetic differentiation of barley populations caused by genetic and geographical separation of the populations in the harsh growing conditions of Fertile Crescent. Principal coordinate, clustering and structure analysis not only separated cultivated and wild barley, but also each single population, showing their genetic basis and original sample site. The obtained Results also revealed that there is lesser genetic communication between cultivated and wild barley under natural environments. The current findings can better be exploited for collection and utilization of plant germplasms. (author)

  11. Molecular Characterization of Human Atypical Sorbitol-Fermenting Enteropathogenic Escherichia coli O157 Reveals High Diversity.

    Science.gov (United States)

    Kossow, Annelene; Zhang, Wenlan; Bielaszewska, Martina; Rhode, Sophie; Hansen, Kevin; Fruth, Angelika; Rüter, Christian; Karch, Helge; Mellmann, Alexander

    2016-05-01

    Alongside the well-characterized enterohemorrhagic Escherichia coli (EHEC) O157:H7, serogroup O157 comprises sorbitol-fermenting typical and atypical enteropathogenic E. coli (EPEC/aEPEC) strains that carry the intimin-encoding gene eae but not Shiga toxin-encoding genes (stx). Since little is known about these pathogens, we characterized 30 clinical isolates from patients with hemolytic uremic syndrome (HUS) or uncomplicated diarrhea with respect to their flagellin gene (fliC) type and multilocus sequence type (MLST). Moreover, we applied whole-genome sequencing (WGS) to determine the phylogenetic relationship with other eae-positive EHEC serotypes and the composition of the rfbO157 region. fliC typing resulted in five fliC types (H7, H16, H34, H39, and H45). Isolates of each fliC type shared a unique ST. In comparison to the 42 HUS-associated E. coli (HUSEC) strains, only the stx-negative isolates with fliCH7 shared their ST with EHEC O157:H7/H(-) strains. With the exception of one O157:H(-) fliCH16 isolate, HUS was exclusively associated with fliCH7. WGS corroborated the separation of the fliCH7 isolates, which were closely related to the EHEC O157:H7/H(-) isolates, and the diverse group of isolates exhibiting different fliC types, indicating independent evolution of the different serotypes. This was also supported by the heterogeneity within the rfbO157 region that exhibited extensive recombinations. The genotypic subtypes and distribution of clinical symptoms suggested that the stx-negative O157 strains with fliCH7 were originally EHEC strains that lost stx The remaining isolates form a distinct and diverse group of atypical EPEC isolates that do not possess the full spectrum of virulence genes, underlining the importance of identifying the H antigen for clinical risk assessment. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. Conformational analysis of oligosaccharides and polysaccharides using molecular dynamics simulations.

    Science.gov (United States)

    Frank, Martin

    2015-01-01

    Complex carbohydrates usually have a large number of rotatable bonds and consequently a large number of theoretically possible conformations can be generated (combinatorial explosion). The application of systematic search methods for conformational analysis of carbohydrates is therefore limited to disaccharides and trisaccharides in a routine analysis. An alternative approach is to use Monte-Carlo methods or (high-temperature) molecular dynamics (MD) simulations to explore the conformational space of complex carbohydrates. This chapter describes how to use MD simulation data to perform a conformational analysis (conformational maps, hydrogen bonds) of oligosaccharides and how to build realistic 3D structures of large polysaccharides using Conformational Analysis Tools (CAT).

  13. Molecular phylogenetics and character evolution of morphologically diverse groups, Dendrobium section Dendrobium and allies

    Science.gov (United States)

    Takamiya, Tomoko; Wongsawad, Pheravut; Sathapattayanon, Apirada; Tajima, Natsuko; Suzuki, Shunichiro; Kitamura, Saki; Shioda, Nao; Handa, Takashi; Kitanaka, Susumu; Iijima, Hiroshi; Yukawa, Tomohisa

    2014-01-01

    It is always difficult to construct coherent classification systems for plant lineages having diverse morphological characters. The genus Dendrobium, one of the largest genera in the Orchidaceae, includes ∼1100 species, and enormous morphological diversification has hindered the establishment of consistent classification systems covering all major groups of this genus. Given the particular importance of species in Dendrobium section Dendrobium and allied groups as floriculture and crude drug genetic resources, there is an urgent need to establish a stable classification system. To clarify phylogenetic relationships in Dendrobium section Dendrobium and allied groups, we analysed the macromolecular characters of the group. Phylogenetic analyses of 210 taxa of Dendrobium were conducted on DNA sequences of internal transcribed spacer (ITS) regions of 18S–26S nuclear ribosomal DNA and the maturase-coding gene (matK) located in an intron of the plastid gene trnK using maximum parsimony and Bayesian methods. The parsimony and Bayesian analyses revealed 13 distinct clades in the group comprising section Dendrobium and its allied groups. Results also showed paraphyly or polyphyly of sections Amblyanthus, Aporum, Breviflores, Calcarifera, Crumenata, Dendrobium, Densiflora, Distichophyllae, Dolichocentrum, Holochrysa, Oxyglossum and Pedilonum. On the other hand, the monophyly of section Stachyobium was well supported. It was found that many of the morphological characters that have been believed to reflect phylogenetic relationships are, in fact, the result of convergence. As such, many of the sections that have been recognized up to this point were found to not be monophyletic, so recircumscription of sections is required. PMID:25107672

  14. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms.

    Science.gov (United States)

    Kumar, Sudhir; Stecher, Glen; Li, Michael; Knyaz, Christina; Tamura, Koichiro

    2018-06-01

    The Molecular Evolutionary Genetics Analysis (Mega) software implements many analytical methods and tools for phylogenomics and phylomedicine. Here, we report a transformation of Mega to enable cross-platform use on Microsoft Windows and Linux operating systems. Mega X does not require virtualization or emulation software and provides a uniform user experience across platforms. Mega X has additionally been upgraded to use multiple computing cores for many molecular evolutionary analyses. Mega X is available in two interfaces (graphical and command line) and can be downloaded from www.megasoftware.net free of charge.

  15. Molecular characterization of Verocytotoxigenic Escherichia coli O157:H7 isolates from Argentina by Multiple-Loci VNTR Analysis (MLVA)

    Science.gov (United States)

    Bustamante, Ana V.; Lucchesi, Paula M.A.; Parma, Alberto E.

    2009-01-01

    The aim of this work was to adapt described MLVA protocols to the molecular typing and characterization of VTEC O157:H7 isolates from Argentina. Nine VNTR loci were amplified by PCR showing diversity values from 0.49 to 0.73. Nine MLVA profiles were observed and the cluster analysis indicated both unrelated and closely related VTEC O157:H7 strains. In spite of the limited number of isolates studied, the panel of VNTR used made it possible to perform a first approach of the high genetic diversity of native strains of O157:H7 by MLVA. PMID:24031443

  16. Analysis of iris surface features in populations of diverse ancestry

    Science.gov (United States)

    Edwards, Melissa; Cha, David; Krithika, S.; Johnson, Monique; Parra, Esteban J.

    2016-01-01

    There are many textural elements that can be found in the human eye, including Fuchs’ crypts, Wolfflin nodules, pigment spots, contraction furrows and conjunctival melanosis. Although iris surface features have been well-studied in populations of European ancestry, the worldwide distribution of these traits is poorly understood. In this paper, we develop a new method of characterizing iris features from photographs of the iris. We then apply this method to a diverse sample of East Asian, European and South Asian ancestry. All five iris features showed significant differences in frequency between the three populations, indicating that iris features are largely population dependent. Although none of the features were correlated with each other in the East and South Asian groups, Fuchs’ crypts were significantly correlated with contraction furrows and pigment spots and contraction furrows were significantly associated with pigment spots in the European group. The genetic marker SEMA3A rs10235789 was significantly associated with Fuchs’ crypt grade in the European, East Asian and South Asian samples and a borderline association between TRAF3IP1 rs3739070 and contraction furrow grade was found in the European sample. The study of iris surface features in diverse populations may provide valuable information of forensic, biomedical and ophthalmological interest. PMID:26909168

  17. Genome-wide analysis of gene expression in primate taste buds reveals links to diverse processes.

    Directory of Open Access Journals (Sweden)

    Peter Hevezi

    Full Text Available Efforts to unravel the mechanisms underlying taste sensation (gustation have largely focused on rodents. Here we present the first comprehensive characterization of gene expression in primate taste buds. Our findings reveal unique new insights into the biology of taste buds. We generated a taste bud gene expression database using laser capture microdissection (LCM procured fungiform (FG and circumvallate (CV taste buds from primates. We also used LCM to collect the top and bottom portions of CV taste buds. Affymetrix genome wide arrays were used to analyze gene expression in all samples. Known taste receptors are preferentially expressed in the top portion of taste buds. Genes associated with the cell cycle and stem cells are preferentially expressed in the bottom portion of taste buds, suggesting that precursor cells are located there. Several chemokines including CXCL14 and CXCL8 are among the highest expressed genes in taste buds, indicating that immune system related processes are active in taste buds. Several genes expressed specifically in endocrine glands including growth hormone releasing hormone and its receptor are also strongly expressed in taste buds, suggesting a link between metabolism and taste. Cell type-specific expression of transcription factors and signaling molecules involved in cell fate, including KIT, reveals the taste bud as an active site of cell regeneration, differentiation, and development. IKBKAP, a gene mutated in familial dysautonomia, a disease that results in loss of taste buds, is expressed in taste cells that communicate with afferent nerve fibers via synaptic transmission. This database highlights the power of LCM coupled with transcriptional profiling to dissect the molecular composition of normal tissues, represents the most comprehensive molecular analysis of primate taste buds to date, and provides a foundation for further studies in diverse aspects of taste biology.

  18. Molecular Epidemiology of P. vivax in Iran: High Diversity and Complex Sub-Structure Using Neutral Markers, but No Evidence of Y976F Mutation at pvmdr1.

    Science.gov (United States)

    Hamedi, Yaghoob; Sharifi-Sarasiabi, Khojasteh; Dehghan, Farzaneh; Safari, Reza; To, Sheren; Handayuni, Irene; Trimarsanto, Hidayat; Price, Ric N; Auburn, Sarah

    2016-01-01

    Malaria remains endemic at low levels in the south-eastern provinces of Iran bordering Afghanistan and Pakistan, with the majority of cases attributable to P. vivax. The national guidelines recommend chloroquine (CQ) as blood-stage treatment for uncomplicated P. vivax, but the large influx of imported cases enhances the risk of introducing CQ resistance (CQR). The genetic diversity at pvmdr1, a putative modulator of CQR, and across nine putatively neutral short tandem repeat (STR) markers were assessed in P. vivax clinical isolates collected between April 2007 and January 2013 in Hormozgan Province, south-eastern Iran. One hundred blood samples were collected from patients with microscopy-confirmed P. vivax enrolled at one of five district clinics. In total 73 (73%) were autochthonous cases, 23 (23%) imported cases from Afghanistan or Pakistan, and 4 (4%) with unknown origin. 97% (97/100) isolates carried the F1076L mutation, but none carried the Y976F mutation. STR genotyping was successful in 71 (71%) isolates, including 57(57%) autochthonous and 11 (11%) imported cases. Analysis of population structure revealed 2 major sub-populations, K1 and K2, with further sub-structure within K2. The K1 sub-population had markedly lower diversity than K2 (HE = 0.06 vs HE = 0.82) suggesting that the sub-populations were sustained by distinct reservoirs with differing transmission dynamics, possibly reflecting local versus imported/introduced populations. No notable separation was observed between the local and imported cases although the sample size was limited. The contrasting low versus high diversity in the two sub-populations (K1 and K2) infers that a combination of local transmission and cross-border malaria from higher transmission regions shape the genetic make-up of the P. vivax population in south-eastern Iran. There was no molecular evidence of CQR amongst the local or imported cases, but ongoing clinical surveillance is warranted.

  19. Optical properties and molecular diversity of dissolved organic matter in the Bering Strait and Chukchi Sea

    Science.gov (United States)

    Gonsior, Michael; Luek, Jenna; Schmitt-Kopplin, Philippe; Grebmeier, Jacqueline M.; Cooper, Lee W.

    2017-10-01

    Changes in the molecular composition of dissolved organic matter (DOM) and its light absorbing chromophoric component (CDOM) are of particular interest in the Arctic region because of climate change effects that lead to warmer sea surface temperatures and longer exposure to sunlight. We used continuous UV-vis (UV-vis) spectroscopy, excitation emission matrix fluorescence and ultrahigh resolution mass spectrometry during a transect from the Aleutian Islands in the Bering Sea to the Chukchi Sea ice edge through Bering Strait to determine the variability of DOM and CDOM. These data were combined with discrete sampling for stable oxygen isotopes of seawater, in order to evaluate the contributions of melted sea ice versus runoff to the DOM and CDOM components. This study demonstrated that high geographical resolution of optical properties in conjunction with stable oxygen ratios and non-targeted ultrahigh resolution mass spectrometry was able to distinguish between different DOM sources in the Arctic, including identification of labile DOM sources in Bering Strait associated with high algal blooms and sampling locations influenced by terrestrially-derived DOM, such as the terrestrial DOM signal originating from Arctic rivers and dirty/anchor sea ice. Results of this study also revealed the overall variability and chemodiversity of Arctic DOM present in the Bering and Chukchi Seas.

  20. Molecular exploration of hidden diversity in the Indo-West Pacific sciaenid clade.

    Science.gov (United States)

    Lo, Pei-Chun; Liu, Shu-Hui; Nor, Siti Azizah Mohd; Chen, Wei-Jen

    2017-01-01

    The family Sciaenidae, known as croakers or drums, is one of the largest perciform fish families. A recent multi-gene based study investigating the phylogeny and biogeography of global sciaenids revealed that the origin and early diversification of this family occurred in tropical America during the Late Oligocene-Early Miocene before undergoing range expansions to other seas including the Indo-West Pacific, where high species richness is observed. Despite this clarification of the overall evolutionary history of the family, knowledge of the taxonomy and phylogeny of sciaenid genera endemic to the Indo-West Pacific is still limited due to lack of a thorough survey of all taxa. In this study, we used DNA-based approaches to investigate the evolutionary relationships, to explore the species diversity, and to elucidate the taxonomic status of sciaenid species/genera within the Indo-West Pacific clade. Three datasets were herein built for the above objectives: the combined dataset (248 samples from 45 currently recognized species) from one nuclear gene (RAG1) and one mitochondrial gene (COI); the dataset with only RAG1 gene sequences (245 samples from 44 currently recognized species); and the dataset with only COI gene sequences (308 samples from 51 currently recognized species). The latter was primarily used for our biodiversity exploration with two different species delimitation methods (Automatic Barcode Gap Discovery, ABGD and Generalized Mixed Yule Coalescent, GMYC). The results were further evaluated with help of four supplementary criteria for species delimitation (genetic similarity, monophyly inferred from individual gene and combined data trees, geographic distribution, and morphology). Our final results confirmed the validity of 32 currently recognized species and identified several potential new species waiting for formal descriptions. We also reexamined the taxonomic status of the genera, Larimichthys, Nibea, Protonibea and Megalonibea, and suggested a

  1. Molecular exploration of hidden diversity in the Indo-West Pacific sciaenid clade.

    Directory of Open Access Journals (Sweden)

    Pei-Chun Lo

    Full Text Available The family Sciaenidae, known as croakers or drums, is one of the largest perciform fish families. A recent multi-gene based study investigating the phylogeny and biogeography of global sciaenids revealed that the origin and early diversification of this family occurred in tropical America during the Late Oligocene-Early Miocene before undergoing range expansions to other seas including the Indo-West Pacific, where high species richness is observed. Despite this clarification of the overall evolutionary history of the family, knowledge of the taxonomy and phylogeny of sciaenid genera endemic to the Indo-West Pacific is still limited due to lack of a thorough survey of all taxa. In this study, we used DNA-based approaches to investigate the evolutionary relationships, to explore the species diversity, and to elucidate the taxonomic status of sciaenid species/genera within the Indo-West Pacific clade. Three datasets were herein built for the above objectives: the combined dataset (248 samples from 45 currently recognized species from one nuclear gene (RAG1 and one mitochondrial gene (COI; the dataset with only RAG1 gene sequences (245 samples from 44 currently recognized species; and the dataset with only COI gene sequences (308 samples from 51 currently recognized species. The latter was primarily used for our biodiversity exploration with two different species delimitation methods (Automatic Barcode Gap Discovery, ABGD and Generalized Mixed Yule Coalescent, GMYC. The results were further evaluated with help of four supplementary criteria for species delimitation (genetic similarity, monophyly inferred from individual gene and combined data trees, geographic distribution, and morphology. Our final results confirmed the validity of 32 currently recognized species and identified several potential new species waiting for formal descriptions. We also reexamined the taxonomic status of the genera, Larimichthys, Nibea, Protonibea and Megalonibea, and

  2. Analysis of a comprehensive dataset of diversity generating retroelements generated by the program DiGReF

    Directory of Open Access Journals (Sweden)

    Schillinger Thomas

    2012-08-01

    Full Text Available Abstract Background Diversity Generating Retroelements (DGRs are genetic cassettes that can introduce tremendous diversity into a short, defined region of the genome. They achieve hypermutation through replacement of the variable region with a strongly mutated cDNA copy generated by the element-encoded reverse transcriptase. In contrast to “selfish” retroelements such as group II introns and retrotransposons, DGRs impart an advantage to their host by increasing its adaptive potential. DGRs were discovered in a bacteriophage, but since then additional examples have been identified in some bacterial genomes. Results Here we present the program DiGReF that allowed us to comprehensively screen available databases for DGRs. We identified 155 DGRs which are found in all major classes of bacteria, though exhibiting sporadic distribution across species. Phylogenetic analysis and sequence comparison showed that DGRs move between genomes by associating with various mobile elements such as phages, transposons and plasmids. The DGR cassettes exhibit high flexibility in the arrangement of their components and easily acquire additional paralogous target genes. Surprisingly, the genomic data alone provide new insights into the molecular mechanism of DGRs. Most notably, our data suggest that the template RNA is transcribed separately from the rest of the element. Conclusions DiGReF is a valuable tool to detect DGRs in genome data. Its output allows comprehensive analysis of various aspects of DGR biology, thus deepening our understanding of the role DGRs play in prokaryotic genome plasticity, from the global down to the molecular level.

  3. Prokaryotic diversity, composition structure, and phylogenetic analysis of microbial communities in leachate sediment ecosystems.

    Science.gov (United States)

    Liu, Jingjing; Wu, Weixiang; Chen, Chongjun; Sun, Faqian; Chen, Yingxu

    2011-09-01

    In order to obtain insight into the prokaryotic diversity and community in leachate sediment, a culture-independent DNA-based molecular phylogenetic approach was performed with archaeal and bacterial 16S rRNA gene clone libraries derived from leachate sediment of an aged landfill. A total of 59 archaeal and 283 bacterial rDNA phylotypes were identified in 425 archaeal and 375 bacterial analyzed clones. All archaeal clones distributed within two archaeal phyla of the Euryarchaeota and Crenarchaeota, and well-defined methanogen lineages, especially Methanosaeta spp., are the most numerically dominant species of the archaeal community. Phylogenetic analysis of the bacterial library revealed a variety of pollutant-degrading and biotransforming microorganisms, including 18 distinct phyla. A substantial fraction of bacterial clones showed low levels of similarity with any previously documented sequences and thus might be taxonomically new. Chemical characteristics and phylogenetic inferences indicated that (1) ammonium-utilizing bacteria might form consortia to alleviate or avoid the negative influence of high ammonium concentration on other microorganisms, and (2) members of the Crenarchaeota found in the sediment might be involved in ammonium oxidation. This study is the first to report the composition of the microbial assemblages and phylogenetic characteristics of prokaryotic populations extant in leachate sediment. Additional work on microbial activity and contaminant biodegradation remains to be explored.

  4. Analysis of the Bacterial Diversity in Liver Abscess: Differences between Pyogenic and Amebic Abscesses

    Science.gov (United States)

    Reyna-Fabián, Miriam E.; Zermeño, Valeria; Ximénez, Cecilia; Flores, Janin; Romero, Miguel F.; Diaz, Daniel; Argueta, Jesús; Moran, Patricia; Valadez, Alicia; Cerritos, René

    2016-01-01

    Several recent studies have demonstrated that virulence in Entamoeba histolytica is triggered in the presence of both pathogenic and nonpathogenic bacteria species using in vitro and in vivo experimental animal models. In this study, we examined samples aspirated from abscess material obtained from patients who were clinically diagnosed with amebic liver abscess (ALA) or pyogenic liver abscess (PLA). To determine the diversity of bacterial species in the abscesses, we performed partial 16S rRNA gene sequencing. In addition, the E. histolytica and Entamoeba dispar species were genotyped using tRNA-linked short tandem repeats as specific molecular markers. The association between clinical data and bacterial and parasite genotypes were examined through a correspondence analysis. The results showed the presence of numerous bacterial groups. These taxonomic groups constitute common members of the gut microbiota, although all of the detected bacterial species have a close phylogenetic relationship with bacterial pathogens. Furthermore, some patients clinically diagnosed with PLA and ALA were coinfected with E. dispar or E. histolytica, which suggests that the virulence of these parasites increased in the presence of bacteria. However, no specific bacterial groups were associated with this effect. Together, our results suggest a nonspecific mechanism of virulence modulation by bacteria in Entamoeba. PMID:26572872

  5. Characterization of Unexplored Deadwood Mycobiome in Highly Diverse Subtropical Forests Using Culture-independent Molecular Technique.

    Science.gov (United States)

    Purahong, Witoon; Pietsch, Katherina A; Lentendu, Guillaume; Schöps, Ricardo; Bruelheide, Helge; Wirth, Christian; Buscot, François; Wubet, Tesfaye

    2017-01-01

    The deadwood mycobiome, also known as wood-inhabiting fungi (WIF), are among the key players in wood decomposition, having a large impact on nutrient cycling in forest soils. However, our knowledge of WIF richness and distribution patterns in different forest biomes is limited. Here, we used pyrotag sequencing of the fungal internal transcribed spacer (ITS2) region to characterize the deadwood mycobiome of two tree species with greatly different wood characteristics ( Schima superba and Pinus massoniana ) in a Chinese subtropical forest ecosystem. Specifically, we tested (i) the effects of tree species and wood quality properties on WIF OTU richness and community composition; (ii) the role of biotic and abiotic factors in shaping the WIF communities; and (iii) the relationship between WIF OTU richness, community composition and decomposition rates. Due to different wood chemical properties, we hypothesized that the WIF communities derived from the two tree species would be correlated differently with biotic and abiotic factors. Our results show that deadwood in subtropical forests harbors diverse fungal communities comprising six ecological functional groups. We found interesting colonization patterns for this subtropical biome, where Resinicium spp. were highly detected in both broadleaved and coniferous deadwood. In addition, the members of Xylariales were frequently found in Schima . The two deadwood species differed significantly in WIF OTU richness ( Pinus > Schima ) and community composition ( P < 0.001). Variations in WIF community composition of both tree species were significantly explained by wood pH and ecological factors (biotic: deadwood species, basal area and abiotic: soil pH), but the WIF communities derived from each tree species correlated differently with abiotic factors. Interestingly, we found that deadwood decomposition rate significantly correlated with WIF communities and negatively correlated with WIF OTU richness. We conclude that the

  6. Assessment of sorghum genetic resources for genetic diversity and drought tolerance using molecular markers and agro-morphological traits

    Energy Technology Data Exchange (ETDEWEB)

    Abu Assar, A H; Salih, M; Ali, A M [Agricultural Research Corporation (ARC), P.O. Box 126 Wad Medani (Sudan); Uptmoor, R [Institute of Vegetable and Fruit Science, University of Hannover, Herrengauser Strabe 2.30419 Hanover (Greece); Abdelmula, A A [Department of Agronomy, Faculty of Agriculture, University of Khartoum, postal code: 13314 Shambat (Sudan); Ordon, F [Institute of Eqidemiology and Resistance, Federal Centre for Breeding Research on Cultivated Plants, Theodor-Roemer-Weg 4, D-06449 Aschersleben (Greece); Wagner, C; Friedt, W [Institute of Crop Science and Plant Breedin 1, Heinrich-Buff-Ring 26-32, D-35392 Giessen (Greece)

    2009-07-01

    Forty sorghum genotype were investigated for genetic diversity and drought tolerance. Diversity parameters were estimated using 16 simple sequence repeats markers. For assessment of drought tolerance, the genotype were field evaluated under normal and drought stress condition for two seasons in three environments, in Sudan. In total, 98 SSRs alleles were detected with an average of 6.1 alleles per locus. The estimated polymorphic information contents ranged from 0.33 to 0.86. The genetic similarity ranged from 0.00 to 0.88 with a low mean of 0.32. The dendrogram, generated from the UPGMA cluster analysis, showed two main clusters differentiated into nine sub-clusters with close relationship to morphological characters and pedigree information. Mantel statistics revealed a good fit of the cophenetic values to the original data set (r= 0.88). The overall mean genetic diversity was 0.67. Significant differences were detected among genotypes under both normal and drought stressed conditions for all measured traits. Based on the relative yield, the most drought-tolerant genotypes were Arfa Gadamak, Wad Ahmed, El-Najada, Korcola, ICSR 92003 And Sham Sham. Drought five days delay in flowering, and the earliest genotypes were PI 569695, PI 570446, PI 569953, Dwarf White Milo and PI 56995. (Author)

  7. Assessment of sorghum genetic resources for genetic diversity and drought tolerance using molecular markers and agro-morphological traits

    International Nuclear Information System (INIS)

    Abu Assar, A. H.; Salih, M.; Ali, A. M.; Uptmoor, R.; Abdelmula, A. A.; Ordon, F.; Wagner, C.; Friedt, W.

    2009-01-01

    Forty sorghum genotype were investigated for genetic diversity and drought tolerance. Diversity parameters were estimated using 16 simple sequence repeats markers. For assessment of drought tolerance, the genotype were field evaluated under normal and drought stress condition for two seasons in three environments, in Sudan. In total, 98 SSRs alleles were detected with an average of 6.1 alleles per locus. The estimated polymorphic information contents ranged from 0.33 to 0.86. The genetic similarity ranged from 0.00 to 0.88 with a low mean of 0.32. The dendrogram, generated from the UPGMA cluster analysis, showed two main clusters differentiated into nine sub-clusters with close relationship to morphological characters and pedigree information. Mantel statistics revealed a good fit of the cophenetic values to the original data set (r= 0.88). The overall mean genetic diversity was 0.67. Significant differences were detected among genotypes under both normal and drought stressed conditions for all measured traits. Based on the relative yield, the most drought-tolerant genotypes were Arfa Gadamak, Wad Ahmed, El-Najada, Korcola, ICSR 92003 And Sham Sham. Drought five days delay in flowering, and the earliest genotypes were PI 569695, PI 570446, PI 569953, Dwarf White Milo and PI 56995. (Author)

  8. Molecular Diversity of Rabies Viruses Associated with Bats in Mexico and Other Countries of the Americas

    OpenAIRE

    Velasco-Villa, Andrés; Orciari, Lillian A.; Juárez-Islas, Víctor; Gómez-Sierra, Mauricio; Padilla-Medina, Irma; Flisser, Ana; Souza, Valeria; Castillo, Amanda; Franka, Richard; Escalante-Mañe, Maribel; Sauri-González, Isaias; Rupprecht, Charles E.

    2006-01-01

    Bat rabies and its transmission to humans and other species in Mexico were investigated. Eighty-nine samples obtained from rabid livestock, cats, dogs, and humans in Mexico were studied by antigenic typing and partial sequence analysis. Samples were further compared with enzootic rabies associated with different species of bats in the Americas. Patterns of nucleotide variation allowed the definition of at least 20 monophyletic clusters associated with 9 or more different bat species. Several ...

  9. Evaluation of Genetic Diversity in Collection from Iranian Jujube Ecotypes (Ziziphus spp. using ISSR-molecular Marker

    Directory of Open Access Journals (Sweden)

    hajar shayesteh

    2018-02-01

    Full Text Available Introduction Jujube (Zizyphus jujuba Mill. as a valuable medicinal plant and adapted to different climatic conditions is widespread in many parts of Iran. Nowadays, beside the export of its fruit, jujube is also used as an herbal medicine to treat the diseases, so it has a high economic value. Study on genetic diversity is the first step to identify and preservation of germplasm. It is also considered as the basic principles of plant breeding. DNA markers seem to be the best way in determination of the genetic diversity. Inter simple sequence repeats (ISSR markers are highly polymorphic and combine most benefits of Simple Sequence Repeats (SSRs and amplified fragment length polymorphism (AFLP to the generality of random amplified polymorphic DNA (RAPD. Materials and Methods In order to study of the genetic diversity among 31 ecotypes collected from eight Jujube-rich provinces, including South Khorasan, Razavi Khorasan, Mazandaran, Golestan, Qom, Isfahan, Lorestan and Fars. Genomic DNA was extracted by CTAB method and polymerase chain reaction (PCR was performed with 13 ISSR primers in which six most efficient primers were selected. Cluster analysis based on Dice similarity coefficient and Unweighed Pair Group Method with Arithmetic Mean (UPGMA was carried out and POPGENe.3.2 software was used to determine the similarity of populations with each other. Results and Discussion 84 loci were amplified and 70 of them (83% revealed a proper polymorphism with the size between 200 and 2000 base pair. The average number of amplified and polymorphic bands per primer was 14 and 11.6 respectively. Primers with di-nucleotide repeats produced more polymorphic bands than ones with tri-nucleotide repeats. It seems that this is due to a higher frequency of sequences containing di-nucleotide repeats in intergenic regions and higher possibility of mutation revealed in more diversity in comparison to gene coding regions. Anchored primers with 1 or 2 nucleotides at

  10. Diversity analysis of Ethiopian mustard breeding lines using RAPD ...

    African Journals Online (AJOL)

    Using cluster analysis based on unweighted pair-group method with arithmetic average (UPGMA) and principal coordinate analysis (PCoA), the 21 Ethiopian inbred lines were grouped into three subgroups and the single genotype introduced from Sweden formed a separate group. The clustering pattern failed to show a ...

  11. Genetic relationship and diversity analysis of Clitoria ternatea ...

    African Journals Online (AJOL)

    use

    2011-12-12

    Dec 12, 2011 ... analysis, cluster analysis of 1-0 bivariate data was carried out; 100 random primers revealed a total of ... white at the base. Its flowering is from August to October. The objectives of this study were to identify the poly- morphism amongst the C. ternatea ... shape, colour, fruit, flower shape, colour, size etc.

  12. TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics

    Directory of Open Access Journals (Sweden)

    von Haeseler Arndt

    2004-06-01

    Full Text Available Abstract Background Most analysis programs for inferring molecular phylogenies are difficult to use, in particular for researchers with little programming experience. Results TREEFINDER is an easy-to-use integrative platform-independent analysis environment for molecular phylogenetics. In this paper the main features of TREEFINDER (version of April 2004 are described. TREEFINDER is written in ANSI C and Java and implements powerful statistical approaches for inferring gene tree and related analyzes. In addition, it provides a user-friendly graphical interface and a phylogenetic programming language. Conclusions TREEFINDER is a versatile framework for analyzing phylogenetic data across different platforms that is suited both for exploratory as well as advanced studies.

  13. Molecular prevalence and genetic diversity of bovine Theileria orientalis in Myanmar.

    Science.gov (United States)

    Bawm, Saw; Shimizu, Kohei; Hirota, Jun-Ichi; Tosa, Yusuke; Htun, Lat Lat; Maw, Ni Ni; Thein, Myint; Kato, Hirotomo; Sakurai, Tatsuya; Katakura, Ken

    2014-08-01

    Theileria orientalis is a causative agent of benign theileriosis in cattle and distributed in mainly Asian countries. In the present study, we examined the prevalence of T. orientalis infection by PCR based on the major piroplasm surface protein gene (MPSP) sequences in cattle in Myanmar, followed by phylogenetic analysis of the MPSP genes. The MPSP gene was amplified in 258 of 713 (36.2%) cattle blood DNA samples collected from five cities in different geographical regions of Myanmar. Phylogenetic analysis of MPSP sequences from 54 T. orientalis-positive DNA samples revealed the presence of six allelic genotypes, including Types 1, 3, 4, 5, 7, and N-3. Types 5 and 7 were the predominant types detected. Sequences of the MPSP genes detected in Myanmar were closely related to those from Thailand, Vietnam or Mongolia. These findings suggest that movement of animals carrying T. orientalis parasites between Southeast Asian countries could be a reason for the similar genotype distribution of the parasites in Myanmar. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  14. Comparative analysis of microsatellites in five different antagonistic Trichoderma species for diversity assessment.

    Science.gov (United States)

    Rai, Shalini; Kashyap, Prem Lal; Kumar, Sudheer; Srivastava, Alok Kumar; Ramteke, Pramod W

    2016-01-01

    Microsatellites provide an ideal molecular markers system to screen, characterize and evaluate genetic diversity of several fungal species. Currently, there is very limited information on the genetic diversity of antagonistic Trichoderma species as determined using a range of molecular markers. In this study, expressed and whole genome sequences available in public database were used to investigate the occurrence, relative abundance and relative density of SSRs in five different antagonistic Trichoderma species: Trichoderma atroviride, T. harzianum, T. reesei, T. virens and T. asperellum. Fifteen SSRs loci were used to evaluate genetic diversity of twenty isolates of Trichoderma spp. from different geographical regions of India. Results indicated that relative abundance and relative density of SSRs were higher in T. asperellum followed by T. reesei and T. atroviride. Tri-nucleotide repeats (80.2%) were invariably the most abundant in all species. The abundance and relative density of SSRs were not influenced by the genome sizes and GC content. Out of eighteen primer sets, only 15 primer pairs showed successful amplification in all the test species. A total of 24 alleles were detected and five loci were highly informative with polymorphism information content values greater than 0.40, these markers provide useful information on genetic diversity and population genetic structure, which, in turn, can exploit for establishing conservation strategy for antagonistic Trichoderma isolates.

  15. Accommodating error analysis in comparison and clustering of molecular fingerprints.

    OpenAIRE

    Salamon, H.; Segal, M. R.; Ponce de Leon, A.; Small, P. M.

    1998-01-01

    Molecular epidemiologic studies of infectious diseases rely on pathogen genotype comparisons, which usually yield patterns comprising sets of DNA fragments (DNA fingerprints). We use a highly developed genotyping system, IS6110-based restriction fragment length polymorphism analysis of Mycobacterium tuberculosis, to develop a computational method that automates comparison of large numbers of fingerprints. Because error in fragment length measurements is proportional to fragment length and is ...

  16. Genetic Diversity Studies Based on Morphological Variability, Pathogenicity and Molecular Phylogeny of the Sclerotinia sclerotiorum Population From Indian Mustard (Brassica juncea

    Directory of Open Access Journals (Sweden)

    Pankaj Sharma

    2018-06-01

    Full Text Available White mold or stem rot disease are ubiquitously distributed throughout the world and the causal organism of this disease Sclerotinia sclerotiorum (Lib. de Bary, is known to infect over 400 plant species. Sclerotinia stem rot is one of the most devastating fungal diseases and poses a serious threat to the worldwide cultivation of oilseed Brassica including India. S. sclerotiorum pathogen usually infects the stem but in severe cases leaves and pods also affected at different developmental stages that deteriorate not only the oil quality but also causing the seed and oil yield losses up to 90% depending on the severity of the disease infestation. This study investigated the morphological and molecular characterization of pathogenic S. sclerotiorum (Lib de Bary geographical isolates from oilseed Brassica including Brassica juncea (Indian mustard. The aim of this study was to compare isolates of S. sclerotiorum originated from different agro-climatic conditions and to analyse similarity or differences between them as well as to examine the virulence of this pathogen specifically in Brassica for the first time. The collection of S. sclerotiorum isolates from symptomatic Brassica plants was done and analyzed for morphological features, and molecular characterization. The virulence evaluation test of 65 isolates on four Brassica cultivars has shown 5 of them were highly virulent, 46 were virulent and 14 were moderately virulent. Phylogenetic analysis encompassing all the morphological features, SSR polymorphism, and ITS sequencing has shown the existence of high genetic diversity among the isolates that categorized all the isolates in three evolutionary lineages in the derived dendrogram. Further, genetic variability analysis based on sequences variation in ITS region of all the isolates has shown the existence of either insertions or deletions of the nucleotides in the ITS region has led to the interspecies variability and observed the variation were

  17. Cultural diversity: blind spot in medical curriculum documents, a document analysis.

    Science.gov (United States)

    Paternotte, Emma; Fokkema, Joanne P I; van Loon, Karsten A; van Dulmen, Sandra; Scheele, Fedde

    2014-08-22

    Cultural diversity among patients presents specific challenges to physicians. Therefore, cultural diversity training is needed in medical education. In cases where strategic curriculum documents form the basis of medical training it is expected that the topic of cultural diversity is included in these documents, especially if these have been recently updated. The aim of this study was to assess the current formal status of cultural diversity training in the Netherlands, which is a multi-ethnic country with recently updated medical curriculum documents. In February and March 2013, a document analysis was performed of strategic curriculum documents for undergraduate and postgraduate medical education in the Netherlands. All text phrases that referred to cultural diversity were extracted from these documents. Subsequently, these phrases were sorted into objectives, training methods or evaluation tools to assess how they contributed to adequate curriculum design. Of a total of 52 documents, 33 documents contained phrases with information about cultural diversity training. Cultural diversity aspects were more prominently described in the curriculum documents for undergraduate education than in those for postgraduate education. The most specific information about cultural diversity was found in the blueprint for undergraduate medical education. In the postgraduate curriculum documents, attention to cultural diversity differed among specialties and was mainly superficial. Cultural diversity is an underrepresented topic in the Dutch documents that form the basis for actual medical training, although the documents have been updated recently. Attention to the topic is thus unwarranted. This situation does not fit the demand of a multi-ethnic society for doctors with cultural diversity competences. Multi-ethnic countries should be critical on the content of the bases for their medical educational curricula.

  18. BATMAN-TCM: a Bioinformatics Analysis Tool for Molecular mechANism of Traditional Chinese Medicine

    Science.gov (United States)

    Liu, Zhongyang; Guo, Feifei; Wang, Yong; Li, Chun; Zhang, Xinlei; Li, Honglei; Diao, Lihong; Gu, Jiangyong; Wang, Wei; Li, Dong; He, Fuchu

    2016-02-01

    Traditional Chinese Medicine (TCM), with a history of thousands of years of clinical practice, is gaining more and more attention and application worldwide. And TCM-based new drug development, especially for the treatment of complex diseases is promising. However, owing to the TCM’s diverse ingredients and their complex interaction with human body, it is still quite difficult to uncover its molecular mechanism, which greatly hinders the TCM modernization and internationalization. Here we developed the first online Bioinformatics Analysis Tool for Molecular mechANism of TCM (BATMAN-TCM). Its main functions include 1) TCM ingredients’ target prediction; 2) functional analyses of targets including biological pathway, Gene Ontology functional term and disease enrichment analyses; 3) the visualization of ingredient-target-pathway/disease association network and KEGG biological pathway with highlighted targets; 4) comparison analysis of multiple TCMs. Finally, we applied BATMAN-TCM to Qishen Yiqi dripping Pill (QSYQ) and combined with subsequent experimental validation to reveal the functions of renin-angiotensin system responsible for QSYQ’s cardioprotective effects for the first time. BATMAN-TCM will contribute to the understanding of the “multi-component, multi-target and multi-pathway” combinational therapeutic mechanism of TCM, and provide valuable clues for subsequent experimental validation, accelerating the elucidation of TCM’s molecular mechanism. BATMAN-TCM is available at http://bionet.ncpsb.org/batman-tcm.

  19. Analysis of the genetic diversity of four rabbit genotypes using ...

    African Journals Online (AJOL)

    Dr.Ola

    2013-05-15

    May 15, 2013 ... consumption and low cost, it has been widely utilized in genetics analysis in ... isozyme variation among the selected individuals within each rabbit genotype. ... with different embryo survival (Bolet and Theau-Clement, 1994).

  20. Molecular phylogenetic diversity of the emerging mucoralean fungus Apophysomyces: proposal of three new species.

    Science.gov (United States)

    Alvarez, Eduardo; Stchigel, Alberto M; Cano, Josep; Sutton, Deanna A; Fothergill, Annette W; Chander, Jagdish; Salas, Valentina; Rinaldi, Michael G; Guarro, Josep

    2010-06-30

    Apophysomyces is a monotypic genus belonging to the order Mucorales. The species Apophysomyces elegans has been reported to cause severe infections in immunocompromised and immunocompetent people. In a previous study of Alvarez et al.(3) [J Clin Microbiol 2009;47:1650-6], we demonstrated a high variability among the 5.8S rRNA gene sequences of clinical strains of A. elegans. We performed a polyphasic study based on the analysis of the sequences of the histone 3 gene, the internal transcribed spacer region of the rDNA gene, and domains D1 and D2 of the 28S rRNA gene, as well as by evaluation of some relevant morphological and physiological characteristics of a set of clinical and environmental strains of A. elegans. We have demonstrated that A. elegans is a complex of species. We propose as new species Apophysomyces ossiformis, characterised by bone-shaped sporangiospores, Apophysomyces trapeziformis, with trapezoid-shaped sporangiospores, and Apophysomyces variabilis, with variable-shaped sporangiospores. These species failed to assimilate esculin, whereas A. elegans was able to assimilate that glycoside. Amphotericin B and posaconazole are the most active in vitro drugs against Apophysomyces. Copyright 2009 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  1. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  2. Incidence and molecular diversity of poleroviruses infecting cucurbit crops and weed plants in Thailand.

    Science.gov (United States)

    Cheewachaiwit, S; Warin, N; Phuangrat, B; Rukpratanporn, S; Gajanandana, O; Balatero, C H; Chatchawankanphanich, O

    2017-07-01

    Overall, 244 samples of cucurbit crops with yellowing symptoms and selected weed species, from 15 provinces in Thailand, were screened by RT-PCR using primers Polero-CP-F and Polero-CP-R. A total of 160 samples (~66%) were infected by poleroviruses. Analysis of a 1.4 kb region covering the 3' RNA-dependent RNA polymerase (RdRp) gene, the intergenic non-coding region (iNCR), and the coat protein (CP), showed that four poleroviruses, namely, cucurbit aphid-borne yellows virus (CABYV), luffa aphid-borne yellows virus (LABYV), melon aphid-borne yellows virus (MABYV) and suakwa aphid-borne yellows virus (SABYV) were associated with the yellowing symptoms in cucurbit crops. Further analyses indicated presence of putative recombinant viruses referred to as CABYV-R and SABYV-R. CABYV-R was derived from the recombination between MABYV and the common strain of CABYV (CABYV-C). SABYV-R was derived from the recombination of MABYV and SABYV.

  3. Molecular diversity of tuliposide A-converting enzyme in the tulip.

    Science.gov (United States)

    Nomura, Taiji; Tsuchigami, Aya; Ogita, Shinjiro; Kato, Yasuo

    2013-01-01

    Tuliposide A-converting enzyme (TCEA) catalyzes the conversion of 6-tuliposide A to its lactonized aglycon, tulipalin A, in the tulip (Tulipa gesneriana). The TgTCEA gene, isolated previously from petals, was transcribed in all tulip tissues but not in the bulbs despite the presence of TCEA activity, which allowed prediction of the presence of a TgTCEA isozyme gene preferentially expressed in the bulbs. Here, the TgTCEA-b gene, the TgTCEA homolog, was identified in bulbs. TgTCEA-b polypeptides showed approximately 77% identity to the petal TgTCEA. Functional characterization of the recombinant enzyme verified that TgTCEA-b encoded the TCEA. Moreover, the TgTCEA-b was found to be localized to plastids, as found for the petal TgTCEA. Transcript analysis revealed that TgTCEA-b was functionally transcribed in the bulb scales, unlike the TgTCEA gene, whose transcripts were absent there. In contrast, TgTCEA-b transcripts were in the minority in other tissues where TgTCEA transcripts were dominant, indicating a tissue preference for the transcription of those isozyme genes.

  4. Molecular Detection of Tick-Borne Pathogen Diversities in Ticks from Livestock and Reptiles along the Shores and Adjacent Islands of Lake Victoria and Lake Baringo, Kenya

    Directory of Open Access Journals (Sweden)

    David Omondi

    2017-06-01

    Full Text Available Although diverse tick-borne pathogens (TBPs are endemic to East Africa, with recognized impact on human and livestock health, their diversity and specific interactions with tick and vertebrate host species remain poorly understood in the region. In particular, the role of reptiles in TBP epidemiology remains unknown, despite having been implicated with TBPs of livestock among exported tortoises and lizards. Understanding TBP ecologies, and the potential role of common reptiles, is critical for the development of targeted transmission control strategies for these neglected tropical disease agents. During the wet months (April–May; October–December of 2012–2013, we surveyed TBP diversity among 4,126 ticks parasitizing livestock and reptiles at homesteads along the shores and islands of Lake Baringo and Lake Victoria in Kenya, regions endemic to diverse neglected tick-borne diseases. After morphological identification of 13 distinct Rhipicephalus, Amblyomma, and Hyalomma tick species, ticks were pooled (≤8 individuals by species, host, sampling site, and collection date into 585 tick pools. By supplementing previously established molecular assays for TBP detection with high-resolution melting analysis of PCR products before sequencing, we identified high frequencies of potential disease agents of ehrlichiosis (12.48% Ehrlichia ruminantium, 9.06% Ehrlichia canis, anaplasmosis (6.32% Anaplasma ovis, 14.36% Anaplasma platys, and 3.08% Anaplasma bovis,, and rickettsiosis (6.15% Rickettsia africae, 2.22% Rickettsia aeschlimannii, 4.27% Rickettsia rhipicephali, and 4.95% Rickettsia spp., as well as Paracoccus sp. and apicomplexan hemoparasites (0.51% Theileria sp., 2.56% Hepatozoon fitzsimonsi, and 1.37% Babesia caballi among tick pools. Notably, we identified E. ruminantium in both Amblyomma and Rhipicephalus pools of ticks sampled from livestock in both study areas as well as in Amblyomma falsomarmoreum (66.7% and Amblyomma nuttalli (100

  5. Molecular Detection of Tick-Borne Pathogen Diversities in Ticks from Livestock and Reptiles along the Shores and Adjacent Islands of Lake Victoria and Lake Baringo, Kenya.

    Science.gov (United States)

    Omondi, David; Masiga, Daniel K; Fielding, Burtram C; Kariuki, Edward; Ajamma, Yvonne Ukamaka; Mwamuye, Micky M; Ouso, Daniel O; Villinger, Jandouwe

    2017-01-01

    Although diverse tick-borne pathogens (TBPs) are endemic to East Africa, with recognized impact on human and livestock health, their diversity and specific interactions with tick and vertebrate host species remain poorly understood in the region. In particular, the role of reptiles in TBP epidemiology remains unknown, despite having been implicated with TBPs of livestock among exported tortoises and lizards. Understanding TBP ecologies, and the potential role of common reptiles, is critical for the development of targeted transmission control strategies for these neglected tropical disease agents. During the wet months (April-May; October-December) of 2012-2013, we surveyed TBP diversity among 4,126 ticks parasitizing livestock and reptiles at homesteads along the shores and islands of Lake Baringo and Lake Victoria in Kenya, regions endemic to diverse neglected tick-borne diseases. After morphological identification of 13 distinct Rhipicephalus, Amblyomma , and Hyalomma tick species, ticks were pooled (≤8 individuals) by species, host, sampling site, and collection date into 585 tick pools. By supplementing previously established molecular assays for TBP detection with high-resolution melting analysis of PCR products before sequencing, we identified high frequencies of potential disease agents of ehrlichiosis (12.48% Ehrlichia ruminantium , 9.06% Ehrlichia canis ), anaplasmosis (6.32% Anaplasma ovis , 14.36% Anaplasma platys , and 3.08% Anaplasma bovis ,), and rickettsiosis (6.15% Rickettsia africae , 2.22% Rickettsia aeschlimannii , 4.27% Rickettsia rhipicephali , and 4.95% Rickettsia spp.), as well as Paracoccus sp. and apicomplexan hemoparasites (0.51% Theileria sp., 2.56% Hepatozoon fitzsimonsi , and 1.37% Babesia caballi ) among tick pools. Notably, we identified E. ruminantium in both Amblyomma and Rhipicephalus pools of ticks sampled from livestock in both study areas as well as in Amblyomma falsomarmoreum (66.7%) and Amblyomma nuttalli (100%) sampled

  6. Diversion Path Analysis handbook. Volume 3 (of 4 volumes). Computer Program 1

    International Nuclear Information System (INIS)

    Schleter, J.C.

    1978-11-01

    The FORTRAN IV computer program, DPA Computer Program 1 (DPACP-1), is used to assemble and tabulate the data for Specific Diversion Paths (SDPs) identified when performing a Diversion Path Analysis (DPA) in accord with the methodology given in Volume 1. The program requires 255498 bytes exclusive of the operating system. The data assembled and tabulated by DPACP-1 are used by the DPA team to assist in analyzing vulnerabilities, in a plant's material control and material accounting subsystems, to diversion of special nuclear material (SNM) by a knowledgable insider. Based on this analysis, the DPA team can identify, and propose to plant management, modifications to the plant's safeguards system that would eliminate, or reduce the severity of, the identified vulnerabilities. The data are also used by plant supervision when investigating a potential diversion

  7. Application of atomic absorption in molecular analysis (spectrophotometry)

    International Nuclear Information System (INIS)

    Baliza, S.V.; Soledade, L.E.B.

    1981-01-01

    The apparatus of atomic absorption has been considered by all the experts in chemical analysis as one of the most important equipments in actual utilization in such field. Among its several applications one should emphasize direct and indirect metals analyses using flame, graphite furnace, cold vapor generator,... Besides such known applications, the authors have developed at the R and D Center of CSN a patent pendent method for the utilization of such equipment for molecular analysis, in substitution of a sophisticated and specific apparatus. (Author) [pt

  8. Molecular diversity of rabies viruses associated with bats in Mexico and other countries of the Americas.

    Science.gov (United States)

    Velasco-Villa, Andrés; Orciari, Lillian A; Juárez-Islas, Víctor; Gómez-Sierra, Mauricio; Padilla-Medina, Irma; Flisser, Ana; Souza, Valeria; Castillo, Amanda; Franka, Richard; Escalante-Mañe, Maribel; Sauri-González, Isaias; Rupprecht, Charles E

    2006-05-01

    Bat rabies and its transmission to humans and other species in Mexico were investigated. Eighty-nine samples obtained from rabid livestock, cats, dogs, and humans in Mexico were studied by antigenic typing and partial sequence analysis. Samples were further compared with enzootic rabies associated with different species of bats in the Americas. Patterns of nucleotide variation allowed the definition of at least 20 monophyletic clusters associated with 9 or more different bat species. Several lineages associated with distinctive antigenic patterns were found in rabies viruses related to rabies in vampire bats in Mexico. Vampire bat rabies virus lineages associated with antigenic variant 3 are widely spread from Mexico to South America, suggesting these lineages as the most likely ancestors of vampire bat rabies and the ones that have been moved by vampire bat populations throughout the Americas. Rabies viruses related to Lasiurus cinereus, Histiotus montanus, and some other not yet identified species of the genus Lasiurus were found circulating in Mexico. Long-range dissemination patterns of rabies are not necessarily associated with migratory bat species, as in the case of rabies in Desmodus rotundus and Histiotus montanus. Human rabies was associated with vampire bat transmission in most cases, and in one case, rabies transmission from free-tailed bats was inferred. The occurrence of rabies spillover from bats to domestic animals was also demonstrated. Genetic typing of rabies viruses allowed us to distinguish trends of disease dissemination and to address, in a preliminary fashion, aspects of the complex evolution of rabies viruses in different host-reservoir species.

  9. Molecular Analysis of Bacterial Microbiota on Brazilian Currency Note Surfaces

    Directory of Open Access Journals (Sweden)

    Tairacan Augusto Pereira da Fonseca

    2015-10-01

    Full Text Available Currency notes have been implicated as a vehicle for transmitting community-acquired bacterial infections. However, the overall diversity of the bacterial population residing on banknotes is still unknown in Brazil. In this study, we aimed to investigate the overall bacterial population from 150 different Brazilian Rial (R$ notes in circulation using a culture-independent Illumina massively parallel sequencing approach of the 16S rRNA genes. Samples were randomly collected from three different street markets or “feiras” in the metropolitan region of São Paulo. Taxonomical composition revealed the abundance of Proteobacteria phyla, followed by Firmicutes and Streptophyta, with a total of 1193 bacterial families and 3310 bacterial genera. Most of these bacterial genera are of human, animal, and environmental origins. Also, our analysis revealed the presence of some potential pathogenic bacterial genera including Salmonella, Staphylococcus, and Klebsiella. The results demonstrate that there is a tremendous diversity of bacterial contamination on currency notes, including organisms known to be opportunistic pathogens. One of the factors that may contribute to the richness of bacterial diversity in currency notes is personal hygiene. Thus, our results underscore the need to increase public awareness of the importance of personal hygiene of money handlers who also handle food.

  10. Molecular Analysis of Bacterial Microbiota on Brazilian Currency Note Surfaces.

    Science.gov (United States)

    Pereira da Fonseca, Tairacan Augusto; Pessôa, Rodrigo; Sanabani, Sabri Saeed

    2015-10-22

    Currency notes have been implicated as a vehicle for transmitting community-acquired bacterial infections. However, the overall diversity of the bacterial population residing on banknotes is still unknown in Brazil. In this study, we aimed to investigate the overall bacterial population from 150 different Brazilian Rial (R$) notes in circulation using a culture-independent Illumina massively parallel sequencing approach of the 16S rRNA genes. Samples were randomly collected from three different street markets or "feiras" in the metropolitan region of São Paulo. Taxonomical composition revealed the abundance of Proteobacteria phyla, followed by Firmicutes and Streptophyta, with a total of 1193 bacterial families and 3310 bacterial genera. Most of these bacterial genera are of human, animal, and environmental origins. Also, our analysis revealed the presence of some potential pathogenic bacterial genera including Salmonella, Staphylococcus, and Klebsiella. The results demonstrate that there is a tremendous diversity of bacterial contamination on currency notes, including organisms known to be opportunistic pathogens. One of the factors that may contribute to the richness of bacterial diversity in currency notes is personal hygiene. Thus, our results underscore the need to increase public awareness of the importance of personal hygiene of money handlers who also handle food.

  11. Molecular Genetic Diversity and Quantitation of Methanogen in Ruminal Fluid of Buffalo (Bubalus bubalis Fed Ration (Wheat Straw and Concentrate Mixture Diet

    Directory of Open Access Journals (Sweden)

    K. M. Singh

    2013-01-01

    Full Text Available High roughage diet causes more methane emissions; however, the total methanogen abundance is not influenced by roughage proportion. Technologies to reduce methane emissions are lacking, and development of inhibitors and vaccines that mitigate rumen-derived methane by targeting methanogens relies on present knowledge of the methanogens. In this work, we have investigated molecular diversity of rumen methanogens of Surti buffalo. DNA from rumen fluid was extracted, and 16S rRNA encoding genes were amplified using methanogen specific primer to generate 16S rDNA clone libraries. Seventy-six clones were randomly selected and analysed by RFLP resulting in 21 operational taxonomic units (OTUs. BLAST analysis with available sequences in database revealed sequences of 13 OTUs (55 clones showing similarity with Methanomicrobium sp, 3 OTUs (15 clones with Methanobrevibacter sp. The remaining 5 OTUs (6 clones belonged to uncultured archaea. The phylogenetic analysis indicated that methanogenic communities found in the library were clustered in the order of Methanomicrobiales (18 OTUs and Methanobacteriales (3 OTUs. The population of Methanomicrobiales, Methanobacteriales, and Methanococcales were also observed, accounting for 1.94%, 0.72%, and 0.47% of total archaea, respectively.

  12. Molecular Techniques Revealed Highly Diverse Microbial Communities in Natural Marine Biofilms on Polystyrene Dishes for Invertebrate Larval Settlement

    KAUST Repository

    Lee, On On

    2014-01-09

    Biofilm microbial communities play an important role in the larval settlement response of marine invertebrates. However, the underlying mechanism has yet to be resolved, mainly because of the uncertainties in characterizing members in the communities using traditional 16S rRNA gene-based molecular methods and in identifying the chemical signals involved. In this study, pyrosequencing was used to characterize the bacterial communities in intertidal and subtidal marine biofilms developed during two seasons. We revealed highly diverse biofilm bacterial communities that varied with season and tidal level. Over 3,000 operational taxonomic units with estimates of up to 8,000 species were recovered in a biofilm sample, which is by far the highest number recorded in subtropical marine biofilms. Nineteen phyla were found, of which Cyanobacteria and Proteobacteria were the most dominant one in the intertidal and subtidal biofilms, respectively. Apart from these, Actinobacteria, Bacteroidetes, and Planctomycetes were the major groups recovered in both intertidal and subtidal biofilms, although their relative abundance varied among samples. Full-length 16S rRNA gene clone libraries were constructed for the four biofilm samples and showed similar bacterial compositions at the phylum level to those revealed by pyrosequencing. Laboratory assays confirmed that cyrids of the barnacle Balanus amphitrite preferred to settle on the intertidal rather than subtidal biofilms. This preference was independent of the biofilm bacterial density or biomass but was probably related to the biofilm community structure, particularly, the Proteobacterial and Cyanobacterial groups. © 2014 Springer Science+Business Media New York.

  13. Food-Borne Outbreak Investigation and Molecular Typing: High Diversity of Staphylococcus aureus Strains and Importance of Toxin Detection

    Science.gov (United States)

    Denayer, Sarah; Nia, Yacine; Botteldoorn, Nadine

    2017-01-01

    Staphylococcus aureus is an important aetiological agent of food intoxications in the European Union as it can cause gastro-enteritis through the production of various staphylococcal enterotoxins (SEs) in foods. Reported enterotoxin dose levels causing food-borne illness are scarce and varying. Three food poisoning outbreaks due to enterotoxin-producing S. aureus strains which occurred in 2013 in Belgium are described. The outbreaks occurred in an elderly home, at a barbecue event and in a kindergarten and involved 28, 18, and six cases, respectively. Various food leftovers contained coagulase positive staphylococci (CPS). Low levels of staphylococcal enterotoxins ranging between 0.015 ng/g and 0.019 ng/g for enterotoxin A (SEA), and corresponding to 0.132 ng/g for SEC were quantified in the food leftovers for two of the reported outbreaks. Molecular typing of human and food isolates using pulsed-field gel electrophoresis (PFGE) and enterotoxin gene typing, confirmed the link between patients and the suspected foodstuffs. This also demonstrated the high diversity of CPS isolates both in the cases and in healthy persons carrying enterotoxin genes encoding emetic SEs for which no detection methods currently exist. For one outbreak, the investigation pointed out to the food handler who transmitted the outbreak strain to the food. Tools to improve staphylococcal food poisoning (SFP) investigations are presented. PMID:29261162

  14. Diversity and Phylogeny of Gymnodiniales (Dinophyceae) from the NW Mediterranean Sea Revealed by a Morphological and Molecular Approach.

    Science.gov (United States)

    Reñé, Albert; Camp, Jordi; Garcés, Esther

    2015-05-01

    The diversity and phylogeny of dinoflagellates belonging to the Gymnodiniales were studied during a 3-year period at several coastal stations along the Catalan coast (NW Mediterranean) by combining analyses of their morphological features with rDNA sequencing. This approach resulted in the detection of 59 different morphospecies, 13 of which were observed for the first time in the Mediterranean Sea. Fifteen of the detected species were HAB producers; four represented novel detections on the Catalan coast and two in the Mediterranean Sea. Partial rDNA sequences were obtained for 50 different morphospecies, including novel LSU rDNA sequences for 27 species, highlighting the current scarcity of molecular information for this group of dinoflagellates. The combination of morphology and genetics allowed the first determinations of the phylogenetic position of several genera, i.e., Torodinium and many Gyrodinium and Warnowiacean species. The results also suggested that among the specimens belonging to the genera Gymnodinium, Apicoporus, and Cochlodinium were those representing as yet undescribed species. Furthermore, the phylogenetic data suggested taxonomic incongruences for some species, i.e., Gyrodinium undulans and Gymnodinium agaricoides. Although a species complex related to G. spirale was detected, the partial LSU rDNA sequences lacked sufficient resolution to discriminate between various other Gyrodinium morphospecies. Copyright © 2015 Elsevier GmbH. All rights reserved.

  15. Food-Borne Outbreak Investigation and Molecular Typing: High Diversity of Staphylococcus aureus Strains and Importance of Toxin Detection.

    Science.gov (United States)

    Denayer, Sarah; Delbrassinne, Laurence; Nia, Yacine; Botteldoorn, Nadine

    2017-12-20

    Staphylococcus aureus is an important aetiological agent of food intoxications in the European Union as it can cause gastro-enteritis through the production of various staphylococcal enterotoxins (SEs) in foods. Reported enterotoxin dose levels causing food-borne illness are scarce and varying. Three food poisoning outbreaks due to enterotoxin-producing S. aureus strains which occurred in 2013 in Belgium are described. The outbreaks occurred in an elderly home, at a barbecue event and in a kindergarten and involved 28, 18, and six cases, respectively. Various food leftovers contained coagulase positive staphylococci (CPS). Low levels of staphylococcal enterotoxins ranging between 0.015 ng/g and 0.019 ng/g for enterotoxin A (SEA), and corresponding to 0.132 ng/g for SEC were quantified in the food leftovers for two of the reported outbreaks. Molecular typing of human and food isolates using pulsed-field gel electrophoresis (PFGE) and enterotoxin gene typing, confirmed the link between patients and the suspected foodstuffs. This also demonstrated the high diversity of CPS isolates both in the cases and in healthy persons carrying enterotoxin genes encoding emetic SEs for which no detection methods currently exist. For one outbreak, the investigation pointed out to the food handler who transmitted the outbreak strain to the food. Tools to improve staphylococcal food poisoning (SFP) investigations are presented.

  16. Optimization of preservation and processing of sea anemones for microbial community analysis using molecular tools.

    Science.gov (United States)

    Rocha, Joana; Coelho, Francisco J R C; Peixe, Luísa; Gomes, Newton C M; Calado, Ricardo

    2014-11-11

    For several years, knowledge on the microbiome associated with marine invertebrates was impaired by the challenges associated with the characterization of bacterial communities. With the advent of culture independent molecular tools it is possible to gain new insights on the diversity and richness of microorganisms associated with marine invertebrates. In the present study, we evaluated if different preservation and processing methodologies (prior to DNA extraction) can affect the bacterial diversity retrieved from snakelocks anemone Anemonia viridis. Denaturing gradient gel electrophoresis (DGGE) community fingerprints were used as proxy to determine the bacterial diversity retrieved (H'). Statistical analyses indicated that preservation significantly affects H'. The best approach to preserve and process A. viridis biomass for bacterial community fingerprint analysis was flash freezing in liquid nitrogen (preservation) followed by the use of a mechanical homogenizer (process), as it consistently yielded higher H'. Alternatively, biomass samples can be processed fresh followed by cell lyses using a mechanical homogenizer or mortar &pestle. The suitability of employing these two alternative procedures was further reinforced by the quantification of the 16S rRNA gene; no significant differences were recorded when comparing these two approaches and the use of liquid nitrogen followed by processing with a mechanical homogenizer.

  17. Molecular analysis of fungal populations in patients with oral candidiasis using internal transcribed spacer region.

    Science.gov (United States)

    Ieda, Shinsuke; Moriyama, Masafumi; Takeshita, Toru; Takashita, Toru; Maehara, Takashi; Imabayashi, Yumi; Shinozaki, Shoichi; Tanaka, Akihiko; Hayashida, Jun-Nosuke; Furukawa, Sachiko; Ohta, Miho; Yamashita, Yoshihisa; Nakamura, Seiji

    2014-01-01

    Oral candidiasis is closely associated with changes in the oral fungal flora and is caused primarily by Candida albicans. Conventional methods of fungal culture are time-consuming and not always conclusive. However, molecular genetic analysis of internal transcribed spacer (ITS) regions of fungal rRNA is rapid, reproducible and simple to perform. In this study we examined the fungal flora in patients with oral candidiasis and investigated changes in the flora after antifungal treatment using length heterogeneity-polymerization chain reaction (LH-PCR) analysis of ITS regions. Fifty-two patients with pseudomembranous oral candidiasis (POC) and 30 healthy controls were included in the study. Fungal DNA from oral rinse was examined for fungal species diversity by LH-PCR. Fungal populations were quantified by real-time PCR and previously-unidentified signals were confirmed by nucleotide sequencing. Relationships between the oral fungal flora and treatment-resistant factors were also examined. POC patients showed significantly more fungal species and a greater density of fungi than control individuals. Sixteen fungi were newly identified. The fungal populations from both groups were composed predominantly of C. albicans, though the ratio of C. dubliniensis was significantly higher in POC patients than in controls. The diversity and density of fungi were significantly reduced after treatment. Furthermore, fungal diversity and the proportion of C. dubliniensis were positively correlated with treatment duration. These results suggest that C. dubliniensis and high fungal flora diversity might be involved in the pathogenesis of oral candidiasis. We therefore conclude that LH-PCR is a useful technique for diagnosing and assessing the severity of oral candidal infection.

  18. Visual characterization and diversity quantification of chemical libraries: 2. Analysis and selection of size-independent, subspace-specific diversity indices.

    Science.gov (United States)

    Colliandre, Lionel; Le Guilloux, Vincent; Bourg, Stephane; Morin-Allory, Luc

    2012-02-27

    High Throughput Screening (HTS) is a standard technique widely used to find hit compounds in drug discovery projects. The high costs associated with such experiments have highlighted the need to carefully design screening libraries in order to avoid wasting resources. Molecular diversity is an established concept that has been used to this end for many years. In this article, a new approach to quantify the molecular diversity of screening libraries is presented. The approach is based on the Delimited Reference Chemical Subspace (DRCS) methodology, a new method that can be used to delimit the densest subspace spanned by a reference library in a reduced 2D continuous space. A total of 22 diversity indices were implemented or adapted to this methodology, which is used here to remove outliers and obtain a relevant cell-based partition of the subspace. The behavior of these indices was assessed and compared in various extreme situations and with respect to a set of theoretical rules that a diversity function should satisfy when libraries of different sizes have to be compared. Some gold standard indices are found inappropriate in such a context, while none of the tested indices behave perfectly in all cases. Five DRCS-based indices accounting for different aspects of diversity were finally selected, and a simple framework is proposed to use them effectively. Various libraries have been profiled with respect to more specific subspaces, which further illustrate the interest of the method.

  19. Analysis of genetic diversity and population structure among exotic ...

    African Journals Online (AJOL)

    The same clustering pattern was also found in the PCoA analysis. In all the geographical populations, genotypes from the same country were often in different clusters and likewise accessions from different countries often clustered together indicating the possibility of exchange of materials between countries. Population ...

  20. Phylogenetic diversity analysis of Trichoderma species based on ...

    African Journals Online (AJOL)

    vi-4177/CSAU be assigned as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit ...

  1. Analysis of genetic diversity in pigeon pea germplasm using ...

    Indian Academy of Sciences (India)

    MANEESHA

    2017-08-16

    Aug 16, 2017 ... Th, Thailand; It, Italy; B, Barbados; Ta, Taiwan; J, Jamaica; V, Venezuela; UK, United Kingdom; My, Myanmar; U, Uganda; G,. Germany. .... from Orissa (105) and AP (15) do not group with any .... In the present work, comparison between SSAP and ... fied polymorphism) for genetic analysis of sweet potato.

  2. Genetic diversity analysis of pearl millet ( Pennisetum glauccum [L ...

    African Journals Online (AJOL)

    between genotype PT 2835/1 and PT 5552 and lowest similarity index was observed between PT 5554 and PT 2835/1. Analysis of RAPD data appears to be helpful in determining the genetic relationship among 20 pearl millet genotypes. The associations among the 20 genotypes were also examined with Principle ...

  3. A comparative genetic diversity analysis in mungbean ( Vigna ...

    African Journals Online (AJOL)

    Amplified fragment length polymorphism (AFLP) and inter-simple sequence repeat (ISSR) markers were used to study the DNA polymorphism in elite mungbean genotypes. A total of nine AFLP primer combination and 22 ISSR primers were used. Amplification of genomic DNA of the 30 genotypes, using AFLP analysis, ...

  4. [Migration and health--from deficiency analysis to diversity vision?].

    Science.gov (United States)

    Weber, A; Hörmann, G

    2011-05-01

    In times of globalization the subjects migration and health are gaining more and more in importance. At the same time, one can observe a discrepancy between published opinions, politically intended messages and scientifically proved evidence. With approximately 15.4 million people with a migration background (this is equivalent to approximately 19% of the German population), migrants perform as an important "customer group" for health care and social security. In 2005, the category migrant background was introduced for the first time by the Federal Statistical Office. This category suggests homogeneity, which in fact is not given. Persons with migration background (including active immigrants, their children and grandchildren, repatriates, foreigners), have to be examined in a differentiated way concerning the consequences that the migration process has on health. Apart from potentially pathogenic influences associated with migration (e. g., ethnicity, national origin, cultural/religious characteristics, migration-related stressors), for example, education, social status, life-style and participation in work and society have to be taken into consideration as important "confounders". In this, a recent sociological approach (sinus migrant milieu) could be useful for socio-medical research and practice. Health-relevant information on migrants results on the one hand from scientific studies primarily designed for this purpose and, on the other hand, from routine data from official health reports. In the interpretation of secondary data, the problem arises that the definition of the target group (migrants) is different in the diverse data sources (for example, Germans, non-Germans, foreigners, migration background) and that important confounders (for example, from socio-cultural milieu) are not included. This may result in, among other things, an under- or overestimation of health risks or even incorrect conclusions. In consideration of these limitations, by means of

  5. Genotyping-By-Sequencing for Plant Genetic Diversity Analysis: A Lab Guide for SNP Genotyping

    Directory of Open Access Journals (Sweden)

    Gregory W. Peterson

    2014-10-01

    Full Text Available Genotyping-by-sequencing (GBS has recently emerged as a promising genomic approach for exploring plant genetic diversity on a genome-wide scale. However, many uncertainties and challenges remain in the application of GBS, particularly in non-model species. Here, we present a GBS protocol we developed and use for plant genetic diversity analysis. It uses two restriction enzymes to reduce genome complexity, applies Illumina multiplexing indexes for barcoding and has a custom bioinformatics pipeline for genotyping. This genetic diversity-focused GBS (gd-GBS protocol can serve as an easy-to-follow lab guide to assist a researcher through every step of a GBS application with five main components: sample preparation, library assembly, sequencing, SNP calling and diversity analysis. Specifically, in this presentation, we provide a brief overview of the GBS approach, describe the gd-GBS procedures, illustrate it with an application to analyze genetic diversity in 20 flax (Linum usitatissimum L. accessions and discuss related issues in GBS application. Following these lab bench procedures and using the custom bioinformatics pipeline, one could generate genome-wide SNP genotype data for a conventional genetic diversity analysis of a non-model plant species.

  6. Network analysis shining light on parasite ecology and diversity.

    Science.gov (United States)

    Poulin, Robert

    2010-10-01

    The vast number of species making up natural communities, and the myriad interactions among them, pose great difficulties for the study of community structure, dynamics and stability. Borrowed from other fields, network analysis is making great inroads in community ecology and is only now being applied to host-parasite interactions. It allows a complex system to be examined in its entirety, as opposed to one or a few components at a time. This review explores what network analysis is and how it can be used to investigate parasite ecology. It also summarizes the first findings to emerge from network analyses of host-parasite interactions and identifies promising future directions made possible by this approach. Copyright © 2010 Elsevier Ltd. All rights reserved.

  7. Accommodating error analysis in comparison and clustering of molecular fingerprints.

    Science.gov (United States)

    Salamon, H; Segal, M R; Ponce de Leon, A; Small, P M

    1998-01-01

    Molecular epidemiologic studies of infectious diseases rely on pathogen genotype comparisons, which usually yield patterns comprising sets of DNA fragments (DNA fingerprints). We use a highly developed genotyping system, IS6110-based restriction fragment length polymorphism analysis of Mycobacterium tuberculosis, to develop a computational method that automates comparison of large numbers of fingerprints. Because error in fragment length measurements is proportional to fragment length and is positively correlated for fragments within a lane, an align-and-count method that compensates for relative scaling of lanes reliably counts matching fragments between lanes. Results of a two-step method we developed to cluster identical fingerprints agree closely with 5 years of computer-assisted visual matching among 1,335 M. tuberculosis fingerprints. Fully documented and validated methods of automated comparison and clustering will greatly expand the scope of molecular epidemiology.

  8. Parasitological Confirmation and Analysis of Leishmania Diversity in Asymptomatic and Subclinical Infection following Resolution of Cutaneous Leishmaniasis.

    Science.gov (United States)

    Rosales-Chilama, Mariana; Gongora, Rafael E; Valderrama, Liliana; Jojoa, Jimena; Alexander, Neal; Rubiano, Luisa C; Cossio, Alexandra; Adams, Emily R; Saravia, Nancy G; Gomez, María Adelaida

    2015-12-01

    The contribution of individuals with subclinical infection to the transmission and endemicity of cutaneous leishmaniasis (CL) is unknown. Immunological evidence of exposure to Leishmania in residents of endemic areas has been the basis for defining the human population with asymptomatic infection. However, parasitological confirmation of subclinical infection is lacking. We investigated the presence and viability of Leishmania in blood and non-invasive mucosal tissue samples from individuals with immunological evidence of subclinical infection in endemic areas for CL caused by Leishmania (Viannia) in Colombia. Detection of Leishmania kDNA was conducted by PCR-Southern Blot, and parasite viability was confirmed by amplification of parasite 7SLRNA gene transcripts. A molecular tool for genetic diversity analysis of parasite populations causing persistent subclinical infection based on PCR amplification and sequence analysis of an 82bp region between kDNA conserved blocks 1 and 2 was developed. Persistent Leishmania infection was demonstrated in 40% (46 of 114) of leishmanin skin test (LST) positive individuals without active disease; parasite viability was established in 59% of these (27 of 46; 24% of total). Parasite burden quantified from circulating blood monocytes, nasal, conjunctival or tonsil mucosal swab samples was comparable, and ranged between 0.2 to 22 parasites per reaction. kDNA sequences were obtained from samples from 2 individuals with asymptomatic infection and from 26 with history of CL, allowing genetic distance analysis that revealed diversity among sequences and clustering within the L. (Viannia) subgenus. Our results provide parasitological confirmation of persistent infection among residents of endemic areas of L. (Viannia) transmission who have experienced asymptomatic infection or recovered from CL, revealing a reservoir of infection that potentially contributes to the endemicity and transmission of disease. kDNA genotyping establishes proof

  9. Parasitological Confirmation and Analysis of Leishmania Diversity in Asymptomatic and Subclinical Infection following Resolution of Cutaneous Leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Mariana Rosales-Chilama

    2015-12-01

    Full Text Available The contribution of individuals with subclinical infection to the transmission and endemicity of cutaneous leishmaniasis (CL is unknown. Immunological evidence of exposure to Leishmania in residents of endemic areas has been the basis for defining the human population with asymptomatic infection. However, parasitological confirmation of subclinical infection is lacking.We investigated the presence and viability of Leishmania in blood and non-invasive mucosal tissue samples from individuals with immunological evidence of subclinical infection in endemic areas for CL caused by Leishmania (Viannia in Colombia. Detection of Leishmania kDNA was conducted by PCR-Southern Blot, and parasite viability was confirmed by amplification of parasite 7SLRNA gene transcripts. A molecular tool for genetic diversity analysis of parasite populations causing persistent subclinical infection based on PCR amplification and sequence analysis of an 82bp region between kDNA conserved blocks 1 and 2 was developed.Persistent Leishmania infection was demonstrated in 40% (46 of 114 of leishmanin skin test (LST positive individuals without active disease; parasite viability was established in 59% of these (27 of 46; 24% of total. Parasite burden quantified from circulating blood monocytes, nasal, conjunctival or tonsil mucosal swab samples was comparable, and ranged between 0.2 to 22 parasites per reaction. kDNA sequences were obtained from samples from 2 individuals with asymptomatic infection and from 26 with history of CL, allowing genetic distance analysis that revealed diversity among sequences and clustering within the L. (Viannia subgenus.Our results provide parasitological confirmation of persistent infection among residents of endemic areas of L. (Viannia transmission who have experienced asymptomatic infection or recovered from CL, revealing a reservoir of infection that potentially contributes to the endemicity and transmission of disease. kDNA genotyping

  10. Bacterial diversity in Adélie penguin, Pygoscelis adeliae, guano: molecular and morpho-physiological approaches.

    Science.gov (United States)

    Zdanowski, Marek K; Weglenski, Piotr; Golik, Pawel; Sasin, Joanna M; Borsuk, Piotr; Zmuda, Magdalena J; Stankovic, Anna

    2004-11-01

    The total number of bacteria and culturable bacteria in Adélie penguin (Pygoscelis adeliae) guano was determined during 42 days of decomposition in a location adjacent to the rookery in Admiralty Bay, King George Island, Antarctica. Of the culturable bacteria, 72 randomly selected colonies were described using 49 morpho-physiological tests, 27 of which were subsequently considered significant in characterizing and differentiating the isolates. On the basis of the nucleotide sequence of a fragment of the 16S rRNA gene in each of 72 pure isolates, three major phylogenetic groups were identified, namely the Moraxellaceae/Pseudomonadaceae (29 isolates), the Flavobacteriaceae (14), and the Micrococcaceae (29). Grouping of the isolates on the basis of morpho-physiological tests (whether 49 or 27 parameters) showed similar results to those based on 16S rRNA gene sequences. Clusters were characterized by considerable intra-cluster variation in both 16S rRNA gene sequences and morpho-physiological responses. High diversity in abundance and morphometry of total bacterial communities during penguin guano decomposition was supported by image analysis of epifluorescence micrographs. The results indicate that the bacterial community in penguin guano is not only one of the richest in Antarctica, but is extremely diverse, both phylogenetically and morpho-physiologically.

  11. Pantoea ananatis Genetic Diversity Analysis Reveals Limited Genomic Diversity as Well as Accessory Genes Correlated with Onion Pathogenicity

    Directory of Open Access Journals (Sweden)

    Shaun P. Stice

    2018-02-01

    Full Text Available Pantoea ananatis is a member of the family Enterobacteriaceae and an enigmatic plant pathogen with a broad host range. Although P. ananatis strains can be aggressive on onion causing foliar necrosis and onion center rot, previous genomic analysis has shown that P. ananatis lacks the primary virulence secretion systems associated with other plant pathogens. We assessed a collection of fifty P. ananatis strains collected from Georgia over three decades to determine genetic factors that correlated with onion pathogenic potential. Previous genetic analysis studies have compared strains isolated from different hosts with varying diseases potential and isolation sources. Strains varied greatly in their pathogenic potential and aggressiveness on different cultivated Allium species like onion, leek, shallot, and chive. Using multi-locus sequence analysis (MLSA and repetitive extragenic palindrome repeat (rep-PCR techniques, we did not observe any correlation between onion pathogenic potential and genetic diversity among strains. Whole genome sequencing and pan-genomic analysis of a sub-set of 10 strains aided in the identification of a novel series of genetic regions, likely plasmid borne, and correlating with onion pathogenicity observed on single contigs of the genetic assemblies. We named these loci Onion Virulence Regions (OVR A-D. The OVR loci contain genes involved in redox regulation as well as pectate lyase and rhamnogalacturonase genes. Previous studies have not identified distinct genetic loci or plasmids correlating with onion foliar pathogenicity or pathogenicity on a single host pathosystem. The lack of focus on a single host system for this phytopathgenic disease necessitates the pan-genomic analysis performed in this study.

  12. Molecular evolution of avian reovirus: evidence for genetic diversity and reassortment of the S-class genome segments and multiple cocirculating lineages

    International Nuclear Information System (INIS)

    Liu, Hung J.; Lee, Long H.; Hsu, Hsiao W.; Kuo, Liam C.; Liao, Ming H.

    2003-01-01

    Nucleotide sequences of the S-class genome segments of 17 field-isolates and vaccine strains of avian reovirus (ARV) isolated over a 23-year period from different hosts, pathotypes, and geographic locations were examined and analyzed to define phylogenetic profiles and evolutionary mechanism. The S1 genome segment showed noticeably higher divergence than the other S-class genes. The σC-encoding gene has evolved into six distinct lineages. In contrast, the other S-class genes showed less divergence than that of the σC-encoding gene and have evolved into two to three major distinct lineages, respectively. Comparative sequence analysis provided evidence indicating extensive sequence divergence between ARV and other orthoreoviruses. The evolutionary trees of each gene were distinct, suggesting that these genes evolve in an independent manner. Furthermore, variable topologies were the result of frequent genetic reassortment among multiple cocirculating lineages. Results showed genetic diversity correlated more closely with date of isolation and geographic sites than with host species and pathotypes. This is the first evidence demonstrating genetic variability among circulating ARVs through a combination of evolutionary mechanisms involving multiple cocirculating lineages and genetic reassortment. The evolutionary rates and patterns of base substitutions were examined. The evolutionary rate for the σC-encoding gene and σC protein was higher than for the other S-class genes and other family of viruses. With the exception of the σC-encoding gene, which nonsynonymous substitutions predominate over synonymous, the evolutionary process of the other S-class genes can be explained by the neutral theory of molecular evolution. Results revealed that synonymous substitutions predominate over nonsynonymous in the S-class genes, even though genetic diversity and substitution rates vary among the viruses

  13. AN ANALYSIS OF THE LINGUISTIC DIVERSITY OF CYBERSPACE

    Directory of Open Access Journals (Sweden)

    Professor dr. habil., eng. Cezar VASILESCU

    2015-10-01

    Full Text Available The article proposes an analysis regarding the relationship between Internet usage and language. Moreover, it highlights the impact the latter have on the human interactions depicted by future knowledge societies within the framework of the Information Age. This endeavor explores from a linguistic perspective how cyber users’ native language affects their Internet usage patterns. Hence, its final goal is to determine whether the Internet is expected to remain overbalanced in English usage. In this respect, the relationship between web users’ native language and the language content of the Internet websites they access is also examined based on statistic data.

  14. Multidisciplinary critical discourse analysis: a plea for diversity

    Directory of Open Access Journals (Sweden)

    Teun A. van Dijk

    2013-12-01

    Full Text Available This text is a Brazilian Portuguese version of the chapter from the book “Methods of Critical Discourse Analysis”. The author outlines a Critical Discourse Analysis framework while presents a synthesis of its thinking about the some possible relations between Discourse and Society. The author’s theorical horizon embraces features since the structuralist paradigm to the socio-cognitivo one. At last, the reader can realize an early presentation of the author’s Theory of Context (2001 categories of a theory of context which was published seven years later.

  15. Molecular diversity of the methanotrophic bacteria communities associated with disused tin-mining ponds in Kampar, Perak, Malaysia.

    Science.gov (United States)

    Sow, S L S; Khoo, G; Chong, L K; Smith, T J; Harrison, P L; Ong, H K A

    2014-10-01

    In a previous study, notable differences of several physicochemical properties, as well as the community structure of ammonia oxidizing bacteria as judged by 16S rRNA gene analysis, were observed among several disused tin-mining ponds located in the town of Kampar, Malaysia. These variations were associated with the presence of aquatic vegetation as well as past secondary activities that occurred at the ponds. Here, methane oxidizing bacteria (MOB), which are direct participants in the nutrient cycles of aquatic environments and biological indicators of environmental variations, have been characterised via analysis of pmoA functional genes in the same environments. The MOB communities associated with disused tin-mining ponds that were exposed to varying secondary activities were examined in comparison to those in ponds that were left to nature. Comparing the sequence and phylogenetic analysis of the pmoA clone libraries at the different ponds (idle, lotus-cultivated and post-aquaculture), we found pmoA genes indicating the presence of type I and type II MOB at all study sites, but type Ib sequences affiliated with the Methylococcus/Methylocaldum lineage were most ubiquitous (46.7 % of clones). Based on rarefaction analysis and diversity indices, the disused mining pond with lotus culture was observed to harbor the highest richness of MOB. However, varying secondary activity or sample type did not show a strong variation in community patterns as compared to the ammonia oxidizers in our previous study.

  16. Molecular Diversity and Population Structure of a Worldwide Collection of Cultivated Tetraploid Alfalfa (Medicago sativa subsp. sativa L.) Germplasm as Revealed by Microsatellite Markers.

    Science.gov (United States)

    Qiang, Haiping; Chen, Zhihong; Zhang, Zhengli; Wang, Xuemin; Gao, Hongwen; Wang, Zan

    2015-01-01

    Information on genetic diversity and population structure of a tetraploid alfalfa collection might be valuable in effective use of the genetic resources. A set of 336 worldwide genotypes of tetraploid alfalfa (Medicago sativa subsp. sativa L.) was genotyped using 85 genome-wide distributed SSR markers to reveal the genetic diversity and population structure in the alfalfa. Genetic diversity analysis identified a total of 1056 alleles across 85 marker loci. The average expected heterozygosity and polymorphism information content values were 0.677 and 0.638, respectively, showing high levels of genetic diversity in the cultivated tetraploid alfalfa germplasm. Comparison of genetic characteristics across chromosomes indicated regions of chromosomes 2 and 3 had the highest genetic diversity. A higher genetic diversity was detected in alfalfa landraces than that of wild materials and cultivars. Two populations were identified by the model-based population structure, principal coordinate and neighbor-joining analyses, corresponding to China and other parts of the world. However, lack of strictly correlation between clustering and geographic origins suggested extensive germplasm exchanges of alfalfa germplasm across diverse geographic regions. The quantitative analysis of the genetic diversity and population structure in this study could be useful for genetic and genomic analysis and utilization of the genetic variation in alfalfa breeding.

  17. Family Wide Molecular Adaptations to Underground Life in African Mole-Rats Revealed by Phylogenomic Analysis.

    Science.gov (United States)

    Davies, Kalina T J; Bennett, Nigel C; Tsagkogeorga, Georgia; Rossiter, Stephen J; Faulkes, Christopher G

    2015-12-01

    During their evolutionary radiation, mammals have colonized diverse habitats. Arguably the subterranean niche is the most inhospitable of these, characterized by reduced oxygen, elevated carbon dioxide, absence of light, scarcity of food, and a substrate that is energetically costly to burrow through. Of all lineages to have transitioned to a subterranean niche, African mole-rats are one of the most successful. Much of their ecological success can be attributed to a diet of plant storage organs, which has allowed them to colonize climatically varied habitats across sub-Saharan Africa, and has probably contributed to the evolution of their diverse social systems. Yet despite their many remarkable phenotypic specializations, little is known about molecular adaptations underlying these traits. To address this, we sequenced the transcriptomes of seven mole-rat taxa, including three solitary species, and combined new sequences with existing genomic data sets. Alignments of more than 13,000 protein-coding genes encompassed, for the first time, all six genera and the full spectrum of ecological and social variation in the clade. We detected positive selection within the mole-rat clade and along ancestral branches in approximately 700 genes including loci associated with tumorigenesis, aging, morphological development, and sociality. By combining these results with gene ontology annotation and protein-protein networks, we identified several clusters of functionally related genes. This family wide analysis of molecular evolution in mole-rats has identified a suite of positively selected genes, deepening our understanding of the extreme phenotypic traits exhibited by this group. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Species diversity of planktonic gastropods (Pteropoda and Heteropoda) from six ocean regions based on DNA barcode analysis

    Science.gov (United States)

    Jennings, Robert M.; Bucklin, Ann; Ossenbrügger, Holger; Hopcroft, Russell R.

    2010-12-01

    Pteropods and heteropods are two distinct groups of holoplanktonic gastropods whose species and genetic diversity remain poorly understood, despite their ubiquity in the world's oceans. Some species apparently attain near cosmopolitan distributions, implying long-distance dispersal or cryptic species assemblages. We present the first multi-regional and species-rich molecular dataset of holoplanktonic gastropods, comprising DNA barcodes from the mitochondrial cytochrome c oxidase I subunit gene (COI) from 115 individuals of 41 species sampled from six ocean regions across the globe. Molecular analysis and assessment of barcoding utility supported the validity of several morphological subspecies and forms (e.g. of Creseis virgula and Limacina helicina), while others were not supported (e.g. Cavolinia uncinata). Significant genetic variation was observed among conspecific specimens collected in different geographic regions for some species, particularly in euthecosomatous pteropods. Several species of euthecosomes showed no evidence of genetic separation among distant ocean regions. Overall, we suggest some taxonomic revision of the holoplanktonic gastropods will be required, pending a more complete molecular inventory of these groups.

  19. Outage Performance Analysis of Cooperative Diversity with MRC and SC in Correlated Lognormal Channels

    Directory of Open Access Journals (Sweden)

    Skraparlis D

    2009-01-01

    Full Text Available Abstract The study of relaying systems has found renewed interest in the context of cooperative diversity for communication channels suffering from fading. This paper provides analytical expressions for the end-to-end SNR and outage probability of cooperative diversity in correlated lognormal channels, typically found in indoor and specific outdoor environments. The system under consideration utilizes decode-and-forward relaying and Selection Combining or Maximum Ratio Combining at the destination node. The provided expressions are used to evaluate the gains of cooperative diversity compared to noncooperation in correlated lognormal channels, taking into account the spectral and energy efficiency of the protocols and the half-duplex or full-duplex capability of the relay. Our analysis demonstrates that correlation and lognormal variances play a significant role on the performance gain of cooperative diversity against noncooperation.

  20. Performance Analysis of Free-Space Optical Communication Systems With Multiuser Diversity Over Atmospheric Turbulence Channels

    KAUST Repository

    Yang, Liang

    2014-04-01

    Free-space optical (FSO) communication has become a cost-effective method to provide high data rates. However, the turbulence-induced fading limits its application to short-range applications. To address this, we propose a multiuser diversity (MD) FSO scheme in which the Nth best user is selected and the channel fluctuations can be effectively exploited to produce a selection diversity gain. More specifically, we first present the statistics analysis for the considered system over both weak and strong atmospheric turbulence channels. Based on these statistics, the outage probability, bit-error rate performance, average capacity, diversity order, and coverage are analyzed. Results show that the diversity order for the gamma-gamma fading is N min{α, β}/2, where N is the number of users, and α and β are the channel fading parameters related to the effective atmospheric conditions of the link.

  1. Changes in Soil Organic Matter Abundance, Molecular Composition, and Diversity in an Arid Ecosystem in Response to Long-term Elevated CO2 Manipulation.

    Science.gov (United States)

    Hess, N. J.; Tfaily, M.; Evans, R. D.; Koyama, A.

    2017-12-01

    Little is known about how soils in arid ecosystems will respond to rising atmospheric CO2 concentration yet arid and semi-arid ecosystems cover more than 40% of Earth's land surface. Previous work in the Mojave Desert (Evans et al., 2014 Nature Climate Change) reported higher soil organic carbon (SOC) and total nitrogen (N) concentrations following 10 years exposure to elevated atmospheric CO2 at the Nevada Desert Free-Air-Carbon dioxide-Enrichment (FACE) Facility (NDFF). In this study, we investigated potential mechanisms that resulted in increased SOC and total N accumulation and stabilization using high resolution mass spectrometry at the NDFF site. Samples were collected from soil profiles to 1 m in depth with a 0.2 m a increment under the dominant evergreen shrub Larrea tridentata. The differences in the molecular composition and diversity of soil organic matter (SOM) were more evident in surface soils and declined with depth, and were consistent with higher SOC and total N concentrations under elevated than ambient CO2. Our molecular analysis also suggested increased root exudation and/or microbial necromass from stabilization of labile C and N contributed to SOM and N stocks. Increased microbial activity and metabolism under elevated CO2 compared to ambient plots suggested that elevated CO2 altered microbial carbon (C) use patterns, reflecting changes in the quality and quantity of SOC inputs. We found that plant-derived compounds were primary substrates for microbial activity under elevated CO2 and microbial products were the main constituents of stabilized SOM. Our results suggest that arid ecosystems are a potential large C sink under elevated CO2, give the extensive coverage of the land surface, and that labile compounds are transformed to stable SOM via microbial processes. Arid systems are limited by water, and thus may have a different C storage potential under changing climates than other ecosystems that are limited by nitrogen or phosphorus.

  2. Molecular evidence of cryptic diversity in Paracaryophyllaeus (Cestoda: Caryophyllidea), parasites of loaches (Cobitidae) in Eurasia, including description of P. vladkae n. sp.

    Science.gov (United States)

    Scholz, Tomáš; Oros, Mikuláš; Bazsalovicsová, Eva; Brabec, Jan; Waeschenbach, Andrea; Xi, Bing-Wen; Aydoğdu, Ali; Besprozvannykh, Vladimir; Shimazu, Takeshi; Králová-Hromadová, Ivica; Littlewood, D Timothy J

    2014-12-01

    Molecular phylogenetic analysis of an extensive collection of monozoic tapeworms of the genus Paracaryophyllaeus Kulakovskaya, 1961 (Cestoda: Caryophyllidea), parasites of loaches (Cypriniformes: Cobitidae) in Eurasia, has revealed cryptic species diversity within this long-time monotypic genus, especially in the Paracaryophyllaeus gotoi (Motomura, 1927) species complex [syn. Paracaryophyllaeus dubininorum (Kulakovskaya, 1961); type species]. Three independent, well-supported clades were discovered on the basis of molecular data: (i) specimens from Misgurnus anguillicaudatus and Cobitis lutheri from China, Russian Far East and Japan - called herein P. cf. gotoi 1, which may be conspecific with P. gotoi (Motomura, 1927), although in the absence of sequence data for P. gotoi from its type locality (basin of the River Kumkan in Korea), no certain inferences about their identity can currently be made; (ii) specimens from M. anguillicaudatus from China and Japan - P. cf. gotoi 2, which are morphologically indistinguishable from those of P. cf. gotoi 1; and (iii) morphologically distinct tapeworms from the endemic loach Cobitis bilseli from southwestern Turkey (Beyşehir Lake), which are described herein as a new species. Paracaryophyllaeus vladkae Scholz, Oros and Aydoğdu n. sp. differs from the remaining species of the genus in the following characteristics: the testes begin anterior to the first vitelline follicles (versus posterior), the body is short and robust (versus more elongate and slender), and the scolex is wide, rounded or apically tapered (versus claviform to truncate). Species composition of the genus, host specificity of species and geographical distribution are briefly discussed. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. Molecular Isotopic Distribution Analysis (MIDAs) with adjustable mass accuracy.

    Science.gov (United States)

    Alves, Gelio; Ogurtsov, Aleksey Y; Yu, Yi-Kuo

    2014-01-01

    In this paper, we present Molecular Isotopic Distribution Analysis (MIDAs), a new software tool designed to compute molecular isotopic distributions with adjustable accuracies. MIDAs offers two algorithms, one polynomial-based and one Fourier-transform-based, both of which compute molecular isotopic distributions accurately and efficiently. The polynomial-based algorithm contains few novel aspects, whereas the Fourier-transform-based algorithm consists mainly of improvements to other existing Fourier-transform-based algorithms. We have benchmarked the performance of the two algorithms implemented in MIDAs with that of eight software packages (BRAIN, Emass, Mercury, Mercury5, NeutronCluster, Qmass, JFC, IC) using a consensus set of benchmark molecules. Under the proposed evaluation criteria, MIDAs's algorithms, JFC, and Emass compute with comparable accuracy the coarse-grained (low-resolution) isotopic distributions and are more accurate than the other software packages. For fine-grained isotopic distributions, we compared IC, MIDAs's polynomial algorithm, and MIDAs's Fourier transform algorithm. Among the three, IC and MIDAs's polynomial algorithm compute isotopic distributions that better resemble their corresponding exact fine-grained (high-resolution) isotopic distributions. MIDAs can be accessed freely through a user-friendly web-interface at http://www.ncbi.nlm.nih.gov/CBBresearch/Yu/midas/index.html.

  4. Aegilops tauschii Accessions with Geographically Diverse Origin Show Differences in Chromosome Organization and Polymorphism of Molecular Markers Linked to Leaf Rust and Powdery Mildew Resistance Genes.

    Science.gov (United States)

    Majka, Maciej; Kwiatek, Michał T; Majka, Joanna; Wiśniewska, Halina

    2017-01-01

    Aegilops tauschii (2n = 2x = 14) is a diploid wild species which is reported as a donor of the D-genome of cultivated bread wheat. The main goal of this study was to examine the differences and similarities in chromosomes organization among accessions of Ae. tauschii with geographically diversed origin, which is believed as a potential source of genes, especially determining resistance to fungal diseases (i.e., leaf rust and powdery mildew) for breeding of cereals. We established and compared the fluorescence in situ hybridization patterns of 21 accessions of Ae. tauschii using various repetitive sequences mainly from the BAC library of wheat cultivar Chinese Spring. Results obtained for Ae. tauschii chromosomes revealed many similarities between analyzed accessions, however, some hybridization patterns were specific for accessions, which become from cognate regions of the World. The most noticeable differences were observed for accessions from China which were characterized by presence of distinct signals of pTa-535 in the interstitial region of chromosome 3D, less intensity of pTa-86 signals in chromosome 2D, as well as lack of additional signals of pTa-86 in chromosomes 1D, 5D, or 6D. Ae. tauschii of Chinese origin appeared homogeneous and separate from landraces that originated in western Asia. Ae. tauschii chromosomes showed similar hybridization patterns to wheat D-genome chromosomes, but some differences were also observed among both species. What is more, we identified reciprocal translocation between short arm of chromosome 1D and long arm of chromosome 7D in accession with Iranian origin. High polymorphism between analyzed accessions and extensive allelic variation were revealed using molecular markers associated with resistance genes. Majority of the markers localized in chromosomes 1D and 2D showed the diversity of banding patterns between accessions. Obtained results imply, that there is a moderate or high level of polymorphism in the genome of Ae

  5. ISSR marker-assisted genetic diversity analysis of Dioscorea hispida and selection of the best variety for sustainable production.

    Science.gov (United States)

    Nudin, Nur Fatihah Hasan; Ali, Abdul Manaf; Ngah, Norhayati; Mazlan, Nor Zuhailah; Mat, Nashriyah; Ghani, Mohd Noor Abd; Alias, Nadiawati; Zakaria, Abd Jamil; Jahan, Md Sarwar

    2017-08-01

    Plant breeding is a way of selection of a particular individual for the production of the progeny by separating or combining desired characteristics. The objective of this study was to justify different characteristics of Dioscorea hispida (Ubi gadong) varieties using molecular techniques to select the best variety for sustainable production at the farmer's level. A total of 160 germplasms of Ubi gadong were collected from different locations at the Terengganu and Kelantan states of Malaysia. Forty eight (48) out of 160 germplasms were selected as "primary" selection based on yield and other qualitative characters. Selected collections were then grown and maintained for ISSR marker-assisted genetic diversity analysis. Overall plant growth and yield of tubers were also determined. A total of 12 ISSR markers were tested to justify the characteristics of Ubi gadong varieties among which three markers showed polymorphic bands and on average 57.3% polymorphism were observed representing the highest variation among germplasms. The ISSR marker based on UPGMA cluster analysis grouped all 48 D. hispida into 10 vital groups that proved a vast genetic variation among germplasm collections. Therefore, hybridization should be made between two distant populations. The D. hispida is already proved as the highest starch content tuber crops and very rich in vitamins with both micro and macro minerals. Considering all these criteria and results from marker-assisted diversity analysis, accessions that are far apart based on their genetic coefficient (like DH27 and DH71; DH30 and DH70; DH43 and DH62; DH45 and DH61; DH77 and DH61; DH78 and DH57) could be selected as parents for further breeding programs. This will bring about greater diversity, which will lead to high productive index in terms of increase in yield and overall quality and for the ultimate target of sustainable Ubi gadong production. Copyright © 2017 Académie des sciences. Published by Elsevier Masson SAS. All rights

  6. Molecular characterization and phylogenetic analysis of Fasciola gigantica from Nigeria.

    Science.gov (United States)

    Ichikawa-Seki, Madoka; Tokashiki, Minami; Opara, Maxwell Nwachukwu; Iroh, Gabriel; Hayashi, Kei; Kumar, Uday Mohanta; Itagaki, Tadashi

    2017-02-01

    Fasciola gigantica is considered the major pathogen causing fasciolosis in Africa; however, molecular characterization of this fluke has not been adequately elucidated. It is important to scientifically elucidate the dispersal history of F. gigantica by analyzing its genetic diversity. Fasciola flukes from Nigeria were analyzed using nuclear and mitochondrial DNA markers. A total of 172 Fasciola flukes collected from cattle were identified as F. gigantica because they displayed the F. gigantica fragment pattern in multiplex PCR for the nuclear marker, phosphoenolpyruvate carboxykinase (pepck). In total, 70 haplotypes were detected from Nigerian F. gigantica on the basis of the concatenated sequence of mitochondrial NADH dehydrogenase subunit 1 (nad1) and cytochrome c oxidase 1 (cox1). The index of neutrality (Fu's Fs) suggests rapid expansion of the Nigerian F. gigantica population. Although four haplogroups, Nigeria 1A, 1B, 2A, and 2B, were detected from Nigerian F. gigantica, a climate-specific genetic structure was not observed among F. gigantica populations from three agro-climatic regions (Sahel, Savannah, and Forest). This is probably because of the frequent transportation of livestock from one part of the country to the other. Nigeria 1A and 1B had close relationships with the Egyptian population of F. gigantica, whereas Nigeria 2A and 2B were comparatively related to the Zambian population. No haplotype was shared among the three countries, and it therefore is difficult to estimate the dispersal route of F. gigantica within the African continent. Copyright © 2016. Published by Elsevier Ireland Ltd.

  7. Multilocus sequence analysis (MLSA) of Bradyrhizobium strains: revealing high diversity of tropical diazotrophic symbiotic bacteria.

    Science.gov (United States)

    Delamuta, Jakeline Renata Marçon; Ribeiro, Renan Augusto; Menna, Pâmela; Bangel, Eliane Villamil; Hungria, Mariangela

    2012-04-01

    Symbiotic association of several genera of bacteria collectively called as rhizobia and plants belonging to the family Leguminosae (=Fabaceae) results in the process of biological nitrogen fixation, playing a key role in global N cycling, and also bringing relevant contributions to the agriculture. Bradyrhizobium is considered as the ancestral of all nitrogen-fixing rhizobial species, probably originated in the tropics. The genus encompasses a variety of diverse bacteria, but the diversity captured in the analysis of the 16S rRNA is often low. In this study, we analyzed twelve Bradyrhizobium strains selected from previous studies performed by our group for showing high genetic diversity in relation to the described species. In addition to the 16S rRNA, five housekeeping genes (recA, atpD, glnII, gyrB and rpoB) were analyzed in the MLSA (multilocus sequence analysis) approach. Analysis of each gene and of the concatenated housekeeping genes captured a considerably higher level of genetic diversity, with indication of putative new species. The results highlight the high genetic variability associated with Bradyrhizobium microsymbionts of a variety of legumes. In addition, the MLSA approach has proved to represent a rapid and reliable method to be employed in phylogenetic and taxonomic studies, speeding the identification of the still poorly known diversity of nitrogen-fixing rhizobia in the tropics.

  8. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences.

    Science.gov (United States)

    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K; Maitra, S S

    2015-01-01

    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about "methanogenic archaea composition" and "abundance" in the contrasting ecosystems like "landfill" and "marshland" may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.

  9. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences

    Directory of Open Access Journals (Sweden)

    Shailendra Yadav

    2015-01-01

    Full Text Available Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic and Thaumarchaeota (mesophilic, were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.

  10. Molecular Epidemiology of P. vivax in Iran: High Diversity and Complex Sub-Structure Using Neutral Markers, but No Evidence of Y976F Mutation at pvmdr1.

    Directory of Open Access Journals (Sweden)

    Yaghoob Hamedi

    Full Text Available Malaria remains endemic at low levels in the south-eastern provinces of Iran bordering Afghanistan and Pakistan, with the majority of cases attributable to P. vivax. The national guidelines recommend chloroquine (CQ as blood-stage treatment for uncomplicated P. vivax, but the large influx of imported cases enhances the risk of introducing CQ resistance (CQR.The genetic diversity at pvmdr1, a putative modulator of CQR, and across nine putatively neutral short tandem repeat (STR markers were assessed in P. vivax clinical isolates collected between April 2007 and January 2013 in Hormozgan Province, south-eastern Iran. One hundred blood samples were collected from patients with microscopy-confirmed P. vivax enrolled at one of five district clinics. In total 73 (73% were autochthonous cases, 23 (23% imported cases from Afghanistan or Pakistan, and 4 (4% with unknown origin. 97% (97/100 isolates carried the F1076L mutation, but none carried the Y976F mutation. STR genotyping was successful in 71 (71% isolates, including 57(57% autochthonous and 11 (11% imported cases. Analysis of population structure revealed 2 major sub-populations, K1 and K2, with further sub-structure within K2. The K1 sub-population had markedly lower diversity than K2 (HE = 0.06 vs HE = 0.82 suggesting that the sub-populations were sustained by distinct reservoirs with differing transmission dynamics, possibly reflecting local versus imported/introduced populations. No notable separation was observed between the local and imported cases although the sample size was limited.The contrasting low versus high diversity in the two sub-populations (K1 and K2 infers that a combination of local transmission and cross-border malaria from higher transmission regions shape the genetic make-up of the P. vivax population in south-eastern Iran. There was no molecular evidence of CQR amongst the local or imported cases, but ongoing clinical surveillance is warranted.

  11. [Genetic diversity analysis of Andrographis paniculata in China based on SRAP and SNP].

    Science.gov (United States)

    Chen, Rong; Wang, Xiao-Yun; Song, Yu-Ning; Zhu, Yun-feng; Wang, Peng-liang; Li, Min; Zhong, Guo-Yue

    2014-12-01

    In order to reveal genetic diversity of domestic Andrographis paniculata and its impact on quality, genetic backgrounds of 103 samples from 7 provinces in China were analyzed using SRAP marker and SNP marker. Genetic structures of the A. paniculata populations were estimated with Powermarker V 3.25 and Mega 6.0 software, and polymorphic SNPs were identified with CodonCode Aligner software. The results showed that the genetic distances of domestic A. paniculata germplasm ranged from 0. 01 to 0.09, and no polymorphic SNPs were discovered in coding sequence fragments of ent-copalyl diphosphate synthase. A. paniculata germplasm from various regions in China had poor genetic diversity. This phenomenon was closely related to strict self-fertilization and earlier introduction from the same origin. Therefore, genetic background had little impact on variable qualities of A. paniculata in domestic market. Mutation breeding, polyploid breeding and molecular breeding were proposed as promising strategies in germplasm innovation.

  12. Implementation of force distribution analysis for molecular dynamics simulations

    Directory of Open Access Journals (Sweden)

    Seifert Christian

    2011-04-01

    Full Text Available Abstract Background The way mechanical stress is distributed inside and propagated by proteins and other biopolymers largely defines their function. Yet, determining the network of interactions propagating internal strain remains a challenge for both, experiment and theory. Based on molecular dynamics simulations, we developed force distribution analysis (FDA, a method that allows visualizing strain propagation in macromolecules. Results To be immediately applicable to a wide range of systems, FDA was implemented as an extension to Gromacs, a commonly used package for molecular simulations. The FDA code comes with an easy-to-use command line interface and can directly be applied to every system built using Gromacs. We provide an additional R-package providing functions for advanced statistical analysis and presentation of the FDA data. Conclusions Using FDA, we were able to explain the origin of mechanical robustness in immunoglobulin domains and silk fibers. By elucidating propagation of internal strain upon ligand binding, we previously also successfully revealed the functionality of a stiff allosteric protein. FDA thus has the potential to be a valuable tool in the investigation and rational design of mechanical properties in proteins and nano-materials.

  13. Intraspecific diversity of Monochamus saltuarius (Gebler based on DNA barcode analysis

    Directory of Open Access Journals (Sweden)

    Jun Hyoung Jeon

    2015-12-01

    Full Text Available Monochamus saltuarius has a morphological polymorphism, but there is no standard phenotype to distinguish the differences in M. saltuarius species. To investigate molecular diversity of M. saltuarius, mitochondrial cytochrome c oxidase I 5’ sequence were analyzed against specimens collected from Chungbuk, Gyeonggi, and Gangwon province. The DNA barcode results showed that the specimens make two groups with a 1.68%–3.1% K2P distance, but cannot find a specific phenotype difference among the specimens.

  14. Large scale aggregate microarray analysis reveals three distinct molecular subclasses of human preeclampsia.

    Science.gov (United States)

    Leavey, Katherine; Bainbridge, Shannon A; Cox, Brian J

    2015-01-01

    Preeclampsia (PE) is a life-threatening hypertensive pathology of pregnancy affecting 3-5% of all pregnancies. To date, PE has no cure, early detection markers, or effective treatments short of the removal of what is thought to be the causative organ, the placenta, which may necessitate a preterm delivery. Additionally, numerous small placental microarray studies attempting to identify "PE-specific" genes have yielded inconsistent results. We therefore hypothesize that preeclampsia is a multifactorial disease encompassing several pathology subclasses, and that large cohort placental gene expression analysis will reveal these groups. To address our hypothesis, we utilized known bioinformatic methods to aggregate 7 microarray data sets across multiple platforms in order to generate a large data set of 173 patient samples, including 77 with preeclampsia. Unsupervised clustering of these patient samples revealed three distinct molecular subclasses of PE. This included a "canonical" PE subclass demonstrating elevated expression of known PE markers and genes associated with poor oxygenation and increased secretion, as well as two other subclasses potentially representing a poor maternal response to pregnancy and an immunological presentation of preeclampsia. Our analysis sheds new light on the heterogeneity of PE patients, and offers up additional avenues for future investigation. Hopefully, our subclassification of preeclampsia based on molecular diversity will finally lead to the development of robust diagnostics and patient-based treatments for this disorder.

  15. Delineation of Chondroid Lipoma: An Immunohistochemical and Molecular Biological Analysis

    Science.gov (United States)

    de Vreeze, Ronald S. A.; van Coevorden, Frits; Boerrigter, Lucie; Nederlof, Petra M.; Haas, Rick L.; Bras, Johannes; Rosenwald, Andreas; Mentzel, Thomas; de Jong, Daphne

    2011-01-01

    Aims. Chondroid lipoma (CL) is a benign tumor that mimics a variety of soft tissue tumors and is characterized by translocation t(11;16). Here, we analyze CL and its histological mimics. Methods. CL (n = 4) was compared to a variety of histological mimics (n = 83) for morphological aspects and immunohistochemical features including cyclinD1(CCND1). Using FISH analysis, CCND1 and FUS were investigated as potential translocation partners. Results. All CLs were strongly positive for CCND1. One of 4 myoepitheliomas, CCND1, was positive. In well-differentiated lipomatous tumors and in chondrosarcomas, CCND1 was frequently expressed, but all myxoid liposarcomas were negative. FISH analysis did not give support for direct involvement of CCND1 and FUS as translocation partners. Conclusions. Chondroid lipoma is extremely rare and has several and more prevalent histological mimics. The differential diagnosis of chondroid lipomas can be unraveled using immunohistochemical and molecular support. PMID:21559269

  16. Molecular activation analysis for organo-halogen contaminants in yogurt

    International Nuclear Information System (INIS)

    Zhang Hong; Chai Zhifang

    2004-01-01

    The concentrations of total halogen (TX), extractable organo-halogen (EOX), extractable persistent organo-halogen (EPOX), organo-chlorine pesticides (OCPs) and polychlorinated biphenyls (PCBs) in 18 different yogurt specimens of 14 brands from Beijing, Tianjin, Shanghai, Guangzhou and Shijiazhuang were determined by epithermal neutron activation analysis (ENAA), molecular activation analysis (MAA) and GC-Mass Spectrometry (GC-MS), respectively. The results indicated that the halogen in yogurt mainly existed as inorganic species and non-extractable organo-halogen compounds. About 1/3 to 1/4 of EOX was EPOX. Further, EOCl and EPOCl were the main organo-halogen species in yogurt. The average concentration of the unknown organo-chlorine was 96% of the EPOCl. HCHs and DDTs were still the main contaminants of OCPs in the yogurt of interest. Also, PCB202, PCB103 and PCB208 were the main contaminants of PCBs. (authors)

  17. Molecular analysis of radiation-induced mutations in vitro

    International Nuclear Information System (INIS)

    Kronenberg, A.

    1996-01-01

    This review will focus on the nature of specific locus mutations detected in mammalian cells exposed in vitro to different types of ionizing radiations. Ionizing radiation has been shown to produce a wide variety of heritable alterations in DNA. These range from single base pair substitutions to stable loss or translocation of large portions of whole chromosomes. Data will be reviewed for certain test systems that reveal different mutation spectra. Techniques for the analysis of molecular alterations include applications of the polymerase chain reaction, some of which may be coupled with DNA sequence analysis, and a variety of hybridization-based techniques. The complexity of large scale rearrangements is approached with cytogenetic techniques including high resolution banding and various applications of the fluorescence in situ hybridization (FISH) technique. Radiation-induced mutant frequencies and mutation spectra are a function of the linkage constraints on the recovery of viable mutants for a given locus and test system. 44 refs

  18. Molecular detection and genetic diversity of bovine Babesia spp., Theileria orientalis, and Anaplasma marginale in beef cattle in Thailand.

    Science.gov (United States)

    Jirapattharasate, Charoonluk; Adjou Moumouni, Paul Franck; Cao, Shinuo; Iguchi, Aiko; Liu, Mingming; Wang, Guanbo; Zhou, Mo; Vudriko, Patrick; Efstratiou, Artemis; Changbunjong, Tanasak; Sungpradit, Sivapong; Ratanakorn, Parntep; Moonarmart, Walasinee; Sedwisai, Poonyapat; Weluwanarak, Thekhawet; Wongsawang, Witsanu; Suzuki, Hiroshi; Xuan, Xuenan

    2017-02-01

    Babesia spp., Theileria orientalis, and Anaplasma marginale are significant tick-borne pathogens that affect the health and productivity of cattle in tropical and subtropical areas. In this study, we used PCR to detect the presence of Babesia bovis, Babesia bigemina, and T. orientalis in 279 beef cattle from Western Thailand and A. marginale in 608 beef cattle from the north, northeastern, and western regions. The PCRs were performed using species-specific primers based on the B. bovis spherical body protein 2 (BboSBP2), B. bigemina rhoptry-associated protein 1a (BbiRAP-1a), T. orientalis major piroplasm surface protein (ToMPSP), and A. marginale major surface protein 4 (AmMSP4) genes. To determine the genetic diversity of the above parasites, amplicons of B. bovis and B. bigemina ITS1-5.8s rRNA gene-ITS2 regions (B. bovis ITS, B. bigemina ITS), ToMPSP, and AmMSP4 genes were sequenced for phylogenetic analysis. PCR results revealed that the prevalence of B. bovis, B. bigemina, T. orientalis, and A. marginale in the Western region was 11.1, 12.5, 7.8, and 39.1 %, respectively. Coinfections of two or three parasites were observed in 17.9 % of the animals sampled. The study revealed that the prevalence of A. marginale in the western region was higher than in the north and northeastern regions (7 %). Sequence analysis showed the BboSBP2 gene to be more conserved than B. bovis ITS in the different isolates and, similarly, the BbiRAP-1a was more conserved than B. bigemina ITS. In the phylogenetic analysis, T. orientalis MPSP sequences were classified into types 3, 5, and 7 as previously reported. A. marginale MSP4 gene sequences shared high identity and similarity with each other and clustered with isolates from other countries. This study provides information on the prevalence and genetic diversity of tick-borne pathogens in beef cattle and highlights the need for effective strategies to control these pathogens in Thailand.

  19. How should health service organizations respond to diversity? A content analysis of six approaches.

    Science.gov (United States)

    Seeleman, Conny; Essink-Bot, Marie-Louise; Stronks, Karien; Ingleby, David

    2015-11-16

    Health care organizations need to be responsive to the needs of increasingly diverse patient populations. We compared the contents of six publicly available approaches to organizational responsiveness to diversity. The central questions addressed in this paper are: what are the most consistently recommended issues for health care organizations to address in order to be responsive to the needs of diverse groups that differ from the majority population? How much consensus is there between various approaches? We purposively sampled six approaches from the US, Australia and Europe and used qualitative textual analysis to categorize the content of each approach into domains (conceptually distinct topic areas) and, within each domain, into dimensions (operationalizations). The resulting classification framework was used for comparative analysis of the content of the six approaches. We identified seven domains that were represented in most or all approaches: organizational commitment, empirical evidence on inequalities and needs, a competent and diverse workforce, ensuring access for all users, ensuring responsiveness in care provision, fostering patient and community participation, and actively promoting responsiveness. Variations in the operationalization of these domains related to different scopes, contexts and types of diversity. For example, approaches that focus on ethnic diversity mostly provide recommendations to handle cultural and language differences; approaches that take an intersectional approach and broaden their target population to vulnerable groups in a more general sense also pay attention to factors such as socio-economic status and gender. Despite differences in labeling, there is a broad consensus about what health care organizations need to do in order to be responsive to patient diversity. This opens the way to full scale implementation of organizational responsiveness in healthcare and structured evaluation of its effectiveness in improving

  20. A unified MGF-based capacity analysis of diversity combiners over generalized fading channels

    KAUST Repository

    Yilmaz, Ferkan; Alouini, Mohamed-Slim

    2012-01-01

    Unified exact ergodic capacity results for L-branch coherent diversity combiners including equal-gain combining (EGC) and maximal-ratio combining (MRC) are not known. This paper develops a novel generic framework for the capacity analysis of L-branch