WorldWideScience

Sample records for molecular bar-coded dna

  1. DNA Bar-Coding for Phytoplasma Identification

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2013-01-01

    Phytoplasma identi fi cation has proved dif fi cult due to their inability to be maintained in vitro. DNA barcoding is an identi fi cation method based on comparison of a short DNA sequence with known sequences from a database. A DNA barcoding tool has been developed for phytoplasma identi fi cat...... genes, can be used to identify the following phytoplasma groups: 16SrI, 16SrII, 16SrIII, 16SrIV, 16SrV, 16SrVI, 16SrVII, 16SrIX, 16SrX, 16SrXI, 16SrXII, 16SrXV, 16SrXX, 16SrXXI....... cation. While other sequencebased methods may be well adapted to identification of particular strains of phytoplasmas, often they cannot be used for the simultaneous identification of phytoplasmas from different groups. The phytoplasma DNA barcoding protocol in this chapter, based on the tuf and 16SrRNA......Phytoplasma identi fi cation has proved dif fi cult due to their inability to be maintained in vitro. DNA barcoding is an identi fi cation method based on comparison of a short DNA sequence with known sequences from a database. A DNA barcoding tool has been developed for phytoplasma identi fi...

  2. Bar codes for nuclear safeguards

    International Nuclear Information System (INIS)

    Keswani, A.N.; Bieber, A.M. Jr.

    1983-01-01

    Bar codes similar to those used in supermarkets can be used to reduce the effort and cost of collecting nuclear materials accountability data. A wide range of equipment is now commercially available for printing and reading bar-coded information. Several examples of each of the major types of commercially available equipment are given, and considerations are discussed both for planning systems using bar codes and for choosing suitable bar code equipment

  3. Bar codes for nuclear safeguards

    International Nuclear Information System (INIS)

    Keswani, A.N.; Bieber, A.M.

    1983-01-01

    Bar codes similar to those used in supermarkets can be used to reduce the effort and cost of collecting nuclear materials accountability data. A wide range of equipment is now commercially available for printing and reading bar-coded information. Several examples of each of the major types of commercially-available equipment are given, and considerations are discussed both for planning systems using bar codes and for choosing suitable bar code equipment

  4. Bar code instrumentation for nuclear safeguards

    International Nuclear Information System (INIS)

    Bieber, A.M. Jr.

    1984-01-01

    This paper presents a brief overview of the basic principles of bar codes and the equipment used to make and to read bar code labels, and a summary of some of the more important factors that need to be considered in integrating bar codes into an information system

  5. Bar Coding and Tracking in Pathology.

    Science.gov (United States)

    Hanna, Matthew G; Pantanowitz, Liron

    2016-03-01

    Bar coding and specimen tracking are intricately linked to pathology workflow and efficiency. In the pathology laboratory, bar coding facilitates many laboratory practices, including specimen tracking, automation, and quality management. Data obtained from bar coding can be used to identify, locate, standardize, and audit specimens to achieve maximal laboratory efficiency and patient safety. Variables that need to be considered when implementing and maintaining a bar coding and tracking system include assets to be labeled, bar code symbologies, hardware, software, workflow, and laboratory and information technology infrastructure as well as interoperability with the laboratory information system. This article addresses these issues, primarily focusing on surgical pathology. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Bar code usage in nuclear materials accountability

    International Nuclear Information System (INIS)

    Mee, W.T.

    1983-01-01

    The Oak Ridge Y-12 Plant began investigating the use of automated data collection devices in 1979. At this time, bar code and optical-character-recognition (OCR) systems were reviewed with the purpose of directly entering data into DYMCAS (Dynamic Special Nuclear Materials Control and Accountability System). Both of these systems appeared applicable, however, other automated devices already employed for production control made implementing the bar code and OCR seem improbable. However, the DYMCAS was placed on line for nuclear material accountability, a decision was made to consider the bar code for physical inventory listings. For the past several months a development program has been underway to use a bar code device to collect and input data to the DYMCAS on the uranium recovery operations. Programs have been completed and tested, and are being employed to ensure that data will be compatible and useful. Bar code implementation and expansion of its use for all nuclear material inventory activity in Y-12 is presented

  7. Bar code usage in nuclear materials accountability

    International Nuclear Information System (INIS)

    Mee, W.T.

    1983-01-01

    The age old method of physically taking an inventory of materials by listing each item's identification number has lived beyond its usefulness. In this age of computerization, which offers the local grocery store a quick, sure, and easy means to inventory, it is time for nuclear materials facilities to automate accountability activities. The Oak Ridge Y-12 Plant began investigating the use of automated data collection devices in 1979. At that time, bar code and optical-character-recognition (OCR) systems were reviewed with the purpose of directly entering data into DYMCAS (Dynamic Special Nuclear Materials Control and Accountability System). Both of these systems appeared applicable; however, other automated devices already employed for production control made implementing the bar code and OCR seem improbable. However, the DYMCAS was placed on line for nuclear material accountability, a decision was made to consider the bar code for physical inventory listings. For the past several months a development program has been underway to use a bar code device to collect and input data to the DYMCAS on the uranium recovery operations. Programs have been completed and tested, and are being employed to ensure that data will be compatible and useful. Bar code implementation and expansion of its use for all nuclear material inventory activity in Y-12 is presented

  8. A bar coding system for environmental projects

    International Nuclear Information System (INIS)

    Barber, R.B.; Hunt, B.J.; Burgess, G.M.

    1988-01-01

    This paper presents BeCode systems, a bar coding system which provides both nuclear and commercial clients with a data capture and custody management program that is accurate, timely, and beneficial to all levels of project operations. Using bar code identifiers is an essentially paperless and error-free method which provides more efficient delivery of data through its menu card-driven structure, which speeds collection of essential data for uploading to a compatible device. The effects of this sequence include real-time information for operator analysis, management review, audits, planning, scheduling, and cost control

  9. Bar-code automated waste tracking system

    International Nuclear Information System (INIS)

    Hull, T.E.

    1994-10-01

    The Bar-Code Automated Waste Tracking System was designed to be a site-Specific program with a general purpose application for transportability to other facilities. The system is user-friendly, totally automated, and incorporates the use of a drive-up window that is close to the areas dealing in container preparation, delivery, pickup, and disposal. The system features ''stop-and-go'' operation rather than a long, tedious, error-prone manual entry. The system is designed for automation but allows operators to concentrate on proper handling of waste while maintaining manual entry of data as a backup. A large wall plaque filled with bar-code labels is used to input specific details about any movement of waste

  10. 21 CFR 610.67 - Bar code label requirements.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Bar code label requirements. 610.67 Section 610.67...) BIOLOGICS GENERAL BIOLOGICAL PRODUCTS STANDARDS Labeling Standards § 610.67 Bar code label requirements. Biological products must comply with the bar code requirements at § 201.25 of this chapter. However, the bar...

  11. Objectivity in Grading: The Promise of Bar Codes

    Science.gov (United States)

    Jae, Haeran; Cowling, John

    2009-01-01

    This article proposes the use of a new technology to assure student anonymity and reduce bias hazards: identifying students by using bar codes. The limited finding suggests that the use of bar codes for assuring student anonymity could potentially cause students to perceive that grades are assigned more fairly and reassure teachers that they are…

  12. Nanoparticle based bio-bar code technology for trace analysis of aflatoxin B1 in Chinese herbs

    Directory of Open Access Journals (Sweden)

    Yu-yan Yu

    2018-04-01

    Full Text Available A novel and sensitive assay for aflatoxin B1 (AFB1 detection has been developed by using bio-bar code assay (BCA. The method that relies on polyclonal antibodies encoded with DNA modified gold nanoparticle (NP and monoclonal antibodies modified magnetic microparticle (MMP, and subsequent detection of amplified target in the form of bio-bar code using a fluorescent quantitative polymerase chain reaction (FQ-PCR detection method. First, NP probes encoded with DNA that was unique to AFB1, MMP probes with monoclonal antibodies that bind AFB1 specifically were prepared. Then, the MMP-AFB1-NP sandwich compounds were acquired, dehybridization of the oligonucleotides on the nanoparticle surface allows the determination of the presence of AFB1 by identifying the oligonucleotide sequence released from the NP through FQ-PCR detection. The bio-bar code techniques system for detecting AFB1 was established, and the sensitivity limit was about 10−8 ng/mL, comparable ELISA assays for detecting the same target, it showed that we can detect AFB1 at low attomolar levels with the bio-bar-code amplification approach. This is also the first demonstration of a bio-bar code type assay for the detection of AFB1 in Chinese herbs. Keywords: Aflatoxin B1, Bio-bar code assay, Chinese herbs, Magnetic microparticle probes, Nanoparticle probes

  13. PCR-free quantitative detection of genetically modified organism from raw materials. An electrochemiluminescence-based bio bar code method.

    Science.gov (United States)

    Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R

    2008-05-15

    A bio bar code assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio bar code assay requires lengthy experimental procedures including the preparation and release of bar code DNA probes from the target-nanoparticle complex and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio bar code assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2,2'-bipyridyl) ruthenium (TBR)-labeled bar code DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products.

  14. Nanoparticle based bio-bar code technology for trace analysis of aflatoxin B1 in Chinese herbs.

    Science.gov (United States)

    Yu, Yu-Yan; Chen, Yuan-Yuan; Gao, Xuan; Liu, Yuan-Yuan; Zhang, Hong-Yan; Wang, Tong-Ying

    2018-04-01

    A novel and sensitive assay for aflatoxin B1 (AFB1) detection has been developed by using bio-bar code assay (BCA). The method that relies on polyclonal antibodies encoded with DNA modified gold nanoparticle (NP) and monoclonal antibodies modified magnetic microparticle (MMP), and subsequent detection of amplified target in the form of bio-bar code using a fluorescent quantitative polymerase chain reaction (FQ-PCR) detection method. First, NP probes encoded with DNA that was unique to AFB1, MMP probes with monoclonal antibodies that bind AFB1 specifically were prepared. Then, the MMP-AFB1-NP sandwich compounds were acquired, dehybridization of the oligonucleotides on the nanoparticle surface allows the determination of the presence of AFB1 by identifying the oligonucleotide sequence released from the NP through FQ-PCR detection. The bio-bar code techniques system for detecting AFB1 was established, and the sensitivity limit was about 10 -8  ng/mL, comparable ELISA assays for detecting the same target, it showed that we can detect AFB1 at low attomolar levels with the bio-bar-code amplification approach. This is also the first demonstration of a bio-bar code type assay for the detection of AFB1 in Chinese herbs. Copyright © 2017. Published by Elsevier B.V.

  15. Phylogenetic reconstruction in the order Nymphaeales: ITS2 secondary structure analysis and in silico testing of maturase k (matK) as a potential marker for DNA bar coding.

    Science.gov (United States)

    Biswal, Devendra Kumar; Debnath, Manish; Kumar, Shakti; Tandon, Pramod

    2012-01-01

    The Nymphaeales (waterlilly and relatives) lineage has diverged as the second branch of basal angiosperms and comprises of two families: Cabombaceae and Nymphaceae. The classification of Nymphaeales and phylogeny within the flowering plants are quite intriguing as several systems (Thorne system, Dahlgren system, Cronquist system, Takhtajan system and APG III system (Angiosperm Phylogeny Group III system) have attempted to redefine the Nymphaeales taxonomy. There have been also fossil records consisting especially of seeds, pollen, stems, leaves and flowers as early as the lower Cretaceous. Here we present an in silico study of the order Nymphaeales taking maturaseK (matK) and internal transcribed spacer (ITS2) as biomarkers for phylogeny reconstruction (using character-based methods and Bayesian approach) and identification of motifs for DNA barcoding. The Maximum Likelihood (ML) and Bayesian approach yielded congruent fully resolved and well-supported trees using a concatenated (ITS2+ matK) supermatrix aligned dataset. The taxon sampling corroborates the monophyly of Cabombaceae. Nuphar emerges as a monophyletic clade in the family Nymphaeaceae while there are slight discrepancies in the monophyletic nature of the genera Nymphaea owing to Victoria-Euryale and Ondinea grouping in the same node of Nymphaeaceae. ITS2 secondary structures alignment corroborate the primary sequence analysis. Hydatellaceae emerged as a sister clade to Nymphaeaceae and had a basal lineage amongst the water lilly clades. Species from Cycas and Ginkgo were taken as outgroups and were rooted in the overall tree topology from various methods. MatK genes are fast evolving highly variant regions of plant chloroplast DNA that can serve as potential biomarkers for DNA barcoding and also in generating primers for angiosperms with identification of unique motif regions. We have reported unique genus specific motif regions in the Order Nymphaeles from matK dataset which can be further validated for

  16. Measuring and test equipment control through bar-code technology

    International Nuclear Information System (INIS)

    Crockett, J.D.; Carr, C.C.

    1993-01-01

    Over the past several years, the use, tracking, and documentation of measuring and test equipment (M ampersand TE) has become a major issue. New regulations are forcing companies to develop new policies for providing use history, traceability, and accountability of M ampersand TE. This paper discusses how the Fast Flux Test Facility (FFTF), operated by Westinghouse Hanford Company and located at the Hanford site in Rich- land, Washington, overcame these obstacles by using a computerized system exercising bar-code technology. A data base was developed to identify M ampersand TE containing 33 separate fields, such as manufacturer, model, range, bar-code number, and other pertinent information. A bar-code label was attached to each piece of M ampersand TE. A second data base was created to identify the employee using the M ampersand TE. The fields contained pertinent user information such as name, location, and payroll number. Each employee's payroll number was bar coded and attached to the back of their identification badge. A computer program was developed to automate certain tasks previously performed and tracked by hand. Bar-code technology was combined with this computer program to control the input and distribution of information, eliminate common mistakes, electronically store information, and reduce the time required to check out the M ampersand TE for use

  17. Application bar-code system for solid radioactive waste management

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Y. H.; Kim, T. K.; Kang, I. S.; Cho, H. S.; Son, J. S. [KAERI, Taejon (Korea, Republic of)

    2004-07-01

    Solid radioactive wastes are generated from the post-irradiated fuel examination facility, the irradiated material examination facility, the research reactor, and the laboratories at KAERI. A bar-code system for a solid radioactive waste management of a research organization became necessary while developing the RAWMIS(Radioactive Waste Management Integration System) which it can generate personal history management for efficient management of a waste, documents, all kinds of statistics. This paper introduces an input and output application program design to do to database with data in the results and a stream process of a treatment that analyzed the waste occurrence present situation and data by bar-code system.

  18. 21 CFR 201.25 - Bar code label requirements.

    Science.gov (United States)

    2010-04-01

    ... Number/Uniform Code Council (EAN.UCC) or Health Industry Business Communications Council (HIBCC... alternative regulatory program or method of product use renders the bar code unnecessary for patient safety... Evaluation and Research, Food and Drug Administration, 5600 Fishers Lane, Rockville, MD 20857 (requests...

  19. CERN access cards - Introduction of a bar code (Reminder)

    CERN Multimedia

    Relations with the Host States Service

    2004-01-01

    In accordance with the latest revised version of the implementation measures relating to Operational Circular No. 2, CERN access cards may bear a bar code transcribing the holder's identification number (the revised version of this subsidiary document to the aforementioned Circular will be published shortly). Relations with the Host States Service http://www.cern.ch/relations/ relations.secretariat@cern.ch Tel. 72848

  20. Improving radiopharmaceutical supply chain safety by implementing bar code technology.

    Science.gov (United States)

    Matanza, David; Hallouard, François; Rioufol, Catherine; Fessi, Hatem; Fraysse, Marc

    2014-11-01

    The aim of this study was to describe and evaluate an approach for improving radiopharmaceutical supply chain safety by implementing bar code technology. We first evaluated the current situation of our radiopharmaceutical supply chain and, by means of the ALARM protocol, analysed two dispensing errors that occurred in our department. Thereafter, we implemented a bar code system to secure selected key stages of the radiopharmaceutical supply chain. Finally, we evaluated the cost of this implementation, from overtime, to overheads, to additional radiation exposure to workers. An analysis of the events that occurred revealed a lack of identification of prepared or dispensed drugs. Moreover, the evaluation of the current radiopharmaceutical supply chain showed that the dispensation and injection steps needed to be further secured. The bar code system was used to reinforce product identification at three selected key stages: at usable stock entry; at preparation-dispensation; and during administration, allowing to check conformity between the labelling of the delivered product (identity and activity) and the prescription. The extra time needed for all these steps had no impact on the number and successful conduct of examinations. The investment cost was reduced (2600 euros for new material and 30 euros a year for additional supplies) because of pre-existing computing equipment. With regard to the radiation exposure to workers there was an insignificant overexposure for hands with this new organization because of the labelling and scanning processes of radiolabelled preparation vials. Implementation of bar code technology is now an essential part of a global securing approach towards optimum patient management.

  1. 77 FR 49818 - Agency Information Collection Activities; Proposed Collection; Comment Request; Bar Code Label...

    Science.gov (United States)

    2012-08-17

    ...] Agency Information Collection Activities; Proposed Collection; Comment Request; Bar Code Label... allow 60 days for public comment in response to the notice. This notice solicits comments on the bar... technology. Bar Code Label Requirement for Human Drug and Biological Products--(OMB Control Number 0910-0537...

  2. Bar Coding the U. S. Government Bill of Lading and the Material Inspection and Receiving Report.

    Science.gov (United States)

    1984-12-01

    of respondents K because some of the replies did not respond to this question.) TABLE 3-2. DD 250 PROCESSING CAPABILITIES AUTOMiATED - BAR CODE...Proposed minimum data elements (both human readable and bar coded) required and why? (3) Proposed signature requirement changes and why? (4) Proposed

  3. The cost of implementing inpatient bar code medication administration.

    Science.gov (United States)

    Sakowski, Julie Ann; Ketchel, Alan

    2013-02-01

    To calculate the costs associated with implementing and operating an inpatient bar-code medication administration (BCMA) system in the community hospital setting and to estimate the cost per harmful error prevented. This is a retrospective, observational study. Costs were calculated from the hospital perspective and a cost-consequence analysis was performed to estimate the cost per preventable adverse drug event averted. Costs were collected from financial records and key informant interviews at 4 not-for profit community hospitals. Costs included direct expenditures on capital, infrastructure, additional personnel, and the opportunity costs of time for existing personnel working on the project. The number of adverse drug events prevented using BCMA was estimated by multiplying the number of doses administered using BCMA by the rate of harmful errors prevented by interventions in response to system warnings. Our previous work found that BCMA identified and intercepted medication errors in 1.1% of doses administered, 9% of which potentially could have resulted in lasting harm. The cost of implementing and operating BCMA including electronic pharmacy management and drug repackaging over 5 years is $40,000 (range: $35,600 to $54,600) per BCMA-enabled bed and $2000 (range: $1800 to $2600) per harmful error prevented. BCMA can be an effective and potentially cost-saving tool for preventing the harm and costs associated with medication errors.

  4. A bar-code reader for an alpha-beta automatic counting system - FAG

    International Nuclear Information System (INIS)

    Levinson, S.; Shemesh, Y.; Ankry, N.; Assido, H.; German, U.; Peled, O.

    1996-01-01

    A bar-code laser system for sample number reading was integrated into the FAG Alpha-Beta automatic counting system. The sample identification by means of an attached bar-code label enables unmistakable and reliable attribution of results to the counted sample. Installation of the bar-code reader system required several modifications: Mechanical changes in the automatic sample changer, design and production of new sample holders, modification of the sample planchettes, changes in the electronic system, update of the operating software of the system (authors)

  5. The study of watermark bar code recognition with light transmission theory

    Science.gov (United States)

    Zhang, Fan; Liu, Tiegen; Zhang, Lianxiang; Zhang, Xiaojun

    2004-10-01

    Watermark bar code is one of the latest anti-counterfeiting technologies, which is applicable to a series of security documents, especially banknotes. With watermark bar codes embedded euro banknotes as an example, a system is designed for watermark bar code detection and recognition based on light transmission theory. We obtain light transmission curves of different denominations along different sampling lines which are paralleled to the latitudinal axis of the banknote. By calculating the correlation coefficient between different light transmission curves, the system can not only distinguish the reference banknote from either the counterfeit ones or other denominations, but also demonstrates high consistency and repeatability.

  6. A bar-code reader for an alpha-beta automatic counting system - FAG

    Energy Technology Data Exchange (ETDEWEB)

    Levinson, S; Shemesh, Y; Ankry, N; Assido, H; German, U; Peled, O [Israel Atomic Energy Commission, Beersheba (Israel). Nuclear Research Center-Negev

    1996-12-01

    A bar-code laser system for sample number reading was integrated into the FAG Alpha-Beta automatic counting system. The sample identification by means of an attached bar-code label enables unmistakable and reliable attribution of results to the counted sample. Installation of the bar-code reader system required several modifications: Mechanical changes in the automatic sample changer, design and production of new sample holders, modification of the sample planchettes, changes in the electronic system, update of the operating software of the system (authors).

  7. Application of bar codes to the automation of analytical sample data collection

    International Nuclear Information System (INIS)

    Jurgensen, H.A.

    1986-01-01

    The Health Protection Department at the Savannah River Plant collects 500 urine samples per day for tritium analyses. Prior to automation, all sample information was compiled manually. Bar code technology was chosen for automating this program because it provides a more accurate, efficient, and inexpensive method for data entry. The system has three major functions: sample labeling is accomplished at remote bar code label stations composed of an Intermec 8220 (Intermec Corp.) interfaced to an IBM-PC, data collection is done on a central VAX 11/730 (Digital Equipment Corp.). Bar code readers are used to log-in samples to be analyzed on liquid scintillation counters. The VAX 11/730 processes the data and generates reports, data storage is on the VAX 11/730 and backed up on the plant's central computer. A brief description of several other bar code applications at the Savannah River Plant is also presented

  8. Use the Bar Code System to Improve Accuracy of the Patient and Sample Identification.

    Science.gov (United States)

    Chuang, Shu-Hsia; Yeh, Huy-Pzu; Chi, Kun-Hung; Ku, Hsueh-Chen

    2018-01-01

    In time and correct sample collection were highly related to patient's safety. The sample error rate was 11.1%, because misbranded patient information and wrong sample containers during January to April, 2016. We developed a barcode system of "Specimens Identify System" through process of reengineering of TRM, used bar code scanners, add sample container instructions, and mobile APP. Conclusion, the bar code systems improved the patient safety and created green environment.

  9. DNA adducts as molecular dosimeters

    International Nuclear Information System (INIS)

    Lucier, G.W.

    1990-01-01

    There is compelling evidence that DNA adducts play an important role in the actions of many pulmonary carcinogens. During the last ten years sensitive methods (antibodies and 32 P-postlabeling) have been developed that permit detection of DNA adducts in tissues of animals or humans exposed to low levels of some genotoxic carcinogens. This capability has led to approaches designed to more reliably estimate the shape of the dose-response curve in the low dose region for a few carcinogens. Moreover, dosimetry comparisions can, in some cases, be made between animals and humans which help in judging the adequacy of animal models for human risk assessments. There are several points that need to be considered in the evaluation of DNA adducts as a molecular dosimeter. For example, DNA adduct formation is only one of many events that are needed for tumor development and some potent carcinogens do not form DNA adducts; i.e., TCDD. Other issues that need to be considered are DNA adduct heterogeneity, DNA repair, relationship of DNA adducts to somatic mutation and cell specificity in DNA adduct formation and persistence. Molecular epidemiology studies often require quantitation of adducts in cells such as lymphocytes which may or may not be reliable surrogates for adduct concentrations in target issues. In summary, accurate quantitation of low levels of DNA adducts may provide data useful in species to species extrapolation of risk including the development of more meaningful human monitoring programs

  10. Management of manufacture and installation of plant pipings by bar code system

    International Nuclear Information System (INIS)

    Suwa, Minoru

    1995-01-01

    As for the piping system of nuclear power plants, the number of parts is very large, and the mill sheet is attached to each part, therefore, it is necessary to manage them individually, and large man power is required. In order to resolve the delay of mechanization in the factory, bar code system was adopted on full scale. At the time of taking parts out from the store, bar code labels are stuck to all piping parts. By this means, all the processes of manufacture and inspection are managed with a computer, and it is useful for labor saving and the prevention of mistaken input. This system is centering around the system of the progress management for piping manufacture, and is operated by being coupled with respective systems of production design, order and inventory, mill sheet management and installation management. The management of production design, manufacture, inspection and installation is explained. There is the problem of sticking bar code labels again as the labels become dirty or parts pass through coating and pickling processes. The direct carving of bar codes on parts by laser marker was tried, and it was successful for stainless steel, but in carbon steel pipes, it was hard to read. It is desirable to develop the bar codes which endure until the end of plant life. (K.I.)

  11. Integrating bar-code devices with computerized MC and A systems

    International Nuclear Information System (INIS)

    Anderson, L.K.; Boor, M.G.; Hurford, J.M.

    1998-01-01

    Over the past seven years, Los Alamos National Laboratory developed several generations of computerized nuclear materials control and accountability (MC and A) systems for tracking and reporting the storage, movement, and management of nuclear materials at domestic and international facilities. During the same period, Oak Ridge National Laboratory was involved with automated data acquisition (ADA) equipment, including installation of numerous bar-code scanning stations at various facilities to serve as input devices to computerized systems. Bar-code readers, as well as other ADA devices, reduce input errors, provide faster input, and allow the capture of data in remote areas where workstations do not exist. Los Alamos National Laboratory and Oak Ridge National Laboratory teamed together to implement the integration of bar-code hardware technology with computerized MC and A systems. With the expertise of both sites, the two technologies were successfully merged with little difficulty. Bar-code input is now available with several functions of the MC and A systems: material movements within material balance areas (MBAs), material movements between MBAs, and physical inventory verification. This paper describes the various components required for the integration of these MC and A systems with the installed bar-code reader devices and the future directions for these technologies

  12. DNA: Polymer and molecular code

    Science.gov (United States)

    Shivashankar, G. V.

    1999-10-01

    The thesis work focusses upon two aspects of DNA, the polymer and the molecular code. Our approach was to bring single molecule micromanipulation methods to the study of DNA. It included a home built optical microscope combined with an atomic force microscope and an optical tweezer. This combined approach led to a novel method to graft a single DNA molecule onto a force cantilever using the optical tweezer and local heating. With this method, a force versus extension assay of double stranded DNA was realized. The resolution was about 10 picoN. To improve on this force measurement resolution, a simple light backscattering technique was developed and used to probe the DNA polymer flexibility and its fluctuations. It combined the optical tweezer to trap a DNA tethered bead and the laser backscattering to detect the beads Brownian fluctuations. With this technique the resolution was about 0.1 picoN with a millisecond access time, and the whole entropic part of the DNA force-extension was measured. With this experimental strategy, we measured the polymerization of the protein RecA on an isolated double stranded DNA. We observed the progressive decoration of RecA on the l DNA molecule, which results in the extension of l , due to unwinding of the double helix. The dynamics of polymerization, the resulting change in the DNA entropic elasticity and the role of ATP hydrolysis were the main parts of the study. A simple model for RecA assembly on DNA was proposed. This work presents a first step in the study of genetic recombination. Recently we have started a study of equilibrium binding which utilizes fluorescence polarization methods to probe the polymerization of RecA on single stranded DNA. In addition to the study of material properties of DNA and DNA-RecA, we have developed experiments for which the code of the DNA is central. We studied one aspect of DNA as a molecular code, using different techniques. In particular the programmatic use of template specificity makes

  13. Addressing challenges in bar-code scanning of large-volume infusion bags.

    Science.gov (United States)

    Raman, Kirthana; Heelon, Mark; Kerr, Gary; Higgins, Thomas L

    2011-08-01

    A hospital pharmacy's efforts to identify and address challenges with bedside scanning of bar codes on large-volume parenteral (LVP) infusion bags are described. Bar-code-assisted medication administration (BCMA) has been shown to reduce medication errors and improve patient safety. After the pilot implementation of a BCMA system and point-of-care scanning procedures at a medical center's intensive care unit, it was noted that nurses' attempted bedside scans of certain LVP bags for product identification purposes often were not successful. An investigation and root-cause analysis, including observation of nurses' scanning technique by a multidisciplinary team, determined that the scanning failures stemmed from the placement of two bar-code imprints-one with the product identification code and another, larger imprint with the expiration date and lot number-adjacently on the LVP bags. The nursing staff was educated on a modified scanning technique, which resulted in significantly improved success rates in the scanning of the most commonly used LVP bags. Representatives of the LVP bag manufacturer met with hospital staff to discuss the problem and corrective measures. As part of a subsequent infusion bag redesign, the manufacturer discontinued the use of the bar-code imprint implicated in the scanning failures. Failures in scanning LVP bags were traced to problematic placement of bar-code imprints on the bags. Interdisciplinary collaboration, consultation with the bag manufacturer, and education of the nursing and pharmacy staff resulted in a reduction in scanning failures and the manufacturer's removal of one of the bar codes from its LVP bags.

  14. 76 FR 66235 - Bar Code Technologies for Drugs and Biological Products; Retrospective Review Under Executive...

    Science.gov (United States)

    2011-10-26

    ... interactions, overdoses, and patient allergies) and retail pharmacy-based computer systems that use a bar-coded... drugs. The goal of this initiative is to implement a system to further ensure patient safety and to..., and ideas on the need, maturity, and acceptability of alternative identification technologies for the...

  15. The Impact of Bar Code Medication Administration Technology on Reported Medication Errors

    Science.gov (United States)

    Holecek, Andrea

    2011-01-01

    The use of bar-code medication administration technology is on the rise in acute care facilities in the United States. The technology is purported to decrease medication errors that occur at the point of administration. How significantly this technology affects actual rate and severity of error is unknown. This descriptive, longitudinal research…

  16. More Than Bar Codes: Integrating Global Standards-Based Bar Code Technology Into National Health Information Systems in Ethiopia and Pakistan to Increase End-to-End Supply Chain Visibility.

    Science.gov (United States)

    Hara, Liuichi; Guirguis, Ramy; Hummel, Keith; Villanueva, Monica

    2017-12-28

    The United Nations Population Fund (UNFPA) and the United States Agency for International Development (USAID) DELIVER PROJECT work together to strengthen public health commodity supply chains by standardizing bar coding under a single set of global standards. From 2015, UNFPA and USAID collaborated to pilot test how tracking and tracing of bar coded health products could be operationalized in the public health supply chains of Ethiopia and Pakistan and inform the ecosystem needed to begin full implementation. Pakistan had been using proprietary bar codes for inventory management of contraceptive supplies but transitioned to global standards-based bar codes during the pilot. The transition allowed Pakistan to leverage the original bar codes that were preprinted by global manufacturers as opposed to printing new bar codes at the central warehouse. However, barriers at lower service delivery levels prevented full realization of end-to-end data visibility. Key barriers at the district level were the lack of a digital inventory management system and absence of bar codes at the primary-level packaging level, such as single blister packs. The team in Ethiopia developed an open-sourced smartphone application that allowed the team to scan bar codes using the mobile phone's camera and to push the captured data to the country's data mart. Real-time tracking and tracing occurred from the central warehouse to the Addis Ababa distribution hub and to 2 health centers. These pilots demonstrated that standardized product identification and bar codes can significantly improve accuracy over manual stock counts while significantly streamlining the stock-taking process, resulting in efficiencies. The pilots also showed that bar coding technology by itself is not sufficient to ensure data visibility. Rather, by using global standards for identification and data capture of pharmaceuticals and medical devices, and integrating the data captured into national and global tracking systems

  17. Patient safety with blood products administration using wireless and bar-code technology.

    Science.gov (United States)

    Porcella, Aleta; Walker, Kristy

    2005-01-01

    Supported by a grant from the Agency for Healthcare Research and Quality, a University of Iowa Hospitals and Clinics interdisciplinary research team created an online data-capture-response tool utilizing wireless mobile devices and bar code technology to track and improve blood products administration process. The tool captures 1) sample collection, 2) sample arrival in the blood bank, 3) blood product dispense from blood bank, and 4) administration. At each step, the scanned patient wristband ID bar code is automatically compared to scanned identification barcode on requisition, sample, and/or product, and the system presents either a confirmation or an error message to the user. Following an eight-month, 5 unit, staged pilot, a 'big bang,' hospital-wide implementation occurred on February 7, 2005. Preliminary results from pilot data indicate that the new barcode process captures errors 3 to 10 times better than the old manual process.

  18. Pictorial AR Tag with Hidden Multi-Level Bar-Code and Its Potential Applications

    Directory of Open Access Journals (Sweden)

    Huy Le

    2017-09-01

    Full Text Available For decades, researchers have been trying to create intuitive virtual environments by blending reality and virtual reality, thus enabling general users to interact with the digital domain as easily as with the real world. The result is “augmented reality” (AR. AR seamlessly superimposes virtual objects on to a real environment in three dimensions (3D and in real time. One of the most important parts that helps close the gap between virtuality and reality is the marker used in the AR system. While pictorial marker and bar-code marker are the two most commonly used marker types in the market, they have some disadvantages in visual and processing performance. In this paper, we present a novelty method that combines the bar-code with the original feature of a colour picture (e.g., photos, trading cards, advertisement’s figure. Our method decorates on top of the original pictorial images additional features with a single stereogram image that optically conceals a multi-level (3D bar-code. Thus, it has a larger capability of storing data compared to the general 1D barcode. This new type of marker has the potential of addressing the issues that the current types of marker are facing. It not only keeps the original information of the picture but also contains encoded numeric information. In our limited evaluation, this pictorial bar-code shows a relatively robust performance under various conditions and scaling; thus, it provides a promising AR approach to be used in many applications such as trading card games, educations, and advertisements.

  19. A Cost-Benefit Between Pyxis and Bar Coding for the Brooke Army Medical Center Operating Room

    Science.gov (United States)

    2005-04-29

    38 C onclusions ...................................................................................... 39 A ppendices ...designed for the care of patients Pyxis vs. Bar Coding 8 by surgical practitioners, namely the acute care hospitals. Thus, hospital facilities began to

  20. Analysis of the technology acceptance model in examining hospital nurses' behavioral intentions toward the use of bar code medication administration.

    Science.gov (United States)

    Song, Lunar; Park, Byeonghwa; Oh, Kyeung Mi

    2015-04-01

    Serious medication errors continue to exist in hospitals, even though there is technology that could potentially eliminate them such as bar code medication administration. Little is known about the degree to which the culture of patient safety is associated with behavioral intention to use bar code medication administration. Based on the Technology Acceptance Model, this study evaluated the relationships among patient safety culture and perceived usefulness and perceived ease of use, and behavioral intention to use bar code medication administration technology among nurses in hospitals. Cross-sectional surveys with a convenience sample of 163 nurses using bar code medication administration were conducted. Feedback and communication about errors had a positive impact in predicting perceived usefulness (β=.26, Pmodel predicting for behavioral intention, age had a negative impact (β=-.17, Pmodel explained 24% (Ptechnology.

  1. Molecular Combing of DNA: Methods and Applications

    DEFF Research Database (Denmark)

    Nazari, Zeniab Esmail; Gurevich, Leonid

    2013-01-01

    studies to nanoelectronics. While molecular combing has been applied in a variety of DNA-related studies, no comprehensive review has been published on different combing methods proposed so far. In this review, the underlying mechanisms of molecular combing of DNA are described followed by discussion...

  2. Development of Attendance Database System Using Bar-coded Student Card

    Directory of Open Access Journals (Sweden)

    Abdul Fadlil

    2008-04-01

    Full Text Available The calculation of the level of attendance is very important, because one indicator of a person's credibility can be seen from the level of attendance. For example, at a university, data about the level of attendance of a student in a lecture is very important as one of components in the assessment. The manual presence system is considered less effective. This research presents the draft of presence system using bar codes (barcodes as input data representing the attendance. The presence system is supported by three main components, those are a bar code found on the student card (KTM, a CCD barcode scanner series and a CD-108E computer. Management of attendance list using this system allows for optimization of functions of KTM. The presence system has been tested with several KTM through a variety of distances and positions of the barcode scanner barcode. The test results is obtained at ideal position for reading a barcode when a barcode scanner is at 2 cm from the object with 90 degree. At this position the level of accuracy reach 100%.

  3. The design of the CMOS wireless bar code scanner applying optical system based on ZigBee

    Science.gov (United States)

    Chen, Yuelin; Peng, Jian

    2008-03-01

    The traditional bar code scanner is influenced by the length of data line, but the farthest distance of the wireless bar code scanner of wireless communication is generally between 30m and 100m on the market. By rebuilding the traditional CCD optical bar code scanner, a CMOS code scanner is designed based on the ZigBee to meet the demands of market. The scan system consists of the CMOS image sensor and embedded chip S3C2401X, when the two dimensional bar code is read, the results show the inaccurate and wrong code bar, resulted from image defile, disturber, reads image condition badness, signal interference, unstable system voltage. So we put forward the method which uses the matrix evaluation and Read-Solomon arithmetic to solve them. In order to construct the whole wireless optics of bar code system and to ensure its ability of transmitting bar code image signals digitally with long distances, ZigBee is used to transmit data to the base station, and this module is designed based on image acquisition system, and at last the wireless transmitting/receiving CC2430 module circuit linking chart is established. And by transplanting the embedded RTOS system LINUX to the MCU, an applying wireless CMOS optics bar code scanner and multi-task system is constructed. Finally, performance of communication is tested by evaluation software Smart RF. In broad space, every ZIGBEE node can realize 50m transmission with high reliability. When adding more ZigBee nodes, the transmission distance can be several thousands of meters long.

  4. Nanomechanical molecular devices made of DNA origami.

    Science.gov (United States)

    Kuzuya, Akinori; Ohya, Yuichi

    2014-06-17

    CONSPECTUS: Eight years have passed since the striking debut of the DNA origami technique ( Rothemund, P. W. K. Nature 2006 , 440 , 297 - 302 ), in which long single-stranded DNA is folded into a designed nanostructure, in either 2D or 3D, with the aid of many short staple strands. The number of proposals for new design principles for DNA origami structures seems to have already reached a peak. It is apparent that DNA origami study is now entering the second phase of creating practical applications. The development of functional nanomechanical molecular devices using the DNA origami technique is one such application attracting significant interest from researchers in the field. Nanomechanical DNA origami devices, which maintain the characteristics of DNA origami structures, have various advantages over conventional DNA nanomachines. Comparatively high assembly yield, relatively large size visible via atomic force microscopy (AFM) or transmission electron microscopy (TEM), and the capability to assemble multiple functional groups with precision using multiple staple strands are some of the advantages of the DNA origami technique for constructing sophisticated molecular devices. This Account describes the recent developments of such nanomechanical DNA origami devices and reviews the emerging target of DNA origami studies. First, simple "dynamic" DNA origami structures with transformation capability, such as DNA origami boxes and a DNA origami hatch with structure control, are briefly summarized. More elaborate nanomechanical DNA origami devices are then reviewed. The first example describes DNA origami pinching devices that can be used as "single-molecule" beacons to detect a variety of biorelated molecules, from metal ions at the size of a few tens of atomic mass number units to relatively gigantic proteins with a molecular mass greater than a hundred kilodaltons, all on a single platform. Clamshell-like DNA nanorobots equipped with logic gates can discriminate

  5. Molecular mechanisms of DNA photodamage

    Energy Technology Data Exchange (ETDEWEB)

    Starrs, S.M

    2000-05-01

    Photodamage in DNA, caused by ultraviolet (UV) light, can occur by direct excitation of the nucleobases or indirectly via the action of photosensitisers. Such, DNA photodamage can be potentially mutagenic or lethal. Among the methods available for detecting UV-induced DNA damage, gel sequencing protocols, utilising synthetic oligodeoxyribonucleotides as targets for UV radiation, allow photolesions to be mapped at nucleotide resolution. This approach has been applied to investigate both DNA damage mechanisms. Following a general overview of DNA photoreactivity, and a description of the main experimental procedures, Chapter 3 identifies the origin of an anomalous mobility shift observed in purine chemical sequence ladders that can confuse the interpretation of DNA cleavage results; measures to abolish this shift are also described. Chapters 4 and 5 examine the alkali-labile DNA damage photosensitised by representative nonsteroidal antiinflammatory drugs (NSAIDs) and the fluoroquinolone antibiotics. Suprofen was the most photoactive NSAID studied, producing different patterns of guanine-specific damage in single-stranded and duplex DNA. Uniform modification of guanine bases, typifying attack by singlet oxygen, was observed in single-stranded oligodeoxyribonucleotides. In duplex molecules, modification was limited to the 5'-G of GG doublets, which is indicative of an electron transfer. The effect of quenchers and photoproduct analysis substantiated these findings. The quinolone, nalidixic acid, behaves similarly. The random base cleavage photosensitised by the fluoroquinolones, has been attributed to free radicals produced during their photodecomposition. Chapter 6 addresses the photoreactivity of purines within unusual DNA structures formed by the repeat sequences (GGA){sub n} and (GA){sub n}, and a minihairpin. There was no definitive evidence for enhanced purine reactivity caused by direct excitation. Finally, Chapter 7 investigates the mutagenic potential of a

  6. Molecular mechanisms of DNA photodamage

    International Nuclear Information System (INIS)

    Starrs, S.M.

    2000-05-01

    Photodamage in DNA, caused by ultraviolet (UV) light, can occur by direct excitation of the nucleobases or indirectly via the action of photosensitisers. Such, DNA photodamage can be potentially mutagenic or lethal. Among the methods available for detecting UV-induced DNA damage, gel sequencing protocols, utilising synthetic oligodeoxyribonucleotides as targets for UV radiation, allow photolesions to be mapped at nucleotide resolution. This approach has been applied to investigate both DNA damage mechanisms. Following a general overview of DNA photoreactivity, and a description of the main experimental procedures, Chapter 3 identifies the origin of an anomalous mobility shift observed in purine chemical sequence ladders that can confuse the interpretation of DNA cleavage results; measures to abolish this shift are also described. Chapters 4 and 5 examine the alkali-labile DNA damage photosensitised by representative nonsteroidal antiinflammatory drugs (NSAIDs) and the fluoroquinolone antibiotics. Suprofen was the most photoactive NSAID studied, producing different patterns of guanine-specific damage in single-stranded and duplex DNA. Uniform modification of guanine bases, typifying attack by singlet oxygen, was observed in single-stranded oligodeoxyribonucleotides. In duplex molecules, modification was limited to the 5'-G of GG doublets, which is indicative of an electron transfer. The effect of quenchers and photoproduct analysis substantiated these findings. The quinolone, nalidixic acid, behaves similarly. The random base cleavage photosensitised by the fluoroquinolones, has been attributed to free radicals produced during their photodecomposition. Chapter 6 addresses the photoreactivity of purines within unusual DNA structures formed by the repeat sequences (GGA) n and (GA) n , and a minihairpin. There was no definitive evidence for enhanced purine reactivity caused by direct excitation. Finally, Chapter 7 investigates the mutagenic potential of a dimeric

  7. DNA Vaccine Electroporation and Molecular Adjuvants

    Science.gov (United States)

    2016-03-16

    Suschak and Schmaljohn DNA Vaccine Electroporation and Molecular Adjuvants 1 Abstract To date, there is no protective vaccine for Ebola virus...the formulation of DNA launched virus-like particles (VLP). In this case, the antigen is encoded in one DNA plasmid, while structural proteins are...Virol, 2010. 155(12): p. 2083-103. 2. Feldmann, H. and T.W. Geisbert, Ebola haemorrhagic fever. Lancet, 2011. 377(9768): p. 849-62. 3. Hart, M.K

  8. Bar Code Medication Administration Technology: Characterization of High-Alert Medication Triggers and Clinician Workarounds.

    Science.gov (United States)

    Miller, Daniel F; Fortier, Christopher R; Garrison, Kelli L

    2011-02-01

    Bar code medication administration (BCMA) technology is gaining acceptance for its ability to prevent medication administration errors. However, studies suggest that improper use of BCMA technology can yield unsatisfactory error prevention and introduction of new potential medication errors. To evaluate the incidence of high-alert medication BCMA triggers and alert types and discuss the type of nursing and pharmacy workarounds occurring with the use of BCMA technology and the electronic medication administration record (eMAR). Medication scanning and override reports from January 1, 2008, through November 30, 2008, for all adult medical/surgical units were retrospectively evaluated for high-alert medication system triggers, alert types, and override reason documentation. An observational study of nursing workarounds on an adult medicine step-down unit was performed and an analysis of potential pharmacy workarounds affecting BCMA and the eMAR was also conducted. Seventeen percent of scanned medications triggered an error alert of which 55% were for high-alert medications. Insulin aspart, NPH insulin, hydromorphone, potassium chloride, and morphine were the top 5 high-alert medications that generated alert messages. Clinician override reasons for alerts were documented in only 23% of administrations. Observational studies assessing for nursing workarounds revealed a median of 3 clinician workarounds per administration. Specific nursing workarounds included a failure to scan medications/patient armband and scanning the bar code once the dosage has been removed from the unit-dose packaging. Analysis of pharmacy order entry process workarounds revealed the potential for missed doses, duplicate doses, and doses being scheduled at the wrong time. BCMA has the potential to prevent high-alert medication errors by alerting clinicians through alert messages. Nursing and pharmacy workarounds can limit the recognition of optimal safety outcomes and therefore workflow processes

  9. Association Between Workarounds and Medication Administration Errors in Bar Code-Assisted Medication Administration : Protocol of a Multicenter Study

    NARCIS (Netherlands)

    van der Veen, Willem; van den Bemt, Patricia Mla; Bijlsma, Maarten; de Gier, Han J; Taxis, Katja

    2017-01-01

    BACKGROUND: Information technology-based methods such as bar code-assisted medication administration (BCMA) systems have the potential to reduce medication administration errors (MAEs) in hospitalized patients. In practice, however, systems are often not used as intended, leading to workarounds.

  10. Use of bar-code technology in MC and A system

    International Nuclear Information System (INIS)

    Mykhaylov, V.; Odeychuk, N.; Tovkanetz, V.; Lapshin, V.; Ewing, T.

    2001-01-01

    Full text: Significant problem during the treatment with nuclear materials is the usage of reliable, rapid, integrant automated systems of nuclear material control and account. Thus the dose loading of attending technical personnel is essentially reduced. One of the directions of the solution of the indicated problems is the usage of bar-code technology. Such integrated system should include protection of materials, measuring of materials, and record of materials and drawing up of an inventory list. Especially it is important for the enterprises, on which the enriched uranium and other nuclear materials, which are under IAEA warranties, are utilized. According to US assistance program in the field of MC and A, NSC KIPT has been received indispensable equipment and software, including equipment of nondestructive analysis and automated inventory material accounting system (AIMAS), which was intended for modernizing of nuclear material account system in NSC KIPT. The purpose of operations was estimation of generalized procedures on both MC and A and nondestructive analysis, and updating them so that they might obey the specific conditions of the Enterprise and demands of the Ukraine Regulatory Administration. In NSC KIPT, which is the largest nuclear and physics research center in Ukraine, the measures on enactment of bar-code technology for nuclear materials control and account with the usage of equipment and software of US leading firms (Intermec, Prodigy Max, Tharo Systems, Inc) have been conducting since 1999. During the introduction of this technology, it has been installed the software on nuclear material control and account (AIMAS data base), which was intended for this activities, on NSC KIPT computers. The structure of the NSC KIPT's facility has been determined according to demands of the State and IAEA demands. The key measuring points of inventory quantity has been determined in nuclear material balance zone and the concrete computers, on which is kept

  11. Molecular mechanisms in radiation damage to DNA

    International Nuclear Information System (INIS)

    Osman, R.

    1991-01-01

    The objectives of this work are to elucidate the molecular mechanisms that are responsible for radiation-induced DNA damage. The overall goal is to understand the relationship between the chemical and structural changes produced by ionizing radiation in DNA and the resulting impairment of biological function expressed as carcinogenesis or cell death. The studies are based on theoretical explorations of possible mechanisms that link initial radiation damage in the form of base and sugar damage to conformational changes in DNA. These mechanistic explorations should lead to the formulation of testable hypothesis regarding the processes of impairment of regulation of gene expression, alternation in DNA repair, and damage to DNA structure involved in cell death or cancer

  12. Molecular Mechanisms of DNA Replication Checkpoint Activation

    Directory of Open Access Journals (Sweden)

    Bénédicte Recolin

    2014-03-01

    Full Text Available The major challenge of the cell cycle is to deliver an intact, and fully duplicated, genetic material to the daughter cells. To this end, progression of DNA synthesis is monitored by a feedback mechanism known as replication checkpoint that is untimely linked to DNA replication. This signaling pathway ensures coordination of DNA synthesis with cell cycle progression. Failure to activate this checkpoint in response to perturbation of DNA synthesis (replication stress results in forced cell division leading to chromosome fragmentation, aneuploidy, and genomic instability. In this review, we will describe current knowledge of the molecular determinants of the DNA replication checkpoint in eukaryotic cells and discuss a model of activation of this signaling pathway crucial for maintenance of genomic stability.

  13. Scaffolded DNA Origami of a DNA Tetrahedron Molecular Container

    DEFF Research Database (Denmark)

    Ke, Yongang; Sharma, Jaswinder; Liu, Minghui

    2009-01-01

    We describe a strategy of scaffolded DNA origami to design and construct 3D molecular cages of tetrahedron geometry with inside volume closed by triangular faces. Each edge of the triangular face is ∼54 nm in dimension. The estimated total external volume and the internal cavity of the triangular...... pyramid are about 1.8 × 10-23 and 1.5 × 10-23 m3, respectively. Correct formation of the tetrahedron DNA cage was verified by gel electrophoresis, atomic force microscopy, transmission electron microscopy, and dynamic light scattering techniques....

  14. Scaffolded DNA origami of a DNA tetrahedron molecular container.

    Science.gov (United States)

    Ke, Yonggang; Sharma, Jaswinder; Liu, Minghui; Jahn, Kasper; Liu, Yan; Yan, Hao

    2009-06-01

    We describe a strategy of scaffolded DNA origami to design and construct 3D molecular cages of tetrahedron geometry with inside volume closed by triangular faces. Each edge of the triangular face is approximately 54 nm in dimension. The estimated total external volume and the internal cavity of the triangular pyramid are about 1.8 x 10(-23) and 1.5 x 10(-23) m(3), respectively. Correct formation of the tetrahedron DNA cage was verified by gel electrophoresis, atomic force microscopy, transmission electron microscopy, and dynamic light scattering techniques.

  15. Minimizing human error in radiopharmaceutical preparation and administration via a bar code-enhanced nuclear pharmacy management system.

    Science.gov (United States)

    Hakala, John L; Hung, Joseph C; Mosman, Elton A

    2012-09-01

    The objective of this project was to ensure correct radiopharmaceutical administration through the use of a bar code system that links patient and drug profiles with on-site information management systems. This new combined system would minimize the amount of manual human manipulation, which has proven to be a primary source of error. The most common reason for dosing errors is improper patient identification when a dose is obtained from the nuclear pharmacy or when a dose is administered. A standardized electronic transfer of information from radiopharmaceutical preparation to injection will further reduce the risk of misadministration. Value stream maps showing the flow of the patient dose information, as well as potential points of human error, were developed. Next, a future-state map was created that included proposed corrections for the most common critical sites of error. Transitioning the current process to the future state will require solutions that address these sites. To optimize the future-state process, a bar code system that links the on-site radiology management system with the nuclear pharmacy management system was proposed. A bar-coded wristband connects the patient directly to the electronic information systems. The bar code-enhanced process linking the patient dose with the electronic information reduces the number of crucial points for human error and provides a framework to ensure that the prepared dose reaches the correct patient. Although the proposed flowchart is designed for a site with an in-house central nuclear pharmacy, much of the framework could be applied by nuclear medicine facilities using unit doses. An electronic connection between information management systems to allow the tracking of a radiopharmaceutical from preparation to administration can be a useful tool in preventing the mistakes that are an unfortunate reality for any facility.

  16. Molecular DNA Analysis in Forensic Identification.

    Science.gov (United States)

    Dumache, Raluca; Ciocan, Veronica; Muresan, Camelia; Enache, Alexandra

    2016-01-01

    Serological and biochemical identification methods used in forensics have several major disadvantages, such as: long time in processing biological sample and lack of sensitivity and specificity. In the last 30 years, DNA molecular analysis has become an important tool in forensic investigations. DNA profiling is based on the short tandem repeats (STR) and aids in human identification from biological samples. Forensic genetics, can provide information on the events which occurred at the crime scene or to supplement other methods of forensic identification. Currently, the methods used in identification are based on polymerase chain reaction (PCR) analyses. This method analyses the autosomal STRs, the Y-chromosome, and the mitochondrial DNA. Correlation of biological samples present at the crime scene with identification, selection, and the probative value factor is therefore the first aspect to be taken into consideration in the forensic genetic analysis. In the last decade, because of the advances in the field of molecular biology, new biomarkers such as: microRNAs (miR), messenger RNA (mRNA), and DNA methylation have been studied and proposed to be used in the forensic identifications of body fluids.

  17. Control of DNA hybridization by photoswitchable molecular glue.

    Science.gov (United States)

    Dohno, Chikara; Nakatani, Kazuhiko

    2011-12-01

    Hybridization of DNA is one of the most intriguing events in molecular recognition and is essential for living matter to inherit life beyond generations. In addition to the function of DNA as genetic material, DNA hybridization is a key to control the function of DNA-based materials in nanoscience. Since the hybridization of two single stranded DNAs is a thermodynamically favorable process, dissociation of the once formed DNA duplex is normally unattainable under isothermal conditions. As the progress of DNA-based nanoscience, methodology to control the DNA hybridization process has become increasingly important. Besides many reports using the chemically modified DNA for the regulation of hybridization, we focused our attention on the use of a small ligand as the molecular glue for the DNA. In 2001, we reported the first designed molecule that strongly and specifically bound to the mismatched base pairs in double stranded DNA. Further studies on the mismatch binding molecules provided us a key discovery of a novel mode of the binding of a mismatch binding ligand that induced the base flipping. With these findings we proposed the concept of molecular glue for DNA for the unidirectional control of DNA hybridization and, eventually photoswitchable molecular glue for DNA, which enabled the bidirectional control of hybridization under photoirradiation. In this tutorial review, we describe in detail how we integrated the mismatch binding ligand into photoswitchable molecular glue for DNA, and the application and perspective in DNA-based nanoscience.

  18. DNA-Enabled Integrated Molecular Systems for Computation and Sensing

    Science.gov (United States)

    2014-05-21

    Computational devices can be chemically conjugated to different strands of DNA that are then self-assembled according to strict Watson − Crick binding rules... DNA -Enabled Integrated Molecular Systems for Computation and Sensing Craig LaBoda,† Heather Duschl,† and Chris L. Dwyer*,†,‡ †Department of...guided folding of DNA , inspired by nature, allows designs to manipulate molecular-scale processes unlike any other material system. Thus, DNA can be

  19. Controlling charge current through a DNA based molecular transistor

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@sci.uut.ac.ir; Fathizadeh, S.; Ziaei, J.

    2017-01-05

    Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I–V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive. - Highlights: • Modeling a DNA based molecular transistor and studying its transport properties. • Choosing the appropriate DNA sequence using the quantum chaos tools. • Choosing the functional interval for voltages via the inverse participation ratio tool. • Detecting the rectifier and negative differential resistance behavior of DNA.

  20. Two dimensional molecular electronics spectroscopy for molecular fingerprinting, DNA sequencing, and cancerous DNA recognition.

    Science.gov (United States)

    Rajan, Arunkumar Chitteth; Rezapour, Mohammad Reza; Yun, Jeonghun; Cho, Yeonchoo; Cho, Woo Jong; Min, Seung Kyu; Lee, Geunsik; Kim, Kwang S

    2014-02-25

    Laser-driven molecular spectroscopy of low spatial resolution is widely used, while electronic current-driven molecular spectroscopy of atomic scale resolution has been limited because currents provide only minimal information. However, electron transmission of a graphene nanoribbon on which a molecule is adsorbed shows molecular fingerprints of Fano resonances, i.e., characteristic features of frontier orbitals and conformations of physisorbed molecules. Utilizing these resonance profiles, here we demonstrate two-dimensional molecular electronics spectroscopy (2D MES). The differential conductance with respect to bias and gate voltages not only distinguishes different types of nucleobases for DNA sequencing but also recognizes methylated nucleobases which could be related to cancerous cell growth. This 2D MES could open an exciting field to recognize single molecule signatures at atomic resolution. The advantages of the 2D MES over the one-dimensional (1D) current analysis can be comparable to those of 2D NMR over 1D NMR analysis.

  1. Molecular biological mechanisms I. DNA repair

    International Nuclear Information System (INIS)

    Friedl, A.A.

    2000-01-01

    Cells of all living systems possess a variety of mechanisms that allow to repair spontaneous and exogeneously induced DNA damage. DNA repair deficiencies may invoke enhanced sensitivity towards DNA-damaging agents such as ionizing radiation. They may also enhance the risk of cancer development, both spontaneously or after induction. This article reviews several DNA repair mechanisms, especially those dealing with DNA double-strand breaks, and describes hereditary diseases associated with DNA repair defects. (orig.) [de

  2. Hydrodynamic caracterization and molecular weight stimation of ultrasonically sheared DNA

    International Nuclear Information System (INIS)

    Garces, F.; Casal, J.I.; Garcia, A.

    1981-01-01

    The sedimentation coefficients and intrinsec viscosities of ultrasonically sheared calf thymus DNA have been determined. The molecular weight stimation according to this parameters have been compared with the ones obtained from the electrophoretic migration rates based on the calibration proposed using the known molecular weight restriction fragments of lambds-DNA. (author) [es

  3. Recent advances in yeast molecular biology: recombinant DNA. [Lead abstract

    Energy Technology Data Exchange (ETDEWEB)

    1982-09-01

    Separate abstracts were prepared for the 25 papers presented at a workshop focusing on chromosomal structure, gene regulation, recombination, DNA repair, and cell type control, that have been obtained by experimental approaches incorporating the new technologies of yeast DNA transformation, molecular cloning, and DNA sequence analysis. (KRM)

  4. Recent advances in yeast molecular biology: recombinant DNA

    International Nuclear Information System (INIS)

    1982-09-01

    Separate abstracts were prepared for the 25 papers presented at a workshop focusing on chromosomal structure, gene regulation, recombination, DNA repair, and cell type control, that have been obtained by experimental approaches incorporating the new technologies of yeast DNA transformation, molecular cloning, and DNA sequence analysis

  5. Molecular dosimetry of chemical mutagens: measurement of molecular dose and DNA repair germ cells

    International Nuclear Information System (INIS)

    Sega, G.A.

    1975-01-01

    Molecular dosimetry in the germ cells of male mice is reviewed with regard to in vivo alkylation of sperm heads, in vivo alkylation of sperm DNA, and possible alkylation of sperm protamine. DNA repair in male germ cells is reviewed with regard to basic design of experiments, DNA repair in various stages of spermatogenesis, effect of protamine on DNA repair following treatment with EMS or x radiation, and induction of DNA repair by methyl methanesulfonate, propyl methanesulfonate, and isopropyl methanesulfonate

  6. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    Science.gov (United States)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  7. DNA nanotechnology: On-command molecular Trojans

    Science.gov (United States)

    Niemeyer, Christof M.

    2017-12-01

    Lipid-motif-decorated DNA nanocapsules filled with photoresponsive polymers are capable of delivering signalling molecules into target organisms for biological perturbations at high spatiotemporal resolution.

  8. DNA microarrays : a molecular cloning manual

    National Research Council Canada - National Science Library

    Sambrook, Joseph; Bowtell, David

    2002-01-01

    .... DNA Microarrays provides authoritative, detailed instruction on the design, construction, and applications of microarrays, as well as comprehensive descriptions of the software tools and strategies...

  9. Molecular mechanisms in radiation damage to DNA: Final report

    International Nuclear Information System (INIS)

    Osman, R.

    1996-01-01

    The objectives of this work were to elucidate the molecular mechanisms that were responsible for radiation-induced DNA damage. The studies were based on theoretical explorations of possible mechanisms that link initial radiation damage in the form of base and sugar damage to conformational changes in DNA

  10. DNA strand exchange catalyzed by molecular crowding in PEG solutions

    KAUST Repository

    Feng, Bobo; Frykholm, Karolin; Nordé n, Bengt; Westerlund, Fredrik

    2010-01-01

    DNA strand exchange is catalyzed by molecular crowding and hydrophobic interactions in concentrated aqueous solutions of polyethylene glycol, a discovery of relevance for understanding the function of recombination enzymes and with potential applications to DNA nanotechnology. © 2010 The Royal Society of Chemistry.

  11. DNAzyme Feedback Amplification: Relaying Molecular Recognition to Exponential DNA Amplification.

    Science.gov (United States)

    Liu, Meng; Yin, Qingxin; McConnell, Erin M; Chang, Yangyang; Brennan, John D; Li, Yingfu

    2018-03-26

    Technologies capable of linking DNA amplification to molecular recognition are very desirable for ultrasensitive biosensing applications. We have developed a simple but powerful isothermal DNA amplification method, termed DNAzyme feedback amplification (DFA), that is capable of relaying molecular recognition to exponential DNA amplification. The method incorporates both an RNA-cleaving DNAzyme (RCD) and rolling circle amplification (RCA) carried out by a special DNA polymerase using a circular DNA template. DFA begins with a stimulus-dependent RCA reaction, producing tandemly linked RCDs in long-chain DNA products. These RCDs cleave an RNA-containing DNA sequence to form additional primers that hybridize to the circular DNA molecule, giving rise to DNA assemblies that act as the new inputs for RCA. The RCA reaction and the cleavage event keep on feeding each other autonomously, resulting in exponential growth of repetitive DNA sequences that can be easily detected. This method can be used for the detection of both nucleic acid based targets and non-nucleic acid analytes. In this article, we discuss the conceptual framework of the feedback amplification approach, the essential features of this method as well as remaining challenges and possible solutions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Biomimetic Molecular Signaling using DNA Walkers on Microparticles.

    Science.gov (United States)

    Damase, Tulsi Ram; Spencer, Adam; Samuel, Bamidele; Allen, Peter B

    2017-06-22

    We report the release of catalytic DNA walkers from hydrogel microparticles and the detection of those walkers by substrate-coated microparticles. This might be considered a synthetic biology analog of molecular signal release and reception. One type of particles was coated with components of a DNA one-step strand displacement (OSD) reaction to release the walker. A second type of particle was coated with substrate (or "track") for the molecular walker. We distinguish these particle types using fluorescence barcoding: we synthesized and distinguished multiple particle types with multicolor fluorescence microscopy and automated image analysis software. This represents a step toward amplified, multiplex, and microscopically localized detection based on DNA nanotechnology.

  13. Hydrodynamic characterization and molecular weight estimation of ultrasonically sheared DNA

    International Nuclear Information System (INIS)

    Casal, J. I.; Garces, F.; Garcia-Sacristan, A.

    1981-01-01

    The sedimentation coefficients and intrinsic viscosities of ultrasonically sheared calf thymus DNA have been determined. The molecular weight estimation according to this parameters have been compared with the ones obtained from the electrophoretic migration rates based on the calibration proposed using the known molecular weight restriction fragments of X-ENA. (Author) 35 refs

  14. Automation and adaptation: Nurses’ problem-solving behavior following the implementation of bar coded medication administration technology

    Science.gov (United States)

    Holden, Richard J.; Rivera-Rodriguez, A. Joy; Faye, Héléne; Scanlon, Matthew C.; Karsh, Ben-Tzion

    2012-01-01

    The most common change facing nurses today is new technology, particularly bar coded medication administration technology (BCMA). However, there is a dearth of knowledge on how BCMA alters nursing work. This study investigated how BCMA technology affected nursing work, particularly nurses’ operational problem-solving behavior. Cognitive systems engineering observations and interviews were conducted after the implementation of BCMA in three nursing units of a freestanding pediatric hospital. Problem-solving behavior, associated problems, and goals, were specifically defined and extracted from observed episodes of care. Three broad themes regarding BCMA’s impact on problem solving were identified. First, BCMA allowed nurses to invent new problem-solving behavior to deal with pre-existing problems. Second, BCMA made it difficult or impossible to apply some problem-solving behaviors that were commonly used pre-BCMA, often requiring nurses to use potentially risky workarounds to achieve their goals. Third, BCMA created new problems that nurses were either able to solve using familiar or novel problem-solving behaviors, or unable to solve effectively. Results from this study shed light on hidden hazards and suggest three critical design needs: (1) ecologically valid design; (2) anticipatory control; and (3) basic usability. Principled studies of the actual nature of clinicians’ work, including problem solving, are necessary to uncover hidden hazards and to inform health information technology design and redesign. PMID:24443642

  15. Atomistic Molecular Dynamics Simulations of Mitochondrial DNA Polymerase γ

    DEFF Research Database (Denmark)

    Euro, Liliya; Haapanen, Outi; Róg, Tomasz

    2017-01-01

    of replisomal interactions, and functional effects of patient mutations that do not affect direct catalysis have remained elusive. Here we report the first atomistic classical molecular dynamics simulations of the human Pol γ replicative complex. Our simulation data show that DNA binding triggers remarkable......DNA polymerase γ (Pol γ) is a key component of the mitochondrial DNA replisome and an important cause of neurological diseases. Despite the availability of its crystal structures, the molecular mechanism of DNA replication, the switch between polymerase and exonuclease activities, the site...... changes in the enzyme structure, including (1) completion of the DNA-binding channel via a dynamic subdomain, which in the apo form blocks the catalytic site, (2) stabilization of the structure through the distal accessory β-subunit, and (3) formation of a putative transient replisome-binding platform...

  16. Programmable molecular recognition based on the geometry of DNA nanostructures.

    Science.gov (United States)

    Woo, Sungwook; Rothemund, Paul W K

    2011-07-10

    From ligand-receptor binding to DNA hybridization, molecular recognition plays a central role in biology. Over the past several decades, chemists have successfully reproduced the exquisite specificity of biomolecular interactions. However, engineering multiple specific interactions in synthetic systems remains difficult. DNA retains its position as the best medium with which to create orthogonal, isoenergetic interactions, based on the complementarity of Watson-Crick binding. Here we show that DNA can be used to create diverse bonds using an entirely different principle: the geometric arrangement of blunt-end stacking interactions. We show that both binary codes and shape complementarity can serve as a basis for such stacking bonds, and explore their specificity, thermodynamics and binding rules. Orthogonal stacking bonds were used to connect five distinct DNA origami. This work, which demonstrates how a single attractive interaction can be developed to create diverse bonds, may guide strategies for molecular recognition in systems beyond DNA nanostructures.

  17. Molecular threading and tunable molecular recognition on DNA origami nanostructures.

    Science.gov (United States)

    Wu, Na; Czajkowsky, Daniel M; Zhang, Jinjin; Qu, Jianxun; Ye, Ming; Zeng, Dongdong; Zhou, Xingfei; Hu, Jun; Shao, Zhifeng; Li, Bin; Fan, Chunhai

    2013-08-21

    The DNA origami technology holds great promise for the assembly of nanoscopic technological devices and studies of biochemical reactions at the single-molecule level. For these, it is essential to establish well controlled attachment of functional materials to predefined sites on the DNA origami nanostructures for reliable measurements and versatile applications. However, the two-sided nature of the origami scaffold has shown limitations in this regard. We hypothesized that holes of the commonly used two-dimensional DNA origami designs are large enough for the passage of single-stranded (ss)-DNA. Sufficiently long ssDNA initially located on one side of the origami should thus be able to "thread" to the other side through the holes in the origami sheet. By using an origami sheet attached with patterned biotinylated ssDNA spacers and monitoring streptavidin binding with atomic force microscopic (AFM) imaging, we provide unambiguous evidence that the biotin ligands positioned on one side have indeed threaded through to the other side. Our finding reveals a previously overlooked critical design feature that should provide new interpretations to previous experiments and new opportunities for the construction of origami structures with new functional capabilities.

  18. Molecular Dynamics Simulation of High Density DNA Arrays

    Directory of Open Access Journals (Sweden)

    Rudolf Podgornik

    2018-01-01

    Full Text Available Densely packed DNA arrays exhibit hexagonal and orthorhombic local packings, as well as a weakly first order transition between them. While we have some understanding of the interactions between DNA molecules in aqueous ionic solutions, the structural details of its ordered phases and the mechanism governing the respective phase transitions between them remains less well understood. Since at high DNA densities, i.e., small interaxial spacings, one can neither neglect the atomic details of the interacting macromolecular surfaces nor the atomic details of the intervening ionic solution, the atomistic resolution is a sine qua non to properly describe and analyze the interactions between DNA molecules. In fact, in order to properly understand the details of the observed osmotic equation of state, one needs to implement multiple levels of organization, spanning the range from the molecular order of DNA itself, the possible ordering of counterions, and then all the way to the induced molecular ordering of the aqueous solvent, all coupled together by electrostatic, steric, thermal and direct hydrogen-bonding interactions. Multiscale simulations therefore appear as singularly suited to connect the microscopic details of this system with its macroscopic thermodynamic behavior. We review the details of the simulation of dense atomistically resolved DNA arrays with different packing symmetries and the ensuing osmotic equation of state obtained by enclosing a DNA array in a monovalent salt and multivalent (spermidine counterions within a solvent permeable membrane, mimicking the behavior of DNA arrays subjected to external osmotic stress. By varying the DNA density, the local packing symmetry, and the counterion type, we are able to analyze the osmotic equation of state together with the full structural characterization of the DNA subphase, the counterion distribution and the solvent structural order in terms of its different order parameters and

  19. Molecular models for DNA damaged by photoreaction

    International Nuclear Information System (INIS)

    Pearlman, D.A.; Holbrook, S.R.; Pirkle, D.H.; Kim, S.H.

    1985-01-01

    Structural models of a DNA molecule containing a radiation-induced psoralen cross-link and of a DNA containing a thymine photodimer were constructed by applying energy-minimization techniques and model-building procedures to data from x-ray crystallographic studies. The helical axes of the models show substantial kinking and unwinding at the sites of the damage, which may have long-range as well as local effects arising from the concomitant changes in the supercoiling and overall structure of the DNA. The damaged areas may also serve as recognition sites for repair enzymes. These results should help in understanding the biologic effects of radiation-induced damage on cells

  20. DNA topology influences molecular machine lifetime in human serum

    Science.gov (United States)

    Goltry, Sara; Hallstrom, Natalya; Clark, Tyler; Kuang, Wan; Lee, Jeunghoon; Jorcyk, Cheryl; Knowlton, William B.; Yurke, Bernard; Hughes, William L.; Graugnard, Elton

    2015-06-01

    DNA nanotechnology holds the potential for enabling new tools for biomedical engineering, including diagnosis, prognosis, and therapeutics. However, applications for DNA devices are thought to be limited by rapid enzymatic degradation in serum and blood. Here, we demonstrate that a key aspect of DNA nanotechnology--programmable molecular shape--plays a substantial role in device lifetimes. These results establish the ability to operate synthetic DNA devices in the presence of endogenous enzymes and challenge the textbook view of near instantaneous degradation.DNA nanotechnology holds the potential for enabling new tools for biomedical engineering, including diagnosis, prognosis, and therapeutics. However, applications for DNA devices are thought to be limited by rapid enzymatic degradation in serum and blood. Here, we demonstrate that a key aspect of DNA nanotechnology--programmable molecular shape--plays a substantial role in device lifetimes. These results establish the ability to operate synthetic DNA devices in the presence of endogenous enzymes and challenge the textbook view of near instantaneous degradation. Electronic supplementary information (ESI) available: DNA sequences, fluorophore and quencher properties, equipment design, and degradation studies. See DOI: 10.1039/c5nr02283e

  1. DNA microarrays : a molecular cloning manual

    National Research Council Canada - National Science Library

    Sambrook, Joseph; Bowtell, David

    2002-01-01

    .... This manual, designed to extend and to complement the information in the best-selling Molecular Cloning, is a synthesis of the expertise and experience of more than 30 contributors all innovators in a fast moving field...

  2. Implementing a bar-code assisted medication administration system: effects on the dispensing process and user perceptions.

    Science.gov (United States)

    Samaranayake, N R; Cheung, S T D; Cheng, K; Lai, K; Chui, W C M; Cheung, B M Y

    2014-06-01

    We assessed the effects of a bar-code assisted medication administration system used without the support of computerised prescribing (stand-alone BCMA), on the dispensing process and its users. The stand-alone BCMA system was implemented in one ward of a teaching hospital. The number of dispensing steps, dispensing time and potential dispensing errors (PDEs) were directly observed one month before and eight months after the intervention. Attitudes of pharmacy and nursing staff were assessed using a questionnaire (Likert scale) and interviews. Among 1291 and 471 drug items observed before and after the introduction of the technology respectively, the number of dispensing steps increased from five to eight and time (standard deviation) to dispense one drug item by one staff personnel increased from 0.8 (0.09) to 1.5 (0.12) min. Among 2828 and 471 drug items observed before and after the intervention respectively, the number of PDEs increased significantly (Psystem offered less benefit to the dispensing process (9/16). Nursing staff perceived the system as useful in improving the accuracy of drug administration (7/10). Implementing a stand-alone BCMA system may slow down and complicate the dispensing process. Nursing staff believe the stand-alone BCMA system could improve the drug administration process but pharmacy staff believes the technology would be more helpful if supported by computerised prescribing. However, periodical assessments are needed to identify weaknesses in the process after implementation, and all users should be educated on the benefits of using this technology. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. BAR-CODE BASED WEIGHT MEASUREMENT STATION FOR PHYSICAL INVENTORY TAKING OF PLUTONIUM OXIDE CONTAINERS AT THE MINING AND CHEMICAL COMBINE RADIOCHEMICAL REPROCESSING PLANT NEAR KRASNOYARSK, SIBERIA

    International Nuclear Information System (INIS)

    SUDA, S.

    1999-01-01

    This paper describes the technical tasks being implemented to computerize the physical inventory taking (PIT) at the Mining and Chemical Combine (Gorno-Khimichesky Kombinat, GKhK) radiochemical plant under the US/Russian cooperative nuclear material protection, control, and accounting (MPC and A) program. Under the MPC and A program, Lab-to-Lab task agreements with GKhK were negotiated that involved computerized equipment for item verification and confirmatory measurement of the Pu containers. Tasks under Phase I cover the work for demonstrating the plan and procedures for carrying out the comparison of the Pu container identification on the container with the computerized inventory records. In addition to the records validation, the verification procedures include the application of bar codes and bar coded TIDs to the Pu containers. Phase II involves the verification of the Pu content. A plan and procedures are being written for carrying out confirmatory measurements on the Pu containers

  4. DNA barcode-based molecular identification system for fish species.

    Science.gov (United States)

    Kim, Sungmin; Eo, Hae-Seok; Koo, Hyeyoung; Choi, Jun-Kil; Kim, Won

    2010-12-01

    In this study, we applied DNA barcoding to identify species using short DNA sequence analysis. We examined the utility of DNA barcoding by identifying 53 Korean freshwater fish species, 233 other freshwater fish species, and 1339 saltwater fish species. We successfully developed a web-based molecular identification system for fish (MISF) using a profile hidden Markov model. MISF facilitates efficient and reliable species identification, overcoming the limitations of conventional taxonomic approaches. MISF is freely accessible at http://bioinfosys.snu.ac.kr:8080/MISF/misf.jsp .

  5. Molecular mechanisms in radiation damage to DNA. Progress report

    International Nuclear Information System (INIS)

    Osman, R.

    1994-01-01

    The objectives of this work are to elucidate the molecular mechanisms that are responsible for radiation-induced DNA damage. The overall goal is to understand the relationship between the chemical and structural changes produced by ionizing radiation in DNA and the resulting impairment of biological function expressed as carcinogenesis or cell death. The studies are based on theoretical explorations of possible mechanisms that link initial radiation damage in the form of base and sugar damage to conformational changes in DNA. These mechanistic explorations should lead to the formulation of testable hypotheses regarding the processes of impairment of regulation of gene expression, alteration in DNA repair, and damage to DNA structure involved in cell death or cancer

  6. Molecular dynamics simulations of DNA-free and DNA-bound TAL effectors.

    Directory of Open Access Journals (Sweden)

    Hua Wan

    Full Text Available TAL (transcriptional activator-like effectors (TALEs are DNA-binding proteins, containing a modular central domain that recognizes specific DNA sequences. Recently, the crystallographic studies of TALEs revealed the structure of DNA-recognition domain. In this article, molecular dynamics (MD simulations are employed to study two crystal structures of an 11.5-repeat TALE, in the presence and absence of DNA, respectively. The simulated results indicate that the specific binding of RVDs (repeat-variable diresidues with DNA leads to the markedly reduced fluctuations of tandem repeats, especially at the two ends. In the DNA-bound TALE system, the base-specific interaction is formed mainly by the residue at position 13 within a TAL repeat. Tandem repeats with weak RVDs are unfavorable for the TALE-DNA binding. These observations are consistent with experimental studies. By using principal component analysis (PCA, the dominant motions are open-close movements between the two ends of the superhelical structure in both DNA-free and DNA-bound TALE systems. The open-close movements are found to be critical for the recognition and binding of TALE-DNA based on the analysis of free energy landscape (FEL. The conformational analysis of DNA indicates that the 5' end of DNA target sequence has more remarkable structural deformability than the other sites. Meanwhile, the conformational change of DNA is likely associated with the specific interaction of TALE-DNA. We further suggest that the arrangement of N-terminal repeats with strong RVDs may help in the design of efficient TALEs. This study provides some new insights into the understanding of the TALE-DNA recognition mechanism.

  7. HBV DNA Integration: Molecular Mechanisms and Clinical Implications

    Science.gov (United States)

    Tu, Thomas; Budzinska, Magdalena A.; Shackel, Nicholas A.; Urban, Stephan

    2017-01-01

    Chronic infection with the Hepatitis B Virus (HBV) is a major cause of liver-related morbidity and mortality. One peculiar observation in cells infected with HBV (or with closely‑related animal hepadnaviruses) is the presence of viral DNA integration in the host cell genome, despite this form being a replicative dead-end for the virus. The frequent finding of somatic integration of viral DNA suggests an evolutionary benefit for the virus; however, the mechanism of integration, its functions, and the clinical implications remain unknown. Here we review the current body of knowledge of HBV DNA integration, with particular focus on the molecular mechanisms and its clinical implications (including the possible consequences of replication-independent antigen expression and its possible role in hepatocellular carcinoma). HBV DNA integration is likely to influence HBV replication, persistence, and pathogenesis, and so deserves greater attention in future studies. PMID:28394272

  8. Sequence-dependent DNA deformability studied using molecular dynamics simulations.

    Science.gov (United States)

    Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori

    2007-01-01

    Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.

  9. Single molecular biology: coming of age in DNA replication.

    Science.gov (United States)

    Liu, Xiao-Jing; Lou, Hui-Qiang

    2017-09-20

    DNA replication is an essential process of the living organisms. To achieve precise and reliable replication, DNA polymerases play a central role in DNA synthesis. Previous investigations have shown that the average rates of DNA synthesis on the leading and lagging strands in a replisome must be similar to avoid the formation of significant gaps in the nascent strands. The underlying mechanism has been assumed to be coordination between leading- and lagging-strand polymerases. However, Kowalczykowski's lab members recently performed single molecule techniques in E. coli and showed the real-time behavior of a replisome. The leading- and lagging-strand polymerases function stochastically and independently. Furthermore, when a DNA polymerase is paused, the helicase slows down in a self-regulating fail-safe mechanism, akin to a ''dead-man's switch''. Based on the real-time single-molecular observation, the authors propose that leading- and lagging-strand polymerases synthesize DNA stochastically within a Gaussian distribution. Along with the development and application of single-molecule techniques, we will witness a new age of DNA replication and other biological researches.

  10. TALENs: customizable molecular DNA scissors for genome engineering of plants.

    Science.gov (United States)

    Chen, Kunling; Gao, Caixia

    2013-06-20

    Precise genome modification with engineered nucleases is a powerful tool for studying basic biology and applied biotechnology. Transcription activator-like effector nucleases (TALENs), consisting of an engineered specific (TALE) DNA binding domain and a Fok I cleavage domain, are newly developed versatile reagents for genome engineering in different organisms. Because of the simplicity of the DNA recognition code and their modular assembly, TALENs can act as customizable molecular DNA scissors inducing double-strand breaks (DSBs) at given genomic location. Thus, they provide a valuable approach to targeted genome modifications such as mutations, insertions, replacements or chromosome rearrangements. In this article, we review the development of TALENs, and summarize the principles and tools for TALEN-mediated gene targeting in plant cells, as well as current and potential strategies for use in plant research and crop improvement. Copyright © 2013. Published by Elsevier Ltd.

  11. Molecular recognition in complexes of TRF proteins with telomeric DNA.

    Directory of Open Access Journals (Sweden)

    Miłosz Wieczór

    Full Text Available Telomeres are specialized nucleoprotein assemblies that protect the ends of linear chromosomes. In humans and many other species, telomeres consist of tandem TTAGGG repeats bound by a protein complex known as shelterin that remodels telomeric DNA into a protective loop structure and regulates telomere homeostasis. Shelterin recognizes telomeric repeats through its two major components known as Telomere Repeat-Binding Factors, TRF1 and TRF2. These two homologous proteins are therefore essential for the formation and normal function of telomeres. Indeed, TRF1 and TRF2 are implicated in a plethora of different cellular functions and their depletion leads to telomere dysfunction with chromosomal fusions, followed by apoptotic cell death. More specifically, it was found that TRF1 acts as a negative regulator of telomere length, and TRF2 is involved in stabilizing the loop structure. Consequently, these proteins are of great interest, not only because of their key role in telomere maintenance and stability, but also as potential drug targets. In the current study, we investigated the molecular basis of telomeric sequence recognition by TRF1 and TRF2 and their DNA binding mechanism. We used molecular dynamics (MD to calculate the free energy profiles for binding of TRFs to telomeric DNA. We found that the predicted binding free energies were in good agreement with experimental data. Further, different molecular determinants of binding, such as binding enthalpies and entropies, the hydrogen bonding pattern and changes in surface area, were analyzed to decompose and examine the overall binding free energies at the structural level. With this approach, we were able to draw conclusions regarding the consecutive stages of sequence-specific association, and propose a novel aspartate-dependent mechanism of sequence recognition. Finally, our work demonstrates the applicability of computational MD-based methods to studying protein-DNA interactions.

  12. The value of cell-free DNA for molecular pathology.

    Science.gov (United States)

    Stewart, Caitlin M; Kothari, Prachi D; Mouliere, Florent; Mair, Richard; Somnay, Saira; Benayed, Ryma; Zehir, Ahmet; Weigelt, Britta; Dawson, Sarah-Jane; Arcila, Maria E; Berger, Michael F; Tsui, Dana Wy

    2018-04-01

    Over the past decade, advances in molecular biology and genomics techniques have revolutionized the diagnosis and treatment of cancer. The technological advances in tissue profiling have also been applied to the study of cell-free nucleic acids, an area of increasing interest for molecular pathology. Cell-free nucleic acids are released from tumour cells into the surrounding body fluids and can be assayed non-invasively. The repertoire of genomic alterations in circulating tumour DNA (ctDNA) is reflective of both primary tumours and distant metastatic sites, and ctDNA can be sampled multiple times, thereby overcoming the limitations of the analysis of single biopsies. Furthermore, ctDNA can be sampled regularly to monitor response to treatment, to define the evolution of the tumour genome, and to assess the acquisition of resistance and minimal residual disease. Recently, clinical ctDNA assays have been approved for guidance of therapy, which is an exciting first step in translating cell-free nucleic acid research tests into clinical use for oncology. In this review, we discuss the advantages of cell-free nucleic acids as analytes in different body fluids, including blood plasma, urine, and cerebrospinal fluid, and their clinical applications in solid tumours and haematological malignancies. We will also discuss practical considerations for clinical deployment, such as preanalytical factors and regulatory requirements. Copyright © 2018 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2018 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  13. Establishing and evaluating bar-code technology in blood sampling system: a model based on human centered human-centered design method.

    Science.gov (United States)

    Chou, Shin-Shang; Yan, Hsiu-Fang; Huang, Hsiu-Ya; Tseng, Kuan-Jui; Kuo, Shu-Chen

    2012-01-01

    This study intended to use a human-centered design study method to develop a bar-code technology in blood sampling process. By using the multilevel analysis to gather the information, the bar-code technology has been constructed to identify the patient's identification, simplify the work process, and prevent medical error rates. A Technology Acceptance Model questionnaire was developed to assess the effectiveness of system and the data of patient's identification and sample errors were collected daily. The average scores of 8 items users' perceived ease of use was 25.21(3.72), 9 items users' perceived usefulness was 28.53(5.00), and 14 items task-technology fit was 52.24(7.09), the rate of patient identification error and samples with order cancelled were down to zero, however, new errors were generated after the new system deployed; which were the position of barcode stickers on the sample tubes. Overall, more than half of nurses (62.5%) were willing to use the new system.

  14. Genotoxicity of formaldehyde: Molecular basis of DNA damage and mutation

    Directory of Open Access Journals (Sweden)

    Masanobu eKawanishi

    2014-09-01

    Full Text Available Formaldehyde is commonly used in the chemical industry and is present in the environment, such as vehicle emissions, some building materials, food and tobacco smoke. It also occurs as a natural product in most organisms, the sources of which include a number of metabolic processes. It causes various acute and chronic adverse effects in humans if they inhale its fumes. Among the chronic effects on human health, we summarize data on genotoxicity and carcinogenicity in this review, and we particularly focus on the molecular mechanisms involved in the formaldehyde mutagenesis. Formaldehyde mainly induces N-hydroxymethyl mono-adducts on guanine, adenine and cytosine, and N-methylene crosslinks between adjacent purines in DNA. These crosslinks are types of DNA damage potentially fatal for cell survival if they are not removed by the nucleotide excision repair pathway. In the previous studies, we showed evidence that formaldehyde causes intra-strand crosslinks between purines in DNA using a unique method (Matsuda et al. Nucleic Acids Res. 26, 1769-1774,1998. Using shuttle vector plasmids, we also showed that formaldehyde as well as acetaldehyde induces tandem base substitutions, mainly at 5’-GG and 5’-GA sequences, which would arise from the intra-strand crosslinks. These mutation features are different from those of other aldehydes such as crotonaldehyde, acrolein, glyoxal and methylglyoxal. These findings provide molecular clues to improve our understanding of the genotoxicity and carcinogenicity of formaldehyde.

  15. Intelligent DNA-based molecular diagnostics using linked genetic markers

    Energy Technology Data Exchange (ETDEWEB)

    Pathak, D.K.; Perlin, M.W.; Hoffman, E.P.

    1994-12-31

    This paper describes a knowledge-based system for molecular diagnostics, and its application to fully automated diagnosis of X-linked genetic disorders. Molecular diagnostic information is used in clinical practice for determining genetic risks, such as carrier determination and prenatal diagnosis. Initially, blood samples are obtained from related individuals, and PCR amplification is performed. Linkage-based molecular diagnosis then entails three data analysis steps. First, for every individual, the alleles (i.e., DNA composition) are determined at specified chromosomal locations. Second, the flow of genetic material among the individuals is established. Third, the probability that a given individual is either a carrier of the disease or affected by the disease is determined. The current practice is to perform each of these three steps manually, which is costly, time consuming, labor-intensive, and error-prone. As such, the knowledge-intensive data analysis and interpretation supersede the actual experimentation effort as the major bottleneck in molecular diagnostics. By examining the human problem solving for the task, we have designed and implemented a prototype knowledge-based system capable of fully automating linkage-based molecular diagnostics in X-linked genetic disorders, including Duchenne Muscular Dystrophy (DMD). Our system uses knowledge-based interpretation of gel electrophoresis images to determine individual DNA marker labels, a constraint satisfaction search for consistent genetic flow among individuals, and a blackboard-style problem solver for risk assessment. We describe the system`s successful diagnosis of DMD carrier and affected individuals from raw clinical data.

  16. Molecular targets, DNA breakage, DNA repair: Their roles in mutation induction in mammalian germ cells

    International Nuclear Information System (INIS)

    Sega, G.A.

    1989-01-01

    Variability in genetic sensitivity among different germ-cell stages in the mammal to various mutagens could be the result of how much chemical reaches the different stages, what molecular targets may be affected in the different stages and whether or not repair of lesions occurs. Several chemicals have been found to bind very strongly to protamine in late-spermatid and early-spermatozoa stages in the mouse. The chemicals also produce their greatest genetic damage in these same germ-cell stages. While chemical binding to DNA has not been correlated with the level of induced genetic damage, DNA breakage in the sensitive stages has been shown to increase. This DNA breakage is believed to indirectly result from chemical binding to sulfhydryl groups in protamine which prevents normal chromatin condensation within the sperm nucleus. 22 refs., 5 figs

  17. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    Science.gov (United States)

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  18. Effect O6-Guanine Alkylation on DNA Flexibility Studied by Comparative Molecular Dynamics Simulations

    Czech Academy of Sciences Publication Activity Database

    Kara, M.; Dršata, Tomáš; Lankaš, Filip; Zacharias, M.

    2015-01-01

    Roč. 103, č. 1 (2015), s. 23-32 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GA14-21893S Institutional support: RVO:61388963 Keywords : DNA damage * DNA alkylation * DNA repair * molecular simulation * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 2.248, year: 2015

  19. Detection of DNA damage by using hairpin molecular beacon probes and graphene oxide.

    Science.gov (United States)

    Zhou, Jie; Lu, Qian; Tong, Ying; Wei, Wei; Liu, Songqin

    2012-09-15

    A hairpin molecular beacon tagged with carboxyfluorescein in combination with graphene oxide as a quencher reagent was used to detect the DNA damage by chemical reagents. The fluorescence of molecular beacon was quenched sharply by graphene oxide; while in the presence of its complementary DNA the quenching efficiency decreased because their hybridization prevented the strong adsorbability of molecular beacon on graphene oxide. If the complementary DNA was damaged by a chemical reagent and could not form intact duplex structure with molecular beacon, more molecular beacon would adsorb on graphene oxide increasing the quenching efficiency. Thus, damaged DNA could be detected based on different quenching efficiencies afforded by damaged and intact complementary DNA. The damage effects of chlorpyrifos-methyl and three metabolites of styrene such as mandelieaeids, phenylglyoxylieaeids and epoxystyrene on DNA were studied as models. The method for detection of DNA damage was reliable, rapid and simple compared to the biological methods. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Automated Processing of 2-D Gel Electrophoretograms of Genomic DNA for Hunting Pathogenic DNA Molecular Changes.

    Science.gov (United States)

    Takahashi; Nakazawa; Watanabe; Konagaya

    1999-01-01

    We have developed the automated processing algorithms for 2-dimensional (2-D) electrophoretograms of genomic DNA based on RLGS (Restriction Landmark Genomic Scanning) method, which scans the restriction enzyme recognition sites as the landmark and maps them onto a 2-D electrophoresis gel. Our powerful processing algorithms realize the automated spot recognition from RLGS electrophoretograms and the automated comparison of a huge number of such images. In the final stage of the automated processing, a master spot pattern, on which all the spots in the RLGS images are mapped at once, can be obtained. The spot pattern variations which seemed to be specific to the pathogenic DNA molecular changes can be easily detected by simply looking over the master spot pattern. When we applied our algorithms to the analysis of 33 RLGS images derived from human colon tissues, we successfully detected several colon tumor specific spot pattern changes.

  1. Molecular mechanisms of mutagenesis determined by the recombinant DNA technology

    International Nuclear Information System (INIS)

    Lee, W.R.

    1985-01-01

    A study of the alteration of the DNA in the mutant gene can determine mechanisms of mutation by distinguishing between mutations induced by transition, transversion, frameshifts of a single base and deletions involving many base pairs. The association of a specific pattern of response with a mutagen will permit detecting mutants induced by the mutagen with a reduced background by removing mutations induced by other mechanisms from the pool of potential mutants. From analyses of studies that have been conducted, it is quite apparent that there are substantial differences among mutagens in their modes of action. Of 31 x-ray induced mutants, 20 were large deletions while only 3 showed normal Southern blots. Only one mutant produced a sub-unit polypeptide of normal molecular weight and charge in the in vivo test whereas in vitro synthesis produced a second one. In contrast, nine of thirteen EMS induced mutants produced cross-reacting proteins with sub-unit polypeptide molecular weights equivalent to wild type. Two of three ENU induced mutants recently analyzed in our laboratory produced protein with sub-unit polypeptide molecular weight and electrical charge similar to the wild type stock in which the mutants were induced. One ENU induced mutation is a large deletion. 21 refs., 1 fig

  2. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    Science.gov (United States)

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  3. DNA replication stress: from molecular mechanisms to human disease.

    Science.gov (United States)

    Muñoz, Sergio; Méndez, Juan

    2017-02-01

    The genome of proliferating cells must be precisely duplicated in each cell division cycle. Chromosomal replication entails risks such as the possibility of introducing breaks and/or mutations in the genome. Hence, DNA replication requires the coordinated action of multiple proteins and regulatory factors, whose deregulation causes severe developmental diseases and predisposes to cancer. In recent years, the concept of "replicative stress" (RS) has attracted much attention as it impinges directly on genomic stability and offers a promising new avenue to design anticancer therapies. In this review, we summarize recent progress in three areas: (1) endogenous and exogenous factors that contribute to RS, (2) molecular mechanisms that mediate the cellular responses to RS, and (3) the large list of diseases that are directly or indirectly linked to RS.

  4. Prolonged decay of molecular rate estimates for metazoan mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Martyna Molak

    2015-03-01

    Full Text Available Evolutionary timescales can be estimated from genetic data using the molecular clock, often calibrated by fossil or geological evidence. However, estimates of molecular rates in mitochondrial DNA appear to scale negatively with the age of the clock calibration. Although such a pattern has been observed in a limited range of data sets, it has not been studied on a large scale in metazoans. In addition, there is uncertainty over the temporal extent of the time-dependent pattern in rate estimates. Here we present a meta-analysis of 239 rate estimates from metazoans, representing a range of timescales and taxonomic groups. We found evidence of time-dependent rates in both coding and non-coding mitochondrial markers, in every group of animals that we studied. The negative relationship between the estimated rate and time persisted across a much wider range of calibration times than previously suggested. This indicates that, over long time frames, purifying selection gives way to mutational saturation as the main driver of time-dependent biases in rate estimates. The results of our study stress the importance of accounting for time-dependent biases in estimating mitochondrial rates regardless of the timescale over which they are inferred.

  5. On some surprising statistical properties of a DNA fingerprinting technique called AFLP

    NARCIS (Netherlands)

    Gort, G.

    2010-01-01

    AFLP is a widely used DNA fingerprinting technique, resulting in band absence - presence profiles, like a bar code. Bands represent DNA fragments, sampled from the genome of an individual plant or other organism. The DNA fragments travel through a lane of an electrophoretic gel or microcapillary

  6. Hydrodynamic characterization and molecular weight estimation of ultrasonically sheared DNA; Caracterizacion hidrodinamica y estimacion de pesos moleculares de DNA degradado por ultrasonidos

    Energy Technology Data Exchange (ETDEWEB)

    Casal, J I; Garces, F; Garcia-Sacristan, A

    1981-07-01

    The sedimentation coefficients and intrinsic viscosities of ultrasonically sheared calf thymus DNA have been determined. The molecular weight estimation according to this parameters have been compared with the ones obtained from the electrophoretic migration rates based on the calibration proposed using the known molecular weight restriction fragments of X-ENA. (Author) 35 refs.

  7. Optical Fiber Nanotips Coated with Molecular Beacons for DNA Detection

    Directory of Open Access Journals (Sweden)

    Ambra Giannetti

    2015-04-01

    Full Text Available Optical fiber sensors, thanks to their compactness, fast response and real-time measurements, have a large impact in the fields of life science research, drug discovery and medical diagnostics. In recent years, advances in nanotechnology have resulted in the development of nanotools, capable of entering the single cell, resulting in new nanobiosensors useful for the detection of biomolecules inside living cells. In this paper, we provide an application of a nanotip coupled with molecular beacons (MBs for the detection of DNA. The MBs were characterized by hybridization studies with a complementary target to prove their functionality both free in solution and immobilized onto a solid support. The solid support chosen as substrate for the immobilization of the MBs was a 30 nm tapered tip of an optical fiber, fabricated by chemical etching. With this set-up promising results were obtained and a limit of detection (LOD of 0.57 nM was reached, opening up the possibility of using the proposed nanotip to detect mRNAs inside the cytoplasm of living cells.

  8. The shear flow processing of controlled DNA tethering and stretching for organic molecular electronics.

    Science.gov (United States)

    Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan

    2011-01-25

    DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.

  9. Feasibility of using microbeads with holographic barcodes to track DNA specimens in the clinical molecular laboratory

    Directory of Open Access Journals (Sweden)

    Jason D. Merker

    2013-07-01

    Full Text Available We demonstrate the feasibility of using glass microbeads with a holographic barcode identifier to track DNA specimens in the molecular pathology laboratory. These beads can be added to peripheral blood specimens and are carried through automated DNA extraction protocols that use magnetic glass particles. We found that an adequate number of microbeads are consistently carried over during genomic DNA extraction to allow specimen identification, that the beads do not interfere with the performance of several different molecular assays, and that the beads and genomic DNA remain stable when stored together under regular storage conditions in the molecular pathology laboratory. The beads function as an internal, easily readable specimen barcode. This approach may be useful for identifying DNA specimens and reducing errors associated with molecular laboratory testing.

  10. Molecular verification on male sterile mutant after injected exogenous λDNA into wheat

    International Nuclear Information System (INIS)

    Yang Jingcheng; Yu Yuanjie; Liu Fengzhen; Qi Yanfang; Shen Fafu

    2000-01-01

    A cytoplasmic male sterile mutant and then a stable CMS line named D-type sterile line were obtained after injected exogenous λDNA into wheat line 814527, and line 814527 could be its maintainer line. By using λDNA labelled with 32 P as probe, unlabelled λDNA as positive check, dot blotting of nuclear DNA and chloroplast DNA of receptor 814527, D-type sterile line and its hybrid F 1 with Lumai 14 were carried out. Positive dots appeared in nuclear DNA and chloroplast DNA of D-type sterile line and its hybrid F 1 , but did not appear in the receptor. It showed that fragments of exogenous λDNA existed in nuclear genome and chloroplast genome of D-type sterile line, and could be inherited stably. All these results, on a molecular level, proved the reliability of exogenous DNA injection

  11. Molecular mechanics of DNA bricks: in situ structure, mechanical properties and ionic conductivity

    International Nuclear Information System (INIS)

    Slone, Scott Michael; Li, Chen-Yu; Aksimentiev, Aleksei; Yoo, Jejoong

    2016-01-01

    The DNA bricks method exploits self-assembly of short DNA fragments to produce custom three-dimensional objects with subnanometer precision. In contrast to DNA origami, the DNA brick method permits a variety of different structures to be realized using the same library of DNA strands. As a consequence of their design, however, assembled DNA brick structures have fewer interhelical connections in comparison to equivalent DNA origami structures. Although the overall shape of the DNA brick objects has been characterized and found to conform to the features of the target designs, the microscopic properties of DNA brick objects remain yet to be determined. Here, we use the all-atom molecular dynamics method to directly compare the structure, mechanical properties and ionic conductivity of DNA brick and DNA origami structures different only by internal connectivity of their consistituent DNA strands. In comparison to equivalent DNA origami structures, the DNA brick structures are found to be less rigid and less dense and have a larger cross-section area normal to the DNA helix direction. At the microscopic level, the junction in the DNA brick structures are found to be right-handed, similar to the structure of individual Holliday junctions (HJ) in solution, which contrasts with the left-handed structure of HJ in DNA origami. Subject to external electric field, a DNA brick plate is more leaky to ions than an equivalent DNA origami plate because of its lower density and larger cross-section area. Overall, our results indicate that the structures produced by the DNA brick method are fairly similar in their overall appearance to those created by the DNA origami method but are more compliant when subject to external forces, which likely is a consequence of their single crossover design. (paper)

  12. A Parallel Biological Optimization Algorithm to Solve the Unbalanced Assignment Problem Based on DNA Molecular Computing.

    Science.gov (United States)

    Wang, Zhaocai; Pu, Jun; Cao, Liling; Tan, Jian

    2015-10-23

    The unbalanced assignment problem (UAP) is to optimally resolve the problem of assigning n jobs to m individuals (m applied mathematics, having numerous real life applications. In this paper, we present a new parallel DNA algorithm for solving the unbalanced assignment problem using DNA molecular operations. We reasonably design flexible-length DNA strands representing different jobs and individuals, take appropriate steps, and get the solutions of the UAP in the proper length range and O(mn) time. We extend the application of DNA molecular operations and simultaneity to simplify the complexity of the computation.

  13. Molecular design of sequence specific DNA alkylating agents.

    Science.gov (United States)

    Minoshima, Masafumi; Bando, Toshikazu; Shinohara, Ken-ichi; Sugiyama, Hiroshi

    2009-01-01

    Sequence-specific DNA alkylating agents have great interest for novel approach to cancer chemotherapy. We designed the conjugates between pyrrole (Py)-imidazole (Im) polyamides and DNA alkylating chlorambucil moiety possessing at different positions. The sequence-specific DNA alkylation by conjugates was investigated by using high-resolution denaturing polyacrylamide gel electrophoresis (PAGE). The results showed that polyamide chlorambucil conjugates alkylate DNA at flanking adenines in recognition sequences of Py-Im polyamides, however, the reactivities and alkylation sites were influenced by the positions of conjugation. In addition, we synthesized conjugate between Py-Im polyamide and another alkylating agent, 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI). DNA alkylation reactivies by both alkylating polyamides were almost comparable. In contrast, cytotoxicities against cell lines differed greatly. These comparative studies would promote development of appropriate sequence-specific DNA alkylating polyamides against specific cancer cells.

  14. DNA extraction from sea anemone (Cnidaria: Actiniaria tissues for molecular analyses

    Directory of Open Access Journals (Sweden)

    Pinto S.M.

    2000-01-01

    Full Text Available A specific DNA extraction method for sea anemones is described in which extraction of total DNA from eight species of sea anemones and one species of corallimorpharian was achieved by changing the standard extraction protocols. DNA extraction from sea anemone tissue is made more difficult both by the tissue consistency and the presence of symbiotic zooxanthellae. The technique described here is an efficient way to avoid problems of DNA contamination and obtain large amounts of purified and integral DNA which can be used in different kinds of molecular analyses.

  15. More on contamination: the use of asymmetric molecular behavior to identify authentic ancient human DNA

    DEFF Research Database (Denmark)

    Malmström, Helena; Svensson, Emma M; Gilbert, M Thomas P

    2007-01-01

    concerning the authenticity of such data. Although several methods have been developed to the purpose of authenticating ancient DNA (aDNA) results, while they are useful in faunal research, most of the methods have proven complicated to apply to ancient human DNA. Here, we investigate in detail...... the reliability of one of the proposed criteria, that of appropriate molecular behavior. Using real-time polymerase chain reaction (PCR) and pyrosequencing, we have quantified the relative levels of authentic aDNA and contaminant human DNA sequences recovered from archaeological dog and cattle remains. In doing...

  16. Molecular studies of fibroblasts transfected with hepatitis B virus DNA

    International Nuclear Information System (INIS)

    Chen, M.L.; Hood, A.; Thung, S.N.; Gerber, M.A.

    1987-01-01

    Two subclones (D7 and F8) derived from an NIH 3T3 mouse fibroblast cell line after transfection with hepatitis B virus (HBV) genomes, secreted significantly different amounts of HBsAg and HBeAg. DNA extracted from the subclones revealed only integrated and no extrachromosomal HBV DNA sequences as determined by the Southern blot technique with a /sup 32/P-labeled full length HBV DNA probe. The amount and integration sites of HBV sequences were significantly different in the two subclones. HBV DNA sequences coding for HBsAg and HBcAg were detected by alkaline phosphatase-conjugated, single-stranded synthetic gene-specific oligonucleotide probes revealing a larger number of copies in D7 DNA than in F8 DNA. Using a biotinylated probe for in situ hybridization, HBV DNA was found in the nuclei of all D7 cells with predominant localization to a single chromsome, but only in 10-20% of F8 cells. These observations demonstrate different integration patterns of HBV and DNA in two subclones derived from a transfected cell line and suggest that the amount of integrated HBV DNA is proportional to the amount of HBV antigens produced

  17. Analysis of Molecular Variance Inferred from Metric Distances among DNA Haplotypes: Application to Human Mitochondrial DNA Restriction Data

    OpenAIRE

    Excoffier, L.; Smouse, P. E.; Quattro, J. M.

    1992-01-01

    We present here a framework for the study of molecular variation within a single species. Information on DNA haplotype divergence is incorporated into an analysis of variance format, derived from a matrix of squared-distances among all pairs of haplotypes. This analysis of molecular variance (AMOVA) produces estimates of variance components and F-statistic analogs, designated here as φ-statistics, reflecting the correlation of haplotypic diversity at different levels of hierarchical subdivisi...

  18. Transfer of molecular recognition information from DNA nanostructures to gold nanoparticles

    Science.gov (United States)

    Edwardson, Thomas G. W.; Lau, Kai Lin; Bousmail, Danny; Serpell, Christopher J.; Sleiman, Hanadi F.

    2016-02-01

    DNA nanotechnology offers unparalleled precision and programmability for the bottom-up organization of materials. This approach relies on pre-assembling a DNA scaffold, typically containing hundreds of different strands, and using it to position functional components. A particularly attractive strategy is to employ DNA nanostructures not as permanent scaffolds, but as transient, reusable templates to transfer essential information to other materials. To our knowledge, this approach, akin to top-down lithography, has not been examined. Here we report a molecular printing strategy that chemically transfers a discrete pattern of DNA strands from a three-dimensional DNA structure to a gold nanoparticle. We show that the particles inherit the DNA sequence configuration encoded in the parent template with high fidelity. This provides control over the number of DNA strands and their relative placement, directionality and sequence asymmetry. Importantly, the nanoparticles produced exhibit the site-specific addressability of DNA nanostructures, and are promising components for energy, information and biomedical applications.

  19. Molecular-Sized DNA or RNA Sequencing Machine | NCI Technology Transfer Center | TTC

    Science.gov (United States)

    The National Cancer Institute's Gene Regulation and Chromosome Biology Laboratory is seeking statements of capability or interest from parties interested in collaborative research to co-develop a molecular-sized DNA or RNA sequencing machine.

  20. High molecular weight DNA assembly in vivo for synthetic biology applications.

    Science.gov (United States)

    Juhas, Mario; Ajioka, James W

    2017-05-01

    DNA assembly is the key technology of the emerging interdisciplinary field of synthetic biology. While the assembly of smaller DNA fragments is usually performed in vitro, high molecular weight DNA molecules are assembled in vivo via homologous recombination in the host cell. Escherichia coli, Bacillus subtilis and Saccharomyces cerevisiae are the main hosts used for DNA assembly in vivo. Progress in DNA assembly over the last few years has paved the way for the construction of whole genomes. This review provides an update on recent synthetic biology advances with particular emphasis on high molecular weight DNA assembly in vivo in E. coli, B. subtilis and S. cerevisiae. Special attention is paid to the assembly of whole genomes, such as those of the first synthetic cell, synthetic yeast and minimal genomes.

  1. Molecular cloning of lupin leghemoglobin cDNA

    DEFF Research Database (Denmark)

    Konieczny, A; Jensen, E O; Marcker, K A

    1987-01-01

    Poly(A)+ RNA isolated from root nodules of yellow lupin (Lupinus luteus, var. Ventus) has been used as a template for the construction of a cDNA library. The ds cDNA was synthesized and inserted into the Hind III site of plasmid pBR 322 using synthetic Hind III linkers. Clones containing sequences...... specific for nodules were selected by differential colony hybridization using 32P-labeled cDNA synthesized either from nodule poly(A)+ RNA or from poly(A)+ RNA of uninfected root as probes. Among the recombinant plasmids, the cDNA gene for leghemoglobin was identified. The protein structure derived from...... its nucleotide sequence was consistent with known amino acid sequence of lupin Lb II. The cloned lupin Lb cDNA hybridized to poly(A)+ RNA from nodules only, which is in accordance with the general concept, that leghemoglobin is expressed exclusively in nodules. Udgivelsesdato: 1987-null...

  2. Exploration of disulfiram dealings with calf thymus DNA using spectroscopic, electrochemical and molecular docking techniques

    International Nuclear Information System (INIS)

    Subastri, A.; Durga, A.; Harikrishna, K.; Sureshkumar, M.; Jeevaratnam, K.; Girish, K.S.; Thirunavukkarasu, C.

    2016-01-01

    Disulfiram (C 10 H 20 N 2 S 4 ) is an acetaldehyde dehydrogenase inhibitor used in the treatment of chronic alcoholism and it has also been subjected to the clinical trial for cancer in recent times. However, there is no report on the binding effect of this emerging drug with DNA. Hence, the present investigation was taken up to study the binding effect of disulfiram on DNA under physiological conditions. UV–vis absorption spectroscopy, fluorescence emission spectroscopy, circular dichroism spectroscopy, cyclic voltammetry and molecular docking techniques were employed to determine the interaction mode of disulfiram with DNA. Further, DNA cleavage property of disulfiram was carried out by using agarose gel electrophoresis. The UV–vis absorption, emission and cyclic voltammetry measurements revealed that disulfiram showed the intercalative mode of interaction with DNA. The circular dichroism study exhibited structural changes of partial transition from B-conformation to A-conformation in DNA upon addition of disulfiram. Molecular docking study of disulfiram with DNA depicted intercalative mode of binding by formation of hydrogen and hydrophobic interaction along with docking score of −3.07 kcal/mol. The DNA cleavage study revealed that low concentration of disulfiram (50 µM) protected the DNA from oxidative damage sequentially, while high concentration of disulfiram (100 µM) showed less protective activity. Conversely, it caused DNA damage in the presence of hydroxyl radical oxidative system. Hence, the results obtained from the present investigations provide detailed discernment into DNA interaction effects of disulfiram.

  3. Nonlinear microrheology and molecular imaging to map microscale deformations of entangled DNA networks

    Science.gov (United States)

    Wu, Tsai-Chin; Anderson, Rae

    We use active microrheology coupled to single-molecule fluorescence imaging to elucidate the microscale dynamics of entangled DNA. DNA naturally exists in a wide range of lengths and topologies, and is often confined in cell nucleui, forming highly concentrated and entangled biopolymer networks. Thus, DNA is the model polymer for understanding entangled polymer dynamics as well as the crowded environment of cells. These networks display complex viscoelastic properties that are not well understood, especially at the molecular-level and in response to nonlinear perturbations. Specifically, how microscopic stresses and strains propagate through entangled networks, and what molecular deformations lead to the network stress responses are unknown. To answer these important questions, we optically drive a microsphere through entangled DNA, perturbing the system far from equilibrium, while measuring the resistive force the DNA exerts on the bead during and after bead motion. We simultaneously image single fluorescent-labeled DNA molecules throughout the network to directly link the microscale stress response to molecular deformations. We characterize the deformation of the network from the molecular-level to the mesoscale, and map the stress propagation throughout the network. We further study the impact of DNA length (11 - 115 kbp) and topology (linear vs ring DNA) on deformation and propagation dynamics, exploring key nonlinear features such as tube dilation and power-law relaxation.

  4. PH- and salt-dependent molecular combing of DNA: experiments and phenomenological model

    International Nuclear Information System (INIS)

    Benke, Annegret; Pompe, Wolfgang; Mertig, Michael

    2011-01-01

    λ-DNA as well as plasmids can be successfully deposited by molecular combing on hydrophobic surfaces, for pH values ranging from 4 to 10. On polydimethylsiloxane (PDMS) substrates, the deposited DNA molecules are overstretched by about 60-100%. There is a significant influence of sodium ions (NaCl) on the surface density of the deposited DNA, with a maximum near to 100 mM NaCl for a DNA solution (28 ng μl -1 ) at pH 8. The combing process can be described by a micromechanical model including: (i) the adsorption of free moving coiled DNA at the substrate; (ii) the stretching of the coiled DNA by the preceding meniscus; (iii) the relaxation of the deposited DNA to the final length. The sticky ends of λ-DNA cause an adhesion force in the range of about 400 pN which allows a stable overstretching of the DNA by the preceding meniscus. The exposing of hidden hydrophobic bonds of the overstretched DNA leads to a stable deposition on the hydrophobic substrate. The pH-dependent density of deposited DNA as well as the observed influence of sodium ions can be explained by their screening of the negatively charged DNA backbone and sticky ends, respectively. The final DNA length can be derived from a balance of the stored elastic energy of the overstretched molecules and the energy of adhesion.

  5. In vitro molecular machine learning algorithm via symmetric internal loops of DNA.

    Science.gov (United States)

    Lee, Ji-Hoon; Lee, Seung Hwan; Baek, Christina; Chun, Hyosun; Ryu, Je-Hwan; Kim, Jin-Woo; Deaton, Russell; Zhang, Byoung-Tak

    2017-08-01

    Programmable biomolecules, such as DNA strands, deoxyribozymes, and restriction enzymes, have been used to solve computational problems, construct large-scale logic circuits, and program simple molecular games. Although studies have shown the potential of molecular computing, the capability of computational learning with DNA molecules, i.e., molecular machine learning, has yet to be experimentally verified. Here, we present a novel molecular learning in vitro model in which symmetric internal loops of double-stranded DNA are exploited to measure the differences between training instances, thus enabling the molecules to learn from small errors. The model was evaluated on a data set of twenty dialogue sentences obtained from the television shows Friends and Prison Break. The wet DNA-computing experiments confirmed that the molecular learning machine was able to generalize the dialogue patterns of each show and successfully identify the show from which the sentences originated. The molecular machine learning model described here opens the way for solving machine learning problems in computer science and biology using in vitro molecular computing with the data encoded in DNA molecules. Copyright © 2017. Published by Elsevier B.V.

  6. Molecular mechanisms of DNA repair inhibition by caffeine

    Energy Technology Data Exchange (ETDEWEB)

    Selby, C.P.; Sancar, A. (Univ. of North Carolina School of Medicine, Chapel Hill (USA))

    1990-05-01

    Caffeine potentiates the mutagenic and lethal effects of genotoxic agents. It is thought that this is due, at least in some organisms, to inhibition of DNA repair. However, direct evidence for inhibition of repair enzymes has been lacking. Using purified Escherichia coli DNA photolyase and (A)BC excinuclease, we show that the drug inhibits photoreactivation and nucleotide excision repair by two different mechanisms. Caffeine inhibits photoreactivation by interfering with the specific binding of photolyase to damaged DNA, and it inhibits nucleotide excision repair by promoting nonspecific binding of the damage-recognition subunit, UvrA, of (A)BC excinuclease. A number of other intercalators, including acriflavin and ethidium bromide, appear to inhibit the excinuclease by a similar mechanism--that is, by trapping the UvrA subunit in nonproductive complexes on undamaged DNA.

  7. In situ structure and dynamics of DNA origami determined through molecular dynamics simulations.

    Science.gov (United States)

    Yoo, Jejoong; Aksimentiev, Aleksei

    2013-12-10

    The DNA origami method permits folding of long single-stranded DNA into complex 3D structures with subnanometer precision. Transmission electron microscopy, atomic force microscopy, and recently cryo-EM tomography have been used to characterize the properties of such DNA origami objects, however their microscopic structures and dynamics have remained unknown. Here, we report the results of all-atom molecular dynamics simulations that characterized the structural and mechanical properties of DNA origami objects in unprecedented microscopic detail. When simulated in an aqueous environment, the structures of DNA origami objects depart from their idealized targets as a result of steric, electrostatic, and solvent-mediated forces. Whereas the global structural features of such relaxed conformations conform to the target designs, local deformations are abundant and vary in magnitude along the structures. In contrast to their free-solution conformation, the Holliday junctions in the DNA origami structures adopt a left-handed antiparallel conformation. We find the DNA origami structures undergo considerable temporal fluctuations on both local and global scales. Analysis of such structural fluctuations reveals the local mechanical properties of the DNA origami objects. The lattice type of the structures considerably affects global mechanical properties such as bending rigidity. Our study demonstrates the potential of all-atom molecular dynamics simulations to play a considerable role in future development of the DNA origami field by providing accurate, quantitative assessment of local and global structural and mechanical properties of DNA origami objects.

  8. Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

    Science.gov (United States)

    Izanloo, Cobra

    2017-09-02

    An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

  9. Analyte-Triggered DNA-Probe Release from a Triplex Molecular Beacon for Nanopore Sensing.

    Science.gov (United States)

    Guo, Bingyuan; Sheng, Yingying; Zhou, Ke; Liu, Quansheng; Liu, Lei; Wu, Hai-Chen

    2018-03-26

    A new nanopore sensing strategy based on triplex molecular beacon was developed for the detection of specific DNA or multivalent proteins. The sensor is composed of a triplex-forming molecular beacon and a stem-forming DNA component that is modified with a host-guest complex. Upon target DNA hybridizing with the molecular beacon loop or multivalent proteins binding to the recognition elements on the stem, the DNA probe is released and produces highly characteristic current signals when translocated through α-hemolysin. The frequency of current signatures can be used to quantify the concentrations of the target molecules. This sensing approach provides a simple, quick, and modular tool for the detection of specific macromolecules with high sensitivity and excellent selectivity. It may find useful applications in point-of-care diagnostics with a portable nanopore kit in the future. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Molecular quantification of environmental DNA using microfluidics and digital PCR.

    Science.gov (United States)

    Hoshino, Tatsuhiko; Inagaki, Fumio

    2012-09-01

    Real-time PCR has been widely used to evaluate gene abundance in natural microbial habitats. However, PCR-inhibitory substances often reduce the efficiency of PCR, leading to the underestimation of target gene copy numbers. Digital PCR using microfluidics is a new approach that allows absolute quantification of DNA molecules. In this study, digital PCR was applied to environmental samples, and the effect of PCR inhibitors on DNA quantification was tested. In the control experiment using λ DNA and humic acids, underestimation of λ DNA at 1/4400 of the theoretical value was observed with 6.58 ng μL(-1) humic acids. In contrast, digital PCR provided accurate quantification data with a concentration of humic acids up to 9.34 ng μL(-1). The inhibitory effect of paddy field soil extract on quantification of the archaeal 16S rRNA gene was also tested. By diluting the DNA extract, quantified copy numbers from real-time PCR and digital PCR became similar, indicating that dilution was a useful way to remedy PCR inhibition. The dilution strategy was, however, not applicable to all natural environmental samples. For example, when marine subsurface sediment samples were tested the copy number of archaeal 16S rRNA genes was 1.04×10(3) copies/g-sediment by digital PCR, whereas real-time PCR only resulted in 4.64×10(2) copies/g-sediment, which was most likely due to an inhibitory effect. The data from this study demonstrated that inhibitory substances had little effect on DNA quantification using microfluidics and digital PCR, and showed the great advantages of digital PCR in accurate quantifications of DNA extracted from various microbial habitats. Copyright © 2012 Elsevier GmbH. All rights reserved.

  11. Molecular dynamics simulations of the adsorption of DNA segments onto graphene oxide

    International Nuclear Information System (INIS)

    Chen, Junlang; Chen, Shude; Chen, Liang; Wang, Yu

    2014-01-01

    Molecular dynamics simulations were performed to investigate the dynamic process of DNA segments’ adsorption on graphene oxide (GO) in aqueous solution. We find that DNA segments finally ‘stand on’ GO’s surface. Due to energy penalty and electrostatic repulsion, DNA segments cannot lie on the surface of GO with their helical axes parallel to GO’s surface. Both π–π stacking and electrostatic interactions contribute to their binding affinity between the contacting basepair and GO. The results are of great importance to understand the interactions between DNA segments and GO. (paper)

  12. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  13. NEXAFS characterization of DNA components and molecular-orientation of surface-bound DNA oligomers

    International Nuclear Information System (INIS)

    Samuel, Newton T.; Lee, C.-Y.; Gamble, Lara J.; Fischer, Daniel A.; Castner, David G.

    2006-01-01

    Single stranded DNA oligomers (ssDNA) immobilized onto solid surfaces forms the basis for several biotechnological applications such as DNA microarrays, affinity separations, and biosensors. Surface structure of Surface-bound oligomers is expected to significantly influence their biological activity and interactions with the environment. In this study near-edge X-ray absorption fine structure spectroscopy (NEXAFS) is used to characterize the components of DNA (nucleobases, nucleotides and nucleosides) and the orientation information of surface-bound ssDNA. The K-edges of carbon, nitrogen and oxygen have spectra with features that are characteristic of the different chemical species present in the nucleobases of DNA. The effect of addition of the DNA sugar and phosphate components on the NEXAFS K-edge spectra was also investigated. The polarization-dependent nitrogen K-edge NEXAFS data show significant changes for different orientations of surface bound ssDNA. These results establish NEXAFS as a powerful technique for chemical and structural characterization of surface-bound DNA oligomers

  14. Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers.

    Science.gov (United States)

    Al-Khalifah, Nasser S; Shanavaskhan, A E

    2017-01-01

    Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.

  15. Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

    International Nuclear Information System (INIS)

    Matsushita, Y.; Murakawa, T.; Shimamura, K.; Oishi, M.; Ohyama, T.; Kurita, N.

    2015-01-01

    The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA

  16. Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

    Energy Technology Data Exchange (ETDEWEB)

    Matsushita, Y., E-mail: kurita@cs.tut.ac.jp; Murakawa, T., E-mail: kurita@cs.tut.ac.jp; Shimamura, K., E-mail: kurita@cs.tut.ac.jp; Oishi, M., E-mail: kurita@cs.tut.ac.jp; Ohyama, T., E-mail: kurita@cs.tut.ac.jp; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Tempaku-cho, Toyohashi, Aichi, 441-8580 (Japan)

    2015-02-27

    The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA.

  17. Molecular engineering of chiral colloidal liquid crystals using DNA origami

    Science.gov (United States)

    Siavashpouri, Mahsa; Wachauf, Christian H.; Zakhary, Mark J.; Praetorius, Florian; Dietz, Hendrik; Dogic, Zvonimir

    2017-08-01

    Establishing precise control over the shape and the interactions of the microscopic building blocks is essential for design of macroscopic soft materials with novel structural, optical and mechanical properties. Here, we demonstrate robust assembly of DNA origami filaments into cholesteric liquid crystals, one-dimensional supramolecular twisted ribbons and two-dimensional colloidal membranes. The exquisite control afforded by the DNA origami technology establishes a quantitative relationship between the microscopic filament structure and the macroscopic cholesteric pitch. Furthermore, it also enables robust assembly of one-dimensional twisted ribbons, which behave as effective supramolecular polymers whose structure and elastic properties can be precisely tuned by controlling the geometry of the elemental building blocks. Our results demonstrate the potential synergy between DNA origami technology and colloidal science, in which the former allows for rapid and robust synthesis of complex particles, and the latter can be used to assemble such particles into bulk materials.

  18. MOLECULAR CLONING OF OVINE cDNA LEPTIN GENE

    Directory of Open Access Journals (Sweden)

    CLAUDIA TEREZIA SOCOL

    2008-05-01

    Full Text Available An efficient bacterial transformation system suitable for cloning the coding sequence of the ovine leptin gene in E. coli DH5α host cells using the pGEMT easy vector it is described in this paper. The necessity of producing leptin is based on the fact that the role of this molecule in the animal and human organism is still unknown, leptin not existing as commercial product on the Romanian market. The results obtained in the bacterial transformation, cloning, recombinant clones selection, control of the insertion experiments and DNA computational analysis represent the first steps in further genetic engineering experiments such as production of DNA libraries, DNA sequencing, protein expression, etc., for a further contribution in elucidating the role of leptin in the animal and human organism.

  19. Investigation of arc repressor DNA-binding specificity by comparative molecular dynamics simulations.

    Science.gov (United States)

    Song, Wei; Guo, Jun-Tao

    2015-01-01

    Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.

  20. Biochemical studies of DNA strand break repair and molecular characterization of mei-41, a gene involved in DNA break repair

    International Nuclear Information System (INIS)

    Oliveri, D.R.

    1989-01-01

    The ability to repair X-irradiation induced single-strand DNA breaks was examined in mutagen-sensitive mutants of Drosophila melanogaster. This analysis demonstrated that examined stocks possess a normal capacity to repair X-ray induced single-strand breaks. One of the mutants in this study, mei-41, has been shown to be involved in a number of DNA metabolizing functions. A molecular characterization of this mutant is presented. A cDNA hybridizing to genomic DNA both proximal and distal to a P element inducing a mei-41 mutation was isolated from both embryonic and adult female recombinant lambda phage libraries. A 2.2 kilobase embryonic cDNA clone was sequenced; the sequence of an open reading frame was identified which would predict a protein of 384 amino acids with a molecular weight of 43,132 daltons. An examination of homologies to sequences in protein and nucleic acid data bases revealed no sequences with significant homology to mei-41, however, two potential Zinc-finger domains were identified. Analysis of RNA hybridizing to the embryonic cDNA demonstrated the existence of a major 2.2 kilobase transcript expressed primarily in embryos and adult flies. An examination of the transcription of this gene in mei-41 mutants revealed significant variation from wild-type, an indication that the embryonic cDNA does represent a mei-41 transcript. Expression in tissues from adult animals demonstrated that the 2.2 kilobase RNA is expressed primarily in reproductive tissues. A 3.8kb transcript is the major species of RNA in the adult head and thorax. Evidence is presented which implies that expression of the mei-41 gene is strongly induced by exposure of certain cells to mutagens

  1. A Molecular Beam Deposition of DNA Nanometer Films

    Science.gov (United States)

    2007-01-01

    device structure consists of ITO/PEDOT:PSS (50 nm)/NPB (30 nm)/ Alq3 (40 nm)/BCP (20 nm)/ Alq3 (10 nm)/Li:Al, while the Bi- OLED has an additional DNA...layer; DNA- CTMA is an electron blocking layer (EBL); NPB is used as hole transport layer; Alq3 is used for both the electron transport layer and the...N,N’-bis(naphthalen-1-yl)-N,N’- bis(phenyl)benzidine)], Alq3 [tris-(8-hydroxyquinoline) aluminum] and BCP [2,9- Dimethyl-4,7-diphenyl-1,10

  2. Transforming bases to bytes: Molecular computing with DNA

    Indian Academy of Sciences (India)

    Despite the popular image of silicon-based computers for computation, an embryonic field of mole- cular computation is emerging, where molecules in solution perform computational ..... [4] Mao C, Sun W, Shen Z and Seeman N C 1999. A nanomechanical device based on the B-Z transition of DNA; Nature 397 144–146.

  3. Rapid isolation of high molecular weight DNA from single dried ...

    African Journals Online (AJOL)

    ANAND

    For studying genetic diversity in populations of predatory coccinellid, Cryptolaemus montrouzieri. Mulsant (Coccinellidae: Coleoptera), our attempts to isolate high quality DNA from individual adult beetle using several previously reported protocols and even modifications were quite unsuccessful as the insect size was small ...

  4. DNA Re-EvolutioN: a game for learning molecular genetics and evolution.

    Science.gov (United States)

    Miralles, Laura; Moran, Paloma; Dopico, Eduardo; Garcia-Vazquez, Eva

    2013-01-01

    Evolution is a main concept in biology, but not many students understand how it works. In this article we introduce the game DNA Re-EvolutioN as an active learning tool that uses genetic concepts (DNA structure, transcription and translation, mutations, natural selection, etc.) as playing rules. Students will learn about molecular evolution while playing a game that mixes up theory and entertainment. The game can be easily adapted to different educational levels. The main goal of this play is to arrive at the end of the game with the longest protein. Students play with pawns and dices, a board containing hypothetical events (mutations, selection) that happen to molecules, "Evolution cards" with indications for DNA mutations, prototypes of a DNA and a mRNA chain with colored "nucleotides" (plasticine balls), and small pieces simulating t-RNA with aminoacids that will serve to construct a "protein" based on the DNA chain. Students will understand how changes in DNA affect the final protein product and may be subjected to positive or negative selection, using a didactic tool funnier than classical theory lectures and easier than molecular laboratory experiments: a flexible and feasible game to learn and enjoy molecular evolution at no-cost. The game was tested by majors and non-majors in genetics from 13 different countries and evaluated with pre- and post-tests obtaining very positive results. © 2013 by The International Union of Biochemistry and Molecular Biology.

  5. Are glutathione S transferases involved in DNA damage signalling? Interactions with DNA damage and repair revealed from molecular epidemiology studies

    Energy Technology Data Exchange (ETDEWEB)

    Dusinska, Maria, E-mail: Maria.DUSINSKA@nilu.no [CEE-Health Effects Group, NILU - Norwegian Institute for Air Research, Kjeller (Norway); Staruchova, Marta; Horska, Alexandra [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia); Smolkova, Bozena [Laboratory of Cancer Genetics, Cancer Research Institute of the Slovak Academy of Sciences, Bratislava (Slovakia); Collins, Andrew [Department of Nutrition, Faculty of Medicine, University of Oslo (Norway); Bonassi, Stefano [Unit of Clinical and Molecular Epidemiology, IRCCS San Raffaele Pisana, Rome (Italy); Volkovova, Katarina [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia)

    2012-08-01

    Glutathione S-transferases (GSTs) are members of a multigene family of isoenzymes that are important in the control of oxidative stress and in phase II metabolism. Acting non-enzymically, GSTs can modulate signalling pathways of cell proliferation, cell differentiation and apoptosis. Using a molecular epidemiology approach, we have investigated a potential involvement of GSTs in DNA damage processing, specifically the modulation of DNA repair in a group of 388 healthy adult volunteers; 239 with at least 5 years of occupational exposure to asbestos, stone wool or glass fibre, and 149 reference subjects. We measured DNA damage in lymphocytes using the comet assay (alkaline single cell gel electrophoresis): strand breaks (SBs) and alkali-labile sites, oxidised pyrimidines with endonuclease III, and oxidised purines with formamidopyrimidine DNA glycosylase. We also measured GST activity in erythrocytes, and the capacity for base excision repair (BER) in a lymphocyte extract. Polymorphisms in genes encoding three GST isoenzymes were determined, namely deletion of GSTM1 and GSTT1 and single nucleotide polymorphism Ile105Val in GSTP1. Consumption of vegetables and wine correlated negatively with DNA damage and modulated BER. GST activity correlated with oxidised bases and with BER capacity, and differed depending on polymorphisms in GSTP1, GSTT1 and GSTM1. A significantly lower BER rate was associated with the homozygous GSTT1 deletion in all asbestos site subjects and in the corresponding reference group. Multifactorial analysis revealed effects of sex and exposure in GSTP1 Ile/Val heterozygotes but not in Ile/Ile homozygotes. These variants affected also SBs levels, mainly by interactions of GSTP1 genotype with exposure, with sex, and with smoking habit; and by an interaction between sex and smoking. Our results show that GST polymorphisms and GST activity can apparently influence DNA stability and repair of oxidised bases, suggesting a potential new role for these

  6. Are glutathione S transferases involved in DNA damage signalling? Interactions with DNA damage and repair revealed from molecular epidemiology studies

    International Nuclear Information System (INIS)

    Dusinska, Maria; Staruchova, Marta; Horska, Alexandra; Smolkova, Bozena; Collins, Andrew; Bonassi, Stefano; Volkovova, Katarina

    2012-01-01

    Glutathione S-transferases (GSTs) are members of a multigene family of isoenzymes that are important in the control of oxidative stress and in phase II metabolism. Acting non-enzymically, GSTs can modulate signalling pathways of cell proliferation, cell differentiation and apoptosis. Using a molecular epidemiology approach, we have investigated a potential involvement of GSTs in DNA damage processing, specifically the modulation of DNA repair in a group of 388 healthy adult volunteers; 239 with at least 5 years of occupational exposure to asbestos, stone wool or glass fibre, and 149 reference subjects. We measured DNA damage in lymphocytes using the comet assay (alkaline single cell gel electrophoresis): strand breaks (SBs) and alkali-labile sites, oxidised pyrimidines with endonuclease III, and oxidised purines with formamidopyrimidine DNA glycosylase. We also measured GST activity in erythrocytes, and the capacity for base excision repair (BER) in a lymphocyte extract. Polymorphisms in genes encoding three GST isoenzymes were determined, namely deletion of GSTM1 and GSTT1 and single nucleotide polymorphism Ile105Val in GSTP1. Consumption of vegetables and wine correlated negatively with DNA damage and modulated BER. GST activity correlated with oxidised bases and with BER capacity, and differed depending on polymorphisms in GSTP1, GSTT1 and GSTM1. A significantly lower BER rate was associated with the homozygous GSTT1 deletion in all asbestos site subjects and in the corresponding reference group. Multifactorial analysis revealed effects of sex and exposure in GSTP1 Ile/Val heterozygotes but not in Ile/Ile homozygotes. These variants affected also SBs levels, mainly by interactions of GSTP1 genotype with exposure, with sex, and with smoking habit; and by an interaction between sex and smoking. Our results show that GST polymorphisms and GST activity can apparently influence DNA stability and repair of oxidised bases, suggesting a potential new role for these

  7. Strip biosensor for amplified detection of nerve growth factor-beta based on a molecular translator and catalytic DNA circuit.

    Science.gov (United States)

    Liu, Jun; Lai, Ting; Mu, Kejie; Zhou, Zheng

    2014-10-07

    We have demonstrated a new visual detection approach based on a molecular translator and a catalytic DNA circuit for the detection of nerve growth factor-beta (NGF-β). In this assay, a molecular translator based on the binding-induced DNA strand-displacement reaction was employed to convert the input protein to an output DNA signal. The molecular translator is composed of a target recognition element and a signal output element. Target recognition is achieved by the binding of the anti-NGF-β antibody to the target protein. Polyclonal anti-NGF-β antibody is conjugated to DNA1 and DNA2. The antibody conjugated DNA1 is initially hybridized to DNA3 to form a stable DNA1/DNA3 duplex. In the presence of NGF-β, the binding of the same target protein brings DNA1 and DNA2 into close proximity, resulting in an increase in their local effective concentration. This process triggers the strand-displacement reaction between DNA2 and DNA3 and releases the output DNA3. The released DNA3 is further amplified by a catalytic DNA circuit. The product of the catalytic DNA circuit is detected by a strip biosensor. This proposed assay has high sensitivity and selectivity with a dynamic response ranging from 10 fM to 10 pM, and its detection limit is 10 fM of NGF-β. This work provides a sensitive, enzyme-free, and universal strategy for the detection of other proteins.

  8. Understanding DNA Under Oxidative Stress and Sensitization: The Role of Molecular Modeling

    Directory of Open Access Journals (Sweden)

    Antonio eMonari

    2015-07-01

    Full Text Available DNA is constantly exposed to damaging threats coming from oxidative stress, i.e. from the presence of free radicals and reactive oxygen species. Sensitization from exogenous and endogenous compounds that strongly enhance the frequency of light-induced lesions also plays an important role. The experimental determination of DNA lesions, though a difficult subject, is somehow well established and allows to elucidate even extremely rare DNA lesions. In parallel, molecular modeling has become fundamental to clearly understand the fine mechanisms related to DNA defects induction. Indeed, it offers an unprecedented possibility to get access to an atomistic or even electronic resolution. Ab initio molecular dynamics may also describe the time-evolution of the molecular system and its reactivity. Yet the modeling of DNA (photo-reactions does necessitate elaborate multi-scale methodologies to tackle a damage induction reactivity that takes place in a complex environment. The double-stranded DNA environment is first characterized by a very high flexibility, that dynamical effects are to be taken into account, but also a strongly inhomogeneous electrostatic embedding. Additionally, one aims at capturing more subtle effects, such as the sequence selectivity which is of critical important for DNA damage. The structure and dynamics of the DNA/sensitizers complexes, as well as the photo-induced electron- and energy-transfer phenomena taking place upon sensitization, should be carefully modeled. Finally the factors inducing different repair ratios for different lesions should also be rationalized.In this review we will critically analyze the different computational strategies used to model DNA lesions. A clear picture of the complex interplay between reactivity and structural factors will be sketched. The use of proper multi-scale modeling leads to the in-depth comprehension of DNA lesions mechanism and also to the rational design of new chemo-therapeutic agents.

  9. Alignment of Gold Nanoparticle-Decorated DNA Origami Nanotubes: Substrate Prepatterning versus Molecular Combing.

    Science.gov (United States)

    Teschome, Bezu; Facsko, Stefan; Gothelf, Kurt V; Keller, Adrian

    2015-11-24

    DNA origami has become an established technique for designing well-defined nanostructures with any desired shape and for the controlled arrangement of functional nanostructures with few nanometer resolution. These unique features make DNA origami nanostructures promising candidates for use as scaffolds in nanoelectronics and nanophotonics device fabrication. Consequently, a number of studies have shown the precise organization of metallic nanoparticles on various DNA origami shapes. In this work, we fabricated large arrays of aligned DNA origami decorated with a high density of gold nanoparticles (AuNPs). To this end, we first demonstrate the high-yield assembly of high-density AuNP arrangements on DNA origami adsorbed to Si surfaces with few unbound background nanoparticles by carefully controlling the concentrations of MgCl2 and AuNPs in the hybridization buffer and the hybridization time. Then, we evaluate two methods, i.e., hybridization to prealigned DNA origami and molecular combing in a receding meniscus, with respect to their potential to yield large arrays of aligned AuNP-decorated DNA origami nanotubes. Because of the comparatively low MgCl2 concentration required for the efficient immobilization of the AuNPs, the prealigned DNA origami become mobile and displaced from their original positions, thereby decreasing the alignment yield. This increased mobility, on the other hand, makes the adsorbed origami susceptible to molecular combing, and a total alignment yield of 86% is obtained in this way.

  10. Towards understanding the molecular basis of bacterial DNA segregation

    DEFF Research Database (Denmark)

    Leonard, Thomas A.; Møller-Jensen, Jakob; Löwe, Jan

    2005-01-01

    Bacteria ensure the fidelity of genetic inheritance by the coordinated control of chromosome segregation and cell division. Here, we review the molecules and mechanisms that govern the correct subcellular positioning and rapid separation of newly replicated chromosomes and plasmids towards the ce...... common to the two processes. Finally, we discuss the role that the bacterial cytoskeleton plays in DNA partitioning and the missing link between prokaryotes and eukaryotes that is bacterial mechano-chemical motor proteins. Udgivelsesdato: Mar 29...

  11. A Parallel Biological Optimization Algorithm to Solve the Unbalanced Assignment Problem Based on DNA Molecular Computing

    Directory of Open Access Journals (Sweden)

    Zhaocai Wang

    2015-10-01

    Full Text Available The unbalanced assignment problem (UAP is to optimally resolve the problem of assigning n jobs to m individuals (m < n, such that minimum cost or maximum profit obtained. It is a vitally important Non-deterministic Polynomial (NP complete problem in operation management and applied mathematics, having numerous real life applications. In this paper, we present a new parallel DNA algorithm for solving the unbalanced assignment problem using DNA molecular operations. We reasonably design flexible-length DNA strands representing different jobs and individuals, take appropriate steps, and get the solutions of the UAP in the proper length range and O(mn time. We extend the application of DNA molecular operations and simultaneity to simplify the complexity of the computation.

  12. Use of electroporation for high-molecular-weight DNA-mediated gene transfer.

    Science.gov (United States)

    Jastreboff, M M; Ito, E; Bertino, J R; Narayanan, R

    1987-08-01

    Electroporation was used to introduce high-molecular-weight DNA into murine hematopoietic cells and NIH3T3 cells. CCRF-CEM cells were stably transfected with SV2NEO plasmid and the genomic DNA from G-418-resistant clones (greater than 65 kb) was introduced into mouse bone marrow and NIH3T3 cells by electroporation. NEO sequences and expression were detected in the hematopoietic tissues of lethally irradiated mice, with 24% of individual spleen colonies expressing NEO. The frequency of genomic DNA transfer into NIH3T3 cells was 0.25 X 10(-3). Electroporation thus offers a powerful mode of gene transfer not only of cloned genes but also of high-molecular-weight DNA into cells.

  13. Exploration of disulfiram dealings with calf thymus DNA using spectroscopic, electrochemical and molecular docking techniques

    Energy Technology Data Exchange (ETDEWEB)

    Subastri, A.; Durga, A. [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605014 (India); Harikrishna, K.; Sureshkumar, M. [Centre for Bioinformatics, Pondicherry University, Puducherry 605014 (India); Jeevaratnam, K. [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605014 (India); Girish, K.S. [Department of Studies & Research in Biochemistry, Tumkur University, Tumkur, Karnataka (India); Thirunavukkarasu, C., E-mail: tchinnasamy@hotmail.com [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605014 (India)

    2016-02-15

    Disulfiram (C{sub 10}H{sub 20}N{sub 2}S{sub 4}) is an acetaldehyde dehydrogenase inhibitor used in the treatment of chronic alcoholism and it has also been subjected to the clinical trial for cancer in recent times. However, there is no report on the binding effect of this emerging drug with DNA. Hence, the present investigation was taken up to study the binding effect of disulfiram on DNA under physiological conditions. UV–vis absorption spectroscopy, fluorescence emission spectroscopy, circular dichroism spectroscopy, cyclic voltammetry and molecular docking techniques were employed to determine the interaction mode of disulfiram with DNA. Further, DNA cleavage property of disulfiram was carried out by using agarose gel electrophoresis. The UV–vis absorption, emission and cyclic voltammetry measurements revealed that disulfiram showed the intercalative mode of interaction with DNA. The circular dichroism study exhibited structural changes of partial transition from B-conformation to A-conformation in DNA upon addition of disulfiram. Molecular docking study of disulfiram with DNA depicted intercalative mode of binding by formation of hydrogen and hydrophobic interaction along with docking score of −3.07 kcal/mol. The DNA cleavage study revealed that low concentration of disulfiram (50 µM) protected the DNA from oxidative damage sequentially, while high concentration of disulfiram (100 µM) showed less protective activity. Conversely, it caused DNA damage in the presence of hydroxyl radical oxidative system. Hence, the results obtained from the present investigations provide detailed discernment into DNA interaction effects of disulfiram.

  14. Size and number of DNA molecules from Chinese hamster ovary cells determined by molecular autoradiography

    International Nuclear Information System (INIS)

    Todd, M.B.

    1980-06-01

    A new method for visualization of separable subunits of DNA is described. Autoradiography of tritium-labeled DNA from one or a few nuclei, lysed with detergent, moderate salt, and proteases, and gently deposited on a filter, allows determination of subunit molecular weight, size distribution, number per nucleus, and organization. The shape of the size distribution of CHO subunit images is similar to that of CHO mitotic chromosomes, and the numbers of subunits per nucleus supports a model of eight subunits per chromosome

  15. Surface-attached molecular beacons light the way for DNA sequencing

    Czech Academy of Sciences Publication Activity Database

    Paleček, Emil

    2004-01-01

    Roč. 22, č. 2 (2004), s. 55-58 ISSN 0167-7799 R&D Projects: GA AV ČR IBS5004355; GA ČR GA204/03/0566 Institutional research plan: CEZ:AV0Z5004920 Keywords : molecular beacon * DNA stem-loop structure * DNA sensors Subject RIV: BO - Biophysics Impact factor: 8.606, year: 2004

  16. Molecular Cytogenetic Mapping of Satellite DNA Sequences in Aegilops geniculata and Wheat

    Czech Academy of Sciences Publication Activity Database

    Koo, D.H.; Tiwari, V.K.; Hřibová, Eva; Doležel, Jaroslav; Friebe, B.; Gill, B.S.

    2016-01-01

    Roč. 148, č. 4 (2016), s. 314-321 ISSN 1424-8581 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : in-situ hybridization * chromosome addition lines * resistance genes lr57 * repetitive dna * triticum-ovatum * powdery mildew * plant genome * bread wheat * leaf rust * identification * Aegilops geniculata * Chromosome identification * Fluorescence in situ hybridization * Satellite DNA * Wheat Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.354, year: 2016

  17. Elucidation of polymer induced DNA condensation. Visualisation at the single molecular level

    International Nuclear Information System (INIS)

    Martin, Alison Laura

    2002-01-01

    DNA condensation is a phenomenon that has stimulated interest from biologists, physicists, and polymer chemists for decades. At the cellular level, this process is key to the packing of DNA within the nuclear envelope, and the exposure of the appropriate nucleic acid sequences in order for transcription to occur, and proteins to be produced. The advent of gene therapy has led to an invigoration of this subject area. In order to successfully deliver to, and transfect target cells, many delivery vectors condense the therapeutic DNA into small compact particles. The nature of these particles have a considerable influence on the ultimate expression of the administered nucleic acid material. In addition, at its most fundamental, DNA itself is a classical polyelectrolyte polymer, the behaviour of which has applicability to other charged polymeric systems. There are two core interwound themes to this investigation; the visualisation of DNA condensate morphology at ultra-resolution, and the elucidation of the mechanisms of formation of these structures. The technique of atomic force microscopy is central to these investigations. Methodologies have been devised allowing the visualisation of the tertiary structure and conformational behaviour of individual DNA condensates in near in situ conditions. Condensation of the nucleic acid material has been induced by two classes of cation; small molecular cations, like those found within eukaryotic cells, and a range of cationic polymers. The cationic polymers investigated all have considerable potential as gene delivery vectors. The resultant DNA condensates have been assessed and contrasted in terms of their tertiary morphology, lateral dimensions, and structural volume. Assessments have also been made regarding the influence of the molecular architecture of the cationic moiety and the nature of the input nucleic acid material on the resultant DNA condensates. With regard to the elucidation of the mechanisms of DNA condensate

  18. Synthetic Ion Channels and DNA Logic Gates as Components of Molecular Robots.

    Science.gov (United States)

    Kawano, Ryuji

    2018-02-19

    A molecular robot is a next-generation biochemical machine that imitates the actions of microorganisms. It is made of biomaterials such as DNA, proteins, and lipids. Three prerequisites have been proposed for the construction of such a robot: sensors, intelligence, and actuators. This Minireview focuses on recent research on synthetic ion channels and DNA computing technologies, which are viewed as potential candidate components of molecular robots. Synthetic ion channels, which are embedded in artificial cell membranes (lipid bilayers), sense ambient ions or chemicals and import them. These artificial sensors are useful components for molecular robots with bodies consisting of a lipid bilayer because they enable the interface between the inside and outside of the molecular robot to function as gates. After the signal molecules arrive inside the molecular robot, they can operate DNA logic gates, which perform computations. These functions will be integrated into the intelligence and sensor sections of molecular robots. Soon, these molecular machines will be able to be assembled to operate as a mass microrobot and play an active role in environmental monitoring and in vivo diagnosis or therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Feasibility study of molecular memory device based on DNA using methylation to store information

    International Nuclear Information System (INIS)

    Jiang, Liming; Al-Dirini, Feras; Qiu, Wanzhi; Skafidas, Efstratios; Hossain, Faruque M.; Evans, Robin

    2016-01-01

    DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

  20. Feasibility study of molecular memory device based on DNA using methylation to store information

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Liming; Al-Dirini, Feras [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); National ICT Australia, The University of Melbourne, Parkville 3010 (Australia); Qiu, Wanzhi; Skafidas, Efstratios, E-mail: sskaf@unimelb.edu.au [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Hossain, Faruque M. [Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Evans, Robin [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia)

    2016-07-14

    DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

  1. Molecular dynamics simulations of the DNA interaction with metallic nanoparticles and TiO2 surfaces

    International Nuclear Information System (INIS)

    Kholmurodov, Kh.T.; Krasavin, E.A.; Dushanov, E.B.; Hassan, H.K.; Galal, A.; ElHabashy, H.A.; Sweilam, N.H.; Yasuoka, K.

    2013-01-01

    The understanding of the mechanism of DNA interactions and binding with metallic nanoparticles (NPs) and surfaces represents a great interest in today's medicine applications due to diagnostic and treatment of oncology diseases. Recent experimental and simulation studies involve the DNA interaction with highly localized proton beams or metallic NPs (such as Ag, Au, etc.), aimed at targeted cancer therapy through the injection of metal micro- or nanoparticles into the tumor tissue with consequent local microwave or laser heating. The effects of mutational structure changes in DNA and protein structures could result in destroying of native chemical (hydrogen) bonds or, on the contrary, creating of new bonds that do not normally exist there. The cause of such changes might be the alteration of one or several nucleotides (in DNA) or the substitution of specific amino acid residues (in proteins) that can lead to the essential structural destabilization or unfolding. At the atomic or molecular level, the replacement of one nucleotide by another (in DNA double helices) or replacement of one amino acid residue by another (in proteins) cause essential modifications of the molecular force fields of the environment that break locally important hydrogen bonds underlying the structural stability of the biological molecules. In this work, the molecular dynamics(MD) simulations were performed for four DNA models and the flexibilities of the purine and pyrimidine nucleotides during the interaction process with the metallic NPs and TiO 2 surface were clarified

  2. Molecular barcoding, DNA from snake venom, and toxinological research: Considerations and concerns.

    Science.gov (United States)

    Powell, Randy L; Reyes, Steven R; Lannutti, Dominic I

    2006-12-15

    The problem of species identification in toxinological research and solutions such as molecular barcoding and DNA extraction from venom samples are addressed. Molecular barcoding is controversial with both perceived advantages and inherent problems. A method of species identification utilizing mitochondrial DNA from venom has been identified. This method could result in deemphasizing the importance of obtaining detailed information on the venom source prior to analysis. Additional concerns include; a cost prohibitive factor, intraspecific venom variation, and venom processing issues. As researchers demand more stringent records and verification, venom suppliers may be prompted to implement improved methods and controls.

  3. Consequences of intramolecular dityrosine formation on a DNA-protein complex: a molecular modeling study

    International Nuclear Information System (INIS)

    Gras, Julien; Sy, Denise; Eon, Severine; Charlier, Michel; Spotheim-Maurizot, Melanie

    2005-01-01

    Irradiation of the free lac repressor with γ-rays abolishes protein's ability to specifically bind operator DNA. A possible radiation-induced protein damage is a dityrosine (DTyr) formed by two spatially close radiation-induced tyrosyl radicals. We performed the molecular modeling of complexes between operator DNA and DTyr-bearing parts (headpieces) of the repressor. The presence of DTyr affects the structure and the interactions between partners. A detailed analysis allows to conclude this damage can partially account for the loss of repressor ability to bind DNA

  4. Analysis of the histone protein tail and DNA in nucleosome using molecular dynamics simulation

    Science.gov (United States)

    Fujimori, R.; Komatsu, Y.; Fukuda, M.; Miyakawa, T.; Morikawa, R.; Takasu, M.

    2013-02-01

    We study the effect of the tails of H3 and H4 histones in the nucleosomes, where DNA and histones are packed in the form of chromatin. We perform molecular dynamics simulations of the complex of DNA and histones and calculate the mean square displacement and the gyration radius of the complex of DNA and histones for the cases with tails intact and the cases with tails missing. Our results show that the H3 tails are important for the motion of the histones. We also find that the motion of one tail is affected by other tails, although the tails are distanced apart, suggesting the correlated motion in biological systems.

  5. Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Greulich-Bode, Karin; Wang, Mei; Rhein, Andreas; Weier, Jingly; Weier, Heinz-Ulli

    2008-12-16

    Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-?B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.

  6. Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Greulich-Bode, Karin M.; Wang, Mei; Rhein, Andreas P.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-12-04

    Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-{kappa}B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.

  7. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett

    2013-11-01

    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  8. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we...... anticipate that it will also be useful for phylogeny and bar-coding studies....

  9. Ultrafast spectroscopy on DNA-cleavage by endonuclease in molecular crowding.

    Science.gov (United States)

    Singh, Priya; Choudhury, Susobhan; Dutta, Shreyasi; Adhikari, Aniruddha; Bhattacharya, Siddhartha; Pal, Debasish; Pal, Samir Kumar

    2017-10-01

    The jam-packed intracellular environments differ the activity of a biological macromolecule from that in laboratory environments (in vitro) through a number of mechanisms called molecular crowding related to structure, function and dynamics of the macromolecule. Here, we have explored the structure, function and dynamics of a model enzyme protein DNase I in molecular crowing of polyethylene glycol (PEG; MW 3350). We have used steady state and picosecond resolved dynamics of a well-known intercalator ethidium bromide (EB) in a 20-mer double-stranded DNA (dsDNA) to monitor the DNA-cleavage by the enzyme in absence and presence PEG. We have also labelled the enzyme by a well-known fluorescent probe 8-anilino-1-naphthalenesulfonic acid ammonium salt (ANS) to study the molecular mechanism of the protein-DNA association through exited state relaxation of the probe in absence (dictated by polarity) and presence of EB in the DNA (dictated by Förster resonance energy transfer (FRET)). The overall and local structures of the protein in presence of PEG have been followed by circular dichroism and time resolved polarization gated spectroscopy respectively. The enhanced dynamical flexibility of protein in presence of PEG as revealed from excited state lifetime and polarization gated anisotropy of ANS has been correlated with the stronger DNA-binding for the higher nuclease activity. We have also used conventional experimental strategy of agarose gel electrophoresis to monitor DNA-cleavage and found consistent results of enhanced nuclease activities both on synthetic 20-mer oligonucleotide and long genomic DNA from calf thymus. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Study of DNA interactions with bifenthrin by spectroscopic techniques and molecular modeling

    Science.gov (United States)

    Zhu, Pan; Zhang, Guowen; Ma, Yadi; Zhang, Yepeng; Miao, Hong; Wu, Yongning

    2013-08-01

    The interaction between bifenthrin (BF) and calf thymus DNA (ctDNA) in physiological buffer (pH 7.4) was investigated by UV-vis absorption, fluorescence, circular dichroism (CD), and Fourier transform infrared (FT-IR) spectroscopy, coupled with viscosity measurements and molecular docking techniques. It was found that BF molecular could intercalate into the base pairs of ctDNA as evidenced by significant increases in absorption intensity, fluorescence polarization and relative viscosity of ctDNA, decrease in iodide quenching effect, and induced CD spectral changes. The association constant of BF with ctDNA was evaluated to be in the order of 104 L mol-1. Thermodynamic analysis of the binding data obtained at different temperatures suggested that the binding process was primarily driven by hydrogen bonds and van der Waals forces, as the values of the enthalpy change (ΔH) and the entropy change (ΔS) were calculated to be -31.13 ± 1.89 kJ mol-1 and -22.79 ± 1.21 J mol-1 K-1, respectively. The results of FT-IR spectra and molecular docking showed that a specific binding mainly existed between BF and adenine and guanine bases.

  11. Chimeric peptide beacons: a direct polypeptide analog of DNA molecular beacons†

    OpenAIRE

    Oh, Kenneth J.; Cash, Kevin J.; Lubin, Arica A.; Plaxco, Kevin W.

    2007-01-01

    We have developed a new biosensor architecture, which is comprised of a polypeptide–peptide nucleic acid tri-block copolymer and which we have termed chimeric peptide beacons (CPB), that generates an optical output via a mechanism analogous to that employed in DNA-based molecular beacons.

  12. Fast parallel DNA-based algorithms for molecular computation: the set-partition problem.

    Science.gov (United States)

    Chang, Weng-Long

    2007-12-01

    This paper demonstrates that basic biological operations can be used to solve the set-partition problem. In order to achieve this, we propose three DNA-based algorithms, a signed parallel adder, a signed parallel subtractor and a signed parallel comparator, that formally verify our designed molecular solutions for solving the set-partition problem.

  13. A DNAzyme-mediated logic gate for programming molecular capture and release on DNA origami.

    Science.gov (United States)

    Li, Feiran; Chen, Haorong; Pan, Jing; Cha, Tae-Gon; Medintz, Igor L; Choi, Jong Hyun

    2016-06-28

    Here we design a DNA origami-based site-specific molecular capture and release platform operated by a DNAzyme-mediated logic gate process. We show the programmability and versatility of this platform with small molecules, proteins, and nanoparticles, which may also be controlled by external light signals.

  14. Perturbations in DNA structure upon interaction with porphyrins revealed by chemical probes, DNA footprinting and molecular modelling.

    Science.gov (United States)

    Ford, K G; Neidle, S

    1995-06-01

    The interactions of several porphyrins with a 74 base-pair DNA sequence have been examined by footprinting and chemical protection methods. Tetra-(4-N-methyl-(pyridyl)) porphyrin (TMPy), two of its metal complexes and tetra-(4-trimethylanilinium) porphyrin (TMAP) bind to closely similar AT-rich sequences. The three TMPy ligands produce modest changes in DNA structure and base accessibility on binding, in contrast to the large-scale conformational changes observed with TMAP. Molecular modelling studies have been performed on TMPy and TMAP bound in the AT-rich minor groove of an oligonucleotide. These have shown that significant structural change is needed to accommodate the bulky trimethyl substituent groups of TMAP, in contrast to the facile minor groove fit of TMPy.

  15. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    Science.gov (United States)

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  16. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing.

    Science.gov (United States)

    Feehan, Joanna M; Scheibel, Katherine E; Bourras, Salim; Underwood, William; Keller, Beat; Somerville, Shauna C

    2017-03-31

    The powdery mildew fungi are a group of economically important fungal plant pathogens. Relatively little is known about the molecular biology and genetics of these pathogens, in part due to a lack of well-developed genetic and genomic resources. These organisms have large, repetitive genomes, which have made genome sequencing and assembly prohibitively difficult. Here, we describe methods for the collection, extraction, purification and quality control assessment of high molecular weight genomic DNA from one powdery mildew species, Golovinomyces cichoracearum. The protocol described includes mechanical disruption of spores followed by an optimized phenol/chloroform genomic DNA extraction. A typical yield was 7 µg DNA per 150 mg conidia. The genomic DNA that is isolated using this procedure is suitable for long-read sequencing (i.e., > 48.5 kbp). Quality control measures to ensure the size, yield, and purity of the genomic DNA are also described in this method. Sequencing of the genomic DNA of the quality described here will allow for the assembly and comparison of multiple powdery mildew genomes, which in turn will lead to a better understanding and improved control of this agricultural pathogen.

  17. Crucial optimization steps in getting premier quality of Aquilaria malaccensis genomic DNA for molecular activities

    International Nuclear Information System (INIS)

    Muhammad Hanif Azhari; Azhar Mohamad

    2013-01-01

    Gaharu resin is derived from Aquilaria sp. or Agar wood tree in a tropical ecosystem. In Malaysia the Aquilaria species especially A. malaccensis in danger of extinction in the wild due to illegal logging as its resin is highly used for the production of greatly valued incense throughout Asia. A significant tool in fingerprinting the species is through molecular activities of Polymerase Chain Reaction (PCR) application on which requires total genomic DNA as a starting material. This paper, described optimizations of both fresh and dried samples derived from A. malaccensis for genomic DNA. Three main parameters for the optimization were temperature (60, 65, and 70 degree Celsius), incubation period (30, 60, 90 minutes) and concentration of CTAB (1 %, 3 %, 5 %). The experimental design in these work resulted a total of 46 combinations of the parameters in which 0.5 g samples was used in each combination. Nano-drop spectrometer was used in detecting the quantitative genomic DNA at ng/ μl. In fresh samples, incubation temperatures at 65 degree Celsius for 60 minutes in 3 % were yielded 723.2 ng/ μl genomic DNA. Whereas, for dried samples, incubation temperature at 70 degree Celsius for 90 minutes in 5 % CTAB were yielded 70.2 ng/ μl of genomic DNA. Spectrometer reading at OD280/ 260 was 1.9 for both type of samples. The isolated genomic DNA is useful for the molecular activities to identify specific plants between the same species or among the Aquilaria species. (author)

  18. Effect of protonation on the electronic properties of DNA base pairs: applications for molecular electronics.

    Science.gov (United States)

    Mallajosyula, Sairam S; Pati, Swapan K

    2007-10-11

    Protonation of DNA basepairs is a reversible phenomenon that can be controlled by tuning the pH of the system. Under mild acidic conditions, the hydrogen-bonding pattern of the DNA basepairs undergoes a change. We study the effect of protonation on the electronic properties of the DNA basepairs to probe for possible molecular electronics applications. We find that, under mild acidic pH conditions, the A:T basepair shows excellent rectification behavior that is, however, absent in the G:C basepair. The mechanism of rectification has been discussed using a simple chemical potential model. We also consider the noncanonical A:A basepair and find that it can be used as efficient pH dependent molecular switch. The switching action in the A:A basepair is explained in the light of pi-pi interactions, which lead to efficient delocalization over the entire basepair.

  19. [Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].

    Science.gov (United States)

    Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi

    2013-01-01

    Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.

  20. A molecular biological study on the identification of the molecular species of DNA polymerases for repairing radiation-damaged DNA and the factors modifying the mutation rate

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Koichi; Inoue, Shuji [National Inst. of Health and Nutrition, Tokyo (Japan)

    1997-02-01

    Aiming at prevention and treatment of radiation damages, the authors have been investigating DNA damages by X-ray and its repairing mechanism, however, the molecular species of DNA polymerase which mediate the repairing could not been identified by biochemical methods using various inhibitors because of their low specificity. Therefore, in this study, anti-sense oligonucleotides for DNA polymerase {alpha}, {delta} and {epsilon} were obtained by chemical synthesis and transduced into human fibroblast cell, NB1RGB by three methods; endocytotic method, electroporation method and lipofection method. For the first method, the addition of those peptides into the cell culture at 5 {mu}M inhibited the polymerase activity by up to 30% and it was economically difficult to use at higher concentrations than it. For the electroporation method, different conditions were tested in the respects of initial potential, time constant and buffer, but the uptake of thimidine was scarcely decreased in the surviving cells, suggesting that the surviving rate would be short in the cells electroporated with those anti-sense peptides. For the lipofection method, among several cationic lipids tested, lipofectamine significantly enlarged the decrease of thymidine uptake by anti-sense {delta}, however it was considered that its application to DNA repairing is difficult because lipofectamine is strongly cytotoxic. Therefore, construction of a vector which allows to express anti-sense RNA in those cells is undertaken. (M.N.)

  1. A molecular biological study on the identification of the molecular species of DNA polymerases for repairing radiation-damaged DNA and the factors modifying the mutation rate

    International Nuclear Information System (INIS)

    Yamada, Koichi; Inoue, Shuji

    1997-01-01

    Aiming at prevention and treatment of radiation damages, the authors have been investigating DNA damages by X-ray and its repairing mechanism, however, the molecular species of DNA polymerase which mediate the repairing could not been identified by biochemical methods using various inhibitors because of their low specificity. Therefore, in this study, anti-sense oligonucleotides for DNA polymerase α, δ and ε were obtained by chemical synthesis and transduced into human fibroblast cell, NB1RGB by three methods; endocytotic method, electroporation method and lipofection method. For the first method, the addition of those peptides into the cell culture at 5 μM inhibited the polymerase activity by up to 30% and it was economically difficult to use at higher concentrations than it. For the electroporation method, different conditions were tested in the respects of initial potential, time constant and buffer, but the uptake of thimidine was scarcely decreased in the surviving cells, suggesting that the surviving rate would be short in the cells electroporated with those anti-sense peptides. For the lipofection method, among several cationic lipids tested, lipofectamine significantly enlarged the decrease of thymidine uptake by anti-sense δ, however it was considered that its application to DNA repairing is difficult because lipofectamine is strongly cytotoxic. Therefore, construction of a vector which allows to express anti-sense RNA in those cells is undertaken. (M.N.)

  2. A universal molecular translator for non-nucleic acid targets that enables dynamic DNA assemblies and logic operations.

    Science.gov (United States)

    Tang, Wei; Hu, Shichao; Wang, Huaming; Zhao, Yan; Li, Na; Liu, Feng

    2014-11-28

    A universal molecular translator based on the target-triggered DNA strand displacement was developed, which was able to convert various kinds of non-nucleic acid targets into a unique output DNA. This translation strategy was successfully applied in directing dynamic DNA assemblies and in realizing three-input logic gate operations.

  3. Preanalytical blood sample workup for cell-free DNA analysis using Droplet Digital PCR for future molecular cancer diagnostics

    NARCIS (Netherlands)

    van Ginkel, Joost H.; van den Broek, Daan A.; van Kuik, Joyce; Linders, Dorothé; de Weger, Roel; Willems, Stefan M.; Huibers, Manon M.H.

    2017-01-01

    In current molecular cancer diagnostics, using blood samples of cancer patients for the detection of genetic alterations in plasma (cell-free) circulating tumor DNA (ctDNA) is an emerging practice. Since ctDNA levels in blood are low, highly sensitive Droplet Digital PCR (ddPCR) can be used for

  4. KRAS detection in colonic tumors by DNA extraction from FTA paper: the molecular touch-prep.

    Science.gov (United States)

    Petras, Melissa L; Lefferts, Joel A; Ward, Brian P; Suriawinata, Arief A; Tsongalis, Gregory J

    2011-12-01

    DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissue is usually more degraded and contains more polymerase chain reaction (PCR) inhibitors than DNA isolated from nonfixed tissue. In addition, the tumor size and cellular heterogeneity found in tissue sections can often impact testing for molecular biomarkers. As a potential remedy to this situation, we evaluated the use of Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA for use in a real-time PCR-based KRAS mutation assay. Eleven colon tumor samples were collected by making a cut into the fresh tumor and applying the Whatman FTA paper to the cut surface. Matched FFPE tissue blocks from these tumors were also collected for comparison. KRAS mutation analysis was carried out using the Applied Biosystems 7500 Fast Real-time PCR System using 7 independent custom TaqMan PCR assays. Of the 11 colon tumors sampled, 6 were positive for KRAS mutations in both the Whatman FTA paper preparations and corresponding FFPE samples. Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA have many advantages including ease of use, intrinsic antimicrobial properties, long storage potential (stability of DNA over time), and a faster turnaround time for results. Extracted DNA should be suitable for most molecular diagnostic assays that use PCR techniques. This novel means of DNA preservation from surgical specimens would benefit from additional study and validation as a dependable and practical technique to preserve specimens for molecular testing.

  5. Role of DNA conformation & energetic insights in Msx-1-DNA recognition as revealed by molecular dynamics studies on specific and nonspecific complexes.

    Science.gov (United States)

    Kachhap, Sangita; Singh, Balvinder

    2015-01-01

    In most of homeodomain-DNA complexes, glutamine or lysine is present at 50th position and interacts with 5th and 6th nucleotide of core recognition region. Molecular dynamics simulations of Msx-1-DNA complex (Q50-TG) and its variant complexes, that is specific (Q50K-CC), nonspecific (Q50-CC) having mutation in DNA and (Q50K-TG) in protein, have been carried out. Analysis of protein-DNA interactions and structure of DNA in specific and nonspecific complexes show that amino acid residues use sequence-dependent shape of DNA to interact. The binding free energies of all four complexes were analysed to define role of amino acid residue at 50th position in terms of binding strength considering the variation in DNA on stability of protein-DNA complexes. The order of stability of protein-DNA complexes shows that specific complexes are more stable than nonspecific ones. Decomposition analysis shows that N-terminal amino acid residues have been found to contribute maximally in binding free energy of protein-DNA complexes. Among specific protein-DNA complexes, K50 contributes more as compared to Q50 towards binding free energy in respective complexes. The sequence dependence of local conformation of DNA enables Q50/Q50K to make hydrogen bond with nucleotide(s) of DNA. The changes in amino acid sequence of protein are accommodated and stabilized around TAAT core region of DNA having variation in nucleotides.

  6. Microbes on building materials - Evaluation of DNA extraction protocols as common basis for molecular analysis

    Energy Technology Data Exchange (ETDEWEB)

    Ettenauer, Joerg D., E-mail: joerg.ettenauer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Pinar, Guadalupe, E-mail: Guadalupe.Pinar@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Lopandic, Ksenija, E-mail: Ksenija.Lopandic@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Spangl, Bernhard, E-mail: Bernhard.Spangl@boku.ac.at [University of Natural Resources and Life Sciences, Department of Landscape, Spatial and Infrastructure Science, Institute of Applied Statistics and Computing (IASC), Gregor Mendel-Str. 33, A-1180 Vienna (Austria); Ellersdorfer, Guenther, E-mail: Guenther.Ellersdorfer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Voitl, Christian, E-mail: Christian.Voitl@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Sterflinger, Katja, E-mail: Katja.Sterflinger@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria)

    2012-11-15

    The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials - common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: Black-Right-Pointing-Pointer Up to thirteen extraction methods were evaluated with three

  7. Microbes on building materials — Evaluation of DNA extraction protocols as common basis for molecular analysis

    International Nuclear Information System (INIS)

    Ettenauer, Jörg D.; Piñar, Guadalupe; Lopandic, Ksenija; Spangl, Bernhard; Ellersdorfer, Günther; Voitl, Christian; Sterflinger, Katja

    2012-01-01

    The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials — common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: ► Up to thirteen extraction methods were evaluated with three building materials.

  8. Development of a sensor to study the DNA conformation using molecular logic gates.

    Science.gov (United States)

    Roy, Arpan Datta; Dey, Dibyendu; Saha, Jaba; Chakraborty, Santanu; Bhattacharjee, D; Hussain, Syed Arshad

    2015-02-05

    This communication reports our investigations on the Fluorescence Resonance Energy Transfer (FRET) between two laser dyes Acriflavine and Rhodamine B in absence and presence of DNA at different pH. It has been observed that energy transfer efficiency is largely affected by the presence of DNA as well as the pH of the system. It is well known that with increase in pH, DNA conformation changes from double stranded to single stranded (denaturation) and finally form random coil. Based on our experimental results two different types of molecular logic gates namely, XOR and OR logic have been demonstrated which can be used to have an idea about DNA conformation in solution. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Development of a sensor to study the DNA conformation using molecular logic gates

    Science.gov (United States)

    Roy, Arpan Datta; Dey, Dibyendu; Saha, Jaba; Chakraborty, Santanu; Bhattacharjee, D.; Hussain, Syed Arshad

    2015-02-01

    This communication reports our investigations on the Fluorescence Resonance Energy Transfer (FRET) between two laser dyes Acriflavine and Rhodamine B in absence and presence of DNA at different pH. It has been observed that energy transfer efficiency is largely affected by the presence of DNA as well as the pH of the system. It is well known that with increase in pH, DNA conformation changes from double stranded to single stranded (denaturation) and finally form random coil. Based on our experimental results two different types of molecular logic gates namely, XOR and OR logic have been demonstrated which can be used to have an idea about DNA conformation in solution.

  10. Molecular analysis and genomic organization of major DNA satellites in banana (Musa spp.).

    Science.gov (United States)

    Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

    2013-01-01

    Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp.) are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome) and inter-specific crosses between M. acuminata and M. balbisiana (B genome). Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa) genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa.

  11. Structural and Molecular Basis for Coordination in a Viral DNA Packaging Motor.

    Science.gov (United States)

    Mao, Huzhang; Saha, Mitul; Reyes-Aldrete, Emilio; Sherman, Michael B; Woodson, Michael; Atz, Rockney; Grimes, Shelley; Jardine, Paul J; Morais, Marc C

    2016-03-01

    Ring NTPases are a class of ubiquitous molecular motors involved in basic biological partitioning processes. dsDNA viruses encode ring ATPases that translocate their genomes to near-crystalline densities within pre-assembled viral capsids. Here, X-ray crystallography, cryoEM, and biochemical analyses of the dsDNA packaging motor in bacteriophage phi29 show how individual subunits are arranged in a pentameric ATPase ring and suggest how their activities are coordinated to translocate dsDNA. The resulting pseudo-atomic structure of the motor and accompanying functional analyses show how ATP is bound in the ATPase active site; identify two DNA contacts, including a potential DNA translocating loop; demonstrate that a trans-acting arginine finger is involved in coordinating hydrolysis around the ring; and suggest a functional coupling between the arginine finger and the DNA translocating loop. The ability to visualize the motor in action illuminates how the different motor components interact with each other and with their DNA substrate. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Structural and Molecular Basis for Coordination in a Viral DNA Packaging Motor

    Directory of Open Access Journals (Sweden)

    Huzhang Mao

    2016-03-01

    Full Text Available Ring NTPases are a class of ubiquitous molecular motors involved in basic biological partitioning processes. dsDNA viruses encode ring ATPases that translocate their genomes to near-crystalline densities within pre-assembled viral capsids. Here, X-ray crystallography, cryoEM, and biochemical analyses of the dsDNA packaging motor in bacteriophage phi29 show how individual subunits are arranged in a pentameric ATPase ring and suggest how their activities are coordinated to translocate dsDNA. The resulting pseudo-atomic structure of the motor and accompanying functional analyses show how ATP is bound in the ATPase active site; identify two DNA contacts, including a potential DNA translocating loop; demonstrate that a trans-acting arginine finger is involved in coordinating hydrolysis around the ring; and suggest a functional coupling between the arginine finger and the DNA translocating loop. The ability to visualize the motor in action illuminates how the different motor components interact with each other and with their DNA substrate.

  13. Influence of molecular weight of DNA on the determination of anti-DNA antibodies in systemic lupus erythematosus (SLE) sera by radioimmunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Geisert, M; Heicke, B; Metzmann, E; Zahn, R K

    1975-04-01

    Using a radioimmunoassay (RIA) based on the Farr technique with radioactively labeled /sup 3/H-DNA for quantitative measurements of anti-DNA antibodies in sera of patients with systemic lupus erythematosus (SLE), the influence of molecular weight of DNA (ranging from 0.1 x 10/sup 6/ to 22.0 x 10/sup 6/ daltons) on binding and precipitation in this system has been investigated. Comparing our results with mathematical models it follows that one antibody molecule is fixed on the average to a statistical DNA segment of 2 x 10/sup 6/ to 4 x 10/sup 6/ daltons. Furthermore binding capacity of the DNA was found to be independent of the molecular weight, as demonstrated in a double label experiment using /sup 14/C and /sup 3/H-labeled DNA of different size. However, the amount of radioactivity precipitated was found to depend on the molecular weight of the labeled DNA following a non-linear function. It was calculated that a minimal ratio of fixed antibody molecules per a certain size of DNA was necessary for precipitation. The mathematical treatment of the observed non-linear precipitation dependence will be discussed using various statistical models. The results indicate that the quantitative measurements of anti-DNA antibodies with the Farr technique e.g., for diagnosis and control of SLE in clinical immunology is highly dependent on the molecular weight of the labeled DNA used in the assay system and reliable results are only obtained with DNA of a sufficiently high molecular weight. (auth)

  14. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

    Science.gov (United States)

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

    2017-02-01

    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  15. Implications of storing urinary DNA from different populations for molecular analyses.

    Directory of Open Access Journals (Sweden)

    Angela Cannas

    2009-09-01

    Full Text Available Molecular diagnosis using urine is established for many sexually transmitted diseases and is increasingly used to diagnose tumours and other infectious diseases. Storage of urine prior to analysis, whether due to home collection or bio-banking, is increasingly advocated yet no best practice has emerged. Here, we examined the stability of DNA in stored urine in two populations over 28 days.Urine from 40 (20 male healthy volunteers from two populations, Italy and Zambia, was stored at four different temperatures (RT, 4 degrees C, -20 degrees C & -80 degrees C with and without EDTA preservative solution. Urines were extracted at days 0, 1, 3, 7 and 28 after storage. Human DNA content was measured using multi-copy (ALU J and single copy (TLR2 targets by quantitative real-time PCR. Zambian and Italian samples contained comparable DNA quantity at time zero. Generally, two trends were observed during storage; no degradation, or rapid degradation from days 0 to 7 followed by little further degradation to 28 days. The biphasic degradation was always observed in Zambia regardless of storage conditions, but only twice in Italy.Site-specific differences in urine composition significantly affect the stability of DNA during storage. Assessing the quality of stored urine for molecular analysis, by using the type of strategy described here, is paramount before these samples are used for molecular prognostic monitoring, genetic analyses and disease diagnosis.

  16. In vitro DNA binding studies of lenalidomide using spectroscopic in combination with molecular docking techniques

    Science.gov (United States)

    Xu, Liang; Hu, Yan-Xi; Li, Yan-Cheng; Zhang, Li; Ai, Hai-Xin; Liu, Yu-Feng; Liu, Hong-Sheng

    2018-02-01

    In the present work, the binding interaction between lenalidomide (LEN) and calf thymus DNA (ct-DNA) was systematically studied by using fluorescence, ultraviolet-visible (UV-vis) absorption, circular dichroism (CD) spectroscopies under imitated physiological conditions (pH = 7.4) coupled with molecular docking. It was found that LEN was bound to ct-DNA with high binding affinity (Ka = 2.308 × 105 M-1 at 283 K) through groove binding as evidenced by a slight decrease in the absorption intensity in combination with CD spectra. Thermodynamic parameters (ΔG 0 and ΔS interaction. Furthermore, competitive binding experiments with ethidium bromide and 4‧, 6-dia-midino-2-phenylindoleas probes showed that LEN could preferentially bind in the minor groove of double-stranded DNA. The average lifetime of LEN was calculated to be 7.645 ns. The φ of LEN was measured as 0.09 and non-radiation energy transfer between LEN and DNA had occurred. The results of the molecular docking were consistent with the experimental results. This study explored the potential applicability of the spectroscopic properties of LEN and also investigated its interactions with relevant biological targets. In addition, it will provide some theoretical references for the deep research of simultaneous administration of LEN with other drugs.

  17. Molecular identification of common Salmonella serovars using multiplex DNA sensor-based suspension array.

    Science.gov (United States)

    Aydin, Muhsin; Carter-Conger, Jacqueline; Gao, Ning; Gilmore, David F; Ricke, Steven C; Ahn, Soohyoun

    2018-04-01

    Salmonella is one of major foodborne pathogens and the leading cause of foodborne illness-related hospitalizations and deaths. It is critical to develop a sensitive and rapid detection assay that can identify Salmonella to ensure food safety. In this study, a DNA sensor-based suspension array system of high multiplexing ability was developed to identify eight Salmonella serovars commonly associated with foodborne outbreaks to the serotype level. Each DNA sensor was prepared by activating pre-encoded microspheres with oligonucleotide probes that are targeting virulence genes and serovar-specific regions. The mixture of 12 different types of DNA sensors were loaded into a 96-well microplate and used as a 12-plex DNA sensor array platform. DNA isolated from Salmonella was amplified by multiplex polymerase chain reaction (mPCR), and the presence of Salmonella was determined by reading fluorescent signals from hybridization between probes on DNA sensors and fluorescently labeled target DNA using the Bio-Plex® system. The developed multiplex array was able to detect synthetic DNA at the concentration as low as 100 fM and various Salmonella serovars as low as 100 CFU/mL within 1 h post-PCR. Sensitivity of this assay was further improved to 1 CFU/mL with 6-h enrichment. The array system also correctly and specifically identified serotype of tested Salmonella strains without any cross-reactivity with other common foodborne pathogens. Our results indicate the developed DNA sensor suspension array can be a rapid and reliable high-throughput method for simultaneous detection and molecular identification of common Salmonella serotypes.

  18. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-01-01

    Full Text Available Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE specific for bromacil. We have identified one MRE with high affinity (Kd=9.6 nM and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device.

  19. Enzymatic Amplification of DNA/RNA Hybrid Molecular Beacon Signaling in Nucleic Acid Detection

    OpenAIRE

    Jacroux, Thomas; Rieck, Daniel C.; Cui, Rong; Ouyang, Yexin; Dong, Wen-Ji

    2012-01-01

    A rapid assay operable under isothermal or non-isothermal conditions is described wherein the sensitivity of a typical molecular beacon (MB) system is improved by utilizing thermostable RNase H to enzymatically cleave an MB comprised of a DNA stem and RNA loop (R/D-MB). Upon hybridization of the R/D-MB to target DNA, there was a modest increase in fluorescence intensity (~5.7x above background) due to an opening of the probe and concomitant reduction in the Förster resonance energy transfer e...

  20. Molecular dynamics simulation studies of radiation damaged DNA. Molecules and repair enzymes

    International Nuclear Information System (INIS)

    Pinak, Miroslav

    2004-12-01

    Molecular dynamics (MD) studies on several radiation damages to DNA and their recognition by repair enzymes are introduced in order to describe the stepwise description of molecular process observed at radiation lesion sites. MD studies were performed on pyrimidine (thymine dimer, thymine glycol) and purine (8-oxoguanine) lesions using an MD simulation code AMBER 5.0. The force field was modified for each lesion. In all cases the significant structural changes in the DNA double helical structure were observed; a) the breaking of hydrogen bond network between complementary bases and resulting opening of the double helix (8-oxoguanine); b) the sharp bending of the DNA helix centered at the lesion site (thymine dimer, thymine glycol); and c) the flipping-out base on the strand complementary to the lesion (8-oxoguanine). These changes were related to the overall collapsing double helical structure around the lesion and might facilitate the docking of the repair enzyme into the DNA and formation of DNA-enzyme complex. In addition to the structural changes, at lesion sites there were found electrostatic interaction energy values different from those at native sites (thymine dimer -10 kcal/mol, thymine glycol -26 kcal/mol, 8-oxoguanine -48 kcal/mol). These values of electrostatic energy may discriminate lesion from values at native sites (thymine 0 kcal/mol, guanine -37 kcal/mol) and enable a repair enzyme to recognize a lesion during scanning DNA surface. The observed specific structural conformation and energetic properties at the lesions sites are factors that guide a repair enzyme to discriminate lesions from non-damaged native DNA segments. (author)

  1. Molecular dynamics simulations revealed structural differences among WRKY domain-DNA interaction in barley (Hordeum vulgare).

    Science.gov (United States)

    Pandey, Bharati; Grover, Abhinav; Sharma, Pradeep

    2018-02-12

    The WRKY transcription factors are a class of DNA-binding proteins involved in diverse plant processes play critical roles in response to abiotic and biotic stresses. Genome-wide divergence analysis of WRKY gene family in Hordeum vulgare provided a framework for molecular evolution and functional roles. So far, the crystal structure of WRKY from barley has not been resolved; moreover, knowledge of the three-dimensional structure of WRKY domain is pre-requisites for exploring the protein-DNA recognition mechanisms. Homology modelling based approach was used to generate structures for WRKY DNA binding domain (DBD) and its variants using AtWRKY1 as a template. Finally, the stability and conformational changes of the generated model in unbound and bound form was examined through atomistic molecular dynamics (MD) simulations for 100 ns time period. In this study, we investigated the comparative binding pattern of WRKY domain and its variants with W-box cis-regulatory element using molecular docking and dynamics (MD) simulations assays. The atomic insight into WRKY domain exhibited significant variation in the intermolecular hydrogen bonding pattern, leading to the structural anomalies in the variant type and differences in the DNA-binding specificities. Based on the MD analysis, residual contribution and interaction contour, wild-type WRKY (HvWRKY46) were found to interact with DNA through highly conserved heptapeptide in the pre- and post-MD simulated complexes, whereas heptapeptide interaction with DNA was missing in variants (I and II) in post-MD complexes. Consequently, through principal component analysis, wild-type WRKY was also found to be more stable by obscuring a reduced conformational space than the variant I (HvWRKY34). Lastly, high binding free energy for wild-type and variant II allowed us to conclude that wild-type WRKY-DNA complex was more stable relative to variants I. The results of our study revealed complete dynamic and structural information

  2. Cas9-catalyzed DNA Cleavage Generates Staggered Ends: Evidence from Molecular Dynamics Simulations

    Science.gov (United States)

    Zuo, Zhicheng; Liu, Jin

    2016-11-01

    The CRISPR-associated endonuclease Cas9 from Streptococcus pyogenes (spCas9) along with a single guide RNA (sgRNA) has emerged as a versatile toolbox for genome editing. Despite recent advances in the mechanism studies on spCas9-sgRNA-mediated double-stranded DNA (dsDNA) recognition and cleavage, it is still unclear how the catalytic Mg2+ ions induce the conformation changes toward the catalytic active state. It also remains controversial whether Cas9 generates blunt-ended or staggered-ended breaks with overhangs in the DNA. To investigate these issues, here we performed the first all-atom molecular dynamics simulations of the spCas9-sgRNA-dsDNA system with and without Mg2+ bound. The simulation results showed that binding of two Mg2+ ions at the RuvC domain active site could lead to structurally and energetically favorable coordination ready for the non-target DNA strand cleavage. Importantly, we demonstrated with our simulations that Cas9-catalyzed DNA cleavage produces 1-bp staggered ends rather than generally assumed blunt ends.

  3. HLA DNA sequence variation among human populations: molecular signatures of demographic and selective events.

    Directory of Open Access Journals (Sweden)

    Stéphane Buhler

    2011-02-01

    Full Text Available Molecular differences between HLA alleles vary up to 57 nucleotides within the peptide binding coding region of human Major Histocompatibility Complex (MHC genes, but it is still unclear whether this variation results from a stochastic process or from selective constraints related to functional differences among HLA molecules. Although HLA alleles are generally treated as equidistant molecular units in population genetic studies, DNA sequence diversity among populations is also crucial to interpret the observed HLA polymorphism. In this study, we used a large dataset of 2,062 DNA sequences defined for the different HLA alleles to analyze nucleotide diversity of seven HLA genes in 23,500 individuals of about 200 populations spread worldwide. We first analyzed the HLA molecular structure and diversity of these populations in relation to geographic variation and we further investigated possible departures from selective neutrality through Tajima's tests and mismatch distributions. All results were compared to those obtained by classical approaches applied to HLA allele frequencies.Our study shows that the global patterns of HLA nucleotide diversity among populations are significantly correlated to geography, although in some specific cases the molecular information reveals unexpected genetic relationships. At all loci except HLA-DPB1, populations have accumulated a high proportion of very divergent alleles, suggesting an advantage of heterozygotes expressing molecularly distant HLA molecules (asymmetric overdominant selection model. However, both different intensities of selection and unequal levels of gene conversion may explain the heterogeneous mismatch distributions observed among the loci. Also, distinctive patterns of sequence divergence observed at the HLA-DPB1 locus suggest current neutrality but old selective pressures on this gene. We conclude that HLA DNA sequences advantageously complement HLA allele frequencies as a source of data used

  4. An Aptamer Bio-barCode (ABC) assay using SPR, RNase H, and probes with RNA and gold-nanorods for anti-cancer drug screening.

    Science.gov (United States)

    Loo, Jacky Fong-Chuen; Yang, Chengbin; Tsang, Hing Lun; Lau, Pui Man; Yong, Ken-Tye; Ho, Ho Pui; Kong, Siu Kai

    2017-10-07

    With modifications to an ultra-sensitive bio-barcode (BBC) assay, we have developed a next generation aptamer-based bio-barcode (ABC) assay to detect cytochrome-c (Cyto-c), a cell death marker released from cancer cells, for anti-cancer drug screening. An aptamer is a short single-stranded DNA selected from a synthetic DNA library that is capable of binding to its target with high affinity and specificity based on its unique DNA sequence and 3D structure after folding. Similar to the BBC assay, Cyto-c is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Ab) and an aptamer specifically against Cyto-c to form sandwich structures ([MMP-Ab]-[Cyto-c]-[Aptamer]). After washing and melting, our aptamers, acting as a DNA bio-barcode, are released from the sandwiches and hybridized with the probes specially designed for RNase H for surface plasmon resonance (SPR) sensing. In an aptamer-probe duplex, RNase H digests the RNA in the probe and releases the intact aptamer for another round of hybridization and digestion. With signal enhancement effects from gold-nanorods (Au-NRs) on probes for SPR sensing, the detection limit was found to be 1 nM for the aptamer and 80 pM for Cyto-c. Without the time-consuming DNA amplification steps by PCR, the detection process of this new ABC assay can be completed within three hours. As a proof-of-concept, phenylarsine oxide was found to be a potent agent to kill liver cancer cells with multi-drug resistance at the nano-molar level. This approach thus provides a fast, sensitive and robust tool for anti-cancer drug screening.

  5. Allosteric analysis of glucocorticoid receptor-DNA interface induced by cyclic Py-Im polyamide: a molecular dynamics simulation study.

    Directory of Open Access Journals (Sweden)

    Yaru Wang

    Full Text Available BACKGROUND: It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. METHODOLOGY/PRINCIPAL FINDINGS: In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. CONCLUSIONS/SIGNIFICANCE: We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.

  6. Solid surface vs. liquid surface: nanoarchitectonics, molecular machines, and DNA origami.

    Science.gov (United States)

    Ariga, Katsuhiko; Mori, Taizo; Nakanishi, Waka; Hill, Jonathan P

    2017-09-13

    The investigation of molecules and materials at interfaces is critical for the accumulation of new scientific insights and technological advances in the chemical and physical sciences. Immobilization on solid surfaces permits the investigation of different properties of functional molecules or materials with high sensitivity and high spatial resolution. Liquid surfaces also present important media for physicochemical innovation and insight based on their great flexibility and dynamicity, rapid diffusion of molecular components for mixing and rearrangements, as well as drastic spatial variation in the prevailing dielectric environment. Therefore, a comparative discussion of the relative merits of the properties of materials when positioned at solid or liquid surfaces would be informative regarding present-to-future developments of surface-based technologies. In this perspective article, recent research examples of nanoarchitectonics, molecular machines, DNA nanotechnology, and DNA origami are compared with respect to the type of surface used, i.e. solid surfaces vs. liquid surfaces, for future perspectives of interfacial physics and chemistry.

  7. Effect O6-guanine alkylation on DNA flexibility studied by comparative molecular dynamics simulations.

    Science.gov (United States)

    Kara, Mahmut; Drsata, Tomas; Lankas, Filip; Zacharias, Martin

    2015-01-01

    Alkylation of guanine at the O6 atom is a highly mutagenic DNA lesion because it alters the coding specificity of the base causing G:C to A:T transversion mutations. Specific DNA repair enzymes, e.g. O(6)-alkylguanin-DNA-Transferases (AGT), recognize and repair such damage after looping out the damaged base to transfer it into the enzyme active site. The exact mechanism how the repair enzyme identifies a damaged site within a large surplus of undamaged DNA is not fully understood. The O(6)-alkylation of guanine may change the deformability of DNA which may facilitate the initial binding of a repair enzyme at the damaged site. In order to characterize the effect of O(6)-methyl-guanine (O(6)-MeG) containing base pairs on the DNA deformability extensive comparative molecular dynamics (MD) simulations on duplex DNA with central G:C, O(6)-MeG:C or O(6)-MeG:T base pairs were performed. The simulations indicate significant differences in the helical deformability due to the presence of O(6)-MeG compared to regular undamaged DNA. This includes enhanced base pair opening, shear and stagger motions and alterations in the backbone fine structure caused in part by transient rupture of the base pairing at the damaged site and transient insertion of water molecules. It is likely that the increased opening motions of O(6)-MeG:C or O(6)-MeG:T base pairs play a decisive role for the induced fit recognition or for the looping out of the damaged base by repair enzymes. © 2014 Wiley Periodicals, Inc.

  8. Effect of gamma-irradiation on rice seed DNA. Pt. 1. Yield and molecular size of DNA extracted from irradiated rice seeds

    International Nuclear Information System (INIS)

    Kawamura, Yoko; Konishi, Akihiro; Yamada, Takashi; Saito, Yukio

    1995-01-01

    The effect of gamma-irradiation on the DNA of hulled rice seeds was investigated. The cetyltrimethylammonium bromide (CTAB) method was preferred for the extraction of DNA from rice seeds because of its high quality and good yield. The yield of DNA that was determined by gel electrophoresis, decreased as the irradiation dose increased from 1 kGy. DNA extracted from rice seeds irradiated with a 30 kGy dose showed a molecular size of less than 20 kb, while that from unirradiated rice showed more than 100 kb in electrophoretic profiles. It can be assumed that the decrease in yield was mainly induced by the crosslinking between protein and DNA, and the reduction in molecular size was induced by double-strand breaks. (J.P.N.)

  9. Molecular Processes Studied at a Single-Molecule Level Using DNA Origami Nanostructures and Atomic Force Microscopy

    Directory of Open Access Journals (Sweden)

    Ilko Bald

    2014-09-01

    Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.

  10. PlasmaDNA: a free, cross-platform plasmid manipulation program for molecular biology laboratories

    Directory of Open Access Journals (Sweden)

    Rainy Jeffrey

    2007-09-01

    Full Text Available Abstract Background Most molecular biology experiments, and the techniques associated with this field of study, involve a great deal of engineering in the form of molecular cloning. Like all forms of engineering, perfect information about the starting material is crucial for successful completion of design and strategies. Results We have generated a program that allows complete in silico simulation of the cloning experiment. Starting with a primary DNA sequence, PlasmaDNA looks for restriction sites, open reading frames, primer annealing sequences, and various common domains. The databases are easily expandable by the user to fit his most common cloning needs. PlasmaDNA can manage and graphically represent multiple sequences at the same time, and keeps in memory the overhangs at the end of the sequences if any. This means that it is possible to virtually digest fragments, to add the digestion products to the project, and to ligate together fragments with compatible ends to generate the new sequences. Polymerase Chain Reaction (PCR fragments can also be virtually generated using the primer database, automatically adding to the fragments any 5' extra sequences present in the primers. Conclusion PlasmaDNA is a program available both on Windows and Apple operating systems, designed to facilitate molecular cloning experiments by building a visual map of the DNA. It then allows the complete planning and simulation of the cloning experiment. It also automatically updates the new sequences generated in the process, which is an important help in practice. The capacity to maintain multiple sequences in the same file can also be used to archive the various steps and strategies involved in the cloning of each construct. The program is freely available for download without charge or restriction.

  11. Isolate extended state in the DNA molecular transistor with surface interaction

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Le, E-mail: wang_le917@gs.zzu.edu.cn; Qin, Zhi-Jie

    2016-02-01

    The field effect characteristic of a DNA molecular device is investigated in a tight binding model with binary disorder and side site correlation. Using the transfer-matrix method and Landauer–Büttiker theory, we find that the system has isolated extended state that is irrespective of the DNA sequence and can be modulated by the gate voltage. When the gate voltage reaches some proper value, the isolated extended state appears at the Fermi level of the system and the long range charge transport is greatly enhanced. We attribute this phenomenon to the combination of the external field, the surface interaction, and the intrinsic disorder of DNA. The result is a generic feature of the nanowire with binary disorder and surface interaction.

  12. Sample preparation methods for quantitative detection of DNA by molecular assays and marine biosensors.

    Science.gov (United States)

    Cox, Annie M; Goodwin, Kelly D

    2013-08-15

    The need for quantitative molecular methods is growing in environmental, food, and medical fields but is hindered by low and variable DNA extraction and by co-extraction of PCR inhibitors. DNA extracts from Enterococcus faecium, seawater, and seawater spiked with E. faecium and Vibrio parahaemolyticus were tested by qPCR for target recovery and inhibition. Conventional and novel methods were tested, including Synchronous Coefficient of Drag Alteration (SCODA) and lysis and purification systems used on an automated genetic sensor (the Environmental Sample Processor, ESP). Variable qPCR target recovery and inhibition were measured, significantly affecting target quantification. An aggressive lysis method that utilized chemical, enzymatic, and mechanical disruption enhanced target recovery compared to commercial kit protocols. SCODA purification did not show marked improvement over commercial spin columns. Overall, data suggested a general need to improve sample preparation and to accurately assess and account for DNA recovery and inhibition in qPCR applications. Published by Elsevier Ltd.

  13. Defined-size DNA triple crossover construct for molecular electronics: modification, positioning and conductance properties.

    Science.gov (United States)

    Linko, Veikko; Leppiniemi, Jenni; Paasonen, Seppo-Tapio; Hytönen, Vesa P; Toppari, J Jussi

    2011-07-08

    We present a novel, defined-size, small and rigid DNA template, a so-called B-A-B complex, based on DNA triple crossover motifs (TX tiles), which can be utilized in molecular scale patterning for nanoelectronics, plasmonics and sensing applications. The feasibility of the designed construct is demonstrated by functionalizing the TX tiles with one biotin-triethylene glycol (TEG) and efficiently decorating them with streptavidin, and furthermore by positioning and anchoring single thiol-modified B-A-B complexes to certain locations on a chip via dielectrophoretic trapping. Finally, we characterize the conductance properties of the non-functionalized construct, first by measuring DC conductivity and second by utilizing AC impedance spectroscopy in order to describe the conductivity mechanism of a single B-A-B complex using a detailed equivalent circuit model. This analysis also reveals further information about the conductivity of DNA structures in general.

  14. Self-Assembling Molecular Logic Gates Based on DNA Crossover Tiles.

    Science.gov (United States)

    Campbell, Eleanor A; Peterson, Evan; Kolpashchikov, Dmitry M

    2017-07-05

    DNA-based computational hardware has attracted ever-growing attention due to its potential to be useful in the analysis of complex mixtures of biological markers. Here we report the design of self-assembling logic gates that recognize DNA inputs and assemble into crossover tiles when the output signal is high; the crossover structures disassemble to form separate DNA stands when the output is low. The output signal can be conveniently detected by fluorescence using a molecular beacon probe as a reporter. AND, NOT, and OR logic gates were designed. We demonstrate that the gates can connect to each other to produce other logic functions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. A Simple Thermoplastic Substrate Containing Hierarchical Silica Lamellae for High-Molecular-Weight DNA Extraction.

    Science.gov (United States)

    Zhang, Ye; Zhang, Yi; Burke, Jeffrey M; Gleitsman, Kristin; Friedrich, Sarah M; Liu, Kelvin J; Wang, Tza-Huei

    2016-12-01

    An inexpensive, magnetic thermoplastic nanomaterial is developed utilizing a hierarchical layering of micro- and nanoscale silica lamellae to create a high-surface-area and low-shear substrate capable of capturing vast amounts of ultrahigh-molecular-weight DNA. Extraction is performed via a simple 45 min process and is capable of achieving binding capacities up to 1 000 000 times greater than silica microparticles. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Molecular and sensory mechanisms to mitigate sunlight-induced DNA damage in treefrog tadpoles.

    Science.gov (United States)

    Schuch, André P; Lipinski, Victor M; Santos, Mauricio B; Santos, Caroline P; Jardim, Sinara S; Cechin, Sonia Z; Loreto, Elgion L S

    2015-10-01

    The increased incidence of solar ultraviolet B (UVB) radiation has been proposed as an environmental stressor, which may help to explain the enigmatic decline of amphibian populations worldwide. Despite growing knowledge regarding the UV-induced biological effects in several amphibian models, little is known about the efficacy of DNA repair pathways. In addition, little attention has been given to the interplay between these molecular mechanisms with other physiological strategies that avoid the damage induced by sunlight. Here, DNA lesions induced by environmental doses of solar UVB and UVA radiation were detected in genomic DNA samples of treefrog tadpoles (Hypsiboas pulchellus) and their DNA repair activity was evaluated. These data were complemented by monitoring the induction of apoptosis in blood cells and tadpole survival. Furthermore, the tadpoles' ability to perceive and escape from UV wavelengths was evaluated as an additional strategy of photoprotection. The results show that tadpoles are very sensitive to UVB light, which could be explained by the slow DNA repair rates for both cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6,4) pyrimidone photoproducts (6,4PPs). However, they were resistant to UVA, probably as a result of the activation of photolyases during UVA irradiation. Surprisingly, a sensory mechanism that triggers their escape from UVB and UVA light avoids the generation of DNA damage and helps to maintain the genomic integrity. This work demonstrates the genotoxic impact of both UVB and UVA radiation on tadpoles and emphasizes the importance of the interplay between molecular and sensory mechanisms to minimize the damage caused by sunlight. © 2015. Published by The Company of Biologists Ltd.

  17. Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

    Science.gov (United States)

    Schwessinger, Benjamin; Rathjen, John P

    2017-01-01

    Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

  18. Molecular dynamics simulation of a DNA containing a single strand break

    Energy Technology Data Exchange (ETDEWEB)

    Yamaguchi, H.; Siebers, G.; Furukawa, A.; Otagiri, N.; Osman, R

    2002-07-01

    Molecular dynamics simulations were performed for a dodecamer DNA containing a single strand break (SSB), which has been represented by a 3'-OH deoxyribose and 5'-OH phosphate in the middle of the strand. Molecular force field parameters of the 5'-OH phosphate region were determined from an ab initio calculation at the HF/6-31G level using the program package GAMESS. The DNA was placed in a periodic boundary box with water molecules and Na+ counter-ions to produce a neutralised system. After minimisation, the system was heated to 300 K, equilibrated and a production run at constant NTP was executed for 1 ns using AMBER 4.1. Snapshots of the SSB-containing DNA and a detailed analysis of the equilibriated average structure revealed surprisingly small conformational changes compared to normal DNA. However, dynamic properties calculated using the essential dynamics method showed some features that may be important for the recognition of this damage by repair enzymes. (author)

  19. Association of thymine glycol lesioned DNA with repair enzyme endonuclease III-molecular dynamics study

    International Nuclear Information System (INIS)

    Pinak, Miroslav

    2001-07-01

    The 2 nanoseconds molecular dynamics (MD) simulation has been performed for the system consisting of repair enzyme and DNA 30-mer with native thymine at position 16 replaced by thymine glycol (TG) solvated in water environment. After 950 picoseconds of MD the enzyme and DNA associated together to form complex that lasted stable up to 2 ns when simulation was terminated. At the contact area of enzyme and DNA there is glutamic acid located as close as 1.6 A to the C3' atom of phosphodiester bond of TG. Initial B-DNA molecule was bent and kinked at the TG during MD. This distortion caused that phosphodiester bond was easier accessible by amino acids of enzyme. The negative value of electrostatic energy (-26 kcal/mol) discriminates TG from nearly neutral native thymine and contributes to the specific recognition of this lesion. Higher number of close water molecules at TG site before formation of complex (compared with other nucleotides) indicates that glycosyl bond of the lesion is easily approached by repair enzyme during scanning of DNA surface and suggests the importance of specific hydration at the lesion during recognition process. (author)

  20. Usage of DNA Fingerprinting Technology for Quality Control in Molecular Lab Bench Work.

    Science.gov (United States)

    McIntosh, Linda Y; Lal, Janella E; Qin, Dahui

    2018-01-01

    One of the major quality assurance (QA) goals in many molecular laboratories is to avoid sample pipetting errors on the lab bench; especially when pipetting into multiwell plates. A pipetting error can cause a switch in patient samples, which can lead to recording the wrong results for the patient samples involved. Such pipetting errors are difficult to identify when it happens in lab bench work. DNA fingerprinting is a powerful tool in determining sample identities. Our laboratory has explored the usage of this technology in our QA process and successfully established that DNA fingerprinting can be used to monitor possible sample switch in gene rearrangement lab bench work. We use florescent light to quench the florescence in the gene rearrangement polymerase chain reaction products. After that, DNA fingerprinting technology is used to identify the sample DNA in the gene rearrangement polymerase chain reaction plate. The result is compared with the corresponding patient's blood sample DNA to determine whether there is a sample switch during the lab bench work.

  1. Association of thymine glycol lesioned DNA with repair enzyme endonuclease III-molecular dynamics study

    Energy Technology Data Exchange (ETDEWEB)

    Pinak, Miroslav [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2001-07-01

    The 2 nanoseconds molecular dynamics (MD) simulation has been performed for the system consisting of repair enzyme and DNA 30-mer with native thymine at position 16 replaced by thymine glycol (TG) solvated in water environment. After 950 picoseconds of MD the enzyme and DNA associated together to form complex that lasted stable up to 2 ns when simulation was terminated. At the contact area of enzyme and DNA there is glutamic acid located as close as 1.6 A to the C3' atom of phosphodiester bond of TG. Initial B-DNA molecule was bent and kinked at the TG during MD. This distortion caused that phosphodiester bond was easier accessible by amino acids of enzyme. The negative value of electrostatic energy (-26 kcal/mol) discriminates TG from nearly neutral native thymine and contributes to the specific recognition of this lesion. Higher number of close water molecules at TG site before formation of complex (compared with other nucleotides) indicates that glycosyl bond of the lesion is easily approached by repair enzyme during scanning of DNA surface and suggests the importance of specific hydration at the lesion during recognition process. (author)

  2. Ex vivo irradiation of human blood to determine DNA damage using molecular techniques

    International Nuclear Information System (INIS)

    Montes, Angel; Agapito, Juan

    2014-01-01

    Biological dosimetry is the assessment of absorbed dose in individuals exposed to ionizing radiation from blood samples based on the radiation induced damage in cellular DNA. The aim of this study was to determine the damage in the DNA through the assessment of an experimental ex vivo assay using irradiated samples of human blood cells. For this purpose, blood samples were irradiated at low doses (<100 mGy) considering the following parameters: blood volume (3mL), temperature (37 °C) and incubation time (0.5, 2, 4, 8 and 24 h). Dose values were: 0, 12.5, 25 and 50 mGy using Cesium -137 gamma rays at 662 keV and a dose rate of 38.46 mGy/h. The qualitative damage in the genomic DNA was determined using agarose gel electrophoresis and polymerase chain reaction (PCR) for the p53 gene in a sequence of 133 pb of exon 7, related to the protein that acts in the cell repair process. The results of the qualitative analysis showed no degradation of genomic DNA; also an increase in the DNA concentration was observed up to the fourth hour of incubation, finding maximum values for all doses in the two samples. As a conclusion, the effects of ionizing radiation at doses used in this experiment do not generate a detectable damage, by means of molecular techniques such as those used in the present study. (authors).

  3. Comparative Analytical Utility of DNA Derived from Alternative Human Specimens for Molecular Autopsy and Diagnostics

    Science.gov (United States)

    Klassen, Tara L.; von Rüden, Eva-Lotta; Drabek, Janice; Noebels, Jeffrey L.; Goldman, Alica M.

    2013-01-01

    Genetic testing and research have increased the demand for high-quality DNA that has traditionally been obtained by venipuncture. However, venous blood collection may prove difficult in special populations and when large-scale specimen collection or exchange is prerequisite for international collaborative investigations. Guthrie/FTA card–based blood spots, buccal scrapes, and finger nail clippings are DNA-containing specimens that are uniquely accessible and thus attractive as alternative tissue sources (ATS). The literature details a variety of protocols for extraction of nucleic acids from a singular ATS type, but their utility has not been systematically analyzed in comparison with conventional sources such as venous blood. Additionally, the efficacy of each protocol is often equated with the overall nucleic acid yield but not with the analytical performance of the DNA during mutation detection. Together with a critical in-depth literature review of published extraction methods, we developed and evaluated an all-inclusive approach for serial, systematic, and direct comparison of DNA utility from multiple biological samples. Our results point to the often underappreciated value of these alternative tissue sources and highlight ways to maximize the ATS-derived DNA for optimal quantity, quality, and utility as a function of extraction method. Our comparative analysis clarifies the value of ATS in genomic analysis projects for population-based screening, diagnostics, molecular autopsy, medico-legal investigations, or multi-organ surveys of suspected mosaicisms. PMID:22796560

  4. Assembling of G-strands into novel tetra-molecular parallel G4-DNA nanostructures using avidin-biotin recognition.

    Science.gov (United States)

    Borovok, Natalia; Iram, Natalie; Zikich, Dragoslav; Ghabboun, Jamal; Livshits, Gideon I; Porath, Danny; Kotlyar, Alexander B

    2008-09-01

    We describe a method for the preparation of novel long (hundreds of nanometers), uniform, inter-molecular G4-DNA molecules composed of four parallel G-strands. The only long continuous G4-DNA reported so far are intra-molecular structures made of a single G-strand. To enable a tetra-molecular assembly of the G-strands we developed a novel approach based on avidin-biotin biological recognition. The steps of the G4-DNA production include: (i) Enzymatic synthesis of long poly(dG)-poly(dC) molecules with biotinylated poly(dG)-strand; (ii) Formation of a complex between avidin-tetramer and four biotinylated poly(dG)-poly(dC) molecules; (iii) Separation of the poly(dC) strands from the poly(dG)-strands, which are connected to the avidin; (iv) Assembly of the four G-strands attached to the avidin into tetra-molecular G4-DNA. The average contour length of the formed structures, as measured by AFM, is equal to that of the initial poly(dG)-poly(dC) molecules, suggesting a tetra-molecular mechanism of the G-strands assembly. The height of tetra-molecular G4-nanostructures is larger than that of mono-molecular G4-DNA molecules having similar contour length. The CD spectra of the tetra- and mono-molecular G4-DNA are markedly different, suggesting different structural organization of these two types of molecules. The tetra-molecular G4-DNA nanostructures showed clear electrical polarizability. This suggests that they may be useful for molecular electronics.

  5. DNA-programmed dynamic assembly of quantum dots for molecular computation.

    Science.gov (United States)

    He, Xuewen; Li, Zhi; Chen, Muzi; Ma, Nan

    2014-12-22

    Despite the widespread use of quantum dots (QDs) for biosensing and bioimaging, QD-based bio-interfaceable and reconfigurable molecular computing systems have not yet been realized. DNA-programmed dynamic assembly of multi-color QDs is presented for the construction of a new class of fluorescence resonance energy transfer (FRET)-based QD computing systems. A complete set of seven elementary logic gates (OR, AND, NOR, NAND, INH, XOR, XNOR) are realized using a series of binary and ternary QD complexes operated by strand displacement reactions. The integration of different logic gates into a half-adder circuit for molecular computation is also demonstrated. This strategy is quite versatile and straightforward for logical operations and would pave the way for QD-biocomputing-based intelligent molecular diagnostics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Fast parallel molecular algorithms for DNA-based computation: factoring integers.

    Science.gov (United States)

    Chang, Weng-Long; Guo, Minyi; Ho, Michael Shan-Hui

    2005-06-01

    The RSA public-key cryptosystem is an algorithm that converts input data to an unrecognizable encryption and converts the unrecognizable data back into its original decryption form. The security of the RSA public-key cryptosystem is based on the difficulty of factoring the product of two large prime numbers. This paper demonstrates to factor the product of two large prime numbers, and is a breakthrough in basic biological operations using a molecular computer. In order to achieve this, we propose three DNA-based algorithms for parallel subtractor, parallel comparator, and parallel modular arithmetic that formally verify our designed molecular solutions for factoring the product of two large prime numbers. Furthermore, this work indicates that the cryptosystems using public-key are perhaps insecure and also presents clear evidence of the ability of molecular computing to perform complicated mathematical operations.

  7. Molecular Dynamics Insights into Polyamine-DNA Binding Modes: Implications for Cross-Link Selectivity.

    Science.gov (United States)

    Bignon, Emmanuelle; Chan, Chen-Hui; Morell, Christophe; Monari, Antonio; Ravanat, Jean-Luc; Dumont, Elise

    2017-09-18

    Biogenic polyamines, which play a role in DNA condensation and stabilization, are ubiquitous and are found at millimolar concentration in the nucleus of eukaryotic cells. The interaction modes of three polyamines-putrescine (Put), spermine (Spm), and spermidine (Spd)-with a self-complementary 16 base pair (bp) duplex, are investigated by all-atom explicit-solvent molecular dynamics. The length of the amine aliphatic chain leads to a change of the interaction mode from minor groove binding to major groove binding. Through all-atom dynamics, noncovalent interactions that stabilize the polyamine-DNA complex and prefigure the reactivity, leading to the low-barrier formation of deleterious DNA-polyamine cross-links, after one-electron oxidation of a guanine nucleobase, are unraveled. The binding strength is quantified from the obtained trajectories by molecular mechanics generalized Born surface area post-processing (MM-GBSA). The values of binding free energies provide the same affinity order, PutDNA-polyamine cross-link formation through the extraction of average approaching distances between the C8 atom of guanines and the ammonium group. These results imply that the formation of DNA-polyamine cross-links involves deprotonation of the guanine radical cation to attack the polyamines, which must be positively charged to lie in the vicinity of the B-helix. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Molecular Alterations Associated with DNA Repair in Pancreatic Adenocarcinoma Are Associated with Sites of Recurrence.

    Science.gov (United States)

    Ferguson, Margaret D; Dong, Lei; Wan, Jim; Deneve, Jeremiah L; Dickson, Paxton V; Behrman, Stephen W; Shibata, David; Martin, Mike G; Glazer, Evan S

    2018-02-10

    Pancreatic ductal adenocarcinoma (PDAC) remains one of the deadliest malignancies with a rising incidence. Mutational analysis of PDAC has provided valuable information but has not yet dramatically changed the therapeutic landscape due to the number of variations detected in any one individual. The pattern of molecular alterations-gene mutations, variations in copy number, and changes in gene expression-has been described in the literature. The purpose of this study is to further investigate the molecular alterations in recurrent or metastatic PDAC based on the site of disease. Molecular alterations in patients with recurrent or metastatic PDAC from 2007 to 2015 were analyzed. The most common molecular alterations found in PDAC tumors from the pancreas were compared to metastatic PDAC specimens from the liver, lung, peritoneum, and other locations. Means were compared with a two-tailed Student's t test or ANOVA as appropriate. Rates of molecular alterations among the different groups were compared with Pearson's χ 2 . Two thousand five hundred fifty-two patients with PDAC were identified in a retrospective database, and the 15 most common molecular alterations were utilized for analysis. The most common alterations among all patients were mutations in KRAS and PTEN (59 and 62%, respectively), with differences in prevalence by site of metastasis (p = 0.042 and p = 0.037, respectively). KRAS mutations were more commonly found in metastasis in the lung (72%) than in other sites (59%, p = 0.042). Low expression of ERCC1 was found in 49% of lung metastases from PDAC but only 15% in PDAC in the pancreas (p molecular alterations significantly associated with site of metastatic disease were involved in DNA maintenance, repair, replication, or transcription (each p molecular alterations warrants further investigation.

  9. Seroprevalence, molecular epidemiology and quantitation of parvovirus B19 DNA levels in Iranian blood donors.

    Science.gov (United States)

    Zadsar, Maryam; Aghakhani, Arezoo; Banifazl, Mohammad; Kazemimanesh, Monireh; Tabatabaei Yazdi, Seyed Morteza; Mamishi, Setareh; Bavand, Anahita; Sadat Larijani, Mona; Ramezani, Amitis

    2018-04-16

    Human parvovirus B19 (B19) infection is common among blood donors, and healthy blood donors can transmit virus via transfusion. Due to resistance of B19 to viral inactivation methods, there is a potential concern regarding transfusion safety in blood products. We aimed to determine the seroprevalence, molecular epidemiology, and quantitation of B19 DNA levels in blood donors in Tehran, Iran. A total of 500 blood donors from Blood Transfusion Research Center were studied. ELISA was used for detection of B19 IgG and IgM and nested PCR was carried out for detection of B19 DNA. PCR products were subjected to direct sequencing. B19 viral load was determined by real time PCR. B19 IgG, IgM, and DNA were detected in 27.6, 2.6, and 1.2% of donors respectively. Ten samples (2%) were positive for both antibodies while in four cases (0.8%), B19 IgG and DNA detected simultaneously. One case had B19 IgM, IgG, and viremia concurrently. The titers of B19 DNA in four of six donors were more than 10 6  IU/mL (high level viremia) and all four cases had IgG simultaneously. All B19 isolates categorized in genotype 1A. Our findings indicated that prevalence of B19 DNA in Iranian blood donors was comparable with previous studies throughout the world. High level B19 viremia found in 0.8% of our donors and all viremic donors revealed neutralizing B19 antibody. Therefore implementation of a B19 screening test for each volunteer blood donor does not appear to be necessary but B19 testing for plasma-derived products seems important in Iranian donors. © 2018 Wiley Periodicals, Inc.

  10. Triple-helix molecular switch-based aptasensors and DNA sensors.

    Science.gov (United States)

    Bagheri, Elnaz; Abnous, Khalil; Alibolandi, Mona; Ramezani, Mohammad; Taghdisi, Seyed Mohammad

    2018-07-15

    Utilization of traditional analytical techniques is limited because they are generally time-consuming and require high consumption of reagents, complicated sample preparation and expensive equipment. Therefore, it is of great interest to achieve sensitive, rapid and simple detection methods. It is believed that nucleic acids assays, especially aptamers, are very important in modern life sciences for target detection and biological analysis. Aptamers and DNA-based sensors have been widely used for the design of various sensors owing to their unique features. In recent years, triple-helix molecular switch (THMS)-based aptasensors and DNA sensors have been broadly utilized for the detection and analysis of different targets. The THMS relies on the formation of DNA triplex via Watson-Crick and Hoogsteen base pairings under optimal conditions. This review focuses on recent progresses in the development and applications of electrochemical, colorimetric, fluorescence and SERS aptasensors and DNA sensors, which are based on THMS. Also, the advantages and drawbacks of these methods are discussed. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Molecular genetic and biochemical analyses of a DNA repair gene from Serratia marcescens

    International Nuclear Information System (INIS)

    Murphy, K.E.

    1989-01-01

    In Escherichia coli, the SOS response and two 3-methyladenine DNA glycosylases (TagI and TagII) are required for repair of DNA damaged by alkylating agents such as methyl methanesulfonate (MMS). Mutations of the recA gene eliminate the SOS response. TagI and TagII are encoded by the tag and alkA genes, respectively. A gene (rpr) encoding 3-methyladenine DNA glycosylase activity was isolated from the Gram-negative bacterium Serratia marcescens. The gene, localized to a 1.5-kilobase pair SmaI-HindIII restriction fragment, was cloned into plasmid pUC18. The clone complemented E. coli tag alkA and recA mutations for MMS resistance. The rpr gene did not, however, complement recA mutations for resistance to ultraviolet light or the ability to perform homologous recombination reactions, nor did it complement E. coli ada or alkB mutations. Two proteins of molecular weights 42,000 and 16,000 were produced from the rpr locus. Analysis of deletion and insertion mutants of rpr suggested that the 42kD molecule is the active protein. The 16kD protein may either be a breakdown product of the 42kD species or may be encoded by another gene overlapping the reading frame of the rpr gene. Biochemical assays showed that the rpr gene product (Rpr) possesses 3-methyladenine DNA glycosylase activity

  12. Sample preparation methods for quantitative detection of DNA by molecular assays and marine biosensors

    International Nuclear Information System (INIS)

    Cox, Annie M.; Goodwin, Kelly D.

    2013-01-01

    Highlights: • DNA extraction methods affected measured qPCR target recovery. • Recovery and variability differed, sometimes by more than an order of magnitude. • SCODA did not offer significant improvement with PCR-inhibited seawater. • Aggressive lysis did appear to improve target recovery. • Reliable and affordable correction methods are needed for quantitative PCR. -- Abstract: The need for quantitative molecular methods is growing in environmental, food, and medical fields but is hindered by low and variable DNA extraction and by co-extraction of PCR inhibitors. DNA extracts from Enterococcus faecium, seawater, and seawater spiked with E. faecium and Vibrio parahaemolyticus were tested by qPCR for target recovery and inhibition. Conventional and novel methods were tested, including Synchronous Coefficient of Drag Alteration (SCODA) and lysis and purification systems used on an automated genetic sensor (the Environmental Sample Processor, ESP). Variable qPCR target recovery and inhibition were measured, significantly affecting target quantification. An aggressive lysis method that utilized chemical, enzymatic, and mechanical disruption enhanced target recovery compared to commercial kit protocols. SCODA purification did not show marked improvement over commercial spin columns. Overall, data suggested a general need to improve sample preparation and to accurately assess and account for DNA recovery and inhibition in qPCR applications

  13. Molecular phylogeny of the lionfish genera Dendrochirus and Pterois (Scorpaenidae, Pteroinae) based on mitochondrial DNA sequences.

    Science.gov (United States)

    Kochzius, Marc; Söller, Rainer; Khalaf, Maroof A; Blohm, Dietmar

    2003-09-01

    This study investigates the molecular phylogeny of seven lionfishes of the genera Dendrochirus and Pterois. MP, ML, and NJ phylogenetic analysis based on 964 bp of partial mitochondrial DNA sequences (cytochrome b and 16S rDNA) revealed two main clades: (1) "Pterois" clade (Pterois miles and Pterois volitans), and (2) "Pteropterus-Dendrochirus" clade (remainder of the sampled species). The position of Dendrochirus brachypterus either basal to the main clades or in the "Pteropterus-Dendrochirus" clade cannot be resolved. However, the molecular phylogeny did not support the current separation of the genera Pterois and Dendrochirus. The siblings P. miles and P. volitans are clearly separated and our results support the proposed allopatric or parapatric distribution in the Indian and Pacific Ocean. However, the present analysis cannot reveal if P. miles and P. volitans are separate species or two populations of a single species, because the observed separation in different clades can be either explained by speciation or lineage sorting. Molecular clock estimates for the siblings P. miles and P. volitans suggest a divergence time of 2.4-8.3 mya, which coincide with geological events that created vicariance between populations of the Indian and Pacific Ocean.

  14. Molecular beacon based biosensor for the sequence-specific detection of DNA using DNA-capped gold nanoparticles-streptavidin conjugates for signal amplification

    International Nuclear Information System (INIS)

    Fang, Xian; Jiang, Wei; Han, Xiaowei; Zhang, Yuzhong

    2013-01-01

    We describe a highly sensitive and selective molecular beacon-based electrochemical impedance biosensor for the sequence-specific detection of DNA. DNA-capped conjugates between gold nanoparticles (Au-NPs) and streptavidin are used for signal amplification. The molecular beacon was labeled with a thiol at its 5′ end and with biotin at its 3′ end, and then immobilized on the surface of a bare gold electrode through the formation of Au-S bonds. Initially, the molecular beacon is present in the “closed” state, and this shields the biotin from being approached by streptavidin due to steric hindrance. In the presence of the target DNA, the target DNA molecules hybridize with the loop and cause a conformational change that moves the biotin away from the surface of the electrode. The biotin thereby becomes accessible for the reporter (the DNA-streptavidin capped Au-NPs), and this results in a distinct increase in electron transfer resistance. Under optimal conditions, the increase in resistance is linearly related to the logarithm of the concentration of complementary target DNA in the range from 1.0 fM to 0.1 μM, with a detection limit of 0.35 fM (at an S/N of 3). This biosensor exhibits good selectivity, and acceptable stability and reproducibility. (author)

  15. Small-angle neutron scattering and molecular dynamics structural study of gelling DNA nanostars

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-Castanon, J.; Bomboi, F. [Sapienza–Università di Roma, P.le A. Moro 5, 00185 Roma (Italy); Rovigatti, L. [Rudolf Peierls C.T.P., University of Oxford, 1 Keble Road, Oxford OX1 3NP (United Kingdom); Faculty of Physics, University of Vienna, Boltzmanngasse 5, A-1090 Vienna (Austria); Zanatta, M. [Dipartimento di Fisica, Università di Perugia, Via Pascoli, 06123 Perugia (Italy); CNR-ISC, UOS Sapienza–Università di Roma, I-00186 Roma (Italy); Paciaroni, A. [Dipartimento di Fisica, Università di Perugia, Via Pascoli, 06123 Perugia (Italy); Comez, L. [Dipartimento di Fisica, Università di Perugia, Via Pascoli, 06123 Perugia (Italy); IOM-CNR, UOS Perugia c/o Dipartimento di Fisica e Geologia, Università di Perugia, Via Pascoli, 06123 Perugia (Italy); Porcar, L. [Institut Laue-Langevin, 71 Avenue des Martyrs, CS 20156, 38042 Grenoble Cedex 9 (France); Jafta, C. J. [Helmholtz-Zentrum Berlin, Hahn-Meitner-Platz 1, 14109 Berlin (Germany); Fadda, G. C. [Laboratoire Léon Brillouin, LLB, CEA Saclay, 91191 Gif-sur-Yvette Cedex (France); Bellini, T. [Department of Medical Biotechnology and Translational Medicine, Università di Milano, I-20133 Milano (Italy); Sciortino, F., E-mail: francesco.sciortino@uniroma1.it [Sapienza–Università di Roma, P.le A. Moro 5, 00185 Roma (Italy); CNR-ISC, UOS Sapienza–Università di Roma, I-00186 Roma (Italy)

    2016-08-28

    DNA oligomers with properly designed sequences self-assemble into well defined constructs. Here, we exploit this methodology to produce bulk quantities of tetravalent DNA nanostars (each one composed of 196 nucleotides) and to explore the structural signatures of their aggregation process. We report small-angle neutron scattering experiments focused on the evaluation of both the form factor and the temperature evolution of the scattered intensity at a nanostar concentration where the system forms a tetravalent equilibrium gel. We also perform molecular dynamics simulations of one isolated tetramer to evaluate the form factor numerically, without resorting to any approximate shape. The numerical form factor is found to be in very good agreement with the experimental one. Simulations predict an essentially temperature-independent form factor, offering the possibility to extract the effective structure factor and its evolution during the equilibrium gelation.

  16. Molecular dynamics simulations of electrostatics and hydration distributions around RNA and DNA motifs

    Science.gov (United States)

    Marlowe, Ashley E.; Singh, Abhishek; Semichaevsky, Andrey V.; Yingling, Yaroslava G.

    2009-03-01

    Nucleic acid nanoparticles can self-assembly through the formation of complementary loop-loop interactions or stem-stem interactions. Presence and concentration of ions can significantly affect the self-assembly process and the stability of the nanostructure. In this presentation we use explicit molecular dynamics simulations to examine the variations in cationic distributions and hydration environment around DNA and RNA helices and loop-loop interactions. Our simulations show that the potassium and sodium ionic distributions are different around RNA and DNA motifs which could be indicative of ion mediated relative stability of loop-loop complexes. Moreover in RNA loop-loop motifs ions are consistently present and exchanged through a distinct electronegative channel. We will also show how we used the specific RNA loop-loop motif to design a RNA hexagonal nanoparticle.

  17. Molecular diversification of Trichuris spp. from Sigmodontinae (Cricetidae) rodents from Argentina based on mitochondrial DNA sequences.

    Science.gov (United States)

    Callejón, Rocío; Robles, María Del Rosario; Panei, Carlos Javier; Cutillas, Cristina

    2016-08-01

    A molecular phylogenetic hypothesis is presented for the genus Trichuris based on sequence data from mitochondrial cytochrome c oxidase 1 (cox1) and cytochrome b (cob). The taxa consisted of nine populations of whipworm from five species of Sigmodontinae rodents from Argentina. Bayesian Inference, Maximum Parsimony, and Maximum Likelihood methods were used to infer phylogenies for each gene separately but also for the combined mitochondrial data and the combined mitochondrial and nuclear dataset. Phylogenetic results based on cox1 and cob mitochondrial DNA (mtDNA) revealed three clades strongly resolved corresponding to three different species (Trichuris navonae, Trichuris bainae, and Trichuris pardinasi) showing phylogeographic variation, but relationships among Trichuris species were poorly resolved. Phylogenetic reconstruction based on concatenated sequences had greater phylogenetic resolution for delimiting species and populations intra-specific of Trichuris than those based on partitioned genes. Thus, populations of T. bainae and T. pardinasi could be affected by geographical factors and co-divergence parasite-host.

  18. A novel reliable method of DNA extraction from olive oil suitable for molecular traceability.

    Science.gov (United States)

    Raieta, Katia; Muccillo, Livio; Colantuoni, Vittorio

    2015-04-01

    Extra virgin olive oil production has a worldwide economic impact. The use of this brand, however, is of great concern to Institutions and private industries because of the increasing number of fraud and adulteration attempts to the market products. Here, we present a novel, reliable and not expensive method for extracting the DNA from commercial virgin and extra virgin olive oils. The DNA is stable overtime and amenable for molecular analyses; in fact, by carrying out simple sequence repeats (SSRs) markers analysis, we characterise the genetic profile of monovarietal olive oils. By comparing the oil-derived pattern with that of the corresponding tree, we can unambiguously identify four cultivars from Samnium, a region of Southern Italy, and distinguish them from reference and more widely used varieties. Through a parentage statistical analysis, we also identify the putative pollinators, establishing an unprecedented and powerful tool for olive oil traceability. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Molecular characterization of Fasciola gigantica from Mauritania based on mitochondrial and nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-10-01

    Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All

  20. Molecular interactions and residues involved in force generation in the T4 viral DNA packaging motor.

    Science.gov (United States)

    Migliori, Amy D; Smith, Douglas E; Arya, Gaurav

    2014-12-12

    Many viruses utilize molecular motors to package their genomes into preformed capsids. A striking feature of these motors is their ability to generate large forces to drive DNA translocation against entropic, electrostatic, and bending forces resisting DNA confinement. A model based on recently resolved structures of the bacteriophage T4 motor protein gp17 suggests that this motor generates large forces by undergoing a conformational change from an extended to a compact state. This transition is proposed to be driven by electrostatic interactions between complementarily charged residues across the interface between the N- and C-terminal domains of gp17. Here we use atomistic molecular dynamics simulations to investigate in detail the molecular interactions and residues involved in such a compaction transition of gp17. We find that although electrostatic interactions between charged residues contribute significantly to the overall free energy change of compaction, interactions mediated by the uncharged residues are equally if not more important. We identify five charged residues and six uncharged residues at the interface that play a dominant role in the compaction transition and also reveal salt bridging, van der Waals, and solvent hydrogen-bonding interactions mediated by these residues in stabilizing the compact form of gp17. The formation of a salt bridge between Glu309 and Arg494 is found to be particularly crucial, consistent with experiments showing complete abrogation in packaging upon Glu309Lys mutation. The computed contributions of several other residues are also found to correlate well with single-molecule measurements of impairments in DNA translocation activity caused by site-directed mutations. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Molecular phylogeny and radiation time of erysiphales inferred from the nuclear ribosomal DNA sequences

    International Nuclear Information System (INIS)

    Mori, Y.; Sato, Y.; Takamatsu, S.

    2000-01-01

    Phylogenetic relationships of Erysiphales within Ascomycota were inferred from the newly determined sequences of the 18S rDNA and partial sequences of the 28S rDNA including the D1 and D2 regions of 10 Erysiphales taxa. Phylogenetic analyses revealed that the Erysiphales form a distinct clade among ascomycetous fungi suggesting that the Erysiphales diverged from a single ancestral taxon. The Myxotrichaceae of the Onygenales was distantly related to the other onygenalean families and was the sister group to the Erysiphales calde, with which it combined to form a clade. The Erysiphales/Myxotrichaceae clade was also closely related to some discomycetous fungi (Leotiales, Cyttariales and Thelebolaceae) including taxa that form cleistothecial ascomata. The present molecular analyses as well as previously reported morphological observations suggest the possible existence of a novel evolutionary pathway from cleistothecial discomycetous fungi to Erysiphales and Myxotrichaceae. However, since most of these fungi, except for the Erysiphales, are saprophytic on dung and/or plant materials, the questions of how and why an obligate biotroph like the Erysiphales radiated from the saprophytic fungi remain to be addressed. We also estimated the radiation time of the Erysiphales using the 18S rDNA sequences and the two molecular clockes that have been previously reported. The calculation showed that the Erysiphales split from the Myxotrichaceae 190–127 myr ago. Since the radiation time of the Erysiphales does not exceed 230 myr ago, even when allowance is made for the uncertainty of the molecular clocks, it is possible to consider that the Erysiphales evolved after the radiation of angiosperms. The results of our calculation also showed that the first radiation within the Erysiphales (138–92 myr ago) coincided with the date of a major diversification of angiosperms (130–90 myr ago). These results may support our early assumption that the radiation of the Erysiphales

  2. O6-methylguanine-DNA methyltransferase in equine sarcoids: molecular and epigenetic analysis

    Directory of Open Access Journals (Sweden)

    Altamura Gennaro

    2012-11-01

    Full Text Available Abstract Background Bovine papillomaviruses (BPVs types 1 and 2 are the only known papillomaviruses able to jump the species. In fact, BPVs 1/2 induce neoplasia in their natural bovine host but infection is also associated to neoplastic skin lesions in equids termed sarcoids. The equine sarcoid is considered to be the most common equine cutaneous tumour worldwide for which no effective therapy is available. Very little is known about the molecular mechanisms underlying tumourigenesis, although genes contributing to sarcoid development have been identified. Several studies associate the development of cancer to the loss of function of a number of oncosuppressor genes. In this study the putative role of O6-methylguanine-DNA methyltrasferase (MGMT was investigated for sarcoids. The expression of the oncosuppressor protein was assessed in normal and sarcoid cells and tissues. In addition, the DNA methylation profile was analysed to assess the role of epigenetic mechanism in regulation of MGMT expression. Results A group of 15 equine sarcoids and two primary sarcoid cell lines (fibroblasts were analyzed for the expression of MGMT protein by immunohistochemistry, immunofluorescence and Western blotting techniques. The sarcoid cell line EqSO4b and the tumour samples showed a reduction or absence of MGMT expression. To investigate the causes of deregulated MGMT expression, ten samples were analyzed for the DNA methylation profile of the CpG island associated to the MGMT promoter. The analysis of 73 CpGs encompassing the region of interest showed in 1 out of 10 (10% sarcoids a pronouncedly altered methylation profile when compared to the control epidermal sample. Similarily the EqSO4b cell line showed an altered MGMT methylation pattern in comparison to normal fibroblasts. Conclusion As previously demonstrated for the oncosuppressor gene FHIT, analysis of MGMT expression in sarcoid tissues and a sarcoid-derived fibroblast cell line further suggests that

  3. Experimental and molecular docking studies on DNA binding interaction of adefovir dipivoxil: Advances toward treatment of hepatitis B virus infections

    Science.gov (United States)

    Shahabadi, Nahid; Falsafi, Monireh

    The toxic interaction of adefovir dipivoxil with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multi-spectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove binding mode. The binding constant of UV-visible and the number of binding sites were 3.33 ± 0.2 × 104 L mol-1and 0.99, respectively. The fluorimetric studies showed that the reaction between the drug and CT-DNA is exothermic (ΔH = 34.4 kJ mol-1; ΔS = 184.32 J mol-1 K-1). Circular dichroism spectroscopy (CD) was employed to measure the conformational change of CT-DNA in the presence of adefovir dipivoxil, which verified the groove binding mode. Furthermore, the drug induces detectable changes in its viscosity. The molecular modeling results illustrated that adefovir strongly binds to groove of DNA by relative binding energy of docked structure -16.83 kJ mol-1. This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the toxic interaction of small molecular pollutants and drugs with bio macromolecules, which contributes to clarify the molecular mechanism of toxicity or side effect in vivo.

  4. Synthesis and Molecular Modeling of Thermally Stable DNA G-Quadruplexes with Anthraquinone Insertions

    DEFF Research Database (Denmark)

    Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....

  5. CMOS Time-Resolved, Contact, and Multispectral Fluorescence Imaging for DNA Molecular Diagnostics

    Directory of Open Access Journals (Sweden)

    Nan Guo

    2014-10-01

    Full Text Available Instrumental limitations such as bulkiness and high cost prevent the fluorescence technique from becoming ubiquitous for point-of-care deoxyribonucleic acid (DNA detection and other in-field molecular diagnostics applications. The complimentary metal-oxide-semiconductor (CMOS technology, as benefited from process scaling, provides several advanced capabilities such as high integration density, high-resolution signal processing, and low power consumption, enabling sensitive, integrated, and low-cost fluorescence analytical platforms. In this paper, CMOS time-resolved, contact, and multispectral imaging are reviewed. Recently reported CMOS fluorescence analysis microsystem prototypes are surveyed to highlight the present state of the art.

  6. Quantum Mechanics/Molecular Mechanics Free Energy Maps and Nonadiabatic Simulations for a Photochemical Reaction in DNA: Cyclobutane Thymine Dimer.

    Science.gov (United States)

    Mendieta-Moreno, Jesús I; Trabada, Daniel G; Mendieta, Jesús; Lewis, James P; Gómez-Puertas, Paulino; Ortega, José

    2016-11-03

    The absorption of ultraviolet radiation by DNA may result in harmful genetic lesions that affect DNA replication and transcription, ultimately causing mutations, cancer, and/or cell death. We analyze the most abundant photochemical reaction in DNA, the cyclobutane thymine dimer, using hybrid quantum mechanics/molecular mechanics (QM/MM) techniques and QM/MM nonadiabatic molecular dynamics. We find that, due to its double helix structure, DNA presents a free energy barrier between nonreactive and reactive conformations leading to the photolesion. Moreover, our nonadiabatic simulations show that most of the photoexcited reactive conformations return to standard B-DNA conformations after an ultrafast nonradiative decay to the ground state. This work highlights the importance of dynamical effects (free energy, excited-state dynamics) for the study of photochemical reactions in biological systems.

  7. DNA-based molecular markers as tools for the discovery of γ-induced mutants in cereals and soybean

    International Nuclear Information System (INIS)

    Bondarenco, E.; Bondarenco, V.; Barbacar, N.; Coretchi, L.

    2009-01-01

    γ-induced mutagenesis is one of the present techniques effective in producing crops with enhanced quality and novel properties. The fast detection of mutants can be nowadays assured by the employment of DNA-based molecular markers. Different kinds of molecular markers are being widely used all over the world to monitor DNA sequence variation and identification of desired traits. In the given paper we present a short overview of the types of molecular markers and the first steps of the attempt of their use for mutants' characterization in the Republic of Moldova (authors)

  8. Molecular Identification of Vertebrate and Hemoparasite DNA Within Mosquito Blood Meals From Eastern North Dakota

    Science.gov (United States)

    Vaughan, Jefferson A.

    2013-01-01

    Abstract To understand local transmission of vector-borne diseases, it is important to identify potential vectors, characterize their host feeding patterns, and determine if vector-borne pathogens are circulating within the region. This study simultaneously investigated these aspects of disease transmission by collecting engorged mosquitoes within two rural study sites in the central Red River Valley of North Dakota. Mosquitoes were identified, midguts were excised, and the blood was expelled from the midguts. DNA was extracted from blood meals and subjected to PCR and direct sequencing to identify the vertebrate origin of the blood. Using different primer sets, PCR was used to screen for two types of vector-borne pathogens, filarioid nematodes and hemosporidian parasites. White-tailed deer were the primary source of blood meals for the eight aedine mosquito species collected. None of the 288 deer-derived blood meals contained filarioid or hemosporidian DNA. In contrast, 18 of 32 Culex tarsalis and three of three Cx. pipiens blood meals contained avian blood, representing eight different species of birds. Of 24 avian-derived blood meals examined, 12 contained Plasmodium DNA, three of which also contained Leucocytozoon DNA (i.e., dual infection). Potential confounding effects resulting from parasite acquisition and development from previous blood meals (e.g., oocysts) were eliminated because host blood had been removed from the midguts prior to DNA extraction. Thus, specific parasite lineages/species could be unequivocally linked to specific vertebrate species. By combining mosquito identification with molecular techniques for identifying blood meal source and pathogens, a relatively small sample of engorged mosquitoes yielded important new information about mosquito feeding patterns and hemosporidia infections in birds. Thorough analyses of wild-caught engorged mosquitoes and other arthropods represent a powerful tool in understanding the local transmission of

  9. Molecular identification of vertebrate and hemoparasite DNA within mosquito blood meals from eastern North Dakota.

    Science.gov (United States)

    Mehus, Joseph O; Vaughan, Jefferson A

    2013-11-01

    To understand local transmission of vector-borne diseases, it is important to identify potential vectors, characterize their host feeding patterns, and determine if vector-borne pathogens are circulating within the region. This study simultaneously investigated these aspects of disease transmission by collecting engorged mosquitoes within two rural study sites in the central Red River Valley of North Dakota. Mosquitoes were identified, midguts were excised, and the blood was expelled from the midguts. DNA was extracted from blood meals and subjected to PCR and direct sequencing to identify the vertebrate origin of the blood. Using different primer sets, PCR was used to screen for two types of vector-borne pathogens, filarioid nematodes and hemosporidian parasites. White-tailed deer were the primary source of blood meals for the eight aedine mosquito species collected. None of the 288 deer-derived blood meals contained filarioid or hemosporidian DNA. In contrast, 18 of 32 Culex tarsalis and three of three Cx. pipiens blood meals contained avian blood, representing eight different species of birds. Of 24 avian-derived blood meals examined, 12 contained Plasmodium DNA, three of which also contained Leucocytozoon DNA (i.e., dual infection). Potential confounding effects resulting from parasite acquisition and development from previous blood meals (e.g., oocysts) were eliminated because host blood had been removed from the midguts prior to DNA extraction. Thus, specific parasite lineages/species could be unequivocally linked to specific vertebrate species. By combining mosquito identification with molecular techniques for identifying blood meal source and pathogens, a relatively small sample of engorged mosquitoes yielded important new information about mosquito feeding patterns and hemosporidia infections in birds. Thorough analyses of wild-caught engorged mosquitoes and other arthropods represent a powerful tool in understanding the local transmission of vector

  10. Arbitrarily amplified DNA: New molecular approaches to plant breeding, ecology and evolution

    Energy Technology Data Exchange (ETDEWEB)

    Caetano-Anolles, G [Department of Biology, University of Oslo, Oslo (Norway)

    2001-11-01

    Several DNA fingerprinting techniques that use arbitrary primers to characterize, scan and tag genomic DNA were optimized and used to study plants and microbial pathogens. The generated arbitrarily amplified DNA (AAD) profiles could be tailored in their complexity and polymorphic content, allowing analysis of closely related organisms, such as vegetatively-propagated horticultural crops or clonal fungal populations. AAD markers were used in cultivar and strain identification, map-based cloning, and marker-assisted breeding, sometimes as sequence-tagged sites. Phenetic analysis using parsimony, cluster, and numerical methods was applied successfully to the identification of genetic relationships in turfgrass species such as bermudagrass, woody plants such as dogwoods, and floricultural species such as petunia and chrysanthemum. AAD profiles were used to measure for the first time a genome-wide mutation rate, directly in a plant. Mutation rates in vegetatively propagated bermudagrass were comparable to those in human, mice, fruit flies, and worms. In combination with established tools used in molecular systematics (e.g. rDNA sequence analysis), AAD markers tracked the introduction of exotic dogwood anthracnose-causing fungi in North America. As part of a breeding effort to combat dogwood diseases, AAD was used in pseudo-testcross mapping of the tree at the intra-specific level. Markers were efficiently generated despite the close relatedness of parental dogwood material. Finally, DNA markers and tags were also generated in soybean, and were used to construct high density maps and walk towards defined genomic regions in the positional cloning of the supernodulation nts-1 symbiotic gene. (author)

  11. Arbitrarily amplified DNA: New molecular approaches to plant breeding, ecology and evolution

    International Nuclear Information System (INIS)

    Caetano-Anolles, G.

    2001-01-01

    Several DNA fingerprinting techniques that use arbitrary primers to characterize, scan and tag genomic DNA were optimized and used to study plants and microbial pathogens. The generated arbitrarily amplified DNA (AAD) profiles could be tailored in their complexity and polymorphic content, allowing analysis of closely related organisms, such as vegetatively-propagated horticultural crops or clonal fungal populations. AAD markers were used in cultivar and strain identification, map-based cloning, and marker-assisted breeding, sometimes as sequence-tagged sites. Phenetic analysis using parsimony, cluster, and numerical methods was applied successfully to the identification of genetic relationships in turfgrass species such as bermudagrass, woody plants such as dogwoods, and floricultural species such as petunia and chrysanthemum. AAD profiles were used to measure for the first time a genome-wide mutation rate, directly in a plant. Mutation rates in vegetatively propagated bermudagrass were comparable to those in human, mice, fruit flies, and worms. In combination with established tools used in molecular systematics (e.g. rDNA sequence analysis), AAD markers tracked the introduction of exotic dogwood anthracnose-causing fungi in North America. As part of a breeding effort to combat dogwood diseases, AAD was used in pseudo-testcross mapping of the tree at the intra-specific level. Markers were efficiently generated despite the close relatedness of parental dogwood material. Finally, DNA markers and tags were also generated in soybean, and were used to construct high density maps and walk towards defined genomic regions in the positional cloning of the supernodulation nts-1 symbiotic gene. (author)

  12. Molecular identification of Malaysian Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) using life stage specific mitochondrial DNA.

    Science.gov (United States)

    Kavitha, R; Tan, T C; Lee, H L; Nazni, W A; Sofian, A M

    2013-06-01

    DNA identification of blow fly species can be a very useful tool in forensic entomology. One of the potential benefits that mitochondrial DNA (mtDNA) has offered in the field of forensic entomology is species determination. Conventional identification methods have limitations for sibling and closely related species of blow fly and stage and quality of the specimen used. This could be overcome by DNA-based identification methods using mitochondrial DNA which does not demand intact or undamaged specimens. Mitochondrial DNA is usually isolated from whole blow fly and legs. Alternate sources for mitochondrial DNA isolation namely, egg, larva, puparium and empty puparium were explored in this study. The sequence of DNA obtained for each sample for every life cycle stage was 100% identical for a particular species, indicating that the egg, 1st instar, 2nd instar, 3rd instar, pupa, empty puparium and adult from the same species and obtained from same generation will exhibit similar DNA sequences. The present study also highlighted the usefulness of collecting all life cycle stages of blow fly during crime scene investigation with proper preservation and subsequent molecular analysis. Molecular identification provides a strong basis for species identification and will prove an invaluable contribution to forensic entomology as an investigative tool in Malaysia.

  13. Redescription and molecular characterisation of Dujardinascaris madagascariensis and a note on D. dujardini (Nematoda: Heterocheilidae), parasites of Crocodylus niloticus, with a key to Dujardinascaris spp. in crocodilians

    Czech Academy of Sciences Publication Activity Database

    Mašová, Š.; Baruš, V.; Seifertová, M.; Malala, J. O.; Jirků, Miloslav

    2014-01-01

    Roč. 3893, č. 3 (2014), s. 261-276 ISSN 1175-5326 R&D Projects: GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : Lake Turkana * Omo River delta * Kenya * Africa * bar-coding * 18S rDNA * ITS2 Subject RIV: EG - Zoology Impact factor: 0.906, year: 2014

  14. Cleavable DNA-protein hybrid molecular beacon: A novel efficient signal translator for sensitive fluorescence anisotropy bioassay.

    Science.gov (United States)

    Hu, Pan; Yang, Bin

    2016-01-15

    Due to its unique features such as high sensitivity, homogeneous format, and independence on fluorescent intensity, fluorescence anisotropy (FA) assay has become a hotspot of study in oligonucleotide-based bioassays. However, until now most FA probes require carefully customized structure designs, and thus are neither generalizable for different sensing systems nor effective to obtain sufficient signal response. To address this issue, a cleavable DNA-protein hybrid molecular beacon was successfully engineered for signal amplified FA bioassay, via combining the unique stable structure of molecular beacon and the large molecular mass of streptavidin. Compared with single DNA strand probe or conventional molecular beacon, the DNA-protein hybrid molecular beacon exhibited a much higher FA value, which was potential to obtain high signal-background ratio in sensing process. As proof-of-principle, this novel DNA-protein hybrid molecular beacon was further applied for FA bioassay using DNAzyme-Pb(2+) as a model sensing system. This FA assay approach could selectively detect as low as 0.5nM Pb(2+) in buffer solution, and also be successful for real samples analysis with good recovery values. Compatible with most of oligonucleotide probes' designs and enzyme-based signal amplification strategies, the molecular beacon can serve as a novel signal translator to expand the application prospect of FA technology in various bioassays. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Biological chemistry as a foundation of DNA genealogy: the emergence of "molecular history".

    Science.gov (United States)

    Klyosov, A A

    2011-05-01

    foundation for "molecular history", in which the principal tool is high-technology analysis of DNA molecules of both our contemporaries and excavated ancient DNA samples, along with their biological kinetics.

  16. Molecular Characterization of Sudanese and Southern Sudanese Chicken Breeds Using mtDNA D-Loop

    Directory of Open Access Journals (Sweden)

    Charles E. Wani

    2014-01-01

    Full Text Available The objective of this study was to assess the genetic relationships and diversity and to estimate the amount of gene flow among the five chicken populations from Sudan and South Sudan and commercial strain of egg line White Leghorn chickens. The chicken populations were genotyped using mtDNA D-loop as a molecular marker. PCR product of the mtDNA D-loop segment was 600 bp and 14 haplotypes were identified. The neighbor-joining phylogenetic tree indicated that the indigenous Sudanese chickens can be grouped into two clades, IV and IIIa only. Median joining networks analysis showed that haplotype LBB49 has the highest frequency. The hierarchal analysis of molecular variance (AMOVA showed that genetic variation within the population was 88.6% and the differentiation among the population was 11.4%. When the populations was redefined into two geographical zones, rich and poor Savanna, the results were fractioned into three genetic variations: between individuals within population 95.5%, between populations within the group 0.75%, and genetic variation between groups 3.75%. The pair wise Fst showed high genetic difference between Betwil populations and the rest with Fst ranging from 0.1492 to 0.2447. We found that there is large number of gene exchanges within the Sudanese indigenous chicken (Nm=4.622.

  17. A Quick-responsive DNA Nanotechnology Device for Bio-molecular Homeostasis Regulation.

    Science.gov (United States)

    Wu, Songlin; Wang, Pei; Xiao, Chen; Li, Zheng; Yang, Bing; Fu, Jieyang; Chen, Jing; Wan, Neng; Ma, Cong; Li, Maoteng; Yang, Xiangliang; Zhan, Yi

    2016-08-10

    Physiological processes such as metabolism, cell apoptosis and immune responses, must be strictly regulated to maintain their homeostasis and achieve their normal physiological functions. The speed with which bio-molecular homeostatic regulation occurs directly determines the ability of an organism to adapt to conditional changes. To produce a quick-responsive regulatory system that can be easily utilized for various types of homeostasis, a device called nano-fingers that facilitates the regulation of physiological processes was constructed using DNA origami nanotechnology. This nano-fingers device functioned in linked open and closed phases using two types of DNA tweezers, which were covalently coupled with aptamers that captured specific molecules when the tweezer arms were sufficiently close. Via this specific interaction mechanism, certain physiological processes could be simultaneously regulated from two directions by capturing one biofactor and releasing the other to enhance the regulatory capacity of the device. To validate the universal application of this device, regulation of the homeostasis of the blood coagulant thrombin was attempted using the nano-fingers device. It was successfully demonstrated that this nano-fingers device achieved coagulation buffering upon the input of fuel DNA. This nano-device could also be utilized to regulate the homeostasis of other types of bio-molecules.

  18. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    Science.gov (United States)

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  19. Exploring the common molecular basis for the universal DNA mutation bias: Revival of Loewdin mutation model

    International Nuclear Information System (INIS)

    Fu, Liang-Yu; Wang, Guang-Zhong; Ma, Bin-Guang; Zhang, Hong-Yu

    2011-01-01

    Highlights: → There exists a universal G:C → A:T mutation bias in three domains of life. → This universal mutation bias has not been sufficiently explained. → A DNA mutation model proposed by Loewdin 40 years ago offers a common explanation. -- Abstract: Recently, numerous genome analyses revealed the existence of a universal G:C → A:T mutation bias in bacteria, fungi, plants and animals. To explore the molecular basis for this mutation bias, we examined the three well-known DNA mutation models, i.e., oxidative damage model, UV-radiation damage model and CpG hypermutation model. It was revealed that these models cannot provide a sufficient explanation to the universal mutation bias. Therefore, we resorted to a DNA mutation model proposed by Loewdin 40 years ago, which was based on inter-base double proton transfers (DPT). Since DPT is a fundamental and spontaneous chemical process and occurs much more frequently within GC pairs than AT pairs, Loewdin model offers a common explanation for the observed universal mutation bias and thus has broad biological implications.

  20. Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum.

    Science.gov (United States)

    Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa

    2017-01-01

    Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

  1. Molecular Characterization and Analysis of 16S Ribosomal DNA in some Isolates of Demodex folliculorum

    Directory of Open Access Journals (Sweden)

    Afrooz DANESHPARVAR

    2017-06-01

    Full Text Available Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct transmitted through close contact with an infested host.Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, obtained from four patients and identified morphologically through clearing with 10% Potassium hydroxide (KOH and microscopical examination. Amplified fragments from the isolates were compared with GenBank database and phylogenetic analysis was carried out using MEGA6 software.Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

  2. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Science.gov (United States)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  3. Rational design of DNA sequences for nanotechnology, microarrays and molecular computers using Eulerian graphs.

    Science.gov (United States)

    Pancoska, Petr; Moravek, Zdenek; Moll, Ute M

    2004-01-01

    Nucleic acids are molecules of choice for both established and emerging nanoscale technologies. These technologies benefit from large functional densities of 'DNA processing elements' that can be readily manufactured. To achieve the desired functionality, polynucleotide sequences are currently designed by a process that involves tedious and laborious filtering of potential candidates against a series of requirements and parameters. Here, we present a complete novel methodology for the rapid rational design of large sets of DNA sequences. This method allows for the direct implementation of very complex and detailed requirements for the generated sequences, thus avoiding 'brute force' filtering. At the same time, these sequences have narrow distributions of melting temperatures. The molecular part of the design process can be done without computer assistance, using an efficient 'human engineering' approach by drawing a single blueprint graph that represents all generated sequences. Moreover, the method eliminates the necessity for extensive thermodynamic calculations. Melting temperature can be calculated only once (or not at all). In addition, the isostability of the sequences is independent of the selection of a particular set of thermodynamic parameters. Applications are presented for DNA sequence designs for microarrays, universal microarray zip sequences and electron transfer experiments.

  4. Susceptibility to DNA damage as a molecular mechanism for non-syndromic cleft lip and palate.

    Directory of Open Access Journals (Sweden)

    Gerson Shigeru Kobayashi

    Full Text Available Non-syndromic cleft lip/palate (NSCL/P is a complex, frequent congenital malformation, determined by the interplay between genetic and environmental factors during embryonic development. Previous findings have appointed an aetiological overlap between NSCL/P and cancer, and alterations in similar biological pathways may underpin both conditions. Here, using a combination of transcriptomic profiling and functional approaches, we report that NSCL/P dental pulp stem cells exhibit dysregulation of a co-expressed gene network mainly associated with DNA double-strand break repair and cell cycle control (p = 2.88×10(-2-5.02×10(-9. This network included important genes for these cellular processes, such as BRCA1, RAD51, and MSH2, which are predicted to be regulated by transcription factor E2F1. Functional assays support these findings, revealing that NSCL/P cells accumulate DNA double-strand breaks upon exposure to H2O2. Furthermore, we show that E2f1, Brca1 and Rad51 are co-expressed in the developing embryonic orofacial primordia, and may act as a molecular hub playing a role in lip and palate morphogenesis. In conclusion, we show for the first time that cellular defences against DNA damage may take part in determining the susceptibility to NSCL/P. These results are in accordance with the hypothesis of aetiological overlap between this malformation and cancer, and suggest a new pathogenic mechanism for the disease.

  5. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    Science.gov (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  6. Molecular modeling of cationic porphyrin-anthraquinone hybrids as DNA topoisomerase IIβ inhibitors.

    Science.gov (United States)

    Arba, Muhammad; Ruslin; Ihsan, Sunandar; Tri Wahyudi, Setyanto; Tjahjono, Daryono H

    2017-12-01

    Human DNA Topoisomerase II has been regarded as a promising target in anticancer drug discovery. In the present study, we designed six porphyrin-anthraquinone hybrids bearing pyrazole or pyridine group as meso substituents and evaluated their potentials as DNA Topoisomerase IIβ inhibitor. First, we investigated the binding orientation of porphyrin hybrids into DNA topoisomerase IIβ employing AutoDock 4.2 and then performed 20-ns molecular dynamics simulations to see the dynamic stability of each porphyrin-Topo IIβ complex using Amber 14. We found that the binding of porphyrin hybrids occured through intercalation and groove binding mode in addition interaction with the amino acid residues constituting the active cavity of Topo IIβ. Each porphyrin-Topo IIβ complex was stabilized during 20-ns dynamics simulations. The MM-PBSA free energy calculation shows that the binding affinities of porphyrin hybrids were modified with the number of meso substituent. Interestingly, the affinity of all porphyrin hybrids to Topo IIβ was stronger than that of native ligand (EVP), indicating the potential of the designed porphyrin to be considered in experimental research. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Binding of Bisphenol-F, a bisphenol analogue, to calf thymus DNA by multi-spectroscopic and molecular docking studies.

    Science.gov (United States)

    Usman, Afia; Ahmad, Masood

    2017-08-01

    BPF (Bisphenol-F), a member of the bisphenol family, having a wide range of industrial applications is gradually replacing Bisphenol-A. It is a recognized endocrine disrupting chemical (EDC). EDCs have been implicated in increased incidences of breast, prostate and testis cancers besides diabetes, obesity and decreased fertility. Due to the adverse effects of EDCs on human health, attempts have been directed towards their mechanism of toxicity especially at the molecular level. Hence, to understand the mechanism at the DNA level, interaction of BPF with calf thymus DNA was studied employing multi-spectroscopic, voltammetric and molecular docking techniques. Fluorescence spectra, cyclic voltammetry (CV), circular dichroism (CD) and molecular docking studies of BPF with DNA were suggestive of minor groove binding of BPF. UV-visible absorption and fluorescence spectra suggested static quenching due to complex formation between BPF and ctDNA. Hoechst 33258 (HO) and ethidium bromide (EB) displacement studies further confirmed such mode of BPF interaction. Thermodynamic and molecular docking parameters revealed the mechanism of binding of BPF with ctDNA to be favorable and spontaneous due to negative ΔG and occurring through hydrogen bonds and van der waals interactions. BPF induced DNA cleavage under in vitro conditions by plasmid nicking assay suggested it to be genotoxic. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Comprehensive profiling of DNA methylation in colorectal cancer reveals subgroups with distinct clinicopathological and molecular features

    International Nuclear Information System (INIS)

    Ang, Pei Woon; Soong, Richie; Loh, Marie; Liem, Natalia; Lim, Pei Li; Grieu, Fabienne; Vaithilingam, Aparna; Platell, Cameron; Yong, Wei Peng; Iacopetta, Barry

    2010-01-01

    Most previous studies of the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC) have been conducted on a relatively small numbers of CpG sites. In the present study we performed comprehensive DNA methylation profiling of CRC with the aim of characterizing CIMP subgroups. DNA methylation at 1,505 CpG sites in 807 cancer-related genes was evaluated using the Illumina GoldenGate ® methylation array in 28 normal colonic mucosa and 91 consecutive CRC samples. Methylation data was analyzed using unsupervised hierarchical clustering. CIMP subgroups were compared for various clinicopathological and molecular features including patient age, tumor site, microsatellite instability (MSI), methylation at a consensus panel of CpG islands and mutations in BRAF and KRAS. A total of 202 CpG sites were differentially methylated between tumor and normal tissue. Unsupervised hierarchical clustering of methylation data from these sites revealed the existence of three CRC subgroups referred to as CIMP-low (CIMP-L, 21% of cases), CIMP-mid (CIMP-M, 14%) and CIMP-high (CIMP-H, 65%). In comparison to CIMP-L tumors, CIMP-H tumors were more often located in the proximal colon and showed more frequent mutation of KRAS and BRAF (P < 0.001). Comprehensive DNA methylation profiling identified three CRC subgroups with distinctive clinicopathological and molecular features. This study suggests that both KRAS and BRAF mutations are involved with the CIMP-H pathway of CRC rather than with distinct CIMP subgroups

  9. Comprehensive profiling of DNA methylation in colorectal cancer reveals subgroups with distinct clinicopathological and molecular features

    Directory of Open Access Journals (Sweden)

    Vaithilingam Aparna

    2010-05-01

    Full Text Available Abstract Background Most previous studies of the CpG island methylator phenotype (CIMP in colorectal cancer (CRC have been conducted on a relatively small numbers of CpG sites. In the present study we performed comprehensive DNA methylation profiling of CRC with the aim of characterizing CIMP subgroups. Methods DNA methylation at 1,505 CpG sites in 807 cancer-related genes was evaluated using the Illumina GoldenGate® methylation array in 28 normal colonic mucosa and 91 consecutive CRC samples. Methylation data was analyzed using unsupervised hierarchical clustering. CIMP subgroups were compared for various clinicopathological and molecular features including patient age, tumor site, microsatellite instability (MSI, methylation at a consensus panel of CpG islands and mutations in BRAF and KRAS. Results A total of 202 CpG sites were differentially methylated between tumor and normal tissue. Unsupervised hierarchical clustering of methylation data from these sites revealed the existence of three CRC subgroups referred to as CIMP-low (CIMP-L, 21% of cases, CIMP-mid (CIMP-M, 14% and CIMP-high (CIMP-H, 65%. In comparison to CIMP-L tumors, CIMP-H tumors were more often located in the proximal colon and showed more frequent mutation of KRAS and BRAF (P Conclusions Comprehensive DNA methylation profiling identified three CRC subgroups with distinctive clinicopathological and molecular features. This study suggests that both KRAS and BRAF mutations are involved with the CIMP-H pathway of CRC rather than with distinct CIMP subgroups.

  10. Genomic and Molecular Landscape of DNA Damage Repair Deficiency across The Cancer Genome Atlas

    Directory of Open Access Journals (Sweden)

    Theo A. Knijnenburg

    2018-04-01

    Full Text Available Summary: DNA damage repair (DDR pathways modulate cancer risk, progression, and therapeutic response. We systematically analyzed somatic alterations to provide a comprehensive view of DDR deficiency across 33 cancer types. Mutations with accompanying loss of heterozygosity were observed in over 1/3 of DDR genes, including TP53 and BRCA1/2. Other prevalent alterations included epigenetic silencing of the direct repair genes EXO5, MGMT, and ALKBH3 in ∼20% of samples. Homologous recombination deficiency (HRD was present at varying frequency in many cancer types, most notably ovarian cancer. However, in contrast to ovarian cancer, HRD was associated with worse outcomes in several other cancers. Protein structure-based analyses allowed us to predict functional consequences of rare, recurrent DDR mutations. A new machine-learning-based classifier developed from gene expression data allowed us to identify alterations that phenocopy deleterious TP53 mutations. These frequent DDR gene alterations in many human cancers have functional consequences that may determine cancer progression and guide therapy. : Knijnenburg et al. present The Cancer Genome Atlas (TCGA Pan-Cancer analysis of DNA damage repair (DDR deficiency in cancer. They use integrative genomic and molecular analyses to identify frequent DDR alterations across 33 cancer types, correlate gene- and pathway-level alterations with genome-wide measures of genome instability and impaired function, and demonstrate the prognostic utility of DDR deficiency scores. Keywords: The Cancer Genome Atlas PanCanAtlas project, DNA damage repair, somatic mutations, somatic copy-number alterations, epigenetic silencing, DNA damage footprints, mutational signatures, integrative statistical analysis, protein structure analysis

  11. Molecular cloning and characterization of an acetylcholinesterase cDNA in the brown planthopper, Nilaparvata lugens.

    Science.gov (United States)

    Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

    2010-01-01

    A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.

  12. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  13. Optimization of ISSR Markers for Molecular DNA Fingerprinting in Aquilaria sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hanif Azhari; Siti Norhayati Ismail; Parween, K.S.A.S.

    2013-01-01

    Aquilaria sp. belongs to the Thymelaeaceae family and well distributed to Asia region. The species is a multipurpose use from root to shoot and becoming an economic important crop, which generates wide interest in understanding the genetic diversity of the species. Understanding of the effectiveness in differentiating DNA-based markers is an important step towards plant germplasm characterization and evaluation. It is becoming a prerequisite for more effective application of molecular marker techniques in breeding and mapping programs. Polymerase Chain Reaction (PCR)-based approaches are in demanding as its simplicity and requirement for only small quantities of sample genomic DNA. Inter-simple sequence repeats (ISRR) requires no prior genomic information as anchor template in producing multi-loci markers of tandem repeats for polymorphic patterns by PCR amplification which becoming a key of advantageous of ISSR primers. ISSR markers have shown rapid, simple, reproducible and inexpensive means in molecular taxonomy, conservation breeding and genetic diversity analysis. The ISSR for marker applications are essential to facilitate management, conservation and genetic improvement programs towards improvement of standard resin quality for perfume and or pharmaceutical industries. In this paper, a total of 100 ISSR primers were optimized by using Aquilaria malaccensis. Primers optimization resulted, 38 ISSR primers affirmative for the polymorphism evaluation study, which encountered both from specific and degenerate ISSR primers. Marker derived from ISSR profiling is a powerful method for identification and molecular classification of Aquilaria sp from species to accessions and further will useful in identifying any mutant lines derived from nature and/or mutagenesis activities. (author)

  14. Molecular characterisation of Colombian yam germplasm by "DNA amplification fingerprinting (DAF" in radioactivo conditions

    Directory of Open Access Journals (Sweden)

    Silvia L. Bustamante

    2003-07-01

    Full Text Available Samples from the Universidad de Córdoba's yam collection (Dioscorea spp. and others originating from IITA (International Institute of Tropical Agriculture, Ibadan, Nigeria were molecularly characterised to complement existing information about them. The yam (Diosocorea spp. represents a basic crop for small-scale farmers on the Colombian Atlantic Coast who sow around 20,000 hectares per year. Even though they are dioecious species, only one sex is represented in Colombia; it must also be stated that climatic conditions are not propitious for its flowering. This situation has caused difficulty for work in yam breeding. The yam species and varieties used in the Colombian ABP (Agricultural Biotechnology Programme have been molecularly characterised by AFLPs in a previous publication describing a preliminary study emerging from the need to broaden the characterisation of those accessions kept at the Universidad de Córdoba. Comparisons have also been done with some African accessions donated by IITA. In this article, samples were molecularly characterised by another fingerprinting technique, the DAF technique (DNA Amplification Fingerprinting based on PCR, using random oligonucleotides for generating characteristic band patterns from each individual. The results showed 0.0413 population diversity with 0.9587 average similarity, indicating that the yam collection studied had very little genetic diversity and, probably, this could be why the crop is vulnerable to plagues and diseases, as happened at the end of the 1980s when anthracnose practically devastated the crop on the Colombian Atlantic coast. Similarity was also found between those Colombian and African samples analysed, agreeing with low diversity and less distance between common ancestors. The molecular results suggest the need for using other molecular techniques having a greater power of discrimination and also the need to broaden the genetic diversity in yam crops for providing greater

  15. New insights into Trypanosoma cruzi evolution, genotyping and molecular diagnostics from satellite DNA sequence analysis.

    Directory of Open Access Journals (Sweden)

    Juan C Ramírez

    2017-12-01

    Full Text Available Trypanosoma cruzi has been subdivided into seven Discrete Typing Units (DTUs, TcI-TcVI and Tcbat. Two major evolutionary models have been proposed to explain the origin of hybrid lineages, but while it is widely accepted that TcV and TcVI are the result of genetic exchange between TcII and TcIII strains, the origin of TcIII and TcIV is still a matter of debate. T. cruzi satellite DNA (SatDNA, comprised of 195 bp units organized in tandem repeats, from both TcV and TcVI stocks were found to have SatDNA copies type TcI and TcII; whereas contradictory results were observed for TcIII stocks and no TcIV sequence has been analyzed yet. Herein, we have gone deeper into this matter analyzing 335 distinct SatDNA sequences from 19 T. cruzi stocks representative of DTUs TcI-TcVI for phylogenetic inference. Bayesian phylogenetic tree showed that all sequences were grouped in three major clusters, which corresponded to sequences from DTUs TcI/III, TcII and TcIV; whereas TcV and TcVI stocks had two sets of sequences distributed into TcI/III and TcII clusters. As expected, the lowest genetic distances were found between TcI and TcIII, and between TcV and TcVI sequences; whereas the highest ones were observed between TcII and TcI/III, and among TcIV sequences and those from the remaining DTUs. In addition, signature patterns associated to specific T. cruzi lineages were identified and new primers that improved SatDNA-based qPCR sensitivity were designed. Our findings support the theory that TcIII is not the result of a hybridization event between TcI and TcII, and that TcIV had an independent origin from the other DTUs, contributing to clarifying the evolutionary history of T. cruzi lineages. Moreover, this work opens the possibility of typing samples from Chagas disease patients with low parasitic loads and improving molecular diagnostic methods of T. cruzi infection based on SatDNA sequence amplification.

  16. New insights into Trypanosoma cruzi evolution, genotyping and molecular diagnostics from satellite DNA sequence analysis.

    Science.gov (United States)

    Ramírez, Juan C; Torres, Carolina; Curto, María de Los A; Schijman, Alejandro G

    2017-12-01

    Trypanosoma cruzi has been subdivided into seven Discrete Typing Units (DTUs), TcI-TcVI and Tcbat. Two major evolutionary models have been proposed to explain the origin of hybrid lineages, but while it is widely accepted that TcV and TcVI are the result of genetic exchange between TcII and TcIII strains, the origin of TcIII and TcIV is still a matter of debate. T. cruzi satellite DNA (SatDNA), comprised of 195 bp units organized in tandem repeats, from both TcV and TcVI stocks were found to have SatDNA copies type TcI and TcII; whereas contradictory results were observed for TcIII stocks and no TcIV sequence has been analyzed yet. Herein, we have gone deeper into this matter analyzing 335 distinct SatDNA sequences from 19 T. cruzi stocks representative of DTUs TcI-TcVI for phylogenetic inference. Bayesian phylogenetic tree showed that all sequences were grouped in three major clusters, which corresponded to sequences from DTUs TcI/III, TcII and TcIV; whereas TcV and TcVI stocks had two sets of sequences distributed into TcI/III and TcII clusters. As expected, the lowest genetic distances were found between TcI and TcIII, and between TcV and TcVI sequences; whereas the highest ones were observed between TcII and TcI/III, and among TcIV sequences and those from the remaining DTUs. In addition, signature patterns associated to specific T. cruzi lineages were identified and new primers that improved SatDNA-based qPCR sensitivity were designed. Our findings support the theory that TcIII is not the result of a hybridization event between TcI and TcII, and that TcIV had an independent origin from the other DTUs, contributing to clarifying the evolutionary history of T. cruzi lineages. Moreover, this work opens the possibility of typing samples from Chagas disease patients with low parasitic loads and improving molecular diagnostic methods of T. cruzi infection based on SatDNA sequence amplification.

  17. Molecular recognition of AT-DNA sequences by the induced CD pattern of dibenzotetraaza[14]annulene (DBTAA)-adenine derivatives.

    Science.gov (United States)

    Stojković, Marijana Radić; Skugor, Marko; Dudek, Lukasz; Grolik, Jarosław; Eilmes, Julita; Piantanida, Ivo

    2014-01-01

    An investigation of the interactions of two novel and several known DBTAA-adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA-propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure-activity relation for the studied series of compounds showed that the essential structural features for the ICD recognition are a) the presence of DNA-binding appendages (adenine side chain and positively charged side chain) on both DBTAA side chains, and b) the presence of a short propyl linker, which does not support intramolecular aromatic stacking between DBTAA and adenine. The observed AT-DNA-ICD pattern differs from previously reported ss-DNA (poly dT) ICD recognition by a strong negative ICD band at 350 nm, which allows for the dynamic differentiation between ss-DNA (poly dT) and coupled ds-AT-DNA.

  18. GEOGRAPHIC DISTRIBUTION OF MOLECULAR VARIANCE WITHIN THE BLUE MARLIN (MAKAIRA NIGRICANS): A HIERARCHICAL ANALYSIS OF ALLOZYME, SINGLE-COPY NUCLEAR DNA, AND MITOCHONDRIAL DNA MARKERS.

    Science.gov (United States)

    Buonaccorsi, Vincent P; Reece, Kimberly S; Morgan, Lee W; Graves, John E

    1999-04-01

    This study presents a comparative hierarchical analysis of variance applied to three classes of molecular markers within the blue marlin (Makaira nigricans). Results are reported from analyses of four polymorphic allozyme loci, four polymorphic anonymously chosen single-copy nuclear DNA (scnDNA) loci, and previously reported restriction fragment length polymorphisms (RFLPs) of mitochondrial DNA (mtDNA). Samples were collected within and among the Atlantic and Pacific Oceans over a period of several years. Although moderate levels of genetic variation were detected at both polymorphic allozyme (H = 0.30) and scnDNA loci (H = 0.37), mtDNA markers were much more diverse (h = 0.85). Allele frequencies were significantly different between Atlantic and Pacific Ocean samples at three of four allozyme loci and three of four scnDNA loci. Estimates of allozyme genetic differentiation (θ O ) ranged from 0.00 to 0.15, with a mean of 0.08. The θ O values for scnDNA loci were similar to those of allozymes, ranging from 0.00 to 0.12 with a mean of 0.09. MtDNA RFLP divergence between oceans (θ O = 0.39) was significantly greater than divergence detected at nuclear loci (95% nuclear confidence interval = 0.04-0.11). The fourfold smaller effective population size of mtDNA and male-mediated gene flow may account for the difference observed between nuclear and mitochondrial divergence estimates. © 1999 The Society for the Study of Evolution.

  19. Investigations on the interactions of diclofenac sodium with HSA and ctDNA using molecular modeling and multispectroscopic methods

    Science.gov (United States)

    Cui, Yanrui; Hao, Erjun; Hui, Guangquan; Guo, Wei; Cui, Fengling

    2013-06-01

    A tentative study on interaction of diclofenac sodium (DF-Na) with human serum albumin (HSA) and calf thymus DNA (ctDNA) was conducted by using multi-spectroscopic and molecular modeling techniques under simulative physiological conditions. The results of spectroscopic measurements suggested that the quenching mechanisms were static quenching. Three-dimensional fluorescence spectroscopy clearly demonstrated the occurrence of conformational changes of HSA with addition of DF-Na. In addition, competitive studies with ethidium bromide (EB) have shown that DF-Na can bind to ctDNA relatively strong via groove binding. Based on the values of thermodynamic parameters and the results of molecular modeling, it was confirmed that hydrophobic forces and hydrogen bond were the mainly binding forces in DF-Na-HSA and DF-Na-DNA systems. The binding distance between DF-Na and HSA was also determined using the theory of the Förster energy transference.

  20. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)

    1999-02-01

    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  1. Multi-spectroscopic and molecular docking studies on the interaction of darunavir, a HIV protease inhibitor with calf thymus DNA.

    Science.gov (United States)

    Shi, Jie-Hua; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi

    2018-03-15

    Molecular interaction of darunavir (DRV), a HIV protease inhibitor with calf thymus deoxyribonucleic acid (ct-DNA) was studied in physiological buffer (pH7.4) by multi-spectroscopic approaches hand in hand with viscosity measurements and molecular docking technique. The UV absorption and fluorescence results together revealed the formation of a DRV-ct-DNA complex having binding affinities of the order of 10 3 M -1 , which was more in keeping with the groove binding. The results that DRV bound to ct-DNA via groove binding mode was further evidenced by KI quenching studies, viscosity measurements, competitive binding investigations with EB and Rhodamine B and CD spectral analysis. The effect of ionic strength indicated the negligible involvement of electrostatic interaction between DRV and ct-DNA. The thermodynamic parameters regarding the binding interaction of DRV with ct-DNA in terms of enthalpy change (ΔH 0 ) and entropy change (ΔS 0 ) were -63.19kJ mol -1 and -141.92J mol -1 K -1 , indicating that hydrogen bonds and van der Waals forces played a predominant role in the binding process. Furthermore, molecular simulation studies suggested that DRV molecule was prone to bind in the A-T rich region of the minor groove of DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Using rapid diagnostic tests as source of malaria parasite DNA for molecular analyses in the era of declining malaria prevalence

    DEFF Research Database (Denmark)

    Ishengoma, Deus S; Lwitiho, Sudi; Madebe, Rashid A

    2011-01-01

    was conducted to examine if sufficient DNA could be successfully extracted from malaria rapid diagnostic tests (RDTs), used and collected as part of routine case management services in health facilities, and thus forming the basis for molecular analyses, surveillance and quality control (QC) testing of RDTs....... continued molecular surveillance of malaria parasites is important to early identify emerging anti-malarial drug resistance, it is becoming increasingly difficult to obtain parasite samples from ongoing studies, such as routine drug efficacy trials. To explore other sources of parasite DNA, this study...

  3. Uncovering the molecular organization of unusual highly scattered 5S rDNA: The case of Chariesterus armatus (Heteroptera).

    Science.gov (United States)

    Bardella, Vanessa Bellini; Cabral-de-Mello, Diogo Cavalcanti

    2018-03-10

    One cluster of 5S rDNA per haploid genome is the most common pattern among Heteroptera. However, in Chariesterus armatus, highly scattered signals were noticed. We isolated and characterized the entire 5S rDNA unit of C. armatus aiming to a deeper knowledge of molecular organization of the 5S rDNA among Heteroptera and to understand possible causes and consequences of 5S rDNA chromosomal spreading. For a comparative analysis, we performed the same approach in Holymenia histrio with 5S rDNA restricted to one bivalent. Multiple 5S rDNA variants were observed in both species, though they were more variable in C. armatus, with some of variants corresponding to pseudogenes. These pseudogenes suggest birth-and-death mechanism, though homogenization was also observed (concerted evolution), indicating evolution through mixed model. Association between transposable elements and 5S rDNA was not observed, suggesting spreading of 5S rDNA through other mechanisms, like ectopic recombination. Scattered organization is a rare example for 5S rDNA, and such organization in C. armatus genome could have led to the high diversification of sequences favoring their pseudogenization. Copyright © 2017. Published by Elsevier B.V.

  4. Decondensation behavior of DNA chains induced by multivalent cations at high salt concentrations: Molecular dynamics simulations and experiments

    International Nuclear Information System (INIS)

    Jiang Yang-Wei; Zhang Lin-Xi; Ran Shi-Yong; He Lin-Li; Wang Xiang-Hong

    2015-01-01

    Using molecular dynamics simulations and atomic force microscopy (AFM), we study the decondensation process of DNA chains induced by multivalent cations at high salt concentrations in the presence of short cationic chains in solutions. The typical simulation conformations of DNA chains with varying salt concentrations for multivalent cations imply that the concentration of salt cations and the valence of multivalent cations have a strong influence on the process of DNA decondensation. The DNA chains are condensed in the absence of salt or at low salt concentrations, and the compacted conformations of DNA chains become loose when a number of cations and anions are added into the solution. It is explicitly demonstrated that cations can overcompensate the bare charge of the DNA chains and weaken the attraction interactions between the DNA chains and short cationic chains at high salt concentrations. The condensation-decondensation transitions of DNA are also experimentally observed in mixing spermidine with λ-phage DNA at different concentrations of NaCl/MgCl 2 solutions. (paper)

  5. Molecular Genetic Characterization of Mutagenesis Using a Highly Sensitive Single-Stranded DNA Reporter System in Budding Yeast.

    Science.gov (United States)

    Chan, Kin

    2018-01-01

    Mutations are permanent alterations to the coding content of DNA. They are starting material for the Darwinian evolution of species by natural selection, which has yielded an amazing diversity of life on Earth. Mutations can also be the fundamental basis of serious human maladies, most notably cancers. In this chapter, I describe a highly sensitive reporter system for the molecular genetic analysis of mutagenesis, featuring controlled generation of long stretches of single-stranded DNA in budding yeast cells. This system is ~100- to ~1000-fold more susceptible to mutation than conventional double-stranded DNA reporters, and is well suited for generating large mutational datasets to investigate the properties of mutagens.

  6. Development and Molecular Characterization of Novel Polymorphic Genomic DNA SSR Markers in Lentinula edodes.

    Science.gov (United States)

    Moon, Suyun; Lee, Hwa-Yong; Shim, Donghwan; Kim, Myungkil; Ka, Kang-Hyeon; Ryoo, Rhim; Ko, Han-Gyu; Koo, Chang-Duck; Chung, Jong-Wook; Ryu, Hojin

    2017-06-01

    Sixteen genomic DNA simple sequence repeat (SSR) markers of Lentinula edodes were developed from 205 SSR motifs present in 46.1-Mb long L. edodes genome sequences. The number of alleles ranged from 3-14 and the major allele frequency was distributed from 0.17-0.96. The values of observed and expected heterozygosity ranged from 0.00-0.76 and 0.07-0.90, respectively. The polymorphic information content value ranged from 0.07-0.89. A dendrogram, based on 16 SSR markers clustered by the paired hierarchical clustering' method, showed that 33 shiitake cultivars could be divided into three major groups and successfully identified. These SSR markers will contribute to the efficient breeding of this species by providing diversity in shiitake varieties. Furthermore, the genomic information covered by the markers can provide a valuable resource for genetic linkage map construction, molecular mapping, and marker-assisted selection in the shiitake mushroom.

  7. Deciphering the BAR code of membrane modulators.

    Science.gov (United States)

    Salzer, Ulrich; Kostan, Julius; Djinović-Carugo, Kristina

    2017-07-01

    The BAR domain is the eponymous domain of the "BAR-domain protein superfamily", a large and diverse set of mostly multi-domain proteins that play eminent roles at the membrane cytoskeleton interface. BAR domain homodimers are the functional units that peripherally associate with lipid membranes and are involved in membrane sculpting activities. Differences in their intrinsic curvatures and lipid-binding properties account for a large variety in membrane modulating properties. Membrane activities of BAR domains are further modified and regulated by intramolecular or inter-subunit domains, by intermolecular protein interactions, and by posttranslational modifications. Rather than providing detailed cell biological information on single members of this superfamily, this review focuses on biochemical, biophysical, and structural aspects and on recent findings that paradigmatically promote our understanding of processes driven and modulated by BAR domains.

  8. Detection of Variation in Long-Term Micropropagated Mature Pistachio via DNA-Based Molecular Markers.

    Science.gov (United States)

    Akdemir, Hülya; Suzerer, Veysel; Tilkat, Engin; Onay, Ahmet; Çiftçi, Yelda Ozden

    2016-12-01

    Determination of genetic stability of in vitro-grown plantlets is needed for safe and large-scale production of mature trees. In this study, genetic variation of long-term micropropagated mature pistachio developed through direct shoot bud regeneration using apical buds (protocol A) and in vitro-derived leaves (protocol B) was assessed via DNA-based molecular markers. Randomly amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR), and amplified fragment length polymorphism (AFLP) were employed, and the obtained PIC values from RAPD (0.226), ISSR (0.220), and AFLP (0.241) showed that micropropagation of pistachio for different periods of time resulted in "reasonable polymorphism" among donor plant and its 18 clones. Mantel's test showed a consistence polymorphism level between marker systems based on similarity matrices. In conclusion, this is the first study on occurrence of genetic variability in long-term micropropagated mature pistachio plantlets. The obtained results clearly indicated that different marker approaches used in this study are reliable for assessing tissue culture-induced variations in long-term cultured pistachio plantlets.

  9. Molecular characterization of Anthurium genotypes by using DNA fingerprinting and SPAR markers.

    Science.gov (United States)

    Souza Neto, J D; Soares, T C B; Motta, L B; Cabral, P D S; Silva, J A

    2014-07-02

    We characterized single primer amplification reaction (SPAR) molecular markers from 20 genotypes of Anthurium andraeanum Lind., including 3 from commercial varieties and 17 from 2 communities in the State of Espírito Santo, Brazil. Twenty-four SPAR, consisting of 7 random amplified polymorphic DNA and 17 inter-simple sequence repeat markers were used to estimate the genetic diversity of 20 Anthurium accessions. The set of SPAR markers generated 288 bands and showed an average polymorphism percentage of 93.39%, ranging from 71.43 to 100%. The polymorphism information content (PIC) of the random amplified polymorphic DNA primers averaged 0.364 and ranged from 0.258 to 0.490. Primer OPF 06 showed the lowest PIC, while OPAM 14 was the highest. The average PIC of the inter-simple sequence repeat primers was 0.299, with values ranging from 0.196 to 0.401. Primer UBC 845 had the lowest PIC (0.196), while primer UCB 810 had the highest (0.401). By using the complement of Jaccard's similarity index and unweighted pair group method with arithmetic mean clustering, 5 clusters were formed with a cophenetic correlation coefficient of 0.8093, indicating an acceptable clustering consistency. However, no genotype clustering patterns agreed with the morphological data. The Anthurium genotypes investigated in this study are a germplasm source for conservational research and may be used in improvement programs for this species.

  10. Radiation and non-radiation damage to DNA. Onset of molecular instability and carcinogenesis. Theoretical explorations on DNA damage and repair

    International Nuclear Information System (INIS)

    Pinak, Miroslay; Bunta, J.K.

    2006-01-01

    The current work is focused on results of molecular dynamics simulations performed on two DNA damages: 8-oxoguanine as the most significant oxidative damage leading to transversion mutation cytosine-guanine→adenine-thymine', which is common mutation found in human cancer cells; and on the DNA strand break, the type of damage that is considered to be one of the most significant damage leading to genetic instability that may result in enhanced cell proliferation or carcinogenesis. Except the structural changes induced by these two lesions the role and importance of electrostatic energy in recognition process in which a respective repair enzyme recognizes damaged DNA site is also described. Among the significant results can be included the fact, that most of the damages on DNA alternate locally electronic state by modifying chemical and electron orbital configuration. This modified configuration may be represented outside DNA molecule as an enhanced electrostatic interaction with surrounding environment, that may signal the presence of the damaged site toward the repair enzyme. Work on the DNA strand break shows that open valences at broken strand ends are quickly filled by the electrons generated during radiolysis. Results of simulation indicate a local instability of hydrogen bonds between complementary bases. (author)

  11. Preanalytical blood sample workup for cell-free DNA analysis using Droplet Digital PCR for future molecular cancer diagnostics.

    Science.gov (United States)

    van Ginkel, Joost H; van den Broek, Daan A; van Kuik, Joyce; Linders, Dorothé; de Weger, Roel; Willems, Stefan M; Huibers, Manon M H

    2017-10-01

    In current molecular cancer diagnostics, using blood samples of cancer patients for the detection of genetic alterations in plasma (cell-free) circulating tumor DNA (ctDNA) is an emerging practice. Since ctDNA levels in blood are low, highly sensitive Droplet Digital PCR (ddPCR) can be used for detecting rare mutational targets. In order to perform ddPCR on blood samples, a standardized procedure for processing and analyzing blood samples is necessary to facilitate implementation into clinical practice. Therefore, we assessed the technical sample workup procedure for ddPCR on blood plasma samples. Blood samples from healthy individuals, as well as lung cancer patients were analyzed. We compared different methods and protocols for sample collection, storage, centrifugation, isolation, and quantification. Cell-free DNA (cfDNA) concentrations of several wild-type targets and BRAF and EGFR-mutant ctDNA concentrations quantified by ddPCR were primary outcome measurements. Highest cfDNA concentrations were measured in blood collected in serum tubes. No significant differences in cfDNA concentrations were detected between various time points of up to 24 h until centrifugation. Highest cfDNA concentrations were detected after DNA isolation with the Quick cfDNA Serum & Plasma Kit, while plasma isolation using the QIAamp Circulating Nucleic Acid Kit yielded the most consistent results. DdPCR results on cfDNA are highly dependent on multiple factors during preanalytical sample workup, which need to be addressed during the development of this diagnostic tool for cancer diagnostics in the future. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  12. DNA barcoding and molecular systematics of the benthic and demersal organisms of the CEAMARC survey

    Science.gov (United States)

    Dettai, Agnes; Adamowizc, Sarah J.; Allcock, Louise; Arango, Claudia P.; Barnes, David K. A.; Barratt, Iain; Chenuil, Anne; Couloux, Arnaud; Cruaud, Corinne; David, Bruno; Denis, Françoise; Denys, Gael; Díaz, Angie; Eléaume, Marc; Féral, Jean-Pierre; Froger, Aurélie; Gallut, Cyril; Grant, Rachel; Griffiths, Huw J.; Held, Christoph; Hemery, Lenaïg G.; Hosie, Graham; Kuklinski, Piotr; Lecointre, Guillaume; Linse, Katrin; Lozouet, Pierre; Mah, Christopher; Monniot, Françoise; Norman, Mark D.; O'Hara, Timothy; Ozouf-Costaz, Catherine; Piedallu, Claire; Pierrat, Benjamin; Poulin, Elie; Puillandre, Nicolas; Riddle, Martin; Samadi, Sarah; Saucède, Thomas; Schubart, Christoph; Smith, Peter J.; Stevens, Darren W.; Steinke, Dirk; Strugnell, Jan M.; Tarnowska, K.; Wadley, Victoria; Ameziane, Nadia

    2011-08-01

    The Dumont d’Urville Sea (East Antarctic region) has been less investigated for DNA barcoding and molecular taxonomy than other parts of the Southern Ocean, such as the Ross Sea and the Antarctic Peninsula. The Collaborative East Antarctic MARine Census (CEAMARC) took place in this area during the austral summer of 2007-2008. The Australian vessel RSV Aurora Australis collected very diverse samples of demersal and benthic organisms. The specimens were sorted centrally, and then distributed to taxonomic experts for molecular and morphological taxonomy and identification, especially barcoding. The COI sequences generated from CEAMARC material provide a sizeable proportion of the Census of Antarctic Marine Life barcodes although the studies are still ongoing, and represent the only source of sequences for a number of species. Barcoding appears to be a valuable method for identification within most groups, despite low divergences and haplotype sharing in a few species, and it is also useful as a preliminary taxonomic exploration method. Several new species are being described. CEAMARC samples have already provided new material for phylogeographic and phylogenetic studies in cephalopods, pycnogonids, teleost fish, crinoids and sea urchins, helping these studies to provide a better insight in the patterns of evolution in the Southern Ocean.

  13. Identifying molecular subtypes in human colon cancer using gene expression and DNA methylation microarray data.

    Science.gov (United States)

    Ren, Zhonglu; Wang, Wenhui; Li, Jinming

    2016-02-01

    Identifying colon cancer subtypes based on molecular signatures may allow for a more rational, patient-specific approach to therapy in the future. Classifications using gene expression data have been attempted before with little concordance between the different studies carried out. In this study we aimed to uncover subtypes of colon cancer that have distinct biological characteristics and identify a set of novel biomarkers which could best reflect the clinical and/or biological characteristics of each subtype. Clustering analysis and discriminant analysis were utilized to discover the subtypes in two different molecular levels on 153 colon cancer samples from The Cancer Genome Atlas (TCGA) Data Portal. At gene expression level, we identified two major subtypes, ECL1 (expression cluster 1) and ECL2 (expression cluster 2) and a list of signature genes. Due to the heterogeneity of colon cancer, the subtype ECL1 can be further subdivided into three nested subclasses, and HOTAIR were found upregulated in subclass 2. At DNA methylation level, we uncovered three major subtypes, MCL1 (methylation cluster 1), MCL2 (methylation cluster 2) and MCL3 (methylation cluster 3). We found only three subtypes of CpG island methylator phenotype (CIMP) in colon cancer instead of the four subtypes in the previous reports, and we found no sufficient evidence to subdivide MCL3 into two distinct subgroups.

  14. Viral-Cellular DNA Junctions as Molecular Markers for Assessing Intra-Tumor Heterogeneity in Cervical Cancer and for the Detection of Circulating Tumor DNA

    Directory of Open Access Journals (Sweden)

    Katrin Carow

    2017-09-01

    Full Text Available The development of cervical cancer is frequently accompanied by the integration of human papillomaviruses (HPV DNA into the host genome. Viral-cellular junction sequences, which arise in consequence, are highly tumor specific. By using these fragments as markers for tumor cell origin, we examined cervical cancer clonality in the context of intra-tumor heterogeneity. Moreover, we assessed the potential of these fragments as molecular tumor markers and analyzed their suitability for the detection of circulating tumor DNA in sera of cervical cancer patients. For intra-tumor heterogeneity analyses tumors of 8 patients with up to 5 integration sites per tumor were included. Tumor islands were micro-dissected from cryosections of several tissue blocks representing different regions of the tumor. Each micro-dissected tumor area served as template for a single junction-specific PCR. For the detection of circulating tumor-DNA (ctDNA junction-specific PCR-assays were applied to sera of 21 patients. Samples were collected preoperatively and during the course of disease. In 7 of 8 tumors the integration site(s were shown to be homogenously distributed throughout different tumor regions. Only one tumor displayed intra-tumor heterogeneity. In 5 of 21 analyzed preoperative serum samples we specifically detected junction fragments. Junction-based detection of ctDNA was significantly associated with reduced recurrence-free survival. Our study provides evidence that HPV-DNA integration is as an early step in cervical carcinogenesis. Clonality with respect to HPV integration opens new perspectives for the application of viral-cellular junction sites as molecular biomarkers in a clinical setting such as disease monitoring.

  15. Molecular phylogeny of Anopheles hyrcanus group (Diptera: Culicidae) based on mtDNA COI.

    Science.gov (United States)

    Fang, Yuan; Shi, Wen-Qi; Zhang, Yi

    2017-05-08

    The Anopheles hyrcanus group, which includes at least 25 species, is widely distributed in the Oriental and Palearctic regions. Some group members have been incriminated as vectors of malaria and other mosquito-borne diseases. It is difficult to identify Hyrcanus Group members by morphological features. Thus, molecular phylogeny has been proposed as an important complementary method to traditional morphological taxonomy. Based on the GenBank database and our original study data, we used 466 mitochondrial DNA COI sequences belonging to 18 species to reconstruct the molecular phylogeny of the Hyrcanus Group across its worldwide geographic range. The results are as follows. 1) The average conspecific K2P divergence was 0.008 (range 0.002-0.017), whereas sequence divergence between congroup species averaged 0.064 (range 0.026-0.108). 2) The topology of COI tree of the Hyrcanus Group was generally consistent with classical morphological taxonomy in terms of species classification, but disagreed in subgroup division. In the COI tree, the group was divided into at least three main clusters. The first cluster contained An. nimpe; the second was composed of the Nigerrimus Subgroup and An. argyropus; and the third cluster was comprised of the Lesteri Subgroup and other unassociated species. 3) Phylogenetic analysis of COI indicated that ancient hybridizations probably occurred among the three closely related species, An. sinensis, An. belenrae, and An. kleini. 4) The results supported An. paraliae as a probable synonym of An. lesteri, and it was possible that An. pseudopictus and An. hyrcanus were the same species, as evident from their extremely low interspecific genetic divergence (0.020 and 0.007, respectively) and their phylogenetic positions. In summary, we reconstructed the molecular phylogeny and analysed genetic divergence of the Hyrcanus Group using mitochondrial COI sequences. Our results suggest that in the future of malaria surveillance, we should not only pay

  16. Molecular dynamics of formation of TD lesioned DNA complexed with repair enzyme - onset of the enzymatic repair process

    Energy Technology Data Exchange (ETDEWEB)

    Pinak, Miroslav [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1999-12-01

    To describe the first step of the enzymatic repair process (formation of complex enzyme-DNA), in which the thymine dimer (TD) part is removed from DNA, the 500 picosecond (ps) molecular dynamics (MD) simulation of TD lesioned DNA and part of repair enzyme cell (inclusive of catalytic center - Arg-22, Glu-23, Arg-26 and Thr-2) was performed. TD is UV originated lesion in DNA and T4 Endonuclease V is TD specific repair enzyme. Both molecules were located in the same simulation cell and their relative movement was examined. During the simulation the research was focused on the role of electrostatic energy in formation of complex enzyme-DNA. It is found, that during the first 100 ps of MD, the part of enzyme approaches the DNA surface at the TD lesion, interacts extensively by electrostatic and van der Walls interactions with TD part of DNA and forms complex that lasts stabile for 500 ps of MD. In the beginning of MD, the positive electrostatic interaction energy between part of enzyme and TD ({approx} +10 kcal/mol) drives enzyme towards the DNA molecule. Water-mediated hydrogen bonds between enzyme and DNA help to keep complex stabile. As a reference, the MD simulation of the identical system with native DNA molecule (two native thymines (TT) instead of TD) was performed. In this system the negative electrostatic interaction energy between part of enzyme and TT ({approx} -11 kcal/mol), in contrary to the positive one in the system with TD, doesn't drive enzyme towards DNA and complex is not formed. (author)

  17. Molecular dynamics of formation of TD lesioned DNA complexed with repair enzyme - onset of the enzymatic repair process

    International Nuclear Information System (INIS)

    Pinak, Miroslav

    1999-12-01

    To describe the first step of the enzymatic repair process (formation of complex enzyme-DNA), in which the thymine dimer (TD) part is removed from DNA, the 500 picosecond (ps) molecular dynamics (MD) simulation of TD lesioned DNA and part of repair enzyme cell (inclusive of catalytic center - Arg-22, Glu-23, Arg-26 and Thr-2) was performed. TD is UV originated lesion in DNA and T4 Endonuclease V is TD specific repair enzyme. Both molecules were located in the same simulation cell and their relative movement was examined. During the simulation the research was focused on the role of electrostatic energy in formation of complex enzyme-DNA. It is found, that during the first 100 ps of MD, the part of enzyme approaches the DNA surface at the TD lesion, interacts extensively by electrostatic and van der Walls interactions with TD part of DNA and forms complex that lasts stabile for 500 ps of MD. In the beginning of MD, the positive electrostatic interaction energy between part of enzyme and TD (∼ +10 kcal/mol) drives enzyme towards the DNA molecule. Water-mediated hydrogen bonds between enzyme and DNA help to keep complex stabile. As a reference, the MD simulation of the identical system with native DNA molecule (two native thymines (TT) instead of TD) was performed. In this system the negative electrostatic interaction energy between part of enzyme and TT (∼ -11 kcal/mol), in contrary to the positive one in the system with TD, doesn't drive enzyme towards DNA and complex is not formed. (author)

  18. Molecular phylogenetic analysis of Enterobius vermicularis and development of an 18S ribosomal DNA-targeted diagnostic PCR.

    Science.gov (United States)

    Zelck, Ulrike E; Bialek, Ralf; Weiss, Michael

    2011-04-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed.

  19. Molecular Phylogenetic Analysis of Enterobius vermicularis and Development of an 18S Ribosomal DNA-Targeted Diagnostic PCR▿

    Science.gov (United States)

    Zelck, Ulrike E.; Bialek, Ralf; Weiß, Michael

    2011-01-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed. PMID:21248085

  20. Fluorescence- and capillary electrophoresis (CE)-based SSR DNA fingerprinting and a molecular identity database for the Louisiana sugarcane industry

    Science.gov (United States)

    A database of Louisiana sugarcane molecular identity has been constructed and is being updated annually using FAM or HEX or NED fluorescence- and capillary electrophoresis (CE)-based microsatellite (SSR) fingerprinting information. The fingerprints are PCR-amplified from leaf DNA samples of current ...

  1. DNA barcodes and molecular diagnostics to distinguish an introduced and native Laricobius (Coleoptera: Derodontidae) species in eastern North America

    Science.gov (United States)

    G.A. Davis; N.P. Havill; Z.N. Adelman; A. Caccone; L.T. Kok; S.M. Salom

    2011-01-01

    Molecular diagnostics based on DNA barcodes can be powerful identification tools in the absence of distinctive morphological characters for distinguishing between closely related species. A specific example is distinguishing the endemic species Laricobius rubidus from Laricobius nigrinus, a biological control agent of hemlock...

  2. Molecular couplings and energy exchange between DNA and water mapped by femtosecond infrared spectroscopy of backbone vibrations

    Directory of Open Access Journals (Sweden)

    Yingliang Liu

    2017-07-01

    Full Text Available Molecular couplings between DNA and water together with the accompanying processes of energy exchange are mapped via the ultrafast response of DNA backbone vibrations after OH stretch excitation of the water shell. Native salmon testes DNA is studied in femtosecond pump-probe experiments under conditions of full hydration and at a reduced hydration level with two water layers around the double helix. Independent of their local hydration patterns, all backbone vibrations in the frequency range from 940 to 1120 cm–1 display a quasi-instantaneous reshaping of the spectral envelopes of their fundamental absorption bands upon excitation of the water shell. The subsequent reshaping kinetics encompass a one-picosecond component, reflecting the formation of a hot ground state of the water shell, and a slower contribution on a time scale of tens of picoseconds. Such results are benchmarked by measurements with resonant excitation of the backbone modes, resulting in distinctly different absorption changes. We assign the fast changes of DNA absorption after OH stretch excitation to structural changes in the water shell which couple to DNA through the local electric fields. The second slower process is attributed to a flow of excess energy from the water shell into DNA, establishing a common heated ground state in the molecular ensemble. This interpretation is supported by theoretical calculations of the electric fields exerted by the water shell at different temperatures.

  3. A Molecular Dynamics-Quantum Mechanics Theoretical Study of DNA-Mediated Charge Transport in Hydrated Ionic Liquids.

    Science.gov (United States)

    Meng, Zhenyu; Kubar, Tomas; Mu, Yuguang; Shao, Fangwei

    2018-05-08

    Charge transport (CT) through biomolecules is of high significance in the research fields of biology, nanotechnology, and molecular devices. Inspired by our previous work that showed the binding of ionic liquid (IL) facilitated charge transport in duplex DNA, in silico simulation is a useful means to understand the microscopic mechanism of the facilitation phenomenon. Here molecular dynamics simulations (MD) of duplex DNA in water and hydrated ionic liquids were employed to explore the helical parameters. Principal component analysis was further applied to capture the subtle conformational changes of helical DNA upon different environmental impacts. Sequentially, CT rates were calculated by a QM/MM simulation of the flickering resonance model based upon MD trajectories. Herein, MD simulation illustrated that the binding of ionic liquids can restrain dynamic conformation and lower the on-site energy of the DNA base. Confined movement among the adjacent base pairs was highly related to the increase of electronic coupling among base pairs, which may lead DNA to a CT facilitated state. Sequentially combining MD and QM/MM analysis, the rational correlations among the binding modes, the conformational changes, and CT rates illustrated the facilitation effects from hydrated IL on DNA CT and supported a conformational-gating mechanism.

  4. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

    Directory of Open Access Journals (Sweden)

    Raupach Michael J

    2010-09-01

    Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  5. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae) using nuclear rDNA expansion segments and DNA barcodes.

    Science.gov (United States)

    Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang

    2010-09-13

    The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  6. Recognition of RNA by amide modified backbone nucleic acids: molecular dynamics simulations of DNA-RNA hybrids in aqueous solution.

    Science.gov (United States)

    Nina, Mafalda; Fonné-Pfister, Raymonde; Beaudegnies, Renaud; Chekatt, Habiba; Jung, Pierre M J; Murphy-Kessabi, Fiona; De Mesmaeker, Alain; Wendeborn, Sebastian

    2005-04-27

    Thermodynamic and structural properties of a chemically modified DNA-RNA hybrid in which a phosphodiester linkage is replaced by a neutral amide-3 linkage (3'-CH(2)-CONH-5') were investigated using UV melting experiments, molecular dynamics simulations in explicit water, and continuum solvent models. van't Hoff analysis of the experimental UV melting curves suggests that the significant increase of the thermodynamic stability of a 15-mer DNA-RNA with seven alternated amide-3 modifications (+11 degrees C) is mainly due to an increased binding enthalpy. To further evaluate the origin in the observed affinities differences, the electrostatic contribution to the binding free energy was calculated by solving the Poisson-Boltzmann equation numerically. The nonelectrostatic contribution was estimated as the product of a hydrophobic surface tension coefficient and the surface area that is buried upon double strand formation. Structures were taken from 10 ns molecular dynamics simulations computed in a consistent fashion using explicit solvent, counterions, and the particle-mesh Ewald procedure. The present preliminary thermodynamic study suggests that the favorable binding free energy of the amide-3 DNA single strand to the complementary RNA is equally driven by electrostatic and nonpolar contributions to the binding compared to their natural analogues. In addition, molecular dynamics simulations in explicit water were performed on an amide-3 DNA single strand and the corresponding natural DNA. Results from the conformations cluster analysis of the simulated amide-3 DNA single strand ensembles suggest that the 25% of the population sampled within 10 ns has a pre-organized conformation where the sugar C3' endo pucker is favored at the 3'-flanking nucleotides. These structural and thermodynamic features contribute to the understanding of the observed increased affinities of the amide-3 DNA-RNA hybrids at the microscopic level.

  7. Base Flip in DNA Studied by Molecular Dynamics Simulationsof Differently-Oxidized Forms of Methyl-Cytosine

    Directory of Open Access Journals (Sweden)

    Mahdi Bagherpoor Helabad

    2014-07-01

    Full Text Available Distortions in the DNA sequence, such as damage or mispairs, are specifically recognized and processed by DNA repair enzymes. Many repair proteins and, in particular, glycosylases flip the target base out of the DNA helix into the enzyme’s active site. Our molecular dynamics simulations of DNA with intact and damaged (oxidized methyl-cytosine show that the probability of being flipped is similar for damaged and intact methyl-cytosine. However, the accessibility of the different 5-methyl groups allows direct discrimination of the oxidized forms. Hydrogen-bonded patterns that vary between methyl-cytosine forms carrying a carbonyl oxygen atom are likely to be detected by the repair enzymes and may thus help target site recognition.

  8. [On the use of FTA technology for collection, archieving, and molecular analysis of microsporidia dna from clinical stool samples].

    Science.gov (United States)

    Sokolova, O I; Dem'ianov, A V; Bovers, L S; Did'e, E S; Sokolova, Iu Ia

    2011-01-01

    The FTA technology was applied for sampling, archiving, and molecular analysis of the DNA isolated from stool samples to diagnose and identify microsporidia, the intracellular opportunistic parasites which induce malabsortion syndrome in immunosuppressed humans, particularly in patients with AIDS. Microsporidia DNA was successfully amplified in 6 of 50 stool samples of HIV-positive patients of the S. P. Botkin Memorial Infectious Disease Hospital (St. Petersburg) applied to FTA cards (FTA-Cars, Whatman Inc. Florham Park, NJ, USA). Amplicons (the fragments of rDNA) were directly sequenced, and microsporidia species--Encephalitozoon intestinalis, E. cuniculi, E. hellem, and Enterocytozoon bieneusi--were identified in Genbank by NCBI BLAST program. The FTA method of DNA immobilization is especially promising for epidemiological and field population studies which involve genotyping of microsporidia species and isolates.

  9. Molecular beacon-based real-time PCR method for detection of porcine DNA in gelatin and gelatin capsules.

    Science.gov (United States)

    Mohamad, Nurhidayatul Asma; Mustafa, Shuhaimi; Khairil Mokhtar, Nur Fadhilah; El Sheikha, Aly Farag

    2018-03-05

    The pharmaceutical industry has boosted gelatin consumption worldwide. This is supported by the availability of cost-effective gelatin production from porcine by-products. However, cross-contamination of gelatin materials, where porcine gelatin was unintentionally included in the other animal sources of gelatin, has caused significant concerns about halal authenticity. The real-time polymerase chain reaction (PCR) has enabled a highly specific and sensitive animal species detection method in various food products. Hence, such a technique was employed in the present study to detect and quantify porcine DNA in gelatin using a molecular beacon probe, with differences in performance between mitochondrial (cytochrome b gene) and chromosomal DNA-(MPRE42 repetitive element) based porcine-specific PCR assays being compared. A higher sensitivity was observed in chromosomal DNA (MPRE-PCR assay), where this assay allows the detection of gelatin DNA at amounts as as low as 1 pg, whereas mitochondrial DNA (CBH-PCR assay) can only detect at levels down to 10 pg of gelatin DNA. When an analysis with commercial gelatin and gelatin capsule samples was conducted, the same result was observed, with a significantly more sensitive detection being provided by the repetitive element of chromosomal DNA. The present study has established highly sensitive DNA-based porcine detection systems derived from chromosomal DNA that are feasible for highly processed products such as gelatin and gelatin capsules containing a minute amount of DNA. This sensitive detection method can also be implemented to assist the halal authentication process of various food products available on the market. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  10. Distribution of Brugia malayi larvae and DNA in vector and non-vector mosquitoes: implications for molecular diagnostics

    Directory of Open Access Journals (Sweden)

    Christensen Bruce M

    2009-11-01

    Full Text Available Abstract Background The purpose of this study was to extend prior studies of molecular detection of Brugia malayi DNA in vector (Aedes aegypti- Liverpool and non-vector (Culex pipiens mosquitoes at different times after ingestion of infected blood. Results Parasite DNA was detected over a two week time course in 96% of pooled thoraces of vector mosquitoes. In contrast, parasite DNA was detected in only 24% of thorax pools from non-vectors; parasite DNA was detected in 56% of midgut pools and 47% of abdomen pools from non-vectors. Parasite DNA was detected in vectors in the head immediately after the blood meal and after 14 days. Parasite DNA was also detected in feces and excreta of the vector and non-vector mosquitoes which could potentially confound results obtained with field samples. However, co-housing experiments failed to demonstrate transfer of parasite DNA from infected to non-infected mosquitoes. Parasites were also visualized in mosquito tissues by immunohistololgy using an antibody to the recombinant filarial antigen Bm14. Parasite larvae were detected consistently after mf ingestion in Ae. aegypti- Liverpool. Infectious L3s were seen in the head, thorax and abdomen of vector mosquitoes 14 days after Mf ingestion. In contrast, parasites were only detected by histology shortly after the blood meal in Cx. pipiens, and these were not labeled by the antibody. Conclusion This study provides new information on the distribution of filarial parasites and parasite DNA in vector and non-vector mosquitoes. This information should be useful for those involved in designing and interpreting molecular xenomonitoring studies.

  11. Long-term storage and safe retrieval of DNA from microorganisms for molecular analysis using FTA matrix cards.

    Science.gov (United States)

    Rajendram, D; Ayenza, R; Holder, F M; Moran, B; Long, T; Shah, H N

    2006-12-01

    We assessed the potential use of Whatman FTA paper as a device for archiving and long-term storage of bacterial cell suspensions of over 400 bacterial strains representing 61 genera, the molecular applications of immobilised DNA on FTA paper, and tested its microbial inactivation properties. The FTA paper extracted bacterial DNA is of sufficiently high quality to successfully carryout the molecular detection of several key genes including 16S rRNA, esp (Enterococcus surface protein), Bft (Bacteroides fragilis enterotoxin) and por (porin protein) by PCR and for DNA fingerprinting by random amplified polymorphic DNA-PCR (RAPD-PCR). To test the long-term stability of the FTA immobilised DNA, 100 of the 400 archived bacterial samples were randomly selected following 3 years of storage at ambient temperature and PCR amplification was used to monitor its success. All of the 100 samples were successfully amplified using the 16S rDNA gene as a target and confirmed by DNA sequencing. Furthermore, the DNA was eluted into solution from the FTA cards using a new alkaline elution procedure for evaluation by real-time PCR-based assays. The viability of cells retained on the FTA cards varied among broad groups of bacteria. For the more fragile gram-negative species, no viable cells were retained even at high cell densities of between 10(7) and 10(8) colony forming units (cfu) ml(-1), and for the most robust species such as spore-formers and acid-fast bacteria, complete inactivation was achieved at cell densities ranging between 10(1) and 10(4) cfu ml(-1). The inactivation of bacterial cells on FTA cards suggest that this is a safe medium for the storage and transport of bacterial nucleic acids.

  12. Plant molecular biology and biotechnology research in the post-recombinant DNA era.

    Science.gov (United States)

    Tyagi, Akhilesh K; Khurana, Jitendra P

    2003-01-01

    After the beginning of the recombinant DNA era in the mid-1970s, researchers in India started to make use of the new technology to understand the structure of plant genes and regulation of their expression. The outcome started to appear in print in early the 1980s and genes for histones, tubulin, photosynthetic membrane proteins, phototransduction components, organelles and those regulated differentially by developmental and extrinsic signals were sequenced and characterized. Some genes of biotechnological importance like those encoding an interesting seed protein and the enzyme glyoxalase were also isolated. While work on the characterization of genome structure and organization was started quite early, it remained largely focused on the identification of DNA markers and genetic variability. In this context, the work on mustard, rice and wheat is worth mentioning. In the year 2000, India became a member of the international consortium to sequence entire rice genome. Several laboratories have also given attention to regulated expression of plastid and nuclear genes as well as to isolate target-specific promoters or design promoters with improved potential. Simultaneously, transgenic systems for crops like mustard, rice, wheat, cotton, legumes and several vegetables have been established. More recently, genes of agronomic importance like those for insect resistance, abiotic stress tolerance, nutritional improvement and male sterility, isolated in India or abroad, have been utilized for raising transgenics for crop improvement. Some of these transgenics have already shown their potential in containment facility or limited field trials conducted under the stipulated guidelines. Plant molecular biology and biotechnology are thus clearly poised to make an impact on research in basic biology and agriculture in the near future.

  13. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  14. Self-consistent treatment of electrostatics in molecular DNA braiding through external forces.

    Science.gov (United States)

    Lee, Dominic J

    2014-06-01

    In this paper we consider a physical system in which two DNA molecules braid about each other. The distance between the two molecular ends, on either side of the braid, is held at a distance much larger than supercoiling radius of the braid. The system is subjected to an external pulling force, and a moment that induces the braiding. In a model, developed for understanding such a system, we assume that each molecule can be divided into a braided and unbraided section. We also suppose that the DNA is nicked so that there is no constraint of the individual linking numbers of the molecules. Included in the model are steric and electrostatic interactions, thermal fluctuations of the braided and unbraided sections of the molecule, as well as the constraint on the braid linking (catenation) number. We compare two approximations used in estimating the free energy of the braided section. One is where the amplitude of undulations of one molecule with respect to the other is determined only by steric interactions. The other is a self-consistent determination of the mean-squared amplitude of these undulations. In this second approximation electrostatics should play an important role in determining this quantity, as suggested by physical arguments. We see that if the electrostatic interaction is sufficiently large there are indeed notable differences between the two approximations. We go on to test the self-consistent approximation-included in the full model-against experimental data for such a system, and we find good agreement. However, there seems to be a slight left-right-handed braid asymmetry in some of the experimental results. We discuss what might be the origin of this small asymmetry.

  15. Detection of supercoiled hepatitis B virus DNA and related forms by means of molecular hybridization to an oligonucleotide probe

    International Nuclear Information System (INIS)

    Lin, H.J.; Chung, H.T.; Lai, C.L.; Leong, S.; Tam, O.S.

    1989-01-01

    A novel assay for supercoiled and other fully double-stranded forms of hepatitis B virus (HBV) DNA in blood is presented that utilizes molecular hybridisation to a radiophosphorous-labeled oligonucleotide probe. The probe [5'-d(ACGTGCAGAGGTGAAGCGA)] is complementary to the S(+)-strand sequence furthest downstream, at the end of the gap. We examined blood specimens from 137 healthy HBsAg-positive individuals, applying the probe to dots representing 2-3.5 ml serum or plasma. We found that supercoiled HBV is present in many HBV DNA-positive blood specimens albeit in small quantities. Of the 104 specimens that were positive for HBV DNA of any form, 53 annealed to the probe. Serial specimens from the same subject taken over a period of months showed that the proportion of supercoil to other HBV DNA forms was variable. The presence of supercoil HBV DNA was not closely correlated with the level of serum HBV DNA polymerase. The supercoil is an HBV DNA form that can persist in the liver in the presence or absence of other replicative intermediates. This assay may enable further characterization of the status of HBV infection

  16. Structure and dynamics of a [1:1] drug-DNA complex: Analysis of 2D NMR data using molecular mechanics and molecular dynamics calculations

    International Nuclear Information System (INIS)

    Sarma, R.H.; Sarma, M.H.; Umemoto, K.

    1990-01-01

    1D/2D NMR studies are reported for a [1:1] complex of d(GA 4 T 4 C) 2 and Dst2 (an analogue of distamycin A). Full- Matrix NOESY Simulations, Molecular Mechanics and Molecular Dynamics Calculations are performed to analyze the NMR data. Results show that drug-DNA complex formation is driven by static features like H-bonding and steric interactions in the minor-groove of DNA. As a consequence of drug binding, a non-linear oscillatory mode is activated. In this mode the molecule samples equilibrium structural states of difference degrees of bending. It is noted that these structures belong to three distinctly different energy wells that satisfy the same NMR data. 14 refs., 4 figs., 2 tabs

  17. What Is Mitochondrial DNA?

    Science.gov (United States)

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  18. Mechanism of the Glycosidic Bond Cleavage of Mismatched Thymine in Human Thymine DNA Glycosylase Revealed by Classical Molecular Dynamics and Quantum Mechanical/Molecular Mechanical Calculations.

    Science.gov (United States)

    Kanaan, Natalia; Crehuet, Ramon; Imhof, Petra

    2015-09-24

    Base excision of mismatched or damaged nucleotides catalyzed by glycosylase enzymes is the first step of the base excision repair system, a machinery preserving the integrity of DNA. Thymine DNA glycosylase recognizes and removes mismatched thymine by cleaving the C1'-N1 bond between the base and the sugar ring. Our quantum mechanical/molecular mechanical calculations of this reaction in human thymine DNA glycosylase reveal a requirement for a positive charge in the active site to facilitate C1'-N1 bond scission: protonation of His151 significantly lowers the free energy barrier for C1'-N1 bond dissociation compared to the situation with neutral His151. Shuttling a proton from His151 to the thymine base further reduces the activation free energy for glycosidic bond cleavage. Classical molecular dynamics simulations of the H151A mutant suggest that the mutation to the smaller, neutral, residue increases the water accessibility of the thymine base, rendering direct proton transfer from the bulk feasible. Quantum mechanical/molecular mechanical calculations of the glycosidic bond cleavage reaction in the H151A mutant show that the activation free energy is slightly lower than in the wild-type enzyme, explaining the experimentally observed higher reaction rates in this mutant.

  19. Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

    Science.gov (United States)

    El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

    2013-07-01

    Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.

  20. Molecular authentication of Pargo fillets Lutjanus purpureus (Perciformes: Lutjanidae by DNA barcoding reveals commercial fraud

    Directory of Open Access Journals (Sweden)

    Ivana Veneza

    2018-03-01

    Full Text Available ABSTRACT The Caribbean Red Snapper (Pargo Lutjanus purpureus is the most economically important snapper in Brazil, which is sold, among other forms, as frozen fillets. During the process of transformation into fillets there is the removal of the distinctive morphological traits, being able to favor the substitution by less valued species. In addition, there is no national legislation requiring the insertion of the specific name on the product label. However, according to a Normative Instruction (IN N ° 29/2015 MAPA that correlates the common and specific names of the products destined to the national trade, in Brazil only L. purpureus and L. campechanus can be denominated “Pargo”. Thus, the DNA barcode tool was used to identify the fillets sold in north of Brazil, labeled “Pargo”, with the aid of sequences from the public and control databases. The results showed that among 142 fillets examined, 78% was identified as L. purpureus and 22% as Rhomboplites aurorubens, a snapper with low commercial value in the country, revealing commercial fraud. The molecular identification method successfully used in this study to authenticate fillets snappers may also be used by surveillance authorities in the quality control of processed fish products, towards ensuring consumer rights.

  1. Use of radioisotopes in agriculture: DNA based molecular markers in crop improvement

    International Nuclear Information System (INIS)

    Sivaramakrishnan, S.; Seetharama, N.; Kannan, Seetha

    2001-01-01

    Agriculture has always benefited from the use of radioisotopes in many ways. In the beginning radioisotopes were mostly used for physiological studies to measure photosynthetic efficiency, nutrient uptake, and for mutation breeding. Radioisotopes have now become a part of the biotechnological tools that are being increasingly used in improving crops and production systems. The tools of biotechnology are being increasingly used to hasten breeding and address problems of biotic and abiotic stresses. Some of the non-radioactive methods have replaced radiotracer techniques and thus led to automation often at high cost. However, still there remain many applications where radioisotopes seem almost indispensable. For some of the applications like comparative genome mapping, the confirmation of transgenics, and establishment of gene copy number, use of RFLP with radioisotopes is essential. The following research areas at ICRISAT use radioisotopes: (1) physiological basis of adaptation to abiotic stresses (ii) development and use of appropriate DNA markers crop improvement; (iii) characterization of cytoplasmic male sterile systems and genetic diversity of breeding materials, land races and the wild relatives and (iv) molecular basis of disease resistance; (v) comparative genome mapping across cereals, (vi) isolation and characterization of genes of potential value to genetic improvement and (vii) verification of genetic transformation events. (author)

  2. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences.

    Science.gov (United States)

    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K; Maitra, S S

    2015-01-01

    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about "methanogenic archaea composition" and "abundance" in the contrasting ecosystems like "landfill" and "marshland" may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.

  3. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences

    Directory of Open Access Journals (Sweden)

    Shailendra Yadav

    2015-01-01

    Full Text Available Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic and Thaumarchaeota (mesophilic, were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.

  4. Helicase Dependent Isothermal Amplification of DNA and RNA using Self-Avoiding Molecular Recognition Systems

    Science.gov (United States)

    Yang, Zunyi; McLendon, Chris; Hutter, Daniel; Bradley, Kevin M.; Hoshika, Shuichi; Frye, Carole; Benner, Steven A.

    2015-01-01

    Assays that target DNA or RNA (xNA) are highly sensitive, as small amounts of xNA can be amplified by PCR. Unfortunately, PCR is inconvenient in low resource environments, requiring equipment and power that may not be available in these environments. However, isothermal procedures that avoid thermal cycling are often confounded by primer dimers, off-target priming, and other artifacts. Here, we show how a “self avoiding molecular recognition system” (SAMRS) eliminates these artifacts to give clean amplicons in a helicase-dependent isothermal amplification (SAMRS-HDA). We also show that incorporating SAMRS into the 3′-ends of primers facilitates the design and screening of primers for HDA assays. Finally, we show that SAMRS-HDA can be twofold multiplexed, something difficult to achieve with HDA using standard primers. This shows that SAMRS-HDA is a more versatile approach than standard HDA with a broader applicability for xNA-targeted diagnostics and research. PMID:25953623

  5. Molecular profiles of Venezuelan isolates of Trypanosoma sp. by random amplified polymorphic DNA method.

    Science.gov (United States)

    Perrone, T M; Gonzatti, M I; Villamizar, G; Escalante, A; Aso, P M

    2009-05-12

    Nine Trypanosoma sp. Venezuelan isolates, initially presumed to be T. evansi, were collected from three different hosts, capybara (Apure state), horse (Apure state) and donkey (Guarico state) and compared by the random amplification polymorphic DNA technique (RAPD). Thirty-one to 46 reproducible fragments were obtained with 12 of the 40 primers that were used. Most of the primers detected molecular profiles with few polymorphisms between the seven horse, capybara and donkey isolates. Quantitative analyses of the RAPD profiles of these isolates revealed a high degree of genetic conservation with similarity coefficients between 85.7% and 98.5%. Ten of the primers generated polymorphic RAPD profiles with two of the three Trypanosoma sp. horse isolates, namely TeAp-N/D1 and TeGu-N/D1. The similarity coefficient between these two isolates and the rest, ranged from 57.9% to 68.4% and the corresponding dendrogram clustered TeAp-N/D1 and Te Gu-N/D1 in a genetically distinct group.

  6. DNA arrays : methods and protocols [Methods in molecular biology, v. 170

    National Research Council Canada - National Science Library

    Rampal, Jang B

    2001-01-01

    "In DNA Arrays: Methods and Protocols, Jang Rampal and a authoritative panel of researchers, engineers, and technologists explain in detail how to design and construct DNA microarrays, as well as how to...

  7. Ex vivo irradiation of human blood to determine DNA damage using molecular techniques; Irradiacion ex vivo de sangre humana para determinar dano genomico utilizando tecnicas moleculares

    Energy Technology Data Exchange (ETDEWEB)

    Montes, Angel; Agapito, Juan [Laboratorio de Biologia Molecular, Instituto Peruano de Energia Nuclear, Lima (Peru)

    2014-07-01

    Biological dosimetry is the assessment of absorbed dose in individuals exposed to ionizing radiation from blood samples based on the radiation induced damage in cellular DNA. The aim of this study was to determine the damage in the DNA through the assessment of an experimental ex vivo assay using irradiated samples of human blood cells. For this purpose, blood samples were irradiated at low doses (<100 mGy) considering the following parameters: blood volume (3mL), temperature (37 °C) and incubation time (0.5, 2, 4, 8 and 24 h). Dose values were: 0, 12.5, 25 and 50 mGy using Cesium -137 gamma rays at 662 keV and a dose rate of 38.46 mGy/h. The qualitative damage in the genomic DNA was determined using agarose gel electrophoresis and polymerase chain reaction (PCR) for the p53 gene in a sequence of 133 pb of exon 7, related to the protein that acts in the cell repair process. The results of the qualitative analysis showed no degradation of genomic DNA; also an increase in the DNA concentration was observed up to the fourth hour of incubation, finding maximum values for all doses in the two samples. As a conclusion, the effects of ionizing radiation at doses used in this experiment do not generate a detectable damage, by means of molecular techniques such as those used in the present study. (authors).

  8. Molecular cloning and characterization of human papilloma virus DNA derived from a laryngeal papilloma.

    OpenAIRE

    Gissmann, L; Diehl, V; Schultz-Coulon, H J; zur Hausen, H

    1982-01-01

    Papilloma virus DNA from a laryngeal papilloma was cloned in phage lambda L 47 and characterized after cleavage with different restriction enzymes. Hybridization with the DNAs of human papilloma virus types 1, 2, 3, 4, 5, and 8 showed no homology under stringent hybridization conditions. Human papilloma virus type 6 DNA, however, was partially identical to laryngeal papilloma virus DNA; different restriction enzyme fragments hybridizing with the other DNA were identified on each genome. The d...

  9. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    International Nuclear Information System (INIS)

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  10. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  11. Molecular spectroscopic and thermodynamic studies on the interaction of anti-platelet drug ticlopidine with calf thymus DNA

    Science.gov (United States)

    Afrin, Shumaila; Rahman, Yusra; Sarwar, Tarique; Husain, Mohammed Amir; Ali, Abad; Shamsuzzaman; Tabish, Mohammad

    2017-11-01

    Ticlopidine is an anti-platelet drug which belongs to the thienopyridine structural family and exerts its effect by functioning as an ADP receptor inhibitor. Ticlopidine inhibits the expression of TarO gene in S. aureus and may provide protection against MRSA. Groove binding agents are known to disrupt the transcription factor DNA complex and consequently inhibit gene expression. Understanding the mechanism of interaction of ticlopidine with DNA can prove useful in the development of a rational drug designing system. At present, there is no such study on the interaction of anti-platelet drugs with nucleic acids. A series of biophysical experiments were performed to ascertain the binding mode between ticlopidine and calf thymus DNA. UV-visible and fluorescence spectroscopic experiments confirmed the formation of a complex between ticlopidine and calf thymus DNA. Moreover, the values of binding constant were found to be in the range of 103 M- 1, which is indicative of groove binding between ticlopidine and calf thymus DNA. These results were further confirmed by studying the effect of denaturation on double stranded DNA, iodide quenching, viscometric studies, thermal melting profile as well as CD spectral analysis. The thermodynamic profile of the interaction was also determined using isothermal titration calorimetric studies. The reaction was found to be endothermic and the parameters obtained were found to be consistent with those of known groove binders. In silico molecular docking studies further corroborated well with the experimental results.

  12. Novel primer specific false terminations during DNA sequencing reactions: danger of inaccuracy of mutation analysis in molecular diagnostics

    Science.gov (United States)

    Anwar, R; Booth, A; Churchill, A J; Markham, A F

    1996-01-01

    The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096

  13. Binding studies of guggulsterone-E to calf thymus DNA by multi-spectroscopic, calorimetric and molecular docking studies

    Science.gov (United States)

    Ikhlas, Shoeb; Ahmad, Masood

    2018-02-01

    Guggulsterone, a sterol found in plants is used as an ayurvedic medicine for many diseases such as obesity, internal tumors, ulcers etc. E and Z are two isoforms of guggulsterone, wherein guggulsterone-E (GUGE) has also been shown to have anticancer potential. Most of the anticancer drugs target nucleic acids. Therefore, we studied the mode of interaction between ctDNA and GUGE using UV-Vis, fluorescence and CD spectroscopy, isothermal calorimetry along with molecular docking studies. Hoechst 3325, ethidium bromide and rhodamine-B displacement experiments confirms that GUGE binds in the minor groove of DNA. ITC results further suggest these interactions to be feasible and spontaneous with hydrogen bond formation and van der waals interactions. Lastly, molecular docking also suggests GUGE to be a minor groove binder interacting through a single hydrogen bond formation between OH group of GUGE and nitrogen (N3) of adenosine (A6).

  14. All-atom molecular dynamics simulations of spin labelled double and single-strand DNA for EPR studies.

    Science.gov (United States)

    Prior, C; Danilāne, L; Oganesyan, V S

    2018-05-16

    We report the first application of fully atomistic molecular dynamics (MD) simulations to the prediction of electron paramagnetic resonance (EPR) spectra of spin labelled DNA. Models for two structurally different DNA spin probes with either the rigid or flexible position of the nitroxide group in the base pair, employed in experimental studies previously, have been developed. By the application of the combined MD-EPR simulation methodology we aimed at the following. Firstly, to provide a test bed against a sensitive spectroscopic technique for the recently developed improved version of the parmbsc1 force field for MD modelling of DNA. The predicted EPR spectra show good agreement with the experimental ones available from the literature, thus confirming the accuracy of the currently employed DNA force fields. Secondly, to provide a quantitative interpretation of the motional contributions into the dynamics of spin probes in both duplex and single-strand DNA fragments and to analyse their perturbing effects on the local DNA structure. Finally, a combination of MD and EPR allowed us to test the validity of the application of the Model-Free (M-F) approach coupled with the partial averaging of magnetic tensors to the simulation of EPR spectra of DNA systems by comparing the resultant EPR spectra with those simulated directly from MD trajectories. The advantage of the M-F based EPR simulation approach over the direct propagation techniques is that it requires motional and order parameters that can be calculated from shorter MD trajectories. The reported MD-EPR methodology is transferable to the prediction and interpretation of EPR spectra of higher order DNA structures with novel types of spin labels.

  15. Characterization of the env gene and long terminal repeat of molecularly cloned Friend mink cell focus-inducing virus DNA.

    OpenAIRE

    Adachi, A; Sakai, K; Kitamura, N; Nakanishi, S; Niwa, O; Matsuyama, M; Ishimoto, A

    1984-01-01

    The highly oncogenic erythroleukemia-inducing Friend mink cell focus-inducing (MCF) virus was molecularly cloned in phage lambda gtWES.lambda B, and the DNA sequences of the env gene and the long terminal repeat were determined. The nucleotide sequences of Friend MCF virus and Friend spleen focus-forming virus were quite homologous, supporting the hypothesis that Friend spleen focus-forming virus might be generated via Friend MCF virus from an ecotropic Friend virus mainly by some deletions. ...

  16. Charge transport and magnetoresistance of G4-DNA molecular device modulated by counter ions and dephasing effect

    International Nuclear Information System (INIS)

    Kang, Da-wei; Sun, Meng-le; Zuo, Zheng-wei; Wang, Hui-xian; Lv, Shi-jie; Li, Xin-zhong; Li, Li-ben

    2016-01-01

    The charge transport properties of the G4-DNA molecular device in the presence of counter ions and dephasing effect are investigated based on the Green function method and Landauer–Büttiker theory. The currents through the G4-DNA molecular device depend on the interference patterns at different coupling configurations. There is an effective electrostatic interaction between the counter ions and the G4-DNA molecule which introduces disorder into the on-site energies of G bases. The current through the device can be enhanced by the small disorder which avoids the strong interference of electrons at the same energy in some coupling configurations, however the diagonal disorder can suppress the overall current due to the Anderson localization of charge carriers when the disorder is large. In the presence of dephasing effect the current through the device at all coupling configurations can be enhanced as a result of the phase coherence losing of electron. As for the magnetic field response, the magnetoresistance of the device is always suppressed by the counter ions and dephasing effect. - Highlights: • The counter ions can some times enhance the current through G4-DNA molecule. • The dephasing effect can enhance the current of the device at all four coupling configurations. • The magnetoresistance is always suppressed by the counter ions and dephasing effect.

  17. Selenium Incorporated Cationic Organochalcogen: Live Cell Compatible and Highly Photostable Molecular Stain for Imaging and Localization of Intracellular DNA.

    Science.gov (United States)

    Gaur, Pankaj; Kumar, Ajay; Dey, Gourab; Kumar, Rajendra; Bhattacharyya, Shalmoli; Ghosh, Subrata

    2016-05-04

    Successful integration of selenium unit into a newly designed cationic chemical architecture led to the development of a highly photostable molecular maker PA5 to be used in fluorescence microscopy as cellular nucleus staining agent for longer duration imaging under continuous laser illumination. Adaptation of a targeted single-atom modification strategy led to the development of a series of proficient DNA light-up probes (PA1-PA5). Further, their comparative photophysical studies in the presence of DNA revealed the potential of electron rich heteroatoms of chalcogen family in improving binding efficiency and specificity of molecular probes toward DNA. The findings of cell studies confirmed the outstanding cell compatibility of probe PA5 in terms of cell permeability, biostability, and extremely low cytotoxicity. Moreover, the photostability experiment employing continuous laser illumination in solution phase as well as in cell assay (both fixed and live cells) revealed the admirable photobleaching resistance of PA5. Finally, while investigating the phototoxicity of PA5, the probe was found not to exhibit light-induced toxicity even when irradiated for longer duration. All these experimental results demonstrated the promising standing of PA5 as a futuristic cell compatible potential stain for bioimaging and temporal profiling of DNA.

  18. Clay-enhanced DNA separation in low-molecular-weight poly(N,N-dimethylacrylamide) solution by capillary electrophoresis.

    Science.gov (United States)

    Liang, D; Song, L; Chen, Z; Chu, B

    2001-06-01

    The effect of the separation medium in capillary electrophoresis consisting of a low-molecular-mass poly(N,N-dimethylacrylamide) (PDMA) solution on the DNA separation by adding a small amount of montmorillonite clay into the polymer matrix is presented. On the separation of the pBR322/HaeIII digest, both the resolution and the efficiency were increased by adding 2.5-5.0 x 10(-5) g/mL clay into the 5% w/v PDMA with a molecular mass of only 100 K. Moreover, there was no increase in the migration time of DNA fragments. Similar results were observed by using a C-terminated pGEM-3Zf(+) sequencing DNA sample in a sequencing buffer. Experimental data also showed that the addition of clay increased the viscosity of the polymer solution. We attribute this effect to the structural change of the polymer matrix caused by the exfoliated clay sheets, whereby the thin clay sheets function like a "dynamic cross-linking plate" for the PDMA chains and effectively increase the apparent molecular mass of PDMA.

  19. Molecular phylogeny of Oncaeidae (Copepoda using nuclear ribosomal internal transcribed spacer (ITS rDNA.

    Directory of Open Access Journals (Sweden)

    Iole Di Capua

    Full Text Available Copepods belonging to the Oncaeidae family are commonly and abundantly found in marine zooplankton. In the Mediterranean Sea, forty-seven oncaeid species occur, of which eleven in the Gulf of Naples. In this Gulf, several Oncaea species were morphologically analysed and described at the end of the XIX century by W. Giesbrecht. In the same area, oncaeids are being investigated over seasonal and inter-annual scales at the long-term coastal station LTER-MC. In the present work, we identified six oncaeid species using the nuclear ribosomal internal transcribed spacers (ITS rDNA and the mitochondrial cytochrome c oxidase subunit I (mtCOI. Phylogenetic analyses based on these two genomic regions validated the sisterhood of the genera Triconia and the Oncaea sensu stricto. ITS1 and ITS2 phylogenies produced incongruent results about the position of Oncaea curta, calling for further investigations on this species. We also characterised the ITS2 region by secondary structure predictions and found that all the sequences analysed presented the distinct eukaryotic hallmarks. A Compensatory Base Change search corroborated the close relationship between O. venusta and O. curta and between O. media and O. venusta already identified by ITS phylogenies. The present results, which stem from the integration of molecular and morphological taxonomy, represent an encouraging step towards an improved knowledge of copepod biodiversity: The two complementary approaches, when applied to long-term copepod monitoring, will also help to better understanding their genetic variations and ecological niches of co-occurring species.

  20. Cooperative assembly of Co-Smad4 MH1 with R-Smad1/3 MH1 on DNA: a molecular dynamics simulation study.

    Directory of Open Access Journals (Sweden)

    Guihong Wang

    Full Text Available Smads, the homologs of Sma and MAD proteins, play a key role in gene expression regulation in the transforming growth factor-β (TGF-β signaling pathway. Recent experimental studies have revealed that Smad4/R-Smad heterodimers bound on DNA are energetically more favorable than homodimeric R-Smad/R-Smad complexes bound on DNA, which indicates that Smad4 might act as binding vehicle to cooperatively assemble with activated R-Smads on DNA in the nucleus. However, the details of interaction mechanism for cooperative recruitment of Smad4 protein to R-Smad proteins on DNA, and allosteric communication between the Smad4-DNA and R-Smad-DNA interfaces via DNA mediating are not yet clear so far.In the present work, we have constructed a series of Smadn+DNA+Smadn (n = 1, 3, 4 models and carried out molecular dynamics simulations, free energy calculations and DNA dynamics analysis for them to study the interaction properties of Smadn (n = 1, 3, 4 with DNA molecule.The results revealed that the binding of Smad4 protein to DNA molecule facilitates energetically the formation of the heteromeric Smad4+DNA+Smad1/3 complex by increasing the affinity of Smad1/3 with DNA molecule. Further investigations through the residue/base motion correlation and DNA dynamics analyses predicted that the binding of Smad4 protein to DNA molecule in the heteromeric Smad4+DNA+Smad1/3 model induces an allosteric communication from the Smad4-DNA interface to Smad1/Smad3-DNA interface via DNA base-pair helical motions, surface conformation changes and new hydrogen bond formations. The present work theoretically explains the mechanism of cooperative recruitment of Smad4 protein to Smad1/3 protein via DNA-mediated indirect readout mode in the nucleus.

  1. A simple and cost-effective method of DNA extraction from small formalin-fixed paraffin-embedded tissue for molecular oncologic testing.

    Science.gov (United States)

    Snow, Anthony N; Stence, Aaron A; Pruessner, Jonathan A; Bossler, Aaron D; Ma, Deqin

    2014-01-01

    Extraction of DNA from formalin-fixed, paraffin-embedded (FFPE) tissue is a critical step in molecular oncologic testing. As molecular oncology testing becomes more important for prognostic and therapeutic decision making and tissue specimens become smaller due to earlier detection of suspicious lesions and the use of fine needle aspiration methods for tissue collection, it becomes more challenging for the typical molecular pathology laboratory to obtain reliable test results. We developed a DNA extraction method to obtain sufficient quantity and high quality genomic DNA from limited FFPE tissue for molecular oncology testing using a combination of H&E stained slides, a matrix capture method and the Qiagen DNA column. THREE DNA EXTRACTION METHODS WERE COMPARED: our standard procedure of manually scraping tissue from unstained slides followed by DNA extraction using the QIAamp FFPE column (Qiagen, Valencia, CA), a glue capture method (Pinpoint Solution, Zymo Research Corp, Inc) on H&E stained slides followed by DNA extraction using either the QIAamp column or the column included with the Pinpoint kit (Zymo Research). The DNA extraction protocol was optimized. Statistical analysis was performed using the paired two-sample student's t-test. The combination of the matrix capture method with the QIAamp column gave an equivalent amount of DNA as our standard extraction method using the unstained slides and a 4.6-fold higher DNA yield than using the Zymo column included in the Pinpoint Slide Solution kit. Several molecular tests were performed and DNA purified using the new method gave the same results as for the previous methods. Using H&E stained slides allows visual confirmation of tumor cells during microdissection. The Pinpoint solution made removal of specific tissue from the slides easier and reduced the risk of contamination and tissue loss. This DNA extraction method is simple, cost-effective, and blends with our current workflow requiring no additional equipment.

  2. Homology modeling, molecular docking and DNA binding studies of nucleotide excision repair UvrC protein from M. tuberculosis.

    Science.gov (United States)

    Parulekar, Rishikesh S; Barage, Sagar H; Jalkute, Chidambar B; Dhanavade, Maruti J; Fandilolu, Prayagraj M; Sonawane, Kailas D

    2013-08-01

    Mycobacterium tuberculosis is a Gram positive, acid-fast bacteria belonging to genus Mycobacterium, is the leading causative agent of most cases of tuberculosis. The pathogenicity of the bacteria is enhanced by its developed DNA repair mechanism which consists of machineries such as nucleotide excision repair. Nucleotide excision repair consists of excinuclease protein UvrABC endonuclease, multi-enzymatic complex which carries out repair of damaged DNA in sequential manner. UvrC protein is a part of this complex and thus helps to repair the damaged DNA of M. tuberculosis. Hence, structural bioinformatics study of UvrC protein from M. tuberculosis was carried out using homology modeling and molecular docking techniques. Assessment of the reliability of the homology model was carried out by predicting its secondary structure along with its model validation. The predicted structure was docked with the ATP and the interacting amino acid residues of UvrC protein with the ATP were found to be TRP539, PHE89, GLU536, ILE402 and ARG575. The binding of UvrC protein with the DNA showed two different domains. The residues from domain I of the protein VAL526, THR524 and LEU521 interact with the DNA whereas, amino acids interacting from the domain II of the UvrC protein included ARG597, GLU595, GLY594 and GLY592 residues. This predicted model could be useful to design new inhibitors of UvrC enzyme to prevent pathogenesis of Mycobacterium and so the tuberculosis.

  3. Enhancement of human immunodeficiency virus type 1-DNA vaccine potency through incorporation of T-helper 1 molecular adjuvants.

    Science.gov (United States)

    Calarota, Sandra A; Weiner, David B

    2004-06-01

    It is clear that the development of a safe and effective vaccine for human immunodeficiency virus type 1 (HIV-1) remains a crucial goal for controlling the acquired immunodeficiency syndrome epidemic. At present, it is not clear what arm of the immune response correlates with protection from HIV-1 infection or disease. Therefore, a strong cellular and humoral immune response will likely be needed to control this infection. Among different vaccine alternatives, DNA vaccines appeared more than a decade ago, demonstrating important qualities of inducing both humoral and cellular immune responses in animal models. However, after several years and various clinical studies in humans, supporting the safety of the HIV-DNA vaccine strategies, it has become clear that their potency should be improved. One way to modulate and enhance the immune responses induced by a DNA vaccine is by including genetic adjuvants such as cytokines, chemokines, or T-cell costimulatory molecules as part of the vaccine itself. Particularly, vaccine immunogenicity can be modulated by factors that attract professional antigen-presenting cells, provide additional costimulation, or enhance the uptake of plasmid DNA. This review focuses on developments in the coadministration of molecular adjuvants for the enhancement of HIV-1 DNA-vaccine potency.

  4. Molecular recognition of AT-DNA sequences by the induced CD pattern of dibenzotetraaza[14]annulene (DBTAA)–adenine derivatives

    OpenAIRE

    Stojković, Marijana Radić; Škugor, Marko; Dudek, Łukasz; Grolik, Jarosław; Eilmes, Julita; Piantanida, Ivo

    2014-01-01

    Summary An investigation of the interactions of two novel and several known DBTAA–adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA–propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure–activity...

  5. Circulating cell-free DNA: an up-coming molecular marker in exercise physiology.

    Science.gov (United States)

    Breitbach, Sarah; Tug, Suzan; Simon, Perikles

    2012-07-01

    The phenomenon of circulating cell-free DNA (cfDNA) concentrations is of importance for many biomedical disciplines including the field of exercise physiology. Increases of cfDNA due to exercise are described to be a potential hallmark for the overtraining syndrome and might be related to, or trigger adaptations of, immune function induced by strenuous exercise. At the same time, exercise provides a practicable model for studying the phenomenon of cfDNA that is described to be of pathophysiological relevance for different topics in clinical medicine like autoimmune diseases and cancer. In this review, we are summarizing the current knowledge of exercise-based acute and chronic alterations in cfDNA levels and their physiological significance. The effects of acute exercise on cfDNA concentrations have been investigated in resistance exercises and in continuous, stepwise and interval endurance exercises of different durations. cfDNA concentrations peaked immediately after acute exercise and showed a rapid return to baseline levels. Typical markers of skeletal muscle damage (creatine kinase, uric acid, C-reactive protein) show delayed kinetics compared with the cfDNA peak response. Exercise parameters such as intensity, duration or average energy expenditure do not explain the extent of increasing cfDNA concentrations after strenuous exercise. This could be due to complex processes inside the human organism during and after physical activity. Therefore, we hypothesize composite effects of different physiological stress parameters that come along with exercise to be responsible for increasing cfDNA concentrations. We suggest that due to acute stress, cfDNA levels increase rapidly by a spontaneous active or passive release mechanism that is not yet known. As a result of the rapid and parallel increase of cfDNA and lactate in an incremental treadmill test leading to exhaustion within 15-20 minutes, it is unlikely that cfDNA is released into the plasma by typical necrosis

  6. Neocarzinostatin as a probe for DNA protection activity--molecular interaction with caffeine.

    Science.gov (United States)

    Chin, Der-Hang; Li, Huang-Hsien; Kuo, Hsiu-Maan; Chao, Pei-Dawn Lee; Liu, Chia-Wen

    2012-04-01

    Neocarzinostatin (NCS), a potent mutagen and carcinogen, consists of an enediyne prodrug and a protein carrier. It has a unique double role in that it intercalates into DNA and imposes radical-mediated damage after thiol activation. Here we employed NCS as a probe to examine the DNA-protection capability of caffeine, one of common dietary phytochemicals with potential cancer-chemopreventive activity. NCS at the nanomolar concentration range could induce significant single- and double-strand lesions in DNA, but up to 75 ± 5% of such lesions were found to be efficiently inhibited by caffeine. The percentage of inhibition was caffeine-concentration dependent, but was not sensitive to the DNA-lesion types. The well-characterized activation reactions of NCS allowed us to explore the effect of caffeine on the enediyne-generated radicals. Postactivation analyses by chromatographic and mass spectroscopic methods identified a caffeine-quenched enediyne-radical adduct, but the yield was too small to fully account for the large inhibition effect on DNA lesions. The affinity between NCS chromophore and DNA was characterized by a fluorescence-based kinetic method. The drug-DNA intercalation was hampered by caffeine, and the caffeine-induced increases in DNA-drug dissociation constant was caffeine-concentration dependent, suggesting importance of binding affinity in the protection mechanism. Caffeine has been shown to be both an effective free radical scavenger and an intercalation inhibitor. Our results demonstrated that caffeine ingeniously protected DNA against the enediyne-induced damages mainly by inhibiting DNA intercalation beforehand. The direct scavenging of the DNA-bound NCS free radicals by caffeine played only a minor role. Copyright © 2011 Wiley Periodicals, Inc.

  7. Molecular mechanisms of the direct radiation effects on the DNA: ESR spectroscopy for examining oriented fibres after X-ray exposure

    International Nuclear Information System (INIS)

    Voit, K.

    1986-01-01

    This thesis contains experiments, investigating molecular interactions between X radiation and DNA. ESR-spectra of the primary radicals are simulated. The types of secondary radicals are described. (AJ) [de

  8. Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST

    NARCIS (Netherlands)

    O'Donnell, K.; Humber, R.A.; Geiser, D.M.; Kang, S.; Robert, V.; Park, B.; Crous, P.W.; Johnston, P.; Aoki, T.; Rooney, A.P.; Rehner, S.A.

    2012-01-01

    We constructed several multilocus DNA sequence datasets to assess the phylogenetic diversity of insecticolous fusaria, especially focusing on those housed at the Agricultural Research Service Collection of Entomopathogenic Fungi (ARSEF), and to aid molecular identifications of unknowns via the

  9. Detecting very low allele fraction variants using targeted DNA sequencing and a novel molecular barcode-aware variant caller.

    Science.gov (United States)

    Xu, Chang; Nezami Ranjbar, Mohammad R; Wu, Zhong; DiCarlo, John; Wang, Yexun

    2017-01-03

    Detection of DNA mutations at very low allele fractions with high accuracy will significantly improve the effectiveness of precision medicine for cancer patients. To achieve this goal through next generation sequencing, researchers need a detection method that 1) captures rare mutation-containing DNA fragments efficiently in the mix of abundant wild-type DNA; 2) sequences the DNA library extensively to deep coverage; and 3) distinguishes low level true variants from amplification and sequencing errors with high accuracy. Targeted enrichment using PCR primers provides researchers with a convenient way to achieve deep sequencing for a small, yet most relevant region using benchtop sequencers. Molecular barcoding (or indexing) provides a unique solution for reducing sequencing artifacts analytically. Although different molecular barcoding schemes have been reported in recent literature, most variant calling has been done on limited targets, using simple custom scripts. The analytical performance of barcode-aware variant calling can be significantly improved by incorporating advanced statistical models. We present here a highly efficient, simple and scalable enrichment protocol that integrates molecular barcodes in multiplex PCR amplification. In addition, we developed smCounter, an open source, generic, barcode-aware variant caller based on a Bayesian probabilistic model. smCounter was optimized and benchmarked on two independent read sets with SNVs and indels at 5 and 1% allele fractions. Variants were called with very good sensitivity and specificity within coding regions. We demonstrated that we can accurately detect somatic mutations with allele fractions as low as 1% in coding regions using our enrichment protocol and variant caller.

  10. Molecular Recognition of DNA Damage Sites by Apurinic/Apyrimidinic Endonucleases

    Energy Technology Data Exchange (ETDEWEB)

    Braun, W. A.

    2005-07-28

    The DNA repair/redox factor AP endonuclease 1 (APE1) is a multifunctional protein which is known to to be essential for DNA repair activity in human cells. Structural/functional analyses of the APE activity is thus been an important research field to assess cellular defense mechanisms against ionizing radiation.

  11. A molecular-based fast method to determine the extent of DNA ...

    African Journals Online (AJOL)

    Comet assay also called 'single cell gel electrophoresis is a technique for the detection of DNA damage and repair at the level of single cells, which is one of the most advanced techniques introduced to the agricultural sciences in recent years. The assay is one of the most popular tests of DNA damage detection (e.g. single ...

  12. The ABCs of molecular dynamics simulations on B-DNA, circa 2012

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... Introduction ... methods and applications of MD simulations to nucleic acids. ... access to high-performance computing, all-atom MD on DNA ... Specifically, the focus in this article is (a) ... of MD on DNA using AMBER came with the development ..... python-based tool for managing this task on widely.

  13. "DNA Re-EvolutioN": A Game for Learning Molecular Genetics and Evolution

    Science.gov (United States)

    Miralles, Laura; Moran, Paloma; Dopico, Eduardo; Garcia-Vazquez, Eva

    2013-01-01

    Evolution is a main concept in biology, but not many students understand how it works. In this article we introduce the game "DNA Re-EvolutioN" as an active learning tool that uses genetic concepts (DNA structure, transcription and translation, mutations, natural selection, etc.) as playing rules. Students will learn about molecular…

  14. Molecular cloning and mammalian expression of human beta 2-glycoprotein I cDNA

    DEFF Research Database (Denmark)

    Kristensen, Torsten; Schousboe, Inger; Boel, Espen

    1991-01-01

    Human β2-glycoprotein (β2gpI) cDNA was isolated from a liver cDNA library and sequenced. The cDNA encoded a 19-residue hydrophobic signal peptide followed by the mature β2gpI of 326 amino acid residues. In liver and in the hepatoma cell line HepG2 there are two mRNA species of about 1.4 and 4.3 kb......, respectively, hybridizing specifically with the β2gpI cDNA. Upon isoelectric focusing, recombinant β2gpI obtained from expression of β2gpI cDNA in baby hamster kidney cells showed the same pattern of bands as β2gpI isolated from plasma, and at least 5 polypeptides were visible...

  15. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  16. Molecular Authentication of the Traditional Medicinal Plant "Lakshman Booti" (Smithia conferta Sm.) and Its Adulterants through DNA Barcoding.

    Science.gov (United States)

    Umdale, Suraj D; Kshirsagar, Parthraj R; Lekhak, Manoj M; Gaikwad, Nikhil B

    2017-07-01

    Smithia conferta Sm. is an annual herb widely used in Indian traditional medical practice and commonly known as "Lakshman booti" in Sanskrit. Morphological resemblance among the species of genus Smithia Aiton . leads to inaccurate identification and adulteration. This causes inconsistent therapeutic effects and also affects the quality of herbal medicine. This study aimed to generate potential barcode for authentication of S. conferta and its adulterants through DNA barcoding technique. Genomic DNA extracted from S. conferta and its adulterants was used as templates for polymerase chain reaction amplification of the barcoding regions. The amplicons were directed for sequencing, and species identification was conducted using BLASTn and unweighted pair-group method with arithmetic mean trees. In addition, the secondary structures of internal transcribed spacer (ITS) 2 region were predicted. The nucleotide sequence of ITS provides species-specific single nucleotide polymorphisms and sequence divergence (22%) than psb A- trn H (10.9%) and rbc L (3.1%) sequences. The ITS barcode indicates that S. conferta and Smithia sensitiva are closely related compared to other species. ITS is the most applicable barcode for molecular authentication of S. conferta , and further chloroplast barcodes should be tested for phylogenetic analysis of genus Smithia. The present investigation is the first effort of utilization of DNA barcode for molecular authentication of S. conferta and its adulterants. Also, this study expanded the application of the ITS2 sequence data in the authentication. The ITS has been proved as a potential and reliable candidate barcode for the authentication of S. conferta . Abbreviations used: BLASTn: Basic Local Alignment Search Tool for Nucleotide; MEGA: Molecular Evolutionary Genetic Analysis; EMBL: European Molecular Biology Laboratory; psb A- trn H: Photosystem II protein D1- stuctural RNA: His tRNA gene; rbcL: Ribulose 1,5 bi-phosphate carboxylase

  17. Recognition, signaling, and repair of DNA double-strand breaks produced by ionizing radiation in mammalian cells: the molecular choreography.

    Science.gov (United States)

    Thompson, Larry H

    2012-01-01

    The faithful maintenance of chromosome continuity in human cells during DNA replication and repair is critical for preventing the conversion of normal diploid cells to an oncogenic state. The evolution of higher eukaryotic cells endowed them with a large genetic investment in the molecular machinery that ensures chromosome stability. In mammalian and other vertebrate cells, the elimination of double-strand breaks with minimal nucleotide sequence change involves the spatiotemporal orchestration of a seemingly endless number of proteins ranging in their action from the nucleotide level to nucleosome organization and chromosome architecture. DNA DSBs trigger a myriad of post-translational modifications that alter catalytic activities and the specificity of protein interactions: phosphorylation, acetylation, methylation, ubiquitylation, and SUMOylation, followed by the reversal of these changes as repair is completed. "Superfluous" protein recruitment to damage sites, functional redundancy, and alternative pathways ensure that DSB repair is extremely efficient, both quantitatively and qualitatively. This review strives to integrate the information about the molecular mechanisms of DSB repair that has emerged over the last two decades with a focus on DSBs produced by the prototype agent ionizing radiation (IR). The exponential growth of molecular studies, heavily driven by RNA knockdown technology, now reveals an outline of how many key protein players in genome stability and cancer biology perform their interwoven tasks, e.g. ATM, ATR, DNA-PK, Chk1, Chk2, PARP1/2/3, 53BP1, BRCA1, BRCA2, BLM, RAD51, and the MRE11-RAD50-NBS1 complex. Thus, the nature of the intricate coordination of repair processes with cell cycle progression is becoming apparent. This review also links molecular abnormalities to cellular pathology as much a possible and provides a framework of temporal relationships. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. DNA-Dependent Protein Kinase As Molecular Target for Radiosensitization of Neuroblastoma Cells.

    Directory of Open Access Journals (Sweden)

    M Emmy M Dolman

    Full Text Available Tumor cells might resist therapy with ionizing radiation (IR by non-homologous end-joining (NHEJ of IR-induced double-strand breaks. One of the key players in NHEJ is DNA-dependent protein kinase (DNA-PK. The catalytic subunit of DNA-PK, i.e. DNA-PKcs, can be inhibited with the small-molecule inhibitor NU7026. In the current study, the in vitro potential of NU7026 to radiosensitize neuroblastoma cells was investigated. DNA-PKcs is encoded by the PRKDC (protein kinase, DNA-activated, catalytic polypeptide gene. We showed that PRKDC levels were enhanced in neuroblastoma patients and correlated with a more advanced tumor stage and poor prognosis, making DNA-PKcs an interesting target for radiosensitization of neuroblastoma tumors. Optimal dose finding for combination treatment with NU7026 and IR was performed using NGP cells. One hour pre-treatment with 10 μM NU7026 synergistically sensitized NGP cells to 0.63 Gy IR. Radiosensitizing effects of NU7026 increased in time, with maximum effects observed from 96 h after IR-exposure on. Combined treatment of NGP cells with 10 μM NU7026 and 0.63 Gy IR resulted in apoptosis, while no apoptotic response was observed for either of the therapies alone. Inhibition of IR-induced DNA-PK activation by NU7026 confirmed the capability of NGP cells to, at least partially, resist IR by NHEJ. NU7026 also synergistically radiosensitized other neuroblastoma cell lines, while no synergistic effect was observed for low DNA-PKcs-expressing non-cancerous fibroblasts. Results obtained for NU7026 were confirmed by PRKDC knockdown in NGP cells. Taken together, the current study shows that DNA-PKcs is a promising target for neuroblastoma radiosensitization.

  19. DNA-Dependent Protein Kinase As Molecular Target for Radiosensitization of Neuroblastoma Cells.

    Science.gov (United States)

    Dolman, M Emmy M; van der Ploeg, Ida; Koster, Jan; Bate-Eya, Laurel Tabe; Versteeg, Rogier; Caron, Huib N; Molenaar, Jan J

    2015-01-01

    Tumor cells might resist therapy with ionizing radiation (IR) by non-homologous end-joining (NHEJ) of IR-induced double-strand breaks. One of the key players in NHEJ is DNA-dependent protein kinase (DNA-PK). The catalytic subunit of DNA-PK, i.e. DNA-PKcs, can be inhibited with the small-molecule inhibitor NU7026. In the current study, the in vitro potential of NU7026 to radiosensitize neuroblastoma cells was investigated. DNA-PKcs is encoded by the PRKDC (protein kinase, DNA-activated, catalytic polypeptide) gene. We showed that PRKDC levels were enhanced in neuroblastoma patients and correlated with a more advanced tumor stage and poor prognosis, making DNA-PKcs an interesting target for radiosensitization of neuroblastoma tumors. Optimal dose finding for combination treatment with NU7026 and IR was performed using NGP cells. One hour pre-treatment with 10 μM NU7026 synergistically sensitized NGP cells to 0.63 Gy IR. Radiosensitizing effects of NU7026 increased in time, with maximum effects observed from 96 h after IR-exposure on. Combined treatment of NGP cells with 10 μM NU7026 and 0.63 Gy IR resulted in apoptosis, while no apoptotic response was observed for either of the therapies alone. Inhibition of IR-induced DNA-PK activation by NU7026 confirmed the capability of NGP cells to, at least partially, resist IR by NHEJ. NU7026 also synergistically radiosensitized other neuroblastoma cell lines, while no synergistic effect was observed for low DNA-PKcs-expressing non-cancerous fibroblasts. Results obtained for NU7026 were confirmed by PRKDC knockdown in NGP cells. Taken together, the current study shows that DNA-PKcs is a promising target for neuroblastoma radiosensitization.

  20. Molecular dynamics simulations and free energy calculations of netropsin and distamycin binding to an AAAAA DNA binding site

    Science.gov (United States)

    Dolenc, Jožica; Oostenbrink, Chris; Koller, Jože; van Gunsteren, Wilfred F.

    2005-01-01

    Molecular dynamics simulations have been performed on netropsin in two different charge states and on distamycin binding to the minor groove of the DNA duplex d(CGCGAAAAACGCG)·d(CGCGTTTTTCGCG). The relative free energy of binding of the two non-covalently interacting ligands was calculated using the thermodynamic integration method and reflects the experimental result. From 2 ns simulations of the ligands free in solution and when bound to DNA, the mobility and the hydrogen-bonding patterns of the ligands were studied, as well as their hydration. It is shown that even though distamycin is less hydrated than netropsin, the loss of ligand–solvent interactions is very similar for both ligands. The relative mobilities of the ligands in their bound and free forms indicate a larger entropic penalty for distamycin when binding to the minor groove compared with netropsin, partially explaining the lower binding affinity of the distamycin molecule. The detailed structural and energetic insights obtained from the molecular dynamics simulations allow for a better understanding of the factors determining ligand–DNA binding. PMID:15687382

  1. Molecular dynamics simulations and free energy calculations of netropsin and distamycin binding to an AAAAA DNA binding site.

    Science.gov (United States)

    Dolenc, Jozica; Oostenbrink, Chris; Koller, Joze; van Gunsteren, Wilfred F

    2005-01-01

    Molecular dynamics simulations have been performed on netropsin in two different charge states and on distamycin binding to the minor groove of the DNA duplex d(CGCGAAAAACGCG).d(CGCGTTTTTCGCG). The relative free energy of binding of the two non-covalently interacting ligands was calculated using the thermodynamic integration method and reflects the experimental result. From 2 ns simulations of the ligands free in solution and when bound to DNA, the mobility and the hydrogen-bonding patterns of the ligands were studied, as well as their hydration. It is shown that even though distamycin is less hydrated than netropsin, the loss of ligand-solvent interactions is very similar for both ligands. The relative mobilities of the ligands in their bound and free forms indicate a larger entropic penalty for distamycin when binding to the minor groove compared with netropsin, partially explaining the lower binding affinity of the distamycin molecule. The detailed structural and energetic insights obtained from the molecular dynamics simulations allow for a better understanding of the factors determining ligand-DNA binding.

  2. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  3. DNA damage in preserved specimens and tissue samples: a molecular assessment

    Directory of Open Access Journals (Sweden)

    Cantin Elizabeth

    2008-10-01

    Full Text Available Abstract The extraction of genetic information from preserved tissue samples or museum specimens is a fundamental component of many fields of research, including the Barcode of Life initiative, forensic investigations, biological studies using scat sample analysis, and cancer research utilizing formaldehyde-fixed, paraffin-embedded tissue. Efforts to obtain genetic information from these sources are often hampered by an inability to amplify the desired DNA as a consequence of DNA damage. Previous studies have described techniques for improved DNA extraction from such samples or focused on the effect of damaging agents – such as light, oxygen or formaldehyde – on free nucleotides. We present ongoing work to characterize lesions in DNA samples extracted from preserved specimens. The extracted DNA is digested to single nucleosides with a combination of DNase I, Snake Venom Phosphodiesterase, and Antarctic Phosphatase and then analyzed by HPLC-ESI-TOF-MS. We present data for moth specimens that were preserved dried and pinned with no additional preservative and for frog tissue samples that were preserved in either ethanol, or formaldehyde, or fixed in formaldehyde and then preserved in ethanol. These preservation methods represent the most common methods of preserving animal specimens in museum collections. We observe changes in the nucleoside content of these samples over time, especially a loss of deoxyguanosine. We characterize the fragmentation state of the DNA and aim to identify abundant nucleoside lesions. Finally, simple models are introduced to describe the DNA fragmentation based on nicks and double-strand breaks.

  4. Molecular Precision at Micrometer Length Scales: Hierarchical Assembly of DNA-Protein Nanostructures.

    Science.gov (United States)

    Schiffels, Daniel; Szalai, Veronika A; Liddle, J Alexander

    2017-07-25

    Robust self-assembly across length scales is a ubiquitous feature of biological systems but remains challenging for synthetic structures. Taking a cue from biology-where disparate molecules work together to produce large, functional assemblies-we demonstrate how to engineer microscale structures with nanoscale features: Our self-assembly approach begins by using DNA polymerase to controllably create double-stranded DNA (dsDNA) sections on a single-stranded template. The single-stranded DNA (ssDNA) sections are then folded into a mechanically flexible skeleton by the origami method. This process simultaneously shapes the structure at the nanoscale and directs the large-scale geometry. The DNA skeleton guides the assembly of RecA protein filaments, which provides rigidity at the micrometer scale. We use our modular design strategy to assemble tetrahedral, rectangular, and linear shapes of defined dimensions. This method enables the robust construction of complex assemblies, greatly extending the range of DNA-based self-assembly methods.

  5. WRN Exonuclease Structure, Molecular Mechanism, and DNA EndProcessing Role

    Energy Technology Data Exchange (ETDEWEB)

    Perry, J. Jefferson P.; Yannone, Steven M.; Holden, Lauren G.; Hitomi, Chiharu; Asaithamby, Aroumougame; Han, Seungil; Cooper, PriscillaK.; Chen, David J.; Tainer, John A.

    2006-02-15

    WRN is unique among the five human RecQ DNA helicases by having a functional exonuclease domain (WRN-exo) and being defective in the premature aging and cancer-related disorder Werner syndrome. Here, we characterize WRN-exo crystal structures, biochemical activity and participation in DNA end-joining. Metal ion complex structures, active site mutations and activity assays reveal a two-metal-ion mediated nuclease mechanism. The DNA end-binding Ku70/80 complex specifically stimulates WRN-exo activity, and structure-based mutational inactivation of WRN-exo alters DNA end-joining in human cells. We furthermore establish structural and biochemical similarities of WRN-exo to DnaQ family replicative proofreading exonucleases, with WRN-specific adaptations consistent with dsDNA specificity and functionally important conformational changes. These results indicate WRN-exo is a human DnaQ family member and support analogous proof-reading activities that are stimulated by Ku70/80 with implications for WRN functions in age related pathologies and maintenance of genomic integrity.

  6. Striking Plasticity of CRISPR-Cas9 and Key Role of Non-target DNA, as Revealed by Molecular Simulations.

    Science.gov (United States)

    Palermo, Giulia; Miao, Yinglong; Walker, Ross C; Jinek, Martin; McCammon, J Andrew

    2016-10-26

    The CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 system recently emerged as a transformative genome-editing technology that is innovating basic bioscience and applied medicine and biotechnology. The endonuclease Cas9 associates with a guide RNA to match and cleave complementary sequences in double stranded DNA, forming an RNA:DNA hybrid and a displaced non-target DNA strand. Although extensive structural studies are ongoing, the conformational dynamics of Cas9 and its interplay with the nucleic acids during association and DNA cleavage are largely unclear. Here, by employing multi-microsecond time scale molecular dynamics, we reveal the conformational plasticity of Cas9 and identify key determinants that allow its large-scale conformational changes during nucleic acid binding and processing. We show how the "closure" of the protein, which accompanies nucleic acid binding, fundamentally relies on highly coupled and specific motions of the protein domains, collectively initiating the prominent conformational changes needed for nucleic acid association. We further reveal a key role of the non-target DNA during the process of activation of the nuclease HNH domain, showing how the nontarget DNA positioning triggers local conformational changes that favor the formation of a catalytically competent Cas9. Finally, a remarkable conformational plasticity is identified as an intrinsic property of the HNH domain, constituting a necessary element that allows for the HNH repositioning. These novel findings constitute a reference for future experimental studies aimed at a full characterization of the dynamic features of the CRISPR-Cas9 system, and-more importantly-call for novel structure engineering efforts that are of fundamental importance for the rational design of new genome-engineering applications.

  7. Functional analysis of molecular mechanisms of radiation induced apoptosis, that are not mediated by DNA damages

    International Nuclear Information System (INIS)

    Angermeier, Marita; Moertl, Simone

    2012-01-01

    The effects of low-dose irradiation pose new challenges on the radiation protection efforts. Enhanced cellular radiation sensitivity is displayed by disturbed cellular reactions and resulting damage like cell cycle arrest, DNA repair and apoptosis. Apoptosis serves as genetically determinate parameter for the individual radiation sensitivity. In the frame of the project the radiation-induced apoptosis was mechanistically investigated. Since ionizing radiation induced direct DNA damage and generates a reactive oxygen species, the main focus of the research was the differentiation and weighting of DNA damage mediated apoptosis and apoptosis caused by the reactive oxygen species (ROS).

  8. Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

    Science.gov (United States)

    Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

    2017-01-01

    Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL , matK , trnH - psbA , trnLC - trnLD , their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus , Conophallus and Amorphophallus . In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK , trnH - psbA , trnLC - trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL .

  9. [Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

    Science.gov (United States)

    Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

    2013-01-01

    To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

  10. Identification of Paramecium bursaria syngens through molecular markers--comparative analysis of three loci in the nuclear and mitochondrial DNA.

    Science.gov (United States)

    Greczek-Stachura, Magdalena; Potekhin, Alexey; Przyboś, Ewa; Rautian, Maria; Skoblo, Inna; Tarcz, Sebastian

    2012-09-01

    This is the first attempt to resolve the phylogenetic relationship between different syngens of Paramecium bursaria and to investigate at a molecular level the intraspecific differentiation of strains originating from very distant geographical locations. Herein we introduce a new collection of five P. bursaria syngens maintained at St Petersburg State University, as the international collection of syngens was lost in the 1960s. To analyze the degree of speciation within Paramecium bursaria, we examined 26 strains belonging to five different syngens from distant and geographically isolated localities using rDNA (ITS1-5.8S-ITS2-5'LSU) fragments, mitochondrial cytochrome c oxidase subunit I (COI), and H4 gene fragments. It was shown that P. bursaria strains of the same syngens cluster together in all three inferred molecular phylogenies. The genetic diversity among the studied P. bursaria strains based on rDNA sequences was rather low. The COI divergence of Paramecium bursaria was also definitely lower than that observed in the Paramecium aurelia complex. The nucleotide sequences of the H4 gene analyzed in the present study indicate the extent of genetic differences between the syngens of Paramecium bursaria. Our study demonstrates the diagnostic value of molecular markers, which are important tools in the identification of Paramecium bursaria syngens. Copyright © 2011 Elsevier GmbH. All rights reserved.

  11. A Molecular Toolbox to Engineer Site-Specific DNA Replication Perturbation.

    Science.gov (United States)

    Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

    2018-01-01

    Site-specific arrest of DNA replication is a useful tool for analyzing cellular responses to DNA replication perturbation. The E. coli Tus-Ter replication barrier can be reconstituted in eukaryotic cells as a system to engineer an unscheduled collision between a replication fork and an "alien" impediment to DNA replication. To further develop this system as a versatile tool, we describe a set of reagents and a detailed protocol that can be used to engineer Tus-Ter barriers into any locus in the budding yeast genome. Because the Tus-Ter complex is a bipartite system with intrinsic DNA replication-blocking activity, the reagents and protocols developed and validated in yeast could also be optimized to engineer site-specific replication fork barriers into other eukaryotic cell types.

  12. dna profiling of capsicum annuum with the help of molecular markers

    African Journals Online (AJOL)

    isha

    2013-07-24

    Jul 24, 2013 ... Since the commercial value of chilli pepper is based on pungency level, ... Randomly Amplified Polymorphic DNA, Dendrogram, Polymerase Chain ..... the Amazon department in Columbia, characterization by AFLPs of.

  13. DNA-binding specificity and molecular functions of NAC transcription factors

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Ernst, Heidi Asschenfeldt; Lo Leggio, Leila

    2005-01-01

    The family of NAC (NAM/ATAF1,2/CUC2) transcription factors has been implicated in a wide range of plant processes, but knowledge on the DNA-binding properties of the family is limited. Using a reiterative selection procedure on random oligonucleotides, we have identified consensus binding sites....... Furthermore, NAC protein binding to the CaMV 35S promoter was shown to depend on sequences similar to the consensus of the selected oligonucleotides. Electrophoretic mobility shift assays demonstrated that NAC proteins bind DNA as homo- or heterodimers and that dimerization is necessary for stable DNA binding....... The ability of NAC proteins to dimerize and to bind DNAwas analysed by structure-based mutagenesis. This identified two salt bridge-forming residues essential for NAC protein dimerization. Alteration of basic residues in a loop region containing several highly conserved residues abolished DNA binding. Thus...

  14. Atomistic details of the molecular recognition of DNA-RNA hybrid ...

    Indian Academy of Sciences (India)

    conformations corresponding to typical A- and B-type nucleic acids and the .... protein chains and five base pairs in DNA-RNA hybrid ... employed to treat the long range electrostatic interac- .... The solvent accessible surface areas (SASA) of.

  15. A Molecular Toolbox to Engineer Site-Specific DNA Replication Perturbation

    DEFF Research Database (Denmark)

    Larsen, Nicolai B; Hickson, Ian D; Mankouri, Hocine W

    2018-01-01

    " impediment to DNA replication. To further develop this system as a versatile tool, we describe a set of reagents and a detailed protocol that can be used to engineer Tus-Ter barriers into any locus in the budding yeast genome. Because the Tus-Ter complex is a bipartite system with intrinsic DNA replication......Site-specific arrest of DNA replication is a useful tool for analyzing cellular responses to DNA replication perturbation. The E. coli Tus-Ter replication barrier can be reconstituted in eukaryotic cells as a system to engineer an unscheduled collision between a replication fork and an "alien......-blocking activity, the reagents and protocols developed and validated in yeast could also be optimized to engineer site-specific replication fork barriers into other eukaryotic cell types....

  16. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    Science.gov (United States)

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S rDNA

  17. The Effect of Small Cosolutes that Mimic Molecular Crowding Conditions on the Stability of Triplexes Involving Duplex DNA

    Directory of Open Access Journals (Sweden)

    Anna Aviñó

    2016-02-01

    Full Text Available Triplex stability is studied in crowding conditions using small cosolutes (ethanol, acetonitrile and dimethylsulfoxide by ultraviolet (UV, circular dichroism (CD and nuclear magnetic resonance (NMR spectroscopies. The results indicate that the triplex is formed preferentially when the triplex forming oligonucleotide (TFO is RNA. In addition, DNA triplexes (D:D·D are clearly less stable in cosolute solutions while the stability of the RNA triplexes (R:D·D is only slightly decreased. The kinetic of triplex formation with RNA-TFO is slower than with DNA-TFO and the thermal stability of the triplex is increased with the salt concentration in EtOH-water solutions. Accordingly, RNA could be considered a potential molecule to form a stable triplex for regulatory purposes in molecular crowding conditions.

  18. Molecular genetic analysis of a vaccinia virus gene with an essential role in DNA replication

    International Nuclear Information System (INIS)

    Evans, E.V.A.

    1989-01-01

    The poxvirus, vaccinia, is large DNA virus which replicates in the cytoplasma of the host cell. The virus is believed to encode most or all of the functions required for the temporally regulated transcription and replication of its 186 kilobase genome. Physical and genetic autonomy from the host make vaccinia a useful eukaryotic organism in which to study replication genes and proteins, using a combination of biochemical and genetic techniques. Essential viral functions for replication are identified by conditional lethal mutants that fail to synthesize DNA at the non-permissive temperatures. One such group contains the non-complementing alleles ts17, ts24, ts69 (WR strain). Studies were undertaken to define the phenotype of ts mutants, and to identify and characterize the affected gene and protein. Mutant infection was essentially normal at 32 degree C, but at 39 degree C the mutants did not incorporate 3 H-thymidine into nascent viral DNA or synthesize late viral proteins. If mutant cultures were shifted to non-permissive conditions at the height of replication, DNA synthesis was halted rapidly, implying that the mutants are defective in DNA elongation. The gene affected in the WR mutants and in ts6389, a DNA-minus mutant of the IHD strain, was mapped by marker rescue and corresponds to open reading frame 5 (orfD5) of the viral HindIII D fragment

  19. Structure and dynamics of double helical DNA in torsion angle hyperspace: a molecular mechanics approach.

    Science.gov (United States)

    Borkar, Aditi; Ghosh, Indira; Bhattacharyya, Dhananjay

    2010-04-01

    Analysis of the conformational space populated by the torsion angles and the correlation between the conformational energy and the sequence of DNA are important for fully understanding DNA structure and function. Presence of seven variable torsion angles about single covalent bonds in DNA main chain puts a big challenge for such analysis. We have carried out restrained energy minimization studies for four representative dinucleosides, namely d(ApA):d(TpT), d(CpG):d(CpG), d(GpC):d(GpC) and d(CpA):d(TpG) to determine the energy hyperspace of DNA in context to the values of the torsion angles and the structural properties of the DNA conformations populating the favorable regions of this energy hyperspace. The torsion angles were manipulated by constraining their values at the reference points and then performing energy minimization. The energy minima obtained on the potential energy contour plots mostly correspond to the conformations populated in crystal structures of DNA. Some novel favorable conformations that are not present in crystal structure data are also found. The plots also suggest few low energy routes for conformational transitions or the associated energy barrier heights. Analyses of base pairing and stacking possibility reveal structural changes accompanying these transitions as well as the flexibility of different base steps towards variations in different torsion angles.

  20. Molecular detection of Anaplasma phagocytophilum DNA in the lesser horseshoe bat (Rhinolophus hipposideros) guano.

    Science.gov (United States)

    Afonso, E; Goydadin, A-C

    2018-05-30

    Although bats are increasingly recognised as potential reservoir hosts of human zoonotic pathogens, bacteria in bats are still poorly studied. To investigate the DNA faecal prevalence of the bacterium Anaplasma phagocytophilum, we sampled 23 lesser horseshoe bat (Rhinolophus hipposideros) maternity colonies located in buildings (churches, barns) in rural villages of eastern France. A total of 552 faecal samples were collected from 278 individuals. Anaplasma phagocytophilum DNA was detected in the faeces of 63 individuals (22.7%). Such high prevalence might suggest persistent infection in bats and/or a frequent consumption of insect preys carrying bacteria. Faecal DNA prevalence varied highly among colonies but was not related to the colony size. Faecal DNA prevalence was the highest in the Jura Department, where the density of ticks is known to be the highest across the study area. Because the sampled bats live in close proximity to humans, we discuss how concerning the presence of A. phagocytophilum DNA in bat guano is for humans frequenting places of worship that shelter bats. We also advocate future research to understand what a high faecal DNA prevalence in bat guano really implicates in terms of bacteria transmission.

  1. Spectroscopic and molecular modeling study on the interaction of ctDNA with 3′-deoxy-3′-azido doxorubicin

    International Nuclear Information System (INIS)

    Geng, Shaoguang; Cui, Yanrui; Liu, Qingfeng; Cui, Fengling; Zhang, Guisheng; Chi, Yanwei; Peng, Hao

    2013-01-01

    The method of synthesizing 3′-deoxy-3′-azido doxorubicin (ADOX) directly from doxorubicin has been developed. This study presents the interaction between ADOX and calf thymus deoxyribonucleic acid (ctDNA) by using spectroscopic methods and molecular modeling techniques. Iodide quenching, fluorescence polarization, viscosity and molecular modeling studies of ADOX–ctDNA interactions indicated that ADOX was an intercalator of ctDNA and preferentially bound to C–G rich regions of ctDNA. Simultaneously, spectroscopic results indicated that the quenching mechanism of ADOX–ctDNA was a static quenching. According to thermodynamic parameters, electrostatic force played roles in the interaction of ADOX with ctDNA. -- Highlights: ●An approach to 3′-deoxy-3′-azido doxorubicin (ADOX) from doxorubicin was developed. ●The quenching mechanism of ADOX with ctDNA was a static quenching type. ●The binding mode between ADOX and ctDNA was intercalative binding. ●The results of molecular docking corroborated results of spectra investigations

  2. Calibration of denaturing agarose gels for molecular weight estimation of DNA: size determination of the single-stranded genomes of parvoviruses

    Energy Technology Data Exchange (ETDEWEB)

    Snyder, C.E. (Oak Ridge National Lab., TN); Schmoyer, R.L.; Bates, R.C.; Mitra, S.

    1982-01-01

    Vertical slab gel electrophoresis of DNA with CH/sub 3/HgOH-containing agarose produces sharp bands whose mobilities are suitable for size estimation of single-stranded DNA containing 600 to 20,000 bases. The relationship of electrophoretic mobility to size of DNA over this range is a smooth, S-shaped function, and an empirical model was developed to express the relationship. The model involves terms in squared and reciprocal mobilities, and produced excellent fit of known standard markers to measured mobilities. It was used to estimate the sizes of six parvovirus DNAs: Kilham rat virus (KRV), H-1, LuIII, and minute virus of mice (MVM) DNAs had molecular weights of 1.66 to 1.70 x 10/sup 6/, while the molecular weight of bovine parvovirus (BPV) DNA was 1.84 x 10/sup 6/ and that of adenoassociated virus (AAV) DNA was 1.52 x 10/sup 6/.

  3. Molecular identification of badger-associated Babesia sp. DNA in dogs: updated phylogeny of piroplasms infecting Caniformia.

    Science.gov (United States)

    Hornok, Sándor; Horváth, Gábor; Takács, Nóra; Kontschán, Jenő; Szőke, Krisztina; Farkas, Róbert

    2018-04-11

    Piroplasms are unicellular, tick-borne parasites. Among them, during the past decade, an increasing diversity of Babesia spp. has been reported from wild carnivores. On the other hand, despite the known contact of domestic and wild carnivores (e.g. during hunting), and a number of ixodid tick species they share, data on the infection of dogs with babesiae from other families of carnivores are rare. In this study blood samples were collected from 90 dogs and five road-killed badgers. Ticks were also removed from these animals. The DNA was extracted from all blood samples, and from 33 ticks of badgers, followed by molecular analysis for piroplasms with PCR and sequencing, as well as by phylogenetic comparison of detected genotypes with piroplasms infecting carnivores. Eleven of 90 blood DNA extracts from dogs, and all five samples from badgers were PCR-positive for piroplasms. In addition to the presence of B. canis DNA in five dogs, sequencing identified the DNA of badger-associated "Babesia sp. Meles-Hu1" in six dogs and in all five badgers. The DNA of "Babesia sp. Meles-Hu1" occurred significantly more frequently in dogs often taken to forests (i.e. the preferred habitat of badgers in Hungary), than in dogs without this characteristic. Moreover, detection of DNA from this Babesia sp. was significantly associated with hunting dogs in comparison with dogs not used for hunting. Two PCR-positive dogs (in one of which the DNA of the badger-associated Babesia sp. was identified, whereas in the other the DNA of B. canis was present) showed clinical signs of babesiosis. Engorged specimens of both I. canisuga and I. hexagonus were collected from badgers with parasitaemia, but only I. canisuga contained the DNA of "Babesia sp. Meles-Hu1". This means a significant association of the DNA from "Babesia sp. Meles-Hu1" with I. canisuga. Phylogenetically, "Babesia sp. Meles-Hu1" belonged to the "B. microti" group. This is the first detection of the DNA from a badger

  4. Molecular phylogeny of Acer monspessulanum L. subspecies from Iran inferred using the ITS region of nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    HANIF KHADEMI

    2016-04-01

    Full Text Available Abstract. Khademi H, Mehregan I, Assadi M, Nejadsatari T, Zarre S. 2015. Molecular phylogeny of Acer monspessulanum L. subspecies from Iran inferred using the ITS region of nuclear ribosomal DNA. Biodiversitas 17: 16-23. This study was carried out on the Acer monspessulanum complex growing wild in Iran. Internal transcribed spacer (ITS sequences for 75 samples representing five different subspecies of Acer monspessulanum were analyzed. Beside this, 86 previously published ITS sequences from GenBank were used to test the monophyly of the complex worldwide. Phylogenetic analyses were conducted using Bayesian inference and maximum parsimony. The results indicate that most samples of A. monspessulanum species from Iran were part of a monophyletic clade with 8 samples of A. ibericum from Georgia, A. hyrcanum from Iran and one of A. sempervirens from Greece (PP= 1; BS= 79%. Our results indicate that use of morphological characteristics coupled with molecular data will be most effective.

  5. Cloning Yeast Actin cDNA Leads to an Investigative Approach for the Molecular Biology Laboratory

    Science.gov (United States)

    Black, Michael W.; Tuan, Alice; Jonasson, Erin

    2008-01-01

    The emergence of molecular tools in multiple disciplines has elevated the importance of undergraduate laboratory courses that train students in molecular biology techniques. Although it would also be desirable to provide students with opportunities to apply these techniques in an investigative manner, this is generally not possible in the…

  6. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  7. Kinetic analysis of Yersinia pestis DNA adenine methyltransferase activity using a hemimethylated molecular break light oligonucleotide.

    Directory of Open Access Journals (Sweden)

    Robert J Wood

    Full Text Available BACKGROUND: DNA adenine methylation plays an important role in several critical bacterial processes including mismatch repair, the timing of DNA replication and the transcriptional control of gene expression. The dependence of bacterial virulence on DNA adenine methyltransferase (Dam has led to the proposal that selective Dam inhibitors might function as broad spectrum antibiotics. METHODOLOGY/PRINCIPAL FINDINGS: Herein we report the expression and purification of Yersinia pestis Dam and the development of a continuous fluorescence based assay for DNA adenine methyltransferase activity that is suitable for determining the kinetic parameters of the enzyme and for high throughput screening against potential Dam inhibitors. The assay utilised a hemimethylated break light oligonucleotide substrate containing a GATC methylation site. When this substrate was fully methylated by Dam, it became a substrate for the restriction enzyme DpnI, resulting in separation of fluorophore (fluorescein and quencher (dabcyl and therefore an increase in fluorescence. The assays were monitored in real time using a fluorescence microplate reader in 96 well format and were used for the kinetic characterisation of Yersinia pestis Dam, its substrates and the known Dam inhibitor, S-adenosylhomocysteine. The assay has been validated for high throughput screening, giving a Z-factor of 0.71+/-0.07 indicating that it is a sensitive assay for the identification of inhibitors. CONCLUSIONS/SIGNIFICANCE: The assay is therefore suitable for high throughput screening for inhibitors of DNA adenine methyltransferases and the kinetic characterisation of the inhibition.

  8. Molecular DNA identification of medicinal plants used by traditional healers in Malaysia.

    Science.gov (United States)

    Aziz, N A A; Ahmad, M I; Naim, D M

    2015-12-07

    Plants have been used throughout human history for food and medicine. However, many plants are toxic, and cannot easily be morphologically distinguished from non-toxic plants. DNA identification solves this problem and is widely used. Nonetheless, plant DNA barcode identification faces a number of challenges, and many studies have been conducted to find suitable barcodes. The present study was conducted to test the efficiency of commonly used primers, namely ITS2, rpoC1, and trnH-psbA, in order to find the best DNA barcode markers for the identification of medicinal plants in Malaysia. Fresh leaves from 12 medicinal plants that are commonly used by Malay traditional healers were collected from the Tropical Spice Garden, Pulau Pinang, and subjected to polymerase chain reaction amplification using ITS2, rpoC1, and trnH-psbA DNA markers. We found that trnH-psbA is the best DNA marker for the species-level identification of medicinal plants in Malaysia.

  9. Chemical modification of DNA: Molecular specificity studied by tandem mass spectrometry and liquid chromatography

    International Nuclear Information System (INIS)

    Chang, Ching-jer; Cooks, R.G.; Chae, Whi-Gun; Wood, J.M.

    1989-01-01

    Chemical modifications of DNA in vitro could be directly studied by C-13 NMR and P-31 NMR, which eliminated all degradation and separation processes. The prospects of utilized the NMR method in the in vitro experiments are limited because of the inherent low sensitivity of NMR and low level of DNA modification. We have developed a reverse-phase ion-paired HPLC method to study DNA modifications by methylating agents. The structural specificity of HPLC is significantly enhanced by conjunction with the specificity of enzymic transformations. The HPLC studies have also revealed the limitation of HPLC method for simultaneous determination of many minor modified nucleosides. This problem has been overcome by tandem mass spectrometry. In conjunction with the resolving power of HPLC in separating isomers, desorption chemical ionization tandem mass spectrometry has been utilized in the determination of the modified nucleosides at the picomole level using stable-isotope labeled compounds as internal references

  10. Molecular cloning and analysis of DNA repair gene from the radioresistant bacterium deinococcus radiodurans

    International Nuclear Information System (INIS)

    Du Zeji; Wang Mingsuo

    1998-12-01

    Deinococcus radiodurans (Dr) possesses a prominent ability to repair DNA injury induced by various DNA-damaging agents including mitomycin C (MC), ultraviolet light (UV) and ionizing radiation. A DNA repair mutant Dr KH3111 is a streptomycin resistant (Sm R ) derivative of KH311 which is generated by treatment with nitrosoguanidine and is sensitive to MC, 8-trimethyl-psoralen, UV and γ-ray irradiation. Gene affected by a mutation in the mutant is identified and its nucleotide sequence is determined. A complete open reading frame (ORF) which encompassed the KH3111 mutation region is found and tentatively designated as orf144b. The deduced amino acid (aa) sequence of orf144b consists of 284 aa and has no significant homology to other known proteins. The exact KH3111 mutation site is one nucleotide altered (G to A) in the sequence of orf144b in the mutant. The KH3111 mutation causes the substitution of Gly for Glu at aa position 149 of Orf144b. Survival measurements of a revertant KH3112 which was produced by transforming with DNA containing a part of the orf144b gene of KD8301 showed that the resistances to MC, UV and γ-ray in the revertant were fully restored at a level equal to the wild type. Thus, the orf144b gene required for the multiple-DNA-damaging agent resistance of Dr was designated with the name of pprA (Pleiotropic gene promoting DNA repair). This new gene can express in E. coli at very high level, and make the host E. coli resistant to MC, UV and γ-ray. The pprA gene does not express in normal Dr, but it can be induced to express by treatment with MC, UV and γ-ray. It was thought that the PprA polypeptide is a cytoplasmic protein because of the absence of characteristics found in the aa sequence of membrane proteins

  11. Molecular and immunological characterization of a DNA-launched yellow fever virus 17D infectious clone.

    Science.gov (United States)

    Jiang, Xiaohong; Dalebout, Tim J; Lukashevich, Igor S; Bredenbeek, Peter J; Franco, David

    2015-04-01

    Yellow fever virus (YFV)-17D is an empirically developed, highly effective live-attenuated vaccine that has been administered to human beings for almost a century. YFV-17D has stood as a paradigm for a successful viral vaccine, and has been exploited as a potential virus vector for the development of recombinant vaccines against other diseases. In this study, a DNA-launched YFV-17D construct (pBeloBAC-FLYF) was explored as a new modality to the standard vaccine to combine the commendable features of both DNA vaccine and live-attenuated viral vaccine. The DNA-launched YFV-17D construct was characterized extensively both in cell culture and in mice. High titres of YFV-17D were generated upon transfection of the DNA into cells, whereas a mutant with deletion in the capsid-coding region (pBeloBAC-YF/ΔC) was restricted to a single round of infection, with no release of progeny virus. Homologous prime-boost immunization of AAD mice with both pBeloBAC-FLYF and pBeloBAC-YF/ΔC elicited specific dose-dependent cellular immune response against YFV-17D. Vaccination of A129 mice with pBeloBAC-FLYF resulted in the induction of YFV-specific neutralizing antibodies in all vaccinated subjects. These promising results underlined the potential of the DNA-launched YFV both as an alternative to standard YFV-17D vaccination and as a vaccine platform for the development of DNA-based recombinant YFV vaccines. © 2015.

  12. A DNA biosensor for molecular diagnosis of Aeromonas hydrophila using zinc sulfide nanospheres

    Directory of Open Access Journals (Sweden)

    M. Negahdary

    2017-07-01

    Full Text Available Today, identification of pathogenic bacteria using modern and accurate methods is inevitable. Integration in electrochemical measurements with nanotechnology has led to the design of efficient and sensitive DNA biosensors against bacterial agents. Here, efforts were made to detect Aeromonas hydrophila using aptamers as probes and zinc sulfide (ZnS nanospheres as signal enhancers and electron transfer facilitators. After modification of the working electrode area (in a screen-printed electrode with ZnS nanospheres through electrodeposition, the coated surface of a modified electrode with ZnS nanospheres was investigated through scanning electron microscopy (SEM. The size of synthesized ZnS nanospheres was estimated at about 20–50 nm and their shape was in the form of porous plates in microscopic observations. All electrochemical measurements were performed using cyclic voltammetry (CV, electrochemical impedance spectroscopy (EIS, and constant potential amperometry (CPA techniques. The designed DNA biosensor was able to detect deoxyribonucleic acid (DNA of Aeromonas hydrophila in the range 1.0  ×  10−4 to 1.0  ×  10−9 mol L−1; the limit of detection (LOD in this study was 1  ×  10−13 mol L−1. This DNA biosensor showed satisfactory thermal and pH stability. Reproducibility for this DNA biosensor was measured and the relative standard deviation (RSD of the performance of this DNA biosensor was calculated as 5 % during 42 days.

  13. Molecular structure and chromosome distribution of three repetitive DNA families in Anemone hortensis L. (Ranunculaceae).

    Science.gov (United States)

    Mlinarec, Jelena; Chester, Mike; Siljak-Yakovlev, Sonja; Papes, Drazena; Leitch, Andrew R; Besendorfer, Visnja

    2009-01-01

    The structure, abundance and location of repetitive DNA sequences on chromosomes can characterize the nature of higher plant genomes. Here we report on three new repeat DNA families isolated from Anemone hortensis L.; (i) AhTR1, a family of satellite DNA (stDNA) composed of a 554-561 bp long EcoRV monomer; (ii) AhTR2, a stDNA family composed of a 743 bp long HindIII monomer and; (iii) AhDR, a repeat family composed of a 945 bp long HindIII fragment that exhibits some sequence similarity to Ty3/gypsy-like retroelements. Fluorescence in-situ hybridization (FISH) to metaphase chromosomes of A. hortensis (2n = 16) revealed that both AhTR1 and AhTR2 sequences co-localized with DAPI-positive AT-rich heterochromatic regions. AhTR1 sequences occur at intercalary DAPI bands while AhTR2 sequences occur at 8-10 terminally located heterochromatic blocks. In contrast AhDR sequences are dispersed over all chromosomes as expected of a Ty3/gypsy-like element. AhTR2 and AhTR1 repeat families include polyA- and polyT-tracks, AT/TA-motifs and a pentanucleotide sequence (CAAAA) that may have consequences for chromatin packing and sequence homogeneity. AhTR2 repeats also contain TTTAGGG motifs and degenerate variants. We suggest that they arose by interspersion of telomeric repeats with subtelomeric repeats, before hybrid unit(s) amplified through the heterochromatic domain. The three repetitive DNA families together occupy approximately 10% of the A. hortensis genome. Comparative analyses of eight Anemone species revealed that the divergence of the A. hortensis genome was accompanied by considerable modification and/or amplification of repeats.

  14. Molecular studies in olive (Olea europaea L.): overview on DNA markers applications and recent advances in genome analysis.

    Science.gov (United States)

    Bracci, T; Busconi, M; Fogher, C; Sebastiani, L

    2011-04-01

    Olive (Olea europaea L.) is one of the oldest agricultural tree crops worldwide and is an important source of oil with beneficial properties for human health. This emblematic tree crop of the Mediterranean Basin, which has conserved a very wide germplasm estimated in more than 1,200 cultivars, is a diploid species (2n = 2x = 46) that is present in two forms, namely wild (Olea europaea subsp. europaea var. sylvestris) and cultivated (Olea europaea subsp. europaea var. europaea). In spite of its economic and nutritional importance, there are few data about the genetic of olive if compared with other fruit crops. Available molecular data are especially related to the application of molecular markers to the analysis of genetic variability in Olea europaea complex and to develop efficient molecular tools for the olive oil origin traceability. With regard to genomic research, in the last years efforts are made for the identification of expressed sequence tag, with particular interest in those sequences expressed during fruit development and in pollen allergens. Very recently the sequencing of chloroplast genome provided new information on the olive nucleotide sequence, opening the olive genomic era. In this article, we provide an overview of the most relevant results in olive molecular studies. A particular attention was given to DNA markers and their application that constitute the most part of published researches. The first important results in genome analysis were reported.

  15. Some new methyl-8-methoxypsoralens: synthesis, photobinding to DNA, photobiological properties and molecular modelling.

    Science.gov (United States)

    Gia, O; Anselmo, A; Pozzan, A; Antonello, C; Magno, S M; Uriarte, E

    1997-01-01

    The tricyclic structure of known natural photochemotherapeutic drugs such as 8-methoxypsoralen and 5-methoxypsoralen is often taken as a model in the search of new photosensitizer agents with less phototoxic and mutagenic effects. This paper describes the synthesis, characterization, photobinding to DNA, photobiological properties and computational chemistry of some 8-methoxypsoralen derivatives bearing two or three methyl groups at the key positions of the two photoactive double bonds. Results showed that photoreactivity and photobiological behaviour depend on the pattern of methyl substitutions. Antiproliferative activity in cell lines shows good correlation with DNA interaction data.

  16. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  17. DNA Immobilization and Hybridization Detection by the Intrinsic Molecular Charge Using Capacitive Field-Effect Sensors Modified with a Charged Weak Polyelectrolyte Layer.

    Science.gov (United States)

    Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J

    2015-09-16

    Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.

  18. DNA fingerprinting of sugarcane for detecting molecular evidence of somaclonal variation

    International Nuclear Information System (INIS)

    Ramos Leal, M.; Canales, E.; Michel, R.; Coto, O.; Cornide, M.T.

    1998-01-01

    Molecular characterisation of eight sugarcane mutants which tolerate 1% NaCl, was performed by means of restriction fragment length polymorphism (RFLP) analysis at the genomic level, using a group of molecular probes for ribosomal DNAs and two others, Δ-pyrroline-5-carboxylate reductase (ΔP5CR) and ATPase, probably related to salinity stress tolerance. Results showed the molecular evidence of genetic changes in comparison to the susceptible donor variety and the possible presence of more that one mechanism to tolerate salt stress. (author)

  19. Birth of scale-free molecular networks and the number of distinct DNA and protein domains per genome.

    Science.gov (United States)

    Rzhetsky, A; Gomez, S M

    2001-10-01

    Current growth in the field of genomics has provided a number of exciting approaches to the modeling of evolutionary mechanisms within the genome. Separately, dynamical and statistical analyses of networks such as the World Wide Web and the social interactions existing between humans have shown that these networks can exhibit common fractal properties-including the property of being scale-free. This work attempts to bridge these two fields and demonstrate that the fractal properties of molecular networks are linked to the fractal properties of their underlying genomes. We suggest a stochastic model capable of describing the evolutionary growth of metabolic or signal-transduction networks. This model generates networks that share important statistical properties (so-called scale-free behavior) with real molecular networks. In particular, the frequency of vertices connected to exactly k other vertices follows a power-law distribution. The shape of this distribution remains invariant to changes in network scale: a small subgraph has the same distribution as the complete graph from which it is derived. Furthermore, the model correctly predicts that the frequencies of distinct DNA and protein domains also follow a power-law distribution. Finally, the model leads to a simple equation linking the total number of different DNA and protein domains in a genome with both the total number of genes and the overall network topology. MatLab (MathWorks, Inc.) programs described in this manuscript are available on request from the authors. ar345@columbia.edu.

  20. Elucidating the evolutionary conserved DNA-binding specificities of WRKY transcription factors by molecular dynamics and in vitro binding assays

    Science.gov (United States)

    Brand, Luise H.; Fischer, Nina M.; Harter, Klaus; Kohlbacher, Oliver; Wanke, Dierk

    2013-01-01

    WRKY transcription factors constitute a large protein family in plants that is involved in the regulation of developmental processes and responses to biotic or abiotic stimuli. The question arises how stimulus-specific responses are mediated given that the highly conserved WRKY DNA-binding domain (DBD) exclusively recognizes the ‘TTGACY’ W-box consensus. We speculated that the W-box consensus might be more degenerate and yet undetected differences in the W-box consensus of WRKYs of different evolutionary descent exist. The phylogenetic analysis of WRKY DBDs suggests that they evolved from an ancestral group IIc-like WRKY early in the eukaryote lineage. A direct descent of group IIc WRKYs supports a monophyletic origin of all other group II and III WRKYs from group I by loss of an N-terminal DBD. Group I WRKYs are of paraphyletic descent and evolved multiple times independently. By homology modeling, molecular dynamics simulations and in vitro DNA–protein interaction-enzyme-linked immunosorbent assay with AtWRKY50 (IIc), AtWRKY33 (I) and AtWRKY11 (IId) DBDs, we revealed differences in DNA-binding specificities. Our data imply that other components are essentially required besides the W-box-specific binding to DNA to facilitate a stimulus-specific WRKY function. PMID:23975197

  1. Molecular mechanism of radioadaptive response: A cross-adaptive response for enhanced repair of DNA damage in adapted cells

    International Nuclear Information System (INIS)

    Takaji Ikushima

    1997-01-01

    The radioadaptive response (RAR) has been attributed to the induction of a repair mechanism by low doses of ionizing radiation, but the molecular nature of the mechanism is not yet elucidated. We have characterized RAR in a series of experiments in cultured Chinese hamster V79 cells. A 4-h interval is required for the full expression of RAR, which decays with the progression of cell proliferation. Treatments with inhibitors of poly(ADP-ribose) polymerase, protein- or RNA synthesis, and protein kinase C suppress the RAR expression. The RAR cross-reacts on clastogenic lesions induced by other physical and chemical DNA-damaging agents. The presence of newly synthesised proteins has been detected during the expression period. Experiments performed using single-cell gel electrophoresis provided more direct evidence for a faster and enhaced DNA repair rate in adapted cells. Here, using single-cell gel electrophoresis, a cross-adaptive response has been demonstrated for enhanced repair of DNA damage induced by neocarzinostatin in radio-adapted cells. (author)

  2. Inclusion of methoxy groups inverts the thermodynamic stabilities of DNA-RNA hybrid duplexes: A molecular dynamics simulation study.

    Science.gov (United States)

    Suresh, Gorle; Priyakumar, U Deva

    2015-09-01

    Modified nucleic acids have found profound applications in nucleic acid based technologies such as antisense and antiviral therapies. Previous studies on chemically modified nucleic acids have suggested that modifications incorporated in furanose sugar especially at 2'-position attribute special properties to nucleic acids when compared to other modifications. 2'-O-methyl modification to deoxyribose sugars of DNA-RNA hybrids is one such modification that increases nucleic acid stability and has become an attractive class of compounds for potential antisense applications. It has been reported that modification of DNA strands with 2'-O-methyl group reverses the thermodynamic stability of DNA-RNA hybrid duplexes. Molecular dynamics simulations have been performed on two hybrid duplexes (DR and RD) which differ from each other and 2'-O-methyl modified counterparts to investigate the effect of 2'-O-methyl modification on their duplex stability. The results obtained suggest that the modification drives the conformations of both the hybrid duplexes towards A-RNA like conformation. The modified hybrid duplexes exhibit significantly contrasting dynamics and hydration patterns compared to respective parent duplexes. In line with the experimental results, the relative binding free energies suggest that the introduced modifications stabilize the less stable DR hybrid, but destabilize the more stable RD duplex. Binding free energy calculations suggest that the increased hydrophobicity is primarily responsible for the reversal of thermodynamic stability of hybrid duplexes. Free energy component analysis further provides insights into the stability of modified duplexes. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  4. Synthesis, spectroscopy, X-ray crystallography, DFT calculations, DNA binding and molecular docking of a propargyl arms containing Schiff base.

    Science.gov (United States)

    Balakrishnan, C; Subha, L; Neelakantan, M A; Mariappan, S S

    2015-11-05

    A propargyl arms containing Schiff base (L) was synthesized by the condensation of 1-[2-hydroxy-4-(prop-2-yn-1-yloxy)phenyl]ethanone with trans-1,2-diaminocyclohexane. The structure of L was characterized by IR, (1)H NMR, (13)C NMR and UV-Vis spectroscopy and by single crystal X-ray diffraction analysis. The UV-Visible spectral behavior of L in different solvents exhibits positive solvatochromism. Density functional calculation of the L in gas phase was performed by using DFT (B3LYP) method with 6-31G basis set. The computed vibrational frequencies and NMR signals of L were compared with the experimental data. Tautomeric stability study inferred that the enolimine is more stable than the ketoamine form. The charge delocalization has been analyzed using natural bond orbital (NBO) analysis. Electronic absorption and emission spectral studies were used to study the binding of L with CT-DNA. The molecular docking was done to identify the interaction of L with A-DNA and B-DNA. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. A molecular-based fast method to determine the extent of DNA ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-07-20

    Jul 20, 2009 ... there is also little amount of cell samples required and it is applicable for most eukaryotic cells, ... pounds present in polluted air, soil or water (Gichner and ... head, the nuclear region and a tail which contains DNA ... elements.

  6. Nuclear DNA polymerase beta from Leishmania infantum. Cloning, molecular analysis and developmental regulation

    Science.gov (United States)

    Taladriz, Soraya; Hanke, Tobias; Ramiro, María J.; García-Díaz, Miguel; Lacoba, Mario García de; Blanco, Luis; Larraga, Vicente

    2001-01-01

    We have identified a novel polymerase beta (Pol β)-like enzyme from Leishmania infantum, a parasite protozoon causing disease in humans. This protein, named Li Pol β, shows a nuclear localization that contrasts with the mitochondrial localization of Pol β from Crithidia fasciculata, a closely related parasite, the only polymerase β described so far in Trypanosomatidae. Li Pol β, that belongs to the DNA polymerase X family, displays an evolutionarily conserved Pol β-type DNA polymerase core, in which most of the key residues involved in DNA binding, nucleotide binding, dRPase and polymerization catalysis are conserved. In agreement with this, Li Pol β, overproduced in Escherichia coli, displayed intrinsic DNA polymerase activity. Cell synchronization experiments showed a correlation between both Li Pol β mRNA and protein levels along the parasite cell cycle. Analysis of these parameters at the different growth phases of the parasite, from the proliferative (non-infective) logarithmic phase to the non-dividing (highly infectious) stationary phase, showed high levels of Li Pol β at the infective phase of the parasite. The data suggest a role of Li Pol β in base excision repair in L.infantum, a parasite usually affected by oxygen stress environments into the macrophage host cells. PMID:11557814

  7. Molecular typing of Borrelia burgdorferi sensu lato by randomly amplified polymorphic DNA fingerprinting analysis

    NARCIS (Netherlands)

    Wang, G.; van Dam, A. P.; Spanjaard, L.; Dankert, J.

    1998-01-01

    To study whether pathogenic clusters of Borrelia burgdorferi sensu lato strains occur, we typed 136 isolates, cultured from specimens from patients (n = 49) with various clinical entities and from ticks (n = 83) or dogs (n = 4) from different geographic regions, by randomly amplified polymorphic DNA

  8. Comparative study of five different DNA fingerprint techniques for molecular typing of Streptococcus pneumoniae strains

    NARCIS (Netherlands)

    P.W.M. Hermans (Peter); M. Sluijter (Marcel); T. Hoogenboezem (Theo); H. Heersma; A.F. van Belkum (Alex); R. de Groot (Ronald)

    1995-01-01

    textabstractThe aim of this study was to identify the strengths and weaknesses of five DNA fingerprint methods for epidemiological typing of Streptococcus pneumoniae. We investigated the usefulness of (i) ribotyping, (ii) BOX fingerprinting with the BOX repetitive sequence of S.

  9. Introduction of exogenous wild soybean DNA into cultivated soybean and RAPD molecular verification

    Institute of Scientific and Technical Information of China (English)

    谢纬武; 王斌; 雷勃钧; 李希臣; 卢翠华; 钱华; 周思君

    1995-01-01

    The exogenous total DNA of the wild high-protein soybean was transferred to cultivatedsoybean through the pollen tube channel and the genomic variation of the transformed progeny was detected bythe method of RAPD(Random Amplified Polymorphic DNA).Distinguished variations were found in one of the 7 transformed plants of the first generation(D1),ofwhich the traits of fruition,outward appearance,leaf shape and flower colour were almost identical withthose of the recipient parent;of which grain weight,seed coat colour and stem strength were situated betweenthe two parents;and there were greatly more pods per plant and 12.5% higher content of protein in seedsthan that of the recipient parent.All the properties have been invariably inherited for 3 generations.Through RAPD analysis of the genomes of the donor,the recipient and the transformed progeny(D3)as agroup,DNA polyrnorphisms were found in amplified products by 24 of 150 primers.The results prove thatthe exogenous DNA caused the distinct variance of the genome.The authors infer that the homogeneousrecombination of large exogenous DNA is the main cause for the variance.

  10. Retinaldehyde dehydrogenase 2 as a molecular adjuvant for enhancement of mucosal immunity during DNA vaccination.

    Science.gov (United States)

    Holechek, Susan A; McAfee, Megan S; Nieves, Lizbeth M; Guzman, Vanessa P; Manhas, Kavita; Fouts, Timothy; Bagley, Kenneth; Blattman, Joseph N

    2016-11-04

    In order for vaccines to induce efficacious immune responses against mucosally transmitted pathogens, such as HIV-1, activated lymphocytes must efficiently migrate to and enter targeted mucosal sites. We have previously shown that all-trans retinoic acid (ATRA) can be used as a vaccine adjuvant to enhance mucosal CD8 + T cell responses during vaccination and improve protection against mucosal viral challenge. However, the ATRA formulation is incompatible with most recombinant vaccines, and the teratogenic potential of ATRA at high doses limits its usage in many clinical settings. We hypothesized that increasing in vivo production of retinoic acid (RA) during vaccination with a DNA vector expressing retinaldehyde dehydrogenase 2 (RALDH2), the rate-limiting enzyme in RA biosynthesis, could similarly provide enhanced programming of mucosal homing to T cell responses while avoiding teratogenic effects. Administration of a RALDH2- expressing plasmid during immunization with a HIVgag DNA vaccine resulted in increased systemic and mucosal CD8 + T cell numbers with an increase in both effector and central memory T cells. Moreover, mice that received RALDH2 plasmid during DNA vaccination were more resistant to intravaginal challenge with a recombinant vaccinia virus expressing the same HIVgag antigen (VACVgag). Thus, RALDH2 can be used as an alternative adjuvant to ATRA during DNA vaccination leading to an increase in both systemic and mucosal T cell immunity and better protection from viral infection at mucosal sites. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. On the Use of Molecular Dynamics Simulations for Probing Allostery through DNA

    Czech Academy of Sciences Publication Activity Database

    Dršata, Tomáš; Zgarbová, M.; Jurečka, P.; Šponer, Jiří; Lankaš, Filip

    2016-01-01

    Roč. 110, č. 4 (2016), s. 874-876 ISSN 0006-3495 R&D Projects: GA ČR(CZ) GA14-21893S Institutional support: RVO:61388963 ; RVO:68081707 Keywords : B-DNA * modulation Subject RIV: BO - Biophysics Impact factor: 3.656, year: 2016

  12. DNA responds to ionizing radiation as an insulator, not as a "molecular wire"

    NARCIS (Netherlands)

    Debije, M.G.; Milano, M.T.; Bernhard, W.A.

    1999-01-01

    The yields of radicals trapped on DNA, measured by EPR spectroscopy of oligodeoxyribonucleotide crystals (the EPR spectrum of a single crystal of d(CCCTAGGG) is shown), are found to be very high (0.7 µmol¿J-1) and insensitive to long-range (>106 base pairs) versus short-range stacking (8 base pairs)

  13. Application of PCR-mediated DNA typing in the molecular epidemiology of medically important microorganisms

    NARCIS (Netherlands)

    A.F. van Belkum (Alex)

    1996-01-01

    textabstractThis thesis describes the development, application and validation of the newer DNA analysis techniques within the field of microbiological epidemiology. Emphasis is placed on the use of the polymerase chain reaction (PCR), a test-tube technique enabling the amplification of (parts of)

  14. Molecular species identification with rich floristic sampling: DNA barcoding the pteridophyte flora of Japan.

    Directory of Open Access Journals (Sweden)

    Atsushi Ebihara

    Full Text Available BACKGROUND: DNA barcoding is expected to be an effective identification tool for organisms with heteromorphic generations such as pteridophytes, which possess a morphologically simple gametophyte generation. Although a reference data set including complete coverage of the target local flora/fauna is necessary for accurate identification, DNA barcode studies including such rich taxonomic sampling on a countrywide scale are lacking. METHODOLOGY/PRINCIPAL FINDINGS: The Japanese pteridophyte flora (733 taxa including subspecies and varieties was used to test the utility of two plastid DNA barcode regions (rbcL and trnH-psbA with the intention of developing an identification system for native gametophytes. DNA sequences were obtained from each of 689 (94.0% taxa for rbcL and 617 (84.2% taxa for trnH-psbA. Mean interspecific divergence values across all taxon pairs (K2P genetic distances did not reveal a significant difference in rate between trnH-psbA and rbcL, but mean K2P distances of each genus showed significant heterogeneity according to systematic position. The minimum fail rate of taxon discrimination in an identification test using BLAST (12.52% was obtained when rbcL and trnH-psbA were combined, and became lower in datasets excluding infraspecific taxa or apogamous taxa, or including sexual diploids only. CONCLUSIONS/SIGNIFICANCE: This study demonstrates the overall effectiveness of DNA barcodes for species identification in the Japanese pteridophyte flora. Although this flora is characterized by a high occurrence of apogamous taxa that pose a serious challenge to identification using DNA barcodes, such taxa are limited to a small number of genera, and only minimally detract from the overall success rate. In the case that a query sequence is matched to a known apogamous genus, routine species identification may not be possible. Otherwise, DNA barcoding is a practical tool for identification of most Japanese pteridophytes, and is especially

  15. Molecular phylogeny of ocelloid-bearing dinoflagellates (Warnowiaceae) as inferred from SSU and LSU rDNA sequences.

    Science.gov (United States)

    Hoppenrath, Mona; Bachvaroff, Tsvetan R; Handy, Sara M; Delwiche, Charles F; Leander, Brian S

    2009-05-25

    Dinoflagellates represent a major lineage of unicellular eukaryotes with unparalleled diversity and complexity in morphological features. The monophyly of dinoflagellates has been convincingly demonstrated, but the interrelationships among dinoflagellate lineages still remain largely unresolved. Warnowiid dinoflagellates are among the most remarkable eukaryotes known because of their possession of highly elaborate ultrastructural systems: pistons, nematocysts, and ocelloids. Complex organelles like these are evolutionary innovations found only in a few athecate dinoflagellates. Moreover, the taxonomy of warnowiids is extremely confusing and inferences about the evolutionary history of this lineage are mired by the absence of molecular phylogenetic data from any member of the group. In this study, we provide the first molecular phylogenetic data for warnowiids and couple them with a review of warnowiid morphological features in order to formulate a hypothetical framework for understanding character evolution within the group. These data also enabled us to evaluate the evolutionary relationship(s) between warnowiids and the other group of dinoflagellates with complex organelles: polykrikoids. Molecular phylogenetic analyses of SSU and LSU rDNA sequences demonstrated that warnowiids form a well-supported clade that falls within the more inclusive Gymnodinium sensu stricto clade. These data also confirmed that polykrikoids are members of the Gymnodinium sensu stricto clade as well; however, a specific sister relationship between the warnowiid clade and the polykrikoid clade was unresolved in all of our analyses. Nonetheless, the new DNA sequences from different isolates of warnowiids provided organismal anchors for several previously unidentified sequences derived from environmental DNA surveys of marine biodiversity. Comparative morphological data and molecular phylogenetic data demonstrate that the polykrikoid and the warnowiid clade are closely related to each other

  16. Molecular phylogeny of ocelloid-bearing dinoflagellates (Warnowiaceae as inferred from SSU and LSU rDNA sequences

    Directory of Open Access Journals (Sweden)

    Handy Sara M

    2009-05-01

    Full Text Available Abstract Background Dinoflagellates represent a major lineage of unicellular eukaryotes with unparalleled diversity and complexity in morphological features. The monophyly of dinoflagellates has been convincingly demonstrated, but the interrelationships among dinoflagellate lineages still remain largely unresolved. Warnowiid dinoflagellates are among the most remarkable eukaryotes known because of their possession of highly elaborate ultrastructural systems: pistons, nematocysts, and ocelloids. Complex organelles like these are evolutionary innovations found only in a few athecate dinoflagellates. Moreover, the taxonomy of warnowiids is extremely confusing and inferences about the evolutionary history of this lineage are mired by the absence of molecular phylogenetic data from any member of the group. In this study, we provide the first molecular phylogenetic data for warnowiids and couple them with a review of warnowiid morphological features in order to formulate a hypothetical framework for understanding character evolution within the group. These data also enabled us to evaluate the evolutionary relationship(s between warnowiids and the other group of dinoflagellates with complex organelles: polykrikoids. Results Molecular phylogenetic analyses of SSU and LSU rDNA sequences demonstrated that warnowiids form a well-supported clade that falls within the more inclusive Gymnodinium sensu stricto clade. These data also confirmed that polykrikoids are members of the Gymnodinium sensu stricto clade as well; however, a specific sister relationship between the warnowiid clade and the polykrikoid clade was unresolved in all of our analyses. Nonetheless, the new DNA sequences from different isolates of warnowiids provided organismal anchors for several previously unidentified sequences derived from environmental DNA surveys of marine biodiversity. Conclusion Comparative morphological data and molecular phylogenetic data demonstrate that the polykrikoid

  17. Saw palmetto alters nuclear measurements reflecting DNA content in men with symptomatic BPH: evidence for a possible molecular mechanism.

    Science.gov (United States)

    Veltri, Robert W; Marks, Leonard S; Miller, M Craig; Bales, Wes D; Fan, John; Macairan, Maria Luz; Epstein, Jonathan I; Partin, Alan W

    2002-10-01

    To examine the nuclear chromatin characteristics of epithelial cells, looking for an SPHB-mediated effect on nuclear DNA structure and organization. Saw palmetto herbal blend (SPHB) causes contraction of prostate epithelial cells and suppression of tissue dihydrotestosterone levels in men with symptomatic benign prostatic hyperplasia, but a fundamental mechanism remains unknown. A 6-month randomized trial, comparing prostatic tissue of men treated with SPHB (n = 20) or placebo (n = 20), was performed. At baseline, the two groups were similar in age (65 versus 64 years), symptoms (International Prostate Symptom Score 18 versus 17), uroflow (maximal urinary flow rate 10 versus 11 mL/s), prostate volume (59 versus 58 cm(3)), prostate-specific antigen (4.2 versus 2.7 ng/mL), and percentage of epithelium (17% versus 16%). Prostatic tissue was obtained by sextant biopsy before and after treatment. Five-micron sections were Feulgen stained and quantitatively analyzed using the AutoCyte QUIC-DNA imaging system. Images were captured from 200 randomly selected epithelial cell nuclei, and 60 nuclear morphometric descriptors (NMDs) (eg, size, shape, DNA content, and textural features) were determined for each nucleus. Logistic regression analysis was used to assess the differences in the variances of the NMDs between the treated and untreated prostate epithelial cells. At baseline, the SPHB and placebo groups had similar NMD values. After 6 months of placebo, no significant change from baseline was found in the NMDs. However, after 6 months of SPHB, 25 of the 60 NMDs were significantly different compared with baseline, and a multivariate model for predicting treatment effect using 4 of the 25 was created (P <0.001). The multivariate model had an area under the receiver operating characteristic curve of 94% and an accuracy of 85%. Six months of SPHB treatment appears to alter the DNA chromatin structure and organization in prostate epithelial cells. Thus, a possible molecular

  18. Comparison of pathogen DNA isolation methods from large volumes of whole blood to improve molecular diagnosis of bloodstream infections.

    Directory of Open Access Journals (Sweden)

    Anne J M Loonen

    Full Text Available For patients suffering from bloodstream infections (BSI molecular diagnostics from whole blood holds promise to provide fast and adequate treatment. However, this approach is hampered by the need of large blood volumes. Three methods for pathogen DNA isolation from whole blood were compared, i.e. an enzymatic method (MolYsis, 1-5 ml, the novel non-enzymatic procedure (Polaris, 1-5 ml, and a method that does not entail removal of human DNA (Triton-Tris-EDTA EasyMAG, 200 µl. These methods were evaluated by processing blood spiked with 0-1000 CFU/ml of Staphylococcus aureus, Pseudomonas aeruginosa and Candida albicans. Downstream detection was performed with real-time PCR assays. Polaris and MolYsis processing followed by real-time PCRs enabled pathogen detection at clinically relevant concentrations of 1-10 CFU/ml blood. By increasing sample volumes, concurrent lower cycle threshold (Ct values were obtained at clinically relevant pathogen concentrations, demonstrating the benefit of using larger blood volumes. A 100% detection rate at a concentration of 10 CFU/ml for all tested pathogens was obtained with the Polaris enrichment, whereas comparatively lower detection rates were measured for MolYsis (50-67% and EasyMAG (58-79%. For the samples with a concentration of 1 CFU/ml Polaris resulted in most optimal detection rates of 70-75% (MolYsis 17-50% and TTE-EasyMAG 20-36%. The Polaris method was more reproducible, less labour intensive, and faster (45 minutes (including Qiagen DNA extraction vs. 2 hours (MolYsis. In conclusion, Polaris and MolYsis enrichment followed by DNA isolation and real-time PCR enables reliable and sensitive detection of bacteria and fungi from 5 ml blood. With Polaris results are available within 3 hours, showing potential for improved BSI diagnostics.

  19. Molecular DNA identification of blood sources fed on, for Culicine mosquitoes (Diptera: Culicidae collected in the Songkhla province, southern Thailand

    Directory of Open Access Journals (Sweden)

    Theerakamol Pengsakul

    2017-12-01

    Full Text Available Culicine mosquitoes are medically important vectors. Therefore, mosquito control measures are a crucial strategy to interrupt disease transmission. Collection of data on mosquito feeding patterns is crucial for developing an effective vector control strategy. The objective of this study was to use molecular biology methods to identify the sources of DNA in mosquito blood meals. The DNA from blood meals in the mosquito stomachs was extracted and amplified with multiplex PCR, using specific primer sets based on the mitochondrial cytochrome b gene, to identify the DNA sources among human, pig, goat, dog, cow, and chicken. Among the 297 mosquito samples collected in the Songkhla province of Thailand, in Aedes spp. mosquitoes the percentages positive for human, dog, pig, chicken, cow, a mixture of 2 vertebrate DNAs, or of 3, and negative (no identified DNA were 61.90, 2.38, 2.38, 0.60, 0.60, 4.18, 1.20 and 26.79% respectively. In Culex spp. blood meals the rank order was different: fractions positive for chicken, human, dog, cow, goat, pig, a mixture of 2 or 3 vertebrate DNAs, and negative were 40.83, 10.00, 5.00, 4.17, 1.67, 0.83, 8.32, 3.32 and 25.83% respectively. This study shows that feeding behaviors of the two species differ, with most Aedes spp. blood meals containing human blood, while Culex spp. had primarily consumed chicken blood. An improved understanding of the feeding behaviors of mosquitoes could contribute to new, more effective strategies for the control of mosquito populations.

  20. Targeted impairment of thymidine kinase 2 expression in cells induces mitochondrial DNA depletion and reveals molecular mechanisms of compensation of mitochondrial respiratory activity

    International Nuclear Information System (INIS)

    Villarroya, Joan; Lara, Mari-Carmen; Dorado, Beatriz; Garrido, Marta; Garcia-Arumi, Elena; Meseguer, Anna; Hirano, Michio; Vila, Maya R.

    2011-01-01

    Highlights: → We impaired TK2 expression in Ost TK1 - cells via siRNA-mediated interference (TK2 - ). → TK2 impairment caused severe mitochondrial DNA (mtDNA) depletion in quiescent cells. → Despite mtDNA depletion, TK2 - cells show high cytochrome oxidase activity. → Depletion of mtDNA occurs without imbalance in the mitochondrial dNTP pool. → Nuclear-encoded ENT1, DNA-pol γ, TFAM and TP gene expression is lowered in TK2 - cells. -- Abstract: The mitochondrial DNA (mtDNA) depletion syndrome comprises a clinically heterogeneous group of diseases characterized by reductions of the mtDNA abundance, without associated point mutations or rearrangements. We have developed the first in vitro model to study of mtDNA depletion due to reduced mitochondrial thymidine kinase 2 gene (TK2) expression in order to understand the molecular mechanisms involved in mtDNA depletion syndrome due to TK2 mutations. Small interfering RNA targeting TK2 mRNA was used to decrease TK2 expression in Ost TK1 - cells, a cell line devoid of endogenous thymidine kinase 1 (TK1). Stable TK2-deficient cell lines showed a reduction of TK2 levels close to 80%. In quiescent conditions, TK2-deficient cells showed severe mtDNA depletion, also close to 80% the control levels. However, TK2-deficient clones showed increased cytochrome c oxidase activity, higher cytochrome c oxidase subunit I transcript levels and higher subunit II protein expression respect to control cells. No alterations of the deoxynucleotide pools were found, whereas a reduction in the expression of genes involved in nucleoside/nucleotide homeostasis (human equilibrative nucleoside transporter 1, thymidine phosphorylase) and mtDNA maintenance (DNA-polymerase γ, mitochondrial transcription factor A) was observed. Our findings highlight the importance of cellular compensatory mechanisms that enhance the expression of respiratory components to ensure respiratory activity despite profound depletion in mtDNA levels.

  1. Towards clinical molecular diagnosis of inherited cardiac conditions: a comparison of bench-top genome DNA sequencers.

    Directory of Open Access Journals (Sweden)

    Xinzhong Li

    Full Text Available Molecular genetic testing is recommended for diagnosis of inherited cardiac disease, to guide prognosis and treatment, but access is often limited by cost and availability. Recently introduced high-throughput bench-top DNA sequencing platforms have the potential to overcome these limitations.We evaluated two next-generation sequencing (NGS platforms for molecular diagnostics. The protein-coding regions of six genes associated with inherited arrhythmia syndromes were amplified from 15 human samples using parallelised multiplex PCR (Access Array, Fluidigm, and sequenced on the MiSeq (Illumina and Ion Torrent PGM (Life Technologies. Overall, 97.9% of the target was sequenced adequately for variant calling on the MiSeq, and 96.8% on the Ion Torrent PGM. Regions missed tended to be of high GC-content, and most were problematic for both platforms. Variant calling was assessed using 107 variants detected using Sanger sequencing: within adequately sequenced regions, variant calling on both platforms was highly accurate (Sensitivity: MiSeq 100%, PGM 99.1%. Positive predictive value: MiSeq 95.9%, PGM 95.5%. At the time of the study the Ion Torrent PGM had a lower capital cost and individual runs were cheaper and faster. The MiSeq had a higher capacity (requiring fewer runs, with reduced hands-on time and simpler laboratory workflows. Both provide significant cost and time savings over conventional methods, even allowing for adjunct Sanger sequencing to validate findings and sequence exons missed by NGS.MiSeq and Ion Torrent PGM both provide accurate variant detection as part of a PCR-based molecular diagnostic workflow, and provide alternative platforms for molecular diagnosis of inherited cardiac conditions. Though there were performance differences at this throughput, platforms differed primarily in terms of cost, scalability, protocol stability and ease of use. Compared with current molecular genetic diagnostic tests for inherited cardiac arrhythmias

  2. Improved Yield of High Molecular Weight DNA Coincides with Increased Microbial Diversity Access from Iron Oxide Cemented Sub-Surface Clay Environments

    Science.gov (United States)

    Hurt, Richard A.; Robeson, Michael S.; Shakya, Migun; Moberly, James G.; Vishnivetskaya, Tatiana A.; Gu, Baohua; Elias, Dwayne A.

    2014-01-01

    Despite over three decades of progress, extraction of high molecular weight (HMW) DNA from high clay soils or iron oxide cemented clay has remained challenging. HMW DNA is desirable for next generation sequencing as it yields the most comprehensive coverage. Several DNA extraction procedures were compared from samples that exhibit strong nucleic acid adsorption. pH manipulation or use of alternative ion solutions offered no improvement in nucleic acid recovery. Lysis by liquid N2 grinding in concentrated guanidine followed by concentrated sodium phosphate extraction supported HMW DNA recovery from clays high in iron oxides. DNA recovered using 1 M sodium phosphate buffer (PB) as a competitive desorptive wash was 15.22±2.33 µg DNA/g clay, with most DNA consisting of >20 Kb fragments, compared to 2.46±0.25 µg DNA/g clay with the Powerlyzer system (MoBio). Increasing PB concentration in the lysis reagent coincided with increasing DNA fragment length during initial extraction. Rarefaction plots of 16S rRNA (V1–V3 region) pyrosequencing from A-horizon and clay soils showed an ∼80% and ∼400% larger accessed diversity compared to the Powerlyzer soil DNA system, respectively. The observed diversity from the Firmicutes showed the strongest increase with >3-fold more operational taxonomic units (OTU) recovered. PMID:25033199

  3. Molecular recognition of AT-DNA sequences by the induced CD pattern of dibenzotetraaza[14]annulene (DBTAA)–adenine derivatives

    Science.gov (United States)

    Stojković, Marijana Radić; Škugor, Marko; Dudek, Łukasz; Grolik, Jarosław; Eilmes, Julita

    2014-01-01

    Summary An investigation of the interactions of two novel and several known DBTAA–adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA–propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure–activity relation for the studied series of compounds showed that the essential structural features for the ICD recognition are a) the presence of DNA-binding appendages (adenine side chain and positively charged side chain) on both DBTAA side chains, and b) the presence of a short propyl linker, which does not support intramolecular aromatic stacking between DBTAA and adenine. The observed AT-DNA-ICD pattern differs from previously reported ss-DNA (poly dT) ICD recognition by a strong negative ICD band at 350 nm, which allows for the dynamic differentiation between ss-DNA (poly dT) and coupled ds-AT-DNA. PMID:25246976

  4. Extraction of inhibitor-free metagenomic DNA from polluted sediments, compatible with molecular diversity analysis using adsorption and ion-exchange treatments.

    Science.gov (United States)

    Desai, Chirayu; Madamwar, Datta

    2007-03-01

    PCR inhibitor-free metagenomic DNA of high quality and high yield was extracted from highly polluted sediments using a simple remediation strategy of adsorption and ion-exchange chromatography. Extraction procedure was optimized with series of steps, which involved gentle mechanical lysis, treatment with powdered activated charcoal (PAC) and ion-exchange chromatography with amberlite resin. Quality of the extracted DNA for molecular diversity analysis was tested by amplifying bacterial 16S rDNA (16S rRNA gene) with eubacterial specific universal primers (8f and 1492r), cloning of the amplified 16S rDNA and ARDRA (amplified rDNA restriction analysis) of the 16S rDNA clones. The presence of discrete differences in ARDRA banding profiles provided evidence for expediency of the DNA extraction protocol in molecular diversity studies. A comparison of the optimized protocol with commercial Ultraclean Soil DNA isolation kit suggested that method described in this report would be more efficient in removing metallic and organic inhibitors, from polluted sediment samples.

  5. Molecular mechanism of DNA replication-coupled inactivation of the initiator protein in Escherichia coli: interaction of DnaA with the sliding clamp-loaded DNA and the sliding clamp-Hda complex.

    Science.gov (United States)

    Su'etsugu, Masayuki; Takata, Makoto; Kubota, Toshio; Matsuda, Yusaku; Katayama, Tsutomu

    2004-06-01

    In Escherichia coli, the ATP-DnaA protein initiates chromosomal replication. After the DNA polymerase III holoenzyme is loaded on to DNA, DnaA-bound ATP is hydrolysed in a manner depending on Hda protein and the DNA-loaded form of the DNA polymerase III sliding clamp subunit, which yields ADP-DnaA, an inactivated form for initiation. This regulatory DnaA-inactivation represses extra initiation events. In this study, in vitro replication intermediates and structured DNA mimicking replicational intermediates were first used to identify structural prerequisites in the process of DnaA-ATP hydrolysis. Unlike duplex DNA loaded with sliding clamps, primer RNA-DNA heteroduplexes loaded with clamps were not associated with DnaA-ATP hydrolysis, and duplex DNA provided in trans did not rescue this defect. At least 40-bp duplex DNA is competent for the DnaA-ATP hydrolysis when a single clamp was loaded. The DnaA-ATP hydrolysis was inhibited when ATP-DnaA was tightly bound to a DnaA box-bearing oligonucleotide. These results imply that the DnaA-ATP hydrolysis involves the direct interaction of ATP-DnaA with duplex DNA flanking the sliding clamp. Furthermore, Hda protein formed a stable complex with the sliding clamp. Based on these, we suggest a mechanical basis in the DnaA-inactivation that ATP-DnaA interacts with the Hda-clamp complex with the aid of DNA binding. Copyright Blackwell Publishing Limited

  6. Protein Science by DNA Sequencing: How Advances in Molecular Biology Are Accelerating Biochemistry.

    Science.gov (United States)

    Higgins, Sean A; Savage, David F

    2018-01-09

    A fundamental goal of protein biochemistry is to determine the sequence-function relationship, but the vastness of sequence space makes comprehensive evaluation of this landscape difficult. However, advances in DNA synthesis and sequencing now allow researchers to assess the functional impact of every single mutation in many proteins, but challenges remain in library construction and the development of general assays applicable to a diverse range of protein functions. This Perspective briefly outlines the technical innovations in DNA manipulation that allow massively parallel protein biochemistry and then summarizes the methods currently available for library construction and the functional assays of protein variants. Areas in need of future innovation are highlighted with a particular focus on assay development and the use of computational analysis with machine learning to effectively traverse the sequence-function landscape. Finally, applications in the fundamentals of protein biochemistry, disease prediction, and protein engineering are presented.

  7. Molecular characterization of MHC-DRB cDNA in water buffalo (Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    Soumen Naskar

    2012-01-01

    Full Text Available In the present study, water buffalo MHC (Bubu-DRB cDNA was cloned and characterized. The 1022 base long-amplified cDNA product encompassed a single open reading frame of 801 bases that coded for 266 amino acids. The Bubu-DRB sequence showed maximum homology with the BoLA-DRB3*0101 allele of cattle. A total of seven amino acid residues were found to be unique for the Bubu-DRB sequence. The majority of amino acid substitutions was observed in the β1 domain. Residues associated with important functions were mostly conserved. Water buffalo DRB was phylogenetically closer to goat DRB*A.

  8. Fast parallel DNA-based algorithms for molecular computation: quadratic congruence and factoring integers.

    Science.gov (United States)

    Chang, Weng-Long

    2012-03-01

    Assume that n is a positive integer. If there is an integer such that M (2) ≡ C (mod n), i.e., the congruence has a solution, then C is said to be a quadratic congruence (mod n). If the congruence does not have a solution, then C is said to be a quadratic noncongruence (mod n). The task of solving the problem is central to many important applications, the most obvious being cryptography. In this article, we describe a DNA-based algorithm for solving quadratic congruence and factoring integers. In additional to this novel contribution, we also show the utility of our encoding scheme, and of the algorithm's submodules. We demonstrate how a variety of arithmetic, shifted and comparative operations, namely bitwise and full addition, subtraction, left shifter and comparison perhaps are performed using strands of DNA.

  9. Three human alcohol dehydrogenase subunits: cDNA structure and molecular and evolutionary divergence

    International Nuclear Information System (INIS)

    Ikuta, T.; Szeto, S.; Yoshida, A.

    1986-01-01

    Class I human alcohol dehydrogenase (ADH; alcohol:NAD + oxidoreductase, EC 1.1.1.1) consists of several homo- and heterodimers of α, β, and γ subunits that are governed by the ADH1, ADH2, and ADH3 loci. The authors previously cloned a full length of cDNA for the β subunit, and the complete sequence of 374 amino acid residues was established. cDNAs for the α and γ subunits were cloned and characterized. A human liver cDNA library, constructed in phage λgt11, was screened by using a synthetic oligonucleotide probe that was matched to the γ but not to the β sequence. Clone pUCADHγ21 and clone pUCADHα15L differed from β cDNA with respect to restriction sites and hybridization with the nucleotide probe. Clone pUCADHγ21 contained an insertion of 1.5 kilobase pairs (kbp) and encodes 374 amino acid residues compatible with the reported amino acid sequence of the γ subunit. Clone pUCADHα15L contained an insertion of 2.4 kbp and included nucleotide sequences that encode 374 amino acid residues for another subunit, the γ subunit. In addition, this clone contained the sequences that encode the COOH-terminal part of the β subunit at its extended 5' region. The amino acid sequences and coding regions of the cDNAs of the three subunits are very similar. A high degree of resemblance is observed also in their 3' noncoding regions. However, distinctive differences exist in the vicinity of the Zn-binding cysteine residue at position 46. Based on the cDNA sequences and the deduced amino acid sequences of the three subunits, their structural and evolutionary relationships are discussed

  10. DNA barcoding for molecular identification of Demodex based on mitochondrial genes.

    Science.gov (United States)

    Hu, Li; Yang, YuanJun; Zhao, YaE; Niu, DongLing; Yang, Rui; Wang, RuiLing; Lu, Zhaohui; Li, XiaoQi

    2017-12-01

    There has been no widely accepted DNA barcode for species identification of Demodex. In this study, we attempted to solve this issue. First, mitochondrial cox1-5' and 12S gene fragments of Demodex folloculorum, D. brevis, D. canis, and D. caprae were amplified, cloned, and sequenced for the first time; intra/interspecific divergences were computed and phylogenetic trees were reconstructed. Then, divergence frequency distribution plots of those two gene fragments were drawn together with mtDNA cox1-middle region and 16S obtained in previous studies. Finally, their identification efficiency was evaluated by comparing barcoding gap. Results indicated that 12S had the higher identification efficiency. Specifically, for cox1-5' region of the four Demodex species, intraspecific divergences were less than 2.0%, and interspecific divergences were 21.1-31.0%; for 12S, intraspecific divergences were less than 1.4%, and interspecific divergences were 20.8-26.9%. The phylogenetic trees demonstrated that the four Demodex species clustered separately, and divergence frequency distribution plot showed that the largest intraspecific divergence of 12S (1.4%) was less than cox1-5' region (2.0%), cox1-middle region (3.1%), and 16S (2.8%). The barcoding gap of 12S was 19.4%, larger than cox1-5' region (19.1%), cox1-middle region (11.3%), and 16S (13.0%); the interspecific divergence span of 12S was 6.2%, smaller than cox1-5' region (10.0%), cox1-middle region (14.1%), and 16S (11.4%). Moreover, 12S has a moderate length (517 bp) for sequencing at once. Therefore, we proposed mtDNA 12S was more suitable than cox1 and 16S to be a DNA barcode for classification and identification of Demodex at lower category level.

  11. Interstrand cross-linking implies contrasting structural consequences for DNA: insights from molecular dynamics

    Czech Academy of Sciences Publication Activity Database

    Bignon, E.; Dršata, Tomáš; Morell, C.; Lankaš, Filip; Dumont, E.

    2017-01-01

    Roč. 45, č. 4 (2017), s. 2188-2195 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GA14-21893S Institutional support: RVO:61388963 Keywords : abasic sites * duplex DNA * mechanical properties Subject RIV: BO - Biophysics OBOR OECD: Biophysics Impact factor: 10.162, year: 2016 https://academic.oup.com/nar/article-lookup/doi/10.1093/nar/gkw1253

  12. Molecular dipole-driven electronic structure modifications of DNA/RNA nucleobases on graphene

    Czech Academy of Sciences Publication Activity Database

    Yin, Y.; Červenka, Jiří; Medhekar, N.

    2017-01-01

    Roč. 8, č. 13 (2017), s. 3087-3094 ISSN 1948-7185 R&D Projects: GA ČR GA14-15357S Grant - others:AV ČR(CZ) Fellowship J. E. Purkyně Institutional support: RVO:68378271 Keywords : graphene * DNA * nucleobase * DFT Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 9.353, year: 2016

  13. DNA Barcoding of Malagasy Rosewoods: Towards a Molecular Identification of CITES-Listed Dalbergia Species.

    Science.gov (United States)

    Hassold, Sonja; Lowry, Porter P; Bauert, Martin R; Razafintsalama, Annick; Ramamonjisoa, Lolona; Widmer, Alex

    2016-01-01

    Illegal selective logging of tropical timber is of increasing concern worldwide. Madagascar is a biodiversity hotspot and home to some of the world's most sought after tropical timber species. Malagasy rosewoods belong to the genus Dalbergia (Fabaceae), which is highly diverse and has a pantropical distribution, but these timber species are among the most threatened as a consequence of intensive illegal selective logging and deforestation. Reliable identification of Dalbergia species from Madagascar is important for law enforcement but is almost impossible without fertile plant material, which is often unavailable during forest inventories or when attempting to identify logged trees of cut wood. DNA barcoding has been promoted as a promising tool for species identification in such cases. In this study we tested whether DNA barcoding with partial sequences of three plastid markers (matK, rbcL and trnL (UAA)) can distinguish between Dalbergia from Madagascar and from other areas of its distributional range, and whether Malagasy species can be distinguished from one another. Phylogenetic analyses revealed that the Malagasy Dalbergia species studied form two monophyletic groups, each containing two subgroups, only one of which corresponds to a single species. We characterized diagnostic polymorphisms in the three DNA barcoding markers that allow rapid discrimination between Dalbergia from Madagascar and from other areas of its distribution range. Species identification success based on individual barcoding markers or combinations was poor, whereas subgroup identification success was much higher (up to 98%), revealing both the value and limitations of a DNA barcoding approach for the identification of closely related Malagasy rosewoods.

  14. Measurement of radiation-induced damage to DNA at the molecular level

    International Nuclear Information System (INIS)

    Dizdaroglu, M.

    1992-01-01

    The present article describes the potential usefulness of the technique of gas chromatography-mass spectrometry (GC/MS) for chemical characterization and quantification of modifications in DNA and in mammalian chromatin. The aim of the article is to give a concise description of the field rather than an exhaustive review, with the emphasis on the practicalities, limitations, applications and comparison with other techniques. (author)

  15. Molecular characterization of six sub population Indonesian local goats based on mitochondrial DNA D-loop

    Directory of Open Access Journals (Sweden)

    Aron Batubara

    2013-03-01

    Full Text Available Indonesian local goats were spread in some region, but there was still limited data’s known about the characteristics of its genetic diversity and origin. The Mitochondrial DNA D-loop sequences were used to study the genetic diversity and relationships of six sub population Indonesian local goats, namely, Kacang, Marica, Samosir, Jawarandu, Muara and Bengali goats. From 539 blood samples and DNA extraction collections were selected about 60 samples (10 samples each sub populations analyzed by PCR-RFLP methods, followed sequence analyzed about 5 PCR products each sub population. The results of the sequence analyses were edited and acquired about 957 bp of nucleotides length. After the alignment analyses were found 50 polymorphic sites which divided into 19 haplotype groups of mtDNA D-loop region. The value of nucleotide diversity was 0.014 ± 0.002. Analysis of Neighbour Joining with Kimura 2 Parameter methods and bootstrap test with 1000 replication indicated that each sub population groups was significantly different between one groups to the others. The maternal lineages origin of six breeds of Indonesian local goats was included to the group of lineage B. The Lineage B was the maternal origin of the haplogroup of goats in the region of East Asia, South Asia, China, Mongolia, North and South Africa, Malaysia, Indonesia, Pakistan and India.

  16. First molecular detection of Leishmania tarentolae-like DNA in Sergentomyia minuta in Spain.

    Science.gov (United States)

    Bravo-Barriga, Daniel; Parreira, Ricardo; Maia, Carla; Blanco-Ciudad, Juan; Afonso, Maria Odete; Frontera, Eva; Campino, Lenea; Pérez-Martín, Juan Enrique; Serrano Aguilera, Francisco Javier; Reina, David

    2016-03-01

    Phlebotomine sand flies (Diptera, Psychodidae) are vectors of multiple Leishmania species, among which Leishmania infantum stands out as a being frequently pathogenic to humans and dogs in Mediterranean countries. In this study, Sergentomyia minuta sand flies were collected using CDC miniature light traps in different 431 biotopes from Southwest Spain. A total of 114 females were tested for the presence of Leishmania DNA by targeting ITS-1 and cyt-B sequences by PCR. Leishmania DNA was detected in one S. minuta. Characterization of the obtained DNA sequences by phylogenetic analyses revealed close relatedness with Leishmania tarentolae Wenyon, 1921 as well as with both human and canine pathogenic strains of Asian origin (China), previously described as Leishmania sp. To our knowledge, this is the first report of phlebotomine sand flies naturally infected with L. tarentolae-like in Spain. The possible infection of sand flies with novel Leishmania species should be taken into consideration in epidemiological studies of vector species in areas where leishmaniosis is endemic.

  17. Anhydrobiotic insect Polypedilum vanderplanki: molecular mechanisms of DNA and protein protection against extreme environments.

    Science.gov (United States)

    Gusev, Oleg; Nakahara, Yuichi; Kikawada, Takahiro; Levinskikh, Margarita; Sychev, Vladimir; Okuda, Takashi

    Some organisms showing no sign of living due to complete desiccation are nevertheless able to resume active life after rehydration. This peculiar biological state is referred to as "anhydrobiosis". Larvae of the sleeping chironomid, P. vanderplanki living in temporary pools in semi-arid areas on the African continent become completely desiccated upon drought, but can revive after water becomes available upon the next rain. The dried larvae can stand other extreme conditions, such as exposure to 100˚C, -270˚C, 100We have adopted several methods to evaluated DNA damage in cells of P. vanderplanki and cloned and analyzed expression of the main agent of genetic stress response showing that the larvae possess highly developed anti-stress genetic system, involving anti-oxidative stress genes, hsp and DNA reparation enzymes acting together to provide stability of proteins and DNA in the absence of water. From 2005, dried larvae were included in a number of research programs, including exposition to space environments onboard ISS and long-term exposure to outer space environment outside of ISS ("Expose-R" and"Biorisk" projects) and now are being considered for including into the Phobos-Grunt mission as a testing organism to analyze capability of resting stages of multicellular organism to interplanetary flights.

  18. Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA

    Science.gov (United States)

    Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.

    1974-01-01

    DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576

  19. Molecular docking and 3D-QSAR studies on inhibitors of DNA damage signaling enzyme human PARP-1.

    Science.gov (United States)

    Fatima, Sabiha; Bathini, Raju; Sivan, Sree Kanth; Manga, Vijjulatha

    2012-08-01

    Poly (ADP-ribose) polymerase-1 (PARP-1) operates in a DNA damage signaling network. Molecular docking and three dimensional-quantitative structure activity relationship (3D-QSAR) studies were performed on human PARP-1 inhibitors. Docked conformation obtained for each molecule was used as such for 3D-QSAR analysis. Molecules were divided into a training set and a test set randomly in four different ways, partial least square analysis was performed to obtain QSAR models using the comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA). Derived models showed good statistical reliability that is evident from their r², q²(loo) and r²(pred) values. To obtain a consensus for predictive ability from all the models, average regression coefficient r²(avg) was calculated. CoMFA and CoMSIA models showed a value of 0.930 and 0.936, respectively. Information obtained from the best 3D-QSAR model was applied for optimization of lead molecule and design of novel potential inhibitors.

  20. Noncanonical structures and their thermodynamics of DNA and RNA under molecular crowding: beyond the Watson-Crick double helix.

    Science.gov (United States)

    Sugimoto, Naoki

    2014-01-01

    How does molecular crowding affect the stability of nucleic acid structures inside cells? Water is the major solvent component in living cells, and the properties of water in the highly crowded media inside cells differ from that in buffered solution. As it is difficult to measure the thermodynamic behavior of nucleic acids in cells directly and quantitatively, we recently developed a cell-mimicking system using cosolutes as crowding reagents. The influences of molecular crowding on the structures and thermodynamics of various nucleic acid sequences have been reported. In this chapter, we discuss how the structures and thermodynamic properties of nucleic acids differ under various conditions such as highly crowded environments, compartment environments, and in the presence of ionic liquids, and the major determinants of the crowding effects on nucleic acids are discussed. The effects of molecular crowding on the activities of ribozymes and riboswitches on noncanonical structures of DNA- and RNA-like quadruplexes that play important roles in transcription and translation are also described. © 2014 Elsevier Inc. All rights reserved.

  1. Smart Sensing Based on DNA-Metal Interaction Enables a Label-Free and Resettable Security Model of Electrochemical Molecular Keypad Lock.

    Science.gov (United States)

    Du, Yan; Han, Xu; Wang, Chenxu; Li, Yunhui; Li, Bingling; Duan, Hongwei

    2018-01-26

    Recently, molecular keypad locks have received increasing attention. As a new subgroup of smart biosensors, they show great potential for protecting information as a molecular security data processor, rather than merely molecular recognition and quantitation. Herein, label-free electrochemically transduced Ag + and cysteine (Cys) sensors were developed. A molecular keypad lock model with reset function was successfully realized based on the balanced interaction of metal ion with its nucleic acid and chemical ligands. The correct input of "1-2-3" (i.e., "Ag + -Cys-cDNA") is the only password of such molecular keypad lock. Moreover, the resetting process of either correct or wrong input order could be easily made by Cys, buffer, and DI water treatment. Therefore, our system provides an even smarter system of molecular keypad lock, which could inhibit illegal access of unauthorized users, holding great promise in information protection at the molecular level.

  2. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  3. Codling moth cytogenetics: karyotype, chromosomal location of rDNA, and molecular differentiation of sex chromosomes

    Czech Academy of Sciences Publication Activity Database

    Fuková, Iva; Nguyen, Petr; Marec, František

    Roč. 48, - ( 2005 ), s. 1083-1092 ISSN 0831-2796 R&D Projects: GA AV ČR(CZ) IAA6007307 Grant - others:IAEA(AT) 12055/R Institutional research plan: CEZ:AV0Z50070508 Keywords : CGH * codling moth * FISH Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.070, year: 2005

  4. Removing external DNA contamination from arthropod predators destined for molecular gut-content analysis

    Science.gov (United States)

    Molecular gut-content analysis enables detection of arthropod predation with minimal disruption of ecosystem processes. Field and laboratory experiments have demonstrated that mass-collection methods, such as sweep-netting, vacuum sampling, and foliage beating, can lead to contamination of fed pred...

  5. Removing external DNA decontamination from arthropod predators destined for molecular gut-content analysis

    Science.gov (United States)

    Molecular gut-content analysis enables detection of arthropod predation with minimal disruption of ecosystem processes. Field and laboratory experiments have demonstrated that mass-collection methods, such as sweep-netting, vacuum sampling, and foliage beating, can lead to contamination of fed pred...

  6. Purification of high molecular weight genomic DNA from powdery mildew for long-read sequencing

    Science.gov (United States)

    The powdery mildew fungi are a group of economically important fungal plant pathogens. Relatively little is known about the molecular biology and genetics of these pathogens, in part due to a lack of well-developed genetic and genomic resources. These organisms have large, repetitive genomes, which ...

  7. Random Amplified Polymorphic DNA PCR in the Teaching of Molecular Epidemiology

    Science.gov (United States)

    Reinoso, Elina B.; Bettera, Susana G.

    2016-01-01

    In this article, we describe a basic practical laboratory designed for fifth-year undergraduate students of Microbiology as part of the Epidemiology course. This practice provides the students with the tools for molecular epidemiological analysis of pathogenic microorganisms using a rapid and simple PCR technique. The aim of this work was to assay…

  8. Molecular genetic diversity of Punica granatum L. (pomegranate) as revealed by microsatellite DNA markers

    Science.gov (United States)

    Pomegranate (Punica granatum L.) is one of the oldest known edible fruits and more and more it arouse interest of scientific community given its numerous biological activities. However, information about its genetic resources and characterization using reliable molecular markers are still scarce. In...

  9. Karyotype analysis, DNA content and molecular screening in Lippia alba (Verbenaceae

    Directory of Open Access Journals (Sweden)

    Patrícia M.O. Pierre

    2011-09-01

    Full Text Available Cytogenetic analyses, of pollen viability, nuclear DNA content and RAPD markers were employed to study three chemotypes of Lippia alba (Mill. (Verbenaceae in order to understand the genetic variation among them. Different ploidy levels and mixoploid individuals were observed. This work comprises the first report of different chromosome numbers (cytotypes in L. alba. The chromosome numbers of La2-carvone and La3-linalool chemotypes suggested that they are polyploids. Flow cytometric analysis showed an increase of nuclear DNA content that was not directly proportional to ploidy level variation. A cluster analysis based on RAPD markers revealed that La3-linalool shares genetic markers with La1-citral and La2-carvone. The analysis showed that the majority of genetic variation of La3-linalool could be a consequence of ixoploidy. ur data indicates that sexual reproduction aong those three chemotypes is unlikely and suggests the beginning of reproductive isolation. The results demonstrated that chromosome analysis, nuclear DNA content estimation and RAPD markers constitute excellent tools for detecting genetic variation among L. alba chemotypes.Análises citogenéticas, de viabilidade do pólen, do conteúdo de DNA nuclear e marcadores RAPD foram empregadas no estudo de três quimiotipos de Lippia alba (Mill. (Verbenaceae visando contribuir para o entendimento da variação genética entre os mesmos. Diferentes níveis de ploidia e indivíduos mixoploides foram observados. Este trabalho compreende o primeiro relato de diferentes números cromossômicos (citótipos em L. alba. Os números cromossômicos dos quimiotipos La2-carvona e La3-linalol sugere que eles seja poliploides. A análise da citometria de fluxo mostrou um aumento do conteúdo de DNA nuclear que não foi diretamente proporcional à variação no nível de ploidia. A análise de agrupamento baseada nos marcadores RAPD demonstrou que La3-linalol compartilha marcadores genéticos com La1

  10. Caracterização molecular de DNA de Delta papillomavirus bovino (BPV1, 2 e 13 em sarcoides equinos

    Directory of Open Access Journals (Sweden)

    Brígida K. de Alcântara

    2015-05-01

    Full Text Available Resumo:Sarcoides são tumores fibroblásticos, considerados os tumores de pele mais comuns em pele de equinos e que raramente apresentam regressão espontânea. Papilomavírus bovino (BPV tipos 1 e 2 são relacionados com a patogenia do sarcoide e, provavelmente, o BPV tipo 13 (BPV13, recentemente descrito, também pode estar associado com a formação dessa lesão. Neste estudo, 20 amostras de lesões cutâneas, sendo 12 constituídas por tecidos frescos e 8 amostras de tecido fixado em formalina e embebido em parafina, provenientes de 15 cavalos foram utilizadas para a identificação do DNA de BPV. A análise histopatológica (HE confirmou todas as lesões como sarcoide. Para a amplificação do DNA de papilomavírus (PV foram realizadas três reações de PCR. Como triagem, os primers IFNR2/IDNT2 foram utilizados para amplificar um fragmento da ORF L1 do PV. O segundo par de primersutilizado é complementar a sequência dos genes E5 e L2 de BPVs 1, 2 e 13. O terceiro par de primers(FAP59/FAP64 utilizado tem o gene L1 como alvo. A primeira e a segunda PCRs permitiram amplificar produtos em todas as amostras avaliadas. Entretanto, na terceira reação, na qual foram utilizados os primers FAP, foi possível amplificar produtos com tamanho molecular esperado somente nas amostras constituídas por tecidos frescos. O sequenciamento de nucleotídeos e as análises filogenéticas realizadas nos fragmentos E5L2 resultaram na identificação de BPV1, 2 e 13 em 14 (70%, 2 (10% e em 4 (20% amostras de sarcoides, respectivamente. As amostras de sarcoides de um dos animais continha somente o DNA de BPV1. Entretanto, nas amostras provenientes do segundo cavalo foi possível identificar o DNA de três tipos de Deltapapillomavirus bovino (BPV1, 2 e 13 em lesões distintas. Este estudo ratifica a presença do DNA de BPV1, 2 e 13 em lesões de sarcoides em equinos, além de identificar três tipos de BPVs em um mesmo animal e descrever pela primeira vez no

  11. Molecular Detection of Leptospiral DNA in Environmental Water on St. Kitts

    Directory of Open Access Journals (Sweden)

    Julienne Rawlins

    2014-08-01

    Full Text Available Leptospirosis is an important waterborne zoonotic disease caused by pathogenic Leptospira. The pathogen is maintained in a population due to chronic colonization and shedding from renal tubules of domestic and wild animals. Humans and other animals become infected when they come in contact with urine from infected animals, either directly or through urine-contaminated surface water. In this study, we screened environmental water on the island of St. Kitts by using a TaqMan based real time quantitative polymerase chain reaction (qPCR targeting a pathogen specific leptospiral gene, lipl32. Our results indicate that around one-fifth of tested water sources have detectable leptospiral DNA.

  12. Molecular cloning and sequence analysis of hamster CENP-A cDNA

    Directory of Open Access Journals (Sweden)

    Valdivia Manuel M

    2002-05-01

    Full Text Available Abstract Background The centromere is a specialized locus that mediates chromosome movement during mitosis and meiosis. This chromosomal domain comprises a uniquely packaged form of heterochromatin that acts as a nucleus for the assembly of the kinetochore a trilaminar proteinaceous structure on the surface of each chromatid at the primary constriction. Kinetochores mediate interactions with the spindle fibers of the mitotic apparatus. Centromere protein A (CENP-A is a histone H3-like protein specifically located to the inner plate of kinetochore at active centromeres. CENP-A works as a component of specialized nucleosomes at centromeres bound to arrays of repeat satellite DNA. Results We have cloned the hamster homologue of human and mouse CENP-A. The cDNA isolated was found to contain an open reading frame encoding a polypeptide consisting of 129 amino acid residues with a C-terminal histone fold domain highly homologous to those of CENP-A and H3 sequences previously released. However, significant sequence divergence was found at the N-terminal region of hamster CENP-A that is five and eleven residues shorter than those of mouse and human respectively. Further, a human serine 7 residue, a target site for Aurora B kinase phosphorylation involved in the mechanism of cytokinesis, was not found in the hamster protein. A human autoepitope at the N-terminal region of CENP-A described in autoinmune diseases is not conserved in the hamster protein. Conclusions We have cloned the hamster cDNA for the centromeric protein CENP-A. Significant differences on protein sequence were found at the N-terminal tail of hamster CENP-A in comparison with that of human and mouse. Our results show a high degree of evolutionary divergence of kinetochore CENP-A proteins in mammals. This is related to the high diverse nucleotide repeat sequences found at the centromere DNA among species and support a current centromere model for kinetochore function and structural

  13. The tilt-dependent potential of mean force of a pair of DNA oligomers from all-atom molecular dynamics simulations

    International Nuclear Information System (INIS)

    Cortini, Ruggero; Cheng, Xiaolin

    2017-01-01

    Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order of 1k B T. Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.

  14. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    Science.gov (United States)

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  15. A molecular phylogeny of the Cephinae (Hymenoptera, Cephidae based on mtDNA COI gene: a test of traditional classification

    Directory of Open Access Journals (Sweden)

    Mahir Budak

    2011-09-01

    Full Text Available Cephinae is traditionally divided into three tribes and about 24 genera based on morphology and host utilization. There has been no study testing the monophyly of taxa under a strict phylogenetic criterion. A molecular phylogeny of Cephinae based on a total of 68 sequences of mtDNA COI gene, representing seven genera of Cephinae, is reconstructed to test the traditional limits and relationships of taxa. Monophyly of the traditional tribes is not supported. Monophyly of the genera are largely supported except for Pachycephus. A few host shift events are suggested based on phylogenetic relationships among taxa. These results indicate that a more robust phylogeny is required for a more plausible conclusion. We also report two species of Cephus for the first time from Turkey.

  16. Rosalind Franklin and the DNA molecular structure: A case of history of science to learn about the nature of science

    Directory of Open Access Journals (Sweden)

    José Antonio Acevedo-Díaz

    2016-08-01

    Full Text Available The Rosalind Franklin’s case regarding the elucidation of the molecular structure of DNA is presented as an interesting story of the history of science to address a set of questions related to the nature of science (NOS from an explicit and reflective approach. The teaching proposal is aimed to the pre-service teachers training in NOS issues and its didactics. Attention is given to both epistemic and non-epistemic aspects in the narration and the NOS questions asked for reflecting about them. Also, some methodological recommendations for implementing the didactic proposal in science classroom are offered. This involves the follows: (i in small groups, the students read the controversy and respond to some questions on NOS; (ii they present their responses to the whole-class; and (iii they revise their initial responses in light of the whole-class discussion.

  17. Molecular discrimination of lactobacilli used as starter and probiotic cultures by amplified ribosomal DNA restriction analysis.

    Science.gov (United States)

    Roy, D; Sirois, S; Vincent, D

    2001-04-01

    Lactic acid bacteria such as Lactobacillus helveticus, L. delbrueckii subsp. delbrueckii, L. delbrueckii subsp. lactis, L. delbrueckii subsp. bulgaricus, L. acidophilus, and L. casei related taxa which are widely used as starter or probiotic cultures can be identified by amplified ribosomal DNA restriction analysis (ARDRA). The genetic discrimination of the related species belonging to these groups was first obtained by PCR amplifications by using group-specific or species-specific 16S rDNA primers. The numerical analysis of the ARDRA patterns obtained by using CfoI, HinfI, Tru9I, and ScrFI was an efficient typing tool for identification of species of the L. acidophilus and L. casei complex. ARDRA by using CfoI was a reliable method for differentiation of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. Finally, strains ATCC 393 and ATCC 15820 exhibited unique ARDRA patterns with CfoI and Tru9I restriction enzymes as compared with the other strains of L. casei, L. paracasei, and L. rhamnosus.

  18. Comparative molecular analysis of Herbaspirillum strains by RAPD, RFLP, and 16S rDNA sequencing

    Directory of Open Access Journals (Sweden)

    Soares-Ramos Juliana R.L.

    2003-01-01

    Full Text Available Herbaspirillum spp. are endophytic diazotrophic bacteria associated with important agricultural crops. In this work, we analyzed six strains of H. seropedicae (Z78, M2, ZA69, ZA95, Z152, and Z67 and one strain of H. rubrisubalbicans (M4 by restriction fragment length polymorphism (RFLP using HindIII or DraI restriction endonucleases, random amplified polymorphic DNA (RAPD, and partial sequencing of 16S rDNA. The results of these analyses ascribed the strains studied to three distinct groups: group I, consisting of M2 and M4; group II, of ZA69; and group III, of ZA95, Z78, Z67, and Z152. RAPD fingerprinting showed a higher variability than the other methods, and each strain had a unique electrophoretic pattern with five of the six primers used. Interestingly, H. seropedicae M2 was found by all analyses to be genetically very close to H. rubrisubalbicans M4. Our results show that RAPD can distinguish between all Herbaspirillum strains tested.

  19. Co-targeting androgen receptor and DNA for imaging and molecular radiotherapy of prostate cancer: in vitro studies.

    Science.gov (United States)

    Han, Guang; Kortylewicz, Zbigniew P; Enke, Thomas; Baranowska-Kortylewicz, Janina

    2014-12-01

    The androgen receptor (AR) axis, the key growth and survival pathway in prostate cancer, remains a prime target for drug development. 5-Radioiodo-3'-O-(17β-succinyl-5α-androstan-3-one)-2'-deoxyuridin-5'-yl phosphate (RISAD-P) is the AR-seeking reagent developed for noninvasive assessment of AR and proliferative status, and for molecular radiotherapy of prostate cancer with Auger electron-emitting radionuclides. RISAD-P radiolabeled with 123I, 124I, and 125I were synthesized using a common stannylated precursor. The cellular uptake, subcellular distribution, and radiotoxicity of 123I-, 124I-, and (125) IRISAD-P were measured in LNCaP, DU145, and PC-3 cell lines expressing various levels of AR. The uptake of RISAD-P by prostate cancer cells is proportional to AR levels and independent of the radionuclide. The intracellular accumulation of radioactivity is directly proportional to the extracellular concentration of RISAD-P and the duration of exposure. Initially, RISAD-P is trapped in the cytoplasm. Within 24 hr, radioactivity is associated exclusively with DNA. The RISAD-P radiotoxicity is determined by the radionuclide; however, the cellular responses are directly proportional to the AR expression levels. LNCaP cells expressing high levels of AR are killed at the rate of up to 60% per day after a brief 1 hr RISAD-P treatment. For the first time, the AR expression in PC-3 and DU 145 cells, generally reported as AR-negative, was quantitated by the ultra sensitive RISAD-P-based method. RISAD-P is a theranostic drug, which targets AR. Its subcellular metabolite participates in DNA synthesis. RISAD-P is a promising candidate for imaging of the AR expression and tumor proliferation as well as molecular radiotherapy of prostate cancer. © 2014 Wiley Periodicals, Inc.

  20. Molecular Analysis and Genomic Organization of Major DNA Satellites in Banana (Musa spp.)

    Czech Academy of Sciences Publication Activity Database

    Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

    2013-01-01

    Roč. 8, č. 1 (2013) E-ISSN 1932-6203 R&D Projects: GA AV ČR KJB500380901; GA MŠk(CZ) LG12021 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511 Keywords : IN-SITU HYBRIDIZATION * LARGE-SCALE ORGANIZATION * RIBOSOMAL-RNA GENES Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  1. The Use of Fta Card on Dna Sample Preparation for Molecular of Plant Disease Identification

    OpenAIRE

    Sulistyawati, Purnamila; Rimbawanto, Anto

    2007-01-01

    Accurate and guick identification of pathogen is key to control the spread of plant disesases. Morphological identification is often ineffective because it requires fruit body which often are not presence, rely on characters which may be highly variable within and among species and can be slow and time consuming. Molecular identification of plant disease can overcome most of the shortcomings of morphological identification. Application of FTA Cardn for sample collection is crucial for the su...

  2. Identifying molecular subtypes in human colon cancer using gene expression and DNA methylation microarray data

    OpenAIRE

    REN, ZHONGLU; WANG, WENHUI; LI, JINMING

    2015-01-01

    Identifying colon cancer subtypes based on molecular signatures may allow for a more rational, patient-specific approach to therapy in the future. Classifications using gene expression data have been attempted before with little concordance between the different studies carried out. In this study we aimed to uncover subtypes of colon cancer that have distinct biological characteristics and identify a set of novel biomarkers which could best reflect the clinical and/or biological characteristi...

  3. Molecular characterisation of Colombian yam germplasm by "DNA amplification fingerprinting (DAF" in radioactivo conditions Caracterización molecular del germoplasma de ñame colombiano utilizando "DNA Amplificaron Fingerprinting (DAF" en condiciones radiactivas

    Directory of Open Access Journals (Sweden)

    Bustamante Silvia L.

    2003-12-01

    Full Text Available Samples from the Universidad de Córdoba's yam collection (Dioscorea spp. and others originating from IITA (International Institute of Tropical Agriculture, Ibadan, Nigeria were molecularly characterised to complement existing information about them. The yam (Diosocorea spp. represents a basic crop for small-scale farmers on the Colombian Atlantic Coast who sow around 20,000 hectares per year. Even though they are dioecious species, only one sex is represented in Colombia; it must also be stated that climatic conditions are not propitious for its flowering. This situation has caused difficulty for work in yam breeding. The yam species and varieties used in the Colombian ABP (Agricultural Biotechnology Programme have been molecularly characterised by AFLPs in a previous publication describing a preliminary study emerging from the need to broaden the characterisation of those accessions kept at the Universidad de Córdoba. Comparisons have also been done with some African accessions donated by IITA. In this article, samples were molecularly characterised by another fingerprinting technique, the DAF technique (DNA Amplification Fingerprinting based on PCR, using random oligonucleotides for generating characteristic band patterns from each individual. The results showed 0.0413 population diversity with 0.9587 average similarity, indicating that the yam collection studied had very little genetic diversity and, probably, this could be why the crop is vulnerable to plagues and diseases, as happened at the end of the 1980s when anthracnose practically devastated the crop on the Colombian Atlantic coast. Similarity was also found between those Colombian and African samples analysed, agreeing with low diversity and less distance between common ancestors. The molecular results suggest the need for using other molecular techniques having a greater power of discrimination and also the need to broaden the genetic diversity in yam crops for providing greater

  4. Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

    Science.gov (United States)

    Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

    2017-10-01

    A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

  5. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    Science.gov (United States)

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  6. Molecular characterization of a complex site-specific radiation-induced DNA double-strand break

    International Nuclear Information System (INIS)

    Datta, K.; Dizdaroglu, M.; Jaruga, P.; Neumann, R.D.; Winters, T.A.

    2003-01-01

    Radiation lethality is a function of radiation-induced DNA double-strand breaks (DSB). Current models propose the lethality of a DSB to be a function of its structural complexity. We present here for the first time a map of damage associated with a site-specific double-strand break produced by decay of 125 I in a plasmid bound by a 125 I-labeled triplex forming oligonucleotide ( 125 I-TFO). The E. coli DNA repair enzymes, endonuclease IV (endo IV), endonuclease III (endo III), and formamidopyrimidine-DNA glycosylase (Fpg), which recognize AP sites, and pyrimidine and purine base damage respectively, were used as probes in this study. 125 I-TFO bound plasmid was incubated with and without DMSO at -80 deg C for 1 month. No significant difference in DSB yield was observed under these conditions. A 32 base pair fragment from the upstream side of the decay site was isolated by restriction digestion and enzymatically probed to identify damage sites. Endo IV treatment of the 5'-end labeled upper strand indicated clustering of AP sites within 3 bases downstream and 7 bases upstream of the targeted base. Also, repeated experiments consistently detected an AP site 4 bases upstream of the 125 Itarget base. This was further supported by complementary results with the 3'-end labeled upper strand. Endo IV analysis of the lower strand also shows clustering of AP sites near the DSB end. Endo III and Fpg probing demonstrated that base damage is also clustered near the targeted break site. DSBs produced in the absence of DMSO displayed a different pattern of enzyme sensitive damage than those produced in the presence of DMSO. Identification of specific base damage types within the restriction fragment containing the DSB end was achieved with GC/MS. Base damage consisted of 8-hydroguanine, 8-hydroxyadenine, and 5-hydroxycytosine. These lesions were observed at relative yields of 8-hydroguanine and 5-hydroxycytosine to 8-hydroxyadenine of 7.4:1 and 4.7:1, respectively, in the absence

  7. Genetic polymorphism in Gymnodinium galatheanum chloroplast DNA sequences and development of a molecular detection assay.

    Science.gov (United States)

    Tengs, T; Bowers, H A; Ziman, A P; Stoecker, D K; Oldach, D W

    2001-02-01

    Nuclear and chloroplast-encoded small subunit ribosomal DNA sequences were obtained from several strains of the toxic dinoflagellate Gymnodinium galatheanum. Phylogenetic analyses and comparison of sequences indicate that the chloroplast sequences show a higher degree of sequence divergence than the nuclear homologue. The chloroplast sequences were chosen as targets for the development of a 5'--3' exonuclease assay for detection of the organism. The assay has a very high degree of specificity and has been used to screen environmental water samples from a fish farm where the presence of this dinoflagellate species has previously been associated with fish kills. Various hypotheses for the derived nature of the chloroplast sequences are discussed, as well as what is known about the toxicity of the species.

  8. Molecular dating of caprines using ancient DNA sequences of Myotragus balearicus, an extinct endemic Balearic mammal

    Directory of Open Access Journals (Sweden)

    Alcover Josep Antoni

    2005-12-01

    Full Text Available Abstract Background Myotragus balearicus was an endemic bovid from the Balearic Islands (Western Mediterranean that became extinct around 6,000-4,000 years ago. The Myotragus evolutionary lineage became isolated in the islands most probably at the end of the Messinian crisis, when the desiccation of the Mediterranean ended, in a geological date established at 5.35 Mya. Thus, the sequences of Myotragus could be very valuable for calibrating the mammalian mitochondrial DNA clock and, in particular, the tree of the Caprinae subfamily, to which Myotragus belongs. Results We have retrieved the complete mitochondrial cytochrome b gene (1,143 base pairs, plus fragments of the mitochondrial 12S gene and the nuclear 28S rDNA multi-copy gene from a well preserved Myotragus subfossil bone. The best resolved phylogenetic trees, obtained with the cytochrome b gene, placed Myotragus in a position basal to the Ovis group. Using the calibration provided by the isolation of Balearic Islands, we calculated that the initial radiation of caprines can be dated at 6.2 ± 0.4 Mya. In addition, alpine and southern chamois, considered until recently the same species, split around 1.6 ± 0.3 Mya, indicating that the two chamois species have been separated much longer than previously thought. Conclusion Since there are almost no extant endemic mammals in Mediterranean islands, the sequence of the extinct Balearic endemic Myotragus has been crucial for allowing us to use the Messinian crisis calibration point for dating the caprines phylogenetic tree.

  9. Blood extracellular DNA after irradiation

    International Nuclear Information System (INIS)

    Vladimirov, V.G.; Tishchenko, L.I.; Surkova, E.A.; Vasil'eva, I.N.

    1993-01-01

    It has been shown that blood extracellular DNA of irradiated rats largely consists of the low-molecular DNA and its oligomers. Molecular masses of oligomers are multiple to molecular mass of monomer fragment with nucleosome size. The low-molecular DNA has linear form. The average content of GC-pairs in low-molecular DNA is higher than in total rat's DNA (48.5% against 41.5%). The low-molecular DNA is a part of complex containing RNA, acidic proteins and lipids. It is assumed that the formation of low-molecular DNA is a result of Ca/Mg - dependent nuclear endonuclease action

  10. Fast parallel molecular algorithms for DNA-based computation: solving the elliptic curve discrete logarithm problem over GF2.

    Science.gov (United States)

    Li, Kenli; Zou, Shuting; Xv, Jin

    2008-01-01

    Elliptic curve cryptographic algorithms convert input data to unrecognizable encryption and the unrecognizable data back again into its original decrypted form. The security of this form of encryption hinges on the enormous difficulty that is required to solve the elliptic curve discrete logarithm problem (ECDLP), especially over GF(2(n)), n in Z+. This paper describes an effective method to find solutions to the ECDLP by means of a molecular computer. We propose that this research accomplishment would represent a breakthrough for applied biological computation and this paper demonstrates that in principle this is possible. Three DNA-based algorithms: a parallel adder, a parallel multiplier, and a parallel inverse over GF(2(n)) are described. The biological operation time of all of these algorithms is polynomial with respect to n. Considering this analysis, cryptography using a public key might be less secure. In this respect, a principal contribution of this paper is to provide enhanced evidence of the potential of molecular computing to tackle such ambitious computations.

  11. Molecular and clinical characterization of the myopathic form of mitochondrial DNA depletion syndrome caused by mutations in the thymidine kinase (TK2) gene.

    Science.gov (United States)

    Chanprasert, Sirisak; Wang, Jing; Weng, Shao-Wen; Enns, Gregory M; Boué, Daniel R; Wong, Brenda L; Mendell, Jerry R; Perry, Deborah A; Sahenk, Zarife; Craigen, William J; Alcala, Francisco J Climent; Pascual, Juan M; Melancon, Serge; Zhang, Victor Wei; Scaglia, Fernando; Wong, Lee-Jun C

    2013-01-01

    Mitochondrial DNA (mtDNA) depletion syndromes (MDSs) are a clinically and molecularly heterogeneous group of mitochondrial cytopathies characterized by severe mtDNA copy number reduction in affected tissues. Clinically, MDSs are mainly categorized as myopathic, encephalomyopathic, hepatocerebral, or multi-systemic forms. To date, the myopathic form of MDS is mainly caused by mutations in the TK2 gene, which encodes thymidine kinase 2, the first and rate limiting step enzyme in the phosphorylation of pyrimidine nucleosides. We analyzed 9 unrelated families with 11 affected subjects exhibiting the myopathic form of MDS, by sequencing the TK2 gene. Twelve mutations including 4 novel mutations were detected in 9 families. Skeletal muscle specimens were available from 7 out of 11 subjects. Respiratory chain enzymatic activities in skeletal muscle were measured in 6 subjects, and enzymatic activities were reduced in 3 subjects. Quantitative analysis of mtDNA content in skeletal muscle was performed in 5 subjects, and marked mtDNA content reduction was observed in each. In addition, we outline the molecular and clinical characteristics of this syndrome in a total of 52 patients including those previously reported, and a total of 36 TK2 mutations are summarized. Clinically, hypotonia and proximal muscle weakness are the major phenotypes present in all subjects. In summary, our study expands the molecular and clinical spectrum associated with TK2 deficiency. © 2013.

  12. Investigating the structural impacts of I64T and P311S mutations in APE1-DNA complex: a molecular dynamics approach.

    Directory of Open Access Journals (Sweden)

    C George Priya Doss

    Full Text Available Elucidating the molecular dynamic behavior of Protein-DNA complex upon mutation is crucial in current genomics. Molecular dynamics approach reveals the changes on incorporation of variants that dictate the structure and function of Protein-DNA complexes. Deleterious mutations in APE1 protein modify the physicochemical property of amino acids that affect the protein stability and dynamic behavior. Further, these mutations disrupt the binding sites and prohibit the protein to form complexes with its interacting DNA.In this study, we developed a rapid and cost-effective method to analyze variants in APE1 gene that are associated with disease susceptibility and evaluated their impacts on APE1-DNA complex dynamic behavior. Initially, two different in silico approaches were used to identify deleterious variants in APE1 gene. Deleterious scores that overlap in these approaches were taken in concern and based on it, two nsSNPs with IDs rs61730854 (I64T and rs1803120 (P311S were taken further for structural analysis.Different parameters such as RMSD, RMSF, salt bridge, H-bonds and SASA applied in Molecular dynamic study reveals that predicted deleterious variants I64T and P311S alters the structure as well as affect the stability of APE1-DNA interacting functions. This study addresses such new methods for validating functional polymorphisms of human APE1 which is critically involved in causing deficit in repair capacity, which in turn leads to genetic instability and carcinogenesis.

  13. Combined quantum-mechanics/molecular-mechanics dynamics simulation of A-DNA double strands irradiated by ultra-low-energy carbon ions

    Energy Technology Data Exchange (ETDEWEB)

    Ngaojampa, C.; Nimmanpipug, P. [Computer Simulation and Modeling Laboratory (CSML), Department of Chemistry and Center for Innovation Chemistry, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Yu, L.D., E-mail: yuld@fnrf.science.cmu.ac.t [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Anuntalabhochai, S. [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Lee, V.S., E-mail: vannajan@gmail.co [Computer Simulation and Modeling Laboratory (CSML), Department of Chemistry and Center for Innovation Chemistry, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand)

    2011-02-15

    In order to promote understanding of the fundamentals of ultra-low-energy ion interaction with DNA, molecular dynamics simulations using combined quantum-mechanics/molecular-mechanics of poly-AT and poly-GC A-DNA double strands irradiated by <200 eV carbon ions were performed to investigate the molecular implications of mutation bias. The simulations were focused on the responses of the DNA backbones and nitrogenous bases to irradiation. Analyses of the root mean square displacements of the backbones and non-hydrogen atoms of base rings of the simulated DNA structure after irradiation revealed a potential preference of DNA double strand separation, dependent on the irradiating energy. The results show that for the backbones, the large difference in the displacement between poly-GC and poly-AT in the initial time period could be the reason for the backbone breakage; for the nitrogenous base pairs, A-T is 30% more sensitive or vulnerable to ion irradiation than G-C, demonstrating a preferential, instead of random, effect of irradiation-induced mutation.

  14. Combined quantum-mechanics/molecular-mechanics dynamics simulation of A-DNA double strands irradiated by ultra-low-energy carbon ions

    International Nuclear Information System (INIS)

    Ngaojampa, C.; Nimmanpipug, P.; Yu, L.D.; Anuntalabhochai, S.; Lee, V.S.

    2011-01-01

    In order to promote understanding of the fundamentals of ultra-low-energy ion interaction with DNA, molecular dynamics simulations using combined quantum-mechanics/molecular-mechanics of poly-AT and poly-GC A-DNA double strands irradiated by <200 eV carbon ions were performed to investigate the molecular implications of mutation bias. The simulations were focused on the responses of the DNA backbones and nitrogenous bases to irradiation. Analyses of the root mean square displacements of the backbones and non-hydrogen atoms of base rings of the simulated DNA structure after irradiation revealed a potential preference of DNA double strand separation, dependent on the irradiating energy. The results show that for the backbones, the large difference in the displacement between poly-GC and poly-AT in the initial time period could be the reason for the backbone breakage; for the nitrogenous base pairs, A-T is 30% more sensitive or vulnerable to ion irradiation than G-C, demonstrating a preferential, instead of random, effect of irradiation-induced mutation.

  15. Molecular identification of Echinococcus granulosus on the Tibetan Plateau using mitochondrial DNA markers.

    Science.gov (United States)

    Hu, D; Song, X; Wang, N; Zhong, X; Wang, J; Liu, T; Jiang, Z; Dawa, T; Gu, X; Peng, X; Yang, G

    2015-10-30

    Cystic echinococcosis (CE) is an important worldwide zoonotic disease that causes large economic losses and human suffering. Echinococcus granulosus, the causative agent of CE, exhibits different genotypes in different locations. In order to identify its genotypes and analyze its genetic structure on the Tibetan Plateau, we collected 72 hydatid cysts from different intermediate hosts and amplified and sequenced their mitochondrial cytochrome c oxidase subunit 2 (cox2) genes. Seventy isolates were identified as the E. granulosus G1 genotype, while two isolates belonged to the G6 genotype. There were 18 haplotypes among the 70 E. granulosus isolates, which exhibited a star-like network pattern and shared a common haplotype (H1). There was little difference between geographical sub-populations. Our results suggest that a recent E. granulosus population expansion occurred on the Tibetan Plateau, suggesting that E. granulosus was introduced into China. This study increases the basic molecular data needed for the molecular diagnosis, epidemiology, prevention, and control of Echinococcus diseases.

  16. Separation of mouse testis cells on a Celsep (TM) apparatus and their usefulness as a source of high molecular weight DNA or RNA

    Science.gov (United States)

    Wolgemuth, D. J.; Gizang-Ginsberg, E.; Engelmyer, E.; Gavin, B. J.; Ponzetto, C.

    1985-01-01

    The use of a self-contained unit-gravity cell separation apparatus for separation of populations of mouse testicular cells is described. The apparatus, a Celsep (TM), maximizes the unit area over which sedimentation occurs, reduces the amount of separation medium employed, and is quite reproducible. Cells thus isolated have been good sources for isolation of DNA, and notably, high molecular weight RNA.

  17. Impact of molecular weight and degree of conjugation on the thermodynamics of DNA complexation and stability of polyethylenimine-graft-poly(ethylene glycol) copolymers.

    Science.gov (United States)

    Smith, Ryan J; Beck, Rachel W; Prevette, Lisa E

    2015-01-01

    Poly(ethylene glycol) (PEG) is often conjugated to polyethylenimine (PEI) to provide colloidal stability to PEI-DNA polyplexes and shield charge leading to toxicity. Here, a library of nine cationic copolymers was synthesized by grafting three molecular weights (750, 2000, 5000Da) of PEG to linear PEI at three conjugation ratios. Using isothermal titration calorimetry, we have quantified the thermodynamics of the associations between the copolymers and DNA and determined the extent to which binding is hindered as a function of PEG molecular weight and conjugation ratio. Low conjugation ratios of 750Da PEG to PEI resulted in little decrease in DNA affinity, but a significant decrease-up to two orders of magnitude-was found for the other copolymers. We identified limitations in determination of affinity using indirect assays (electrophoretic mobility shift and ethidium bromide exclusion) commonly used in the field. Dynamic light scattering of the DNA complexes at physiological ionic strength showed that PEI modifications that did not reduce DNA affinity also did not confer significant colloidal stability, a finding that was supported by calorimetric data on the aggregation process. These results quantify the DNA interaction thermodynamics of PEGylated polycations for the first time and indicate that there is an optimum PEG chain length and degree of substitution in the design of agents that have desirable properties for effective in vivo gene delivery. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. A mononuclear zinc(II) complex with piroxicam: Crystal structure, DNA- and BSA-binding studies; in vitro cell cytotoxicity and molecular modeling of oxicam complexes

    Science.gov (United States)

    Jannesari, Zahra; Hadadzadeh, Hassan; Amirghofran, Zahra; Simpson, Jim; Khayamian, Taghi; Maleki, Batool

    2015-02-01

    A new mononuclear Zn(II) complex, trans-[Zn(Pir)2(DMSO)2], where Pir- is 4-hydroxy-2-methyl-N-2-pyridyl-2H-1,2-benzothiazine-3-carboxamide-1,1-dioxide (piroxicam), has been synthesized and characterized. The crystal structure of the complex was obtained by the single crystal X-ray diffraction technique. The interaction of the complex with DNA and BSA was investigated. The complex interacts with FS-DNA by two binding modes, viz., electrostatic and groove binding (major and minor). The microenvironment and the secondary structure of BSA are changed in the presence of the complex. The anticancer effects of the seven complexes of oxicam family were also determined on the human K562 cell lines and the results showed reasonable cytotoxicities. The interactions of the oxicam complexes with BSA and DNA were modeled by molecular docking and molecular dynamic simulation methods.

  19. Optimal lipofection reagent varies with the molecular modifications of the DNA.

    Science.gov (United States)

    Conrad, A H; Behlke, M A; Jaffredo, T; Conrad, G W

    1998-10-01

    Cationic lipid reagents differ in their cytofection efficacy with different cell types. No evidence has addressed whether the same lipid reagent is best for different DNAs in a single cell line. Immortalized avian embryonic cardiomyocytes cultured in vitro were tested with 15 cationic lipid reagents using (A) a beta-gal expression plasmid, (B) a fluorescein-tagged, phosphorothioate-modified ODN B, (C) a fluorescein-tagged, ethoxy-modified ODN C with the same nucleotide sequence as ODN B, and (D) a fluorescein-tagged, phosphorothioate-modified ODN D with a different nucleotide sequence from ODNs B and C. Cytofection was scored as percent of cells expressing beta-gal activity or showing diffuse cellular fluorescence. The best lipid reagents for the phosphorothioate-modified ODNs were ODN-specific and markedly different from the best lipid reagents for the expression plasmid or for the ethoxy-modified ODN. These results suggest that the best cationic lipid reagent for a particular cell type varies with the physical and chemical form of the DNA being transfected into the cells.

  20. Radioactive and enzymatic cloned cDNA probes for bovine enteric coronavirus detection by molecular hybridization

    International Nuclear Information System (INIS)

    Collomb, J.; Finance, C.; Alabouch, S.; Laporte, J.

    1992-01-01

    Genomic RNA of F15 strain bovine enteric coronavirus (BECV) was cloned in E. coli. Three clones (174, 160, PG 78), selected in the cDNA library, including a large portion of the nucleocapsid (N), matrix (M) and peplomeric (S) protein genes , were used as probes for a slot blot hybridization assay. Two probe labelling techniques were compared, radiolabelling with 32 P and enzymatic labelling through covalent linkage to peroxidase and chemiluminescence detection. The radioactive probe 174 detected as little as 1 to 3 pg of viral RNA, while the less sensitive enzymatic probe could not reveal more than 100 pg of RNA. No significant detection amplification was achieved when a mixture of the three probes was used. Probe 174 allowed specific identification for BECV. No hybridization was noticed either with rotaviruses or even with other antigenically unrelated members of the family Coronaviridae such as transmissible gastroenteritis virus. The test proved valid for detection of BECV in the supernatant of infected HRT-18 cells: genomic RNA could be detected after direct spotting of samples, but prior nucleic acid extraction after proteinase K treatment improved virus detection. BECV diagnosis in faecal samples using enzymatic probe was compared with conventional diagnostic methods. (authors)

  1. Radioactive and enzymatic cloned cDNA probes for bovine enteric coronavirus detection by molecular hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Collomb, J; Finance, C; Alabouch, S [Lab. de Microbiologie Moleculaire, Faculte des Sciences Pharmaceutiques et Biologiques, Univ. de Nancy I, Nancy (France); Laporte, J [Station de Virologie et d' Immunologie Moleculaires, INRA, Jouy-en-Josas (France)

    1992-01-01

    Genomic RNA of F15 strain bovine enteric coronavirus (BECV) was cloned in E. coli. Three clones (174, 160, PG 78), selected in the cDNA library, including a large portion of the nucleocapsid (N), matrix (M) and peplomeric (S) protein genes , were used as probes for a slot blot hybridization assay. Two probe labelling techniques were compared, radiolabeled with [sup 32]P and enzymatic labeled through covalent linkage to peroxidase for chemiluminescence detection. The radioactive probe 174 detected as little as 1-3 pg of viral RNA, while the less sensitive enzymatic probe could not reveal more than 100 pg of RNA. No significant detection amplification was achieved when a mixture of the three probes was used. Probe 174 allowed specific identification for BECV. No hybridization was noticed either with rotaviruses or even with other antigenically unrelated members of the family Coronaviridae such as transmissible gastroenteritis virus. The test proved valid for detection of BECV in the supernatant of infected HRT-18 cells: genomic RNA could be detected after direct spotting of samples, but prior nucleic acid extraction after proteinase K treatment improved virus detection. BECV diagnosis in fecal samples using enzymatic probe was compared with conventional diagnostic methods. (authors).

  2. Molecular systematics of Indian Alysicarpus (Fabaceae) based on analyses of nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Gholami, Akram; Subramaniam, Shweta; Geeta, R; Pandey, Arun K

    2017-06-01

    Alysicarpus Necker ex Desvaux (Fabaceae, Desmodieae) consists of ~30 species that are distributed in tropical and subtropical regions of theworld. In India, the genus is represented by ca. 18 species, ofwhich seven are endemic. Sequences of the nuclear Internal transcribed spacer from38 accessions representing 16 Indian specieswere subjected to phylogenetic analyses. The ITS sequence data strongly support the monophyly of the genus Alysicarpus. Analyses revealed four major well-supported clades within Alysicarpus. Ancestral state reconstructions were done for two morphological characters, namely calyx length in relation to pod (macrocalyx and microcalyx) and pod surface ornamentation (transversely rugose and nonrugose). The present study is the first report on molecular systematics of Indian Alysicarpus.

  3. Molecular Biology In Young Women With Breast Cancer: From Tumor Gene Expression To DNA Mutations.

    Science.gov (United States)

    Gómez-Flores-Ramos, Liliana; Castro-Sánchez, Andrea; Peña-Curiel, Omar; Mohar-Betancourt, Alejandro

    2017-01-01

    Young women with breast cancer (YWBC) represent roughly 15% of breast cancer (BC) cases in Latin America and other developing regions. Breast tumors occurring at an early age are more aggressive and have an overall worse prognosis compared to breast tumors in postmenopausal women. The expression of relevant proliferation biomarkers such as endocrine receptors and human epidermal growth factor receptor 2 appears to be unique in YWBC. Moreover, histopathological, molecular, genetic, and genomic studies have shown that YWBC exhibit a higher frequency of aggressive subtypes, differential tumor gene expression, increased genetic susceptibility, and specific genomic signatures, compared to older women with BC. This article reviews the current knowledge on tumor biology and genomic signatures in YWBC.

  4. Diversity and molecular phylogeny of mitochondrial DNA of rhesus macaques (Macaca mulatta) in Bangladesh.

    Science.gov (United States)

    Hasan, M Kamrul; Feeroz, M Mostafa; Jones-Engel, Lisa; Engel, Gregory A; Kanthaswamy, Sree; Smith, David Glenn

    2014-11-01

    While studies of rhesus macaques (Macaca mulatta) in the eastern (e.g., China) and western (e.g., India) parts of their geographic range have revealed major genetic differences that warrant the recognition of two different subspecies, little is known about genetic characteristics of rhesus macaques in the transitional zone extending from eastern India and Bangladesh through the northern part of Indo-China, the probable original homeland of the species. We analyzed genetic variation of 762 base pairs of mitochondrial DNA from 86 fecal swab samples and 19 blood samples from 25 local populations of rhesus macaque in Bangladesh collected from January 2010 to August 2012. These sequences were compared with those of rhesus macaques from India, China, and Myanmar. Forty-six haplotypes defined by 200 (26%) polymorphic nucleotide sites were detected. Estimates of gene diversity, expected heterozygosity, and nucleotide diversity for the total population were 0.9599 ± 0.0097, 0.0193 ± 0.0582, and 0.0196 ± 0.0098, respectively. A mismatch distribution of paired nucleotide differences yielded a statistically significantly negative value of Tajima's D, reflecting a population that rapidly expanded after the terminal Pleistocene. Most haplotypes throughout regions of Bangladesh, including an isolated region in the southwestern area (Sundarbans), clustered with haplotypes assigned to the minor haplogroup Ind-2 from India reflecting an east to west dispersal of rhesus macaques to India. Haplotypes from the southeast region of Bangladesh formed a cluster with those from Myanmar, and represent the oldest rhesus macaque haplotypes of Bangladesh. These results are consistent with the hypothesis that rhesus macaques first entered Bangladesh from the southeast, probably from Indo-China, then dispersed westward throughout eastern and central India. © 2014 Wiley Periodicals, Inc.

  5. Molecular Typing of Borrelia burgdorferi Sensu Lato by Randomly Amplified Polymorphic DNA Fingerprinting Analysis

    Science.gov (United States)

    Wang, Guiqing; van Dam, Alje P.; Spanjaard, Lodewijk; Dankert, Jacob

    1998-01-01

    To study whether pathogenic clusters of Borrelia burgdorferi sensu lato strains occur, we typed 136 isolates, cultured from specimens from patients (n = 49) with various clinical entities and from ticks (n = 83) or dogs (n = 4) from different geographic regions, by randomly amplified polymorphic DNA (RAPD) fingerprinting with four arbitrary primers. The RAPD patterns were reproducible up to the 95% similarity level as shown in duplicate experiments. In these experiments the purified DNAs prepared on different days, from different colonies, and after various passages were used as templates. With an intergroup difference of 55%, the 136 strains could be divided into seven genetic clusters. Six clusters comprised and corresponded to the established species B. burgdorferi sensu stricto (n = 23), Borrelia garinii (n = 39), Borrelia afzelii (n = 59), Borrelia japonica (n = 1), Borrelia valaisiana (n = 12), and genomic group DN127 (n = 1). One strain from a patient with erythema migrans (EM) did not belong to any of the species or genomic groups known up to now. The RAPD types of B. burgdorferi sensu stricto, B. garinii, and B. afzelii isolates, which may give rise to human Lyme borreliosis (LB), were associated with their geographic origins. A high degree of genetic diversity was observed among the 39 B. garinii strains, and six subgroups could be recognized. One of these comprised eight isolates from patients with disseminated LB only and no tick isolates. B. afzelii strains from patients with EM or acrodermatitis chronica atrophicans were not clustered in particular branches. Our study showed that RAPD analysis is a powerful tool for discriminating different Borrelia species as well as Borrelia isolates within species. PMID:9508310

  6. A molecular phylogeny of the orange subfamily(Rutaceae: Aurantioideae) using nine cpDNA sequences.

    Science.gov (United States)

    Bayer, Randall J; Mabberley, David J; Morton, Cynthia; Miller, Cathy H; Sharma, Ish K; Pfeil, Bernard E; Rich, Sarah; Hitchcock, Roberta; Sykes, Steve

    2009-03-01

    The breeding of new, high-quality citrus cultivars depends on dependable information about the relationships of taxa within the tribe Citreae; therefore, it is important to have a well-supported phylogeny of the relationships between species not only to advance breeding strategies, but also to advance conservation strategies for the wild taxa. The recent history of the systematics of Citrus (Rutaceae: Aurantioideae) and its allies, in the context of Rutaceae taxonomy as a whole, is reviewed. The most recent classification is tested using nine cpDNA sequence regions in representatives of all genera of the subfam. Aurantioideae (save Limnocitrus) and numerous species and hybrids referred to Citrus s.l. Aurantioideae are confirmed as monophyletic. Within Aurantioideae, tribe Clauseneae are not monophyletic unless Murraya s.s. and Merrillia are removed to Aurantieae. Within tribe Aurantieae, the three traditionally recognized subtribes are not monophyletic. Triphasiinae is not monophyletic unless Oxanthera is returned to Citrus (Citrinae). Balsamocitrinae is polyphyletic. Feroniella, traditionally considered allied closely to Limonia (=Feronia), is shown to be nested in Citrus. The proposed congenericity of Severinia and Atalantia is confirmed. The most recent circumscription of Citrus is strongly supported by this analysis, with hybrids appearing with their putative maternal parents. The genus was resolved into two clades, one comprising wild species from New Guinea, Australia, and New Caledonia (formerly Clymenia, Eremocitrus, Microcitrus, Oxanthera), but surprisingly also Citrus medica, traditionally believed to be native in India. The second clade is largely from the Asian mainland (including species formerly referred to Fortunella and Poncirus).

  7. Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers.

    Science.gov (United States)

    Turek, Diane; Van Simaeys, Dimitri; Johnson, Judith; Ocsoy, Ismail; Tan, Weihong

    2013-01-01

    To generate DNA-aptamers binding to Methicillin-resistant Staphylococcus aureus (MRSA) . The Cell-Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology was used to run the selection against MRSA bacteria and develop target-specific aptamers. MRSA bacteria were targeted while Enterococcus faecalis bacteria were used for counter selection during that process. Binding assays to determine the right aptamer candidates as well as binding assays on clinical samples were performed through flow cytometry and analyzed using the FlowJo software. The characterization of the aptamers was done by determination of their K d values and determined by analysis of flow data at different aptamer concentration using SigmaPlot. Finally, the recognition of the complex Gold-nanoparticle-aptamer to the bacteria cells was observed using transmission electron microscopy (TEM). During the cell-SELEX selection process, 17 rounds were necessary to generate enrichment of the pool. While the selection was run using fixed cells, it was shown that the binding of the pools with live cells was giving similar results. After sequencing and analysis of the two last pools, four sequences were identified to be aptamer candidates. The characterization of those aptamers showed that based on their K d values, DTMRSA4 presented the best binding with a K d value of 94.61 ± 18.82 nmol/L. A total of ten clinical samples of MRSA , S. aureus and Enterococcus faecalis were obtained to test those aptamers and determine their binding on a panel of samples. DTMRSA1 and DTMRSA3 showed the best results regarding their specificity to MRSA , DTMRSA1 being the most specific of all. Finally, those aptamers were coupled with gold-nanoparticle and their binding to MRSA cells was visualized through TEM showing that adduction of nanoparticles on the aptamers did not change their binding property. A total of four aptamers that bind to MRSA were obtained with K d values ranking from 94 to 200 nmol/L.

  8. DOE contractors' workshop: Cellular and molecular aspects of radiation induced DNA damage and repair

    Energy Technology Data Exchange (ETDEWEB)

    1987-01-01

    For four decades the US Department of Energy and its predecessors have been the lead federal agency in supporting radiation biology research. Over the years emphasis in this program has gradually shifted from dose-effect studies on animals to research on the effects of radiations of various qualities on cells and molecules. Mechanistic studies on the action of radiation at the subcellular level are few in number and there is a need for more research in this area if we are to gain a better understanding of how radiation affects living cells. The intent of this workshop was to bring together DOE contractors and grantees who are investigating the effects of radiation at the cellular and molecular levels. The aims were to foster the exchange of information on research projects and experimental results, promote collaborative research efforts, and obtain an overview of research currently supported by the Health Effects Research Division of the Office of Health and Environmental Research. The latter is needed by the Office for program planning purposes. This report on the workshop which took place in Albuquerque, New Mexico on March 10-11, 1987, includes an overview with future research recommendations, extended abstracts of the plenary presentations, shorter abstracts of each poster presentation, a workshop agenda and the names and addresses of the attendees.

  9. DNA Variations in Oculocutaneous Albinism: An Updated Mutation List and Current Outstanding Issues in Molecular Diagnostics

    Science.gov (United States)

    Simeonov, Dimitre R.; Wang, Xinjing; Wang, Chen; Sergeev, Yuri; Dolinska, Monika; Bower, Matthew; Fischer, Roxanne; Winer, David; Dubrovsky, Genia; Balog, Joan Z.; Huizing, Marjan; Hart, Rachel; Zein, Wadih M.; Gahl, William A.; Brooks, Brian P.; Adams, David R.

    2014-01-01

    Oculocutaneous albinism (OCA) is a rare genetic disorder of melanin synthesis that results in hypopigmented hair, skin, and eyes. There are four types of OCA, caused by mutations in TYR (OCA-1), OCA2 (OCA-2), TYRP1 (OCA-3), or SLC45A2 (OCA-4). Here we report 22 novel mutations; 14 from a cohort of 61 patients seen as part of the NIH OCA Natural History Study and 8 from a prior study at the University of Minnesota. We also include a comprehensive list of almost 600 previously reported OCA mutations, along with ethnicity information, carrier frequencies, and in silico pathogenicity predictions. In addition to discussing the clinical and molecular features of OCA, we address the cases of apparent missing heritability. In our cohort, 25% of patients did not have two mutations in a single OCA gene. We demonstrate the utility of multiple detection methods to reveal mutations missed by Sanger sequencing. Finally, we review the TYR p.R402Q temperature sensitive variant and confirm its association with cases of albinism with only one identifiable TYR mutation. PMID:23504663

  10. DOE contractors' workshop: Cellular and molecular aspects of radiation induced DNA damage and repair

    International Nuclear Information System (INIS)

    1987-01-01

    For four decades the US Department of Energy and its predecessors have been the lead federal agency in supporting radiation biology research. Over the years emphasis in this program has gradually shifted from dose-effect studies on animals to research on the effects of radiations of various qualities on cells and molecules. Mechanistic studies on the action of radiation at the subcellular level are few in number and there is a need for more research in this area if we are to gain a better understanding of how radiation affects living cells. The intent of this workshop was to bring together DOE contractors and grantees who are investigating the effects of radiation at the cellular and molecular levels. The aims were to foster the exchange of information on research projects and experimental results, promote collaborative research efforts, and obtain an overview of research currently supported by the Health Effects Research Division of the Office of Health and Environmental Research. The latter is needed by the Office for program planning purposes. This report on the workshop which took place in Albuquerque, New Mexico on March 10-11, 1987, includes an overview with future research recommendations, extended abstracts of the plenary presentations, shorter abstracts of each poster presentation, a workshop agenda and the names and addresses of the attendees

  11. Molecular phylogeny of the spoonbills (Aves: Threskiornithidae) based on mitochondrial DNA

    Science.gov (United States)

    Chesser, R. Terry; Yeung, Carol K.L.; Yao, Cheng-Te; Tian, Xiu-Hua; Li, Shou-Hsien

    2010-01-01

    Spoonbills (genus Platalea) are a small group of wading birds, generally considered to constitute the subfamily Plataleinae (Aves: Threskiornithidae). We reconstructed phylogenetic relationships among the six species of spoonbills using variation in sequences of the mitochondrial genes ND2 and cytochrome b (total 1796 bp). Topologies of phylogenetic trees reconstructed using maximum likelihood, maximum parsimony, and Bayesian analyses were virtually identical and supported monophyly of the spoonbills. Most relationships within Platalea received strong support: P. minor and P. regia were closely related sister species, P. leucorodia was sister to the minor-regia clade, and P. alba was sister to the minor-regia-leucorodia clade. Relationships of P. flavipes and P. ajaja were less well resolved: these species either formed a clade that was sister to the four-species clade, or were successive sisters to this clade. This phylogeny is consistent with ideas of relatedness derived from spoonbill morphology. Our limited sampling of the Threskiornithinae (ibises), the putative sister group to the spoonbills, indicated that this group is paraphyletic, in agreement with previous molecular data; this suggests that separation of the Threskiornithidae into subfamilies Plataleinae and Threskiornithinae may not be warranted.

  12. Correlation between energy deposition and molecular damage from Auger electrons: A case study of ultra-low energy (5–18 eV) electron interactions with DNA

    Energy Technology Data Exchange (ETDEWEB)

    Rezaee, Mohammad, E-mail: Mohammad.Rezaee@USherbrooke.ca; Hunting, Darel J.; Sanche, Léon [Groupe en Sciences des Radiations, Département de Médecine Nucléaire et Radiobiologie, Faculté de Médecine et des Sciences de la Santé, Université de Sherbrooke, Sherbrooke, Québec J1H 5N4 (Canada)

    2014-07-15

    Purpose: The present study introduces a new method to establish a direct correlation between biologically related physical parameters (i.e., stopping and damaging cross sections, respectively) for an Auger-electron emitting radionuclide decaying within a target molecule (e.g., DNA), so as to evaluate the efficacy of the radionuclide at the molecular level. These parameters can be applied to the dosimetry of Auger electrons and the quantification of their biological effects, which are the main criteria to assess the therapeutic efficacy of Auger-electron emitting radionuclides. Methods: Absorbed dose and stopping cross section for the Auger electrons of 5–18 eV emitted by{sup 125}I within DNA were determined by developing a nanodosimetric model. The molecular damages induced by these Auger electrons were investigated by measuring damaging cross section, including that for the formation of DNA single- and double-strand breaks. Nanoscale films of pure plasmid DNA were prepared via the freeze-drying technique and subsequently irradiated with low-energy electrons at various fluences. The damaging cross sections were determined by employing a molecular survival model to the measured exposure–response curves for induction of DNA strand breaks. Results: For a single decay of{sup 125}I within DNA, the Auger electrons of 5–18 eV deposit the energies of 12.1 and 9.1 eV within a 4.2-nm{sup 3} volume of a hydrated or dry DNA, which results in the absorbed doses of 270 and 210 kGy, respectively. DNA bases have a major contribution to the deposited energies. Ten-electronvolt and high linear energy transfer 100-eV electrons have a similar cross section for the formation of DNA double-strand break, while 100-eV electrons are twice as efficient as 10 eV in the induction of single-strand break. Conclusions: Ultra-low-energy electrons (<18 eV) substantially contribute to the absorbed dose and to the molecular damage from Auger-electron emitting radionuclides; hence, they should

  13. Molecular analyses reveal two geographic and genetic lineages for tapeworms, Taenia solium and Taenia saginata, from Ecuador using mitochondrial DNA.

    Science.gov (United States)

    Solano, Danilo; Navarro, Juan Carlos; León-Reyes, Antonio; Benítez-Ortiz, Washington; Rodríguez-Hidalgo, Richar

    2016-12-01

    Tapeworms Taenia solium and Taenia saginata are the causative agents of taeniasis/cysticercosis. These are diseases with high medical and veterinary importance due to their impact on public health and rural economy in tropical countries. The re-emergence of T. solium as a result of human migration, the economic burden affecting livestock industry, and the large variability of symptoms in several human cysticercosis, encourage studies on genetic diversity, and the identification of these parasites with molecular phylogenetic tools. Samples collected from the Ecuadorian provinces: Loja, Guayas, Manabí, Tungurahua (South), and Imbabura, Pichincha (North) from 2000 to 2012 were performed under Maximum Parsimony analyses and haplotype networks using partial sequences of mitochondrial DNA, cytochrome oxidase subunit I (COI) and NADH subunit I (NDI), from Genbank and own sequences of Taenia solium and Taenia saginata from Ecuador. Both species have shown reciprocal monophyly, which confirms its molecular taxonomic identity. The COI and NDI genes results suggest phylogenetic structure for both parasite species from south and north of Ecuador. In T. solium, both genes gene revealed greater geographic structure, whereas in T. saginata, the variability for both genes was low. In conclusion, COI haplotype networks of T. solium suggest two geographical events in the introduction of this species in Ecuador (African and Asian lineages) and occurring sympatric, probably through the most common routes of maritime trade between the XV-XIX centuries. Moreover, the evidence of two NDI geographical lineages in T. solium from the north (province of Imbabura) and the south (province of Loja) of Ecuador derivate from a common Indian ancestor open new approaches for studies on genetic populations and eco-epidemiology. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. RNA/DNA Hybrid Interactome Identifies DXH9 as a Molecular Player in Transcriptional Termination and R-Loop-Associated DNA Damage.

    Science.gov (United States)

    Cristini, Agnese; Groh, Matth