WorldWideScience

Sample records for mitochondrial voltage-dependent anion

  1. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta

    2017-06-01

    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  2. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

    Science.gov (United States)

    Gupta, Rajeev; Ghosh, Subhendu

    2017-06-01

    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  3. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  4. The voltage-dependent anion selective channel 1 (VDAC1 topography in the mitochondrial outer membrane as detected in intact cell.

    Directory of Open Access Journals (Sweden)

    Marianna F Tomasello

    Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.

  5. Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

    Directory of Open Access Journals (Sweden)

    John J. Lemasters

    2017-12-01

    Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

  6. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise.

    Science.gov (United States)

    Gupta, Rajeev

    2017-09-02

    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

    2010-01-01

    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  8. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy.

    Science.gov (United States)

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda

    2015-12-25

    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.

    Science.gov (United States)

    Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer

    2013-09-01

    Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.

  10. The Anion Paradox in Sodium Taste Reception: Resolution by Voltage-Clamp Studies

    Science.gov (United States)

    Ye, Qing; Heck, Gerard L.; Desimone, John A.

    1991-11-01

    Sodium salts are potent taste stimuli, but their effectiveness is markedly dependent on the anion, with chloride yielding the greatest response. The cellular mechanisms that mediate this phenomenon are not known. This "anion paradox" has been resolved by considering the field potential that is generated by restricted electrodiffusion of the anion through paracellular shunts between taste-bud cells. Neural responses to sodium chloride, sodium acetate, and sodium gluconate were studied while the field potential was voltage-clamped. Clamping at electronegative values eliminated the anion effect, whereas clamping at electropositive potentials exaggerated it. Thus, field potentials across the lingual epithelium modulate taste reception, indicating that the functional unit of taste reception includes the taste cell and its paracellular microenvironment.

  11. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li

    2013-01-01

    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  12. Cloning and functional expression of a plant voltage-dependent chloride channel.

    Science.gov (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  13. Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

    Directory of Open Access Journals (Sweden)

    Xufeng Li

    2009-05-01

    Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

  14. Chloride Anions Regulate Kinetics but Not Voltage-Sensor Qmax of the Solute Carrier SLC26a5.

    Science.gov (United States)

    Santos-Sacchi, Joseph; Song, Lei

    2016-06-07

    In general, SLC26 solute carriers serve to transport a variety of anions across biological membranes. However, prestin (SLC26a5) has evolved, now serving as a motor protein in outer hair cells (OHCs) of the mammalian inner ear and is required for cochlear amplification, a mechanical feedback mechanism to boost auditory performance. The mechanical activity of the OHC imparted by prestin is driven by voltage and controlled by anions, chiefly intracellular chloride. Current opinion is that chloride anions control the Boltzmann characteristics of the voltage sensor responsible for prestin activity, including Qmax, the total sensor charge moved within the membrane, and Vh, a measure of prestin's operating voltage range. Here, we show that standard narrow-band, high-frequency admittance measures of nonlinear capacitance (NLC), an alternate representation of the sensor's charge-voltage (Q-V) relationship, is inadequate for assessment of Qmax, an estimate of the sum of unitary charges contributed by all voltage sensors within the membrane. Prestin's slow transition rates and chloride-binding kinetics adversely influence these estimates, contributing to the prevalent concept that intracellular chloride level controls the quantity of sensor charge moved. By monitoring charge movement across frequency, using measures of multifrequency admittance, expanded displacement current integration, and OHC electromotility, we find that chloride influences prestin kinetics, thereby controlling charge magnitude at any particular frequency of interrogation. Importantly, however, this chloride dependence vanishes as frequency decreases, with Qmax asymptoting at a level irrespective of the chloride level. These data indicate that prestin activity is significantly low-pass in the frequency domain, with important implications for cochlear amplification. We also note that the occurrence of voltage-dependent charge movements in other SLC26 family members may be hidden by inadequate

  15. Mitochondrial respiration scavenges extramitochondrial superoxide anion via a nonenzymatic mechanism.

    OpenAIRE

    Guidot, D M; Repine, J E; Kitlowski, A D; Flores, S C; Nelson, S K; Wright, R M; McCord, J M

    1995-01-01

    We determined that mitochondrial respiration reduced cytosolic oxidant stress in vivo and scavenged extramitochondrial superoxide anion (O2-.) in vitro. First, Saccharomyces cerevisiae deficient in both the cytosolic antioxidant cupro-zinc superoxide dismutase (Cu,Zn-SOD) and electron transport (Rho0 state) grew poorly (P 0.05) in all yeast. Seco...

  16. Ca2+ and Mg2+-enhanced reduction of arsenazo III to its anion free radical metabolite and generation of superoxide anion by an outer mitochondrial membrane azoreductase.

    Science.gov (United States)

    Moreno, S N; Mason, R P; Docampo, R

    1984-12-10

    At the concentrations usually employed as a Ca2+ indicator, arsenazo III underwent a one-electron reduction by rat liver mitochondria to produce an azo anion radical as demonstrated by electron-spin resonance spectroscopy. Either NADH or NADPH could serve as a source of reducing equivalents for the production of this free radical by intact rat liver mitochondria. Under aerobic conditions, addition of arsenazo III to rat liver mitochondria produced an increase in electron flow from NAD(P)H to molecular oxygen, generating superoxide anion. NAD(P)H generated from endogenous mitochondrial NAD(P)+ by intramitochondrial reactions could not be used for the NAD(P)H azoreductase reaction unless the mitochondria were solubilized by detergent or anaerobiosis. In addition, NAD(P)H azoreductase activity was higher in the crude outer mitochondrial membrane fraction than in mitoplasts and intact mitochondria. The steady-state concentration of the azo anion radical and the arsenazo III-stimulated cyanide-insensitive oxygen consumption were enhanced by calcium and magnesium, suggesting that, in addition to an enhanced azo anion radical-stabilization by complexation with the metal ions, enhanced reduction of arsenazo III also occurred. Accordingly, addition of cations to crude outer mitochondrial membrane preparations increased arsenazo III-stimulated cyanide-insensitive O2 consumption, H2O2 formation, and NAD(P)H oxidation. Antipyrylazo III was much less effective than arsenazo III in increasing superoxide anion formation by rat liver mitochondria and gave a much weaker electron spin resonance spectrum of an azo anion radical. These results provide direct evidence of an azoreductase activity associated with the outer mitochondrial membrane and of a stimulation of arsenazo III reduction by cations.

  17. Kinetics of Ca2+- and ATP-dependent, voltage-controlled anion conductance in the plasma membrane of mesophyll cells of Pisum sativum

    NARCIS (Netherlands)

    Elzenga, J.T.M.; van Volkenburgh, E.

    Whole-cell patch-clamp techniques were used to measure anion currents through the plasma membrane of protoplasts of mesophyll cells of expanding pea (Pisum sativum L.) leaves. Voltage-induced changes of the currents could be modelled with single exponential activation and deactivation kinetics. The

  18. Morphofunctional and Biochemical Approaches for Studying Mitochondrial Changes during Myoblasts Differentiation

    Directory of Open Access Journals (Sweden)

    Elena Barbieri

    2011-01-01

    Full Text Available This study describes mitochondrial behaviour during the C2C12 myoblast differentiation program and proposes a proteomic approach to mitochondria integrated with classical morphofunctional and biochemical analyses. Mitochondrial ultrastructure variations were determined by transmission electron microscopy; mitochondrial mass and membrane potential were analysed by Mitotracker Green and JC-1 stains and by epifluorescence microscope. Expression of PGC1 , NRF1 , and Tfam genes controlling mitochondrial biogenesis was studied by real-time PCR. The mitochondrial functionality was tested by cytochrome c oxidase activity and COXII expression. Mitochondrial proteomic profile was also performed. These assays showed that mitochondrial biogenesis and activity significantly increase in differentiating myotubes. The proteomic profile identifies 32 differentially expressed proteins, mostly involved in oxidative metabolism, typical of myotubes formation. Other notable proteins, such as superoxide dismutase (MnSOD, a cell protection molecule, and voltage-dependent anion-selective channel protein (VDAC1 involved in the mitochondria-mediated apoptosis, were found to be regulated by the myogenic process. The integration of these approaches represents a helpful tool for studying mitochondrial dynamics, biogenesis, and functionality in comparative surveys on mitochondrial pathogenic or senescent satellite cells.

  19. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  20. Dynamics of enhanced mitochondrial respiration in female compared with male rat cerebral arteries.

    Science.gov (United States)

    Rutkai, Ibolya; Dutta, Somhrita; Katakam, Prasad V; Busija, David W

    2015-11-01

    Mitochondrial respiration has never been directly examined in intact cerebral arteries. We tested the hypothesis that mitochondrial energetics of large cerebral arteries ex vivo are sex dependent. The Seahorse XFe24 analyzer was used to examine mitochondrial respiration in isolated cerebral arteries from adult male and female Sprague-Dawley rats. We examined the role of nitric oxide (NO) on mitochondrial respiration under basal conditions, using N(ω)-nitro-l-arginine methyl ester, and following pharmacological challenge using diazoxide (DZ), and also determined levels of mitochondrial and nonmitochondrial proteins using Western blot, and vascular diameter responses to DZ. The components of mitochondrial respiration including basal respiration, ATP production, proton leak, maximal respiration, and spare respiratory capacity were elevated in females compared with males, but increased in both male and female arteries in the presence of the NOS inhibitor. Although acute DZ treatment had little effect on mitochondrial respiration of male arteries, it decreased the respiration in female arteries. Levels of mitochondrial proteins in Complexes I-V and the voltage-dependent anion channel protein were elevated in female compared with male cerebral arteries. The DZ-induced vasodilation was greater in females than in males. Our findings show that substantial sex differences in mitochondrial respiratory dynamics exist in large cerebral arteries and may provide the mechanistic basis for observations that the female cerebral vasculature is more adaptable after injury. Copyright © 2015 the American Physiological Society.

  1. Cytotoxic mechanisms of hydrosulfide anion and cyanide anion in primary rat hepatocyte cultures

    International Nuclear Information System (INIS)

    Thompson, Rodney W.; Valentine, Holly L.; Valentine, William M.

    2003-01-01

    Hydrogen sulfide and hydrogen cyanide are known to compromise mitochondrial respiration through inhibition of cytochrome c oxidase and this is generally considered to be their primary mechanism of toxicity. Experimental studies and the efficiency of current treatment protocols suggest that H 2 S may exert adverse physiological effects through additional mechanisms. To evaluate the role of alternative mechanisms in H 2 S toxicity, the relative contributions of electron transport inhibition, uncoupling of mitochondrial respiration, and opening of the mitochondrial permeability transition pore (MPTP) to hydrosulfide and cyanide anion cytotoxicity in primary hepatocyte cultures were examined. Supplementation of hepatocytes with the glycolytic substrate, fructose, rescued hepatocytes from cyanide anion induced toxicity, whereas fructose supplementation increased hydrosulfide anion toxicity suggesting that hydrosulfide anion may compromise glycolysis in hepatocytes. Although inhibitors of the MPTP opening were protective for hydrosulfide anion, they had no effect on cyanide anion toxicity, consistent with an involvement of the permeability transition pore in hydrosulfide anion toxicity but not cyanide anion toxicity. Exposure of isolated rat liver mitochondria to hydrosulfide did not result in large amplitude swelling suggesting that if H 2 S induces the permeability transition it does so indirectly through a mechanism requiring other cellular components. Hydrosulfide anion did not appear to be an uncoupler of mitochondrial respiration in hepatocytes based upon the inability of oligomycin and fructose to protect hepatocytes from hydrosulfide anion toxicity. These findings support mechanisms additional to inhibition of cytochrome c oxidase in hydrogen sulfide toxicity. Further investigations are required to assess the role of the permeability transition in H 2 S toxicity, determine whether similar affects occur in other cell types or in vivo and evaluate whether this may

  2. Concentration dependence of halide fluxes and selectivity of the anion pathway in toad skin

    DEFF Research Database (Denmark)

    Harck, A F; Larsen, Erik Hviid

    1986-01-01

    The isolated toad (Bufo bufo) skin was mounted under voltage-clamp conditions in a chamber shown to cause no significant edge damage. The serosal side of the skin was bathed with NaCl-Ringer's, and the passive voltage-sensitive anion conductance studied in its fully voltage activated state, V = -...

  3. Myostatin induces mitochondrial metabolic alteration and typical apoptosis in cancer cells

    Science.gov (United States)

    Liu, Y; Cheng, H; Zhou, Y; Zhu, Y; Bian, R; Chen, Y; Li, C; Ma, Q; Zheng, Q; Zhang, Y; Jin, H; Wang, X; Chen, Q; Zhu, D

    2013-01-01

    Myostatin, a member of the transforming growth factor-β superfamily, regulates the glucose metabolism of muscle cells, while dysregulated myostatin activity is associated with a number of metabolic disorders, including muscle cachexia, obesity and type II diabetes. We observed that myostatin induced significant mitochondrial metabolic alterations and prolonged exposure of myostatin induced mitochondria-dependent apoptosis in cancer cells addicted to glycolysis. To address the underlying mechanism, we found that the protein levels of Hexokinase II (HKII) and voltage-dependent anion channel 1 (VDAC1), two key regulators of glucose metabolisms as well as metabolic stress-induced apoptosis, were negatively correlated. In particular, VDAC1 was dramatically upregulated in cells that are sensitive to myostatin treatment whereas HKII was downregulated and dissociated from mitochondria. Myostatin promoted the translocation of Bax from cytosol to mitochondria, and knockdown of VDAC1 inhibited myostatin-induced Bax translocation and apoptosis. These apoptotic changes can be partially rescued by repletion of ATP, or by ectopic expression of HKII, suggesting that perturbation of mitochondrial metabolism is causally linked with subsequent apoptosis. Our findings reveal novel function of myostatin in regulating mitochondrial metabolism and apoptosis in cancer cells. PMID:23412387

  4. Anion channels: master switches of stress responses.

    Science.gov (United States)

    Roelfsema, M Rob G; Hedrich, Rainer; Geiger, Dietmar

    2012-04-01

    During stress, plant cells activate anion channels and trigger the release of anions across the plasma membrane. Recently, two new gene families have been identified that encode major groups of anion channels. The SLAC/SLAH channels are characterized by slow voltage-dependent activation (S-type), whereas ALMT genes encode rapid-activating channels (R-type). Both S- and R-type channels are stimulated in guard cells by the stress hormone ABA, which leads to stomatal closure. Besides their role in ABA-dependent stomatal movement, anion channels are also activated by biotic stress factors such as microbe-associated molecular patterns (MAMPs). Given that anion channels occur throughout the plant kingdom, they are likely to serve a general function as master switches of stress responses. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle.

    Science.gov (United States)

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S

    2011-08-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    Science.gov (United States)

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Quercetin Affects Erythropoiesis and Heart Mitochondrial Function in Mice

    Directory of Open Access Journals (Sweden)

    Lina M. Ruiz

    2015-01-01

    Full Text Available Quercetin, a dietary flavonoid used as a food supplement, showed powerful antioxidant effects in different cellular models. However, recent in vitro and in vivo studies in mammals have suggested a prooxidant effect of quercetin and described an interaction with mitochondria causing an increase in O2∙- production, a decrease in ATP levels, and impairment of respiratory chain in liver tissue. Therefore, because of its dual actions, we studied the effect of quercetin in vivo to analyze heart mitochondrial function and erythropoiesis. Mice were injected with 50 mg/kg of quercetin for 15 days. Treatment with quercetin decreased body weight, serum insulin, and ceruloplasmin levels as compared with untreated mice. Along with an impaired antioxidant capacity in plasma, quercetin-treated mice showed a significant delay on erythropoiesis progression. Heart mitochondrial function was also impaired displaying more protein oxidation and less activity for IV, respectively, than no-treated mice. In addition, a significant reduction in the protein expression levels of Mitofusin 2 and Voltage-Dependent Anion Carrier was observed. All these results suggest that quercetin affects erythropoiesis and mitochondrial function and then its potential use as a dietary supplement should be reexamined.

  8. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  9. Metformin reduces hyper-reactivity of platelets from patients with polycystic ovary syndrome by improving mitochondrial integrity.

    Science.gov (United States)

    Randriamboavonjy, Voahanginirina; Mann, W Alexander; Elgheznawy, Amro; Popp, Rüdiger; Rogowski, Paul; Dornauf, Imke; Dröse, Stefan; Fleming, Ingrid

    2015-08-31

    Polycystic ovary syndrome (PCOS) is associated with decreased fertility, insulin resistance and an increased risk of developing cardiovascular disease. Treating PCOS patients with metformin improves fertility and decreases cardiovascular complications. Given that platelet activation contributes to both infertility and cardiovascular disease development, we assessed platelet reactivity in PCOS patients and the consequences of metformin treatment. Compared to washed platelets from healthy donors, platelets from PCOS patients demonstrated enhanced reactivity and impaired activation of the AMP-activated kinase (AMPK). PCOS platelets also demonstrated enhanced expression of mitochondrial proteins such as the cytochrome c reductase, ATP synthase and the voltage-dependent anion channel-1. However, mitochondrial function was impaired as demonstrated by a decreased respiration rate. In parallel, the phosphorylation of dynamin-related protein-1 (Drp-1) on Ser616 was increased while that on Ser637 decreased. The latter changes were accompanied by decreased mitochondrial size. In insulin-resistant PCOS patients (HOMA-IR> 2) metformin treatment (1.7 g per day for 4 weeks to 6 months) improved insulin sensitivity, restored mitochondrial integrity and function and normalised platelet aggregation. Treatment was without effect in PCOS patients with HOMA-IRtreatment of megakaryocytes with metformin enhanced mitochondrial content and in the same cells metformin enhanced the phosphorylation of the Drp-1 on Ser637 via an AMPKα1-dependent mechanism. In conclusion, the improvement of mitochondrial integrity and platelet reactivity may contribute to the beneficial effects of metformin on cardiovascular disease.

  10. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    Science.gov (United States)

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  11. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    Science.gov (United States)

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Helicobacter pylori VacA toxin/subunit p34: targeting of an anion channel to the inner mitochondrial membrane.

    Directory of Open Access Journals (Sweden)

    Grazyna Domańska

    2010-04-01

    Full Text Available The vacuolating toxin VacA, released by Helicobacter pylori, is an important virulence factor in the pathogenesis of gastritis and gastroduodenal ulcers. VacA contains two subunits: The p58 subunit mediates entry into target cells, and the p34 subunit mediates targeting to mitochondria and is essential for toxicity. In this study we found that targeting to mitochondria is dependent on a unique signal sequence of 32 uncharged amino acid residues at the p34 N-terminus. Mitochondrial import of p34 is mediated by the import receptor Tom20 and the import channel of the outer membrane TOM complex, leading to insertion of p34 into the mitochondrial inner membrane. p34 assembles in homo-hexamers of extraordinary high stability. CD spectra of the purified protein indicate a content of >40% beta-strands, similar to pore-forming beta-barrel proteins. p34 forms an anion channel with a conductivity of about 12 pS in 1.5 M KCl buffer. Oligomerization and channel formation are independent both of the 32 uncharged N-terminal residues and of the p58 subunit of the toxin. The conductivity is efficiently blocked by 5-nitro-2-(3-phenylpropylaminobenzoic acid (NPPB, a reagent known to inhibit VacA-mediated apoptosis. We conclude that p34 essentially acts as a small pore-forming toxin, targeted to the mitochondrial inner membrane by a special hydrophobic N-terminal signal.

  13. Peripheral-type benzodiazepine receptor: a protein of mitochondrial outer membranes utilizing porphyrins as endogenous ligands

    International Nuclear Information System (INIS)

    Snyder, S.H.; Verma, A.; Trifiletti, R.R.

    1987-01-01

    The peripheral-type benzodiazepine receptor is a site identified by its nanomolar affinity for [ 3 H]diazepam, similar to the affinity of diazepam for the central-type benzodiazepine receptor in the brain. The peripheral type benzodiazepine receptor occurs in many peripheral tissues but has discrete localizations as indicated by autoradiographic studies showing uniquely high densities of the receptors in the adrenal cortex and in Leydig cells of the testes. Subcellular localization studies reveal a selective association of the receptors with the outer membrane of mitochondria. Photoaffinity labeling of the mitochondrial receptor with [ 3 H]flunitrazepam reveals two discrete labeled protein bands of 30 and 35 kDa, respectively. The 35-kDa band appears to be identical with the voltage-dependent anion channel protein porin. Fractionation of numerous peripheral tissues reveals a single principal endogenous ligand for the receptor, consisting of porphyrins, which display nanomolar affinity. Interactions of porphyrins with the mitochondrial receptor may clarify its physiological role and account for many pharmacological actions of benzodiazepines

  14. Influenza virus PB1-F2 protein induces cell death through mitochondrial ANT3 and VDAC1.

    Directory of Open Access Journals (Sweden)

    Dmitriy Zamarin

    2005-09-01

    Full Text Available The influenza virus PB1-F2 is an 87-amino acid mitochondrial protein that previously has been shown to induce cell death, although the mechanism of apoptosis induction has remained unclear. In the process of characterizing its mechanism of action we found that the viral PB1-F2 protein sensitizes cells to apoptotic stimuli such as tumor necrosis factor alpha, as demonstrated by increased cleavage of caspase 3 substrates in PB1-F2-expressing cells. Moreover, treatment of purified mouse liver mitochondria with recombinant PB1-F2 protein resulted in cytochrome c release, loss of the mitochondrial membrane potential, and enhancement of tBid-induced mitochondrial permeabilization, suggesting a possible mechanism for the observed cellular sensitization to apoptosis. Using glutathione-S-transferase pulldowns with subsequent mass spectrometric analysis, we identified the mitochondrial interactors of the PB1-F2 protein and showed that the viral protein uniquely interacts with the inner mitochondrial membrane adenine nucleotide translocator 3 and the outer mitochondrial membrane voltage-dependent anion channel 1, both of which are implicated in the mitochondrial permeability transition during apoptosis. Consistent with this interaction, blockers of the permeability transition pore complex (PTPC inhibited PB1-F2-induced mitochondrial permeabilization. Based on our findings, we propose a model whereby the proapoptotic PB1-F2 protein acts through the mitochondrial PTPC and may play a role in the down-regulation of the host immune response to infection.

  15. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

    Science.gov (United States)

    Cui, Jianmin

    2016-01-01

    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  16. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    Science.gov (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  17. Characterization of canine mitochondrial protein expression in natural and induced forms of idiopathic dilated cardiomyopathy.

    Science.gov (United States)

    Lopes, Rosana; Solter, Philip F; Sisson, D David; Oyama, Mark A; Prosek, Robert

    2006-06-01

    To map canine mitochondrial proteins and identify qualitative and quantitative differences in heart mitochondrial protein expression between healthy dogs and dogs with naturally occurring and induced dilated cardiomyopathy (DCM). Left ventricle samples were obtained from 7 healthy dogs, 7 Doberman Pinschers with naturally occurring DCM, and 7 dogs with induced DCM. Fresh and frozen mitochondrial fractions were isolated from the left ventricular free wall and analyzed by 2-dimensional electrophoresis. Protein spots that increased or decreased in density by >or= 2-fold between groups were analyzed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry or quadrupole selecting, quadrupole collision cell, time-of-flight mass spectrometry. Within narrow pH gradients of control canine heart mitochondrial samples, a total of 1,528 protein spots were revealed. Forty subunits of heart mitochondrial proteins that differ significantly from control tissues were altered in tissue specimens from dogs with naturally occurring and induced forms of DCM. The most affected heart mitochondrial proteins in both groups were those of oxidative phosphorylation (55%). Upregulation of manganese superoxide dismutase was suggestive of heart oxidative injury in tissue specimens from dogs with both forms of DCM. Evidence of apoptosis was associated with overexpression of the heart mitochondrial voltage-dependent anion channel-2 protein and endonuclease G in tissue specimens from dogs with induced DCM. Alterations of heart mitochondrial proteins related to oxidative phosphorylation dysfunction were more prevalent in tissue specimens from dogs with induced or naturally occurring DCM, compared with those of control dogs.

  18. Zinc-dependent multi-conductance channel activity in mitochondria isolated from ischemic brain.

    Science.gov (United States)

    Bonanni, Laura; Chachar, Mushtaque; Jover-Mengual, Teresa; Li, Hongmei; Jones, Adrienne; Yokota, Hidenori; Ofengeim, Dimitry; Flannery, Richard J; Miyawaki, Takahiro; Cho, Chang-Hoon; Polster, Brian M; Pypaert, Marc; Hardwick, J Marie; Sensi, Stefano L; Zukin, R Suzanne; Jonas, Elizabeth A

    2006-06-21

    Transient global ischemia is a neuronal insult that induces delayed cell death. A hallmark event in the early post-ischemic period is enhanced permeability of mitochondrial membranes. The precise mechanisms by which mitochondrial function is disrupted are, as yet, unclear. Here we show that global ischemia promotes alterations in mitochondrial membrane contact points, a rise in intramitochondrial Zn2+, and activation of large, multi-conductance channels in mitochondrial outer membranes by 1 h after insult. Mitochondrial channel activity was associated with enhanced protease activity and proteolytic cleavage of BCL-xL to generate its pro-death counterpart, deltaN-BCL-xL. The findings implicate deltaN-BCL-xL in large, multi-conductance channel activity. Consistent with this, large channel activity was mimicked by introduction of recombinant deltaN-BCL-xL to control mitochondria and blocked by introduction of a functional BCL-xL antibody to post-ischemic mitochondria via the patch pipette. Channel activity was also inhibited by nicotinamide adenine dinucleotide, indicative of a role for the voltage-dependent anion channel (VDAC) of the outer mitochondrial membrane. In vivo administration of the membrane-impermeant Zn2+ chelator CaEDTA before ischemia or in vitro application of the membrane-permeant Zn2+ chelator tetrakis-(2-pyridylmethyl) ethylenediamine attenuated channel activity, suggesting a requirement for Zn2+. These findings reveal a novel mechanism by which ischemic insults disrupt the functional integrity of the outer mitochondrial membrane and implicate deltaN-BCL-xL and VDAC in the large, Zn2+-dependent mitochondrial channels observed in post-ischemic hippocampal mitochondria.

  19. Increased mitochondrial content in remyelinated axons: implications for multiple sclerosis

    Science.gov (United States)

    Zambonin, Jessica L.; Zhao, Chao; Ohno, Nobuhiko; Campbell, Graham R.; Engeham, Sarah; Ziabreva, Iryna; Schwarz, Nadine; Lee, Sok Ee; Frischer, Josa M.; Turnbull, Doug M.; Trapp, Bruce D.; Lassmann, Hans; Franklin, Robin J. M.

    2011-01-01

    Mitochondrial content within axons increases following demyelination in the central nervous system, presumably as a response to the changes in energy needs of axons imposed by redistribution of sodium channels. Myelin sheaths can be restored in demyelinated axons and remyelination in some multiple sclerosis lesions is extensive, while in others it is incomplete or absent. The effects of remyelination on axonal mitochondrial content in multiple sclerosis, particularly whether remyelination completely reverses the mitochondrial changes that follow demyelination, are currently unknown. In this study, we analysed axonal mitochondria within demyelinated, remyelinated and myelinated axons in post-mortem tissue from patients with multiple sclerosis and controls, as well as in experimental models of demyelination and remyelination, in vivo and in vitro. Immunofluorescent labelling of mitochondria (porin, a voltage-dependent anion channel expressed on all mitochondria) and axons (neurofilament), and ultrastructural imaging showed that in both multiple sclerosis and experimental demyelination, mitochondrial content within remyelinated axons was significantly less than in acutely and chronically demyelinated axons but more numerous than in myelinated axons. The greater mitochondrial content within remyelinated, compared with myelinated, axons was due to an increase in density of porin elements whereas increase in size accounted for the change observed in demyelinated axons. The increase in mitochondrial content in remyelinated axons was associated with an increase in mitochondrial respiratory chain complex IV activity. In vitro studies showed a significant increase in the number of stationary mitochondria in remyelinated compared with myelinated and demyelinated axons. The number of mobile mitochondria in remyelinated axons did not significantly differ from myelinated axons, although significantly greater than in demyelinated axons. Our neuropathological data and findings in

  20. Induced voltage due to time-dependent magnetisation textures

    International Nuclear Information System (INIS)

    Kudtarkar, Santosh Kumar; Dhadwal, Renu

    2010-01-01

    We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.

  1. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  2. Impaired mitochondrial respiration and protein nitration in the rat hippocampus after acute inhalation of combustion smoke

    International Nuclear Information System (INIS)

    Lee, Heung M.; Reed, Jason; Greeley, George H.; Englander, Ella W.

    2009-01-01

    Survivors of massive inhalation of combustion smoke endure critical injuries, including lasting neurological complications. We have previously reported that acute inhalation of combustion smoke disrupts the nitric oxide homeostasis in the rat brain. In this study, we extend our findings and report that a 30-minute exposure of awake rats to ambient wood combustion smoke induces protein nitration in the rat hippocampus and that mitochondrial proteins are a sensitive nitration target in this setting. Mitochondria are central to energy metabolism and cellular signaling and are critical to proper cell function. Here, analyses of the mitochondrial proteome showed elevated protein nitration in the course of a 24-hour recovery following exposure to smoke. Mass spectrometry identification of several significantly nitrated mitochondrial proteins revealed diverse functions and involvement in central aspects of mitochondrial physiology. The nitrated proteins include the ubiquitous mitochondrial creatine kinase, F1-ATP synthase α subunit, dihydrolipoamide dehydrogenase (E3), succinate dehydrogenase Fp subunit, and voltage-dependent anion channel (VDAC1) protein. Furthermore, acute exposure to combustion smoke significantly compromised the respiratory capacity of hippocampal mitochondria. Importantly, elevated protein nitration and reduced mitochondrial respiration in the hippocampus persisted beyond the time required for restoration of normal oxygen and carboxyhemoglobin blood levels after the cessation of exposure to smoke. Thus, the time frame for intensification of the various smoke-induced effects differs between blood and brain tissues. Taken together, our findings suggest that nitration of essential mitochondrial proteins may contribute to the reduction in mitochondrial respiratory capacity and underlie, in part, the brain pathophysiology after acute inhalation of combustion smoke

  3. Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage

    International Nuclear Information System (INIS)

    Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji

    2016-01-01

    We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.

  4. Ontogeny and nutritional programming of mitochondrial proteins in the ovine kidney, liver and lung.

    Science.gov (United States)

    Yakubu, D P; Mostyn, A; Hyatt, M A; Kurlak, L O; Budge, H; Stephenson, T; Symonds, M E

    2007-12-01

    This study investigated the developmental and nutritional programming of two important mitochondrial proteins, namely voltage-dependent anion channel (VDAC) and cytochrome c, in the sheep kidney, liver and lung. The effect of maternal nutrient restriction between early and mid-gestation (i.e. 28- to 80-day gestation, the period of maximal placental growth) on the abundance of these proteins was also examined in fetal and juvenile offspring. Fetuses were sampled at 80 and 140 days of gestation (term approximately 147 days), and postnatal animals at 1 and 30 days and 6 months of age. The abundance of VDAC peaked at 140 days of gestation in the lung, compared with 1 day after birth in the kidney and liver, whereas cytochrome c abundance was greatest at 140 days of gestation in the liver, 1 day after birth in the kidney and 6 months of age in lungs. This differential ontogeny in mitochondrial protein abundance between tissues was accompanied with very different tissue-specific responses to changes in maternal food intake. In the liver, maternal nutrient restriction only increased mitochondrial protein abundance at 80 days of gestation, compared with no effect in the kidney. In contrast, in the lung mitochondrial protein, abundance was raised near to term, whereas VDAC abundance was decreased by 6 months of age. These findings demonstrate the tissue-specific nature of mitochondrial protein development that reflects differences in functional adaptation after birth. The divergence in mitochondrial response between tissues to maternal nutrient restriction early in pregnancy further reflects these differential ontogenies.

  5. The role of mitochondrial superoxide anion (O2-) on physiological aging in C57BL/6J mice

    International Nuclear Information System (INIS)

    Miyazawa, Masaki; Ishii, Takamasa; Yasuda, Kayo; Onouchi, Hiromi; Ishii, Naoaki; Noda, Setsuko; Hartman, Philip S.

    2009-01-01

    Much attention has been focused on the mitochondrial superoxide anion (O 2 - ), which is also a critical free radical produced by ionizing radiation. The specific role of the mitochondrial O 2 - on physiological aging in mammals is still nuclear despite wide-spread evidence that oxidative stress is involved in aging and age-related diseases. The major endogenous source of O 2 - is generated as a byproduct of energy metabolism from mitochondria. In order to better understand how O 2 - relates to metazoan aging, we have comprehensively examined age-related changes in the levels of oxidative damage, mitochondrial O 2 - production, mitochondrial antioxidant enzyme activity and apoptosis induction in key organs of an inbred mouse strain (C57BL/6J). Oxidative damage accumulated and excess apoptosis occurred in the brain, oculus and kidney with aging, but comparatively little occurred in the heart and muscle. These rates are correlated with O 2 - levels. Mitochondrial O 2 - production levels increased with aging in the brain, oculus and kidney, and did not significantly increased in the heart and muscle. In contrast to O 2 - production, mitochondrial SOD activities increased in heart and muscle, and remained unchanged in the brain, oculus and kidney with aging. These results suggest that O 2 - production has high organ specificity, and oxidative damage by O 2 - from mitochondria mediated apoptosis can lead to organ atrophy and physiological dysfunction. In addition, O 2 - from mitochondria plays a core role in physiological aging. (author)

  6. The role of mitochondrial superoxide anion (O2(-)) on physiological aging in C57BL/6J mice.

    Science.gov (United States)

    Miyazawa, Masaki; Ishii, Takamasa; Yasuda, Kayo; Noda, Setsuko; Onouchi, Hiromi; Hartman, Philip S; Ishii, Naoaki

    2009-01-01

    Much attention has been focused on the mitochondrial superoxide anion (O2(-)), which is also a critical free radial produced by ionizing radiation. The specific role of the mitochondrial O2(-) on physiological aging in mammals is still unclear despite wide-spread evidence that oxidative stress is involved in aging and age-related diseases. The major endogenous source of O2(-) is generated as a byproduct of energy metabolism from mitochondria. In order to better understand how O2(-)relates to metazoan aging, we have comprehensively examined age-related changes in the levels of oxidative damage, mitochondrial O2(-) production, mitochondrial antioxidant enzyme activity and apoptosis induction in key organs of an inbred mouse strain (C57BL/6J). Oxidative damage accumulated and excess apoptosis occurred in the brain, oculus and kidney with aging, but comparatively little occurred in the heart and muscle. These rates are correlated with O2(-) levels. Mitochondrial O2(-) production levels increased with aging in the brain, oculus and kidney, and did not significantly increased in the heart and muscle. In contrast to O2(-) production, mitochondrial SOD activities increased in heart and muscle, and remained unchanged in the brain, oculus and kidney with aging. These results suggest that O2(-) production has high organ specificity, and oxidative damage by O2(-) from mitochondria mediated apoptosis can lead to organ atrophy and physiological dysfunction. In addition, O2(-) from mitochondria plays a core role in physiological aging.

  7. TGF-β1-mediated differentiation of fibroblasts is associated with increased mitochondrial content and cellular respiration.

    Directory of Open Access Journals (Sweden)

    Ulugbek Negmadjanov

    Full Text Available Cytokine-dependent activation of fibroblasts to myofibroblasts, a key event in fibrosis, is accompanied by phenotypic changes with increased secretory and contractile properties dependent on increased energy utilization, yet changes in the energetic profile of these cells are not fully described. We hypothesize that the TGF-β1-mediated transformation of myofibroblasts is associated with an increase in mitochondrial content and function when compared to naive fibroblasts.Cultured NIH/3T3 mouse fibroblasts treated with TGF-β1, a profibrotic cytokine, or vehicle were assessed for transformation to myofibroblasts (appearance of α-smooth muscle actin [α-SMA] stress fibers and associated changes in mitochondrial content and functions using laser confocal microscopy, Seahorse respirometry, multi-well plate reader and biochemical protocols. Expression of mitochondrial-specific proteins was determined using western blotting, and the mitochondrial DNA quantified using Mitochondrial DNA isolation kit.Treatment with TGF-β1 (5 ng/mL induced transformation of naive fibroblasts into myofibroblasts with a threefold increase in the expression of α-SMA (6.85 ± 0.27 RU compared to cells not treated with TGF-β1 (2.52 ± 0.11 RU. TGF-β1 exposure increased the number of mitochondria in the cells, as monitored by membrane potential sensitive dye tetramethylrhodamine, and expression of mitochondria-specific proteins; voltage-dependent anion channels (0.54 ± 0.05 vs. 0.23 ± 0.05 RU and adenine nucleotide transporter (0.61 ± 0.11 vs. 0.22 ± 0.05 RU, as well as mitochondrial DNA content (530 ± 12 μg DNA/106 cells vs. 307 ± 9 μg DNA/106 cells in control. TGF-β1 treatment was associated with an increase in mitochondrial function with a twofold increase in baseline oxygen consumption rate (2.25 ± 0.03 vs. 1.13 ± 0.1 nmol O2/min/106 cells and FCCP-induced mitochondrial respiration (2.87 ± 0.03 vs. 1.46 ± 0.15 nmol O2/min/106 cells.TGF-β1 induced

  8. Mitochondrial dysfunction accounts for the stochastic heterogeneity in telomere-dependent senescence.

    Directory of Open Access Journals (Sweden)

    João F Passos

    2007-05-01

    Full Text Available Aging is an inherently stochastic process, and its hallmark is heterogeneity between organisms, cell types, and clonal populations, even in identical environments. The replicative lifespan of primary human cells is telomere dependent; however, its heterogeneity is not understood. We show that mitochondrial superoxide production increases with replicative age in human fibroblasts despite an adaptive UCP-2-dependent mitochondrial uncoupling. This mitochondrial dysfunction is accompanied by compromised [Ca(2+]i homeostasis and other indicators of a retrograde response in senescent cells. Replicative senescence of human fibroblasts is delayed by mild mitochondrial uncoupling. Uncoupling reduces mitochondrial superoxide generation, slows down telomere shortening, and delays formation of telomeric gamma-H2A.X foci. This indicates mitochondrial production of reactive oxygen species (ROS as one of the causes of replicative senescence. By sorting early senescent (SES cells from young proliferating fibroblast cultures, we show that SES cells have higher ROS levels, dysfunctional mitochondria, shorter telomeres, and telomeric gamma-H2A.X foci. We propose that mitochondrial ROS is a major determinant of telomere-dependent senescence at the single-cell level that is responsible for cell-to-cell variation in replicative lifespan.

  9. Voltage-Dependent Gating of hERG Potassium Channels

    Science.gov (United States)

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  10. Metformin Antagonizes Cancer Cell Proliferation by Suppressing Mitochondrial-Dependent Biosynthesis.

    Directory of Open Access Journals (Sweden)

    Takla Griss

    2015-12-01

    Full Text Available Metformin is a biguanide widely prescribed to treat Type II diabetes that has gained interest as an antineoplastic agent. Recent work suggests that metformin directly antagonizes cancer cell growth through its actions on complex I of the mitochondrial electron transport chain (ETC. However, the mechanisms by which metformin arrests cancer cell proliferation remain poorly defined. Here we demonstrate that the metabolic checkpoint kinases AMP-activated protein kinase (AMPK and LKB1 are not required for the antiproliferative effects of metformin. Rather, metformin inhibits cancer cell proliferation by suppressing mitochondrial-dependent biosynthetic activity. We show that in vitro metformin decreases the flow of glucose- and glutamine-derived metabolic intermediates into the Tricarboxylic Acid (TCA cycle, leading to reduced citrate production and de novo lipid biosynthesis. Tumor cells lacking functional mitochondria maintain lipid biosynthesis in the presence of metformin via glutamine-dependent reductive carboxylation, and display reduced sensitivity to metformin-induced proliferative arrest. Our data indicate that metformin inhibits cancer cell proliferation by suppressing the production of mitochondrial-dependent metabolic intermediates required for cell growth, and that metabolic adaptations that bypass mitochondrial-dependent biosynthesis may provide a mechanism of tumor cell resistance to biguanide activity.

  11. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  12. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  13. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  14. Role of phosphate and other proton-donating anions in respiration-coupled transport of Ca2+ by mitochondria.

    Science.gov (United States)

    Lehninger, A L

    1974-04-01

    Measurements of extra oxygen consumption, (45)Ca(2+) uptake, and the osmotic expansion of the matrix compartment show that not all permeant anions are capable of supporting and accompanying the energy-dependent transport of Ca(2+) from the medium into the matrix in respiring rat-liver mitochondria. Phosphate, arsenate, acetate, butyrate, beta-hydroxybutyrate, lactate, and bicarbonate + CO(2) supported Ca(2+) uptake, whereas the permeant anions, nitrate, thiocyanate, chlorate, and perchlorate, did not. The active anions share a common denominator, the potential ability to donate a proton to the mitochondrial matrix; the inactive anions lack this capacity. Phosphate and the other active permeant anions move into the matrix in response to the alkaline-inside electrochemical gradient of protons generated across the mitochondrial membrane by electron transport, thus forming a negative-inside anion gradient. It is postulated that the latter gradient is the immediate "pulling" force for the influx of Ca(2+) on the electrogenic Ca(2+) carrier in respiring mitochondria under intracellular conditions. Since mitochondria in the cell are normally exposed to an excess of phosphate (and the bicarbonate-CO(2) system), particularly in state 4, inward transport of these proton-yielding anions probably precedes and is necessary for inward transport of Ca(2+) and other cations under biological conditions. These observations indicate that a negative-inside gradient of phosphate generated by electron transport is a common step and provides the immediate motive power not only for (a) the inward transport of dicarboxylates and tricarboxylates and (b) the energy-dependent exchange of external ADP(3-) for internal ATP(4-) during oxidative phosphorylation, as has already been established, but also for (c) the inward transport of Ca(2+), K(+), and other cations.

  15. Cr(VI) induces mitochondrial-mediated and caspase-dependent apoptosis through reactive oxygen species-mediated p53 activation in JB6 Cl41 cells

    International Nuclear Information System (INIS)

    Son, Young-Ok; Hitron, J. Andrew; Wang Xin; Chang Qingshan; Pan Jingju; Zhang Zhuo; Liu Jiankang; Wang Shuxia; Lee, Jeong-Chae; Shi Xianglin

    2010-01-01

    Cr(VI) compounds are known to cause serious toxic and carcinogenic effects. Cr(VI) exposure can lead to a severe damage to the skin, but the mechanisms involved in the Cr(VI)-mediated toxicity in the skin are unclear. The present study examined whether Cr(VI) induces cell death by apoptosis or necrosis using mouse skin epidermal cell line, JB6 Cl41 cells. We also investigated the cellular mechanisms of Cr(VI)-induced cell death. This study showed that Cr(VI) induced apoptotic cell death in a dose-dependent manner, as demonstrated by the appearance of cell shrinkage, the migration of cells into the sub-G1 phase, the increase of Annexin V positively stained cells, and the formation of nuclear DNA ladders. Cr(VI) treatment resulted in the increases of mitochondrial membrane depolarization and caspases activation. Electron spin resonance (ESR) and fluorescence analysis revealed that Cr(VI) increased intracellular levels of reactive oxygen species (ROS) such as hydrogen peroxide and superoxide anion radical in dose-dependent manner. Blockage of p53 by si-RNA transfection suppressed mitochondrial changes of Bcl-2 family composition, mitochondrial membrane depolarization, caspase activation and PARP cleavage, leading to the inhibition of Cr(VI)-induced apoptosis. Further, catalase treatment prevented p53 phosphorylation stimulated by Cr(VI) with the concomitant inhibition of caspase activation. These results suggest that Cr(VI) induced a mitochondrial-mediated and caspase-dependent apoptosis in skin epidermal cells through activation of p53, which are mainly mediated by reactive oxidants generated by the chemical.

  16. Melatonin protects cardiac microvasculature against ischemia/reperfusion injury via suppression of mitochondrial fission-VDAC1-HK2-mPTP-mitophagy axis.

    Science.gov (United States)

    Zhou, Hao; Zhang, Ying; Hu, Shunying; Shi, Chen; Zhu, Pingjun; Ma, Qiang; Jin, Qinhua; Cao, Feng; Tian, Feng; Chen, Yundai

    2017-08-01

    The cardiac microvascular system, which is primarily composed of monolayer endothelial cells, is the site of blood supply and nutrient exchange to cardiomyocytes. However, microvascular ischemia/reperfusion injury (IRI) following percutaneous coronary intervention is a woefully neglected topic, and few strategies are available to reverse such pathologies. Here, we studied the effects of melatonin on microcirculation IRI and elucidated the underlying mechanism. Melatonin markedly reduced infarcted area, improved cardiac function, restored blood flow, and lower microcirculation perfusion defects. Histological analysis showed that cardiac microcirculation endothelial cells (CMEC) in melatonin-treated mice had an unbroken endothelial barrier, increased endothelial nitric oxide synthase expression, unobstructed lumen, reduced inflammatory cell infiltration, and less endothelial damage. In contrast, AMP-activated protein kinase α (AMPKα) deficiency abolished the beneficial effects of melatonin on microvasculature. In vitro, IRI activated dynamin-related protein 1 (Drp1)-dependent mitochondrial fission, which subsequently induced voltage-dependent anion channel 1 (VDAC1) oligomerization, hexokinase 2 (HK2) liberation, mitochondrial permeability transition pore (mPTP) opening, PINK1/Parkin upregulation, and ultimately mitophagy-mediated CMEC death. However, melatonin strengthened CMEC survival via activation of AMPKα, followed by p-Drp1 S616 downregulation and p-Drp1 S37 upregulation, which blunted Drp1-dependent mitochondrial fission. Suppression of mitochondrial fission by melatonin recovered VDAC1-HK2 interaction that prevented mPTP opening and PINK1/Parkin activation, eventually blocking mitophagy-mediated cellular death. In summary, this study confirmed that melatonin protects cardiac microvasculature against IRI. The underlying mechanism may be attributed to the inhibitory effects of melatonin on mitochondrial fission-VDAC1-HK2-mPTP-mitophagy axis via activation

  17. Origin of negative resistance in anion migration controlled resistive memory

    Science.gov (United States)

    Banerjee, Writam; Wu, Facai; Hu, Yuan; Wu, Quantan; Wu, Zuheng; Liu, Qi; Liu, Ming

    2018-03-01

    Resistive random access memory (RRAM) is one of the most promising emerging nonvolatile technologies for the futuristic memory devices. Resistive switching behavior often shows negative resistance (NR), either voltage controlled or current controlled. In this work, the origin of a current compliance dependent voltage controlled NR effect during the resetting of anion migration based RRAM devices is discussed. The N-type voltage controlled NR is a high field driven phenomena. The current conduction within the range of a certain negative voltage is mostly dominated by space charge limited current. But with the higher negative voltage, a field induced tunneling effect is generated in the NR region. The voltage controlled NR is strongly dependent on the compliance current. The area independent behavior indicates the filamentary switching. The peak to valley ratio (PVR) is > 5. The variation of PVR as a function of the conduction band offset is achieved. Compared to other reported works, based on the PVR, it is possible to distinguish the RRAM types. Generally, due to the higher electric field effect on the metallic bridge during RESET, the electrochemical metallization type RRAM shows much higher PVR than the valance change type RRAM.

  18. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    Science.gov (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  19. Mitochondrial modulation of oxygen-dependent radiosensitivity in some human tumour cell lines.

    LENUS (Irish Health Repository)

    Anoopkumar-Dukie, S

    2009-10-01

    Oxygen-dependent radiosensitivity of tumour cells reflects direct oxidative damage to DNA, but non-nuclear mechanisms including signalling pathways may also contribute. Mitochondria are likely candidates because not only do they integrate signals from each of the main kinase pathways but mitochondrial kinases responsive to oxidative stress communicate to the rest of the cell. Using pharmacological and immunochemical methods, we tested the role of mitochondrial permeability transition (MPT) and the Bcl-2 proteins in oxygen-dependent radiosensitivity. Drug-treated or untreated cervical cancer HeLa, breast cancer MCF-7 and melanoma MeWo cell lines were irradiated at 6.2 Gy under normoxic and hypoxic conditions then allowed to proliferate for 7 days. The MPT blocker cyclosporin A (2 microM) strongly protected HeLa but not the other two lines against oxygen-dependent radiosensitivity. By contrast, bongkrekic acid (50 microM), which blocks MPT by targeting the adenine nucleotide transporter, had only marginal effect and calcineurin inhibitor FK-506 (0.1 microM) had none. Nor was evidence found for the modulation of oxygen-dependent radiosensitivity by Bax\\/Bcl-2 signalling, mitochondrial ATP-dependent potassium (mitoK(ATP)) channels or mitochondrial Ca(2+) uptake. In conclusion, calcineurin-independent protection by cyclosporin A suggests that MPT but not mitoK(ATP) or the mitochondrial apoptosis pathway plays a causal role in oxygen-dependent radiosensitivity of HeLa cells. Targeting MPT may therefore improve the effectiveness of radiotherapy in some solid tumours.

  20. Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-09-12

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-01-01

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

  2. Time scales of bias voltage effects in FE/MgO-based magnetic tunnel junctions with voltage-dependent perpendicular anisotropy

    International Nuclear Information System (INIS)

    Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.

    2015-01-01

    Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height

  3. Arabidopsis thaliana VDAC2 involvement in salt stress response ...

    African Journals Online (AJOL)

    Soil salinity seriously affects plants distribution and yield, while salt stress induces SOS genes, and voltage-dependent anion channels (VDAC) and a mitochondrial porin, are induced too. In this paper, phenotypes of AtVDAC2 transgenic lines and wild type (RLD) were analyzed. It was found that AtVDAC2 over-expressing ...

  4. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H+-dependent mitochondrial pathway

    International Nuclear Information System (INIS)

    Pelin, Marco; Ponti, Cristina; Sosa, Silvio; Gibellini, Davide; Florio, Chiara; Tubaro, Aurelia

    2013-01-01

    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na + influx due to the transformation of Na + /K + ATPase in a cationic channel. Recently, we have demonstrated that Na + overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na + intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O 2 − production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na + -mediated H + -imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O 2 − production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O 2 − production induced by PLTX-mediated ionic imbalance. Indeed, the H + intracellular overload that follows PLTX-induced intracellular Na + accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O 2 − production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O 2 − ) production by reversing mitochondrial transport chain. ► The mechanism of O 2 − production is dependent on PLTX-induced ionic imbalance. ► The results led to the

  5. A crosstalk between Na⁺ channels, Na⁺/K⁺ pump and mitochondrial Na⁺ transporters controls glucose-dependent cytosolic and mitochondrial Na⁺ signals.

    Science.gov (United States)

    Nita, Iulia I; Hershfinkel, Michal; Lewis, Eli C; Sekler, Israel

    2015-02-01

    Glucose-dependent cytosolic Na(+) influx in pancreatic islet β cells is mediated by TTX-sensitive Na(+) channels and is propagated into the mitochondria through the mitochondrial Na(+)/Ca(2+) exchanger, NCLX. Mitochondrial Na(+) transients are also controlled by the mitochondrial Na(+)/H(+) exchanger, NHE, while cytosolic Na(+) changes are governed by Na(+)/K(+) ATPase pump. The functional interaction between the Na(+) channels, Na(+)/K(+) ATPase pump and mitochondrial Na(+) transporters, NCLX and NHE, in mediating Na(+) signaling is poorly understood. Here, we combine fluorescent Na(+) imaging, pharmacological inhibition by TTX, ouabain and EIPA, with molecular control of NCLX expression, so as to investigate the crosstalk between Na(+) transporters on both the plasma membrane and the mitochondria. According to our results, glucose-dependent cytosolic Na(+) response was enhanced by ouabain and was followed by a rise in mitochondrial Na(+) signal. Silencing of NCLX expression using siNCLX, did not affect the glucose- or ouabain-dependent cytosolic rise in Na(+). In contrast, the ouabain-dependent rise in mitochondrial Na(+) was strongly suppressed by siNCLX. Furthermore, mitochondrial Na(+) influx rates were accelerated in cells treated with the Na(+)/H(+) exchanger inhibitor, EIPA or by combination of EIPA and ouabain. Similarly, TTX blocked the cytosolic and mitochondrial Na(+) responses, which were enhanced by ouabain or EIPA, respectively. Our results suggest that Na(+)/K(+) ATPase pump controls cytosolic glucose-dependent Na(+) rise, in a manner that is mediated by TTX-sensitive Na(+) channels and subsequent mitochondrial Na(+) uptake via NCLX. Furthermore, these results indicate that mitochondrial Na(+) influx via NCLX is antagonized by Na(+) efflux, which is mediated by the mitochondrial NHE; thus, the duration of mitochondrial Na(+) transients is set by the interplay between these pivotal transporters. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2014-01-01

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  7. Ethanol Influences on Bax Associations with Mitochondrial Membrane Proteins in Neonatal Rat Cerebellum

    Science.gov (United States)

    Heaton, Marieta Barrow; Siler-Marsiglio, Kendra; Paiva, Michael; Kotler, Alexandra; Rogozinski, Jonathan; Kubovec, Stacey; Coursen, Mary; Madorsky, Vladimir

    2012-01-01

    These studies investigated interactions taking place at the mitochondrial membrane in neonatal rat cerebellum following ethanol exposure, and focused on interactions between pro-apoptotic Bax and proteins of the permeability transition pore (PTP), voltage-dependent anion channel (VDAC), and adenine nucleotide translocator (ANT), of the outer and inner mitochondrial membranes, respectively. Cultured cerebellar granule cells were used to assess the role of these interactions in ethanol neurotoxicity. Analyses were made at the age of maximal cerebellar ethanol vulnerability (P4), compared to the later age of relative resistance (P7), to determine whether differential ethanol sensitivity was mirrored by differences in these molecular interactions. We found that following ethanol exposure, Bax pro-apoptotic associations with both VDAC and ANT were increased, particularly at the age of greater ethanol sensitivity, and these interactions were sustained at this age for at least two hours post-exposure. Since Bax:VDAC interactions disrupt protective VDAC interactions with mitochondrial hexokinase (HXK), we also assessed VDAC:HXK associations following ethanol treatment, and found such interactions were altered by ethanol treatment, but only at two-hours post-exposure, and only in the P4, ethanol-sensitive cerebellum. Ethanol neurotoxicity in cultured neuronal preparations was abolished by pharmacological inhibition of both VDAC and ANT interactions with Bax, but not by a Bax channel blocker. Therefore, we conclude that at this age, within the constraints of our experimental model, a primary mode of Bax-induced initiation of the apoptosis cascade following ethanol insult involves interactions with proteins of the PTP complex, and not channel formation independent of PTP constituents. PMID:22767450

  8. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

    Science.gov (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-11-17

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  9. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  10. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    Science.gov (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  11. Stimulation of Na+-alanine cotransport activates a voltage-dependent conductance in single proximal tubule cells isolated from frog kidney

    Science.gov (United States)

    Robson, L; Hunter, M

    1999-01-01

    The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159

  12. Double-stranded DNA-dependent ATPase Irc3p is directly involved in mitochondrial genome maintenance.

    Science.gov (United States)

    Sedman, Tiina; Gaidutšik, Ilja; Villemson, Karin; Hou, YingJian; Sedman, Juhan

    2014-12-01

    Nucleic acid-dependent ATPases are involved in nearly all aspects of DNA and RNA metabolism. Previous studies have described a number of mitochondrial helicases. However, double-stranded DNA-dependent ATPases, including translocases or enzymes remodeling DNA-protein complexes, have not been identified in mitochondria of the yeast Saccharomyces cerevisae. Here, we demonstrate that Irc3p is a mitochondrial double-stranded DNA-dependent ATPase of the Superfamily II. In contrast to the other mitochondrial Superfamily II enzymes Mss116p, Suv3p and Mrh4p, which are RNA helicases, Irc3p has a direct role in mitochondrial DNA (mtDNA) maintenance. Specific Irc3p-dependent mtDNA metabolic intermediates can be detected, including high levels of double-stranded DNA breaks that accumulate in irc3Δ mutants. irc3Δ-related topology changes in rho- mtDNA can be reversed by the deletion of mitochondrial RNA polymerase RPO41, suggesting that Irc3p counterbalances adverse effects of transcription on mitochondrial genome stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Anion-Dependent Exocyclic Mercury(II) Coordination Polymers of Bis-dithiamacrocycle

    Energy Technology Data Exchange (ETDEWEB)

    Siewe, Arlette Deukam; Kim, Seul Gi; Choi, Kyu Seong [Kyungnam University, Changwon (Korea, Republic of); Lee, Shim Sung [Gyeongsang National University, Jinju (Korea, Republic of)

    2014-09-15

    Synthesis and structural characterization of mercury(II) halides and perchlorate complexes of bis-OS{sub 2}-Synthesis and structural characterization of mercury(II) halides and perchlorate complexes of bis-OS{sub 2}- macrocycle (L) are reported. L reacts with mercury(II) chloride and bromide to yield an isostructural 2D coordination polymers with type [Hg(L)X{sub 2}]n (1: X = Cl and 2: X = Br). In 1, each Hg atom which lies outside the cavity is six-coordinate with a distorted octahedral geometry, being bound to four adjacent ligands via monodentate Hg-S bonds and two remaining sites are occupied by two terminal chlorido ligands to form a fishnet-like 2D structure. When reacting with mercury(II) iodide, L afforded a 1D coordination polymer [Hg{sub 2}(L)I{sub 4}]·CHCl{sub 3}n in which each exocyclic Hg atom is four-coordinate, being bound to two sulfur donors from different ligands doubly bridging the ligand molecules in a head-to-tail mode. The coordination sphere in 3 is completed by two iodo terminal ligands, adopting a distorted tetrahedral geometry. On reacting with mercury(II) perchlorate, L forms solvent-coordinated 1D coordination polymer ([Hg{sub 2}(L)(DMF){sub 6}](ClO{sub 4}){sub 4}·2DMF)n instead of the anion-coordination. In 4, the Hg atom is five-coordinate, being bound to two sulfur donors from two different ligands doubly bridging the ligand molecules in a side-by-side mode to form a ribbon-like 1D structure.. The three remaining coordination sites in 4 are completed by three DMF molecules in a monodentate manner. Consequently, the different structures and connectivity patterns for the observed exocyclic coordination polymers depending on the anions used are influenced not only by the coordination ability of the anions but also by anion sizes macrocycle (L) are reported. L reacts with mercury(II) chloride and bromide to yield an isostructural 2D coordination polymers with type [Hg(L)X{sub 2}]n (1: X = Cl and 2: X = Br). In 1, each Hg atom which lies

  14. Vitamin E protects against the mitochondrial damage caused by cyclosporin A in LLC-PK1 cells

    International Nuclear Information System (INIS)

    Arriba, G. de; Perez de Hornedo, J.; Ramirez Rubio, S.; Calvino Fernandez, M.; Benito Martinez, S.; Maiques Camarero, M.; Parra Cid, T.

    2009-01-01

    Cyclosporin A (CsA) has nephrotoxic effects known to involve reactive oxygen species (ROS), since antioxidants prevent the kidney damage induced by this drug. Given that mitochondria are among the main sources of intracellular ROS, the aims of our study were to examine the mitochondrial effects of CsA in the porcine renal endothelial cell line LLC-PK1 and the influence of the antioxidant Vitamin E (Vit E). Following the treatment of LLC-PK1 cells with CsA, we assessed the mitochondrial synthesis of superoxide anion, permeability transition pore opening, mitochondrial membrane potential, cardiolipin peroxidation, cytochrome c release and cellular apoptosis, using flow cytometry and confocal microscopy procedures. Similar experiments were done after Vit E preincubation of cells. CsA treatment increased superoxide anion in a dose-dependent way. CsA opened the permeability transition pores, caused Bax migration to mitochondria, and decreased mitochondrial membrane potential and cardiolipin content. Also CsA released cytochrome c into cytosol and provoked cellular apoptosis. Vit E pretreatment inhibited the effects that CsA induced on mitochondrial structure and function in LLC-PK1 cells and avoided apoptosis. CsA modifies mitochondrial LLC-PK1 cell physiology with loss of negative electrochemical gradient across the inner mitochondrial membrane and increased lipid peroxidation. These features are related to apoptosis and can explain the cellular damage that CsA induces. As Vit E inhibited these effects, our results suggest that they were mediated by an increase in ROS production by mitochondria.

  15. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

    Science.gov (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

    2014-03-01

    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  16. Is cell aging caused by respiration-dependent injury to the mitochondrial genome

    Science.gov (United States)

    Fleming, J. E.; Yengoyan, L. S.; Miquel, J.; Cottrell, S. F.; Economos, A. C.

    1982-01-01

    Though intrinsic mitochondrial aging has been considered before as a possible cause of cellular senescence, the mechanisms of such mitochondrial aging have remained obscure. In this article, the hypothesis of free-radical-induced inhibition of mitochondrial replenishment in fixed postmitotic cells is expanded. It is maintained that the respiration-dependent production of superoxide and hydroxyl radicals may not be fully counteracted, leading to a continuous production of lipoperoxides and malonaldehyde in actively respiring mitochondria. These compounds, in turn, can easily react with the mitochondrial DNA which is in close spatial relationship with the inner mitochondrial membrane, producing an injury that the mitochondria may be unable to counteract because of their apparent lack of adequate repair mechanisms. Mitochondrial division may thus be inhibited leading to age-related reduction of mitochondrial numbers, a deficit in energy production with a concomitant decrease in protein synthesis, deterioration of physiological performance, and, therefore, of organismic performance.

  17. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  18. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  19. PINK1/Parkin-Dependent Mitochondrial Surveillance: From Pleiotropy to Parkinson's Disease

    Directory of Open Access Journals (Sweden)

    Olga Corti

    2017-05-01

    Full Text Available Parkinson's disease (PD is one of the most frequent neurodegenerative disease caused by the preferential, progressive degeneration of the dopaminergic (DA neurons of the substantia nigra (SN pars compacta. PD is characterized by a multifaceted pathological process involving protein misfolding, mitochondrial dysfunction, neuroinflammation and metabolism deregulation. The molecular mechanisms governing the complex interplay between the different facets of this process are still unknown. PARK2/Parkin and PARK6/PINK1, two genes responsible for familial forms of PD, act as a ubiquitous core signaling pathway, coupling mitochondrial stress to mitochondrial surveillance, by regulating mitochondrial dynamics, the removal of damaged mitochondrial components by mitochondria-derived vesicles, mitophagy, and mitochondrial biogenesis. Over the last decade, PINK1/Parkin-dependent mitochondrial quality control emerged as a pleiotropic regulatory pathway. Loss of its function impinges on a number of physiological processes suspected to contribute to PD pathogenesis. Its role in the regulation of innate immunity and inflammatory processes stands out, providing compelling support to the contribution of non-cell-autonomous immune mechanisms in PD. In this review, we illustrate the central role of this multifunctional pathway at the crossroads between mitochondrial stress, neuroinflammation and metabolism. We discuss how its dysfunction may contribute to PD pathogenesis and pinpoint major unresolved questions in the field.

  20. Effect of superoxide anion scavenger on rat hearts with chronic intermittent hypoxia.

    Science.gov (United States)

    Pai, Peiying; Lai, Ching Jung; Lin, Ching-Yuang; Liou, Yi-Fan; Huang, Chih-Yang; Lee, Shin-Da

    2016-04-15

    Only very limited information regarding the protective effects of the superoxide anion scavenger on chronic intermittent hypoxia-induced cardiac apoptosis is available. The purpose of this study is to evaluate the effects of the superoxide anion scavenger on cardiac apoptotic and prosurvival pathways in rats with sleep apnea. Forty-two Sprague-Dawley rats were divided into three groups, rats with normoxic exposure (Control, 21% O2, 1 mo), rats with chronic intermittent hypoxia exposure (Hypoxia, 3-7% O2vs. 21% O2per 40 s cycle, 8 h per day, 1 mo), and rats with pretreatment of the superoxide anion scavenger and chronic intermittent hypoxia exposure (Hypoxia-O2 (-)-Scavenger, MnTMPyP pentachloride, 1 mg/kg ip per day; 3-7% O2vs. 21% O2per 40 s cycle, 8 h per day, 1 mo) at 5-6 mo of age. After 1 mo, the protein levels and apoptotic cells of excised hearts from three groups were measured by Western blotting and terminal deoxynucleotide transferase-mediated dUTP nick end labeling (TUNEL) assay. The superoxide anion scavenger decreased hypoxia-induced myocardial architecture abnormalities, left ventricular hypertrophy, and TUNEL-positive apoptosis. The superoxide anion scavenger decreased hypoxia-induced Fas ligand, Fas death receptors, Fas-associated death domain (FADD), activated caspase-8, and activated caspase-3 (Fas-dependent apoptotic pathway) as well as Bad, activated caspase-9 and activated caspase-3 (mitochondria-dependent apoptotic pathway), endonuclease G (EndoG), apoptosis-inducing factor (AIF), and TUNEL-positive apoptosis. The superoxide anion scavenger increased IGF-1, IGF-1R, p-PI3k, p-Akt, p-Bad, Bcl-2, and Bcl-xL (survival pathway). Our findings imply that the superoxide anion scavenger might prevent cardiac Fas-mediated and mitochondrial-mediated apoptosis and enhance the IGF-1-related survival pathway in chronic intermittent hypoxia. The superoxide anion scavenger may prevent chronic sleep apnea-enhanced cardiac apoptotic pathways and enhances

  1. Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.

    Science.gov (United States)

    Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu

    2016-11-14

    Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

  2. Pinocembrin Suppresses H2O2-Induced Mitochondrial Dysfunction by a Mechanism Dependent on the Nrf2/HO-1 Axis in SH-SY5Y Cells.

    Science.gov (United States)

    de Oliveira, Marcos Roberto; da Costa Ferreira, Gustavo; Brasil, Flávia Bittencourt; Peres, Alessandra

    2018-02-01

    Mitochondria are susceptible to redox impairment, which has been associated with neurodegeneration. These organelles are both a source and target of reactive species. In that context, there is increasing interest in finding natural compounds that modulate mitochondrial function and mitochondria-related signaling in order to prevent or to treat diseases involving mitochondrial impairment. Herein, we investigated whether and how pinocembrin (PB) would prevent mitochondrial dysfunction elicited by the exposure of human neuroblastoma SH-SY5Y cells to hydrogen peroxide (H 2 O 2 ). PB (25 μM) was administrated for 4 h before H 2 O 2 treatment (300 μM for 24 h). PB prevented H 2 O 2 -induced loss of cell viability mitochondrial depolarization in SH-SY5Y cells. PB also attenuated redox impairment in mitochondrial membranes. The production of superoxide anion radical (O 2 -• ) and nitric oxide (NO • ) was alleviated by PB in cells exposed to H 2 O 2 . PB suppressed the H 2 O 2 -induced inhibition of the tricarboxylic acid (TCA) cycle enzymes aconitase, α-ketoglutarate dehydrogenase, and succinate dehydrogenase. Furthermore, PB induced anti-inflammatory effects by abolishing the H 2 O 2 -dependent activation of the nuclear factor-κB (NF-κB) and upregulation of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α). The PB-induced antioxidant and anti-inflammatory effects are dependent on the heme oxygenate-1 (HO-1) enzyme and on the activation of the transcription factor nuclear factor erythroid 2-related factor 2 (Nrf2), since HO-1 inhibition (with 0.5 μM ZnPP IX) or Nrf2 silencing (with small interfering RNA (siRNA)) abolished the effects of PB. Overall, PB afforded cytoprotection by the Nrf2/HO-1 axis in H 2 O 2 -treated SH-SY5Y cells.

  3. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H{sup +}-dependent mitochondrial pathway

    Energy Technology Data Exchange (ETDEWEB)

    Pelin, Marco, E-mail: marco.pelin@phd.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Ponti, Cristina, E-mail: cponti@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Sosa, Silvio, E-mail: silvio.sosa@econ.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Gibellini, Davide, E-mail: davide.gibellini@unibo.it [Department of Haematology and Oncological Sciences, University of Bologna, Via Massarenti 9, 40138 Bologna (Italy); Florio, Chiara, E-mail: florioc@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Tubaro, Aurelia, E-mail: tubaro@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy)

    2013-01-01

    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na{sup +} influx due to the transformation of Na{sup +}/K{sup +} ATPase in a cationic channel. Recently, we have demonstrated that Na{sup +} overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na{sup +} intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O{sub 2}{sup −} production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na{sup +}-mediated H{sup +}-imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O{sub 2}{sup −} production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O{sub 2}{sup −} production induced by PLTX-mediated ionic imbalance. Indeed, the H{sup +} intracellular overload that follows PLTX-induced intracellular Na{sup +} accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O{sub 2}{sup −} production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O{sub 2}{sup −}) production by reversing mitochondrial transport chain. ► The mechanism of

  4. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    Science.gov (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  5. Mitochondrial Sirt3 supports cell proliferation by regulating glutamine-dependent oxidation in renal cell carcinoma

    International Nuclear Information System (INIS)

    Choi, Jieun; Koh, Eunjin; Lee, Yu Shin; Lee, Hyun-Woo; Kang, Hyeok Gu; Yoon, Young Eun; Han, Woong Kyu; Choi, Kyung Hwa; Kim, Kyung-Sup

    2016-01-01

    Clear cell renal carcinoma (RCC), the most common malignancy arising in the adult kidney, exhibits increased aerobic glycolysis and low mitochondrial respiration due to von Hippel-Lindau gene defects and constitutive hypoxia-inducible factor-α expression. Sirt3 is a major mitochondrial deacetylase that mediates various types of energy metabolism. However, the role of Sirt3 as a tumor suppressor or oncogene in cancer depends on cell types. We show increased Sirt3 expression in the mitochondrial fraction of human RCC tissues. Sirt3 depletion by lentiviral short-hairpin RNA, as well as the stable expression of the inactive mutant of Sirt3, inhibited cell proliferation and tumor growth in xenograft nude mice, respectively. Furthermore, mitochondrial pyruvate, which was used for oxidation in RCC, might be derived from glutamine, but not from glucose and cytosolic pyruvate, due to depletion of mitochondrial pyruvate carrier and the relatively high expression of malic enzyme 2. Depletion of Sirt3 suppressed glutamate dehydrogenase activity, leading to impaired mitochondrial oxygen consumption. Our findings suggest that Sirt3 plays a tumor-progressive role in human RCC by regulating glutamine-derived mitochondrial respiration, particularly in cells where mitochondrial usage of cytosolic pyruvate is severely compromised. -- Highlights: •Sirt3 is required for the maintenance of RCC cell proliferation. •Mitochondrial usage of cytosolic pyruvate is severely compromised in RCC. •Sirt3 supports glutamine-dependent oxidation in RCC.

  6. Mitochondrial Sirt3 supports cell proliferation by regulating glutamine-dependent oxidation in renal cell carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Jieun; Koh, Eunjin; Lee, Yu Shin; Lee, Hyun-Woo; Kang, Hyeok Gu [Department of Biochemistry and Molecular Biology, Brain Korea 21 PLUS Project for Medical Sciences, Institute of Genetic Science, Integrated Genomic Research Center for Metabolic Regulation, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of); Yoon, Young Eun; Han, Woong Kyu [Department of Urology, Urological Science Institute, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of); Choi, Kyung Hwa [Department of Urology, CHA Bundang Medical Center, CHA University, Seongnam 463-712 (Korea, Republic of); Kim, Kyung-Sup, E-mail: KYUNGSUP59@yuhs.ac [Department of Biochemistry and Molecular Biology, Brain Korea 21 PLUS Project for Medical Sciences, Institute of Genetic Science, Integrated Genomic Research Center for Metabolic Regulation, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of)

    2016-06-03

    Clear cell renal carcinoma (RCC), the most common malignancy arising in the adult kidney, exhibits increased aerobic glycolysis and low mitochondrial respiration due to von Hippel-Lindau gene defects and constitutive hypoxia-inducible factor-α expression. Sirt3 is a major mitochondrial deacetylase that mediates various types of energy metabolism. However, the role of Sirt3 as a tumor suppressor or oncogene in cancer depends on cell types. We show increased Sirt3 expression in the mitochondrial fraction of human RCC tissues. Sirt3 depletion by lentiviral short-hairpin RNA, as well as the stable expression of the inactive mutant of Sirt3, inhibited cell proliferation and tumor growth in xenograft nude mice, respectively. Furthermore, mitochondrial pyruvate, which was used for oxidation in RCC, might be derived from glutamine, but not from glucose and cytosolic pyruvate, due to depletion of mitochondrial pyruvate carrier and the relatively high expression of malic enzyme 2. Depletion of Sirt3 suppressed glutamate dehydrogenase activity, leading to impaired mitochondrial oxygen consumption. Our findings suggest that Sirt3 plays a tumor-progressive role in human RCC by regulating glutamine-derived mitochondrial respiration, particularly in cells where mitochondrial usage of cytosolic pyruvate is severely compromised. -- Highlights: •Sirt3 is required for the maintenance of RCC cell proliferation. •Mitochondrial usage of cytosolic pyruvate is severely compromised in RCC. •Sirt3 supports glutamine-dependent oxidation in RCC.

  7. Nonlinear Impedance of Whole Cells Near an Electrode as a Probe of Mitochondrial Activity

    Directory of Open Access Journals (Sweden)

    John H. Miller Jr.

    2011-04-01

    Full Text Available By simultaneously measuring the bulk media and electrode interface voltages of a yeast (Saccharomyces cerevisiae suspension subjected to an AC voltage, a yeast-dependent nonlinear response was found only near the current injection electrodes. Computer simulation of yeast near a current injection electrode found an enhanced voltage drop across the yeast near the electrode due to slowed charging of the electrode interfacial capacitance. This voltage drop is sufficient to induce conformation change in membrane proteins. Disruption of the mitochondrial electron transport chain is found to significantly change the measured nonlinear current response, suggesting nonlinear impedance can be used as a non-invasive probe of cellular metabolic activity.

  8. Is There Still Any Role for Oxidative Stress in Mitochondrial DNA-Dependent Aging?

    Directory of Open Access Journals (Sweden)

    Gábor Zsurka

    2018-03-01

    Full Text Available Recent deep sequencing data has provided compelling evidence that the spectrum of somatic point mutations in mitochondrial DNA (mtDNA in aging tissues lacks G > T transversion mutations. This fact cannot, however, be used as an argument for the missing contribution of reactive oxygen species (ROS to mitochondria-related aging because it is probably caused by the nucleotide selectivity of mitochondrial DNA polymerase γ (POLG. In contrast to point mutations, the age-dependent accumulation of mitochondrial DNA deletions is, in light of recent experimental data, still explainable by the segregation of mutant molecules generated by the direct mutagenic effects of ROS (in particular, of HO· radicals formed from H2O2 by a Fenton reaction. The source of ROS remains controversial, because the mitochondrial contribution to tissue ROS production is probably lower than previously thought. Importantly, in the discussion about the potential role of oxidative stress in mitochondria-dependent aging, ROS generated by inflammation-linked processes and the distribution of free iron also require careful consideration.

  9. Monitoring operating temperature and supply voltage in achieving high system dependability

    NARCIS (Netherlands)

    Khan, M.A.; Kerkhoff, Hans G.

    2013-01-01

    System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability

  10. Molecular basis of interactions between mitochondrial proteins and hydroxyapatite in the presence of Triton X-100, as revealed by proteomic and recombinant techniques.

    Science.gov (United States)

    Yamamoto, Takenori; Tamaki, Haruna; Katsuda, Chie; Nakatani, Kiwami; Terauchi, Satsuki; Terada, Hiroshi; Shinohara, Yasuo

    2013-08-02

    Hydroxyapatite chromatography is a very important step in the purification of voltage-dependent anion channels (VDACs) and several members of solute carrier family 25 (Slc25) from isolated mitochondria. In the presence of Triton X-100, VDACs and Slc25 members present a peculiar property, i.e., a lack of interaction with hydroxyapatite, resulting in their presence in the flow-through fraction of hydroxyapatite chromatography. This property has allowed selective isolation of VDACs and Slc25 members from a mixture of total mitochondrial proteins. However, the reason why only these few proteins are selectively obtained in the presence of Triton X-100 from the flow-though fraction of hydroxyapatite chromatography has not yet been adequately understood. In this study, when we examined the protein species in the flow-through fractions by proteomic analysis, VDAC isoforms, Slc25 members, and some other membrane proteins were identified. All the mitochondrial proteins had in common high hydrophobicity over their entire protein sequences. When the proteins were fused to soluble proteins, the fused proteins showed affinity for hydroxyapatite even in the presence of Triton X-100. Based on these results, we discussed the molecular basis of the interactions between proteins and hydroxyapatite in the presence of Triton X-100. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  12. Fluorescence assay for mitochondrial permeability transition in cardiomyocytes cultured in a microtiter plate

    DEFF Research Database (Denmark)

    Christensen, Marie Louise Muff; Braunstein, Thomas Hartig; Treiman, Marek

    2008-01-01

    Mitochondrial permeability transition pore (MPTP) is a voltage-dependent, large-conductance channel of the inner mitochondrial membrane with an important role in a range of pathophysiological conditions. To facilitate studies of pharmacological pore modulation, we describe an assay in a model using......, dequenching occurred on the distribution of rhodamine-123 into the extracellular volume. The addition of a small buffer volume containing digitonin (final concentration 10 microg/ml) and Ca(2+) (final concentrations up to 100 microM free Ca(2+)) caused dequenching (Delta F) due to Delta Psi m dissipation...

  13. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

    Science.gov (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

    2018-04-01

    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  14. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  15. Cisplatin cytotoxicity is dependent on mitochondrial respiration in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Santhipriya Inapurapu

    2017-01-01

    Full Text Available Objective(s: To understand the role of mitochondrial respiration in cisplatin sensitivity, we have employed wild-type and mitochondrial DNA depleted Rho0 yeast cells. Materials and Methods: Wild type and Rho0 yeast cultured in fermentable and non-fermentable sugar containing media, were studied for their sensitivity against cisplatin by monitoring growth curves, oxygen consumption, pH changes in cytosol/mitochondrial compartments, reactive oxygen species production and respiratory control ratio. Results: Wild-type yeast grown on glycerol exhibited heightened sensitivity to cisplatin than yeast grown on glucose. Cisplatin (100 μM, although significantly reduced the growth of wild- type cells, only slightly altered the growth rate of Rho0 cells. Cisplatin treatment decreased both pHcyt and pHmit to a similar extent without affecting the pH difference. Cisplatin dose-dependently increased the oxidative stress in wild-type, but not in respiration-deficient Rho0 strain. Cisplatin decreased the respiratory control ratio. Conclusion: These results suggest that cisplatin toxicity is influenced by the respiratory capacity of the cells and the intracellular oxidative burden. Although cisplatin per se slightly decreased the respiration of yeast cells grown in glucose, it did not disturb the mitochondrial chemiosmotic gradient.

  16. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  17. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    Science.gov (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  18. Increased mitochondrial DNA deletions and copy number in transfusion-dependent thalassemia

    Science.gov (United States)

    Calloway, Cassandra

    2016-01-01

    BACKGROUND. Iron overload is the primary cause of morbidity in transfusion-dependent thalassemia. Increase in iron causes mitochondrial dysfunction under experimental conditions, but the occurrence and significance of mitochondrial damage is not understood in patients with thalassemia. METHODS. Mitochondrial DNA (mtDNA) to nuclear DNA copy number (Mt/N) and frequency of the common 4977-bp mitochondrial deletion (ΔmtDNA4977) were quantified using a quantitative PCR assay on whole blood samples from 38 subjects with thalassemia who were receiving regular transfusions. RESULTS. Compared with healthy controls, Mt/N and ΔmtDNA4977 frequency were elevated in thalassemia (P = 0.038 and P 15 mg/g dry-weight or splenectomy, with the highest levels observed in subjects who had both risk factors (P = 0.003). Myocardial iron (MRI T2* 40/1 × 107 mtDNA, respectively (P = 0.025). Subjects with Mt/N values below the group median had significantly lower Matsuda insulin sensitivity index (5.76 ± 0.53) compared with the high Mt/N group (9.11 ± 0.95, P = 0.008). CONCLUSION. Individuals with transfusion-dependent thalassemia demonstrate age-related increase in mtDNA damage in leukocytes. These changes are markedly amplified by splenectomy and are associated with extrahepatic iron deposition. Elevated mtDNA damage in blood cells may predict the risk of iron-associated organ damage in thalassemia. FUNDING. This project was supported by Children’s Hospital & Research Center Oakland Institutional Research Award and by the National Center for Advancing Translational Sciences, NIH, through UCSF-CTSI grant UL1 TR000004. PMID:27583305

  19. Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites

    OpenAIRE

    Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.

    2000-01-01

    We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...

  20. Study on temperature dependence of output voltage of electrochemical detector for environmental neutrinos

    International Nuclear Information System (INIS)

    Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika

    2006-01-01

    An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)

  1. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

    Science.gov (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

    2003-03-01

    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  2. Cisplatin Induces a Mitochondrial-ROS Response That Contributes to Cytotoxicity Depending on Mitochondrial Redox Status and Bioenergetic Functions

    Science.gov (United States)

    Marullo, Rossella; Werner, Erica; Degtyareva, Natalya; Moore, Bryn; Altavilla, Giuseppe; Ramalingam, Suresh S.; Doetsch, Paul W.

    2013-01-01

    Cisplatin is one of the most effective and widely used anticancer agents for the treatment of several types of tumors. The cytotoxic effect of cisplatin is thought to be mediated primarily by the generation of nuclear DNA adducts, which, if not repaired, cause cell death as a consequence of DNA replication and transcription blockage. However, the ability of cisplatin to induce nuclear DNA (nDNA) damage per se is not sufficient to explain its high degree of effectiveness nor the toxic effects exerted on normal, post-mitotic tissues. Oxidative damage has been observed in vivo following exposure to cisplatin in several tissues, suggesting a role for oxidative stress in the pathogenesis of cisplatin-induced dose-limiting toxicities. However, the mechanism of cisplatin-induced generation of ROS and their contribution to cisplatin cytotoxicity in normal and cancer cells is still poorly understood. By employing a panel of normal and cancer cell lines and the budding yeast Saccharomyces cerevisiae as model system, we show that exposure to cisplatin induces a mitochondrial-dependent ROS response that significantly enhances the cytotoxic effect caused by nDNA damage. ROS generation is independent of the amount of cisplatin-induced nDNA damage and occurs in mitochondria as a consequence of protein synthesis impairment. The contribution of cisplatin-induced mitochondrial dysfunction in determining its cytotoxic effect varies among cells and depends on mitochondrial redox status, mitochondrial DNA integrity and bioenergetic function. Thus, by manipulating these cellular parameters, we were able to enhance cisplatin cytotoxicity in cancer cells. This study provides a new mechanistic insight into cisplatin-induced cell killing and may lead to the design of novel therapeutic strategies to improve anticancer drug efficacy. PMID:24260552

  3. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu

    2009-01-01

    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  4. Mitochondrial Disease

    OpenAIRE

    Bulent Kurt; Turgut Topal

    2013-01-01

    Mitochondria are the major energy source of cells. Mitochondrial disease occurs due to a defect in mitochondrial energy production. A valuable energy production in mitochondria depend a healthy interconnection between nuclear and mitochondrial DNA. A mutation in nuclear or mitochondrial DNA may cause abnormalities in ATP production and single or multiple organ dysfunctions, secondarily. In this review, we summarize mitochondrial physiology, mitochondrial genetics, and clinical expression and ...

  5. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  6. The purified ATPase from chromaffin granule membranes is an anion-dependent proton pump.

    Science.gov (United States)

    Moriyama, Y; Nelson, N

    1987-07-05

    The proton-ATPase of chromaffin granules was purified so as to maintain its proton-pumping activity when reconstituted into phospholipid vesicles. The purification procedure involved solubilization with polyoxyethylene 9 lauryl ether, hydroxylapatite column, precipitation by ammonium sulfate, and glycerol gradient centrifugation. The protease inhibitor mixture used in previous studies inhibited the proton-pumping activity of the enzyme; therefore, the protein was stabilized by pepstatin A and leupeptin. The enzyme was purified at least 50-fold with respect to both ATPase and proton-pumping activity. The ATP-dependent proton uptake activity of the reconstituted enzyme was absolutely dependent on the presence of Cl- or Br- outside the vesicles, whereas sulfate, acetate, formate, nitrate, and thiocyanate were inhibitory. Sulfate inhibition seems to be due to competition with Cl- on the anion-binding site outside the vesicles, whereas nitrate and thiocyanate inhibited only from the internal side. As with the inhibition by N-ethylmaleimide, the proton-pumping activity was much more sensitive to nitrate than the ATPase activity. About 20 mM nitrate were sufficient for 90% inhibition of the proton-pumping activity while 100 mM inhibited only 50% of the ATPase activity both in situ and in the reconstituted enzyme. The possible regulatory effect of anions on the ATP-dependent proton uptake in secretory granules is discussed.

  7. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  8. Exercise training protects against aging-induced mitochondrial fragmentation in mouse skeletal muscle in a PGC-1α dependent manner

    DEFF Research Database (Denmark)

    Halling, Jens Frey; Jørgensen, Stine Ringholm; Olesen, Jesper

    2017-01-01

    Aging is associated with impaired mitochondrial function, whereas exercise training enhances mitochondrial content and function in part through activation of PGC-1α. Mitochondria form dynamic networks regulated by fission and fusion with profound effects on mitochondrial functions, yet the effect...... evidence that exercise training rescues aging-induced mitochondrial fragmentation in skeletal muscle by suppressing mitochondrial fission protein expression in a PGC-1α dependent manner....

  9. Modulation of myocardial mitochondrial mechanisms during severe polymicrobial sepsis in the rat.

    Directory of Open Access Journals (Sweden)

    Mani Chopra

    Full Text Available We tested the hypothesis that 5-Hydroxydecanoic acid (5HD, a putative mitoK(ATP channel blocker, will reverse sepsis-induced cardiodynamic and adult rat ventricular myocyte (ARVM contractile dysfunction, restore mitochondrial membrane permeability alterations and improve survival.Male Sprague-Dawley rats (350-400 g were made septic using 400 mg/kg cecal inoculum, ip. Sham animals received 5% dextrose water, ip. The Voltage Dependent Anion Channels (VDAC1, Bax and cytochrome C levels were determined in isolated single ARVMs obtained from sham and septic rat heart. Mitochondria and cytosolic fractions were isolated from ARVMs treated with norepinephrine (NE, 10 µmoles in the presence/absence of 5HD (100 µmoles. A continuous infusion of 5HD using an Alzet pump reversed sepsis-induced mortality when administered at the time of induction of sepsis (-40% and at 6 hr post-sepsis (-20%. Electrocardiography revealed that 5HD reversed sepsis-induced decrease in the average ejection fraction, Simpsons+m Mode (53.5±2.5 in sepsis and 69.2±1.2 at 24 hr in sepsis+5HD vs. 79.9±1.5 basal group and cardiac output (63.3±1.2 mL/min sepsis and 79.3±3.9 mL/min at 24 hr in sepsis+5HD vs. 85.8±1.5 mL/min basal group. The treatment of ARVMs with 5HD also reversed sepsis-induced depressed contractility in both the vehicle and NE-treated groups. Sepsis produced a significant downregulation of VDAC1, and upregulation of Bax levels, along with mitochondrial membrane potential collapse in ARVMs. Pretreatment of septic ARVMs with 5HD blocked a NE-induced decrease in the VDAC1 and release of cytochrome C.The data suggest that Bax activation is an upstream event that may precede the opening of the mitoK(ATP channels in sepsis. We concluded that mitoK(ATP channel inhibition via decreased mitochondrial membrane potential and reduced release of cytochrome C provided protection against sepsis-induced ARVM and myocardial contractile dysfunction.

  10. Modulation of myocardial mitochondrial mechanisms during severe polymicrobial sepsis in the rat.

    Science.gov (United States)

    Chopra, Mani; Golden, Honey B; Mullapudi, Srinivas; Dowhan, William; Dostal, David E; Sharma, Avadhesh C

    2011-01-01

    We tested the hypothesis that 5-Hydroxydecanoic acid (5HD), a putative mitoK(ATP) channel blocker, will reverse sepsis-induced cardiodynamic and adult rat ventricular myocyte (ARVM) contractile dysfunction, restore mitochondrial membrane permeability alterations and improve survival. Male Sprague-Dawley rats (350-400 g) were made septic using 400 mg/kg cecal inoculum, ip. Sham animals received 5% dextrose water, ip. The Voltage Dependent Anion Channels (VDAC1), Bax and cytochrome C levels were determined in isolated single ARVMs obtained from sham and septic rat heart. Mitochondria and cytosolic fractions were isolated from ARVMs treated with norepinephrine (NE, 10 µmoles) in the presence/absence of 5HD (100 µmoles). A continuous infusion of 5HD using an Alzet pump reversed sepsis-induced mortality when administered at the time of induction of sepsis (-40%) and at 6 hr post-sepsis (-20%). Electrocardiography revealed that 5HD reversed sepsis-induced decrease in the average ejection fraction, Simpsons+m Mode (53.5±2.5 in sepsis and 69.2±1.2 at 24 hr in sepsis+5HD vs. 79.9±1.5 basal group) and cardiac output (63.3±1.2 mL/min sepsis and 79.3±3.9 mL/min at 24 hr in sepsis+5HD vs. 85.8±1.5 mL/min basal group). The treatment of ARVMs with 5HD also reversed sepsis-induced depressed contractility in both the vehicle and NE-treated groups. Sepsis produced a significant downregulation of VDAC1, and upregulation of Bax levels, along with mitochondrial membrane potential collapse in ARVMs. Pretreatment of septic ARVMs with 5HD blocked a NE-induced decrease in the VDAC1 and release of cytochrome C. The data suggest that Bax activation is an upstream event that may precede the opening of the mitoK(ATP) channels in sepsis. We concluded that mitoK(ATP) channel inhibition via decreased mitochondrial membrane potential and reduced release of cytochrome C provided protection against sepsis-induced ARVM and myocardial contractile dysfunction.

  11. MITOCHONDRIAL BKCa CHANNEL

    Directory of Open Access Journals (Sweden)

    Enrique eBalderas

    2015-03-01

    Full Text Available Since its discovery in a glioma cell line 15 years ago, mitochondrial BKCa channel (mitoBKCa has been studied in brain cells and cardiomyocytes sharing general biophysical properties such as high K+ conductance (~300 pS, voltage-dependency and Ca2+-sensitivity. Main advances in deciphering the molecular composition of mitoBKCa have included establishing that it is encoded by the Kcnma1 gene, that a C-terminal splice insert confers mitoBKCa ability to be targeted to cardiac mitochondria, and evidence for its potential coassembly with β subunits. Notoriously, β1 subunit directly interacts with cytochrome c oxidase and mitoBKCa can be modulated by substrates of the respiratory chain. mitoBKCa channel has a central role in protecting the heart from ischemia, where pharmacological activation of the channel impacts the generation of reactive oxygen species and mitochondrial Ca2+ preventing cell death likely by impeding uncontrolled opening of the mitochondrial transition pore. Supporting this view, inhibition of mitoBKCa with Iberiotoxin, enhances cytochrome c release from glioma mitochondria. Many tantalizing questions remain. Some of them are: how is mitoBKCa coupled to the respiratory chain? Does mitoBKCa play non-conduction roles in mitochondria physiology? Which are the functional partners of mitoBKCa? What are the roles of mitoBKCa in other cell types? Answers to these questions are essential to define the impact of mitoBKCa channel in mitochondria biology and disease.

  12. The proline metabolism intermediate Δ1-pyrroline-5-carboxylate directly inhibits the mitochondrial respiration in budding yeast.

    Science.gov (United States)

    Nishimura, Akira; Nasuno, Ryo; Takagi, Hiroshi

    2012-07-30

    The proline metabolism intermediate Δ(1)-pyrroline-5-carboxylate (P5C) induces cell death in animals, plants and yeasts. To elucidate how P5C triggers cell death, we analyzed P5C metabolism, mitochondrial respiration and superoxide anion generation in the yeast Saccharomyces cerevisiae. Gene disruption analysis revealed that P5C-mediated cell death was not due to P5C metabolism. Interestingly, deficiency in mitochondrial respiration suppressed the sensitivity of yeast cells to P5C. In addition, we found that P5C inhibits the mitochondrial respiration and induces a burst of superoxide anions from the mitochondria. We propose that P5C regulates cell death via the inhibition of mitochondrial respiration. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  13. Mitochondrial uncouplers with an extraordinary dynamic range.

    Science.gov (United States)

    Lou, Phing-How; Hansen, Birgit S; Olsen, Preben H; Tullin, Søren; Murphy, Michael P; Brand, Martin D

    2007-10-01

    We have discovered that some weak uncouplers (typified by butylated hydroxytoluene) have a dynamic range of more than 10(6) in vitro: the concentration giving measurable uncoupling is less than one millionth of the concentration causing full uncoupling. They achieve this through a high-affinity interaction with the mitochondrial adenine nucleotide translocase that causes significant but limited uncoupling at extremely low uncoupler concentrations, together with more conventional uncoupling at much higher concentrations. Uncoupling at the translocase is not by a conventional weak acid/anion cycling mechanism since it is also caused by substituted triphenylphosphonium molecules, which are not anionic and cannot protonate. Covalent attachment of the uncoupler to a mitochondrially targeted hydrophobic cation sensitizes it to membrane potential, giving a small additional effect. The wide dynamic range of these uncouplers in isolated mitochondria and intact cells reveals a novel allosteric activation of proton transport through the adenine nucleotide translocase and provides a promising starting point for designing safer uncouplers for obesity therapy.

  14. Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

    International Nuclear Information System (INIS)

    Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

    2012-01-01

    Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

  15. Neuroactive Steroids: Receptor Interactions and Responses

    Directory of Open Access Journals (Sweden)

    Kald Beshir Tuem

    2017-08-01

    Full Text Available Neuroactive steroids (NASs are naturally occurring steroids, which are synthesized centrally as de novo from cholesterol and are classified as pregnane, androstane, and sulfated neurosteroids (NSs. NASs modulate many processes via interacting with gamma-aminobutyric acid (GABA, N-methyl-d-aspartate, serotonin, voltage-gated calcium channels, voltage-dependent anion channels, α-adrenoreceptors, X-receptors of the liver, transient receptor potential channels, microtubule-associated protein 2, neurotrophin nerve growth factor, and σ1 receptors. Among these, NSs (especially allopregnanolone have high potency and extensive GABA-A receptors and hence demonstrate anticonvulsant, anesthetic, central cytoprotectant, and baroreflex inhibitory effects. NSs are also involved in mood and learning via serotonin and anti-nociceptive activity via T-type voltage-gated Ca2+ channels. Moreover, they are modulators of mitochondrial function, synaptic plasticity, or regulators of apoptosis, which have a role in neuroprotective via voltage-dependent anion channels receptors. For proper functioning, NASs need to be in their normal level, whereas excess and deficiency may lead to abnormalities. When they are below the normal, NSs could have a part in development of depression, neuro-inflammation, multiple sclerosis, experimental autoimmune encephalitis, epilepsy, and schizophrenia. On the other hand, stress and attention deficit disorder could occur during excessive level. Overall, NASs are very important molecules with major neuropsychiatric activity.

  16. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

    2002-01-01

    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  17. Investigation of channel width-dependent threshold voltage variation in a-InGaZnO thin-film transistors

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)

    2014-03-31

    This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.

  18. Mitochondrial permeability transition pore (MPTP) desensitization increases sea urchin spermatozoa fertilization rate.

    Science.gov (United States)

    Torrezan-Nitao, Elis; Boni, Raianna; Marques-Santos, Luis Fernando

    2016-10-01

    Mitochondrial permeability transition pore (MPTP) is a protein complex whose opening promotes an abrupt increase in mitochondrial inner membrane permeability. Calcium signaling pathways are described in gametes and are involved in the fertilization process. Although mitochondria may act as Ca(2+) store and have a fast calcium-releasing mechanism through MPTP, its contribution to fertilization remains unclear. The work aimed to investigate the MPTP phenomenon in sea urchin spermatozoa and its role on the fertilization. Several pharmacological tools were used to evaluate the MPTP's physiology. Our results demonstrated that MPTP occurs in male gametes in a Ca(2+) - and voltage-dependent manner and it is sensitive to cyclosporine A. Additionally, our data show that MPTP opening does not alter ROS generation in sperm cells. Inhibition of MPTP in spermatozoa strongly improved the fertilization rate, which may involve mechanisms that increase the spermatozoa lifespan. The present work is the first report of the presence of a voltage- and Ca(2+) -dependent MPTP in gametes of invertebrates and indicates MPTP opening as another evolutionary feature shared by sea urchins and mammals. Studies about MPTP in sea urchin male gametes may contribute to the elucidation of several mechanisms involved in sperm infertility. © 2016 International Federation for Cell Biology.

  19. 4SC-202 activates ASK1-dependent mitochondrial apoptosis pathway to inhibit hepatocellular carcinoma cells

    International Nuclear Information System (INIS)

    Fu, Meili; Wan, Fuqiang; Li, Zhengling; Zhang, Fenghua

    2016-01-01

    The aim of the present study is to investigate the potential anti-hepatocellular carcinoma (HCC) cell activity by 4SC-202, a novel class I HDAC inhibitor (HDACi). The associated signaling mechanisms were also analyzed. We showed that 4SC-202 treatment induced potent cytotoxic and proliferation–inhibitory activities against established HCC cell lines (HepG2, HepB3, SMMC-7721) and patient-derived primary HCC cells. Further, adding 4SC-202 in HCC cells activated mitochondrial apoptosis pathway, which was evidenced by mitochondrial permeability transition pore (mPTP) opening, cytochrome C cytosol release and caspase-3/-9 activation. Inhibition of this apoptosis pathway, by caspase-3/-9 inhibitors, mPTP blockers, or by shRNA-mediated knockdown of cyclophilin-D (Cyp-D, a key component of mPTP), significantly attenuated 4SC-202-induced HCC cell death and apoptosis. Reversely, over-expression of Cyp-D enhanced 4SC-202's sensitivity in HCC cells. Further studies showed that 4SC-202 induced apoptosis signal-regulating kinase 1 (ASK1) activation, causing it translocation to mitochondria and physical association with Cyp-D. This mitochondrial ASK1-Cyp-D complexation appeared required for mediating 4SC-202-induced apoptosis activation. ASK1 stable knockdown by targeted-shRNAs largely inhibited 4SC-202-induced mPTP opening, cytochrome C release, and following HCC cell apoptotic death. Together, we suggest that 4SC-202 activates ASK1-dependent mitochondrial apoptosis pathway to potently inhibit human HCC cells. - Highlights: • 4SC-202 exerts potent anti-proliferative and cytotoxic activity against established/primary HCC cells. • SC-202-induced anti-HCC cell activity relies on caspase-dependent apoptosis activation. • 4SC-202 activates Cyp-D-dependent mitochondrial apoptosis pathway in HCC cells. • 4SC-202 activates ASK1 in HCC cells, causing it translocation to mitochondria. • Mitochondrial ASK1-Cyp-D complexation mediates 4SC-202's activity in HCC cells.

  20. 4SC-202 activates ASK1-dependent mitochondrial apoptosis pathway to inhibit hepatocellular carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Meili, E-mail: fumeilidrlinyi@tom.com [Department of Infectious Disease, Linyi People' s Hospital, Linyi 276000 (China); Wan, Fuqiang [Department of Head and Neck Surgery, Linyi Tumor Hospital, Linyi 276000 (China); Li, Zhengling [Department of Nursing, Tengzhou Central People' s Hospital, Tengzhou 277500 (China); Zhang, Fenghua [Department of Operating Room, Linyi People' s Hospital, Linyi 276000 (China)

    2016-03-04

    The aim of the present study is to investigate the potential anti-hepatocellular carcinoma (HCC) cell activity by 4SC-202, a novel class I HDAC inhibitor (HDACi). The associated signaling mechanisms were also analyzed. We showed that 4SC-202 treatment induced potent cytotoxic and proliferation–inhibitory activities against established HCC cell lines (HepG2, HepB3, SMMC-7721) and patient-derived primary HCC cells. Further, adding 4SC-202 in HCC cells activated mitochondrial apoptosis pathway, which was evidenced by mitochondrial permeability transition pore (mPTP) opening, cytochrome C cytosol release and caspase-3/-9 activation. Inhibition of this apoptosis pathway, by caspase-3/-9 inhibitors, mPTP blockers, or by shRNA-mediated knockdown of cyclophilin-D (Cyp-D, a key component of mPTP), significantly attenuated 4SC-202-induced HCC cell death and apoptosis. Reversely, over-expression of Cyp-D enhanced 4SC-202's sensitivity in HCC cells. Further studies showed that 4SC-202 induced apoptosis signal-regulating kinase 1 (ASK1) activation, causing it translocation to mitochondria and physical association with Cyp-D. This mitochondrial ASK1-Cyp-D complexation appeared required for mediating 4SC-202-induced apoptosis activation. ASK1 stable knockdown by targeted-shRNAs largely inhibited 4SC-202-induced mPTP opening, cytochrome C release, and following HCC cell apoptotic death. Together, we suggest that 4SC-202 activates ASK1-dependent mitochondrial apoptosis pathway to potently inhibit human HCC cells. - Highlights: • 4SC-202 exerts potent anti-proliferative and cytotoxic activity against established/primary HCC cells. • SC-202-induced anti-HCC cell activity relies on caspase-dependent apoptosis activation. • 4SC-202 activates Cyp-D-dependent mitochondrial apoptosis pathway in HCC cells. • 4SC-202 activates ASK1 in HCC cells, causing it translocation to mitochondria. • Mitochondrial ASK1-Cyp-D complexation mediates 4SC-202's activity in HCC cells.

  1. Josephson tunneling current in the presence of a time-dependent voltage

    International Nuclear Information System (INIS)

    Harris, R.E.

    1975-01-01

    The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field

  2. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  3. Hypercapnia modulates cAMP signalling and cystic fibrosis transmembrane conductance regulator‐dependent anion and fluid secretion in airway epithelia

    Science.gov (United States)

    Turner, Mark J.; Saint‐Criq, Vinciane; Patel, Waseema; Ibrahim, Salam H.; Verdon, Bernard; Ward, Christopher; Garnett, James P.; Tarran, Robert; Cann, Martin J.

    2015-01-01

    Key points Raised arterial blood CO2 (hypercapnia) is a feature of many lung diseases.CO2 has been shown to act as a cell signalling molecule in human cells, notably by influencing the levels of cell signalling second messengers: cAMP and Ca2+.Hypercapnia reduced cAMP‐stimulated cystic fibrosis transmembrane conductance regulator‐dependent anion and fluid transport in Calu‐3 cells and primary human airway epithelia but did not affect cAMP‐regulated HCO3 − transport via pendrin or Na+/HCO3 − cotransporters.These results further support the role of CO2 as a cell signalling molecule and suggests CO2‐induced reductions in airway anion and fluid transport may impair innate defence mechanisms of the lungs. Abstract Hypercapnia is clinically defined as an arterial blood partial pressure of CO2 of above 40 mmHg and is a feature of chronic lung disease. In previous studies we have demonstrated that hypercapnia modulates agonist‐stimulated cAMP levels through effects on transmembrane adenylyl cyclase activity. In the airways, cAMP is known to regulate cystic fibrosis transmembrane conductance regulator (CFTR)‐mediated anion and fluid secretion, which contributes to airway surface liquid homeostasis. The aim of the current work was to investigate if hypercapnia could modulate cAMP‐regulated ion and fluid transport in human airway epithelial cells. We found that acute exposure to hypercapnia significantly reduced forskolin‐stimulated elevations in intracellular cAMP as well as both adenosine‐ and forskolin‐stimulated increases in CFTR‐dependent transepithelial short‐circuit current, in polarised cultures of Calu‐3 human airway cells. This CO2‐induced reduction in anion secretion was not due to a decrease in HCO3 − transport given that neither a change in CFTR‐dependent HCO3 − efflux nor Na+/HCO3 − cotransporter‐dependent HCO3 − influx were CO2‐sensitive. Hypercapnia also reduced the volume of forskolin‐stimulated fluid

  4. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    Science.gov (United States)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  5. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  6. CLC-Nt1, a putative chloride channel protein of tobacco, co-localizes with mitochondrial membrane markers.

    Science.gov (United States)

    Lurin, C; Güclü, J; Cheniclet, C; Carde, J P; Barbier-Brygoo, H; Maurel, C

    2000-06-01

    The voltage-dependent chloride channel (CLC) family of membrane proteins has cognates in animals, yeast, bacteria and plants, and chloride-channel activity has been assigned to most of the animal homologues. Lack of evidence of CLC functions in plants prompted us to characterize the cellular localization of the tobacco CLC-Nt1 protein. Specific polyclonal antibodies were raised against an N-terminal polypeptide of CLC-Nt1. These antibodies were used to probe membrane proteins prepared by various cell-fractionation methods. These included aqueous two-phase partitioning (for plasma membranes), free-flow electrophoresis (for vacuolar and plasma membranes), intact vacuole isolation, Percoll-gradient centrifugation (for plastids and mitochondria) and stepped, linear, sucrose-density-gradient centrifugation (for mitochondria). Each purified membrane fraction was characterized with specific marker enzyme activities or antibodies. Our studies ruled out the possibility that the major cell localization of CLC-Nt1 was the vacuolar or plasma membranes, the endoplasmic reticulum, the Golgi apparatus or the plastids. In contrast, we showed that the tobacco CLC-Nt1 specifically co-localized with the markers of the mitochondrial inner membrane, cytochrome c oxidase and NAD9 protein. CLC-Nt1 may correspond to the inner membrane anion channel ('IMAC') described previously in animal and plant mitochondria.

  7. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  8. Tributyltin induces mitochondrial fission through NAD-IDH dependent mitofusin degradation in human embryonic carcinoma cells.

    Science.gov (United States)

    Yamada, Shigeru; Kotake, Yaichiro; Nakano, Mizuho; Sekino, Yuko; Kanda, Yasunari

    2015-08-01

    Organotin compounds, such as tributyltin (TBT), are well-known endocrine disruptors. TBT acts at the nanomolar level through genomic pathways via the peroxisome proliferator activated receptor (PPAR)/retinoid X receptor (RXR). We recently reported that TBT inhibits cell growth and the ATP content in the human embryonic carcinoma cell line NT2/D1 via a non-genomic pathway involving NAD(+)-dependent isocitrate dehydrogenase (NAD-IDH), which metabolizes isocitrate to α-ketoglutarate. However, the molecular mechanisms by which NAD-IDH mediates TBT toxicity remain unclear. In the present study, we evaluated the effects of TBT on mitochondrial NAD-IDH and energy production. Staining with MitoTracker revealed that nanomolar TBT levels induced mitochondrial fragmentation. TBT also degraded the mitochondrial fusion proteins, mitofusins 1 and 2. Interestingly, apigenin, an inhibitor of NAD-IDH, mimicked the effects of TBT. Incubation with an α-ketoglutarate analogue partially recovered TBT-induced mitochondrial dysfunction, supporting the involvement of NAD-IDH. Our data suggest that nanomolar TBT levels impair mitochondrial quality control via NAD-IDH in NT2/D1 cells. Thus, mitochondrial function in embryonic cells could be used to assess cytotoxicity associated with metal exposure.

  9. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  10. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  11. A reaction-diffusion model of ROS-induced ROS release in a mitochondrial network.

    Directory of Open Access Journals (Sweden)

    Lufang Zhou

    2010-01-01

    Full Text Available Loss of mitochondrial function is a fundamental determinant of cell injury and death. In heart cells under metabolic stress, we have previously described how the abrupt collapse or oscillation of the mitochondrial energy state is synchronized across the mitochondrial network by local interactions dependent upon reactive oxygen species (ROS. Here, we develop a mathematical model of ROS-induced ROS release (RIRR based on reaction-diffusion (RD-RIRR in one- and two-dimensional mitochondrial networks. The nodes of the RD-RIRR network are comprised of models of individual mitochondria that include a mechanism of ROS-dependent oscillation based on the interplay between ROS production, transport, and scavenging; and incorporating the tricarboxylic acid (TCA cycle, oxidative phosphorylation, and Ca(2+ handling. Local mitochondrial interaction is mediated by superoxide (O2.- diffusion and the O2.(--dependent activation of an inner membrane anion channel (IMAC. In a 2D network composed of 500 mitochondria, model simulations reveal DeltaPsi(m depolarization waves similar to those observed when isolated guinea pig cardiomyocytes are subjected to a localized laser-flash or antioxidant depletion. The sensitivity of the propagation rate of the depolarization wave to O(2.- diffusion, production, and scavenging in the reaction-diffusion model is similar to that observed experimentally. In addition, we present novel experimental evidence, obtained in permeabilized cardiomyocytes, confirming that DeltaPsi(m depolarization is mediated specifically by O2.-. The present work demonstrates that the observed emergent macroscopic properties of the mitochondrial network can be reproduced in a reaction-diffusion model of RIRR. Moreover, the findings have uncovered a novel aspect of the synchronization mechanism, which is that clusters of mitochondria that are oscillating can entrain mitochondria that would otherwise display stable dynamics. The work identifies the

  12. Drp1-Dependent Mitochondrial Autophagy Plays a Protective Role Against Pressure Overload-Induced Mitochondrial Dysfunction and Heart Failure.

    Science.gov (United States)

    Shirakabe, Akihiro; Zhai, Peiyong; Ikeda, Yoshiyuki; Saito, Toshiro; Maejima, Yasuhiro; Hsu, Chiao-Po; Nomura, Masatoshi; Egashira, Kensuke; Levine, Beth; Sadoshima, Junichi

    2016-03-29

    Mitochondrial autophagy is an important mediator of mitochondrial quality control in cardiomyocytes. The occurrence of mitochondrial autophagy and its significance during cardiac hypertrophy are not well understood. Mice were subjected to transverse aortic constriction (TAC) and observed at multiple time points up to 30 days. Cardiac hypertrophy developed after 5 days, the ejection fraction was reduced after 14 days, and heart failure was observed 30 days after TAC. General autophagy was upregulated between 1 and 12 hours after TAC but was downregulated below physiological levels 5 days after TAC. Mitochondrial autophagy, evaluated by electron microscopy, mitochondrial content, and Keima with mitochondrial localization signal, was transiently activated at ≈3 to 7 days post-TAC, coinciding with mitochondrial translocation of Drp1. However, it was downregulated thereafter, followed by mitochondrial dysfunction. Haploinsufficiency of Drp1 abolished mitochondrial autophagy and exacerbated the development of both mitochondrial dysfunction and heart failure after TAC. Injection of Tat-Beclin 1, a potent inducer of autophagy, but not control peptide, on day 7 after TAC, partially rescued mitochondrial autophagy and attenuated mitochondrial dysfunction and heart failure induced by overload. Haploinsufficiency of either drp1 or beclin 1 prevented the rescue by Tat-Beclin 1, suggesting that its effect is mediated in part through autophagy, including mitochondrial autophagy. Mitochondrial autophagy is transiently activated and then downregulated in the mouse heart in response to pressure overload. Downregulation of mitochondrial autophagy plays an important role in mediating the development of mitochondrial dysfunction and heart failure, whereas restoration of mitochondrial autophagy attenuates dysfunction in the heart during pressure overload. © 2016 American Heart Association, Inc.

  13. Prenatal iron deficiency causes sex-dependent mitochondrial dysfunction and oxidative stress in fetal rat kidneys and liver.

    Science.gov (United States)

    Woodman, Andrew G; Mah, Richard; Keddie, Danae; Noble, Ronan M N; Panahi, Sareh; Gragasin, Ferrante S; Lemieux, Hélène; Bourque, Stephane L

    2018-06-01

    Prenatal iron deficiency alters fetal developmental trajectories, which results in persistent changes in organ function. Here, we studied the effects of prenatal iron deficiency on fetal kidney and liver mitochondrial function. Pregnant Sprague-Dawley rats were fed partially or fully iron-restricted diets to induce a state of moderate or severe iron deficiency alongside iron-replete control rats. We assessed mitochondrial function via high-resolution respirometry and reactive oxygen species generation via fluorescence microscopy on gestational d 21. Hemoglobin levels were reduced in dams in the moderate (-31%) and severe groups (-54%) compared with controls, which was accompanied by 55% reductions in fetal hemoglobin levels in both moderate and severe groups versus controls. Male iron-deficient kidneys exhibited globally reduced mitochondrial content and respiration, as well as increased cytosolic superoxide and decreased NO. Female iron-deficient kidneys exhibited complex II down-regulation and increased mitochondrial oxidative stress. Male iron-deficient livers exhibited reduced complex IV respiration and increased cytosolic superoxide, whereas female liver tissues exhibited no alteration in oxidant levels or mitochondrial function. These findings indicate that prenatal iron deficiency causes changes in mitochondrial content and function as well as oxidant status in a sex- and organ-dependent manner, which may be an important mechanism that underlies the programming of cardiovascular disease.-Woodman, A. G., Mah, R., Keddie, D., Noble, R. M. N., Panahi, S., Gragasin, F. S., Lemieux, H., Bourque, S. L. Prenatal iron deficiency causes sex-dependent mitochondrial dysfunction and oxidative stress in fetal rat kidneys and liver.

  14. Impairment of mitochondrial calcium handling in a mtSOD1 cell culture model of motoneuron disease

    Directory of Open Access Journals (Sweden)

    Zippelius Annette

    2009-06-01

    Full Text Available Abstract Background Amyotrophic lateral sclerosis (ALS is a fatal neurodegenerative disorder characterized by the selective loss of motor neurons (MN in the brain stem and spinal cord. Intracellular disruptions of cytosolic and mitochondrial calcium have been associated with selective MN degeneration, but the underlying mechanisms are not well understood. The present evidence supports a hypothesis that mitochondria are a target of mutant SOD1-mediated toxicity in familial amyotrophic lateral sclerosis (fALS and intracellular alterations of cytosolic and mitochondrial calcium might aggravate the course of this neurodegenerative disease. In this study, we used a fluorescence charged cool device (CCD imaging system to separate and simultaneously monitor cytosolic and mitochondrial calcium concentrations in individual cells in an established cellular model of ALS. Results To gain insights into the molecular mechanisms of SOD1G93A associated motor neuron disease, we simultaneously monitored cytosolic and mitochondrial calcium concentrations in individual cells. Voltagedependent cytosolic Ca2+ elevations and mitochondria – controlled calcium release mechanisms were monitored after loading cells with fluorescent dyes fura-2 and rhod-2. Interestingly, comparable voltage-dependent cytosolic Ca2+ elevations in WT (SH-SY5YWT and G93A (SH-SY5YG93A expressing cells were observed. In contrast, mitochondrial intracellular Ca2+ release responses evoked by bath application of the mitochondrial toxin FCCP were significantly smaller in G93A expressing cells, suggesting impaired calcium stores. Pharmacological experiments further supported the concept that the presence of G93A severely disrupts mitochondrial Ca2+ regulation. Conclusion In this study, by fluorescence measurement of cytosolic calcium and using simultaneous [Ca2+]i and [Ca2+]mito measurements, we are able to separate and simultaneously monitor cytosolic and mitochondrial calcium concentrations

  15. Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP

    Science.gov (United States)

    Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.

    2010-01-01

    In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128

  16. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

    2002-01-01

    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  17. Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

    Directory of Open Access Journals (Sweden)

    Mohamad Khairul Anuar

    2017-01-01

    Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

  18. Novel mitochondrial extensions provide evidence for a link between microtubule-directed movement and mitochondrial fission

    International Nuclear Information System (INIS)

    Bowes, Timothy; Gupta, Radhey S.

    2008-01-01

    Mitochondrial dynamics play an important role in a large number of cellular processes. Previously, we reported that treatment of mammalian cells with the cysteine-alkylators, N-ethylmaleimide and ethacrynic acid, induced rapid mitochondrial fusion forming a large reticulum approximately 30 min after treatment. Here, we further investigated this phenomenon using a number of techniques including live-cell confocal microscopy. In live cells, drug-induced fusion coincided with a cessation of fast mitochondrial movement which was dependent on microtubules. During this loss of movement, thin mitochondrial tubules extending from mitochondria were also observed, which we refer to as 'mitochondrial extensions'. The formation of these mitochondrial extensions, which were not observed in untreated cells, depended on microtubules and was abolished by pretreatment with nocodazole. In this study, we provide evidence that these extensions result from of a block in mitochondrial fission combined with continued application of motile force by microtubule-dependent motor complexes. Our observations strongly suggest the existence of a link between microtubule-based mitochondrial trafficking and mitochondrial fission

  19. The ATPase and protease domains of yeast mitochondrial Lon : Roles in proteolysis and respiration-dependent growth

    NARCIS (Netherlands)

    van Dijl, JM; Kutejova, E; Suda, K; Perecko, D; Schatz, G; Suzuki, CK

    1998-01-01

    The ATP-dependent Lon protease of Saccharomyces cerevisiae mitochondria is required for selective proteolysis in the matrix, maintenance of mitochondrial DNA, and respiration-dependent growth. Lon may also possess a chaperone-like function that facilitates protein degradation and protein-complex

  20. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2001-01-01

    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  1. Phospholipase A2 activity-dependent and -independent fusogenic activity of Naja nigricollis CMS-9 on zwitterionic and anionic phospholipid vesicles.

    Science.gov (United States)

    Chiou, Yi-Ling; Chen, Ying-Jung; Lin, Shinne-Ren; Chang, Long-Sen

    2011-11-01

    CMS-9, a phospholipase A(2) (PLA(2)) from Naja nigricollis venom, induced the death of human breast cancer MCF-7 cells accompanied with the formation of cell clumps without clear boundaries between cells. Annexin V-FITC staining indicated that abundant phosphatidylserine appeared on the outer membrane of MCF-7 cell clumps, implying the possibility that CMS-9 may promote membrane fusion via anionic phospholipids. To validate this proposition, fusogenic activity of CMS-9 on vesicles composed of zwitterionic phospholipid alone or a combination of zwitterionic and anionic phospholipids was examined. Although CMS-9-induced fusion of zwitterionic phospholipid vesicles depended on PLA(2) activity, CMS-9-induced fusion of vesicles containing anionic phospholipids could occur without the involvement of PLA(2) activity. Membrane-damaging activity of CMS-9 was associated with its fusogenicity. Moreover, CMS-9 induced differently membrane leakage and membrane fusion of vesicles with different compositions. Membrane fluidity and binding capability with phospholipid vesicles were not related to the fusogenicity of CMS-9. However, membrane-bound conformation and mode of CMS-9 depended on phospholipid compositions. Collectively, our data suggest that PLA(2) activity-dependent and -independent fusogenicity of CMS-9 are closely related to its membrane-bound modes and targeted membrane compositions. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Mitochondrial dysfunction in brain cortex mitochondria of STZ-diabetic rats: effect of l-Arginine.

    Science.gov (United States)

    Ortiz, M Del Carmen; Lores-Arnaiz, Silvia; Albertoni Borghese, M Florencia; Balonga, Sabrina; Lavagna, Agustina; Filipuzzi, Ana Laura; Cicerchia, Daniela; Majowicz, Monica; Bustamante, Juanita

    2013-12-01

    Mitochondrial dysfunction has been implicated in many diseases, including diabetes. It is well known that oxygen free radical species are produced endogenously by mitochondria, and also nitric oxide (NO) by nitric oxide synthases (NOS) associated to mitochondrial membranes, in consequence these organelles constitute main targets for oxidative damage. The aim of this study was to analyze mitochondrial physiology and NO production in brain cortex mitochondria of streptozotocin (STZ) diabetic rats in an early stage of diabetes and the potential effect of L-arginine administration. The diabetic condition was characterized by a clear hyperglycaemic state with loose of body weight after 4 days of STZ injection. This hyperglycaemic state was associated with mitochondrial dysfunction that was evident by an impairment of the respiratory activity, increased production of superoxide anion and a clear mitochondrial depolarization. In addition, the alteration in mitochondrial physiology was associated with a significant decrease in both NO production and nitric oxide synthase type I (NOS I) expression associated to the mitochondrial membranes. An increased level of thiobarbituric acid-reactive substances (TBARS) in brain cortex homogenates from STZ-diabetic rats indicated the presence of lipid peroxidation. L-arginine treatment to diabetic rats did not change blood glucose levels but significantly ameliorated the oxidative stress evidenced by lower TBARS and a lower level of superoxide anion. This effect was paralleled by improvement of mitochondrial respiratory function and a partial mitochondrial repolarization.In addition, the administration of L-arginine to diabetic rats prevented the decrease in NO production and NOSI expression. These results could indicate that exogenously administered L-arginine may have beneficial effects on mitochondrial function, oxidative stress and NO production in brain cortex mitochondria of STZ-diabetic rats.

  3. Two weeks of one-leg immobilization decreases skeletal muscle respiratory capacity equally in young and elderly men

    DEFF Research Database (Denmark)

    Gram, Martin; Vigelsø Hansen, Andreas; Yokota, Takashi

    2014-01-01

    Physical inactivity affects human skeletal muscle mitochondrial oxidative capacity but the influence of aging combined with physical inactivity is not known. This study investigates the effect of two weeks of immobilization followed by six weeks of supervised cycle training on muscle oxidative...... capacity in 17 young (23±1years) and 15 elderly (68±1years) healthy men. We applied high-resolution respirometry in permeabilized fibers from muscle biopsies at inclusion after immobilization and training. Furthermore, protein content of mitochondrial complexes I-V, mitochondrial heat shock protein 70 (mt......HSP70) and voltage dependent anion channel (VDAC) were measured in skeletal muscle by Western blotting. The elderly men had lower content of complexes I-V and mtHSP70 but similar respiratory capacity and content of VDAC compared to the young. In both groups the respiratory capacity and protein content...

  4. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

    OpenAIRE

    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

    2013-01-01

    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  5. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

    Science.gov (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

    2004-10-01

    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  6. REDOX IMAGING OF THE p53-DEPENDENT MITOCHONDRIAL REDOX STATE IN COLON CANCER EX VIVO

    Science.gov (United States)

    XU, HE N.; FENG, MIN; MOON, LILY; DOLLOFF, NATHAN; EL-DEIRY, WAFIK; LI, LIN Z.

    2015-01-01

    The mitochondrial redox state and its heterogeneity of colon cancer at tissue level have not been previously reported. Nor has how p53 regulates mitochondrial respiration been measured at (deep) tissue level, presumably due to the unavailability of the technology that has sufficient spatial resolution and tissue penetration depth. Our prior work demonstrated that the mitochondrial redox state and its intratumor heterogeneity is associated with cancer aggressiveness in human melanoma and breast cancer in mouse models, with the more metastatic tumors exhibiting localized regions of more oxidized redox state. Using the Chance redox scanner with an in-plane spatial resolution of 200 μm, we imaged the mitochondrial redox state of the wild-type p53 colon tumors (HCT116 p53 wt) and the p53-deleted colon tumors (HCT116 p53−/−) by collecting the fluorescence signals of nicotinamide adenine dinucleotide (NADH) and oxidized flavoproteins [Fp, including flavin adenine dinucleotide (FAD)] from the mouse xenografts snap-frozen at low temperature. Our results show that: (1) both tumor lines have significant degree of intratumor heterogeneity of the redox state, typically exhibiting a distinct bi-modal distribution that either correlates with the spatial core–rim pattern or the “hot/cold” oxidation-reduction patches; (2) the p53−/− group is significantly more heterogeneous in the mitochondrial redox state and has a more oxidized tumor core compared to the p53 wt group when the tumor sizes of the two groups are matched; (3) the tumor size dependence of the redox indices (such as Fp and Fp redox ratio) is significant in the p53−/− group with the larger ones being more oxidized and more heterogeneous in their redox state, particularly more oxidized in the tumor central regions; (4) the H&E staining images of tumor sections grossly correlate with the redox images. The present work is the first to reveal at the submillimeter scale the intratumor heterogeneity pattern

  7. Inhibition of Drp-1 dependent mitochondrial fission augments alcohol-induced cardiotoxicity via dysregulated Akt signaling

    Directory of Open Access Journals (Sweden)

    Anusha Sivakumar

    2017-10-01

    Full Text Available Cardiovascular disorders (CVDs still claim high mortality in spite of advancements in prognosis and treatment strategies. Alcohol is one of the most commonly consumed drugs globally and chronic/binge consumption (BAC 0.08 g/dL in 2 hours is a risk factor for CVDs. However, the aetiology and pathophysiological mechanisms of alcohol induced cardiotoxicity are still poorly understood. Mitochondria are the prime site for the ATP demands of the heart and also ethanol metabolism. These subcellular organelles depict dynamic fusion and fission events that are vital for structure and functional integrity. While fused mitochondrial improve ATP production and cell survival, increased fragmentation can be the cause or result of apoptosis. In this study, we proposed to analyze the mechanism of mitochondrial fission protein Drp-1-dependent apoptosis during alcohol toxicity. Male Wistar rats (220-250 kg body weight were given isocaloric sucrose or ethanol for 45 days, orally, via drinking water and intermittent gavage twice a week. Histopathological examination of the heart displayed hypertrophy with mild inflammation. Drp-1 immunoblotting showed over-expression of the protein during ethanol treatment. We next hypothesized that inhibiting Drp-1 could attenuate alcohol-induced cardiotoxicity. Interestingly, silencing Drp-1 with siRNA in-vitro augmented cytotoxicity. Also, crude mitochondrial fraction showed increased Bak aggregation, reduced cytochrome c release but increased SMAC/DIABLO. We analyzed the Akt cell survival signaling and found that PTEN showed over-expression at both transcriptional and translational level with no significant change in total Akt but down-regulation of p-Akt (Ser473. In conclusion, we have shown that inhibition of Drp-1 dependent mitochondrial fission is not cardioprotective against alcohol-induced apoptotic signaling and augments the cytotoxicity. To our knowledge, this study is the first to interlink cell survival AKT signaling

  8. Neuroglobin overexpression inhibits oxygen-glucose deprivation-induced mitochondrial permeability transition pore opening in primary cultured mouse cortical neurons.

    Science.gov (United States)

    Yu, Zhanyang; Liu, Ning; Li, Yadan; Xu, Jianfeng; Wang, Xiaoying

    2013-08-01

    Neuroglobin (Ngb) is an endogenous neuroprotective molecule against hypoxic/ischemic brain injury, but the underlying mechanisms remain largely undefined. Our recent study revealed that Ngb can bind to voltage-dependent anion channel (VDAC), a regulator of mitochondria permeability transition (MPT). In this study we examined the role of Ngb in MPT pore (mPTP) opening following oxygen-glucose deprivation (OGD) in primary cultured mouse cortical neurons. Co-immunoprecipitation (Co-IP) and immunocytochemistry showed that the binding between Ngb and VDAC was increased after OGD compared to normoxia, indicating the OGD-enhanced Ngb-VDAC interaction. Ngb overexpression protected primary mouse cortical neurons from OGD-induced neuronal death, to an extent comparable to mPTP opening inhibitor, cyclosporine A (CsA) pretreatment. We further measured the role of Ngb in OGD-induced mPTP opening using Ngb overexpression and knockdown approaches in primary cultured neurons, and recombinant Ngb exposure to isolated mitochondria. Same as CsA pretreatment, Ngb overexpression significantly reduced OGD-induced mPTP opening markers including mitochondria swelling, mitochondrial NAD(+) release, and cytochrome c (Cyt c) release in primary cultured neurons. Recombinant Ngb incubation significantly reduced OGD-induced NAD(+) release and Cyt c release from isolated mitochondria. In contrast, Ngb knockdown significantly increased OGD-induced neuron death, and increased OGD-induced mitochondrial NAD(+) release and Cyt c release as well, and these outcomes could be rescued by CsA pretreatment. In summary, our results demonstrated that Ngb overexpression can inhibit OGD-induced mPTP opening in primary cultured mouse cortical neurons, which may be one of the molecular mechanisms of Ngb's neuroprotection. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Role of Mitochondrial Complex IV in Age-Dependent Obesity

    Directory of Open Access Journals (Sweden)

    Ines Soro-Arnaiz

    2016-09-01

    Full Text Available Aging is associated with progressive white adipose tissue (WAT enlargement initiated early in life, but the molecular mechanisms involved remain unknown. Here we show that mitochondrial complex IV (CIV activity and assembly are already repressed in white adipocytes of middle-aged mice and involve a HIF1A-dependent decline of essential CIV components such as COX5B. At the molecular level, HIF1A binds to the Cox5b proximal promoter and represses its expression. Silencing of Cox5b decreased fatty acid oxidation and promoted intracellular lipid accumulation. Moreover, local in vivo Cox5b silencing in WAT of young mice increased the size of adipocytes, whereas restoration of COX5B expression in aging mice counteracted adipocyte enlargement. An age-dependent reduction in COX5B gene expression was also found in human visceral adipose tissue. Collectively, our findings establish a pivotal role for CIV dysfunction in progressive white adipocyte enlargement during aging, which can be restored to alleviate age-dependent WAT expansion.

  10. Anion Effects on the Ion Exchange Process and the Deformation Property of Ionic Polymer Metal Composite Actuators

    Directory of Open Access Journals (Sweden)

    Wataru Aoyagi

    2016-06-01

    Full Text Available An ionic polymer-metal composite (IPMC actuator composed of a thin perfluorinated ionomer membrane with electrodes plated on both surfaces undergoes a large bending motion when a low electric field is applied across its thickness. Such actuators are soft, lightweight, and able to operate in solutions and thus show promise with regard to a wide range of applications, including MEMS sensors, artificial muscles, biomimetic systems, and medical devices. However, the variations induced by changing the type of anion on the device deformation properties are not well understood; therefore, the present study investigated the effects of different anions on the ion exchange process and the deformation behavior of IPMC actuators with palladium electrodes. Ion exchange was carried out in solutions incorporating various anions and the actuator tip displacement in deionized water was subsequently measured while applying a step voltage. In the step voltage response measurements, larger anions such as nitrate or sulfate led to a more pronounced tip displacement compared to that obtained with smaller anions such as hydroxide or chloride. In AC impedance measurements, larger anions generated greater ion conductivity and a larger double-layer capacitance at the cathode. Based on these mechanical and electrochemical measurements, it is concluded that the presence of larger anions in the ion exchange solution induces a greater degree of double-layer capacitance at the cathode and results in enhanced tip deformation of the IPMC actuators.

  11. Ursolic acid mediates photosensitization by initiating mitochondrial-dependent apoptosis

    Science.gov (United States)

    Lee, Yuan-Hao; Wang, Exing; Kumar, Neeru; Glickman, Randolph D.

    2013-02-01

    The signaling pathways PI3K/Akt and MAPK play key roles in transcription, translation and carcinogenesis, and may be activated by light exposure. These pathways may be modulated or inhibited by naturally-occurring compounds, such as the triterpenoid, ursolic acid (UA). Previously, the transcription factors p53 and NF-kB, which transactivate mitochondrial apoptosis-related genes, were shown to be differentially modulated by UA. Our current work indicates that UA causes these effects via the mTOR and insulin-mediated pathways. UA-modulated apoptosis, following exposure to UV radiation, is observed to correspond to differential levels of oxidative stress in retinal pigment epithelial (RPE) and skin melanoma (SM) cells. Flow cytometry analysis, DHE (dihydroethidium) staining and membrane permeability assay showed that UA pretreatment potentiated cell cycle arrest and radiation-induced apoptosis selectively on SM cells while DNA photo-oxidative damage (i.e. strand breakage) was reduced, presumably by some antioxidant activity of UA in RPE cells. The UA-mediated NF-κB activation in SM cells was reduced by rapamycin pretreatment, which indicates that these agents exert inter-antagonistic effects in the PI3K/Akt/mTOR pathway. In contrast, the antagonistic effect of UA on the PI3K/Akt pathway was reversed by insulin leading to greater NF-κB and p53 activation in RPE cells. MitoTracker, a mitochondrial functional assay, indicated that mitochondria in RPE cells experienced reduced oxidative stress while those in SM cells exhibited increased oxidative stress upon UA pretreatment. When rapamycin administration was followed by UA, mitochondrial oxidative stress was increased in RPE cells but decreased in SM cells. These results indicate that UA modulates p53 and NF-κB, initiating a mitogenic response to radiation that triggers mitochondria-dependent apoptosis.

  12. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

    Science.gov (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

    2018-02-21

    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  13. OXPHOS-Dependent Cells Identify Environmental Disruptors of Mitochondrial Function

    Science.gov (United States)

    Mitochondrial dysfunction is associated with numerous chronic diseases including metabolic syndrome. Environmental chemicals can impair mitochondrial function through numerous mechanisms such as membrane disruption, complex inhibition and electron transport chain uncoupling. Curr...

  14. Shaping charge excitations in chiral edge states with a time-dependent gate voltage

    Science.gov (United States)

    Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine

    2018-02-01

    We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.

  15. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

    2001-01-01

    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  16. PGC-1α-Dependent Mitochondrial Adaptation Is Necessary to Sustain IL-2-Induced Activities in Human NK Cells.

    Science.gov (United States)

    Miranda, Dante; Jara, Claudia; Ibañez, Jorge; Ahumada, Viviana; Acuña-Castillo, Claudio; Martin, Adrian; Córdova, Alexandra; Montoya, Margarita

    2016-01-01

    Human Natural Killer (NK) cells are a specialized heterogeneous subpopulation of lymphocytes involved in antitumor defense reactions. NK cell effector functions are critically dependent on cytokines and metabolic activity. Among various cytokines modulating NK cell function, interleukin-2 (IL-2) can induce a more potent cytotoxic activity defined as lymphokine activated killer activity (LAK). Our aim was to determine if IL-2 induces changes at the mitochondrial level in NK cells to support the bioenergetic demand for performing this enhanced cytotoxic activity more efficiently. Purified human NK cells were cultured with high IL-2 concentrations to develop LAK activity, which was assessed by the ability of NK cells to lyse NK-resistant Daudi cells. Here we show that, after 72 h of culture of purified human NK cells with enough IL-2 to induce LAK activity, both the mitochondrial mass and the mitochondrial membrane potential increased in a PGC-1α-dependent manner. In addition, oligomycin, an inhibitor of ATP synthase, inhibited IL-2-induced LAK activity at 48 and 72 h of culture. Moreover, the secretion of IFN-γ from NK cells with LAK activity was also partially dependent on PGC-1α expression. These results indicate that PGC-1α plays a crucial role in regulating mitochondrial function involved in the maintenance of LAK activity in human NK cells stimulated with IL-2.

  17. Fipronil induces apoptosis through caspase-dependent mitochondrial pathways in Drosophila S2 cells.

    Science.gov (United States)

    Zhang, Baoyan; Xu, Zhiping; Zhang, Yixi; Shao, Xusheng; Xu, Xiaoyong; Cheng, Jiaogao; Li, Zhong

    2015-03-01

    Fipronil is the first phenylpyrazole insecticide widely used in controlling pests, including pyrethroid, organophosphate and carbamate insecticides. It is generally accepted that fipronil elicits neurotoxicity via interactions with GABA and glutamate receptors, although alternative mechanisms have recently been proposed. This study evaluates the genotoxicity of fipronil and its likely mode of action in Drosophila S2 cells, as an in vitro model. Fipronil administrated the concentration- and time-dependent S2 cell proliferation. Intracellular biochemical assays showed that fipronil-induced S2 cell apoptosis coincided with a decrease in the mitochondrial membrane potential and an increase reactive oxygen species generation, a significant decrease of Bcl-2 and DIAP1, and a marked augmentation of Cyt c and caspase-3. Because caspase-3 is the major executioner caspase downstream of caspase-9 in Drosophila, enzyme activity assays were used to determine the activities of caspase-3 and caspase-9. Our results indicated that fipronil effectively induced apoptosis in Drosophila S2 cells through caspase-dependent mitochondrial pathways. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Insulin and IGF-1 improve mitochondrial function in a PI-3K/Akt-dependent manner and reduce mitochondrial generation of reactive oxygen species in Huntington's disease knock-in striatal cells.

    Science.gov (United States)

    Ribeiro, Márcio; Rosenstock, Tatiana R; Oliveira, Ana M; Oliveira, Catarina R; Rego, A Cristina

    2014-09-01

    Oxidative stress and mitochondrial dysfunction have been described in Huntington's disease, a disorder caused by expression of mutant huntingtin (mHtt). IGF-1 was previously shown to protect HD cells, whereas insulin prevented neuronal oxidative stress. In this work we analyzed the role of insulin and IGF-1 in striatal cells derived from HD knock-in mice on mitochondrial production of reactive oxygen species (ROS) and related antioxidant and signaling pathways influencing mitochondrial function. Insulin and IGF-1 decreased mitochondrial ROS induced by mHtt and normalized mitochondrial SOD activity, without affecting intracellular glutathione levels. IGF-1 and insulin promoted Akt phosphorylation without changing the nuclear levels of phosphorylated Nrf2 or Nrf2/ARE activity. Insulin and IGF-1 treatment also decreased mitochondrial Drp1 phosphorylation, suggesting reduced mitochondrial fragmentation, and ameliorated mitochondrial function in HD cells in a PI-3K/Akt-dependent manner. This was accompanied by increased total and phosphorylated Akt, Tfam, and mitochondrial-encoded cytochrome c oxidase II, as well as Tom20 and Tom40 in mitochondria of insulin- and IGF-1-treated mutant striatal cells. Concomitantly, insulin/IGF-1-treated mutant cells showed reduced apoptotic features. Hence, insulin and IGF-1 improve mitochondrial function and reduce mitochondrial ROS caused by mHtt by activating the PI-3K/Akt signaling pathway, in a process independent of Nrf2 transcriptional activity, but involving enhanced mitochondrial levels of Akt and mitochondrial-encoded complex IV subunit. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen

    2016-05-01

    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  20. Mitochondrial p38β and manganese superoxide dismutase interaction mediated by estrogen in cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Han Liu

    Full Text Available While etiology behind the observed acceleration of ischemic heart disease in postmenopausal women is poorly understood, collective scientific data suggest cardioprotective effects of the endogenous female sex hormone, estrogen. We have previously shown that 17β-estradiol (E2 protects cardiomyocytes exposed to hypoxia-reoxygenation (H/R by inhibiting p38α - p53 signaling in apoptosis and activating pro-survival p38β mitogen activated protein kinase (p38β MAPK, leading to suppression of reactive oxygen species (ROS post H/R. However, little is known about the mechanism behind the antioxidant actions of E2-dependent p38β. The aim of this study is to determine whether the cytoprotection by estrogen involves regulation of manganese superoxide dismutase (MnSOD, a major mitochondrial ROS scavenging enzyme, via cardiac p38β.We identified mitochondrial p38β by immunocytochemistry and by immunoblotting in mitochondria isolated from neonatal cardiomyocytes of Sprague-Dawley rats. E2 facilitated the mitochondrial localization of the active form of the kinase, phosphorylated p38β (p-p38β. E2 also reduced the H/R-induced mitochondrial membrane potential decline, augmented the MnSOD activity and suppressed anion superoxide generation, while the dismutase protein expression remained unaltered. Co-immunoprecipitation studies showed physical association between MnSOD and p38β. p38β phosphorylated MnSOD in an E2-dependent manner in in-vitro kinase assays.This work demonstrates for the first time a mitochondrial pool of active p38β and E2-mediated phosphorylation of MnSOD by the kinase. The results shed light on the mechanism behind the cytoprotective actions of E2 in cardiomyocytes under oxidative stress.

  1. Voltage-gated proton channel is expressed on phagosomes

    International Nuclear Information System (INIS)

    Okochi, Yoshifumi; Sasaki, Mari; Iwasaki, Hirohide; Okamura, Yasushi

    2009-01-01

    Voltage-gated proton channel has been suggested to help NADPH oxidase activity during respiratory burst of phagocytes through its activities of compensating charge imbalance and regulation of pH. In phagocytes, robust production of reactive oxygen species occurs in closed membrane compartments, which are called phagosomes. However, direct evidence for the presence of voltage-gated proton channels in phagosome has been lacking. In this study, the expression of voltage-gated proton channels was studied by Western blot with the antibody specific to the voltage-sensor domain protein, VSOP/Hv1, that has recently been identified as the molecular correlate for the voltage-gated proton channel. Phagosomal membranes of neutrophils contain VSOP/Hv1 in accordance with subunits of NADPH oxidases, gp91, p22, p47 and p67. Superoxide anion production upon PMA activation was significantly reduced in neutrophils from VSOP/Hv1 knockout mice. These are consistent with the idea that voltage-gated proton channels help NADPH oxidase in phagocytes to produce reactive oxygen species.

  2. Indirect photometric detection of boron cluster anions electrophoretically separated in methanol.

    Science.gov (United States)

    Vítová, Lada; Fojt, Lukáš; Vespalec, Radim

    2014-04-18

    3,5-Dinitrobenzoate and picrate are light absorbing anions pertinent to indirect photometric detection of boron cluster anions in buffered methanolic background electrolytes (BGEs). Tris(hydroxymethyl)aminomethane and morpholine have been used as buffering bases, which eliminated baseline steps, and minimized the baseline noise. In methanolic BGEs, mobilities of boron cluster anions depend on both ionic constituents of the BGE buffer. This dependence can be explained by ion pair interaction of detected anions with BGE cations, which are not bonded into ion pairs with the BGE anions. The former ion pair interaction decreases sensitivity of the indirect photometric detection. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Field and polarity dependence of time-to-resistance increase in Fe-O films studied by constant voltage stress method

    International Nuclear Information System (INIS)

    Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms

  4. Infertility and recurrent miscarriage with complex II deficiency-dependent mitochondrial oxidative stress in animal models.

    Science.gov (United States)

    Ishii, Takamasa; Yasuda, Kayo; Miyazawa, Masaki; Mitsushita, Junji; Johnson, Thomas E; Hartman, Phil S; Ishii, Naoaki

    2016-04-01

    Oxidative stress is associated with some forms of both male and female infertility. However, there is insufficient knowledge of the influence of oxidative stress on the maintenance of a viable pregnancy, including pregnancy complications and fetal development. There are a number of animal models for understanding age-dependent decrease of reproductive ability and diabetic embryopathy, especially abnormal spermatogenesis, oogenesis and embryogenesis with mitochondrial dysfunctions. Several important processes occur in mitochondria, including ATP synthesis, calcium ion storage, induction of apoptosis and production of reactive oxygen species (ROS). These events have different effects on the several aspects of reproductive function. Tet-mev-1 conditional transgenic mice, developed after studies with the mev-1 mutant of the nematode C. elegans, offer the ability to carefully regulate expression of doxycycline-induced mutated SDHC(V69E) levels and hence modulate endogenous oxidative stress. The mev-1 models have served to illuminate the effects of complex II deficiency-dependent mitochondrial ROS production, although interestingly they maintain normal mitochondrial and intracellular ATP levels. In this review, the reproductive dysfunctions are presented focusing on fertility potentials in each gamete, early embryogenesis, maternal conditions with placental function and neonatal development. Copyright © 2016. Published by Elsevier Ireland Ltd.

  5. Probes of the Mitochondrial cAMP-dependent Protein Kinase

    Science.gov (United States)

    Shell, Jennifer R.; Lawrence, David S.

    2013-01-01

    The development of a fluorescent assay to detect activity of the mitochondrial cAMP-dependent protein kinase (PKA) is described. A peptide-based sensor was utilized to quantify the relative amount of PKA activity present in each compartment of the mitochondria (the outer membrane, the intermembrane space, and the matrix). In the process of validating this assay, we discovered that PKA activity is regulated by the protease calpain. Upon exposure of bovine heart mitochondria to digitonin, Ca2+, and a variety of electron transport chain inhibitors, the regulatory subunits of the PKA holoenzyme (R2C2) are digested, releasing active catalytic subunits. This proteolysis is attenuated by calpain inhibitor I (ALLN). PMID:23410952

  6. Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

    Directory of Open Access Journals (Sweden)

    Wei Xia

    2015-01-01

    Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

  7. Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Wan, Chunhua [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China); Ma, Xa; Shi, Shangshi [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Zhao, Jianya; Nie, Xiaoke [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Han, Jingling; Xiao, Jing; Wang, Xiaoke [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiang, Shengyang [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China); Jiang, Junkang, E-mail: Jiang_junkang@163.com [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China)

    2014-12-15

    Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is

  8. Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis

    International Nuclear Information System (INIS)

    Wan, Chunhua; Ma, Xa; Shi, Shangshi; Zhao, Jianya; Nie, Xiaoke; Han, Jingling; Xiao, Jing; Wang, Xiaoke; Jiang, Shengyang; Jiang, Junkang

    2014-01-01

    Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H 2 O 2 production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is robustly

  9. NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

    Science.gov (United States)

    Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

    2018-01-01

    Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

    Science.gov (United States)

    Vaccaro, S. R.

    2011-09-01

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  11. Adenosine 3',5'-cyclic monophosphate (cAMP)-dependent phosphoregulation of mitochondrial complex I is inhibited by nucleoside reverse transcriptase inhibitors

    International Nuclear Information System (INIS)

    Lund, Kaleb C.; Wallace, Kendall B.

    2008-01-01

    Nucleoside analog reverse transcriptase inhibitors (NRTIs) are known to directly inhibit mitochondrial complex I activity as well as various mitochondrial kinases. Recent observations that complex I activity and superoxide production are modulated through cAMP-dependent phosphorylation suggests a mechanism through which NRTIs may affect mitochondrial respiration via kinase-dependent protein phosphorylation. In the current study, we examine the potential for NRTIs to inhibit the cAMP-dependent phosphorylation of complex I and the associated NADH:CoQ oxidoreductase activities and rates of superoxide production using HepG2 cells. Phosphoprotein staining of immunocaptured complex I revealed that 3'-azido-3'-deoxythymidine (AZT; 10 and 50 μM), AZT monophosphate (150 μM), and 2',3'-dideoxycytidine (ddC; 1 μM) prevented the phosphorylation of the NDUFB11 subunit of complex I. This was associated with a decrease in complex I activity with AZT and AZT monophosphate only. In the presence of succinate, superoxide production was increased with 2',3'-dideoxyinosine (ddI; 10 μM) and ddC (1 μM). In the presence of succinate + cAMP, AZT showed an inverse dose-dependent effect on superoxide production. None of the NRTIs examined inhibit PKA activity suggesting that the observed effects are due to a direct interaction with complex I. These data demonstrate a direct effect of NRTIs on cAMP-dependent regulation of mitochondrial bioenergetics independent of DNA polymerase-γ activity; in the case of AZT, these observations may provide a mechanism for the observed long-term toxicity with this drug

  12. Interaction and dynamics of (alkylamide + electrolyte) deep eutectics: Dependence on alkyl chain-length, temperature, and anion identity

    International Nuclear Information System (INIS)

    Guchhait, Biswajit; Das, Suman; Daschakraborty, Snehasis; Biswas, Ranjit

    2014-01-01

    Here we investigate the solute-medium interaction and solute-centered dynamics in (RCONH 2 + LiX) deep eutectics (DEs) via carrying out time-resolved fluorescence measurements and all-atom molecular dynamics simulations at various temperatures. Alkylamides (RCONH 2 ) considered are acetamide (CH 3 CONH 2 ), propionamide (CH 3 CH 2 CONH 2 ), and butyramide (CH 3 CH 2 CH 2 CONH 2 ); the electrolytes (LiX) are lithium perchlorate (LiClO 4 ), lithium bromide (LiBr), and lithium nitrate (LiNO 3 ). Differential scanning calorimetric measurements reveal glass transition temperatures (T g ) of these DEs are ∼195 K and show a very weak dependence on alkyl chain-length and electrolyte identity. Time-resolved and steady state fluorescence measurements with these DEs have been carried out at six-to-nine different temperatures that are ∼100–150 K above their individual T g s. Four different solute probes providing a good spread of fluorescence lifetimes have been employed in steady state measurements, revealing strong excitation wavelength dependence of probe fluorescence emission peak frequencies. Extent of this dependence, which shows sensitivity to anion identity, has been found to increase with increase of amide chain-length and decrease of probe lifetime. Time-resolved measurements reveal strong fractional power dependence of average rates for solute solvation and rotation with fraction power being relatively smaller (stronger viscosity decoupling) for DEs containing longer amide and larger (weaker decoupling) for DEs containing perchlorate anion. Representative all-atom molecular dynamics simulations of (CH 3 CONH 2 + LiX) DEs at different temperatures reveal strongly stretched exponential relaxation of wavevector dependent acetamide self dynamic structure factor with time constants dependent both on ion identity and temperature, providing justification for explaining the fluorescence results in terms of temporal heterogeneity and amide clustering in these multi

  13. Inorganic polyphosphate (polyP) as an activator and structural component of the mitochondrial permeability transition pore.

    Science.gov (United States)

    Solesio, Maria E; Elustondo, Pia A; Zakharian, Eleonora; Pavlov, Evgeny V

    2016-02-01

    Mitochondrial permeability transition pore (mPTP) is a large channel located in the mitochondrial inner membrane. The opening of mPTP during pathological calcium overload leads to the membrane depolarization and disruption of ATP production. mPTP activation has been implicated as a central event during the process of stress-induced cell death. mPTP is a supramolecular complex composed of many proteins. Recent studies suggest that mitochondrial ATPase plays the central role in the formation of mPTP. However, the structure of the central conducting pore part of mPTP (mPTPore) remains elusive. Here we review current models proposed for the mPTPore and involvement of polyP in its formation and regulation. We discuss the underestimated role of polyP as an effector and a putative structural component of the mPTPore. We propose the hypothesis that inclusion of polyP can explain such properties of mPTP activity as calcium activation, selectivity and voltage-dependence. © 2016 Authors; published by Portland Press Limited.

  14. Mitochondrial PKA mediates sperm motility.

    Science.gov (United States)

    Mizrahi, Rashel; Breitbart, Haim

    2014-12-01

    Mitochondria are the major source of ATP to power sperm motility. Phosphorylation of mitochondrial proteins has been proposed as a major regulatory mechanism for mitochondrial bioenergetics. Sperm motility was measured by a computer-assisted analyzer, protein detection by western blotting, membrane potential by tetramethylrhodamine, cellular ATP by luciferase assay and localization of PKA by immuno-electron microscopy. Bicarbonate is essential for the creation of mitochondrial electro-chemical gradient, ATP synthesis and sperm motility. Bicarbonate stimulates PKA-dependent phosphorylation of two 60kDa proteins identified as Tektin and glucose-6-phosphate isomerase. This phosphorylation was inhibited by respiration inhibition and phosphorylation could be restored by glucose in the presence of bicarbonate. However, this effect of glucose cannot be seen when the mitochondrial ATP/ADP exchanger was inhibited indicating that glycolytic-produced ATP is transported into the mitochondria and allows PKA-dependent protein phosphorylation inside the mitochondria. Bicarbonate activates mitochondrial soluble adenylyl cyclase (sAC) which catalyzes cAMP production leading to the activation of mitochondrial PKA. Glucose can overcome the lack of ATP in the absence of bicarbonate but it cannot affect the mitochondrial sAC/PKA system, therefore the PKA-dependent phosphorylation of the 60kDa proteins does not occur in the absence of bicarbonate. Production of CO2 in Krebs cycle, which is converted to bicarbonate is essential for sAC/PKA activation leading to mitochondrial membrane potential creation and ATP synthesis. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Ofloxacin induces apoptosis in microencapsulated juvenile rabbit chondrocytes by caspase-8-dependent mitochondrial pathway

    International Nuclear Information System (INIS)

    Sheng Zhiguo; Cao Xiaojuan; Peng Shuangqing; Wang Changyong; Li Qianqian; Wang Yimei; Liu Mifeng

    2008-01-01

    Quinolones (QNs)-induced arthropathy is an important toxic effect in immature animals leading to restriction of their therapeutic use in pediatrics. However, the exact mechanism still remains unclear. Recently, we have demonstrated that ofloxacin, a typical QN, induces apoptosis of alginate microencapsulated juvenile rabbit joint chondrocytes by disturbing the β 1 integrin functions and inactivating the ERK/MAPK signaling pathway. In this study, we extend our initial observations to further elucidate the mechanism(s) of ofloxacin-induced apoptosis by utilizing specific caspase inhibitors. Pretreatment with both caspase-9-specific inhibitor zLEHD-fmk and caspase-8 inhibitor zIETD-fmk attenuated ofloxacin-induced apoptosis and activation of caspase-3 of chondrocyte in a concentration-dependent manner, as determined by fluorescent dye staining, enzyme activity assay and immunoblotting. Furthermore, the activation of caspase-9, -8 and -3 stimulated by ofloxacin was significantly inhibited in the presence of zIETD-fmk while pretreatment with zLEHD-fmk only blocked the activation of caspase-9 and -3. Ofloxacin also stimulated a concentration-dependent translocation of cytochrome c from mitochondria into the cytosol and a decrease of mitochondrial transmembrane potential, which was completely inhibited by zIETD-fmk. In addition, ofloxacin was found to increase the level of Bax, tBid, p53 in a concentration- and time-dependent manner. Taken together, The current results indicate that the caspase-8-dependent mitochondrial pathway is primarily involved in the ofloxacin-induced apoptosis of microencapsulated juvenile rabbit joint chondrocytes

  16. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Science.gov (United States)

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  17. Activation of mPTP-dependent mitochondrial apoptosis pathway by a novel pan HDAC inhibitor resminostat in hepatocellular carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Meili [Department of Infectious Disease, Linyi People’s Hospital, Linyi (China); Shi, Wenhong [Department of Radiotherapy, Linyi Tumor Hospital, Linyi (China); Li, Zhengling [Department of Nursing, Tengzhou Central People’s Hospital, Tengzhou (China); Liu, Haiyan, E-mail: liuhaiyanlinyi5@sina.com [Department of Nursing, Linyi People’s Hospital, No. 27 Jiefang Road, Linyi 276000, Shandong (China)

    2016-09-02

    Over-expression and aberrant activation of histone deacetylases (HDACs) are often associated with poor prognosis of hepatocellular carcinoma (HCC). Here, we evaluated the potential anti-hepatocellular carcinoma (HCC) cell activity by resminostat, a novel pan HDAC inhibitor (HDACi). We demonstrated that resminostat induced potent cytotoxic and anti-proliferative activity against established HCC cell lines (HepG2, HepB3, SMMC-7721) and patient-derived primary HCC cells. Further, resminostat treatment in HCC cells activated mitochondrial permeability transition pore (mPTP)-dependent apoptosis pathway, which was evidenced by physical association of cyclophilin-D and adenine nucleotide translocator 1 (ANT-1), mitochondrial depolarization, cytochrome C release and caspase-9 activation. Intriguingly, the mPTP blockers (sanglifehrin A and cyclosporine A), shRNA knockdown of cyclophilin-D or the caspase-9 inhibitor dramatically attenuated resminostat-induced HCC cell apoptosis and cytotoxicity. Reversely, HCC cells with exogenous cyclophilin-D over-expression were hyper-sensitive to resminostat. Intriguingly, a low concentration of resminostat remarkably potentiated sorafenib-induced mitochondrial apoptosis pathway activation, leading to a profound cytotoxicity in HCC cells. The results of this preclinical study indicate that resminostat (or plus sorafenib) could be further investigated as a valuable anti-HCC strategy. - Highlights: • Resminostat inhibits human HCC cell survival and proliferation. • Resminostat activates mPTP-dependent mitochondrial apoptosis pathway in HCC cells. • Resminostat potentiates sorafenib-induced mitochondrial apoptosis pathway activation. • mPTP or caspase-9 inhibition attenuates apoptosis by resminostat or plus sorafenib.

  18. Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

    Science.gov (United States)

    Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

    2015-03-01

    Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

  19. Semi-empirical model for the threshold voltage of a double implanted MOSFET and its temperature dependence

    Energy Technology Data Exchange (ETDEWEB)

    Arora, N D

    1987-05-01

    A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.

  20. Synthetic cation-selective nanotube: permeant cations chaperoned by anions.

    Science.gov (United States)

    Hilder, Tamsyn A; Gordon, Dan; Chung, Shin-Ho

    2011-01-28

    The ability to design ion-selective, synthetic nanotubes which mimic biological ion channels may have significant implications for the future treatment of bacteria, diseases, and as ultrasensitive biosensors. We present the design of a synthetic nanotube made from carbon atoms that selectively allows monovalent cations to move across and rejects all anions. The cation-selective nanotube mimics some of the salient properties of biological ion channels. Before practical nanodevices are successfully fabricated it is vital that proof-of-concept computational studies are performed. With this in mind we use molecular and stochastic dynamics simulations to characterize the dynamics of ion permeation across a single-walled (10, 10), 36 Å long, carbon nanotube terminated with carboxylic acid with an effective radius of 5.08 Å. Although cations encounter a high energy barrier of 7 kT, its height is drastically reduced by a chloride ion in the nanotube. The presence of a chloride ion near the pore entrance thus enables a cation to enter the pore and, once in the pore, it is chaperoned by the resident counterion across the narrow pore. The moment the chaperoned cation transits the pore, the counterion moves back to the entrance to ferry another ion. The synthetic nanotube has a high sodium conductance of 124 pS and shows linear current-voltage and current-concentration profiles. The cation-anion selectivity ratio ranges from 8 to 25, depending on the ionic concentrations in the reservoirs.

  1. Film size-dependent voltage-modulated magnetism in multiferroic heterostructures

    Science.gov (United States)

    Hu, J.-M.; Shu, L.; Li, Z.; Gao, Y.; Shen, Y.; Lin, Y. H.; Chen, L. Q.; Nan, C. W.

    2014-01-01

    The electric-voltage-modulated magnetism in multiferroic heterostructures, also known as the converse magnetoelectric (ME) coupling, has drawn increasing research interest recently owing to its great potential applications in future low-power, high-speed electronic and/or spintronic devices, such as magnetic memory and computer logic. In this article, based on combined theoretical analysis and experimental demonstration, we investigate the film size dependence of such converse ME coupling in multiferroic magnetic/ferroelectric heterostructures, as well as exploring the interaction between two relating coupling mechanisms that are the interfacial strain and possibly the charge effects. We also briefly discuss some issues for the next step and describe new device prototypes that can be enabled by this technology. PMID:24421375

  2. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  3. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  4. Interstellar dehydrogenated PAH anions: vibrational spectra

    Science.gov (United States)

    Buragohain, Mridusmita; Pathak, Amit; Sarre, Peter; Gour, Nand Kishor

    2018-03-01

    Interstellar polycyclic aromatic hydrocarbon (PAH) molecules exist in diverse forms depending on the local physical environment. Formation of ionized PAHs (anions and cations) is favourable in the extreme conditions of the interstellar medium (ISM). Besides in their pure form, PAHs are also likely to exist in substituted forms; for example, PAHs with functional groups, dehydrogenated PAHs etc. A dehydrogenated PAH molecule might subsequently form fullerenes in the ISM as a result of ongoing chemical processes. This work presents a density functional theory (DFT) calculation on dehydrogenated PAH anions to explore the infrared emission spectra of these molecules and discuss any possible contribution towards observed IR features in the ISM. The results suggest that dehydrogenated PAH anions might be significantly contributing to the 3.3 μm region. Spectroscopic features unique to dehydrogenated PAH anions are highlighted that may be used for their possible identification in the ISM. A comparison has also been made to see the size effect on spectra of these PAHs.

  5. Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

    DEFF Research Database (Denmark)

    Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

    2016-01-01

    This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

  6. Mitochondrial shaping cuts.

    Science.gov (United States)

    Escobar-Henriques, Mafalda; Langer, Thomas

    2006-01-01

    A broad range of cellular processes are regulated by proteolytic events. Proteolysis has now also been established to control mitochondrial morphology which results from the balanced action of fusion and fission. Two out of three known core components of the mitochondrial fusion machinery are under proteolytic control. The GTPase Fzo1 in the outer membrane of mitochondria is degraded along two independent proteolytic pathways. One controls mitochondrial fusion in vegetatively growing cells, the other one acts upon mating factor-induced cell cycle arrest. Fusion also depends on proteolytic processing of the GTPase Mgm1 by the rhomboid protease Pcp1 in the inner membrane of mitochondria. Functional links of AAA proteases or other proteolytic components to mitochondrial dynamics are just emerging. This review summarises the current understanding of regulatory roles of proteolytic processes for mitochondrial plasticity.

  7. Interaction and dynamics of (alkylamide + electrolyte) deep eutectics: Dependence on alkyl chain-length, temperature, and anion identity

    Energy Technology Data Exchange (ETDEWEB)

    Guchhait, Biswajit; Das, Suman; Daschakraborty, Snehasis; Biswas, Ranjit, E-mail: ranjit@bose.res.in [Department of Chemical, Biological and Macromolecular Sciences, S. N. Bose National Centre for Basic Sciences, Block-JD, Sector-III, Salt Lake, Kolkata 700098 (India)

    2014-03-14

    Here we investigate the solute-medium interaction and solute-centered dynamics in (RCONH{sub 2} + LiX) deep eutectics (DEs) via carrying out time-resolved fluorescence measurements and all-atom molecular dynamics simulations at various temperatures. Alkylamides (RCONH{sub 2}) considered are acetamide (CH{sub 3}CONH{sub 2}), propionamide (CH{sub 3}CH{sub 2}CONH{sub 2}), and butyramide (CH{sub 3}CH{sub 2}CH{sub 2}CONH{sub 2}); the electrolytes (LiX) are lithium perchlorate (LiClO{sub 4}), lithium bromide (LiBr), and lithium nitrate (LiNO{sub 3}). Differential scanning calorimetric measurements reveal glass transition temperatures (T{sub g}) of these DEs are ∼195 K and show a very weak dependence on alkyl chain-length and electrolyte identity. Time-resolved and steady state fluorescence measurements with these DEs have been carried out at six-to-nine different temperatures that are ∼100–150 K above their individual T{sub g}s. Four different solute probes providing a good spread of fluorescence lifetimes have been employed in steady state measurements, revealing strong excitation wavelength dependence of probe fluorescence emission peak frequencies. Extent of this dependence, which shows sensitivity to anion identity, has been found to increase with increase of amide chain-length and decrease of probe lifetime. Time-resolved measurements reveal strong fractional power dependence of average rates for solute solvation and rotation with fraction power being relatively smaller (stronger viscosity decoupling) for DEs containing longer amide and larger (weaker decoupling) for DEs containing perchlorate anion. Representative all-atom molecular dynamics simulations of (CH{sub 3}CONH{sub 2} + LiX) DEs at different temperatures reveal strongly stretched exponential relaxation of wavevector dependent acetamide self dynamic structure factor with time constants dependent both on ion identity and temperature, providing justification for explaining the fluorescence results in

  8. Structural damage to lymphocyte nuclei by H2O2 or gamma irradiation is dependent on the mechanism of OH anion radical production

    International Nuclear Information System (INIS)

    Allan, I.M.; Vaughan, A.T.M.; Milner, A.E.; Lunec, J.; Bacon, P.A.

    1988-01-01

    Normal human lymphocytes were exposed to OH anion radicals produced indirectly by exposure to H 2 O 2 or directly by gamma irradiation. Using a flow cytometry technique to measure changes in nucleoid size, it was found that generation of OH anion in each system produced a characteristic relaxation in nuclear supercoiling. Exposure of cells to H 2 O 2 produced a metal-dependent step-wise relaxation in extracted nucleoids, while gamma irradiation induced a gradual dose-dependent increase in nucleoid size. The site-specific metal-dependent changes produced in lymphocytes incubated in H 2 O 2 should also occur in gamma irradiated cells, but the characteristic effects on nuclear supercoiling would not be detected within the background of random DNA damage. The importance of metals in maintaining the supercoiled loop configuration of DNA within the protein matrix suggests that free radical damage at metal locations may be particularly toxic for the cell. (author)

  9. Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

    International Nuclear Information System (INIS)

    Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

    2008-01-01

    Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  10. Drp-1 dependent mitochondrial fragmentation and protective autophagy in dopaminergic SH-SY5Y cells overexpressing alpha-synuclein.

    Science.gov (United States)

    Martinez, Jimena Hebe; Alaimo, Agustina; Gorojod, Roxana Mayra; Porte Alcon, Soledad; Fuentes, Federico; Coluccio Leskow, Federico; Kotler, Mónica Lidia

    2018-04-01

    Parkinson's disease is a neurodegenerative movement disorder caused by the loss of dopaminergic neurons from substantia nigra. It is characterized by the accumulation of aggregated α-synuclein as the major component of the Lewy bodies. Additional common features of this disease are the mitochondrial dysfunction and the activation/inhibition of autophagy both events associated to the intracellular accumulation of α-synuclein. The mechanism by which these events contribute to neural degeneration remains unknown. In the present work we investigated the effect of α-synuclein on mitochondrial dynamics and autophagy/mitophagy in SH-SY5Y cells, an in vitro model of Parkinson disease. We demonstrated that overexpression of wild type α-synuclein causes moderated toxicity, ROS generation and mitochondrial dysfunction. In addition, α-synuclein induces the mitochondrial fragmentation on a Drp-1-dependent fashion. Overexpression of the fusion protein Opa-1 prevented both mitochondrial fragmentation and cytotoxicity. On the other hand, cells expressing α-synuclein showed activated autophagy and particularly mitophagy. Employing a genetic strategy we demonstrated that autophagy is triggered in order to protect cells from α-synuclein-induced cell death. Our results clarify the role of Opa-1 and Drp-1 in mitochondrial dynamics and cell survival, a controversial α-synuclein research issue. The findings presented point to the relevance of mitochondrial homeostasis and autophagy in the pathogenesis of PD. Better understanding of the molecular interaction between these processes could give rise to novel therapeutic methods for PD prevention and amelioration. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

    International Nuclear Information System (INIS)

    Miah, M. Idrish

    2008-01-01

    The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V AH ) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V AH on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V AH depends on the doping density. The results are discussed

  12. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

    2006-01-01

    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  13. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  14. ATG5 is essential for ATG8-dependent autophagy and mitochondrial homeostasis in Leishmania major.

    Directory of Open Access Journals (Sweden)

    Roderick A M Williams

    Full Text Available Macroautophagy has been shown to be important for the cellular remodelling required for Leishmania differentiation. We now demonstrate that L. major contains a functional ATG12-ATG5 conjugation system, which is required for ATG8-dependent autophagosome formation. Nascent autophagosomes were found commonly associated with the mitochondrion. L. major mutants lacking ATG5 (Δatg5 were viable as promastigotes but were unable to form autophagosomes, had morphological abnormalities including a much reduced flagellum, were less able to differentiate and had greatly reduced virulence to macrophages and mice. Analyses of the lipid metabolome of Δatg5 revealed marked elevation of phosphatidylethanolamines (PE in comparison to wild type parasites. The Δatg5 mutants also had increased mitochondrial mass but reduced mitochondrial membrane potential and higher levels of reactive oxygen species. These findings indicate that the lack of ATG5 and autophagy leads to perturbation of the phospholipid balance in the mitochondrion, possibly through ablation of membrane use and conjugation of mitochondrial PE to ATG8 for autophagosome biogenesis, resulting in a dysfunctional mitochondrion with impaired oxidative ability and energy generation. The overall result of this is reduced virulence.

  15. Molecular mechanism of voltage sensing in voltage-gated proton channels

    Science.gov (United States)

    Rebolledo, Santiago; Perez, Marta E.

    2013-01-01

    Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

  16. Important mitochondrial proteins in human omental adipose tissue show reduced expression in obesity.

    Science.gov (United States)

    Lindinger, Peter W; Christe, Martine; Eberle, Alex N; Kern, Beatrice; Peterli, Ralph; Peters, Thomas; Jayawardene, Kamburapola J I; Fearnley, Ian M; Walker, John E

    2015-09-01

    Obesity is associated with impaired mitochondrial function. This study compares mitochondrial protein expression in omental fat in obese and non-obese humans. Omental adipose tissue was obtained by surgical biopsy, adipocytes were purified and mitochondria isolated. Using anion-exchange chromatography, SDS-PAGE and mass-spectrometry, 128 proteins with potentially different abundances in patient groups were identified, 62 of the 128 proteins are mainly localized in the mitochondria. Further quantification of 12 of these 62 proteins by immune dot blot analysis revealed four proteins citrate synthase, HADHA, LETM1 and mitofilin being inversely associated with BMI, and mitofilin being inversely correlated with gender.

  17. Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

    Energy Technology Data Exchange (ETDEWEB)

    Miah, M. Idrish [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)], E-mail: m.miah@griffith.edu.au

    2008-10-15

    The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V{sub AH}) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V{sub AH} on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V{sub AH} depends on the doping density. The results are discussed.

  18. Anion effect on the retention of recoil atom of coordination crystalline compounds

    International Nuclear Information System (INIS)

    Dimotakis, P.N.; Papadopoulos, B.P.

    1980-01-01

    The anion effect of various cobaltic crystalline compounds - having the same cation and differing in anion -on the retention of neutron activated central cobalt atom has been studied. The cation was trans-dichloro(bis)ethylenediamine cobalt(III) and the anions were simple spherical anions (Cl - , Br - , I - ), planar anions (NO 3 - ), trigonal pyramidal anions (ClO 3 - , BrO 3 - ), tetrahedral anions (SO 4 2- , CrO 4 2- , MnO 4 - ) and linear anions (SCN - ). The cobalt-60 activity after reactor irradiation either in simple Co 2+ cation or in cobaltic complex cation determined the retention values. In all irradiations at ordinary temperature and at liquid nitrogen temperature the results showed an effect of the different anions, depending on the geometry, volume and charge, on the recombination of the recoil cobalt with the ligands in the coordination sphere. (author)

  19. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

    Science.gov (United States)

    Shirokov, Roman E.

    2018-01-01

    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  20. Formation and Regulation of Mitochondrial Membranes

    Directory of Open Access Journals (Sweden)

    Laila Cigana Schenkel

    2014-01-01

    Full Text Available Mitochondrial membrane phospholipids are essential for the mitochondrial architecture, the activity of respiratory proteins, and the transport of proteins into the mitochondria. The accumulation of phospholipids within mitochondria depends on a coordinate synthesis, degradation, and trafficking of phospholipids between the endoplasmic reticulum (ER and mitochondria as well as intramitochondrial lipid trafficking. Several studies highlight the contribution of dietary fatty acids to the remodeling of phospholipids and mitochondrial membrane homeostasis. Understanding the role of phospholipids in the mitochondrial membrane and their metabolism will shed light on the molecular mechanisms involved in the regulation of mitochondrial function and in the mitochondrial-related diseases.

  1. Design of Anion Exchange Membranes and Electrodialysis Studies for Water Desalination

    Directory of Open Access Journals (Sweden)

    Muhammad Imran Khan

    2016-05-01

    Full Text Available Anion exchange membranes are highly versatile and nowadays have many applications, ranging from water treatment to sensing materials. The preparation of anion exchange membranes (AEMs from brominated poly(2,6-dimethyl-1,6-phenylene oxide (BPPO and methyl(diphenylphosphine (MDPP for electrodialysis was performed. The physiochemical properties and electrochemical performance of fabricated membranes can be measured by changing MDPP contents in the membrane matrix. The influence of a quaternary phosphonium group associated with the removal of NaCl from water is discussed. The prepared membranes have ion exchange capacities (IEC 1.09–1.52 mmol/g, water uptake (WR 17.14%–21.77%, linear expansion ratio (LER 7.96%–11.86%, tensile strength (TS 16.66–23.97 MPa and elongation at break (Eb 485.57%–647.98%. The prepared anion exchange membranes were employed for the electrodialytic removal of 0.1 M NaCl aqueous solution at a constant applied voltage. It is found that the reported membranes could be the promising candidate for NaCl removal via electrodialysis.

  2. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

    Science.gov (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A

    1999-07-01

    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  3. Silencing of mitochondrial NADP+-dependent isocitrate dehydrogenase gene enhances glioma radiosensitivity

    International Nuclear Information System (INIS)

    Kim, Sung Youl; Yoo, Young Hyun; Park, Jeen-Woo

    2013-01-01

    Highlights: •Silencing of the IDPm gene enhances IR-induced autophagy in glioma cells. •Autophagy inhibition augmented apoptosis of irradiated glioma cells. •Results offer a redox-active therapeutic strategy for the treatment of cancer. -- Abstract: Reactive oxygen species (ROS) levels are elevated in organisms that have been exposed to ionizing radiation and are protagonists in the induction of cell death. Recently, we demonstrated that the control of mitochondrial redox balance and the cellular defense against oxidative damage are primary functions of mitochondrial NADP + -dependent isocitrate dehydrogenase (IDPm) via the supply of NADPH for antioxidant systems. In the present study, we report an autophagic response to ionizing radiation in A172 glioma cells transfected with small interfering RNA (siRNA) targeting the IDPm gene. Autophagy in A172 transfectant cells was associated with enhanced autophagolysosome formation and GFP–LC3 punctuation/aggregation. Furthermore, we found that the inhibition of autophagy by chloroquine augmented apoptotic cell death of irradiated A172 cells transfected with IDPm siRNA. Taken together, our data suggest that autophagy functions as a survival mechanism in A172 cells against ionizing radiation-induced apoptosis and the sensitizing effect of IDPm siRNA and autophagy inhibitor on the ionizing radiation-induced apoptotic cell death of glioma cells offers a novel redox-active therapeutic strategy for the treatment of cancer

  4. Activation-dependent mitochondrial translocation of Foxp3 in human hepatocytes

    International Nuclear Information System (INIS)

    Rojas, Joselyn; Teran-Angel, Guillermo; Barbosa, Luisa; Peterson, Darrell L.; Berrueta, Lisbeth; Salmen, Siham

    2016-01-01

    Foxp3 is considered to be the master regulator for the development and function of regulatory T cells (Treg). Recently Foxp3, has been detected in extra lymphoid tissue, and in hepatocytes and has been associated with hepatocellular carcinoma (HCC), although its role has not been defined. Since it is expected that there is a relationship between protein localization, activity and cellular function, the aim of this study was to explore the subcellular localization of Foxp3 in resting and stimulated human hepatocytes. Foxp3 expression was measured by flow cytometry, subcellular fractioning, and immunofluorescence, and this data was used to track the shuttling of Foxp3 in different subcellular compartments in hepatocytes (HepG2 cell line), stimulated by using the PKC activators (PMA), core and preS1/2 antigen from hepatitis B virus (HBV). Our data shows that besides the nuclear location, mitochondrial translocation was detected after stimulation with PMA and at to a lesser extent, with preS1/2. In addition, Foxp3 is localizes at outer mitochondrial membrane. These results suggest a non-canonical role of Foxp3 in the mitochondrial compartment in human hepatocytes, and opens a new field about their role in liver damages during HBV infection. - Highlights: • The expression and subcellular distribution of Foxp3, is modulated by PMA and preS1/2. • PMA and preS1/2 increase Foxp3 expression on HepG2. • PMA and preS1/2 induce foxp3 enrichment at mitochondrial, microsomal and nuclear compartments. • Results suggest a non-canonical function of Foxp3 or a mitochondrial transcriptional activity.

  5. Activation-dependent mitochondrial translocation of Foxp3 in human hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Rojas, Joselyn; Teran-Angel, Guillermo; Barbosa, Luisa [Instituto de Inmunología Clínica, Facultad de Medicina, Universidad de Los Andes, Merida (Venezuela, Bolivarian Republic of); Peterson, Darrell L. [Department of Biochemistry and Molecular Biology, Virginia Commonwealth University, Richmond, VA (United States); Berrueta, Lisbeth, E-mail: lberruet@ula.ve [Instituto de Inmunología Clínica, Facultad de Medicina, Universidad de Los Andes, Merida (Venezuela, Bolivarian Republic of); Division of Preventive Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Salmen, Siham, E-mail: sihamsa@ula.ve [Instituto de Inmunología Clínica, Facultad de Medicina, Universidad de Los Andes, Merida (Venezuela, Bolivarian Republic of)

    2016-05-01

    Foxp3 is considered to be the master regulator for the development and function of regulatory T cells (Treg). Recently Foxp3, has been detected in extra lymphoid tissue, and in hepatocytes and has been associated with hepatocellular carcinoma (HCC), although its role has not been defined. Since it is expected that there is a relationship between protein localization, activity and cellular function, the aim of this study was to explore the subcellular localization of Foxp3 in resting and stimulated human hepatocytes. Foxp3 expression was measured by flow cytometry, subcellular fractioning, and immunofluorescence, and this data was used to track the shuttling of Foxp3 in different subcellular compartments in hepatocytes (HepG2 cell line), stimulated by using the PKC activators (PMA), core and preS1/2 antigen from hepatitis B virus (HBV). Our data shows that besides the nuclear location, mitochondrial translocation was detected after stimulation with PMA and at to a lesser extent, with preS1/2. In addition, Foxp3 is localizes at outer mitochondrial membrane. These results suggest a non-canonical role of Foxp3 in the mitochondrial compartment in human hepatocytes, and opens a new field about their role in liver damages during HBV infection. - Highlights: • The expression and subcellular distribution of Foxp3, is modulated by PMA and preS1/2. • PMA and preS1/2 increase Foxp3 expression on HepG2. • PMA and preS1/2 induce foxp3 enrichment at mitochondrial, microsomal and nuclear compartments. • Results suggest a non-canonical function of Foxp3 or a mitochondrial transcriptional activity.

  6. The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

    DEFF Research Database (Denmark)

    Bennekou, P.; Barksmann, T. L.; Christophersen, P.

    2006-01-01

    The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

  7. Gas-Grain Models for Interstellar Anion Chemistry

    Science.gov (United States)

    Cordiner, M. A.; Charnely, S. B.

    2012-01-01

    Long-chain hydrocarbon anions C(sub n) H(-) (n = 4, 6, 8) have recently been found to be abundant in a variety of interstellar clouds. In order to explain their large abundances in the denser (prestellar/protostellar) environments, new chemical models are constructed that include gas-grain interactions. Models including accretion of gas-phase species onto dust grains and cosmic-ray-induced desorption of atoms are able to reproduce the observed anion-to-neutral ratios, as well as the absolute abundances of anionic and neutral carbon chains, with a reasonable degree of accuracy. Due to their destructive effects, the depletion of oxygen atoms onto dust results in substantially greater polyyne and anion abundances in high-density gas (with n(sub H2) approx > / cubic cm). The large abundances of carbon-chain-bearing species observed in the envelopes of protostars such as L1527 can thus be explained without the need for warm carbon-chain chemistry. The C6H(-) anion-to-neutral ratio is found to be most sensitive to the atomic O and H abundances and the electron density. Therefore, as a core evolves, falling atomic abundances and rising electron densities are found to result in increasing anion-to-neutral ratios. Inclusion of cosmic-ray desorption of atoms in high-density models delays freeze-out, which results in a more temporally stable anion-to-neutral ratio, in better agreement with observations. Our models include reactions between oxygen atoms and carbon-chain anions to produce carbon-chain-oxide species C6O, C7O, HC6O, and HC7O, the abundances of which depend on the assumed branching ratios for associative electron detachment

  8. Analysis of regional brain mitochondrial bioenergetics and susceptibility to mitochondrial inhibition utilizing a microplate based system

    Science.gov (United States)

    Sauerbeck, Andrew; Pandya, Jignesh; Singh, Indrapal; Bittman, Kevin; Readnower, Ryan; Bing, Guoying; Sullivan, Patrick

    2012-01-01

    The analysis of mitochondrial bioenergetic function typically has required 50–100 μg of protein per sample and at least 15 min per run when utilizing a Clark-type oxygen electrode. In the present work we describe a method utilizing the Seahorse Biosciences XF24 Flux Analyzer for measuring mitochondrial oxygen consumption simultaneously from multiple samples and utilizing only 5 μg of protein per sample. Utilizing this method we have investigated whether regionally based differences exist in mitochondria isolated from the cortex, striatum, hippocampus, and cerebellum. Analysis of basal mitochondrial bioenergetics revealed that minimal differences exist between the cortex, striatum, and hippocampus. However, the cerebellum exhibited significantly slower basal rates of Complex I and Complex II dependent oxygen consumption (p < 0.05). Mitochondrial inhibitors affected enzyme activity proportionally across all samples tested and only small differences existed in the effect of inhibitors on oxygen consumption. Investigation of the effect of rotenone administration on Complex I dependent oxygen consumption revealed that exposure to 10 pM rotenone led to a clear time dependent decrease in oxygen consumption beginning 12 min after administration (p < 0.05). These studies show that the utilization of this microplate based method for analysis of mitochondrial bioenergetics is effective at quantifying oxygen consumption simultaneously from multiple samples. Additionally, these studies indicate that minimal regional differences exist in mitochondria isolated from the cortex, striatum, or hippocampus. Furthermore, utilization of the mitochondrial inhibitors suggests that previous work indicating regionally specific deficits following systemic mitochondrial toxin exposure may not be the result of differences in the individual mitochondria from the affected regions. PMID:21402103

  9. Mitochondrial NUDIX hydrolases: A metabolic link between NAD catabolism, GTP and mitochondrial dynamics.

    Science.gov (United States)

    Long, Aaron; Klimova, Nina; Kristian, Tibor

    2017-10-01

    NAD + catabolism and mitochondrial dynamics are important parts of normal mitochondrial function and are both reported to be disrupted in aging, neurodegenerative diseases, and acute brain injury. While both processes have been extensively studied there has been little reported on how the mechanisms of these two processes are linked. This review focuses on how downstream NAD + catabolism via NUDIX hydrolases affects mitochondrial dynamics under pathologic conditions. Additionally, several potential targets in mitochondrial dysfunction and fragmentation are discussed, including the roles of mitochondrial poly(ADP-ribose) polymerase 1(mtPARP1), AMPK, AMP, and intra-mitochondrial GTP metabolism. Mitochondrial and cytosolic NUDIX hydrolases (NUDT9α and NUDT9β) can affect mitochondrial and cellular AMP levels by hydrolyzing ADP- ribose (ADPr) and subsequently altering the levels of GTP and ATP. Poly (ADP-ribose) polymerase 1 (PARP1) is activated after DNA damage, which depletes NAD + pools and results in the PARylation of nuclear and mitochondrial proteins. In the mitochondria, ADP-ribosyl hydrolase-3 (ARH3) hydrolyzes PAR to ADPr, while NUDT9α metabolizes ADPr to AMP. Elevated AMP levels have been reported to reduce mitochondrial ATP production by inhibiting the adenine nucleotide translocase (ANT), allosterically activating AMPK by altering the cellular AMP: ATP ratio, and by depleting mitochondrial GTP pools by being phosphorylated by adenylate kinase 3 (AK3), which uses GTP as a phosphate donor. Recently, activated AMPK was reported to phosphorylate mitochondria fission factor (MFF), which increases Drp1 localization to the mitochondria and promotes mitochondrial fission. Moreover, the increased AK3 activity could deplete mitochondrial GTP pools and possibly inhibit normal activity of GTP-dependent fusion enzymes, thus altering mitochondrial dynamics. Published by Elsevier Ltd.

  10. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Science.gov (United States)

    Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

    2008-06-25

    Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  11. Aging-dependent changes in rat heart mitochondrial glutaredoxins—Implications for redox regulation

    Directory of Open Access Journals (Sweden)

    Xing-Huang Gao

    2013-01-01

    Full Text Available Clinical and animal studies have documented that hearts of the elderly are more susceptible to ischemia/reperfusion damage compared to young adults. Recently we found that aging-dependent increase in susceptibility of cardiomyocytes to apoptosis was attributable to decrease in cytosolic glutaredoxin 1 (Grx1 and concomitant decrease in NF-κB-mediated expression of anti-apoptotic proteins. Besides primary localization in the cytosol, Grx1 also exists in the mitochondrial intermembrane space (IMS. In contrast, Grx2 is confined to the mitochondrial matrix. Here we report that Grx1 is decreased by 50–60% in the IMS, but Grx2 is increased by 1.4–2.6 fold in the matrix of heart mitochondria from elderly rats. Determination of in situ activities of the Grx isozymes from both subsarcolemmal (SSM and interfibrillar (IFM mitochondria revealed that Grx1 was fully active in the IMS. However, Grx2 was mostly in an inactive form in the matrix, consistent with reversible sequestration of the active-site cysteines of two Grx2 molecules in complex with an iron–sulfur cluster. Our quantitative evaluations of the active/inactive ratio for Grx2 suggest that levels of dimeric Grx2 complex with iron–sulfur clusters are increased in SSM and IFM in the hearts of elderly rats. We found that the inactive Grx2 can be fully reactivated by sodium dithionite or exogenous superoxide production mediated by xanthine oxidase. However, treatment with rotenone, which generates intramitochondrial superoxide through inhibition of mitochondrial respiratory chain Complex I, did not lead to Grx2 activation. These findings suggest that insufficient ROS accumulates in the vicinity of dimeric Grx2 to activate it in situ.

  12. Important mitochondrial proteins in human omental adipose tissue show reduced expression in obesity

    Directory of Open Access Journals (Sweden)

    Peter W. Lindinger

    2015-09-01

    Full Text Available Obesity is associated with impaired mitochondrial function. This study compares mitochondrial protein expression in omental fat in obese and non-obese humans. Omental adipose tissue was obtained by surgical biopsy, adipocytes were purified and mitochondria isolated. Using anion-exchange chromatography, SDS-PAGE and mass-spectrometry, 128 proteins with potentially different abundances in patient groups were identified, 62 of the 128 proteins are mainly localized in the mitochondria. Further quantification of 12 of these 62 proteins by immune dot blot analysis revealed four proteins citrate synthase, HADHA, LETM1 and mitofilin being inversely associated with BMI, and mitofilin being inversely correlated with gender.

  13. Mitochondrial uncoupling proteins in unicellular eukaryotes.

    Science.gov (United States)

    Jarmuszkiewicz, Wieslawa; Woyda-Ploszczyca, Andrzej; Antos-Krzeminska, Nina; Sluse, Francis E

    2010-01-01

    Uncoupling proteins (UCPs) are members of the mitochondrial anion carrier protein family that are present in the mitochondrial inner membrane and mediate free fatty acid (FFA)-activated, purine nucleotide (PN)-inhibited proton conductance. Since 1999, the presence of UCPs has been demonstrated in some non-photosynthesising unicellular eukaryotes, including amoeboid and parasite protists, as well as in non-fermentative yeast and filamentous fungi. In the mitochondria of these organisms, UCP activity is revealed upon FFA-induced, PN-inhibited stimulation of resting respiration and a decrease in membrane potential, which are accompanied by a decrease in membranous ubiquinone (Q) reduction level. UCPs in unicellular eukaryotes are able to divert energy from oxidative phosphorylation and thus compete for a proton electrochemical gradient with ATP synthase. Our recent work indicates that membranous Q is a metabolic sensor that might utilise its redox state to release the PN inhibition of UCP-mediated mitochondrial uncoupling under conditions of phosphorylation and resting respiration. The action of reduced Q (QH2) could allow higher or complete activation of UCP. As this regulatory feature was demonstrated for microorganism UCPs (A. castellanii UCP), plant and mammalian UCP1 analogues, and UCP1 in brown adipose tissue, the process could involve all UCPs. Here, we discuss the functional connection and physiological role of UCP and alternative oxidase, two main energy-dissipating systems in the plant-type mitochondrial respiratory chain of unicellular eukaryotes, including the control of cellular energy balance as well as preventive action against the production of reactive oxygen species. Copyright © 2009 Elsevier B.V. All rights reserved.

  14. Power conditioning using dynamic voltage restorers under different voltage sag types.

    Science.gov (United States)

    Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

    2016-01-01

    Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

  15. Mitochondrial isocitrate dehydrogenase is inactivated upon oxidation and reactivated by thioredoxin-dependent reduction in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Keisuke eYoshida

    2014-09-01

    Full Text Available Regulation of mitochondrial metabolism is essential for ensuring cellular growth and maintenance in plants. Based on redox-proteomics analysis, several proteins involved in diverse mitochondrial reactions have been identified as potential redox-regulated proteins. NAD+-dependent isocitrate dehydrogenase (IDH, a key enzyme in the tricarboxylic acid cycle, is one such candidate. In this study, we investigated the redox regulation mechanisms of IDH by biochemical procedures. In contrast to mammalian and yeast counterparts reported to date, recombinant IDH in Arabidopsis mitochondria did not show adenylate-dependent changes in enzymatic activity. Instead, IDH was inactivated by oxidation treatment and partially reactivated by subsequent reduction. Functional IDH forms a heterodimer comprising regulatory (IDH-r and catalytic (IDH-c subunits. IDH-r was determined to be the target of oxidative modifications forming an oligomer via intermolecular disulfide bonds. Mass spectrometric analysis combined with tryptic digestion of IDH-r indicated that Cys128 and Cys216 are involved in intermolecular disulfide bond formation. Furthermore, we showed that mitochondria-localized o-type thioredoxin (Trx-o promotes the reduction of oxidized IDH-r. These results suggest that IDH-r is susceptible to oxidative stress, and Trx-o serves to convert oxidized IDH-r to the reduced form that is necessary for active IDH complex.

  16. Anion exchange membrane

    Science.gov (United States)

    Verkade, John G; Wadhwa, Kuldeep; Kong, Xueqian; Schmidt-Rohr, Klaus

    2013-05-07

    An anion exchange membrane and fuel cell incorporating the anion exchange membrane are detailed in which proazaphosphatrane and azaphosphatrane cations are covalently bonded to a sulfonated fluoropolymer support along with anionic counterions. A positive charge is dispersed in the aforementioned cations which are buried in the support to reduce the cation-anion interactions and increase the mobility of hydroxide ions, for example, across the membrane. The anion exchange membrane has the ability to operate at high temperatures and in highly alkaline environments with high conductivity and low resistance.

  17. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Directory of Open Access Journals (Sweden)

    Alicia Lundby

    2008-06-01

    Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  18. Mitochondrial DNA triplication and punctual mutations in patients with mitochondrial neuromuscular disorders

    Energy Technology Data Exchange (ETDEWEB)

    Mkaouar-Rebai, Emna, E-mail: emna.mkaouar@gmail.com [Département des Sciences de la Vie, Faculté des Sciences de Sfax, Université de Sfax (Tunisia); Felhi, Rahma; Tabebi, Mouna [Laboratoire de Génétique Moléculaire Humaine, Faculté de Médecine de Sfax, Université de Sfax (Tunisia); Alila-Fersi, Olfa; Chamkha, Imen [Département des Sciences de la Vie, Faculté des Sciences de Sfax, Université de Sfax (Tunisia); Maalej, Marwa; Ammar, Marwa [Laboratoire de Génétique Moléculaire Humaine, Faculté de Médecine de Sfax, Université de Sfax (Tunisia); Kammoun, Fatma [Service de pédiatrie, C.H.U. Hedi Chaker de Sfax (Tunisia); Keskes, Leila [Laboratoire de Génétique Moléculaire Humaine, Faculté de Médecine de Sfax, Université de Sfax (Tunisia); Hachicha, Mongia [Service de pédiatrie, C.H.U. Hedi Chaker de Sfax (Tunisia); Fakhfakh, Faiza, E-mail: faiza.fakhfakh02@gmail.com [Département des Sciences de la Vie, Faculté des Sciences de Sfax, Université de Sfax (Tunisia)

    2016-04-29

    Mitochondrial diseases are a heterogeneous group of disorders caused by the impairment of the mitochondrial oxidative phosphorylation system which have been associated with various mutations of the mitochondrial DNA (mtDNA) and nuclear gene mutations. The clinical phenotypes are very diverse and the spectrum is still expanding. As brain and muscle are highly dependent on OXPHOS, consequently, neurological disorders and myopathy are common features of mtDNA mutations. Mutations in mtDNA can be classified into three categories: large-scale rearrangements, point mutations in tRNA or rRNA genes and point mutations in protein coding genes. In the present report, we screened mitochondrial genes of complex I, III, IV and V in 2 patients with mitochondrial neuromuscular disorders. The results showed the presence the pathogenic heteroplasmic m.9157G>A variation (A211T) in the MT-ATP6 gene in the first patient. We also reported the first case of triplication of 9 bp in the mitochondrial NC7 region in Africa and Tunisia, in association with the novel m.14924T>C in the MT-CYB gene in the second patient with mitochondrial neuromuscular disorder. - Highlights: • We reported 2 patients with mitochondrial neuromuscular disorders. • The heteroplasmic MT-ATP6 9157G>A variation was reported. • A triplication of 9 bp in the mitochondrial NC7 region was detected. • The m.14924T>C transition (S60P) in the MT-CYB gene was found.

  19. Effect of combined platinum and electron on the temperature dependence of forward voltage in fast recovery diode

    International Nuclear Information System (INIS)

    Jia Yun-Peng; Zhao Bao; Wu Yu; Zhou Xuan; Li Zhe; Tan Jian; Yang Fei

    2015-01-01

    The temperature dependences of forward voltage drop (V F ) of the fast recovery diodes (FRDs) are remarkably influenced by different lifetime controlled treatments. In this paper the results of an experimental study are presented, which are the lifetime controls of platinum treatment, electron irradiation treatment, and the combined treatment of the above ones. Based on deep level transient spectroscopy (DLTS) measurements, a new level E6 (E C -0.376 eV) is found in the combined lifetime treated (CLT) sample, which is different from the levels of the individual platinum and electron irradiation ones. Comparing the tested V F results of CLT samples with the others, the level E6 is responsible for the degradation of temperature dependence of the forward voltage drop in the FRD. (paper)

  20. Voltage Controlled Dynamic Demand Response

    DEFF Research Database (Denmark)

    Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

  1. Protosappanin B protects PC12 cells against oxygen-glucose deprivation-induced neuronal death by maintaining mitochondrial homeostasis via induction of ubiquitin-dependent p53 protein degradation.

    Science.gov (United States)

    Zeng, Ke-Wu; Liao, Li-Xi; Zhao, Ming-Bo; Song, Fang-Jiao; Yu, Qian; Jiang, Yong; Tu, Peng-Fei

    2015-03-15

    Protosappanin B (PTB) is a bioactive dibenzoxocin derivative isolated from Caesalpinia sappan L. Here, we investigated the neuroprotective effects and the potential mechanisms of PTB on oxygen-glucose deprivation (OGD)-injured PC12 cells. Results showed that PTB significantly increased cell viability, inhibited cell apoptosis and up-regulated the expression of growth-associated protein 43 (a marker of neural outgrowth). Moreover, our study revealed that PTB effectively maintained mitochondrial homeostasis by up-regulation of mitochondrial membrane potential (MMP), inhibition of cytochrome c release from mitochondria and inactivation of mitochondrial caspase-9/3 apoptosis pathway. Further study showed that PTB significantly promoted cytoplasmic component degradation of p53 protein, a key negative regulator for mitochondrial function, resulting in a release of Bcl-2 from p53-Bcl-2 complex and an enhancing translocation of Bcl-2 to mitochondrial outer membrane. Finally, we found the degradation of p53 protein was induced by PTB via activation of a MDM2-dependent ubiquitination process. Taken together, our findings provided a new viewpoint of neuronal protection strategy for anoxia and ischemic injury with natural small molecular dibenzoxocin derivative by activating ubiquitin-dependent p53 protein degradation as well as increasing mitochondrial function. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Caveolin-1 sensitizes cisplatin-induced lung cancer cell apoptosis via superoxide anion-dependent mechanism.

    Science.gov (United States)

    Pongjit, Kanittha; Chanvorachote, Pithi

    2011-12-01

    Caveolin-1 (Cav-1) expression frequently found in lung cancer was linked with disease prognosis and progression. This study reveals for the first time that Cav-1 sensitizes cisplatin-induced lung carcinoma cell death by the mechanism involving oxidative stress modulation. We established stable Cav-1 overexpressed (H460/Cav-1) cells and investigated their cisplatin susceptibility in comparison with control-transfected cells and found that Cav-1 expression significantly enhanced cisplatin-mediated cell death. Results indicated that the different response to cisplatin between these cells was resulted from different level of superoxide anion induced by cisplatin. Inhibitory study revealed that superoxide anion inhibitor MnTBAP could inhibit cisplatin-mediated toxicity only in H460/Cav-1 cells while had no effect on H460 cells. Further, superoxide anion detected by DHE probe indicated that H460/Cav-1 cells generated significantly higher superoxide anion level in response to cisplatin than that of control cells. The role of Cav-1 in regulating cisplatin sensitivity was confirmed in shRNA-mediated Cav-1 down-regulated (H460/shCav-1) cells and the cells exhibited decreased cisplatin susceptibility and superoxide generation. In summary, these findings reveal novel aspects regarding role of Cav-1 in modulating oxidative stress induced by cisplatin, possibly providing new insights for cancer biology and cisplatin-based chemotherapy.

  3. Quantum mechanics of toroidal anions

    International Nuclear Information System (INIS)

    Afanas'ev, G.N.

    1990-01-01

    We consider a toroidal solenoid with an electric charge attached to it. It turns out that statistical properties of the wave function describing interacting toroidal anions depend on both their relative position and orientation. The influence of the particular gauge choice on the exchange properties of the wave function is studied. 30 refs.; 6 figs

  4. A proteomic study of memory after imprinting in the domestic chick

    Directory of Open Access Journals (Sweden)

    Maia eMeparishvili

    2015-11-01

    Full Text Available The intermediate and medial mesopallium (IMM of the domestic chick forebrain has previously been shown to be a memory system for visual imprinting. Learning-related changes occur in certain plasma membrane and mitochondrial proteins in the IMM. Two-dimensional gel electrophoresis/mass spectrometry has been employed to identify more comprehensively learning-related expression of proteins in the membrane-mitochondrial fraction of the IMM 24 h after training. We inquired whether amounts of these proteins in the IMM and a control region (posterior pole of the nidopallium, PPN are correlated with a behavioural estimate of memory for the imprinting stimulus. Learning-related increases in amounts of the following proteins were found in the left IMM, but not the right IMM or the left or right PPN: (i membrane cognin; (ii a protein resembling the P32 subunit of splicing factor SF2; (iii voltage-dependent anionic channel-1; (iv dynamin-1; (v heterogeneous nuclear ribonucleoprotein A2/B1. Learning-related increases in some transcription factors involved in mitochondrial biogenesis were also found, without significant change in mitochondrial DNA copy number. The results indicate that the molecular processes involved in learning and memory underlying imprinting include protein stabilization, increased mRNA trafficking, synaptic vesicle recycling and specific changes in the mitochondrial proteome.

  5. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

    Science.gov (United States)

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

    2016-02-01

    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  6. Patchy proteins, anions and the Hofmeister series

    Energy Technology Data Exchange (ETDEWEB)

    Lund, Mikael; Jungwirth, Pavel [Institute of Organic Chemistry and Biochemistry, Academy of Sciences of the Czech Republic, Flemingovo namesti 2, 16610 Prague 6 (Czech Republic); Center for Complex Molecular Systems and Biomolecules, Flemingovo namesti 2, 16610 Prague 6 (Czech Republic)], E-mail: mikael.lund@uochb.cas.cz

    2008-12-10

    We investigate specific anion binding to a range of patchy protein models and use our results to probe protein-protein interactions for aqueous lysozyme solutions. Our molecular simulation studies show that the ion-protein interaction mechanism and strength largely depend on the nature of the interfacial amino acid residues. Via direct ion pairing, small anions interact with charged side-chains while larger anions are attracted to non-polar residues due to several solvent assisted mechanisms. Incorporating ion and surface specificity into a mesoscopic model for protein-protein interactions we calculate the free energy of interaction between lysozyme molecules in aqueous solutions of sodium chloride and sodium iodide. In agreement with experiment, our finding is that 'salting out' follows the reverse Hofmeister series for pH below the iso-electric point and the direct series for pH above pI.

  7. Voltage-gated lipid ion channels

    DEFF Research Database (Denmark)

    Blicher, Andreas; Heimburg, Thomas Rainer

    2013-01-01

    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  8. Granzyme A Cleaves a Mitochondrial Complex I Protein to Initiate Caspase-Independent Cell Death

    Science.gov (United States)

    Martinvalet, Denis; Dykxhoorn, Derek M.; Ferrini, Roger; Lieberman, Judy

    2010-01-01

    SUMMARY The killer lymphocyte protease granzyme A (GzmA) triggers caspase-independent target cell death with morphological features of apoptosis. We previously showed that GzmA acts directly on mitochondria to generate reactive oxygen species (ROS) and disrupt the transmembrane potential (ΔΨm) but does not permeabilize the mitochondrial outer membrane. Mitochondrial damage is critical to GzmA-induced cell death since cells treated with superoxide scavengers are resistant to GzmA. Here we find that GzmA accesses the mitochondrial matrix to cleave the complex I protein NDUFS3, an iron-sulfur subunit of the NADH:ubiquinone oxidoreductase complex I, after Lys56 to interfere with NADH oxidation and generate superoxide anions. Target cells expressing a cleavage site mutant of NDUFS3 are resistant to GzmA-mediated cell death but remain sensitive to GzmB. PMID:18485875

  9. Effect of Structure on Charge Distribution in the Isatin Anions in Aprotic Environment: Spectral Study

    Directory of Open Access Journals (Sweden)

    Pavol Tisovský

    2017-11-01

    Full Text Available Five isatin anions were prepared by deprotonation of initial isatins in aprotic solvents using basic fluoride and acetate anions (F− and CH3COO−. The F− basicity is sufficient to deprotonate isatin NH hydrogen from all the studied compounds. This process is reversible. In the presence of proton donor solvents, the anions form the corresponding isatins. The isatin hydrogen acidity depends on the overall structure of the isatin derivatives. The anions were characterized by ultraviolet–visible (UV–Vis, Fourier transform infrared (FTIR and nuclear magnetic resonance (NMR spectroscopy. Interestingly, the anions form aggregates at concentrations above 10−3 mol·dm−3. Further, the effect of cations on the UV–Vis spectra of the studied anions was studied. Charge transfer and its distribution in the anion depends on the radius and the cation electron configuration. The alkali metal cations, tetrabutylammonium (TBA+, Mg2+ and Ag+, interact with the C-2 carbonyl oxygen of the isatin anion. The interaction has a coulombic character. On the other hand, Cd2+, Zn2+, Hg2+, Co2+, and Cu+ cations form a coordinate bond with the isatin nitrogen.

  10. Solid-state NMR, electrophysiology and molecular dynamics characterization of human VDAC2

    International Nuclear Information System (INIS)

    Gattin, Zrinka; Schneider, Robert; Laukat, Yvonne; Giller, Karin; Maier, Elke; Zweckstetter, Markus; Griesinger, Christian; Benz, Roland; Becker, Stefan; Lange, Adam

    2015-01-01

    The voltage-dependent anion channel (VDAC) is the most abundant protein of the outer mitochondrial membrane and constitutes the major pathway for the transport of ADP, ATP, and other metabolites. In this multidisciplinary study we combined solid-state NMR, electrophysiology, and molecular dynamics simulations, to study the structure of the human VDAC isoform 2 in a lipid bilayer environment. We find that the structure of hVDAC2 is similar to the structure of hVDAC1, in line with recent investigations on zfVDAC2. However, hVDAC2 appears to exhibit an increased conformational heterogeneity compared to hVDAC1 which is reflected in broader solid-state NMR spectra and less defined electrophysiological profiles

  11. Solid-state NMR, electrophysiology and molecular dynamics characterization of human VDAC2

    Energy Technology Data Exchange (ETDEWEB)

    Gattin, Zrinka; Schneider, Robert; Laukat, Yvonne; Giller, Karin [Max Planck Institute for Biophysical Chemistry (Germany); Maier, Elke [Theodor-Boveri-Institut (Biozentrum) der Universität Würzburg, Lehrstuhl für Biotechnologie (Germany); Zweckstetter, Markus; Griesinger, Christian [Max Planck Institute for Biophysical Chemistry (Germany); Benz, Roland [Theodor-Boveri-Institut (Biozentrum) der Universität Würzburg, Lehrstuhl für Biotechnologie (Germany); Becker, Stefan; Lange, Adam, E-mail: alange@fmp-berlin.de [Max Planck Institute for Biophysical Chemistry (Germany)

    2015-04-15

    The voltage-dependent anion channel (VDAC) is the most abundant protein of the outer mitochondrial membrane and constitutes the major pathway for the transport of ADP, ATP, and other metabolites. In this multidisciplinary study we combined solid-state NMR, electrophysiology, and molecular dynamics simulations, to study the structure of the human VDAC isoform 2 in a lipid bilayer environment. We find that the structure of hVDAC2 is similar to the structure of hVDAC1, in line with recent investigations on zfVDAC2. However, hVDAC2 appears to exhibit an increased conformational heterogeneity compared to hVDAC1 which is reflected in broader solid-state NMR spectra and less defined electrophysiological profiles.

  12. Vibrational Fano resonances in the photodetachment of dipole-bound anions

    International Nuclear Information System (INIS)

    Edwards, Stephen T; Tully, John C; Johnson, Mark A

    2012-01-01

    A simple model for the photodetachment of dipole-bound anions is proposed where non-adiabatic coupling of vibrational states leads to a Fano resonance in the spectrum. It is found that the shape of the photodetachment spectrum depends significantly on the parameter representing molecular polarizability. The model is also applied to a Fano profile observed in the photodetachment of small water cluster anions.

  13. Mitochondrial function, ornamentation, and immunocompetence.

    Science.gov (United States)

    Koch, Rebecca E; Josefson, Chloe C; Hill, Geoffrey E

    2017-08-01

    Understanding the mechanisms that link ornamental displays and individual condition is key to understanding the evolution and function of ornaments. Immune function is an aspect of individual quality that is often associated with the expression of ornamentation, but a general explanation for why the expression of some ornaments seems to be consistently linked to immunocompetence remains elusive. We propose that condition-dependent ornaments may be linked to key aspects of immunocompetence through co-dependence on mitochondrial function. Mitochondrial involvement in immune function is rarely considered outside of the biomedical literature, but the role of mitochondria as the primary energy producers of the cell and the centres of biosynthesis, the oxidative stress response, and cellular signalling place them at the hub of a variety of immune pathways. A promising new mechanistic explanation for correlations between a wide range of ornamental traits and the properties of individual quality is that mitochondrial function may be the 'shared pathway' responsible for links between ornament production and individual condition. Herein, we first review the role of mitochondria as both signal transducers and metabolic regulators of immune function. We then describe connections between hormonal pathways and mitochondria, with implications for both immune function and the expression of ornamentation. Finally, we explore the possibility that ornament expression may link directly to mitochondrial function. Considering condition-dependent traits within the framework of mitochondrial function has the potential to unify central tenets within the study of sexual selection, eco-immunology, oxidative stress ecology, stress and reproductive hormone biology, and animal physiology. © 2016 Cambridge Philosophical Society.

  14. Identification of mitochondrial electron transport chain-mediated NADH radical formation by EPR spin-trapping techniques.

    Science.gov (United States)

    Matsuzaki, Satoshi; Kotake, Yashige; Humphries, Kenneth M

    2011-12-20

    The mitochondrial electron transport chain (ETC) is a major source of free radical production. However, due to the highly reactive nature of radical species and their short lifetimes, accurate detection and identification of these molecules in biological systems is challenging. The aim of this investigation was to determine the free radical species produced from the mitochondrial ETC by utilizing EPR spin-trapping techniques and the recently commercialized spin-trap, 5-(2,2-dimethyl-1,3-propoxycyclophosphoryl)-5-methyl-1-pyrroline N-oxide (CYPMPO). We demonstrate that this spin-trap has the preferential quality of having minimal mitochondrial toxicity at concentrations required for radical detection. In rat heart mitochondria and submitochondrial particles supplied with NADH, the major species detected under physiological pH was a carbon-centered radical adduct, indicated by markedly large hyperfine coupling constant with hydrogen (a(H) > 2.0 mT). In the presence of the ETC inhibitors, the carbon-centered radical formation was increased and exhibited NADH concentration dependency. The same carbon-centered radical could also be produced with the NAD biosynthesis precursor, nicotinamide mononucleotide, in the presence of a catalytic amount of NADH. The results support the conclusion that the observed species is a complex I derived NADH radical. The formation of the NADH radical could be blocked by hydroxyl radical scavengers but not SOD. In vitro experiments confirmed that an NADH-radical is readily formed by hydroxyl radical but not superoxide anion, further implicating hydroxyl radical as an upstream mediator of NADH radical production. These findings demonstrate the identification of a novel mitochondrial radical species with potential physiological significance and highlight the diverse mechanisms and sites of production within the ETC.

  15. Revealing mechanisms of selective, concentration-dependent potentials of 4-hydroxy-2-nonenal to induce apoptosis in cancer cells through inactivation of membrane-associated catalase.

    Science.gov (United States)

    Bauer, Georg; Zarkovic, Neven

    2015-04-01

    Tumor cells generate extracellular superoxide anions and are protected against superoxide anion-mediated intercellular apoptosis-inducing signaling by the expression of membrane-associated catalase. 4-Hydroxy-2-nonenal (4-HNE), a versatile second messenger generated during lipid peroxidation, has been shown to induce apoptosis selectively in malignant cells. The findings described in this paper reveal the strong, concentration-dependent potential of 4-HNE to specifically inactivate extracellular catalase of tumor cells both indirectly and directly and to consequently trigger apoptosis in malignant cells through superoxide anion-mediated intercellular apoptosis-inducing signaling. Namely, 4-HNE caused apoptosis selectively in NOX1-expressing tumor cells through inactivation of their membrane-associated catalase, thus reactivating subsequent intercellular signaling through the NO/peroxynitrite and HOCl pathways, followed by the mitochondrial pathway of apoptosis. Concentrations of 4-HNE of 1.2 µM and higher directly inactivated membrane-associated catalase of tumor cells, whereas at lower concentrations, 4-HNE triggered a complex amplificatory pathway based on initial singlet oxygen formation through H2O2 and peroxynitrite interaction. Singlet-oxygen-dependent activation of the FAS receptor and caspase-8 increased superoxide anion generation by NOX1 and amplification of singlet oxygen generation, which allowed singlet-oxygen-dependent inactivation of catalase. 4-HNE and singlet oxygen cooperate in complex autoamplificatory loops during this process. The finding of these novel anticancer pathways may be useful for understanding the role of 4-HNE in the control of malignant cells and for the optimization of ROS-dependent therapeutic approaches including antioxidant treatments. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

    International Nuclear Information System (INIS)

    Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

    2015-01-01

    Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

  17. The supply voltage scaled dependency of the recovery of single event upset in advanced complementary metal—oxide—semiconductor static random-access memory cells

    International Nuclear Information System (INIS)

    Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming

    2013-01-01

    Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)

  18. Peroxidative damage of mitochondrial respiration is substrate-dependent

    Czech Academy of Sciences Publication Activity Database

    Endlicher, R.; Křiváková, P.; Rauchová, Hana; Nůsková, Hana; Červinková, Z.; Drahota, Zdeněk

    2009-01-01

    Roč. 58, č. 5 (2009), s. 685-692 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA303/06/1261 Institutional research plan: CEZ:AV0Z50110509 Keywords : mitochondrial enzymes * peroxidative damage * tert-butyl hydroperoxide Subject RIV: CE - Biochemistry Impact factor: 1.430, year: 2009

  19. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  20. Non-bilayer structures in mitochondrial membranes regulate ATP synthase activity.

    Science.gov (United States)

    Gasanov, Sardar E; Kim, Aleksandr A; Yaguzhinsky, Lev S; Dagda, Ruben K

    2018-02-01

    Cardiolipin (CL) is an anionic phospholipid at the inner mitochondrial membrane (IMM) that facilitates the formation of transient non-bilayer (non-lamellar) structures to maintain mitochondrial integrity. CL modulates mitochondrial functions including ATP synthesis. However, the biophysical mechanisms by which CL generates non-lamellar structures and the extent to which these structures contribute to ATP synthesis remain unknown. We hypothesized that CL and ATP synthase facilitate the formation of non-bilayer structures at the IMM to stimulate ATP synthesis. By using 1 H NMR and 31 P NMR techniques, we observed that increasing the temperature (8°C to 37°C), lowering the pH (3.0), or incubating intact mitochondria with CTII - an IMM-targeted toxin that increases the formation of immobilized non-bilayer structures - elevated the formation of non-bilayer structures to stimulate ATP synthesis. The F 0 sector of the ATP synthase complex can facilitate the formation of non-bilayer structures as incubating model membranes enriched with IMM-specific phospholipids with exogenous DCCD-binding protein of the F 0 sector (DCCD-BPF) elevated the formation of immobilized non-bilayer structures to a similar manner as CTII. Native PAGE assays revealed that CL, but not other anionic phospholipids, specifically binds to DCCD-BPF to promote the formation of stable lipid-protein complexes. Mechanistically, molecular docking studies identified two lipid binding sites for CL in DCCD-BPF. We propose a new model of ATP synthase regulation in which CL mediates the formation of non-bilayer structures that serve to cluster protons and ATP synthase complexes as a mechanism to enhance proton translocation to the F 0 sector, and thereby increase ATP synthesis. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Redox Regulation of Mitochondrial Function

    Science.gov (United States)

    Handy, Diane E.

    2012-01-01

    Abstract Redox-dependent processes influence most cellular functions, such as differentiation, proliferation, and apoptosis. Mitochondria are at the center of these processes, as mitochondria both generate reactive oxygen species (ROS) that drive redox-sensitive events and respond to ROS-mediated changes in the cellular redox state. In this review, we examine the regulation of cellular ROS, their modes of production and removal, and the redox-sensitive targets that are modified by their flux. In particular, we focus on the actions of redox-sensitive targets that alter mitochondrial function and the role of these redox modifications on metabolism, mitochondrial biogenesis, receptor-mediated signaling, and apoptotic pathways. We also consider the role of mitochondria in modulating these pathways, and discuss how redox-dependent events may contribute to pathobiology by altering mitochondrial function. Antioxid. Redox Signal. 16, 1323–1367. PMID:22146081

  2. The absorption of plutonium by anion resins

    Energy Technology Data Exchange (ETDEWEB)

    Durham, R. W.; Mills, R.

    1961-10-15

    Equilibrium experiments have shown Pu{sup +4} to be absorbed from nitric acid onto an anion resin as a complex anion Pu(NO{sub 3}){sub 6}{sup -2}. The amount of absorption is dependent on the plutonium and nitric acid concentrations in the equilibrium solution with a maximum at 7N to 8N HNO{sub 3}. A low cross-linked resin has a higher capacity and reaches equilibrium more rapidly than the normally supplied resin. Saturation capacity of one per cent cross-linked Nalcite SBR (Dowex 1), 50 -- 100 mesh, is 385 mg Pu/gram dry resin. (author)

  3. Fluorescence anisotropy of tyrosinate anion using one-, two- and three-photon excitation: tyrosinate anion fluorescence.

    Science.gov (United States)

    Kierdaszuk, Borys

    2013-03-01

    We examined the emission spectra and steady-state anisotropy of tyrosinate anion fluorescence with one-photon (250-310 nm), two-photon (570-620 nm) and three-photon (750-930 nm) excitation. Similar emission spectra of the neutral (pH 7.2) and anionic (pH 13) forms of N-acetyl-L-tyrosinamide (NATyrA) (pKa 10.6) were observed for all modes of excitation, with the maxima at 302 and 352 nm, respectively. Two-photon excitation (2PE) and three-photon excitation (3PE) spectra of the anionic form were the same as that for one-photon excitation (1PE). In contrast, 2PE spectrum from the neutral form showed ~30-nm shift to shorter wavelengths relative to 1PE spectrum (λmax 275 nm) at two-photon energy (550 nm), the latter being overlapped with 3PE spectrum, both at two-photon energy (550 nm). Two-photon cross-sections for NATyrA anion at 565-580 nm were 10 % of that for N-acetyl-L-tryptophanamide (NATrpA), and increased to 90 % at 610 nm, while for the neutral form of NATyrA decreased from 2 % of that for NATrpA at 570 nm to near zero at 585 nm. Surprisingly, the fundamental anisotropy of NATyrA anion in vitrified solution at -60 °C was ~0.05 for 2PE at 610 nm as compared to near 0.3 for 1PE at 305 nm, and wavelength-dependence appears to be a basic feature of its anisotropy. In contrast, the 3PE anisotropy at 900 nm was about 0.5, and 3PE and 1PE anisotropy values appear to be related by the cos(6) θ to cos(2) θ photoselection factor (approx. 10/6) independently of excitation wavelength. Attention is drawn to the possible effect of tyrosinate anions in proteins on their multi-photon induced fluorescence emission and excitation spectra as well as excitation anisotropy spectra.

  4. Anion analysis in uranium more concentrates by ion chromatography

    International Nuclear Information System (INIS)

    Badaut, V.

    2009-01-01

    In the present exploratory study, the applicability of anionic impurities or attributing nuclear material to a certain chemical process or origin has been investigated. Anions (e.g., nitrate, sulphate, fluoride, chloride) originate from acids or salt solutions that are used for processing of solutions containing uranium or plutonium. The study focuses on uranium ore concentrates ('yellow cakes') originating from different mines. Uranium is mined from different types of ore body and depending on the type of rock, different chemical processes for leaching, dissolving and precipitating the uranium need to be applied. Consequently, the anionic patterns observed in he products of these processes (the 'ore concentrates') are different. The concentrations of different anionic species were measured by ion chromatography using conductivity detection. The results show clear differences of anion concentrations and patterns between samples from different uranium mines. Besides this, differences between sampling campaigns n a same mine were also observed indicating that the uranium ore is not homogeneous in a mine. These within-mine variations, however, were smaller than the between-mine variations. (author)

  5. Pulse-voltage fast generator

    International Nuclear Information System (INIS)

    Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

    1988-01-01

    The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

  6. The triel bond: a potential force for tuning anion-π interactions

    Science.gov (United States)

    Esrafili, Mehdi D.; Mousavian, Parisasadat

    2018-02-01

    Using ab-initio calculations, the mutual influence between anion-π and B···N or B···C triel bond interactions is investigated in some model complexes. The properties of these complexes are studied by molecular electrostatic potential, noncovalent interaction index, quantum theory of atoms in molecules (QTAIM) and natural bond orbital (NBO) analyses. According to the results, the formation of B···N or B···C triel bond interactions in the multi-component systems makes a significant shortening of anion-π distance. Such remarkable variation in the anion-π distances has not been reported previously. The strengthening of the anion-π bonding in the multi-component systems depend significantly on the nature of the anion, and it becomes larger in the order Br- > Cl- > F-. The parameters derived from the QTAIM and NBO methodologies are used to study the mechanism of the cooperativity between the anion-π and triel bond interactions in the multi-component complexes.

  7. Anion induced conformational preference of Cα NN motif residues in functional proteins.

    Science.gov (United States)

    Patra, Piya; Ghosh, Mahua; Banerjee, Raja; Chakrabarti, Jaydeb

    2017-12-01

    Among different ligand binding motifs, anion binding C α NN motif consisting of peptide backbone atoms of three consecutive residues are observed to be important for recognition of free anions, like sulphate or biphosphate and participate in different key functions. Here we study the interaction of sulphate and biphosphate with C α NN motif present in different proteins. Instead of total protein, a peptide fragment has been studied keeping C α NN motif flanked in between other residues. We use classical force field based molecular dynamics simulations to understand the stability of this motif. Our data indicate fluctuations in conformational preferences of the motif residues in absence of the anion. The anion gives stability to one of these conformations. However, the anion induced conformational preferences are highly sequence dependent and specific to the type of anion. In particular, the polar residues are more favourable compared to the other residues for recognising the anion. © 2017 Wiley Periodicals, Inc.

  8. Exploration of pH-dependent behavior of the anion receptor pocket of subdomain IIA of HSA: determination of effective pocket charge using the Debye-Hückel limiting law.

    Science.gov (United States)

    Bolel, Priyanka; Datta, Shubhashis; Mahapatra, Niharendu; Halder, Mintu

    2014-01-09

    Protein-ligand electrostatic interaction can be looked upon as ion receptor-ligand interaction, and the binding cavity of protein can be either an anion or cation receptor depending on the charge of the guest. Here we focus on the exploration of pH-modulated binding of a number of anionic ligands, specific to the subdomain IIA cavity of HSA, such as carmoisine, tartrazine, cochineal red, and warfarin. The logarithm of the binding constant is found to vary linearly with the square-root of ionic strength, indicating applicability of the Debye-Hückel limiting law to protein-ligand electrostatic binding equilibrium, and concludes that the subdomain IIA cavity is an anion receptor. The present approach is very unique that one can calculate the effective charge of the protein-based anion receptor pocket, and the calculated charge has been found to vary between +1 and +3 depending on the pH and ligand itself. The study also indicates that in such cases of specific ligand binding the pocket charge rather than the overall or surface charge of the macromolecule seems to have a paramount role in determining the strength of interaction. For the first time, it is demonstrated that the Debye-Hückel interionic interaction model can be successfully applied to understand the protein-based receptor-ligand electrostatic interaction in general.

  9. The Effect of Voltage Charging on the Transport Properties of Gold Nanotube Membranes.

    Science.gov (United States)

    Experton, Juliette; Martin, Charles R

    2018-05-01

    Porous membranes are used in chemical separations and in many electrochemical processes and devices. Research on the transport properties of a unique class of porous membranes that contain monodisperse gold nanotubes traversing the entire membrane thickness is reviewed here. These gold nanotubes can act as conduits for ionic and molecular transports through the membrane. Because the tubes are electronically conductive, they can be electrochemically charged by applying a voltage to the membrane. How this "voltage charging" affects the transport properties of gold nanotube membranes is the subject of this Review. Experiments showing that voltage charging can be used to reversibly switch the membrane between ideally cation- and anion-transporting states are reviewed. Voltage charging can also be used to enhance the ionic conductivity of gold nanotube membranes. Finally, voltage charging to accomplish electroporation of living bacteria as they pass through gold nanotube membranes is reviewed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. How do yeast sense mitochondrial dysfunction?

    Directory of Open Access Journals (Sweden)

    Dmitry A. Knorre

    2016-09-01

    Full Text Available Apart from energy transformation, mitochondria play important signaling roles. In yeast, mitochondrial signaling relies on several molecular cascades. However, it is not clear how a cell detects a particular mitochondrial malfunction. The problem is that there are many possible manifestations of mitochondrial dysfunction. For example, exposure to the specific antibiotics can either decrease (inhibitors of respiratory chain or increase (inhibitors of ATP-synthase mitochondrial transmembrane potential. Moreover, even in the absence of the dysfunctions, a cell needs feedback from mitochondria to coordinate mitochondrial biogenesis and/or removal by mitophagy during the division cycle. To cope with the complexity, only a limited set of compounds is monitored by yeast cells to estimate mitochondrial functionality. The known examples of such compounds are ATP, reactive oxygen species, intermediates of amino acids synthesis, short peptides, Fe-S clusters and heme, and also the precursor proteins which fail to be imported by mitochondria. On one hand, the levels of these molecules depend not only on mitochondria. On the other hand, these substances are recognized by the cytosolic sensors which transmit the signals to the nucleus leading to general, as opposed to mitochondria-specific, transcriptional response. Therefore, we argue that both ways of mitochondria-to-nucleus communication in yeast are mostly (if not completely unspecific, are mediated by the cytosolic signaling machinery and strongly depend on cellular metabolic state.

  11. Multifunctional Mitochondrial AAA Proteases.

    Science.gov (United States)

    Glynn, Steven E

    2017-01-01

    Mitochondria perform numerous functions necessary for the survival of eukaryotic cells. These activities are coordinated by a diverse complement of proteins encoded in both the nuclear and mitochondrial genomes that must be properly organized and maintained. Misregulation of mitochondrial proteostasis impairs organellar function and can result in the development of severe human diseases. ATP-driven AAA+ proteins play crucial roles in preserving mitochondrial activity by removing and remodeling protein molecules in accordance with the needs of the cell. Two mitochondrial AAA proteases, i-AAA and m-AAA, are anchored to either face of the mitochondrial inner membrane, where they engage and process an array of substrates to impact protein biogenesis, quality control, and the regulation of key metabolic pathways. The functionality of these proteases is extended through multiple substrate-dependent modes of action, including complete degradation, partial processing, or dislocation from the membrane without proteolysis. This review discusses recent advances made toward elucidating the mechanisms of substrate recognition, handling, and degradation that allow these versatile proteases to control diverse activities in this multifunctional organelle.

  12. Field and polarity dependence of time-to-resistance increase in Fe–O films studied by constant voltage stress method

    OpenAIRE

    Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...

  13. Ubiquitination of specific mitochondrial matrix proteins

    International Nuclear Information System (INIS)

    Lehmann, Gilad; Ziv, Tamar; Braten, Ori; Admon, Arie; Udasin, Ronald G.; Ciechanover, Aaron

    2016-01-01

    Several protein quality control systems in bacteria and/or mitochondrial matrix from lower eukaryotes are absent in higher eukaryotes. These are transfer-messenger RNA (tmRNA), The N-end rule ATP-dependent protease ClpAP, and two more ATP-dependent proteases, HslUV and ClpXP (in yeast). The lost proteases resemble the 26S proteasome and the role of tmRNA and the N-end rule in eukaryotic cytosol is performed by the ubiquitin proteasome system (UPS). Therefore, we hypothesized that the UPS might have substituted these systems – at least partially – in the mitochondrial matrix of higher eukaryotes. Using three independent experimental approaches, we demonstrated the presence of ubiquitinated proteins in the matrix of isolated yeast mitochondria. First, we show that isolated mitochondria contain ubiquitin (Ub) conjugates, which remained intact after trypsin digestion. Second, we demonstrate that the mitochondrial soluble fraction contains Ub-conjugates, several of which were identified by mass spectrometry and are localized to the matrix. Third, using immunoaffinity enrichment by specific antibodies recognizing digested ubiquitinated peptides, we identified a group of Ub-modified matrix proteins. The modification was further substantiated by separation on SDS-PAGE and immunoblots. Last, we attempted to identify the ubiquitin ligase(s) involved, and identified Dma1p as a trypsin-resistant protein in our mitochondrial preparations. Taken together, these data suggest a yet undefined role for the UPS in regulation of the mitochondrial matrix proteins. -- Highlights: •Mitochondrial matrix contains ubiquitinated proteins. •Ubiquitination occurs most probably in the matrix. •Dma1p is a ubiquitin ligase present in mitochondrial preparations.

  14. Ubiquitination of specific mitochondrial matrix proteins

    Energy Technology Data Exchange (ETDEWEB)

    Lehmann, Gilad [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel); Ziv, Tamar [The Smoler Proteomics Center, Faculty of Biology – Technion-Israel Institute of Technology, Haifa, 32000 (Israel); Braten, Ori [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel); Admon, Arie [The Smoler Proteomics Center, Faculty of Biology – Technion-Israel Institute of Technology, Haifa, 32000 (Israel); Udasin, Ronald G. [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel); Ciechanover, Aaron, E-mail: aaroncie@tx.technion.ac.il [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel)

    2016-06-17

    Several protein quality control systems in bacteria and/or mitochondrial matrix from lower eukaryotes are absent in higher eukaryotes. These are transfer-messenger RNA (tmRNA), The N-end rule ATP-dependent protease ClpAP, and two more ATP-dependent proteases, HslUV and ClpXP (in yeast). The lost proteases resemble the 26S proteasome and the role of tmRNA and the N-end rule in eukaryotic cytosol is performed by the ubiquitin proteasome system (UPS). Therefore, we hypothesized that the UPS might have substituted these systems – at least partially – in the mitochondrial matrix of higher eukaryotes. Using three independent experimental approaches, we demonstrated the presence of ubiquitinated proteins in the matrix of isolated yeast mitochondria. First, we show that isolated mitochondria contain ubiquitin (Ub) conjugates, which remained intact after trypsin digestion. Second, we demonstrate that the mitochondrial soluble fraction contains Ub-conjugates, several of which were identified by mass spectrometry and are localized to the matrix. Third, using immunoaffinity enrichment by specific antibodies recognizing digested ubiquitinated peptides, we identified a group of Ub-modified matrix proteins. The modification was further substantiated by separation on SDS-PAGE and immunoblots. Last, we attempted to identify the ubiquitin ligase(s) involved, and identified Dma1p as a trypsin-resistant protein in our mitochondrial preparations. Taken together, these data suggest a yet undefined role for the UPS in regulation of the mitochondrial matrix proteins. -- Highlights: •Mitochondrial matrix contains ubiquitinated proteins. •Ubiquitination occurs most probably in the matrix. •Dma1p is a ubiquitin ligase present in mitochondrial preparations.

  15. Loss of Mitochondrial Function Impairs Lysosomes.

    Science.gov (United States)

    Demers-Lamarche, Julie; Guillebaud, Gérald; Tlili, Mouna; Todkar, Kiran; Bélanger, Noémie; Grondin, Martine; Nguyen, Angela P; Michel, Jennifer; Germain, Marc

    2016-05-06

    Alterations in mitochondrial function, as observed in neurodegenerative diseases, lead to disrupted energy metabolism and production of damaging reactive oxygen species. Here, we demonstrate that mitochondrial dysfunction also disrupts the structure and function of lysosomes, the main degradation and recycling organelle. Specifically, inhibition of mitochondrial function, following deletion of the mitochondrial protein AIF, OPA1, or PINK1, as well as chemical inhibition of the electron transport chain, impaired lysosomal activity and caused the appearance of large lysosomal vacuoles. Importantly, our results show that lysosomal impairment is dependent on reactive oxygen species. Given that alterations in both mitochondrial function and lysosomal activity are key features of neurodegenerative diseases, this work provides important insights into the etiology of neurodegenerative diseases. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Mitochondrial Reactive Oxygen Species (ROS) and ROS-Induced ROS Release

    Science.gov (United States)

    Zorov, Dmitry B.; Juhaszova, Magdalena; Sollott, Steven J.

    2014-01-01

    Byproducts of normal mitochondrial metabolism and homeostasis include the buildup of potentially damaging levels of reactive oxygen species (ROS), Ca2+, etc., which must be normalized. Evidence suggests that brief mitochondrial permeability transition pore (mPTP) openings play an important physiological role maintaining healthy mitochondria homeostasis. Adaptive and maladaptive responses to redox stress may involve mitochondrial channels such as mPTP and inner membrane anion channel (IMAC). Their activation causes intra- and intermitochondrial redox-environment changes leading to ROS release. This regenerative cycle of mitochondrial ROS formation and release was named ROS-induced ROS release (RIRR). Brief, reversible mPTP opening-associated ROS release apparently constitutes an adaptive housekeeping function by the timely release from mitochondria of accumulated potentially toxic levels of ROS (and Ca2+). At higher ROS levels, longer mPTP openings may release a ROS burst leading to destruction of mitochondria, and if propagated from mitochondrion to mitochondrion, of the cell itself. The destructive function of RIRR may serve a physiological role by removal of unwanted cells or damaged mitochondria, or cause the pathological elimination of vital and essential mitochondria and cells. The adaptive release of sufficient ROS into the vicinity of mitochondria may also activate local pools of redox-sensitive enzymes involved in protective signaling pathways that limit ischemic damage to mitochondria and cells in that area. Maladaptive mPTP- or IMAC-related RIRR may also be playing a role in aging. Because the mechanism of mitochondrial RIRR highlights the central role of mitochondria-formed ROS, we discuss all of the known ROS-producing sites (shown in vitro) and their relevance to the mitochondrial ROS production in vivo. PMID:24987008

  17. Mitochondrial-dependent Autoimmunity in Membranous Nephropathy of IgG4-related Disease

    Science.gov (United States)

    Buelli, Simona; Perico, Luca; Galbusera, Miriam; Abbate, Mauro; Morigi, Marina; Novelli, Rubina; Gagliardini, Elena; Tentori, Chiara; Rottoli, Daniela; Sabadini, Ettore; Saito, Takao; Kawano, Mitsuhiro; Saeki, Takako; Zoja, Carlamaria; Remuzzi, Giuseppe; Benigni, Ariela

    2015-01-01

    The pathophysiology of glomerular lesions of membranous nephropathy (MN), including seldom-reported IgG4-related disease, is still elusive. Unlike in idiopathic MN where IgG4 prevails, in this patient IgG3 was predominant in glomerular deposits in the absence of circulating anti-phospholipase A2 receptor antibodies, suggesting a distinct pathologic process. Here we documented that IgG4 retrieved from the serum of our propositus reacted against carbonic anhydrase II (CAII) at the podocyte surface. In patient's biopsy, glomerular CAII staining increased and co-localized with subepithelial IgG4 deposits along the capillary walls. Patient's IgG4 caused a drop in cell pH followed by mitochondrial dysfunction, excessive ROS production and cytoskeletal reorganization in cultured podocytes. These events promoted mitochondrial superoxide-dismutase-2 (SOD2) externalization on the plasma membrane, becoming recognizable by complement-binding IgG3 anti-SOD2. Among patients with IgG4-related disease only sera of those with IgG4 anti-CAII antibodies caused low intracellular pH and mitochondrial alterations underlying SOD2 externalization. Circulating IgG4 anti-CAII can cause podocyte injury through processes of intracellular acidification, mitochondrial oxidative stress and neoantigen induction in patients with IgG4 related disease. The onset of MN in a subset of patients could be due to IgG4 antibodies recognizing CAII with consequent exposure of mitochondrial neoantigen in the context of multifactorial pathogenesis of disease. PMID:26137589

  18. Low voltage stress-induced leakage current and traps in ultrathin oxide (1.2 2.5 nm) after constant voltage stresses

    Science.gov (United States)

    Petit, C.; Zander, D.

    2007-10-01

    It has been shown that the low voltage gate current in ultrathin oxide metal-oxide-semiconductor devices is very sensitive to electrical stresses. Therefore, it can be used as a reliability monitor when the oxide thickness becomes too small for traditional electrical measurements to be used. In this work, we present a study on n-MOSCAP devices at negative gate bias in the direct tunneling (DT) regime. If the low voltage stress-induced leakage current (LVSILC) depends strongly on the low sense voltages, it also depends strongly on the stress voltage magnitude. We show that two LVSILC peaks appear as a function of the sense voltage in the LVSILC region and that their magnitude, one compared to the other, depends strongly on the stress voltage magnitude. One is larger than the other at low stress voltage and smaller at high stress voltage. From our experimental results, different conduction mechanisms are analyzed. To explain LVSILC variations, we propose a model of the conduction through the ultrathin gate oxide based on two distinctly different trap-assisted tunneling mechanisms: inelastic of gate electron (INE) and trap-assisted electron (ETAT).

  19. Enhancement of encaged electron concentration by Sr(2+) doping and improvement of Gd(3+) emission through controlling encaged anions in conductive C12A7 phosphors.

    Science.gov (United States)

    Zhang, Meng; Liu, Yuxue; Zhu, Hancheng; Yan, Duanting; Yang, Jian; Zhang, Xinyang; Liu, Chunguang; Xu, Changshan

    2016-07-28

    Conductive C12A7:0.1%Gd(3+),y%Sr(2+) powders with different Sr(2+) doping concentrations have been prepared in a H2 atmosphere by a solid state method in combination with subsequent UV-irradiation. The encaged electron concentration could be modulated through tuning Sr(2+) doping and its maximum value reaches 2.3 × 10(19) cm(-3). This is attributed to the competition between enhanced uptake and the release of the encaged anions during their formation and diffusion processes and the suppression of encaged electrons generation due to the increased encaged OH(-) anions and the decreased encaged O(2-) anions. Although there exists encaged electrons and different encaged anions (O(2-), H(-) and OH(-)) in C12A7 conductive powders prepared through the hydrogen route, a dominant local environment around Gd(3+) could be observed using electron spin resonance (ESR) detection. It can be ascribed to the stronger coupling of the encaged OH(-) to the framework of C12A7 than those of the encaged electrons, O(2-) and H(-) anions. In addition, emission of Gd(3+) ions is enhanced under UV or low voltage electron beam excitation and a new local environment around Gd(3+) ions appears through the thermal annealing in air because of the decrease of the encaged OH(-) anions and the increase of the encaged O(2-) anions. Our results suggested that Sr(2+) doping in combination with thermal annealing in air is an effective strategy for increasing the conductive performance and enhancing the emission of rare earth ions doped into C12A7 conductive phosphors for low-voltage field emission displays (FEDs).

  20. Anions in Cometary Comae

    Science.gov (United States)

    Charnley, Steven B.

    2011-01-01

    The presence of negative ions (anions) in cometary comae is known from Giotto mass spectrometry of IP/Halley. The anions 0-, OH-, C-, CH- and CN- have been detected, as well as unidentified anions with masses 22-65 and 85-110 amu (Chaizy et al. 1991). Organic molecular anions are known to have a significant impact on the charge balance of interstellar clouds and circumstellar envelopes and have been shown to act as catalysts for the gas-phase synthesis of larger hydrocarbon molecules in the ISM, but their importance in cometary comae has not yet been explored. We present details of the first attempt to model the chemistry of anions in cometary comae. Based on the combined chemical and hydro dynamical model of Rodgers & Charnley (2002), we investigate the role of large carbon-chain anions in cometary coma chemistry. We calculate the effects of these anions on coma thermodynamics, charge balance and examine their impact on molecule formation.

  1. REACTIVITY OF ANIONS IN INTERSTELLAR MEDIA: DETECTABILITY AND APPLICATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Senent, M. L. [Departamento de Quimica y Fisica Teoricas, Instituto de Estructura de la Materia, IEM-C.S.I.C., Serrano 121, Madrid E-28006 (Spain); Hochlaf, M., E-mail: senent@iem.cfmac.csic.es, E-mail: hochlaf@univ-mlv.fr [Laboratoire de Modelisation et Simulation Multi Echelle, Universite Paris-Est, MSME UMR 8208 CNRS, 5 boulevard Descartes, F-77454 Marne-la-Vallee (France)

    2013-05-01

    We propose a general rule to distinguish between detectable and undetectable astronomical anions. We believe that only few anions live long enough in the interstellar medium and thus can be detected. Our method is based on quantum mechanical calculations capable of describing accurately the evolution of electronic states during chemical processes. The still not fully understood reactivity at low temperatures is discussed considering non-adiabatic effects. The role of excited states has usually been neglected in previous works which basically focused on the ground electronic state for interpretations of experimental observations. Here, we deal with unsaturated carbon chains (e.g., C{sub n} H{sup -}), which show a high density of electronic states close to their corresponding ground electronic states, complex molecular dynamics, and non-adiabatic phenomena. Our general rule shows that it is not sufficient that anions exist in the gas phase (in the laboratory) to be present in media such as astrophysical media, since formation and decomposition reactions of these anions may allow the population of anionic electronic states to autodetach, forming neutrals. For C{sub n} H, reactivity depends strongly on n, where long and short chains behave differently. Formation of linear chains is relevant.

  2. Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

    Science.gov (United States)

    Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

    2012-01-01

    The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

  3. Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing

    Science.gov (United States)

    Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.

    2013-01-01

    Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the

  4. High voltage and high specific capacity dual intercalating electrode Li-ion batteries

    Science.gov (United States)

    West, William C. (Inventor); Blanco, Mario (Inventor)

    2010-01-01

    The present invention provides high capacity and high voltage Li-ion batteries that have a carbonaceous cathode and a nonaqueous electrolyte solution comprising LiF salt and an anion receptor that binds the fluoride ion. The batteries can comprise dual intercalating electrode Li ion batteries. Methods of the present invention use a cathode and electrode pair, wherein each of the electrodes reversibly intercalate ions provided by a LiF salt to make a high voltage and high specific capacity dual intercalating electrode Li-ion battery. The present methods and systems provide high-capacity batteries particularly useful in powering devices where minimizing battery mass is important.

  5. Inhibiting c-Jun N-terminal kinase partially attenuates caffeine-dependent cell death without alleviating the caffeine-induced reduction in mitochondrial respiration in C2C12 skeletal myotubes

    International Nuclear Information System (INIS)

    Downs, R.M.; Hughes, M.A.; Kinsey, S.T.; Johnson, M.C.; Baumgarner, B.L.

    2016-01-01

    Caffeine is a widely consumed stimulant that has previously been shown to promote cytotoxic stress and even cell death in numerous mammalian cell lines. Thus far there is little information available regarding the toxicity of caffeine in skeletal muscle cells. Our preliminary data revealed that treating C2C12 myotubes with 5 mM caffeine for 6 h increased nuclear fragmentation and reduced basal and maximal oxygen consumption rate (OCR) in skeletal myotubes. The purpose of this study was to further elucidate the pathways by which caffeine increased cell death and reduced mitochondrial respiration. We specifically examined the role of c-Jun N-terminal kinase (JNK), which has previously been shown to simultaneously increase caspase-dependent cell death and reduce mitochondrial respiration in other mammalian cell lines. We found that caffeine promoted a dose-dependent increase in cell death in multinucleated myotubes but did not in mononucleated myoblasts. The addition of 10 μM Z-DEVD-FMK, a specific inhibitor of executioner caspases, completely inhibited caffeine-dependent cell death. Further, the addition of 400 μM dantrolene, a specific ryanodine receptor (RYR) inhibitor, prevented the caffeine-dependent increase in cell death and the reduction in basal and maximal OCR. We also discovered that caffeine treatment significantly increased the phosphorylation of JNK and that the addition of 30 μM SP600125 (JNKi), a specific JNK inhibitor, partially attenuated caffeine-induced cell death without preventing the caffeine-dependent reduction in basal and maximal OCR. Our results suggest that JNK partially mediates the increase in caspase-dependent cell death but does not contribute to reduced mitochondrial respiration in caffeine-treated skeletal muscle cells. We conclude that caffeine increased cell death and reduced mitochondrial respiration in a calcium-dependent manner by activating the RYR and promoting reticular calcium release. - Highlights: • Caffeine

  6. Mechanism of voltage-gated channel formation in lipid membranes.

    Science.gov (United States)

    Guidelli, Rolando; Becucci, Lucia

    2016-04-01

    Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. The measurement of reversible redox dependent post-translational modifications and their regulation of mitochondrial and skeletal muscle function

    Directory of Open Access Journals (Sweden)

    Philip A Kramer

    2015-11-01

    Full Text Available Mitochondrial oxidative stress is a common feature of skeletal myopathies across multiple conditions; however, the mechanism by which it contributes to skeletal muscle dysfunction remains controversial. Oxidative damage to proteins, lipids, and DNA has received the most attention, yet an important role for reversible redox post-translational modifications (PTMs in pathophysiology is emerging. The possibility that these PTMs can exert dynamic control of muscle function implicates them as a mechanism contributing to skeletal muscle dysfunction in chronic disease. Herein, we discuss the significance of thiol-based redox dependent modifications to mitochondrial, myofibrillar and excitation-contraction (EC coupling proteins with an emphasis on how these changes could alter skeletal muscle performance under chronically stressed conditions. A major barrier to a better mechanistic understanding of the role of reversible redox PTMs in muscle function is the technical challenges associated with accurately measuring the changes of site-specific redox PTMs. Here we will critically review current approaches with an emphasis on sample preparation artifacts, quantitation, and specificity. Despite these challenges, the ability to accurately quantify reversible redox PTMs is critical to understanding the mechanisms by which mitochondrial oxidative stress contributes to skeletal muscle dysfunction in chronic diseases.

  8. The Measurement of Reversible Redox Dependent Post-translational Modifications and Their Regulation of Mitochondrial and Skeletal Muscle Function

    Energy Technology Data Exchange (ETDEWEB)

    Kramer, Philip A.; Duan, Jicheng; Qian, Wei-Jun; Marcinek, David J.

    2015-11-25

    Mitochondrial oxidative stress is a common feature of skeletal myopathies across multiple conditions; however, the mechanism by which it contributes to skeletal muscle dysfunction remains controversial. Oxidative damage to proteins, lipids, and DNA has received the most attention, yet an important role for reversible redox post-translational modifications (PTMs) in pathophysiology is emerging. The possibility that these PTMs can exert dynamic control of muscle function implicates them as a mechanism contributing to skeletal muscle dysfunction in chronic disease. Herein, we discuss the significance of thiol-based redox dependent modifications to mitochondrial, myofibrillar and excitation-contraction (EC) coupling proteins with an emphasis on how these changes could alter skeletal muscle performance under chronically stressed conditions. A major barrier to a better mechanistic understanding of the role of reversible redox PTMs in muscle function is the technical challenges associated with accurately measuring the changes of site-specific redox PTMs. Here we will critically review current approaches with an emphasis on sample preparation artifacts, quantitation, and specificity. Despite these challenges, the ability to accurately quantify reversible redox PTMs is critical to understanding the mechanisms by which mitochondrial oxidative stress contributes to skeletal muscle dysfunction in chronic diseases.

  9. Ionizing radiation induces PI3K-dependent JNK activation for amplifying mitochondrial dysfunction in human cervical cancer cells

    International Nuclear Information System (INIS)

    Kim, Min Jung; Choi, Soon Young; Bae, Sang Woo; Kang, Chang Mo; Lee, Yun Sil; Lee, Su Jae

    2005-01-01

    Ionizing radiation is one of the most commonly used treatments for a wide variety of tumors. Exposure of cells to ionizing radiation results in the simultaneous activation or down regulation of multiple signaling pathways, which play critical role in controlling cell death and cell survival after irradiation in a cell type specific manner. The molecular mechanism by which apoptotic cell death occurs in response to ionizing radiation has been widely explored but not precisely deciphered. Therefore an improved understanding of the mechanisms involved in radiation-induced apoptosis may ultimately provide novel strategies of intervention in specific signal transduction pathways to favorably alter the therapeutic ratio in the treatment of human malignancies. The aim of our investigation was to elucidate molecular mechanisms of the mitochondrial dysfunction mediated apoptotic cell death triggered by ionizing radiation in human cervical cancer cells. We demonstrated that ionizing radiation utilizes PI3K-JNK signaling pathway for amplifying mitochondrial dysfunction and susequent apoptotic cell death: We showed that PI3K-dependent JNK activation leads to transcriptional upregulation of Fas and the phosphorylation/inactivation of Bcl-2, resulting in mitochondrial dysfunction-mediated apoptotic cell death in response to ionizing radiation

  10. Resveratrol induces mitochondrial biogenesis in endothelial cells.

    Science.gov (United States)

    Csiszar, Anna; Labinskyy, Nazar; Pinto, John T; Ballabh, Praveen; Zhang, Hanrui; Losonczy, Gyorgy; Pearson, Kevin; de Cabo, Rafael; Pacher, Pal; Zhang, Cuihua; Ungvari, Zoltan

    2009-07-01

    Pathways that regulate mitochondrial biogenesis are potential therapeutic targets for the amelioration of endothelial dysfunction and vascular disease. Resveratrol was shown to impact mitochondrial function in skeletal muscle and the liver, but its role in mitochondrial biogenesis in endothelial cells remains poorly defined. The present study determined whether resveratrol induces mitochondrial biogenesis in cultured human coronary arterial endothelial cells (CAECs). In CAECs resveratrol increased mitochondrial mass and mitochondrial DNA content, upregulated protein expression of electron transport chain constituents, and induced mitochondrial biogenesis factors (proliferator-activated receptor-coactivator-1alpha, nuclear respiratory factor-1, mitochondrial transcription factor A). Sirtuin 1 (SIRT1) was induced, and endothelial nitric oxide (NO) synthase (eNOS) was upregulated in a SIRT1-dependent manner. Knockdown of SIRT1 (small interfering RNA) or inhibition of NO synthesis prevented resveratrol-induced mitochondrial biogenesis. In aortas of type 2 diabetic (db/db) mice impaired mitochondrial biogenesis was normalized by chronic resveratrol treatment, showing the in vivo relevance of our findings. Resveratrol increases mitochondrial content in endothelial cells via activating SIRT1. We propose that SIRT1, via a pathway that involves the upregulation of eNOS, induces mitochondrial biogenesis. Resveratrol induced mitochondrial biogenesis in the aortas of type 2 diabetic mice, suggesting the potential for new treatment approaches targeting endothelial mitochondria in metabolic diseases.

  11. Conductance of single-atom platinum contacts: Voltage dependence of the conductance histogram

    DEFF Research Database (Denmark)

    Nielsen, S.K.; Noat, Y.; Brandbyge, Mads

    2003-01-01

    The conductance of a single-atom contact is sensitive to the coupling of this contact atom to the atoms in the leads. Notably for the transition metals this gives rise to a considerable spread in the observed conductance values. The mean conductance value and spread can be obtained from the first...... peak in conductance histograms recorded from a large set of contact-breaking cycles. In contrast to the monovalent metals, this mean value for Pt depends strongly on the applied voltage bias and other experimental conditions and values ranging from about 1 G(0) to 2.5 G(0) (G(0)=2e(2)/h) have been...... reported. We find that at low bias the first peak in the conductance histogram is centered around 1.5 G(0). However, as the bias increases past 300 mV the peak shifts to 1.8 G(0). Here we show that this bias dependence is due to a geometric effect where monatomic chains are replaced by single-atom contacts...

  12. Molecular Evolution of Slow and Quick Anion Channels (SLACs and QUACs/ALMTs).

    Science.gov (United States)

    Dreyer, Ingo; Gomez-Porras, Judith Lucia; Riaño-Pachón, Diego Mauricio; Hedrich, Rainer; Geiger, Dietmar

    2012-01-01

    Electrophysiological analyses conducted about 25 years ago detected two types of anion channels in the plasma membrane of guard cells. One type of channel responds slowly to changes in membrane voltage while the other responds quickly. Consequently, they were named SLAC, for SLow Anion Channel, and QUAC, for QUick Anion Channel. Recently, genes SLAC1 and QUAC1/ALMT12, underlying the two different anion current components, could be identified in the model plant Arabidopsis thaliana. Expression of the gene products in Xenopus oocytes confirmed the quick and slow current kinetics. In this study we provide an overview on our current knowledge on slow and quick anion channels in plants and analyze the molecular evolution of ALMT/QUAC-like and SLAC-like channels. We discovered fingerprints that allow screening databases for these channel types and were able to identify 192 (177 non-redundant) SLAC-like and 422 (402 non-redundant) ALMT/QUAC-like proteins in the fully sequenced genomes of 32 plant species. Phylogenetic analyses provided new insights into the molecular evolution of these channel types. We also combined sequence alignment and clustering with predictions of protein features, leading to the identification of known conserved phosphorylation sites in SLAC1-like channels along with potential sites that have not been yet experimentally confirmed. Using a similar strategy to analyze the hydropathicity of ALMT/QUAC-like channels, we propose a modified topology with additional transmembrane regions that integrates structure and function of these membrane proteins. Our results suggest that cross-referencing phylogenetic analyses with position-specific protein properties and functional data could be a very powerful tool for genome research approaches in general.

  13. Molecular evolution of slow and quick anion channels (SLACs and QUACs/ALMTs

    Directory of Open Access Journals (Sweden)

    Ingo eDreyer

    2012-11-01

    Full Text Available Electrophysiological analyses conducted about 25 years ago detected two types of anion channels in the plasma membrane of guard cells. One type of channel responds slowly to changes in membrane voltage while the other responds quickly. Consequently, they were named SLAC, for SLow Anion Channel, and QUAC, for QUick Anion Channel. Recently, genes SLAC1 and QUAC1/ALMT12, underlying the two different anion current components, could be identified in the model plant Arabidopsis thaliana. Expression of the gene products in Xenopus oocytes confirmed the quick and slow current kinetics. In this study we provide an overview on our current knowledge on slow and quick anion channels in plants and analyze the molecular evolution of ALMT/QUAC-like and SLAC-like channels. We discovered fingerprints that allow screening databases for these channel types and were able to identify 192 (177 non-redundant SLAC-like and 422 (402 non-redundant ALMT/QUAC-like proteins in the fully sequenced genomes of 32 plant species. Phylogenetic analyses provided new insights into the molecular evolution of these channel types. We also combined sequence alignment and clustering with predictions of protein features, leading to the identification of known conserved phosphorylation sites in SLAC1-like channels along with potential sites that have not been yet experimentally confirmed. Using a similar strategy to analyze the hydropathicity of ALMT/QUAC-like channels, we propose a modified topology with additional transmembrane regions that integrates structure and function of these membrane proteins. Our results suggest that cross-referencing phylogenetic analyses with position-specific protein properties and functional data could be a very powerful tool for genome research approaches in general.

  14. Mitochondrial Protection and Anti-aging Activity of Astragalus Polysaccharides and Their Potential Mechanism

    Directory of Open Access Journals (Sweden)

    Xiao-Juan Xin

    2012-02-01

    Full Text Available The current study was performed to investigate mitochondrial protection and anti-aging activity of Astragalus polysaccharides (APS and the potential underlying mechanism. Lipid peroxidation of liver and brain mitochondria was induced by Fe2+–Vit C in vitro. Thiobarbituric acid (TBA colorimetry was used to measure the content of thiobarbituric acid reactive substances (TBARS. Mouse liver mitochondrial permeability transition (PT was induced by calcium overload in vitro and spectrophotometry was used to measure it. The scavenging activities of APS on superoxide anion (O2•- and hydroxyl radical (•OH, which were produced by reduced nicotinamide adenine dinucleotide (NADH—N-Methylphenazonium methyl sulfate (PMS and hydrogen peroxide (H2O2–Fe2+ system respectively, were measured by 4-nitrobluetetrazolium chloride (NBT reduction and Fenton reaction colorimetry respectively. The Na2S2O3 titration method was used to measure the scavenging activities of APS on H2O2. APS could inhibit TBARS production, protect mitochondria from PT, and scavenge O2•-, •OH and H2O2 significantly in a concentration-dependent manner respectively. The back of the neck of mice was injected subcutaneously with D-galactose to induce aging at a dose of 100 mg/kg/d for seven weeks. Moreover, the activities of catalase (CAT, surperoxide dismutase (SOD and glutathione peroxidase (GPx and anti-hydroxyl radical which were assayed by using commercial monitoring kits were increased significantly in vivo by APS. According to this research, APS protects mitochondria by scavenging reactive oxygen species (ROS, inhibiting mitochondrial PT and increasing the activities of antioxidases. Therefore, APS has the effect of promoting health.

  15. Ionizing radiation induces mitochondrial reactive oxygen species production accompanied by upregulation of mitochondrial electron transport chain function and mitochondrial content under control of the cell cycle checkpoint.

    Science.gov (United States)

    Yamamori, Tohru; Yasui, Hironobu; Yamazumi, Masayuki; Wada, Yusuke; Nakamura, Yoshinari; Nakamura, Hideo; Inanami, Osamu

    2012-07-15

    Whereas ionizing radiation (Ir) instantaneously causes the formation of water radiolysis products that contain some reactive oxygen species (ROS), ROS are also suggested to be released from biological sources in irradiated cells. It is now becoming clear that these ROS generated secondarily after Ir have a variety of biological roles. Although mitochondria are assumed to be responsible for this Ir-induced ROS production, it remains to be elucidated how Ir triggers it. Therefore, we conducted this study to decipher the mechanism of Ir-induced mitochondrial ROS production. In human lung carcinoma A549 cells, Ir (10 Gy of X-rays) induced a time-dependent increase in the mitochondrial ROS level. Ir also increased mitochondrial membrane potential, mitochondrial respiration, and mitochondrial ATP production, suggesting upregulation of the mitochondrial electron transport chain (ETC) function after Ir. Although we found that Ir slightly enhanced mitochondrial ETC complex II activity, the complex II inhibitor 3-nitropropionic acid failed to reduce Ir-induced mitochondrial ROS production. Meanwhile, we observed that the mitochondrial mass and mitochondrial DNA level were upregulated after Ir, indicating that Ir increased the mitochondrial content of the cell. Because irradiated cells are known to undergo cell cycle arrest under control of the checkpoint mechanisms, we examined the relationships between cell cycle and mitochondrial content and cellular oxidative stress level. We found that the cells in the G2/M phase had a higher mitochondrial content and cellular oxidative stress level than cells in the G1 or S phase, regardless of whether the cells were irradiated. We also found that Ir-induced accumulation of the cells in the G2/M phase led to an increase in cells with a high mitochondrial content and cellular oxidative stress level. This suggested that Ir upregulated mitochondrial ETC function and mitochondrial content, resulting in mitochondrial ROS production, and that

  16. Mitochondrial Metabolism in Aging Heart

    Science.gov (United States)

    Lesnefsky, Edward J.; Chen, Qun; Hoppel, Charles L.

    2016-01-01

    Altered mitochondrial metabolism is the underlying basis for the increased sensitivity in the aged heart to stress. The aged heart exhibits impaired metabolic flexibility, with a decreased capacity to oxidize fatty acids and enhanced dependence on glucose metabolism. Aging impairs mitochondrial oxidative phosphorylation, with a greater role played by the mitochondria located between the myofibrils, the interfibrillar mitochondria. With aging, there is a decrease in activity of complexes III and IV, which account for the decrease in respiration. Furthermore, aging decreases mitochondrial content among the myofibrils. The end result is that in the interfibrillar area there is an approximate 50% decrease in mitochondrial function, affecting all substrates. The defective mitochondria persist in the aged heart, leading to enhanced oxidant production and oxidative injury and the activation of oxidant signaling for cell death. Aging defects in mitochondria represent new therapeutic targets, whether by manipulation of the mitochondrial proteome, modulation of electron transport, activation of biogenesis or mitophagy, or the regulation of mitochondrial fission and fusion. These mechanisms provide new ways to attenuate cardiac disease in elders by preemptive treatment of age-related defects, in contrast to the treatment of disease-induced dysfunction. PMID:27174952

  17. Cutaneous respirometry by dynamic measurement of mitochondrial oxygen tension for monitoring mitochondrial function in vivo.

    Science.gov (United States)

    Harms, Floor A; Voorbeijtel, Wilhelmina J; Bodmer, Sander I A; Raat, Nicolaas J H; Mik, Egbert G

    2013-09-01

    Progress in diagnosis and treatment of mitochondrial dysfunction in chronic and acute disease could greatly benefit from techniques for monitoring of mitochondrial function in vivo. In this study we demonstrate the feasibility of in vivo respirometry in skin. Mitochondrial oxygen measurements by means of oxygen-dependent delayed fluorescence of protoporphyrin IX are shown to provide a robust basis for measurement of local oxygen disappearance rate (ODR). The fundamental principles behind the technology are described, together with an analysis method for retrievel of respirometry data. The feasibility and reproducibility of this clinically useful approach are demonstrated in a series of rats. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Improved Performance of Ionic Liquid Supercapacitors by using Tetracyanoborate Anions.

    Science.gov (United States)

    Martins, Vitor L; Rennie, Anthony J R; Sanchez-Ramirez, Nedher; Torresi, Roberto M; Hall, Peter J

    2018-02-01

    Supercapacitors are energy storage devices designed to operate at higher power densities than conventional batteries, but their energy density is still too low for many applications. Efforts are made to design new electrolytes with wider electrochemical windows than aqueous or conventional organic electrolytes in order to increase energy density. Ionic liquids (ILs) with wide electrochemical stability windows are excellent candidates to be employed as supercapacitor electrolytes. ILs containing tetracyanoborate anions [B(CN) 4 ] offer wider electrochemical stability than conventional electrolytes and maintain a high ionic conductivity (6.9 mS cm -1 ). Herein, we report the use of ILs containing the [B(CN) 4 ] anion for such an application. They presented a high maximum operating voltage of 3.7 V, and two-electrode devices demonstrate high specific capacitances even when operating at relatively high rates (ca. 20 F g -1 @ 15 A g -1 ). This supercapacitor stored more energy and operated at a higher power at all rates studied when compared with cells using a commonly studied ILs.

  19. BID links ferroptosis to mitochondrial cell death pathways

    Directory of Open Access Journals (Sweden)

    Sandra Neitemeier

    2017-08-01

    Full Text Available Ferroptosis has been defined as an oxidative and iron-dependent pathway of regulated cell death that is distinct from caspase-dependent apoptosis and established pathways of death receptor-mediated regulated necrosis. While emerging evidence linked features of ferroptosis induced e.g. by erastin-mediated inhibition of the Xc- system or inhibition of glutathione peroxidase 4 (Gpx4 to an increasing number of oxidative cell death paradigms in cancer cells, neurons or kidney cells, the biochemical pathways of oxidative cell death remained largely unclear. In particular, the role of mitochondrial damage in paradigms of ferroptosis needs further investigation.In the present study, we find that erastin-induced ferroptosis in neuronal cells was accompanied by BID transactivation to mitochondria, loss of mitochondrial membrane potential, enhanced mitochondrial fragmentation and reduced ATP levels. These hallmarks of mitochondrial demise are also established features of oxytosis, a paradigm of cell death induced by Xc- inhibition by millimolar concentrations of glutamate. Bid knockout using CRISPR/Cas9 approaches preserved mitochondrial integrity and function, and mediated neuroprotective effects against both, ferroptosis and oxytosis. Furthermore, the BID-inhibitor BI-6c9 inhibited erastin-induced ferroptosis, and, in turn, the ferroptosis inhibitors ferrostatin-1 and liproxstatin-1 prevented mitochondrial dysfunction and cell death in the paradigm of oxytosis. These findings show that mitochondrial transactivation of BID links ferroptosis to mitochondrial damage as the final execution step in this paradigm of oxidative cell death. Keywords: Ferroptosis, BID, Mitochondria, CRISPR, Oxytosis, Neuronal death

  20. Targeting mitochondrial respiration as a therapeutic strategy for cervical cancer.

    Science.gov (United States)

    Tian, Shenglan; Chen, Heng; Tan, Wei

    2018-05-23

    Targeting mitochondrial respiration has been documented as an effective therapeutic strategy in cancer. However, the impact of mitochondrial respiration inhibition on cervical cancer cells are not well elucidated. Using a panel of cervical cancer cell lines, we show that an existing drug atovaquone is active against the cervical cancer cells with high profiling of mitochondrial biogenesis. Atovaquone inhibited proliferation and induced apoptosis with varying efficacy among cervical cancer cell lines regardless of HPV infection, cellular origin and their sensitivity to paclitaxel. We further demonstrated that atovaquone acts on cervical cancer cells via inhibiting mitochondrial respiration. In particular, atovaquone specifically inhibited mitochondrial complex III but not I, II or IV activity, leading to respiration inhibition and energy crisis. Importantly, we found that the different sensitivity of cervical cancer cell lines to atovaquone were due to their differential level of mitochondrial biogenesis and dependency to mitochondrial respiration. In addition, we demonstrated that the in vitro observations were translatable to in vivo cervical cancer xenograft mouse model. Our findings suggest that the mitochondrial biogenesis varies among patients with cervical cancer. Our work also suggests that atovaquone is a useful addition to cervical cancer treatment, particularly to those with high dependency on mitochondrial respiration. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. Degree of glutathione deficiency and redox imbalance depend on subtype of mitochondrial disease and clinical status.

    Directory of Open Access Journals (Sweden)

    Gregory M Enns

    Full Text Available Mitochondrial disorders are associated with decreased energy production and redox imbalance. Glutathione plays a central role in redox signaling and protecting cells from oxidative damage. In order to understand the consequences of mitochondrial dysfunction on in vivo redox status, and to determine how this varies by mitochondrial disease subtype and clinical severity, we used a sensitive tandem mass spectrometry assay to precisely quantify whole blood reduced (GSH and oxidized (GSSG glutathione levels in a large cohort of mitochondrial disorder patients. Glutathione redox potential was calculated using the Nernst equation. Compared to healthy controls (n = 59, mitochondrial disease patients (n = 58 as a group showed significant redox imbalance (redox potential -251 mV ± 9.7, p<0.0001 with an increased level of oxidation by ∼ 9 mV compared to controls (-260 mV ± 6.4. Underlying this abnormality were significantly lower whole blood GSH levels (p = 0.0008 and GSH/GSSG ratio (p = 0.0002, and significantly higher GSSG levels (p<0.0001 in mitochondrial disease patients compared to controls. Redox potential was significantly more oxidized in all mitochondrial disease subgroups including Leigh syndrome (n = 15, electron transport chain abnormalities (n = 10, mitochondrial encephalomyopathy, lactic acidosis and stroke-like episodes (n = 8, mtDNA deletion syndrome (n = 7, mtDNA depletion syndrome (n = 7, and miscellaneous other mitochondrial disorders (n = 11. Patients hospitalized in metabolic crisis (n = 7 showed the greatest degree of redox imbalance at -242 mV ± 7. Peripheral whole blood GSH and GSSG levels are promising biomarkers of mitochondrial dysfunction, and may give insights into the contribution of oxidative stress to the pathophysiology of the various mitochondrial disorders. In particular, evaluation of redox potential may be useful in monitoring of clinical status or response to redox-modulating therapies in clinical trials.

  2. Membrane Potential-dependent Uptake of 18F-triphenylphosphonium - A New Voltage Sensor as an Imaging Agent for Detecting Burn-induced Apoptosis

    Science.gov (United States)

    Zhao, Gaofeng; Yu, Yong-Ming; Shoup, Timothy M.; Elmaleh, David R.; Bonab, Ali A.; Tompkins, Ronald G.; Fischman, Alan J.

    2014-01-01

    Background Mitochondrial dysfunction has been closely related to many pathological processes, such as cellular apoptosis. Alterations in organelle membrane potential are associated with mitochondrial dysfunction. A fluorine -18 labeled phosphonium compound: 18F-triphenylphosphonium (18F-TPP) was prepared to determine its potential use as a mitochondria-targeting radiopharmaceutical to evaluate cellular apoptosis. Methods Studies were conducted in both ex vivo cell lines and in vivo using a burned animal model. Uptake of 18F-TPP was assessed in PC-3 cells by gamma counting under the following conditions: graded levels of extra-cellular potassium concentrations, incubation with carbonyl cyanide m-chlorophenylhydrazone (CCCP) and staurosporine. Apoptosis was studied in a burn animal model using TUNEL staining and simultaneous assessment of 18F-TPP uptake by biodistribution. Results We found that stepwise membrane depolarization by potassium (K) resulted in a linear decrease in 18F-TPP uptake, with a slope of 0.62+/−0.08 and a correlation coefficient of 0.936+/−0.11. Gradually increased concentrations of CCCP lead to decreased uptakes of 18F-TPP. Staurosporine significantly decreased the uptake of 18F-TPP in PC-3 cells from 14.2+/−3.8% to 5.6+/−1.3% (P<0.001). Burn induced significant apoptosis (sham: 4.4 +/−1.8% vs. burn: 24.6+/− 6.7 %; p<0.005) and a reduced uptake of tracer in the spleens of burn injured animals as compared to sham burn controls (burn: 1.13+/−0.24% vs. sham: 3.28+/−0.67%; p<0.005). Biodistribution studies demonstrated that burn induced significant reduction in 18F-TPP uptake in spleen, heart, lung, and liver, which were associated with significantly increased apoptosis. Conclusions 18F-TPP is a promising new voltage sensor for detecting mitochondrial dysfunction and apoptosis in various tissues. PMID:24582214

  3. Voltage stability in low voltage microgrids in aspects of active and reactive power demand

    Directory of Open Access Journals (Sweden)

    Parol Mirosław

    2016-03-01

    Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

  4. Voltage-probe-position dependence and magnetic-flux contribution to the measured voltage in ac transport measurements: which measuring circuit determines the real losses?

    International Nuclear Information System (INIS)

    Pe, T.; McDonald, J.; Clem, J.R.

    1995-01-01

    The voltage V ab measured between two voltage taps a and b during magnetic flux transport in a type-II superconductor carrying current I is the sum of two contributions, the line integral from a to b of the electric field along an arbitrary path C s through the superconductor and a term proportional to the time rate of change of magnetic flux through the area bounded by the path C s and the measuring circuit leads. When the current I(t) is oscillating with time t, the apparent ac loss (the time average of the product IV ab ) depends upon the measuring circuit used. Only when the measuring-circuit leads are brought out far from the surface does the apparent power dissipation approach the real (or true) ac loss associated with the length of sample probed. Calculations showing comparisons between the apparent and real ac losses in a flat strip of rectangular cross section will be presented, showing the behavior as a function of the measuring-circuit dimensions. Corresponding calculations also are presented for a sample of elliptical cross section

  5. Cell cycle-dependent activity of the volume- and Ca2+-activated anion currents in Ehrlich lettre ascites cells

    DEFF Research Database (Denmark)

    Klausen, Thomas Kjaer; Bergdahl, Andreas; Christophersen, Palle

    2007-01-01

    Recent evidence implicates the volume-regulated anion current (VRAC) and other anion currents in control or modulation of cell cycle progression; however, the precise involvement of anion channels in this process is unclear. Here, Cl- currents in Ehrlich Lettre Ascites (ELA) cells were monitored...... during cell cycle progression, under three conditions: (i) after osmotic swelling (i.e., VRAC), (ii) after an increase in the free intracellular Ca2+ concentration (i.e., the Ca2+-activated Cl- current, CaCC), and (iii) under steady-state isotonic conditions. The maximal swelling-activated VRAC current......+ in the pipette), was unaltered from G0 to G1, but decreased in early S phase. A novel high-affinity anion channel inhibitor, the acidic di-aryl-urea NS3728, which inhibited both VRAC and CaCC, attenuated ELA cell growth, suggesting a possible mechanistic link between cell cycle progression and cell cycle...

  6. Mechanism of action of anions on the electron transport chain in thylakoid membranes of higher plants.

    Science.gov (United States)

    Singh-Rawal, Pooja; Zsiros, Ottó; Bharti, Sudhakar; Garab, Gyozo; Jajoo, Anjana

    2011-04-01

    With an aim to improve our understanding of the mechanisms behind specific anion effects in biological membranes, we have studied the effects of sodium salts of anions of varying valency in thylakoid membranes. Rates of electron transport of PS II and PS I, 77K fluorescence emission and excitation spectra, cyclic electron flow around PS I and circular dichroism (CD) spectra were measured in thylakoid membranes in order to elucidate a general mechanism of action of inorganic anions on photosynthetic electron transport chain. Re-distribution of absorbed excitation energy has been observed as a signature effect of inorganic anions. In the presence of anions, such as nitrite, sulphate and phosphate, distribution of absorbed excitation energy was found to be more in favor of Photosystem I (PS I). The amount of energy distributed towards PS I depended on the valency of the anion. In this paper, we propose for the first time that energy re-distribution and its valence dependence may not be the effect of anions per se. The entry of negative charge (anion) is accompanied by influx of positive charge (protons) to maintain a balance of charge across the thylakoid membranes. As reflected by the CD spectra, the observed energy re-distribution could be a result of structural rearrangements of the protein complexes of PS II caused by changes in the ionic environment of the thylakoid lumen.

  7. Modelling the transport of carbonic acid anions through anion-exchange membranes

    International Nuclear Information System (INIS)

    Nikonenko, V.; Lebedev, K.; Manzanares, J.A.; Pourcelly, G.

    2003-01-01

    Electrodiffusion of carbonate and bicarbonate anions through anion-exchange membranes (AEM) is described on the basis of the Nernst-Planck equations taking into account coupled hydrolysis reactions in the external diffusion boundary layers (DBLs) and internal pore solution. The model supposes local electroneutrality as well as chemical and thermodynamic equilibrium. The transport is considered in three layers being an anion exchange membrane and two adjoining diffusion layers. A mechanism of competitive transport of HCO 3 - and CO 3 2- anions through the membrane which takes into account Donnan exclusion of H + ions is proposed. It is predicted that the pH of the depleting solution decreases and that of the concentrating solution increases during electrodialysis (ED). Eventual deviations from local electroneutrality and local chemical equilibrium are discussed

  8. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

    2006-01-01

    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  9. Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

    Science.gov (United States)

    Cui, B. S.; Guo, X. B.; Wu, K.; Li, D.; Zuo, Y. L.; Xi, L.

    2016-03-01

    Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe65Co35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (~4 GPa for PI as compared to ~180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work.

  10. Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

    International Nuclear Information System (INIS)

    Cui, B S; Guo, X B; Wu, K; Li, D; Zuo, Y L; Xi, L

    2016-01-01

    Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe 65 Co 35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (∼4 GPa for PI as compared to ∼180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work. (paper)

  11. BID links ferroptosis to mitochondrial cell death pathways.

    Science.gov (United States)

    Neitemeier, Sandra; Jelinek, Anja; Laino, Vincenzo; Hoffmann, Lena; Eisenbach, Ina; Eying, Roman; Ganjam, Goutham K; Dolga, Amalia M; Oppermann, Sina; Culmsee, Carsten

    2017-08-01

    Ferroptosis has been defined as an oxidative and iron-dependent pathway of regulated cell death that is distinct from caspase-dependent apoptosis and established pathways of death receptor-mediated regulated necrosis. While emerging evidence linked features of ferroptosis induced e.g. by erastin-mediated inhibition of the X c - system or inhibition of glutathione peroxidase 4 (Gpx4) to an increasing number of oxidative cell death paradigms in cancer cells, neurons or kidney cells, the biochemical pathways of oxidative cell death remained largely unclear. In particular, the role of mitochondrial damage in paradigms of ferroptosis needs further investigation. In the present study, we find that erastin-induced ferroptosis in neuronal cells was accompanied by BID transactivation to mitochondria, loss of mitochondrial membrane potential, enhanced mitochondrial fragmentation and reduced ATP levels. These hallmarks of mitochondrial demise are also established features of oxytosis, a paradigm of cell death induced by X c - inhibition by millimolar concentrations of glutamate. Bid knockout using CRISPR/Cas9 approaches preserved mitochondrial integrity and function, and mediated neuroprotective effects against both, ferroptosis and oxytosis. Furthermore, the BID-inhibitor BI-6c9 inhibited erastin-induced ferroptosis, and, in turn, the ferroptosis inhibitors ferrostatin-1 and liproxstatin-1 prevented mitochondrial dysfunction and cell death in the paradigm of oxytosis. These findings show that mitochondrial transactivation of BID links ferroptosis to mitochondrial damage as the final execution step in this paradigm of oxidative cell death. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Modulation of liver mitochondrial NOS is implicated in thyroid-dependent regulation of O(2) uptake.

    Science.gov (United States)

    Carreras, M C; Peralta, J G; Converso, D P; Finocchietto, P V; Rebagliati, I; Zaninovich, A A; Poderoso, J J

    2001-12-01

    Changes in O(2) uptake at different thyroid status have been explained on the basis of the modulation of mitochondrial enzymes and membrane biophysical properties. Regarding the nitric oxide (NO) effects, we tested whether liver mitochondrial nitric oxide synthase (mtNOS) participates in the modulation of O(2) uptake in thyroid disorders. Wistar rats were inoculated with 400 microCi (131)I (hypothyroid group), 20 microg thyroxine (T(4))/100 g body wt administered daily for 2 wk (hyperthyroid group) or vehicle (control). Basal metabolic rate, mitochondrial function, and mtNOS activity were analyzed. Systemic and liver mitochondrial O(2) uptake and cytochrome oxidase activity were lower in hypothyroid rats with respect to controls; mitochondrial parameters were further decreased by L-arginine (-42 and -34%, P activity (260%) were selectively increased in hypothyroidism and reverted by hormone replacement without changes in other nitric oxide isoforms. Moreover, mtNOS activity correlated with serum 3,5,3'-triiodothyronine (T(3)) and O(2) uptake. Increased mtNOS activity was also observed in skeletal muscle mitochondria from hypothyroid rats. Therefore, we suggest that modulation of mtNOS is a substantial part of thyroid effects on mitochondrial O(2) uptake.

  13. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva

    2017-05-01

    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  14. Analysing destruction channels of interstellar hydrocarbon anions with a 22pol ion-trap

    Energy Technology Data Exchange (ETDEWEB)

    Endres, Eric; Lakhmanskaya, Olga; Best, Thorsten; Hauser, Daniel; Kumar, Sunil; Wester, Roland [Universitaet Innsbruck, Institut fuer Ionenphysik und Angewandte Physik (Austria)

    2014-07-01

    In the interstellar medium (ISM), ion-molecule reactions are considered to play a key role in the formation of complex molecules. The detection of the first interstellar anions, which happen to be carbon chain anions, has raised new interest in the quantitative composition of the ISM and the underlying reaction network. To understand the observed abundance of these carbon chain anions, a detailed analysis of the possible destruction channels is indispensable. A cryogenic 22-pol radio frequency ion trap is an ideal tool to observe reactions that take place slowly, such as carbon chain anions with molecular hydrogen. Furthermore, measurements over a large temperature scale are feasible. Longitudinal optical access to the trap also provides the possibility to make precise photodetachment measurements. Temperature dependent measurements of the reaction rates for the reaction between hydrocarbon chain anions and H{sub 2} are presented.

  15. Temperature dependence of the radiation induced change of depletion voltage in silicon PIN detectors

    International Nuclear Information System (INIS)

    Ziock, H.J.; Holzscheiter, K.; Morgan, A.; Palounek, A.P.T.; Ellison, J.; Heinson, A.P.; Mason, M.; Wimpenny, S.J.; Barberis, E.; Cartiglia, N.; Grillo, A.; O'Shaughnessy, K.; Rahn, J.; Rinaldi, P.; Rowe, W.A.; Sadrozinski, H.F.W.; Seiden, A.; Spencer, E.; Webster, A.; Wichmann, R.; Wilder, M.; Coupal, D.; Pal, T.

    1993-01-01

    The silicon microstrip detectors that will be used in the SDC experiment at the Superconducting Super Collider (SSC) will be exposed to very large fluences of charged particles, neutrons, and gammas. The authors present a study of how temperature affects the change in the depletion voltage of silicon PIN detectors damaged by radiation. They study the initial radiation damage and the short-term and long-term annealing of that damage as a function of temperature in the range from -10 degrees C to +50 degrees C, and as a function of 800 MeV proton fluence up to 1.5 x 10 14 p/cm 2 . They express the pronounced temperature dependencies in a simple model in terms of two annealing time constants which depend exponentially on the temperature

  16. Partitioning of hydrophobic pesticides within a soil-water-anionic surfactant system.

    Science.gov (United States)

    Wang, Peng; Keller, Arturo A

    2009-02-01

    Surfactants can be added to pesticide-contaminated soils to enhance the treatment efficiency of soil washing. Our results showed that pesticide (atrazine and diuron) partitioning and desorbability within a soil-water-anionic surfactant system is soil particle-size dependent and is significantly influenced by the presence of anionic surfactant. Anionic surfactant (linear alkylbenzene sulphonate, LAS) sorption was influenced by its complexation with both the soluble and exchangeable divalent cations in soils (e.g. Ca2+, Mg2+). In this study, we propose a new concept: soil system hardness which defines the total amount of soluble and exchangeable divalent cations associated with a soil. Our results showed that anionic surfactant works better with soils having lower soil system hardness. It was also found that the hydrophobic organic compounds (HOCs) sorbed onto the LAS-divalent cation precipitate, resulting in a significant decrease in the aqueous concentration of HOC. Our results showed that the effect of exchangeable cations and sorption of HOC onto the surfactant precipitates needs to be considered to accurately predict HOC behavior within soil-water-anionic surfactant systems.

  17. Controlled Release Kinetics in Hydroxy Double Salts: Effect of Host Anion Structure

    Directory of Open Access Journals (Sweden)

    Stephen Majoni

    2014-01-01

    Full Text Available Nanodimensional layered metal hydroxides such as layered double hydroxides (LDHs and hydroxy double salts (HDSs can undergo anion exchange reactions releasing intercalated anions. Because of this, these metal hydroxides have found applications in controlled release delivery of bioactive species such as drugs and pesticides. In this work, isomers of hydroxycinnamate were used as model compounds to systematically explore the effects of anion structure on the rate and extent of anion release in HDSs. Following intercalation and subsequent release of the isomers, it has been demonstrated that the nature and position of substituent groups on intercalated anions have profound effects on the rate and extent of release. The extent of release was correlated with the magnitude of dipole moments while the rate of reaction showed strong dependence on the extent of hydrogen bonding within the layers. The orthoisomer showed a more sustained and complete release as compared to the other isomers.

  18. Irreversible magnetic-field dependence of ferromagnetic resonance and inverse spin Hall effect voltage in CoFeB/Pt bilayer

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sang-Il [Department of Materials Science and Engineering, Korea University, Seoul, 136-713 (Korea, Republic of); Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Seo, Min-Su [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Choi, Yeon Suk, E-mail: ychoi@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Park, Seung-Young, E-mail: parksy@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of)

    2017-01-01

    Magnetic field (H) sweeping direction dependences of the mixed voltage V{sub mix} induced by the inverse-spin Hall effect(ISHE) and spin-rectified effect (SRE) in a CoFeB (5 nm)/Pt (10 nm) bilayer structure are investigated using the ferromagnetic resonance in the TE mode cavities and coplanar waveguide methods. Conventionally, the magnitude of ISHE voltage V{sub ISH} (symmetric) excluding the SRE (antisymmetric component) was unavoidably separated from the fitting curve of V{sub mix} (a sum of a symmetric and an antisymmetric part) for one direction of H-source. By studying the ratio of the two voltage parts with the bi-directional H sweeping, the optimized V{sub ISH} (no SRE condition) value which also include a well-defined spin Hall angle can be obtained via the linear response relation of ISHE and SRE components. - Highlights: • Hysteretic behavior of ferromagnetic resonance spectra in the CoFeB/Pt sample. • Hysteretic behavior of inverse-spin Hall effect voltage in the CoFeB/Pt sample. • Proportion of inverse spin-Hall effect voltage can be determined by the cavity mode. • The hysteretic behavior arise from the unsaturated magnetization limit. • The well-defined spin Hall angle which consider a hysteresis can be obtained.

  19. Nicotine induces resistance to chemotherapy by modulating mitochondrial signaling in lung cancer.

    Science.gov (United States)

    Zhang, Jingmei; Kamdar, Opal; Le, Wei; Rosen, Glenn D; Upadhyay, Daya

    2009-02-01

    Continued smoking causes tumor progression and resistance to therapy in lung cancer. Carcinogens possess the ability to block apoptosis, and thus may induce development of cancers and resistance to therapy. Tobacco carcinogens have been studied widely; however, little is known about the agents that inhibit apoptosis, such as nicotine. We determine whether mitochondrial signaling mediates antiapoptotic effects of nicotine in lung cancer. A549 cells were exposed to nicotine (1 muM) followed by cisplatin (35 muM) plus etoposide (20 muM) for 24 hours. We found that nicotine prevented chemotherapy-induced apoptosis, improved cell survival, and caused modest increases in DNA synthesis. Inhibition of mitogen-activated protein kinase (MAPK) and Akt prevented the antiapoptotic effects of nicotine and decreased chemotherapy-induced apoptosis. Small interfering RNA MAPK kinase-1 blocked antiapoptotic effects of nicotine, whereas small interfering RNA MAPK kinase-2 blocked chemotherapy-induced apoptosis. Nicotine prevented chemotherapy-induced reduction in mitochondrial membrane potential and caspase-9 activation. Antiapoptotic effects of nicotine were blocked by mitochondrial anion channel inhibitor, 4,4'diisothiocyanatostilbene-2,2'disulfonic acid. Chemotherapy enhanced translocation of proapoptotic Bax to the mitochondria, whereas nicotine blocked these effects. Nicotine up-regulated Akt-mediated antiapoptotic X-linked inhibitor of apoptosis protein and phosphorylated proapoptotic Bcl2-antagonist of cell death. The A549-rho0 cells, which lack mitochondrial DNA, demonstrated partial resistance to chemotherapy-induced apoptosis, but blocked the antiapoptotic effects of nicotine. Accordingly, we provide evidence that nicotine modulates mitochondrial signaling and inhibits chemotherapy-induced apoptosis in lung cancer. The mitochondrial regulation of nicotine imposes an important mechanism that can critically impair the treatment of lung cancer, because many cancer

  20. Quantitative optical measurement of mitochondrial superoxide dynamics in pulmonary artery endothelial cells

    Directory of Open Access Journals (Sweden)

    Zahra Ghanian

    2018-01-01

    Full Text Available Reactive oxygen species (ROS play a vital role in cell signaling and redox regulation, but when present in excess, lead to numerous pathologies. Detailed quantitative characterization of mitochondrial superoxide anion (O2•− production in fetal pulmonary artery endothelia cells (PAECs has never been reported. The aim of this study is to assess mitochondrial O2•− production in cultured PAECs over time using a novel quantitative optical approach. The rate, the sources, and the dynamics of O2•− production were assessed using targeted metabolic modulators of the mitochondrial electron transport chain (ETC complexes, specifically an uncoupler and inhibitors of the various ETC complexes, and inhibitors of extra-mitochondrial sources of O2•−. After stabilization, the cells were loaded with nanomolar mitochondrial-targeted hydroethidine (Mito-HE, MitoSOX online during the experiment without washout of the residual dye. Time-lapse fluorescence microscopy was used to monitor the dynamic changes in O2•− fluorescence intensity over time in PAECs. The transient behaviors of the fluorescence time course showed exponential increases in the rate of O2•− production in the presence of the ETC uncoupler or inhibitors. The most dramatic and the fastest increase in O2•− production was observed when the cells were treated with the uncoupling agent, PCP. We also showed that only the complex IV inhibitor, KCN, attenuated the marked surge in O2•− production induced by PCP. The results showed that mitochondrial respiratory complexes I, III and IV are sources of O2•− production in PAECs, and a new observation that ROS production during uncoupling of mitochondrial respiration is mediated in part via complex IV. This novel method can be applied in other studies that examine ROS production under stress condition and during ROS-mediated injuries in vitro.

  1. Ultrahigh surface area meso/microporous carbon formed with self-template for high-voltage aqueous supercapacitors

    Science.gov (United States)

    Yang, Jie; Hu, Jiangtao; Zhu, Min; Zhao, Yan; Chen, Haibiao; Pan, Feng

    2017-10-01

    A new hierarchically porous carbon has been synthesized with self-template of silica phase from a commercial silicone resin by pyrolysis and subsequent NaOH activation. The obtained carbon materials achieve an ultrahigh specific surface area (2896 m2 g-1) with abundant mesopores. The C800 sample demonstrates excellent performance in supercapacitors, with a high capacitance of 322 F g-1 at 0.5 A g-1 and outstanding rate capability (182 F g-1 at 100 A g-1) in a three-electrode system using 6.0 mol L-1 KOH electrolyte. The energy density is improved by widening the voltage window using 1.0 mol L-1 alkali metal nitrate solutions (LiNO3, NaNO3, KNO3) in which the strong solvation of alkali metal cations and nitrate anions effectively reduce the activity of water. In a symmetric supercapacitor, the maximum operating voltage is essentially restricted by the potential of positive electrode and the total capacitance is dominated by the capacitance of the anion at the positive electrode. The symmetric supercapacitors based on C800 deliver a high energy density of 22.4 Wh kg-1 at a power density of 0.23 kW kg-1 in 1.0 mol L-1 LiNO3 with a voltage of 1.8 V and long-term stability with a retention of 89.87% after 10000 cycles.

  2. ABA-Induced Stomatal Closure Involves ALMT4, a Phosphorylation-Dependent Vacuolar Anion Channel of Arabidopsis[OPEN

    Science.gov (United States)

    Baetz, Ulrike; Huck, Nicola V.; Zhang, Jingbo

    2017-01-01

    Stomatal pores are formed between a pair of guard cells and allow plant uptake of CO2 and water evaporation. Their aperture depends on changes in osmolyte concentration of guard cell vacuoles, specifically of K+ and Mal2−. Efflux of Mal2− from the vacuole is required for stomatal closure; however, it is not clear how the anion is released. Here, we report the identification of ALMT4 (ALUMINUM ACTIVATED MALATE TRANSPORTER4) as an Arabidopsis thaliana ion channel that can mediate Mal2− release from the vacuole and is required for stomatal closure in response to abscisic acid (ABA). Knockout mutants showed impaired stomatal closure in response to the drought stress hormone ABA and increased whole-plant wilting in response to drought and ABA. Electrophysiological data show that ALMT4 can mediate Mal2− efflux and that the channel activity is dependent on a phosphorylatable C-terminal serine. Dephosphomimetic mutants of ALMT4 S382 showed increased channel activity and Mal2− efflux. Reconstituting the active channel in almt4 mutants impaired growth and stomatal opening. Phosphomimetic mutants were electrically inactive and phenocopied the almt4 mutants. Surprisingly, S382 can be phosphorylated by mitogen-activated protein kinases in vitro. In brief, ALMT4 likely mediates Mal2− efflux during ABA-induced stomatal closure and its activity depends on phosphorylation. PMID:28874508

  3. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

    Science.gov (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

    2006-03-01

    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  4. The regulation of mitochondrial respiration by opening of mKCa channels is age-dependent

    NARCIS (Netherlands)

    Heinen, André; Winning, Adrian; Schlack, Wolfgang; Hollmann, Markus W.; Preckel, Benedikt; Frässdorf, Jan; Weber, Nina C.

    2008-01-01

    The protective potency of ischemic preconditioning decreases with increasing age. A key step in ischemic preconditioning is the opening of mitochondrial Ca(2+) sensitive K(+) (mK(Ca)) channels, which causes mild uncoupling of mitochondrial respiration. We hypothesized that aging reduces the effects

  5. Grafting voltage and pharmacological sensitivity in potassium channels.

    Science.gov (United States)

    Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing

    2016-08-01

    A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.

  6. Supramolecular Chemistry of Selective Anion Recognition for Anions of Environmental Relevance

    International Nuclear Information System (INIS)

    Sessler, Jonathan L.

    2007-01-01

    The major thrust of this project, led by the University of Kansas (Prof. Kristin Bowman-James), entails an exploration of the basic determinants of anion recognition and their application to the design, synthesis, and testing of novel sulfate extractants. A key scientific inspiration for the work comes from the need, codified in simple-to-appreciate terms by the Oak Ridge National Laboratory component of the team (viz. Dr. Bruce Moyer), for chemical entities that can help in the extractive removal of species that have low solubilities in borosilicate glass. Among such species, sulfate anion, has been identified as particularly insidious. Its presence interferes with the vitrification process, thus rendering the remediation of tank waste from, e.g., the Hanford site far more difficult and expensive. The availability of effective extractants, that would allow for the separation of separating sulfate from the major competing anions in the waste, especially nitrate, could allow for pre-vitrification removal of sulfate via liquid-liquid extraction. The efforts at The University of Texas, the subject of this report, have thus concentrated on the development of new sulfate receptors. These systems are designed to increase our basic understanding of anion recognition events and set the stage for the development of viable sulfate anion extractants. In conjunction with the Oak Ridge National Laboratory (ORNL) members of the research team, several of these new receptors were studied as putative extractants, with two of the systems being shown to act as promising synergists for anion exchange.

  7. Widespread Mitochondrial Depletion via Mitophagy Does Not Compromise Necroptosis

    Directory of Open Access Journals (Sweden)

    Stephen W.G. Tait

    2013-11-01

    Full Text Available Programmed necrosis (or necroptosis is a form of cell death triggered by the activation of receptor interacting protein kinase-3 (RIPK3. Several reports have implicated mitochondria and mitochondrial reactive oxygen species (ROS generation as effectors of RIPK3-dependent cell death. Here, we directly test this idea by employing a method for the specific removal of mitochondria via mitophagy. Mitochondria-deficient cells were resistant to the mitochondrial pathway of apoptosis, but efficiently died via tumor necrosis factor (TNF-induced, RIPK3-dependent programmed necrosis or as a result of direct oligomerization of RIPK3. Although the ROS scavenger butylated hydroxyanisole (BHA delayed TNF-induced necroptosis, it had no effect on necroptosis induced by RIPK3 oligomerization. Furthermore, although TNF-induced ROS production was dependent on mitochondria, the inhibition of TNF-induced necroptosis by BHA was observed in mitochondria-depleted cells. Our data indicate that mitochondrial ROS production accompanies, but does not cause, RIPK3-dependent necroptotic cell death.

  8. Pseudocapacitance of MnO{sub 2} originates from reversible insertion/desertion of thiocyanate anions studied using in situ X-ray absorption spectroscopy in ionic liquid electrolyte

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ming-Tsung; Tsai, Wen-Ta; Chang, Jeng-Kuei [Department of Materials Science and Engineering, National Cheng Kung University, 1 University Road, Tainan (China); Deng, Ming-Jay; Cheng, Hui-Fang; Sun, I-Wen [Department of Chemistry, National Cheng Kung University, 1 University Road, Tainan (China)

    2010-02-01

    Charge storage mechanisms of electrodeposited MnO{sub 2} in various aprotic ionic liquids (ILs) are studied using in situ X-ray absorption spectroscopy (XAS). The analytical results show that a unique thiocyanate (SCN{sup -}) anion can reversibly insert/desert into/from the tunnels between the [MnO{sub 6}] octahedral subunits depending on the applied potential. This process charge compensates the Mn{sup 3+}/Mn{sup 4+} redox transition upon charging-discharging and thus contributes to an ideal pseudocapacitive behavior of the MnO{sub 2} electrode. The present work would open up a route for developing a novel oxide-based supercapacitor, with high cell-voltage, high thermal stability, and high safety, incorporating IL electrolytes. (author)

  9. A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore.

    Science.gov (United States)

    Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A

    2017-05-01

    Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.

  10. Oleanolic acid induces mitochondrial-dependent apoptosis and G0/G1 phase arrest in gallbladder cancer cells

    Directory of Open Access Journals (Sweden)

    Li HF

    2015-06-01

    Full Text Available Huai-Feng Li,1–3,* Xu-An Wang,1–3,* Shan-Shan Xiang,1–3,* Yun-Ping Hu,1–3 Lin Jiang,1–3 Yi-Jun Shu,1–3 Mao-Lan Li,1–3 Xiang-Song Wu,1–3 Fei Zhang,1–3 Yuan-Yuan Ye,1–3 Hao Weng,1–3 Run-Fa Bao,1–3 Yang Cao,1–3 Wei Lu,1–3 Qian Dong,1–3 Ying-Bin Liu1–3 1Department of General Surgery, 2Laboratory of General Surgery, 3Institute of Biliary Tract Disease, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Oleanolic acid (OA, a naturally occurring triterpenoid, exhibits potential antitumor activity in many tumor cell lines. Gallbladder carcinoma is the most common malignancy of the biliary tract, and is a highly aggressive tumor with an extremely poor prognosis. Unfortunately, the effects of OA on gallbladder carcinoma are unknown. In this study, we investigated the effects of OA on gallbladder cancer cells and the underlying mechanism. The results showed that OA inhibits proliferation of gallbladder cancer cells in a dose-dependent and time-dependent manner on MTT and colony formation assay. A flow cytometry assay revealed apoptosis and G0/G1 phase arrest in GBC-SD and NOZ cells. Western blot analysis and a mitochondrial membrane potential assay demonstrated that OA functions through the mitochondrial apoptosis pathway. Moreover, this drug inhibited tumor growth in nude mice carrying subcutaneous NOZ tumor xenografts. These data suggest that OA inhibits proliferation of gallbladder cancer cells by regulating apoptosis and the cell cycle process. Thus, OA may be a promising drug for adjuvant chemotherapy in gallbladder carcinoma. Keywords: oleanolic acid, gallbladder carcinoma, apoptosis, cell cycle arrest, mitochondrial pathway

  11. Mitochondrial shape governs BAX-induced membrane permeabilization and apoptosis.

    Science.gov (United States)

    Renault, Thibaud T; Floros, Konstantinos V; Elkholi, Rana; Corrigan, Kelly-Ann; Kushnareva, Yulia; Wieder, Shira Y; Lindtner, Claudia; Serasinghe, Madhavika N; Asciolla, James J; Buettner, Christoph; Newmeyer, Donald D; Chipuk, Jerry E

    2015-01-08

    Proapoptotic BCL-2 proteins converge upon the outer mitochondrial membrane (OMM) to promote mitochondrial outer membrane permeabilization (MOMP) and apoptosis. Here we investigated the mechanistic relationship between mitochondrial shape and MOMP and provide evidence that BAX requires a distinct mitochondrial size to induce MOMP. We utilized the terminal unfolded protein response pathway to systematically define proapoptotic BCL-2 protein composition after stress and then directly interrogated their requirement for a productive mitochondrial size. Complementary biochemical, cellular, in vivo, and ex vivo studies reveal that Mfn1, a GTPase involved in mitochondrial fusion, establishes a mitochondrial size that is permissive for proapoptotic BCL-2 family function. Cells with hyperfragmented mitochondria, along with size-restricted OMM model systems, fail to support BAX-dependent membrane association and permeabilization due to an inability to stabilize BAXα9·membrane interactions. This work identifies a mechanistic contribution of mitochondrial size in dictating BAX activation, MOMP, and apoptosis. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca2+ channels

    DEFF Research Database (Denmark)

    Garau, Gianpiero; Magotti, Paola; Heine, Martin

    2015-01-01

    Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

  13. Genetically encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics.

    Science.gov (United States)

    Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

    2012-07-15

    A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Genetically-encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics

    Science.gov (United States)

    Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

    2012-01-01

    A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212

  15. Methylene blue improves mitochondrial respiration and decreases oxidative stress in a substrate-dependent manner in diabetic rat hearts.

    Science.gov (United States)

    Duicu, Oana M; Privistirescu, Andreea; Wolf, Adrian; Petruş, Alexandra; Dănilă, Maria D; Raţiu, Corina D; Muntean, Danina M; Sturza, Adrian

    2017-11-01

    Diabetic cardiomyopathy has been systematically associated with compromised mitochondrial energetics and increased generation of reactive oxygen species (ROS) that underlie its progression to heart failure. Methylene blue is a redox drug with reported protective effects mainly on brain mitochondria. The purpose of the present study was to characterize the effects of acute administration of methylene blue on mitochondrial respiration, H 2 O 2 production, and calcium sensitivity in rat heart mitochondria isolated from healthy and 2 months (streptozotocin-induced) diabetic rats. Mitochondrial respiratory function was assessed by high-resolution respirometry. H 2 O 2 production and calcium retention capacity were measured spectrofluorimetrically. The addition of methylene blue (0.1 μmol·L -1 ) elicited an increase in oxygen consumption of mitochondria energized with complex I and II substrates in both normal and diseased mitochondria. Interestingly, methylene blue elicited a significant increase in H 2 O 2 release in the presence of complex I substrates (glutamate and malate), but had an opposite effect in mitochondria energized with complex II substrate (succinate). No changes in the calcium retention capacity of healthy or diabetic mitochondria were found in the presence of methylene blue. In conclusion, in cardiac mitochondria isolated from diabetic and nondiabetic rat hearts, methylene blue improved respiratory function and elicited a dichotomic, substrate-dependent effect on ROS production.

  16. Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.

    Science.gov (United States)

    Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C

    2018-05-07

    Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.

  17. Estimation of πd-Interactions in Organic Conductors Including Magnetic Anions

    Science.gov (United States)

    Mori, Takehiko; Katsuhara, Mao

    2002-03-01

    Magnetic interactions in organic conductors including magnetic anions, such as λ-(BETS)2FeCl4 and κ-(BETS)2FeX4 [X = Cl and Br], are estimated from intermolecular overlap integrals; the overlaps between anions afford Jdd, and those between anions and donors give Jπ d. From this, the most stable spin alignments are decided, and such quantities as the Néel and Weiss temperatures, as well as the magnitude of spin polarization on the π-molecules are evaluated on the basis of the mean-field theory of πd-systems. The calculation is extended to several other πd-conductors, which are classified depending on the relative magnitudes of the direct dd- and indirect πd-interactions.

  18. Mitochondrial-targeted aryl hydrocarbon receptor and the impact of 2,3,7,8-tetrachlorodibenzo-p-dioxin on cellular respiration and the mitochondrial proteome

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Hye Jin [Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, MI 48824 (United States); Center for Mitochondrial Science and Medicine, Michigan State University, East Lansing, MI 48824 (United States); Dornbos, Peter [Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, MI 48824 (United States); Institute for Integrative Toxicology, Michigan State University, East Lansing, MI 48824-1319 (United States); Steidemann, Michelle [Institute for Integrative Toxicology, Michigan State University, East Lansing, MI 48824-1319 (United States); Department of Pharmacology and Toxicology, Michigan State University, East Lansing, MI 48824 (United States); Dunivin, Taylor K. [Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, MI 48824 (United States); Rizzo, Mike [Institute for Integrative Toxicology, Michigan State University, East Lansing, MI 48824-1319 (United States); Cell and Molecular Biology Graduate Program, Michigan State University, East Lansing, MI 48824 (United States); LaPres, John J., E-mail: lapres@msu.edu [Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, MI 48824 (United States); Center for Mitochondrial Science and Medicine, Michigan State University, East Lansing, MI 48824 (United States)

    2016-08-01

    The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor within the Per-Arnt-Sim (PAS) domain superfamily. Exposure to the most potent AHR ligand, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), is associated with various pathological effects including metabolic syndrome. While research over the last several years has demonstrated a role for oxidative stress and metabolic dysfunction in AHR-dependent TCDD-induced toxicity, the role of the mitochondria in this process has not been fully explored. Our previous research suggested that a portion of the cellular pool of AHR could be found in the mitochondria (mitoAHR). Using a protease protection assay with digitonin extraction, we have now shown that this mitoAHR is localized to the inter-membrane space (IMS) of the organelle. TCDD exposure induced a degradation of mitoAHR similar to that of cytosolic AHR. Furthermore, siRNA-mediated knockdown revealed that translocase of outer-mitochondrial membrane 20 (TOMM20) was involved in the import of AHR into the mitochondria. In addition, TCDD altered cellular respiration in an AHR-dependent manner to maintain respiratory efficiency as measured by oxygen consumption rate (OCR). Stable isotope labeling by amino acids in cell culture (SILAC) identified a battery of proteins within the mitochondrial proteome influenced by TCDD in an AHR-dependent manner. Among these, 17 proteins with fold changes ≥ 2 are associated with various metabolic pathways, suggesting a role of mitochondrial retrograde signaling in TCDD-mediated pathologies. Collectively, these studies suggest that mitoAHR is localized to the IMS and AHR-dependent TCDD-induced toxicity, including metabolic dysfunction, wasting syndrome, and hepatic steatosis, involves mitochondrial dysfunction. - Highlights: • The mitoAHR is localized in the mitochondrial intermembrane space. • TOMM20 participates in mitoAHR translocation. • AHR contributes to the maintenance of respiratory control ratio following

  19. Sensing mechanism for a fluorescent off–on chemosensor for cyanide anion

    International Nuclear Information System (INIS)

    Li, Yang; Chen, Junsheng; Chu, Tian-Shu

    2016-01-01

    In this article, the sensing mechanism of cyanide anion chemosensor 2-((2-phenyl-2H-1,2,3-triazol-4-yl)methylene)malononitrile (M1) has been investigated through the density functional theory (DFT) and time-dependent density functional theory (TDDFT) methods. The theoretical results demonstrate that the reaction barrier of 13.02 kcal/mol means a favorable response speed of the chemosensor M1 for cyanide anion. Cyanide anion attacks C=C double bond and hinders the ICT process from the malononitrile moiety to the fluorophore phenyl ring. The high viscosity of DMSO restrains the twisting of the group, inhibits the formation of the ICT state in the first excited state. Due to weak ICT character, the nucleophilic addition product shows the dramatic “off–on” fluorescence enhancement. Meanwhile, intramolecular charge transfer (ICT) mechanism accounts for how different solvents influence the fluorescence spectra. That is, more obvious ICT character of product in EtOH causes fluorescence quenching. The “reaction-based” recognition mode and large bond energy between M1 and cyanide anion minimize the interference by other anions, such as F − , AcO − . Thus, the chemosensor M1 has a high selectivity for cyanide.

  20. Size-dependent dynamic stability analysis of microbeams actuated by piezoelectric voltage based on strain gradient elasticity theory

    Energy Technology Data Exchange (ETDEWEB)

    Sahmani, Saeid; Bahrami, Mohsen [Amirkabir University of Technology, Tehran (Iran, Islamic Republic of)

    2015-01-15

    In the current paper, dynamic stability analysis of microbeams subjected to piezoelectric voltage is presented in which the microbeam is integrated with piezoelectric layers on the lower and upper surfaces. Both of the flutter and divergence instabilities of microbeams with clamped-clamped and clamped-free boundary conditions are predicted corresponding to various values of applied voltage. To take size effect into account, the classical Timoshenko beam theory in conjunction with strain gradient elasticity theory is utilized to develop nonclassical beam model containing three additional internal length scale parameters. By using Hamilton's principle, the higher-order governing differential equations and associated boundary conditions are derived. Afterward, generalized differential quadrature method is employed to discretize the size-dependent governing differential equations along with clamped-clamped and clamped-free end supports. The critical piezoelectric voltages corresponding to various values dimensionless length scale parameter are evaluated and compared with those predicted by the classical beam theory. It is revealed that in the case of clamped-free boundary conditions, the both of flutter and divergence instabilities occur. However, for the clamped-clamped microbeams, only divergence instability takes place.

  1. Behavior of neutral solutes in pressurized flow driven electrochromatography using a mixed stationary phase of ODS and anion-exchange.

    Science.gov (United States)

    Kitagawa, Shinya; Tsuda, Takao

    2003-05-02

    The behavior of neutral sample solutes in pressurized flow driven electrochromatography using a mixed stationary phase, which consisted of ODS and anion-exchange (ODS-SAX), was studied. Applications of both positive and negative voltage on a column induced increases in retention factors of sample solutes. The direction of an electroosmotic flow under applications of positive and negative voltage were the same, therefore, the sign of the surface charge density under positive and negative voltage was opposite. We proposed a new equation for the relationship between applied voltage and surface charge density, and the practical electroosmotic flow conformed to this equation. Studying the electroosmotic flow using our proposed equation revealed that the applied negative voltage accelerates the protonation of the quaternary ammonium group and dissociation of the silanol group on packing materials. The retention behavior of a neutral solute was affected by the existence of the charged functional groups. We propose that this phenomenon is applicable to the control of the retention behavior of a sample solute using an electric field.

  2. [Effect of 3-bromopyruvate on mitochondrial membrane potential and apoptosis of human breast carcinoma SK-BR-3 cells].

    Science.gov (United States)

    Zhang, Yuanyuan; Liu, Zhe; Zhang, Qianwen; Chao, Zhenhua; Zhang, Pei; Xia, Fei; Jiang, Chenchen; Liu, Hao; Jiang, Zhiwen

    2013-09-01

    To study the effect of glycolysis inhibitor 3-bromopyruvate (3-BrPA) in inducing apoptosis of human breast carcinoma cells SK-BR-3 and the possible mechanism. MTT assay was used to detect the growth inhibition induced by 3-BrPA in breast cancer cells SK-BR-3. The apoptotic cells were detected by flow cytometry with propidium iodide (PI). ATP levels in the cells were detected by ATP assay kit, and DHE fluorescent probe technique was used to determine superoxide anion levels; the mitochondrial membrane potential was assessed using JC-1 staining assay. MTT assay showed that the proliferation of SK-BR-3 cells was inhibited by 3-BrPA in a time- and concentration-dependent manner. Exposure to 80, 160, and 320 µmol·L(-1) 3-BrPA for 24 h resulted in cell apoptosis rates of 6.7%, 22.3%, and 79.6%, respectively, and the intracellular ATP levels of SK-BR-3 cells treated with 80, 160, 320 µmol·L(-1) 3-BrPA for 5 h were 87.7%, 60.6%, and 23.7% of the control levels. 3-BrPA at 160 µmol·L(-1) increased reactive oxygen levels and lowered mitochondrial membrane potential of SK-BR-3 cells. 3-BrPA can inhibit cell proliferation, reduce the mitochondrial membrane potential and induce apoptosis in SK-BR-3 cells, the mechanism of which may involve a reduced ATP level by inhibiting glycolysis and increasing the reactive oxygen level in the cells.

  3. Measurement and statistical analysis of single-molecule current-voltage characteristics, transition voltage spectroscopy, and tunneling barrier height.

    Science.gov (United States)

    Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian

    2011-11-30

    We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.

  4. Sera of patients with celiac disease and neurologic disorders evoke a mitochondrial-dependent apoptosis in vitro.

    Science.gov (United States)

    Cervio, Elisabetta; Volta, Umberto; Verri, Manuela; Boschi, Federica; Pastoris, Ornella; Granito, Alessandro; Barbara, Giovanni; Parisi, Claudia; Felicani, Cristina; Tonini, Marcello; De Giorgio, Roberto

    2007-07-01

    The mechanisms underlying neurologic impairment in celiac disease remain unknown. We tested whether antineuronal antibody-positive sera of patients with celiac disease evoke neurodegeneration via apoptosis in vitro. SH-Sy5Y cells were exposed to crude sera, isolated immunoglobulin (Ig) G and IgG-depleted sera of patients with and without celiac disease with and without neurologic disorders, and antineuronal antibodies. Adsorption studies with gliadin and tissue transglutaminase (tTG) were performed in celiac disease sera. Apoptosis activated caspase-3, apaf-1, Bax, cytochrome c, cleaved caspase-8 and caspase-9 and mitochondrial respiratory chain complexes were evaluated with different methods. SH-Sy5Y cells exposed to antineuronal antibody-positive sera and isolated IgG from the same sera exhibited a greater percentage of TUNEL-positive nuclei than that of antineuronal antibody-negative sera. Neuroblasts exposed to antineuronal antibody-negative celiac disease sera also showed greater TUNEL positivity and apaf-1 immunolabeled cells than controls. Antigliadin- and anti-tTG-depleted celiac disease sera had an apoptotic effect similar to controls. Anti-caspase-3 immunostained cells were greater than controls when exposed to positive sera. The mitochondrial respiratory chain complex was reduced by positive sera. Western blot demonstrated only caspase-9 cleavage in positive sera. Cytochrome c and Bax showed reciprocal translocation (from mitochondria to cytoplasm and vice versa) after treatment with positive sera. Antineuronal antibodies and, to a lower extent, combined antigliadin and anti-tTG antibodies in celiac disease sera contribute to neurologic impairment via apoptosis. Apaf-1 activation with Bax and cytochrome c translocation suggest a mitochondrial-dependent apoptosis.

  5. Increased intrinsic mitochondrial function in humans with mitochondrial haplogroup H

    DEFF Research Database (Denmark)

    Larsen, Steen; Díez-Sánchez, Carmen; Rabøl, Rasmus

    2014-01-01

    and determined their mitochondrial haplogroup, mitochondrial oxidative phosphorylation capacity (OXPHOS), mitochondrial content (citrate synthase (CS)) and VO2max. Intrinsic mitochondrial function is calculated as mitochondrial OXPHOS capacity divided by mitochondrial content (CS). Haplogroup H showed a 30......% higher intrinsic mitochondrial function compared with the other haplo group U. There was no relationship between haplogroups and VO2max. In skeletal muscle from men with mitochondrial haplogroup H, an increased intrinsic mitochondrial function is present....

  6. The harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter.

    OpenAIRE

    ПАНЧЕНКО, В В

    2015-01-01

    The author investigates a rectifier unit constructed on the basis of cascade connection of the main non-controlled m-pulse rectifier and PWM voltage booster converter. The research presents the analysis of the harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter on completely controlled keys. The dependence of the relative harmonic amplitude on the commutation corner is defined. The estimation of a rectifier unit electromagnetic compatibility wit...

  7. Dual Regulation of Voltage-Sensitive Ion Channels by PIP2

    Directory of Open Access Journals (Sweden)

    Aldo A Rodríguez Menchaca

    2012-09-01

    Full Text Available Over the past 16 years, there has been an impressive number of ion channels shown to be sensitive to the major phosphoinositide in the plasma membrane, phosphatidilinositol 4,5-bisphosphate (PIP2. Among them are voltage-gated channels, which are crucial for both neuronal and cardiac excitability. Voltage-gated calcium (Cav channels were shown to be regulated bidirectionally by PIP2. On one hand, PIP2 stabilized their activity by reducing current rundown but on the other hand it produced a voltage-dependent inhibition by shifting the activation curve to more positive voltages. For voltage-gated potassium (Kv channels PIP2 was first shown to prevent N-type inactivation. Careful examination of the effects of PIP2 on the activation mechanism of Kv1.2 has shown a similar bidirectional regulation as in the Cav channels. The two effects could be distinguished kinetically, in terms of their sensitivities to PIP2 and by distinct molecular determinants. The rightward shift of the Kv1.2 voltage dependence implicated basic residues in the S4-S5 linker and was consistent with stabilization of the inactive state of the voltage sensor. A third type of a voltage-gated ion channel modulated by PIP2 is the hyperpolarization-activated cyclic nucleotide-gated (HCN channel. PIP2 has been shown to enhance the opening of HCN channels by shifting their voltage-dependent activation toward depolarized potentials. The sea urchin HCN channel, SpIH, showed again a PIP2-mediated bidirectional effect but in reverse order than the depolarization-activated Cav and Kv channels: a voltage-dependent potentiation, like the mammalian HCN channels, but also an inhibition of the cGMP-induced current activation. Just like the Kv1.2 channels, distinct molecular determinants underlied the PIP2 dual effects on SpIH channels. The dual regulation of these very different ion channels, all of which are voltage dependent, points to conserved mechanisms of regulation of these channels by PIP2.

  8. Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

    Science.gov (United States)

    Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

    2013-11-01

    As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

  9. Mitochondrial bioenergetics decay in aging: beneficial effect of melatonin.

    Science.gov (United States)

    Paradies, Giuseppe; Paradies, Valeria; Ruggiero, Francesca M; Petrosillo, Giuseppe

    2017-11-01

    Aging is a biological process characterized by progressive decline in physiological functions, increased oxidative stress, reduced capacity to respond to stresses, and increased risk of contracting age-associated disorders. Mitochondria are referred to as the powerhouse of the cell through their role in the oxidative phosphorylation to generate ATP. These organelles contribute to the aging process, mainly through impairment of electron transport chain activity, opening of the mitochondrial permeability transition pore and increased oxidative stress. These events lead to damage to proteins, lipids and mitochondrial DNA. Cardiolipin, a phospholipid of the inner mitochondrial membrane, plays a pivotal role in several mitochondrial bioenergetic processes as well as in mitochondrial-dependent steps of apoptosis and in mitochondrial membrane stability and dynamics. Cardiolipin alterations are associated with mitochondrial bienergetics decline in multiple tissues in a variety of physiopathological conditions, as well as in the aging process. Melatonin, the major product of the pineal gland, is considered an effective protector of mitochondrial bioenergetic function. Melatonin preserves mitochondrial function by preventing cardiolipin oxidation and this may explain, at least in part, the protective role of this compound in mitochondrial physiopathology and aging. Here, mechanisms through which melatonin exerts its protective role against mitochondrial dysfunction associated with aging and age-associated disorders are discussed.

  10. Protein Carbonylation and Adipocyte Mitochondrial Function*

    Science.gov (United States)

    Curtis, Jessica M.; Hahn, Wendy S.; Stone, Matthew D.; Inda, Jacob J.; Droullard, David J.; Kuzmicic, Jovan P.; Donoghue, Margaret A.; Long, Eric K.; Armien, Anibal G.; Lavandero, Sergio; Arriaga, Edgar; Griffin, Timothy J.; Bernlohr, David A.

    2012-01-01

    Carbonylation is the covalent, non-reversible modification of the side chains of cysteine, histidine, and lysine residues by lipid peroxidation end products such as 4-hydroxy- and 4-oxononenal. In adipose tissue the effects of such modifications are associated with increased oxidative stress and metabolic dysregulation centered on mitochondrial energy metabolism. To address the role of protein carbonylation in the pathogenesis of mitochondrial dysfunction, quantitative proteomics was employed to identify specific targets of carbonylation in GSTA4-silenced or overexpressing 3T3-L1 adipocytes. GSTA4-silenced adipocytes displayed elevated carbonylation of several key mitochondrial proteins including the phosphate carrier protein, NADH dehydrogenase 1α subcomplexes 2 and 3, translocase of inner mitochondrial membrane 50, and valyl-tRNA synthetase. Elevated protein carbonylation is accompanied by diminished complex I activity, impaired respiration, increased superoxide production, and a reduction in membrane potential without changes in mitochondrial number, area, or density. Silencing of the phosphate carrier or NADH dehydrogenase 1α subcomplexes 2 or 3 in 3T3-L1 cells results in decreased basal and maximal respiration. These results suggest that protein carbonylation plays a major instigating role in cytokine-dependent mitochondrial dysfunction and may be linked to the development of insulin resistance in the adipocyte. PMID:22822087

  11. Protein carbonylation and adipocyte mitochondrial function.

    Science.gov (United States)

    Curtis, Jessica M; Hahn, Wendy S; Stone, Matthew D; Inda, Jacob J; Droullard, David J; Kuzmicic, Jovan P; Donoghue, Margaret A; Long, Eric K; Armien, Anibal G; Lavandero, Sergio; Arriaga, Edgar; Griffin, Timothy J; Bernlohr, David A

    2012-09-21

    Carbonylation is the covalent, non-reversible modification of the side chains of cysteine, histidine, and lysine residues by lipid peroxidation end products such as 4-hydroxy- and 4-oxononenal. In adipose tissue the effects of such modifications are associated with increased oxidative stress and metabolic dysregulation centered on mitochondrial energy metabolism. To address the role of protein carbonylation in the pathogenesis of mitochondrial dysfunction, quantitative proteomics was employed to identify specific targets of carbonylation in GSTA4-silenced or overexpressing 3T3-L1 adipocytes. GSTA4-silenced adipocytes displayed elevated carbonylation of several key mitochondrial proteins including the phosphate carrier protein, NADH dehydrogenase 1α subcomplexes 2 and 3, translocase of inner mitochondrial membrane 50, and valyl-tRNA synthetase. Elevated protein carbonylation is accompanied by diminished complex I activity, impaired respiration, increased superoxide production, and a reduction in membrane potential without changes in mitochondrial number, area, or density. Silencing of the phosphate carrier or NADH dehydrogenase 1α subcomplexes 2 or 3 in 3T3-L1 cells results in decreased basal and maximal respiration. These results suggest that protein carbonylation plays a major instigating role in cytokine-dependent mitochondrial dysfunction and may be linked to the development of insulin resistance in the adipocyte.

  12. Exponential dependence of potential barrier height on biased voltages of inorganic/organic static induction transistor

    International Nuclear Information System (INIS)

    Zhang Yong; Yang Jianhong; Cai Xueyuan; Wang Zaixing

    2010-01-01

    The exponential dependence of the potential barrier height φ c on the biased voltages of the inorganic/organic static induction transistor (SIT/OSIT) through a normalized approach in the low-current regime is presented. It shows a more accurate description than the linear expression of the potential barrier height. Through the verification of the numerical calculated and experimental results, the exponential dependence of φ c on the applied biases can be used to derive the I-V characteristics. For both SIT and OSIT, the calculated results, using the presented relationship, are agreeable with the experimental results. Compared to the previous linear relationship, the exponential description of φ c can contribute effectively to reduce the error between the theoretical and experimental results of the I-V characteristics. (semiconductor devices)

  13. EQCM Study of Influence of Anion Nature on Electrochemical Reduction of Bismuth Sulfide in Nickel Plating Solution

    Directory of Open Access Journals (Sweden)

    Loreta TAMAŠAUSKAITĖ-TAMAŠIŪNAITĖ

    2011-03-01

    Full Text Available The influence of anion nature on the reduction of bismuth sulfide film deposited on gold using the successive ionic layer adsorption and reaction method in solutions containing Ni2+ ions has been investigated by electrochemical quartz crystal microbalance combined with cyclic voltammetry and X-ray photoelectron spectroscopy. It has been determined that the reduction of bismuth sulfide film in the nickel plating solution depends on the anion nature: larger cathodic current and mass changes (Dƒ are observed in the solution containing acetate anion as compared to those in the solution containing sulfate anion. As the reduction of bismuth sulfide film in the background solutions depends on the nature of anion, it influences the cathodic reduction of Ni2+ ions prior to OPD of Ni. A greater current and mass change (Dƒ is conditioned by simultaneously occurring reduction of bismuth sulfide film when the film is reduced in the acetate nickel plating electrolyte in contrast to that in the sulfate one.http://dx.doi.org/10.5755/j01.ms.17.1.244

  14. Biophysical characterization of the fluorescent protein voltage probe VSFP2.3 based on the voltage-sensing domain of Ci-VSP.

    Science.gov (United States)

    Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas

    2010-11-01

    A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.

  15. The many ways of making anionic clays

    Indian Academy of Sciences (India)

    Together with hydrotalcite-like layered double hydroxides, bivalent and trivalent metal hydroxides and their hydroxy salts are actually anionic clays consisting of positively charged hydroxide layers with anions intercalated in the interlayer region. The anionic clays exhibit anion sorption, anion diffusion and exchange ...

  16. Saikosaponin d induces cell death through caspase-3-dependent, caspase-3-independent and mitochondrial pathways in mammalian hepatic stellate cells

    International Nuclear Information System (INIS)

    Chen, Ming-Feng; Huang, S. Joseph; Huang, Chao-Cheng; Liu, Pei-Shan; Lin, Kun-I; Liu, Ching-Wen; Hsieh, Wen-Chuan; Shiu, Li-Yen; Chen, Chang-Han

    2016-01-01

    Saikosaponin d (SSd) is one of the main active triterpene saponins in Bupleurum falcatum. It has a steroid-like structure, and is reported to have pharmacological activities, including liver protection in rat, cell cycle arrest and apoptosis induction in several cancer cell lines. However, the biological functions and molecular mechanisms of mammalian cells under SSd treatment are still unclear. The cytotoxicity and apoptosis of hepatic stellate cells (HSCs) upon SSd treatment were discovered by MTT assay, colony formation assay and flow cytometry. The collage I/III, caspase activity and apoptotic related genes were examined by quantitative PCR, Western blotting, immunofluorescence and ELISA. The mitochondrial functions were monitored by flow cytometry, MitoTracker staining, ATP production and XF24 bioenergetic assay. This study found that SSd triggers cell death via an apoptosis path. An example of this path might be typical apoptotic morphology, increased sub-G1 phase cell population, inhibition of cell proliferation and activation of caspase-3 and caspase-9. However, the apoptotic effects induced by SSd are partially blocked by the caspase-3 inhibitor, Z-DEVD-FMK, suggesting that SSd may trigger both HSC-T6 and LX-2 cell apoptosis through caspase-3-dependent and independent pathways. We also found that SSd can trigger BAX and BAK translocation from the cytosol to the mitochondria, resulting in mitochondrial function inhibition, membrane potential disruption. Finally, SSd also increases the release of apoptotic factors. The overall analytical data indicate that SSd-elicited cell death may occur through caspase-3-dependent, caspase-3-independent and mitochondrial pathways in mammalian HSCs, and thus can delay the formation of liver fibrosis by reducing the level of HSCs

  17. Inorganic anion-dependent assembly of zero-, one-, two- and three-dimensional Cu(II)/Ag(I) complexes under the guidance of the HSAB theory: Synthesis, structure, and magnetic property

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yaru; Xing, Zhiyan [School of Science, North University of China, Taiyuan, Shanxi 030051 (China); Zhang, Xiao [MIIT Key Laboratory of Critical Materials Technology for New Energy Conversion and Storage, School of Chemistry and Chemical Engineering, Harbin Institute of Technology, Harbin 150080 (China); Key Laboratory of Functional Inorganic Material Chemistry, Ministry of Education, School of Chemistry and Materials Science, Heilongjiang University, Harbin 150080 PR China (China); Liang, Guorui [School of Science, North University of China, Taiyuan, Shanxi 030051 (China)

    2017-02-15

    To systematically explore the influence of inorganic anions on building coordination complexes, five novel complexes based on 1-(benzotriazole-1-methyl)−2-propylimidazole (bpmi), [Cu(bpmi){sub 2}(Ac){sub 2}]·H{sub 2}O (1), [Cu(bpmi){sub 2}(H{sub 2}O){sub 2}]·2NO{sub 3}·2H{sub 2}O (2), [Cu(bpmi)(N{sub 3}){sub 2}] (3), [Ag(bpmi)(NO{sub 3})] (4) and [Cu{sub 3}(bpmi){sub 2}(SCN){sub 4}(DMF)] (5) (Ac{sup −}=CH{sub 3}COO{sup −}, DMF=N,N-Dimethylformamide) are synthesized through rationally introducing Cu(II) salts and Ag(I) salt with different inorganic anions. X-ray single-crystal analyses reveal that these complexes show interesting structural features from mononuclear (1), one-dimensional (2 and 3), two-dimensional (4) to three-dimensional (5) under the influence of inorganic anions with different basicities. The structural variation can be explained by the hard-soft-acid-base (HSAB) theory. Magnetic susceptibility measurement indicates that complex 3 exhibits an antiferromagnetic coupling between adjacent Cu(II) ions. - Graphical abstract: Five new Cu(II)/Ag(I) complexes show interesting structural features from mononuclear, one-dimension, two-dimension to three-dimension under the influence of inorganic anions. The structural variation can be explained by the HSAB theory. - Highlights: • Five inorganic anion-dependent complexes are synthesized. • Structural variation can be explained by the hard-soft-acid-base (HSAB) theory. • The magnetic property of complex has been studied.

  18. CaMKII determines mitochondrial stress responses in heart

    Science.gov (United States)

    Joiner, Mei-ling A.; Koval, Olha M.; Jingdong, Li; He, B. Julie; Allamargot, Chantal; Gao, Zhan; Luczak, Elizabeth D.; Hall, Duane D.; Fink, Brian D.; Chen, Biyi; Yang, Jinying; Moore, Steven A.; Scholz, Thomas D.; Strack, Stefan; Mohler, Peter J.; Sivitz, William I.; Song, Long-Sheng; Anderson, Mark E.

    2012-01-01

    Myocardial cell death is initiated by excessive mitochondrial Ca2+ entry, causing Ca2+ overload, mitochondrial permeability transition pore (mPTP) opening and dissipation of the mitochondrial inner membrane potential (ΔΨm)1,2. However, the signaling pathways that control mitochondrial Ca2+ entry through the inner membrane mitochondrial Ca2+ uniporter (MCU)3–5 are not known. The multifunctional Ca2+ and calmodulin-dependent protein kinase II (CaMKII) is activated in ischemia reperfusion (I/R), myocardial infarction (MI) and neurohumoral injury, common causes of myocardial death and heart failure, suggesting CaMKII could couple disease stress to mitochondrial injury. Here we show that CaMKII promotes mPTP opening and myocardial death by increasing MCU current (IMCU). Mitochondrial-targeted CaMKII inhibitory protein or cyclosporin A (CsA), an mPTP antagonist with clinical efficacy in I/R injury6, equivalently prevent mPTP opening, ΔΨm deterioration and diminish mitochondrial disruption and programmed cell death in response to I/R injury. Mice with myocardial and mitochondrial-targeted CaMKII inhibition are resistant to I/R injury, MI and neurohumoral injury, suggesting pathological actions of CaMKII are substantially mediated by increasing IMCU. Our findings identify CaMKII activity as a central mechanism for mitochondrial Ca2+ entry and suggest mitochondrial-targeted CaMKII inhibition could prevent or reduce myocardial death and heart failure dysfunction in response to common experimental forms of pathophysiological stress. PMID:23051746

  19. Introducing various ligands into superhalogen anions reduces their electronic stabilities

    Science.gov (United States)

    Smuczyńska, Sylwia; Skurski, Piotr

    2008-02-01

    The vertical electron detachment energies (VDE) of six NaX2- anions (where X = F, Cl, Br) were calculated at the OVGF level with the 6-311++G(3df) basis sets. In all the cases studied the VDE exceeds the electron affinity of chlorine atom and thus those species were classified as superhalogen anions. The largest vertical binding energy was found for the NaF2- system (6.644 eV). The strong VDE dependence on the ligand type, ligand-central atom distance, and the character of the highest occupied molecular orbital (HOMO) was observed and discussed.

  20. Crosslinked anion exchange membranes prepared from poly(phenylene oxide) (PPO) for non-aqueous redox flow batteries

    Science.gov (United States)

    Li, Yun; Sniekers, Jeroen; Malaquias, João C.; Van Goethem, Cedric; Binnemans, Koen; Fransaer, Jan; Vankelecom, Ivo F. J.

    2018-02-01

    A stable and eco-friendly anion-exchange membrane (AEM) was prepared and applied in a non-aqueous all-copper redox flow battery (RFB). The AEM was prepared via a simple procedure, leading to a cross-linked structure containing quaternary ammonium groups without involvement of harmful trimethylamine. A network was thus constructed which ensured both ion transport and solvent resistance. The ion exchange capacity (IEC) of the membrane was tuned from 0.49 to 1.03 meq g-1 by varying the content of the 4, 4‧-bipyridine crosslinking agent. The membrane showed a good anion conductivity and retention of copper ions. As a proof of principle, a RFB single cell with this crosslinked membrane yielded a coulombic efficiency of 89%, a voltage efficiency of 61% and an energy efficiency of 54% at 7.5 mA cm-2.

  1. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz

    2012-10-01

    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  2. Mitochondrial Dynamics: Coupling Mitochondrial Fitness with Healthy Aging.

    Science.gov (United States)

    Sebastián, David; Palacín, Manuel; Zorzano, Antonio

    2017-03-01

    Aging is associated with a decline in mitochondrial function and the accumulation of abnormal mitochondria. However, the precise mechanisms by which aging promotes these mitochondrial alterations and the role of the latter in aging are still not fully understood. Mitochondrial dynamics is a key process regulating mitochondrial function and quality. Altered expression of some mitochondrial dynamics proteins has been recently associated with aging and with age-related alterations in yeast, Caenorhabditis elegans, mice, and humans. Here, we review the link between alterations in mitochondrial dynamics, aging, and age-related impairment. We propose that the dysregulation of mitochondrial dynamics leads to age-induced accumulation of unhealthy mitochondria and contributes to alterations linked to aging, such as diabetes and neurodegeneration. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Voltage Unbalance Compensation with Smart Three-phase Loads

    DEFF Research Database (Denmark)

    Douglass, Philip; Trintis, Ionut; Munk-Nielsen, Stig

    2016-01-01

    unbalance originating in the power supply network. Two variants of the algorithm are tested: first, using phase-neutral voltage as input, second, using phase-phase voltage. The control algorithm is described, and evaluated in simulations and laboratory tests. Two metrics for quantifying voltage unbalance...... are evaluated: one metric based on the maximum deviation of RMS phaseneutral voltage from the average voltage and one metric based on negative sequence voltage. The tests show that controller that uses phase-neutral voltage as input can in most cases eliminate the deviations of phase voltage from the average...... is caused by asymmetrical loads. These results suggest that the optimal algorithm to reduce system unbalance depends on which system parameter is most important: phase-neutral voltage unbalance, phase-phase voltage unbalance, or current unbalance....

  4. Supramolecular Chemistry of Environmentally Relevant Anions

    International Nuclear Information System (INIS)

    Bowman-James, Kristin; Moyer, B.A.; Sessler, Jonathan L.

    2003-01-01

    The goal of this project is the development of highly selective extractants for anions targeting important and timely problems of critical interest to the EMSP mission. In particular, sulfate poses a special problem in cleaning up the Hanford waste tanks in that it interferes with vitrification, but available technologies for sulfate removal are limited. The basic chemical aspects of anion receptor design of functional pH independent systems as well as design of separations strategies for selective and efficient removal of targeted anions have been probed. Key findings include: (1) some of the first synthetic sulfate-selective anion-binding agents; (2) simple, structure-based methods for modifying the intrinsic anion selectivity of a given class of anion receptors; and (3) the first system capable of extracting sulfate from acidic, nitrate-containing aqueous media. Receptor design, structural influences on anion binding affinities, and findings from liquid-liquid extraction studies will be discussed

  5. Hydration of a Large Anionic Charge Distribution - Naphthalene-Water Cluster Anions

    Science.gov (United States)

    Weber, J. Mathias; Adams, Christopher L.

    2010-06-01

    We report the infrared spectra of anionic clusters of naphthalene with up to three water molecules. Comparison of the experimental infrared spectra with theoretically predicted spectra from quantum chemistry calculations allow conclusions regarding the structures of the clusters under study. The first water molecule forms two hydrogen bonds with the π electron system of the naphthalene moiety. Subsequent water ligands interact with both the naphthalene and the other water ligands to form hydrogen bonded networks, similar to other hydrated anion clusters. Naphthalene-water anion clusters illustrate how water interacts with negative charge delocalized over a large π electron system. The clusters are interesting model systems that are discussed in the context of wetting of graphene surfaces and polyaromatic hydrocarbons.

  6. Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

    Science.gov (United States)

    Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

    2018-05-01

    Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

  7. Supramolecular Chemistry of Selective Anion Recognition for Anions of Environmental Relevance

    International Nuclear Information System (INIS)

    Bowman-James, K.; Wilson, G.; Moyer, B. A.

    2004-01-01

    This project involves the design and synthesis of receptors for oxoanions of environmental importance, including emphasis on high level and low activity waste. Target anions have included primarily oxoanions and a study of the basic concepts behind selective binding of target anions. A primary target has been sulfate because of its deleterious influence on the vitrification of tank wastes

  8. A Novel Index for Online Voltage Stability Assessment Based on Correlation Characteristic of Voltage Profiles

    Directory of Open Access Journals (Sweden)

    M. R. Aghamohammadi

    2011-06-01

    Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.

  9. Mitochondrial quality control: a matter of life and death for neurons

    OpenAIRE

    Rugarli, Elena I; Langer, Thomas

    2012-01-01

    Mitochondrial integrity and functionality is monitored via multiple levels of cellular and organellar quality control that critically depend on mitochondrial proteases. Defects in these surveillance mechanisms cause neuronal loss in a number of prevalent neurodegenerative diseases.

  10. Sensing mechanism for a fluorescent off–on chemosensor for cyanide anion

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yang [State Key Laboratory of Molecular Reaction Dynamics, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Chen, Junsheng [State Key Laboratory of Molecular Reaction Dynamics, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Chu, Tian-Shu, E-mail: tschu@dicp.ac.cn [State Key Laboratory of Molecular Reaction Dynamics, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023 (China); Institute for Computational Sciences and Engineering, Laboratory of New Fiber, Materials and Modern Textile, the Growing Base for State Key Laboratory, Qingdao University, Qingdao 266071 (China)

    2016-11-15

    In this article, the sensing mechanism of cyanide anion chemosensor 2-((2-phenyl-2H-1,2,3-triazol-4-yl)methylene)malononitrile (M1) has been investigated through the density functional theory (DFT) and time-dependent density functional theory (TDDFT) methods. The theoretical results demonstrate that the reaction barrier of 13.02 kcal/mol means a favorable response speed of the chemosensor M1 for cyanide anion. Cyanide anion attacks C=C double bond and hinders the ICT process from the malononitrile moiety to the fluorophore phenyl ring. The high viscosity of DMSO restrains the twisting of the group, inhibits the formation of the ICT state in the first excited state. Due to weak ICT character, the nucleophilic addition product shows the dramatic “off–on” fluorescence enhancement. Meanwhile, intramolecular charge transfer (ICT) mechanism accounts for how different solvents influence the fluorescence spectra. That is, more obvious ICT character of product in EtOH causes fluorescence quenching. The “reaction-based” recognition mode and large bond energy between M1 and cyanide anion minimize the interference by other anions, such as F{sup −}, AcO{sup −}. Thus, the chemosensor M1 has a high selectivity for cyanide.

  11. Infrared multiple photon dissociation spectroscopy of sodium and potassium chlorate anions.

    Science.gov (United States)

    Dain, Ryan P; Leavitt, Christopher M; Oomens, Jos; Steill, Jeffrey D; Groenewold, Gary S; Van Stipdonk, Michael J

    2010-01-01

    The structures of gas-phase, metal chlorate anions with the formula [M(ClO(3))(2)](-), M = Na and K, were determined using tandem mass spectrometry and infrared multiple photon dissociation (IRMPD) spectroscopy. Structural assignments for both anions are based on comparisons of the experimental vibrational spectra for the two species with those predicted by density functional theory (DFT) and involve conformations that feature either bidentate or tridentate coordination of the cation by chlorate. Our results strongly suggest that a structure in which both chlorate anions are bidentate ligands is preferred for [Na(ClO(3))(2)](-). However, for [K(ClO(3))(2)](-) the best agreement between experimental and theoretical spectra is obtained from a composite of predicted spectra for which the chlorate anions are either both bidentate or both tridentate ligands. In general, we find that the overall accuracy of DFT calculations for prediction of IR spectra is dependent on both functional and basis set, with best agreement achieved using frequencies generated at the B3LYP/6-311+g(3df) level of theory. Copyright 2009 John Wiley & Sons, Ltd.

  12. Loss of VPS13C Function in Autosomal-Recessive Parkinsonism Causes Mitochondrial Dysfunction and Increases PINK1/Parkin-Dependent Mitophagy.

    Science.gov (United States)

    Lesage, Suzanne; Drouet, Valérie; Majounie, Elisa; Deramecourt, Vincent; Jacoupy, Maxime; Nicolas, Aude; Cormier-Dequaire, Florence; Hassoun, Sidi Mohamed; Pujol, Claire; Ciura, Sorana; Erpapazoglou, Zoi; Usenko, Tatiana; Maurage, Claude-Alain; Sahbatou, Mourad; Liebau, Stefan; Ding, Jinhui; Bilgic, Basar; Emre, Murat; Erginel-Unaltuna, Nihan; Guven, Gamze; Tison, François; Tranchant, Christine; Vidailhet, Marie; Corvol, Jean-Christophe; Krack, Paul; Leutenegger, Anne-Louise; Nalls, Michael A; Hernandez, Dena G; Heutink, Peter; Gibbs, J Raphael; Hardy, John; Wood, Nicholas W; Gasser, Thomas; Durr, Alexandra; Deleuze, Jean-François; Tazir, Meriem; Destée, Alain; Lohmann, Ebba; Kabashi, Edor; Singleton, Andrew; Corti, Olga; Brice, Alexis

    2016-03-03

    Autosomal-recessive early-onset parkinsonism is clinically and genetically heterogeneous. The genetic causes of approximately 50% of autosomal-recessive early-onset forms of Parkinson disease (PD) remain to be elucidated. Homozygozity mapping and exome sequencing in 62 isolated individuals with early-onset parkinsonism and confirmed consanguinity followed by data mining in the exomes of 1,348 PD-affected individuals identified, in three isolated subjects, homozygous or compound heterozygous truncating mutations in vacuolar protein sorting 13C (VPS13C). VPS13C mutations are associated with a distinct form of early-onset parkinsonism characterized by rapid and severe disease progression and early cognitive decline; the pathological features were striking and reminiscent of diffuse Lewy body disease. In cell models, VPS13C partly localized to the outer membrane of mitochondria. Silencing of VPS13C was associated with lower mitochondrial membrane potential, mitochondrial fragmentation, increased respiration rates, exacerbated PINK1/Parkin-dependent mitophagy, and transcriptional upregulation of PARK2 in response to mitochondrial damage. This work suggests that loss of function of VPS13C is a cause of autosomal-recessive early-onset parkinsonism with a distinctive phenotype of rapid and severe progression. Copyright © 2016 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  13. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    International Nuclear Information System (INIS)

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

    1986-01-01

    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

  14. Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain

    Directory of Open Access Journals (Sweden)

    Yukiko eMishina

    2014-09-01

    Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

  15. Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.

    Science.gov (United States)

    Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas

    2014-01-01

    Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

  16. Astaxanthin Restrains Nitrative-Oxidative Peroxidation in Mitochondrial-Mimetic Liposomes: A Pre-Apoptosis Model

    Science.gov (United States)

    Mano, Camila M.; Cardozo, Karina H. M.; Colepicolo, Pio; Bechara, Etelvino J. H.

    2018-01-01

    Astaxanthin (ASTA) is a ketocarotenoid found in many marine organisms and that affords many benefits to human health. ASTA is particularly effective against radical-mediated lipid peroxidation, and recent findings hypothesize a “mitochondrial-targeted” action of ASTA in cells. Therefore, we examined the protective effects of ASTA against lipid peroxidation in zwitterionic phosphatidylcholine liposomes (PCLs) and anionic phosphatidylcholine: phosphatidylglycerol liposomes (PCPGLs), at different pHs (6.2 to 8.0), which were challenged by oxidizing/nitrating conditions that mimic the regular and preapoptotic redox environment of active mitochondria. Pre-apoptotic conditions were created by oxidized/nitr(osyl)ated cytochrome c and resulted in the highest levels of lipoperoxidation in both PCL and PCPGLs (pH 7.4). ASTA was less protective at acidic conditions, especially in anionic PCPGLs. Our data demonstrated the ability of ASTA to hamper oxidative and nitrative events that lead to cytochrome c-peroxidase apoptosis and lipid peroxidation, although its efficiency changes with pH and lipid composition of membranes. PMID:29649159

  17. Optogenetic control of mitochondrial metabolism and Ca2+ signaling by mitochondria-targeted opsins.

    Science.gov (United States)

    Tkatch, Tatiana; Greotti, Elisa; Baranauskas, Gytis; Pendin, Diana; Roy, Soumitra; Nita, Luliaoana I; Wettmarshausen, Jennifer; Prigge, Matthias; Yizhar, Ofer; Shirihai, Orian S; Fishman, Daniel; Hershfinkel, Michal; Fleidervish, Ilya A; Perocchi, Fabiana; Pozzan, Tullio; Sekler, Israel

    2017-06-27

    Key mitochondrial functions such as ATP production, Ca 2+ uptake and release, and substrate accumulation depend on the proton electrochemical gradient (ΔμH + ) across the inner membrane. Although several drugs can modulate ΔμH + , their effects are hardly reversible, and lack cellular specificity and spatial resolution. Although channelrhodopsins are widely used to modulate the plasma membrane potential of excitable cells, mitochondria have thus far eluded optogenetic control. Here we describe a toolkit of optometabolic constructs based on selective targeting of channelrhodopsins with distinct functional properties to the inner mitochondrial membrane of intact cells. We show that our strategy enables a light-dependent control of the mitochondrial membrane potential (Δψ m ) and coupled mitochondrial functions such as ATP synthesis by oxidative phosphorylation, Ca 2+ dynamics, and respiratory metabolism. By directly modulating Δψ m , the mitochondria-targeted opsins were used to control complex physiological processes such as spontaneous beats in cardiac myocytes and glucose-dependent ATP increase in pancreatic β-cells. Furthermore, our optometabolic tools allow modulation of mitochondrial functions in single cells and defined cell regions.

  18. Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

    Science.gov (United States)

    Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

    2016-06-01

    Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms

  19. Benzaldehyde thiosemicarbazone derived from limonene complexed with copper induced mitochondrial dysfunction in Leishmania amazonensis.

    Directory of Open Access Journals (Sweden)

    Elizandra Aparecida Britta

    Full Text Available BACKGROUND: Leishmaniasis is a major health problem that affects more than 12 million people. Treatment presents several problems, including high toxicity and many adverse effects, leading to the discontinuation of treatment and emergence of resistant strains. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the in vitro antileishmanial activity of benzaldehyde thiosemicarbazone derived from limonene complexed with copper, termed BenzCo, against Leishmania amazonensis. BenzCo inhibited the growth of the promastigote and axenic amastigote forms, with IC(50 concentrations of 3.8 and 9.5 µM, respectively, with 72 h of incubation. Intracellular amastigotes were inhibited by the compound, with an IC(50 of 10.7 µM. BenzCo altered the shape, size, and ultrastructure of the parasites. Mitochondrial membrane depolarization was observed in protozoa treated with BenzCo but caused no alterations in the plasma membrane. Additionally, BenzCo induced lipoperoxidation and the production of mitochondrial superoxide anion radicals in promastigotes and axenic amastigotes of Leishmania amazonensis. CONCLUSION/SIGNIFICANCE: Our studies indicated that the antileishmania activity of BenzCo might be associated with mitochondrial dysfunction and oxidative damage, leading to parasite death.

  20. Actin and myosin contribute to mammalian mitochondrial DNA maintenance

    Science.gov (United States)

    Reyes, A.; He, J.; Mao, C. C.; Bailey, L. J.; Di Re, M.; Sembongi, H.; Kazak, L.; Dzionek, K.; Holmes, J. B.; Cluett, T. J.; Harbour, M. E.; Fearnley, I. M.; Crouch, R. J.; Conti, M. A.; Adelstein, R. S.; Walker, J. E.; Holt, I. J.

    2011-01-01

    Mitochondrial DNA maintenance and segregation are dependent on the actin cytoskeleton in budding yeast. We found two cytoskeletal proteins among six proteins tightly associated with rat liver mitochondrial DNA: non-muscle myosin heavy chain IIA and β-actin. In human cells, transient gene silencing of MYH9 (encoding non-muscle myosin heavy chain IIA), or the closely related MYH10 gene (encoding non-muscle myosin heavy chain IIB), altered the topology and increased the copy number of mitochondrial DNA; and the latter effect was enhanced when both genes were targeted simultaneously. In contrast, genetic ablation of non-muscle myosin IIB was associated with a 60% decrease in mitochondrial DNA copy number in mouse embryonic fibroblasts, compared to control cells. Gene silencing of β-actin also affected mitochondrial DNA copy number and organization. Protease-protection experiments and iodixanol gradient analysis suggest some β-actin and non-muscle myosin heavy chain IIA reside within human mitochondria and confirm that they are associated with mitochondrial DNA. Collectively, these results strongly implicate the actomyosin cytoskeleton in mammalian mitochondrial DNA maintenance. PMID:21398640

  1. 17β-Estradiol prevents cell death and mitochondrial dysfunction by an estrogen receptor-dependent mechanism in astrocytes after oxygen-glucose deprivation/reperfusion.

    Science.gov (United States)

    Guo, Jiabin; Duckles, Sue P; Weiss, John H; Li, Xuejun; Krause, Diana N

    17β-Estradiol (E2) has been shown to protect against ischemic brain injury, yet its targets and the mechanisms are unclear. E2 may exert multiple regulatory actions on astrocytes that may greatly contribute to its ability to protect the brain. Mitochondria are recognized as playing central roles in the development of injury during ischemia. Increasing evidence indicates that mitochondrial mechanisms are critically involved in E2-mediated protection. In this study, the effects of E2 and the role of mitochondria were evaluated in primary cultures of astrocytes subjected to an ischemia-like condition of oxygen-glucose deprivation (OGD)/reperfusion. We showed that E2 treatment significantly protects against OGD/reperfusion-induced cell death as determined by cell viability, apoptosis, and lactate dehydrogenase leakage. The protective effects of E2 on astrocytic survival were blocked by an estrogen receptor (ER) antagonist (ICI-182,780) and were mimicked by an ER agonist selective for ERα (PPT), but not by an ER agonist selective for ERβ (DPN). OGD/reperfusion provoked mitochondrial dysfunction as manifested by an increase in cellular reactive oxygen species production, loss of mitochondrial membrane potential, and depletion of ATP. E2 pretreatment significantly inhibited OGD/reperfusion-induced mitochondrial dysfunction, and this effect was also blocked by ICI-182,780. Therefore, we conclude that E2 provides direct protection to astrocytes from ischemic injury by an ER-dependent mechanism, highlighting an important role for ERα. Estrogen protects against mitochondrial dysfunction at the early phase of ischemic injury. However, overall implications for protection against brain ischemia and its complex sequelae await further exploration. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. DJ-1 KNOCK-DOWN IMPAIRS ASTROCYTE MITOCHONDRIAL FUNCTION

    Science.gov (United States)

    LARSEN, N. J.; AMBROSI, G.; MULLETT, S. J.; BERMAN, S. B.; HINKLE, D. A.

    2012-01-01

    Mitochondrial dysfunction has long been implicated in the pathogenesis of Parkinson’s disease (PD). PD brain tissues show evidence for mitochondrial respiratory chain Complex I deficiency. Pharmacological inhibitors of Complex I, such as rotenone, cause experimental parkinsonism. The cytoprotective protein DJ-1, whose deletion is sufficient to cause genetic PD, is also known to have mitochondria-stabilizing properties. We have previously shown that DJ-1 is over-expressed in PD astrocytes, and that DJ-1 deficiency impairs the capacity of astrocytes to protect co-cultured neurons against rotenone. Since DJ-1 modulated, astrocyte-mediated neuroprotection against rotenone may depend upon proper astrocytic mitochondrial functioning, we hypothesized that DJ-1 deficiency would impair astrocyte mitochondrial motility, fission/fusion dynamics, membrane potential maintenance, and respiration, both at baseline and as an enhancement of rotenone-induced mitochondrial dysfunction. In astrocyte-enriched cultures, we observed that DJ-1 knock-down reduced mitochondrial motility primarily in the cellular processes of both untreated and rotenone treated cells. In these same cultures, DJ-1 knock-down did not appreciably affect mitochondrial fission, fusion, or respiration, but did enhance rotenone-induced reductions in the mitochondrial membrane potential. In neuron–astrocyte co-cultures, astrocytic DJ-1 knock-down reduced astrocyte process mitochondrial motility in untreated cells, but this effect was not maintained in the presence of rotenone. In the same co-cultures, astrocytic DJ-1 knock-down significantly reduced mitochondrial fusion in the astrocyte cell bodies, but not the processes, under the same conditions of rotenone treatment in which DJ-1 deficiency is known to impair astrocyte-mediated neuroprotection. Our studies therefore demonstrated the following new findings: (i) DJ-1 deficiency can impair astrocyte mitochondrial physiology at multiple levels, (ii) astrocyte

  3. Molecular cloning of a peroxisomal Ca2+-dependent member of the mitochondrial carrier superfamily

    Science.gov (United States)

    Weber, Franz E.; Minestrini, Gianluca; Dyer, James H.; Werder, Moritz; Boffelli, Dario; Compassi, Sabina; Wehrli, Ernst; Thomas, Richard M.; Schulthess, Georg; Hauser, Helmut

    1997-01-01

    A cDNA from a novel Ca2+-dependent member of the mitochondrial solute carrier superfamily was isolated from a rabbit small intestinal cDNA library. The full-length cDNA clone was 3,298 nt long and coded for a protein of 475 amino acids, with four elongation factor-hand motifs located in the N-terminal half of the molecule. The 25-kDa N-terminal polypeptide was expressed in Escherichia coli, and it was demonstrated that it bound Ca2+, undergoing a reversible and specific conformational change as a result. The conformation of the polypeptide was sensitive to Ca2+ which was bound with high affinity (Kd ≈ 0.37 μM), the apparent Hill coefficient for Ca2+-induced changes being about 2.0. The deduced amino acid sequence of the C-terminal half of the molecule revealed 78% homology to Grave disease carrier protein and 67% homology to human ADP/ATP translocase; this sequence homology identified the protein as a new member of the mitochondrial transporter superfamily. Northern blot analysis revealed the presence of a single transcript of about 3,500 bases, and low expression of the transporter could be detected in the kidney but none in the liver. The main site of expression was the colon with smaller amounts found in the small intestine proximal to the ileum. Immunoelectron microscopy localized the transporter in the peroxisome, although a minor fraction was found in the mitochondria. The Ca2+ binding N-terminal half of the transporter faces the cytosol. PMID:9238007

  4. Methods and systems for measuring anions

    KAUST Repository

    Masih, Dilshad; Mohammed, Omar F.; Aly, Shawkat M.; Alarousu, Erkki

    2016-01-01

    Embodiments of the present disclosure provide for methods for detecting the presence and/or concentration of anions in a solution, systems for detecting the presence and/or concentration of anions in a solution, anion sensor systems, and the like.

  5. Methods and systems for measuring anions

    KAUST Repository

    Masih, Dilshad

    2016-08-18

    Embodiments of the present disclosure provide for methods for detecting the presence and/or concentration of anions in a solution, systems for detecting the presence and/or concentration of anions in a solution, anion sensor systems, and the like.

  6. Bias voltage dependence of a flux-sensitive Al/GaAs/Al (SNS) interferometer

    DEFF Research Database (Denmark)

    Kutchinsky, Jonatan; Taboryski, Rafael Jozef; Hansen, Jørn Bindslev

    1999-01-01

    bias voltage the fabricated interferometers typically exhibit 3% sinusoidal modulation of the conductance as a function of a magnetic field applied perpendicular to the loop. The conductance modulation is caused by resonant Andreev states in the normal GaAs region of the device. With increasing bias...... voltage of the order of a few microvolts the device is driven out of resonance and the conductance oscillations are extinguished. However, at higher bias voltage corresponding to the superconducting energy gap of Al (178 mu V) the conductance oscillations reappear but with reduced amplitude...

  7. Phosphazene-promoted anionic polymerization

    KAUST Repository

    Zhao, Junpeng

    2014-01-01

    In the recent surge of metal-free polymerization techniques, phosphazene bases have shown their remarkable potential as organic promoters/catalysts for the anionic polymerization of various types of monomers. By complexation with the counterion (e.g. proton or lithium cation), phosphazene base significantly improve the nucleophilicity of the initiator/chain-end resulting in rapid and usually controlled anionic/quasi-anionic polymerization. In this review, we will introduce the general mechanism, i.e. in situ activation (of initiating sites) and polymerization, and summarize the applications of such a mechanism on macromolecular engineering toward functionalized polymers, block copolymers and complex macromolecular architectures.

  8. Separating inverse spin Hall voltage and spin rectification voltage by inverting spin injection direction

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wenxu, E-mail: xwzhang@uestc.edu.cn; Peng, Bin; Han, Fangbin; Wang, Qiuru; Zhang, Wanli [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Soh, Wee Tee; Ong, Chong Kim [Center for Superconducting and Magnetic Materials, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117551 (Singapore)

    2016-03-07

    We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.

  9. Glial and Neuronal Glutamate Transporters Differ in the Na+ Requirements for Activation of the Substrate-Independent Anion Conductance

    Directory of Open Access Journals (Sweden)

    Christopher B. Divito

    2017-05-01

    Full Text Available Excitatory amino acid transporters (EAATs are secondary active transporters of L-glutamate and L- or D-aspartate. These carriers also mediate a thermodynamically uncoupled anion conductance that is gated by Na+ and substrate binding. The activation of the anion channel by binding of Na+ alone, however, has only been demonstrated for mammalian EAAC1 (EAAT3 and EAAT4. To date, no difference has been observed for the substrate dependence of anion channel gating between the glial, EAAT1 and EAAT2, and the neuronal isoforms EAAT3, EAAT4 and EAAT5. Here we describe a difference in the Na+-dependence of anion channel gating between glial and neuronal isoforms. Chloride flux through transporters without glutamate binding has previously been described as substrate-independent or “leak” channel activity. Choline or N-methyl-D-glucamine replacement of external Na+ ions significantly reduced or abolished substrate-independent EAAT channel activity in EAAT3 and EAAT4 yet has no effect on EAAT1 or EAAT2. The interaction of Na+ with the neuronal carrier isoforms was concentration dependent, consistent with previous data. The presence of substrate and Na+-independent open states in the glial EAAT isoforms is a novel finding in the field of EAAT function. Our results reveal an important divergence in anion channel function between glial and neuronal glutamate transporters and highlight new potential roles for the EAAT-associated anion channel activity based on transporter expression and localization in the central nervous system.

  10. ESR study of the anion radicals of 5-nitropyrimidines: conversion to iminoxy radicals

    International Nuclear Information System (INIS)

    Sevilla, M.D.; Clark, C.; Failor, R.

    1976-01-01

    The anion radicals of a number of 5-nitropyrimidines have been investigated by ESR spectroscopy. The anions are formed by electrolysis in dimethylformamide and by electron attachment in aqueous glasses, 12 M LiCl--D 2 O and 8 M NaOD. The electrolysis of 5-nitrouracil and 5-nitro-6-methyluracil results in relatively stable anion radicals. The results for 5-nitrouracil give evidence for two or perhaps three anions which differ only by the degree of ring nitrogen protonation. The results for 5-nitro-6-methyluracil suggest that the nitro group of the anion is twisted so that it is coupled only weakly to the ring π-electron system. The anions of 5-nitrouracil, 5-nitroorotic acid, 5-nitrobarbituric acid, and 5-nitro-6-methyluracil have been produced in the alkaline and neutral aqueous glasses. The anisotropic spectra found have been analyzed with the aid of computer simulations which assume axial symmetry. For example, the analysis of the spectrum of 5-nitrouracil anion in 12 M LiCl yields A/sub parallel//sup N/ = 33; A/sub perpendicular to//sup N/ = 5, a 6 /sup H/ = 5.5 G, g/sub parallel/ = 2.0016, and g/sub perpendicular to/ = 2.0059. A concentration dependence in the splittings is noted and discussed. Ultraviolet photolysis of the anions of 5-nitro-6-methyluracil and 5-nitrobarbituric acid results in the formation of iminoxy radicals. Mechanisms of formation of the iminoxy radicals are discussed and results found in this work are compared to results found in single crystals and aqueous solution

  11. Mitochondrial myopathies.

    Science.gov (United States)

    DiMauro, Salvatore

    2006-11-01

    Our understanding of mitochondrial diseases (defined restrictively as defects of the mitochondrial respiratory chain) is expanding rapidly. In this review, I will give the latest information on disorders affecting predominantly or exclusively skeletal muscle. The most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency and mutations in genes controlling mitochondrial DNA abundance and structure, such as POLG, TK2, and MPV17. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with decreased amount and altered structure of cardiolipin, the main phospholipid of the inner mitochondrial membrane, but a secondary impairment of respiratory chain function is plausible. The role of mutations in protein-coding genes of mitochondrial DNA in causing isolated myopathies has been confirmed. Mutations in tRNA genes of mitochondrial DNA can also cause predominantly myopathic syndromes and--contrary to conventional wisdom--these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, cramps, recurrent myoglobinuria, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  12. Origin of the transition voltage in gold–vacuum–gold atomic junctions

    International Nuclear Information System (INIS)

    Wu Kunlin; Bai Meilin; Hou Shimin; Sanvito, Stefano

    2013-01-01

    The origin and the distance dependence of the transition voltage of gold–vacuum–gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold–vacuum–gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold–vacuum–gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. (paper)

  13. Cationic and Anionic Disorder in CZTSSe Kesterite Compounds: A Chemical Crystallography Study.

    Science.gov (United States)

    Bais, Pierre; Caldes, Maria Teresa; Paris, Michaël; Guillot-Deudon, Catherine; Fertey, Pierre; Domengès, Bernadette; Lafond, Alain

    2017-10-02

    The cationic and anionic disorder in the Cu 2 ZnSnSe 4 -Cu 2 ZnSnS 4 (CZTSe-CZTS) system has been investigated through a chemical crystallography approach including X-ray diffraction (in conventional and resonant setup), 119 Sn and 77 Se NMR spectroscopy, and high-resolution transmission electron microscopy (HRTEM) techniques. Single-crystal XRD analysis demonstrates that the studied compounds behave as a solid solution with the kesterite crystal structure in the whole S/(S + Se) composition range. As previously reported for pure sulfide and pure selenide compounds, the 119 Sn NMR spectroscopy study gives clear evidence that the level of Cu/Zn disorder in mixed S/Se compounds depends on the thermal history of the samples (slow cooled or quenched). This conclusion is also supported by the investigation of the 77 Se NMR spectra. The resonant single-crystal XRD technique shows that regardless of the duration of annealing step below the order-disorder critical temperature the ordering is not a long-range phenomenon. Finally, for the very first time, HREM images of pure selenide and mixed S/Se crystals clearly show that these compounds have different microstructures. Indeed, only the mixed S/Se compound exhibits a mosaic-type contrast which could be the sign of short-range anionic order. Calculated images corroborate that HRTEM contrast is highly dependent on the nature of the anion as well as on the local anionic order.

  14. Mitochondrial nucleoid interacting proteins support mitochondrial protein synthesis.

    Science.gov (United States)

    He, J; Cooper, H M; Reyes, A; Di Re, M; Sembongi, H; Litwin, T R; Gao, J; Neuman, K C; Fearnley, I M; Spinazzola, A; Walker, J E; Holt, I J

    2012-07-01

    Mitochondrial ribosomes and translation factors co-purify with mitochondrial nucleoids of human cells, based on affinity protein purification of tagged mitochondrial DNA binding proteins. Among the most frequently identified proteins were ATAD3 and prohibitin, which have been identified previously as nucleoid components, using a variety of methods. Both proteins are demonstrated to be required for mitochondrial protein synthesis in human cultured cells, and the major binding partner of ATAD3 is the mitochondrial ribosome. Altered ATAD3 expression also perturbs mtDNA maintenance and replication. These findings suggest an intimate association between nucleoids and the machinery of protein synthesis in mitochondria. ATAD3 and prohibitin are tightly associated with the mitochondrial membranes and so we propose that they support nucleic acid complexes at the inner membrane of the mitochondrion.

  15. Mitochondrial depolarization in yeast zygotes inhibits clonal expansion of selfish mtDNA.

    Science.gov (United States)

    Karavaeva, Iuliia E; Golyshev, Sergey A; Smirnova, Ekaterina A; Sokolov, Svyatoslav S; Severin, Fedor F; Knorre, Dmitry A

    2017-04-01

    Non-identical copies of mitochondrial DNA (mtDNA) compete with each other within a cell and the ultimate variant of mtDNA present depends on their relative replication rates. Using yeast Saccharomyces cerevisiae cells as a model, we studied the effects of mitochondrial inhibitors on the competition between wild-type mtDNA and mutant selfish mtDNA in heteroplasmic zygotes. We found that decreasing mitochondrial transmembrane potential by adding uncouplers or valinomycin changes the competition outcomes in favor of the wild-type mtDNA. This effect was significantly lower in cells with disrupted mitochondria fission or repression of the autophagy-related genes ATG8 , ATG32 or ATG33 , implying that heteroplasmic zygotes activate mitochondrial degradation in response to the depolarization. Moreover, the rate of mitochondrially targeted GFP turnover was higher in zygotes treated with uncoupler than in haploid cells or untreated zygotes. Finally, we showed that vacuoles of zygotes with uncoupler-activated autophagy contained DNA. Taken together, our data demonstrate that mitochondrial depolarization inhibits clonal expansion of selfish mtDNA and this effect depends on mitochondrial fission and autophagy. These observations suggest an activation of mitochondria quality control mechanisms in heteroplasmic yeast zygotes. © 2017. Published by The Company of Biologists Ltd.

  16. Anion-π Catalysts with Axial Chirality.

    Science.gov (United States)

    Wang, Chao; Matile, Stefan

    2017-09-04

    The idea of anion-π catalysis is to stabilize anionic transition states by anion-π interactions on aromatic surfaces. For asymmetric anion-π catalysis, π-acidic surfaces have been surrounded with stereogenic centers. This manuscript introduces the first anion-π catalysts that operate with axial chirality. Bifunctional catalysts with tertiary amine bases next to π-acidic naphthalenediimide planes are equipped with a bulky aromatic substituent in the imide position to produce separable atropisomers. The addition of malonic acid half thioesters to enolate acceptors is used for evaluation. In the presence of a chiral axis, the selective acceleration of the disfavored but relevant enolate addition was much better than with point chirality, and enantioselectivity could be observed for the first time for this reaction with small-molecule anion-π catalysts. Enantioselectivity increased with the π acidity of the π surface, whereas the addition of stereogenic centers around the aromatic plane did not cause further improvements. These results identify axial chirality of the active aromatic plane generated by atropisomerism as an attractive strategy for asymmetric anion-π catalysis. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  18. Current–voltage characteristics of manganite–titanite perovskite junctions

    Directory of Open Access Journals (Sweden)

    Benedikt Ifland

    2015-07-01

    Full Text Available After a general introduction into the Shockley theory of current voltage (J–V characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1−yNbyO3, y = 0.002 and p-doped Pr1−xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface.

  19. ER-mediated stress induces mitochondrial-dependent caspases activation in NT2 neuron-like cells.

    Science.gov (United States)

    Arduino, Daniela M; Esteves, A Raquel; Domingues, A Filipa; Pereira, Claudia M F; Cardoso, Sandra M; Oliveira, Catarina R

    2009-11-30

    Recent studies have revealed that endoplasmic reticulum (ER) disturbance is involved in the pathophysiology of neurodegenerative disorders, contributing to the activation of the ER stress-mediated apoptotic pathway. Therefore, we investigated here the molecular mechanisms underlying the ER-mitochondria axis, focusing on calcium as a potential mediator of cell death signals. Using NT2 cells treated with brefeldin A or tunicamycin, we observed that ER stress induces changes in the mitochondrial function, impairing mitochondrial membrane potential and distressing mitochondrial respiratory chain complex Moreover, stress stimuli at ER level evoked calcium fluxes between ER and mitochondria. Under these conditions, ER stress activated the unfolded protein response by an overexpression of GRP78, and also caspase-4 and-2, both involved upstream of caspase-9. Our findings show that ER and mitochondria interconnection plays a prominent role in the induction of neuronal cell death under particular stress circumstances.

  20. Induction of a stringent metabolic response in intracellular stages of Leishmania mexicana leads to increased dependence on mitochondrial metabolism.

    Directory of Open Access Journals (Sweden)

    Eleanor C Saunders

    2014-01-01

    Full Text Available Leishmania parasites alternate between extracellular promastigote stages in the insect vector and an obligate intracellular amastigote stage that proliferates within the phagolysosomal compartment of macrophages in the mammalian host. Most enzymes involved in Leishmania central carbon metabolism are constitutively expressed and stage-specific changes in energy metabolism remain poorly defined. Using (13C-stable isotope resolved metabolomics and (2H2O labelling, we show that amastigote differentiation is associated with reduction in growth rate and induction of a distinct stringent metabolic state. This state is characterized by a global decrease in the uptake and utilization of glucose and amino acids, a reduced secretion of organic acids and increased fatty acid β-oxidation. Isotopomer analysis showed that catabolism of hexose and fatty acids provide C4 dicarboxylic acids (succinate/malate and acetyl-CoA for the synthesis of glutamate via a compartmentalized mitochondrial tricarboxylic acid (TCA cycle. In vitro cultivated and intracellular amastigotes are acutely sensitive to inhibitors of mitochondrial aconitase and glutamine synthetase, indicating that these anabolic pathways are essential for intracellular growth and virulence. Lesion-derived amastigotes exhibit a similar metabolism to in vitro differentiated amastigotes, indicating that this stringent response is coupled to differentiation signals rather than exogenous nutrient levels. Induction of a stringent metabolic response may facilitate amastigote survival in a nutrient-poor intracellular niche and underlie the increased dependence of this stage on hexose and mitochondrial metabolism.

  1. Macroeconomic Assessment of Voltage Sags

    Directory of Open Access Journals (Sweden)

    Sinan Küfeoğlu

    2016-12-01

    Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

  2. Probing Intermolecular Electron Delocalization in Dimer Radical Anions by Vibrational Spectroscopy

    International Nuclear Information System (INIS)

    Mani, Tomoyasu; Brookhaven National Laboratory; Grills, David C.

    2017-01-01

    Delocalization of charges is one of the factors controlling charge transport in conjugated molecules. It is considered to play an important role in the performance of a wide range of molecular technologies, including organic solar cells and organic electronics. Dimerization reactions are well-suited as a model to investigate intermolecular spatial delocalization of charges. And while dimerization reactions of radical cations are well investigated, studies on radical anions are still scarce. Upon dimerization of radical anions with neutral counterparts, an electron is considered to delocalize over the two molecules. By using time-resolved infrared (TRIR) detection coupled with pulse radiolysis, we show that radical anions of 4-n-hexyl-4'-cyanobiphenyl (6CB) undergo such dimerization reactions, with an electron equally delocalized over the two molecules. We have recently demonstrated that nitrile ν(C≡N) vibrations respond to the degree of electron localization of nitrile-substituted anions: we can quantify the changes in the electronic charges from the neutral to the anion states in the nitriles by monitoring the ν(C≡N) IR shifts. In the first part of this article, we show that the sensitivity of the ν(C≡N) IR shifts does not depend on solvent polarity. In the second part, we describe how probing the shifts of the nitrile IR vibrational band unambiguously confirms the formation of dimer radical anions, with K dim = 3 × 10 4 M –1 . IR findings are corroborated by electronic absorption spectroscopy and electronic structure calculations. We find that the presence of a hexyl chain and the formation of π–π interactions are both crucial for dimerization of radical anions of 6CB with neutral 6CB. Our study provides clear evidence of spatial delocalization of electrons over two molecular fragments.

  3. Sensitization of microorganisms and enzymes by radiation-induced selective inorganic radical anions

    International Nuclear Information System (INIS)

    Schubert, J.; Stegeman, H.

    1981-01-01

    Bacterial survival and enzymatic inactivation were examined following exposure to radiolytically-generated radical anions, X - 2 , where X=Cl, Br, I or CNS - . Depending on pH, radical anions react selectively or specifically with cysteine, tryptophan, tyrosine and histidine. Consequently, when one or more of these amino acids is crucial for enzymatic activity or bacterial survival and is attacked by a radical anion, a high degree or radiosensitization may be realized. Halide radical anions can form free chlorine, bromine or iodine. However, these bactericidal halogens are destroyed by reaction with the hydrated electron, e - sub(aq), or at pHs>9, as occurs, for example, when a medium saturated with nitrous oxide, N 2 O, and e - sub(aq) scavenger, is replaced by nitrogen or oxygen. Increasing concentration of other e - sub(aq) scavengers, such as phosphate buffer, promotes formation of halogen from halides. The conditions producing formation and elimination of halogens in irradiated media must be appreciated to avoid confusing radiosensitization by X 2 to X - 2 . Radiosensitization by radical anions of several microorganisms: S. faecalis, S. typhimurium, E. coli, and M. radiodurens is described. A crucial amino acid for survival of S. faecalis appears to be tyrosine, while both tyrosine and tryptophan seem essential for recovery of S. typhimurium from effects of ionizing radiation. It is postulated that the radiosensitizing action of radical anions involves inhibition of DNA repair of strand-breaks by depriving the cells of energy. In view of the high OH scavenging power of foods, it is concluded that the radiosensitization of bacteria and enzymes in foods by radical anions, except for special cases, is not practical. Rather, radical anions serve to identify crucial amino acids to radiosensitization mechanisms in model systems, and possibly in radiotherapy. (author)

  4. Current and Voltage Conveyors in Current- and Voltage-Mode Precision Full-Wave Rectifiers

    Directory of Open Access Journals (Sweden)

    J. Koton

    2011-04-01

    Full Text Available In this paper new versatile precision full-wave rectifiers using current and/or voltage conveyors as active elements and two diodes are presented. The performance of these circuit solutions is analysed and compared to the opamp based precision rectifier. To analyze the behavior of the functional blocks, the frequency dependent RMS error and DC transient value are evaluated for different values of input voltage amplitudes. Furthermore, experimental results are given that show the feasibilities of the conveyor based rectifiers superior to the corresponding operational amplifier based topology.

  5. Application of capillary electrophoresis to anion speciation in soil water extracts: 2. Arsenic

    Energy Technology Data Exchange (ETDEWEB)

    Naidu, R.; Smith, J.; McLaren, R.G.; Stevens, D.P.; Sumner, M.E.; Jackson, P.E.

    2000-02-01

    A method has been developed for the speciation of arsenic (AsO{sub 2}{sup {minus}}, AsO{sub 4}{sup 3{minus}}, and dimethylarsinic [DMA]) in natural soil solutions from contaminated sites in Australia. The separation of these anions was achieved by capillary zone electrophoresis (CZE) using a fused silica capillary with a basic chromate buffer and on-column indirect UV detection at 254 nm. Method parameters, such as electrolyte pH, run voltage, and capillary temperature were studied in order to establish suitable analytical conditions. The ideal separation for As(III) and DMA was achieved with a buffer pH of 8.0, a run voltage of 25 kV, and a capillary temperature of 30 C. Under these conditions, As(V) and orthophosphate ions comigrated. However, the use of a chromate buffer at pH 10, a run voltage of 20 kV, and capillary temperature of 20 C led to complete separation of As(V) and phosphate peaks. Results of these investigations together with recovery test data suggest that separation of the As species from soil solutions can be achieved in less than 5 min with detection limits of 0.50, 0.10, and 0.10 mg L{sup {minus}1} for As(III), As(V), and DMA, respectively.

  6. Iron overload triggers mitochondrial fragmentation via calcineurin-sensitive signals in HT-22 hippocampal neuron cells

    International Nuclear Information System (INIS)

    Park, Junghyung; Lee, Dong Gil; Kim, Bokyung; Park, Sun-Ji; Kim, Jung-Hak; Lee, Sang-Rae; Chang, Kyu-Tae; Lee, Hyun-Shik; Lee, Dong-Seok

    2015-01-01

    Highlights: • FAC-induced iron overload promotes neuronal apoptosis. • Iron overload causes mitochondrial fragmentation in a Drp1-dependent manner. • Iron-induced Drp1 activation depends on dephosphorylation of Drp1(Ser637). • Calcineurin is a key regulator of Drp1-dependent mitochondrial fission by iron. - Abstract: The accumulation of iron in neurons has been proposed to contribute to the pathology of numerous neurodegenerative diseases, such as Alzheimer’s disease and Parkinson’s disease. However, insufficient research has been conducted on the precise mechanism underlying iron toxicity in neurons. In this study, we investigated mitochondrial dynamics in hippocampal HT-22 neurons exposed to ferric ammonium citrate (FAC) as a model of iron overload and neurodegeneration. Incubation with 150 μM FAC for 48 h resulted in decreased cell viability and apoptotic death in HT-22 cells. The FAC-induced iron overload triggered mitochondrial fragmentation, which was accompanied by Drp1(Ser637) dephosphorylation. Iron chelation with deferoxamine prevented the FAC-induced mitochondrial fragmentation and apoptotic cell death by inhibiting Drp1(Ser637) dephosphorylation. In addition, a S637D mutation of Drp1, which resulted in a phosphorylation-mimetic form of Drp1 at Ser637, protected against the FAC-induced mitochondrial fragmentation and neuronal apoptosis. FK506 and cyclosporine A, inhibitors of calcineurin activation, determined that calcineurin was associated with the iron-induced changes in mitochondrial morphology and the phosphorylation levels of Drp1. These results indicate that the FAC-induced dephosphorylation of Drp1-dependent mitochondrial fragmentation was rescued by the inhibition of calcineurin activation. Therefore, these findings suggest that calcineurin-mediated phosphorylation of Drp1(Ser637) acts as a key regulator of neuronal cell loss by modulating mitochondrial dynamics in iron-induced toxicity. These results may contribute to the

  7. Status epilepticus in immature rats is associated with oxidative stress and mitochondrial dysfunction

    Directory of Open Access Journals (Sweden)

    Jaroslava eFolbergrová

    2016-05-01

    Full Text Available Epilepsy is a neurologic disorder, particularly frequent in infants and children where it can lead to serious consequences later in life. Oxidative stress and mitochondrial dysfunction are implicated in the pathogenesis of many neurological disorders including epilepsy in adults. However, their role in immature epileptic brain is unclear since there have been two contrary opinions: oxidative stress is age-dependent and does not occur in immature brain during status epilepticus and, on the other hand, evidence of oxidative stress in immature brain during a specific model of status epilepticus. To solve this dilemma, we have decided to investigate oxidative stress following status epilepticus induced in immature 12-day-old rats by three substances with a different mechanism of action, namely 4-aminopyridine, LiCl-pilocarpine or kainic acid. FluoroJade-B staining revealed mild brain damage especially in hippocampus and thalamus in each of the tested models. Decrease of glucose and glycogen with parallel rises of lactate clearly indicate high rate of glycolysis, which was apparently not sufficient in 4-AP and Li-Pilo status, as evident from the decreases of PCr levels. Hydroethidium method revealed significantly higher levels of superoxide anion (by ~60 % in the hippocampus, cerebral cortex and thalamus of immature rats during status. Status epilepticus lead to mitochondrial dysfunction with a specific pronounced decrease of complex I activity that persisted for a long period of survival. Complex II and IV activities remained in the control range. Antioxidant treatment with SOD mimetic MnTMPYP or peroxynitrite scavenger FeTPPS significantly attenuated oxidative stress and inhibition of complex I activity. These findings bring evidence that oxidative stress and mitochondrial dysfunction are age and model independent, and may thus be considered a general phenomenon. They can have a clinical relevance for a novel approach to the treatment of epilepsy

  8. Salvianolic Acid-A Induces Apoptosis, Mitochondrial Membrane ...

    African Journals Online (AJOL)

    using Hoechst 33258 staining. The effect of the compound on mitochondrial membrane potential loss ... Fluorescence microscopy demonstrated that salvianolic acid-A induced dose- dependent ..... aggregation and anticancer properties. It has.

  9. Hofmeister effect of anions on calcium translocation by sarcoplasmic reticulum Ca2+-ATPase

    Science.gov (United States)

    Tadini-Buoninsegni, Francesco; Moncelli, Maria Rosa; Peruzzi, Niccolò; Ninham, Barry W.; Dei, Luigi; Nostro, Pierandrea Lo

    2015-10-01

    The occurrence of Hofmeister (specific ion) effects in various membrane-related physiological processes is well documented. For example the effect of anions on the transport activity of the ion pump Na+, K+-ATPase has been investigated. Here we report on specific anion effects on the ATP-dependent Ca2+ translocation by the sarcoplasmic reticulum Ca2+-ATPase (SERCA). Current measurements following ATP concentration jumps on SERCA-containing vesicles adsorbed on solid supported membranes were carried out in the presence of different potassium salts. We found that monovalent anions strongly interfere with ATP-induced Ca2+ translocation by SERCA, according to their increasing chaotropicity in the Hofmeister series. On the contrary, a significant increase in Ca2+ translocation was observed in the presence of sulphate. We suggest that the anions can affect the conformational transition between the phosphorylated intermediates E1P and E2P of the SERCA cycle. In particular, the stabilization of the E1P conformation by chaotropic anions seems to be related to their adsorption at the enzyme/water and/or at the membrane/water interface, while the more kosmotropic species affect SERCA conformation and functionality by modifying the hydration layers of the enzyme.

  10. Creating molecular macrocycles for anion recognition

    Directory of Open Access Journals (Sweden)

    Amar H. Flood

    2016-03-01

    Full Text Available The creation and functionality of new classes of macrocycles that are shape persistent and can bind anions is described. The genesis of triazolophane macrocycles emerges out of activity surrounding 1,2,3-triazoles made using click chemistry; and the same triazoles are responsible for anion capture. Mistakes made and lessons learnt in anion recognition provide deeper understanding that, together with theory, now provides for computer-aided receptor design. The lessons are acted upon in the creation of two new macrocycles. First, cyanostars are larger and like to capture large anions. Second is tricarb, which also favors large anions but shows a propensity to self-assemble in an orderly and stable manner, laying a foundation for future designs of hierarchical nanostructures.

  11. Mild mitochondrial uncoupling and calorie restriction increase fasting eNOS, akt and mitochondrial biogenesis.

    Science.gov (United States)

    Cerqueira, Fernanda M; Laurindo, Francisco R M; Kowaltowski, Alicia J

    2011-03-31

    Enhanced mitochondrial biogenesis promoted by eNOS activation is believed to play a central role in the beneficial effects of calorie restriction (CR). Since treatment of mice with dinitrophenol (DNP) promotes health and lifespan benefits similar to those observed in CR, we hypothesized that it could also impact biogenesis. We found that DNP and CR increase citrate synthase activity, PGC-1α, cytochrome c oxidase and mitofusin-2 expression, as well as fasting plasma levels of NO• products. In addition, eNOS and Akt phosphorylation in skeletal muscle and visceral adipose tissue was activated in fasting CR and DNP animals. Overall, our results indicate that systemic mild uncoupling activates eNOS and Akt-dependent pathways leading to mitochondrial biogenesis.

  12. Damage of Inner Ear Sensory Hair Cells via Mitochondrial Loss in a Murine Model of Sleep Apnea With Chronic Intermittent Hypoxia.

    Science.gov (United States)

    Seo, Young Joon; Ju, Hyun Mi; Lee, Sun Hee; Kwak, Sang Hyun; Kang, Min Jung; Yoon, Joo-Heon; Kim, Chang-Hoon; Cho, Hyung-Ju

    2017-09-01

    Investigating the exact pathophysiology of obstructive sleep apnea syndrome (OSAS)-induced hearing loss is critical. We sought to verify the hypothesis that a correlation exists between mitochondrial dysfunction in inner ear hair cells and the auditory dysfunction induced by chronic intermittent hypoxia (CIH) in a murine model of sleep apnea. C57BL/6J adult male mice were randomized to 4 weeks of CIH (n = 12) or normoxia (Sham) (n = 12). Hearing threshold was determined by auditory brainstem response. The activity of mitochondria was compared between CIH and Sham mice. Histological assessment and transmission electron microscopy were performed for assessing morphologic changes in mitochondria. The number of mtDNA copies as well as the levels of PGC1-α, Tfam, and VDAC (voltage-dependent anion channel) were determined in the hair cells of CIH mice. We observed that hearing ability in CIH mice was impaired and hair-cell mitochondria in CIH mice were fewer compared to that in Sham and also displayed an aberrant morphology. The mRNA levels of PGC-1α and Tfam were higher in the CIH group than in the Sham group. Moreover, the expression of VDAC was increased in the tectorial membrane, the basilar membrane, and especially in the inner hair cells of CIH mice. This study using CIH mice as a model for OSAS provides evidence of an association between OSAS and auditory function alteration, as well as of mitochondria being part of the pathophysiology of hearing impairment. Further investigation is required to determine whether mitochondria could serve as a valid target for preventive or therapeutic purposes. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.

  13. Role of mitochondrial calcium uptake homeostasis in resting state fMRI brain networks.

    Science.gov (United States)

    Kannurpatti, Sridhar S; Sanganahalli, Basavaraju G; Herman, Peter; Hyder, Fahmeed

    2015-11-01

    Mitochondrial Ca(2+) uptake influences both brain energy metabolism and neural signaling. Given that brain mitochondrial organelles are distributed in relation to vascular density, which varies considerably across brain regions, we hypothesized different physiological impacts of mitochondrial Ca(2+) uptake across brain regions. We tested the hypothesis by monitoring brain "intrinsic activity" derived from the resting state functional MRI (fMRI) blood oxygen level dependent (BOLD) fluctuations in different functional networks spanning the somatosensory cortex, caudate putamen, hippocampus and thalamus, in normal and perturbed mitochondrial Ca(2+) uptake states. In anesthetized rats at 11.7 T, mitochondrial Ca(2+) uptake was inhibited or enhanced respectively by treatments with Ru360 or kaempferol. Surprisingly, mitochondrial Ca(2+) uptake inhibition by Ru360 and enhancement by kaempferol led to similar dose-dependent decreases in brain-wide intrinsic activities in both the frequency domain (spectral amplitude) and temporal domain (resting state functional connectivity; RSFC). The fact that there were similar dose-dependent decreases in the frequency and temporal domains of the resting state fMRI-BOLD fluctuations during mitochondrial Ca(2+) uptake inhibition or enhancement indicated that mitochondrial Ca(2+) uptake and its homeostasis may strongly influence the brain's functional organization at rest. Interestingly, the resting state fMRI-derived intrinsic activities in the caudate putamen and thalamic regions saturated much faster with increasing dosage of either drug treatment than the drug-induced trends observed in cortical and hippocampal regions. Regional differences in how the spectral amplitude and RSFC changed with treatment indicate distinct mitochondrion-mediated spontaneous neuronal activity coupling within the various RSFC networks determined by resting state fMRI. Copyright © 2015 John Wiley & Sons, Ltd.

  14. Strapped Calix[4]pyrroles Bearing an 1,3-Indanedione at a β-Pyrrolic Position: Chemodosimeters for the Cyanide Anion

    Science.gov (United States)

    Kim, Sook-Hee; Hong, Seong-Jin; Yoo, Jaeduk; Kim, Sung Kuk; Sessler, Janathan L.; Lee, Chang-Hee

    2014-01-01

    A strapped calix[4]pyrrole bearing an 1,3-indanedione group at a β-pyrrolic position has been synthesized and studied as a ratiometric cyanide selective chemosensor. A concentration-dependent bleaching of the initial yellow color was observed upon addition of the cyanide anion. The bleaching, which was observed exclusively with the cyanide anion, occurred even in the presence of other anions. Spectroscopic studies provides support for a mechanistic interpretation wherein the cyanide anion forms a complex with the receptor (K = 2.78 × 104 M-1) through a fast equilibrium, which is followed by slow nucleophilic addition to the β-position of the 1,3-indanedione group. A minimum inhibitory effect from other anions was observed, a feature that could be beneficial in the selective sensing of the cyanide anion. PMID:19639968

  15. [Endoplasmic-mitochondrial Ca(2+)-functional unit: dependence of respiration of secretory cells on activity of ryanodine- and IP3 - sensitive Ca(2+)-channels].

    Science.gov (United States)

    Velykopols'ka, O Iu; Man'ko, B O; Man'ko, V V

    2012-01-01

    Using Clark oxygen electrode, dependence of mitochondrial functions on Ca(2+)-release channels activity of Chironomus plumosus L. larvae salivary glands suspension was investigated. Cells were ATP-permeabilized in order to enable penetration of exogenous oxidative substrates. Activation of plasmalemmal P2X-receptors (as well as P2Y-receptors) per se does not modify the endogenous respiration of salivary gland suspension. That is, Ca(2+)-influx from extracellular medium does not influence functional activity of mitochondria, although they are located along the basal part of the plasma membrane. Activation of RyRs intensifies endogenous respiration and pyruvate-malate-stimulated respiration, but not succinate-stimulated respiration. Neither activation of IP3Rs (via P2Y-receptors activation), nor their inhibition alters endogenous respiration. Nevertheless, IP3Rs inhibition by 2-APB intensifies succinate-stimulated respiration. All abovementioned facts testify that Ca2+, released from stores via channels, alters functional activity of mitochondria, and undoubtedly confirm the existence of endoplasmic-mitochondrial Ca(2+)-functional unit in Ch. plumosus larvae salivary glands secretory cells. In steady state of endoplasmic-mitochondrial Ca(2+)-functional unit the spontaneous activity of IP3Rs is observed; released through IP3Rs, Ca2+ is accumulated in mitochondria via uniporter and modulates oxidative processes. Activation of RyRs induces the transition of endoplasmic-mitochondrial Ca(2+)-functional unit to the active state, which is required to intensify cell respiration and oxidative phosphorylation. As expected, the transition of endoplasmic-mitochondrial Ca(2+)-functional unit to inactivated state (i. e. inhibition of Ca(2+)-release channels at excessive [Ca2+]i) limits the duration of signal transduction, has protective nature and prevents apoptosis.

  16. Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.

    Science.gov (United States)

    Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J

    2012-07-01

    Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.

  17. Origin of the transition voltage in gold–vacuum–gold atomic junctions

    KAUST Repository

    Wu, Kunlin

    2012-12-13

    The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments. © 2013 IOP Publishing Ltd.

  18. Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.

    Science.gov (United States)

    Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J

    2017-10-01

    Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.

  19. An ab initio study on BeX 3- superhalogen anions (X = F, Cl, Br)

    Science.gov (United States)

    Anusiewicz, Iwona; Skurski, Piotr

    2002-06-01

    The vertical electron detachment energies (VDE) of 10 BeX 3- (X = F, Cl, Br) anions were calculated at the outer valence Green function (OVGF) level with the 6-311++G(3df) basis sets. The largest vertical electron binding energy was found for BeF 3- system (7.63 eV). All negatively charged species possess the vertical electron detachment energies that are larger than 5.5 eV and thus may be termed superhalogen anions. The strong dependence of the VDE of the BeX 3- species on the ligand-central atom (Be-X) distance and on the partial atomic charge localized on Be was observed and discussed, as well as the other factors that may influence the electronic stability of such anions. In addition, the usefulness of the various theoretical treatments for estimating the VDEs of superhalogen anions was tested and analyzed.

  20. rf power dependence of subharmonic voltage spectra of two-dimensional Josephson-junction arrays

    International Nuclear Information System (INIS)

    Hebboul, S.E.; Garland, J.C.

    1993-01-01

    We have measured the rf-bias-current dependence of the ν/2 subharmonic spectral response of planar 300x300 Nb-Au-Nb proximity-coupled Josephson-junction arrays. The ν/2 subharmonic voltage spectrum was examined at two rf-bias frequencies, ν/ν c ∼1.4, 2.0 (ν c ∼120 MHz), and in applied magnetic fields corresponding to f=0,1/2 flux quantum per plaquette. The measurements were compared to analytical predictions for an rf-biased asymmetric superconducting quantum interference device with non-negligble loop inductance and large rf-bias-current amplitudes, based on the resistively shunted Josephson-junction model. Reasonable agreement was found between experiment and theory, suggesting that a possible origin for the observed subharmonic behavior in arrays involves an interplay between array plaquette inductances and junction critical-current variations

  1. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

    2007-01-01

    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  2. Mitochondrial cardiomyopathies

    Directory of Open Access Journals (Sweden)

    Ayman W. El-Hattab

    2016-07-01

    Full Text Available Mitochondria are found in all nucleated human cells and perform a variety of essential functions, including the generation of cellular energy. Mitochondria are under dual genome control. Only a small fraction of their proteins are encoded by mitochondrial DNA (mtDNA while more than 99% of them are encoded by nuclear DNA (nDNA. Mutations in mtDNA or mitochondria-related nDNA genes result in mitochondrial dysfunction leading to insufficient energy production required to meet the needs of various organs, particularly those with high energy requirements, including the central nervous system, skeletal and cardiac muscles, kidneys, liver, and endocrine system. Because cardiac muscles are one of the high energy demanding tissues, cardiac involvement occurs in mitochondrial diseases with cardiomyopathies being one of the most frequent cardiac manifestations found in these disorders. Cardiomyopathy is estimated to occur in 20-40% of children with mitochondrial diseases. Mitochondrial cardiomyopathies can vary in severity from asymptomatic status to severe manifestations including heart failure, arrhythmias, and sudden cardiac death. Hypertrophic cardiomyopathy is the most common type; however, mitochondrial cardiomyopathies might also present as dilated, restrictive, left ventricular noncompaction, and histiocytoid cardiomyopathies. Cardiomyopathies are frequent manifestations of mitochondrial diseases associated with defects in electron transport chain (ETC complexes subunits and their assembly factors, mitochondrial tRNAs, rRNAs, ribosomal proteins, and translation factors, mtDNA maintenance, and coenzyme Q10 synthesis. Other mitochondrial diseases with cardiomyopathies include Barth syndrome, Sengers syndrome, TMEM70-related mitochondrial complex V deficiency, and Friedreich ataxia.

  3. Alkaline anion exchange membrane water electrolysis: Effects of electrolyte feed method and electrode binder content

    Science.gov (United States)

    Cho, Min Kyung; Park, Hee-Young; Lee, Hye Jin; Kim, Hyoung-Juhn; Lim, Ahyoun; Henkensmeier, Dirk; Yoo, Sung Jong; Kim, Jin Young; Lee, So Young; Park, Hyun S.; Jang, Jong Hyun

    2018-04-01

    Herein, we investigate the effects of catholyte feed method and anode binder content on the characteristics of anion exchange membrane water electrolysis (AEMWE) to construct a high-performance electrolyzer, revealing that the initial AEMWE performance is significantly improved by pre-feeding 0.5 M aqueous KOH to the cathode. The highest long-term activity during repeated voltage cycling is observed for AEMWE operation in the dry cathode mode, for which the best long-term performance among membrane electrode assemblies (MEAs) featuring polytetrafluoroethylene (PTFE) binder-impregnated (5-20 wt%) anodes is detected for a PTFE content of 20 wt%. MEAs with low PTFE content (5 and 9 wt%) demonstrate high initial performance, rapid performance decay, and significant catalyst loss from the electrode during long-term operation, whereas the MEA with 20 wt% PTFE allows stable water electrolysis for over 1600 voltage cycles. Optimization of cell operating conditions (i.e., operation in dry cathode mode at an optimum anode binder content following an initial solution feed) achieves an enhanced water splitting current density (1.07 A cm-2 at 1.8 V) and stable long-term AEMWE performance (0.01% current density reduction per voltage cycle).

  4. Alkylation of nido-7,8-dicarbollide anion in liquid ammonia by propargyl bromide yielding 8-propargyl-nido-7,9-dicarbaundecaborate and 9-propargyl-nido-7,8-dicarbaundecaborate anions

    International Nuclear Information System (INIS)

    Zakharkin, L.I.; Ol'shevskaya, V.A.; Zhigareva, G.G.; Petrovskij, P.V.; Vinogradova, L.E.

    2002-01-01

    Products of alkylation of nido-7,8-dicarbollide anion by propargyl bromide in liquid ammonia at a temperature of -50 deg C were studied by the methods of 11 B NMR, IR and UV spectroscopy. It was ascertained that the above-mentioned reaction is accompanied by framework regroupings and results, depending on the reaction conditions, in formation of 8-propargyl-nido-7,9-dicarbaundecaborate- and 9-propargyl-nido-7,8-dicarbaundecaborate-anion. Ability of the salts prepared to get colored in alcohol solution as a result of action of diluted mineral acids, which is unusual for carborane derivatives, was revealed [ru

  5. Imaging Voltage in Genetically Defined Neuronal Subpopulations with a Cre Recombinase-Targeted Hybrid Voltage Sensor.

    Science.gov (United States)

    Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B

    2017-09-20

    Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In

  6. Novel fluoropolymer anion exchange membranes for alkaline direct methanol fuel cells.

    Science.gov (United States)

    Zhang, Yanmei; Fang, Jun; Wu, Yongbin; Xu, Hankun; Chi, Xianjun; Li, Wei; Yang, Yixu; Yan, Ge; Zhuang, Yongze

    2012-09-01

    A series of novel fluoropolymer anion exchange membranes based on the copolymer of vinylbenzyl chloride, butyl methacrylate, and hexafluorobutyl methacrylate has been prepared. Fourier transform infrared (FT-IR) spectroscopy and elemental analysis techniques are used to study the chemical structure and chemical composition of the membranes. The water uptake, ion-exchange capacity (IEC), conductivity, methanol permeability, and chemical stability of the membranes are also determined. The membranes exhibit high anionic conductivity in deionized water at 65 °C ranging from 3.86×10(-2) S cm(-1) to 4.36×10(-2) S cm(-1). The methanol permeability coefficients of the membranes are in the range of 4.21-5.80×10(-8) cm(2) s(-1) at 65 °C. The novel membranes also show good chemical and thermal stability. An open-circuit voltage of 0.7 V and a maximum power density of 53.2 mW cm(-2) of alkaline direct methanol fuel cell (ADMFC) with the membrane C, 1 M methanol, 1 M NaOH, and humidified oxygen are achieved at 65 °C. Therefore, these membranes have great potential for applications in fuel cell systems. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Anion concurrence and anion selectivity in the sorption of radionuclides by organotones

    International Nuclear Information System (INIS)

    Behnsen, Julia G.

    2007-01-01

    Some long-lived and radiologically important nuclear fission products, such as I-129 (half-life t 1/2 = 1,6 . 10 7 a), Tc-99 (t 1/2 = 2,1 . 10 5 a), and Se-79 (t 1/2 = 6,5 . 10 4 a) are anionic in aqueous environments. This study focuses on the adsorption of such anions to organoclays and the understanding of the selectivity of the process. The organoclays used in this study were prepared from a bentonite (MX-80) and a vermiculite clay, and the cationic surfactants hexadcylpyridium, hexadecyltrimethylammonium, and benzethonium. Surfactant adsorption to the bentonite exceeds the cation exchange capacity of the clay, with the surplus positive charge being balanced by the co-adsorption of chloride. The interlayer distance of the bentonites is increased sufficiently to contain bi- and pseudotrimolecular structures of the surfactants. Adsorption experiments were carried out using the batch technique. Anion adsorption of iodide, perrhenate, selenite, nitrate, and sulphate is mainly due to ion exchange with chloride. As an additional adsorption mechanism, the incorporation of inorganic ion pairs into the interlayer space of the clay is proposed as a result of experiments showing differences in the adsorption levels of sodium and potassium iodide. Anion adsorption results show a clear selectivity of the organoclays, with the affinity sequence being: ReO - 4 > I - > NO - 3 > Cl - > SO 2- 4 > SeO 2- 3 . This sequence corresponds to the sequence of increasing hydration energies of the anions, thus selectivity could be due to the process of minimization of free energy of the system. (orig.)

  8. Mechanistic perspective of mitochondrial fusion: tubulation vs. fragmentation.

    Science.gov (United States)

    Escobar-Henriques, Mafalda; Anton, Fabian

    2013-01-01

    Mitochondrial fusion is a fundamental process driven by dynamin related GTPase proteins (DRPs), in contrast to the general SNARE-dependence of most cellular fusion events. The DRPs Mfn1/Mfn2/Fzo1 and OPA1/Mgm1 are the key effectors for fusion of the mitochondrial outer and inner membranes, respectively. In order to promote fusion, these two DRPs require post-translational modifications and proteolysis. OPA1/Mgm1 undergoes partial proteolytic processing, which results in a combination between short and long isoforms. In turn, ubiquitylation of mitofusins, after oligomerization and GTP hydrolysis, promotes and positively regulates mitochondrial fusion. In contrast, under conditions of mitochondrial dysfunction, negative regulation by proteolysis on these DRPs results in mitochondrial fragmentation. This occurs by complete processing of OPA1 and via ubiquitylation and degradation of mitofusins. Mitochondrial fragmentation contributes to the elimination of damaged mitochondria by mitophagy, and may play a protective role against Parkinson's disease. Moreover, a link of Mfn2 to Alzheimer's disease is emerging and mutations in Mfn2 or OPA1 cause Charcot-Marie-Tooth type 2A neuropathy or autosomal-dominant optic atrophy. Here, we summarize our current understanding on the molecular mechanisms promoting or inhibiting fusion of mitochondrial membranes, which is essential for cellular survival and disease control. This article is part of a Special Issue entitled: Mitochondrial dynamics and physiology. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Lactate is oxidized outside of the mitochondrial matrix in rodent brain.

    Science.gov (United States)

    Herbst, Eric A F; George, Mitchell A J; Brebner, Karen; Holloway, Graham P; Kane, Daniel A

    2018-05-01

    The nature and existence of mitochondrial lactate oxidation is debated in the literature. Obscuring the issue are disparate findings in isolated mitochondria, as well as relatively low rates of lactate oxidation observed in permeabilized muscle fibres. However, respiration with lactate has yet to be directly assessed in brain tissue with the mitochondrial reticulum intact. To determine if lactate is oxidized in the matrix of brain mitochondria, oxygen consumption was measured in saponin-permeabilized mouse brain cortex samples, and rat prefrontal cortex and hippocampus (dorsal) subregions. While respiration in the presence of ADP and malate increased with the addition of lactate, respiration was maximized following the addition of exogenous NAD + , suggesting maximal lactate metabolism involves extra-matrix lactate dehydrogenase. This was further supported when NAD + -dependent lactate oxidation was significantly decreased with the addition of either low-concentration α-cyano-4-hydroxycinnamate or UK-5099, inhibitors of mitochondrial pyruvate transport. Mitochondrial respiration was comparable between glutamate, pyruvate, and NAD + -dependent lactate oxidation. Results from the current study demonstrate that permeabilized brain is a feasible model for assessing lactate oxidation, and support the interpretation that lactate oxidation occurs outside the mitochondrial matrix in rodent brain.

  10. Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

  11. Simulation of forward dark current voltage characteristics of tandem solar cells

    International Nuclear Information System (INIS)

    Rubinelli, F.A.

    2012-01-01

    The transport mechanisms tailoring the shape of dark current–voltage characteristics of amorphous and microcrystalline silicon based tandem solar cell structures are explored with numerical simulations. Our input parameters were calibrated by fitting experimental current voltage curves of single and double junction structures measured under dark and illuminated conditions. At low and intermediate forward voltages the dark current–voltage characteristics show one or two regions with a current–voltage exponential dependence. The diode factor is unique in tandem cells with the same material in both intrinsic layers and two dissimilar diode factors are observed in tandem cells with different materials on the top and bottom intrinsic layers. In the exponential regions the current is controlled by recombination through gap states and by free carrier diffusion. At high forward voltages the current grows more slowly with the applied voltage. The current is influenced by the onset of electron space charge limited current (SCLC) in tandem cells where both intrinsic layers are of amorphous silicon and by series resistance of the bottom cell in tandem cells where both intrinsic layers are of microcrystalline silicon. In the micromorph cell the onset of SCLC becomes visible on the amorphous top sub-cell. The dark current also depends on the thermal generation of electron–hole (e–h) pairs present at the tunneling recombination junction. The highest dependence is observed in the tandem structure where both intrinsic layers are of microcrystalline silicon. The prediction of meaningless dark currents at low forward and reverse voltages by our code is discussed and one solution is given. - Highlights: ► Transport mechanisms shaping the dark current-voltage curves of tandem devices. ► The devices are amorphous and microcrystalline based tandem solar cells. ► Two regions with a current-voltage exponential dependence are observed. ► The tandem J-V diode factor is the

  12. γ-Synuclein antibodies have neuroprotective potential on neuroretinal cells via proteins of the mitochondrial apoptosis pathway.

    Directory of Open Access Journals (Sweden)

    Corina Wilding

    Full Text Available The family of synuclein proteins (α, β and γ are related to neurodegenerative disease e.g. Parkinson disease and Morbus Alzheimer. Additionally, a connection between γ-synuclein and glaucoma, a neurodegenerative disease characterized by a progressive loss of retinal ganglion cells, which finally leads to blindness, exists. The reason for the development of glaucoma is still unknown. Recent studies evaluating the participation of immunological components, demonstrate complex changed antibody reactivities in glaucoma patients in comparison to healthy people, showing not only up-regulations (e.g. alpha-fodrin antibody but also down-regulations (e.g. γ-synuclein antibody of antibodies in glaucoma patients. Up-regulated antibodies could be auto-aggressive, but the role of down-regulated antibodies is still unclear. Previous studies show a significant influence of the serum and the antibodies of glaucoma patients on protein expression profiles of neuroretinal cells. The aim of this study was to investigate the effect of γ-synuclein antibody on the viability and reactive oxygen species levels of a neuroretinal cell line (RGC-5 as well as their interaction with cellular proteins. We found a protective effect of γ-synuclein antibody resulting in an increased viability (up to 15% and decreased reactive oxygen species levels (up to -12% of glutamate and oxidative stressed RGC-5. These can be traced back to anti-apoptotic altered protein expressions in the mitochondrial apoptosis pathway indicated by mass spectrometry and validated by microarray analysis such as active caspase 3, bcl-2 associated-x-protein, S100A4, voltage-dependent anion channel, extracellular-signal-regulated-kinase (down-regulated and baculoviral IAP repeat-containing protein 6, phosphorylated extracellular-signal-regulated-kinase (up-regulated. These changed protein expression are triggered by the γ-synuclein antibody internalization of RGC-5 we could see in immunohistochemical

  13. Ion Concentration- and Voltage-Dependent Push and Pull Mechanisms of Potassium Channel Ion Conduction.

    Directory of Open Access Journals (Sweden)

    Kota Kasahara

    Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.

  14. On the profile of frequency and voltage dependent interface states and series resistance in MIS structures

    Energy Technology Data Exchange (ETDEWEB)

    Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)

    2007-04-30

    The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.

  15. Trichothecene Mycotoxins Inhibit Mitochondrial Translation—Implication for the Mechanism of Toxicity

    Directory of Open Access Journals (Sweden)

    Susan McCormick

    2011-12-01

    Full Text Available Fusarium head blight (FHB reduces crop yield and results in contamination of grains with trichothecene mycotoxins. We previously showed that mitochondria play a critical role in the toxicity of a type B trichothecene. Here, we investigated the direct effects of type A and type B trichothecenes on mitochondrial translation and membrane integrity in Saccharomyces cerevisiae. Sensitivity to trichothecenes increased when functional mitochondria were required for growth, and trichothecenes inhibited mitochondrial translation at concentrations, which did not inhibit total translation. In organello translation in isolated mitochondria was inhibited by type A and B trichothecenes, demonstrating that these toxins have a direct effect on mitochondrial translation. In intact yeast cells trichothecenes showed dose-dependent inhibition of mitochondrial membrane potential and reactive oxygen species, but only at doses higher than those affecting mitochondrial translation. These results demonstrate that inhibition of mitochondrial translation is a primary target of trichothecenes and is not secondary to the disruption of mitochondrial membranes.

  16. Effect of Aquo-glycolic Media and Added Anions on the Anodization of Zircaloy-4 in Sulphamic Acid

    Directory of Open Access Journals (Sweden)

    Viplav Duth Shukla

    2011-01-01

    Full Text Available Anodization of zircaloy-4 in 0.1 M sulphamic acid has been carried out. Kinetics of anodic oxidation of zircaloy-4 has been studied at a constant current density of 8 mA/cm2 and at room temperature. Thickness estimates were made from capacitance data. The plots of formation voltage vs. time, reciprocal capacitance vs. time, reciprocal capacitance vs. formation voltage and thickness vs. formation voltage were drawn and rate of formation, current efficiency and differential field were calculated. The addition of solvent (ethylene glycol showed better kinetic results. For 25%, 50% and 75% aquo-glycolic media, the dielectric constant values are low leading to a marked improvement in the kinetics. In 80% ethylene glycol, though the dielectric constant value of solution is less, the kinetics was slow which may be attributed to the fact that the electrolyte becomes highly non-polar. Improvement in the kinetics of oxide film formation was observed by the addition of millimolar concentration of anions (CO32-, SO42-, PO43-. The presence of phosphate ions improved the kinetics of anodization to better extent.

  17. Thermal Properties of Anionic Polyurethane Composition for Leather Finishing

    Directory of Open Access Journals (Sweden)

    Olga KOVTUNENKO

    2016-09-01

    Full Text Available Thermal properties of anionic polyurethane composition mixed with collagen product and hydrophilic sodium form of montmorillonite for use in the finishing of leather were studied by thermogravimetric method. The thermal indices of processes of thermal and thermo-oxidative destruction depending on the polyurethane composition were determined. The influence of anionic polyurethane composition on thermal behavior of chromium tanned gelatin films that imitate the leather were studied. APU composition with natural compounds increases their thermal stability both in air and in nitrogen atmosphere due to the formation of additional bonds between active groups of APU, protein and chrome tanning agent as the result of chemical reactions between organic and inorganic parts with the new structure formation.DOI: http://dx.doi.org/10.5755/j01.ms.22.3.10043

  18. Prolonged decay of molecular rate estimates for metazoan mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Martyna Molak

    2015-03-01

    Full Text Available Evolutionary timescales can be estimated from genetic data using the molecular clock, often calibrated by fossil or geological evidence. However, estimates of molecular rates in mitochondrial DNA appear to scale negatively with the age of the clock calibration. Although such a pattern has been observed in a limited range of data sets, it has not been studied on a large scale in metazoans. In addition, there is uncertainty over the temporal extent of the time-dependent pattern in rate estimates. Here we present a meta-analysis of 239 rate estimates from metazoans, representing a range of timescales and taxonomic groups. We found evidence of time-dependent rates in both coding and non-coding mitochondrial markers, in every group of animals that we studied. The negative relationship between the estimated rate and time persisted across a much wider range of calibration times than previously suggested. This indicates that, over long time frames, purifying selection gives way to mutational saturation as the main driver of time-dependent biases in rate estimates. The results of our study stress the importance of accounting for time-dependent biases in estimating mitochondrial rates regardless of the timescale over which they are inferred.

  19. Simultaneous anion and cation mobility in polypyrrole

    DEFF Research Database (Denmark)

    Skaarup, Steen; Bay, Lasse; Vidanapathirana, K.

    2003-01-01

    and the expulsion of anions; a broad anodic peak centered at ca. - 0.5 V representing the expulsion of cations; and a second broad peak at +0.2 to +0.5 V corresponding to anions being inserted. Although the motion of cations is the most important, as expected, there is a significant anion contribution, thereby...... complicating reproducibility when employing PPy(DBS) polymers as actuators. When the cation is doubly charged, it enters the film less readily, and anions dominate the mobility. Using a large and bulky cation switches the mechanism to apparently total anion motion. The changes in area of the three peaks...

  20. Graphene-coated polymeric anion exchangers for ion chromatography

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Kai; Cao, Minyi; Lou, Chaoyan [Department of Chemistry, Xixi Campus, Zhejiang University, Hangzhou 310028 (China); Wu, Shuchao, E-mail: wushch2002@163.com [Zhejiang Institute of Geology and Mineral Resources, Hangzhou 310007 (China); Zhang, Peimin [Department of Chemistry, Xixi Campus, Zhejiang University, Hangzhou 310028 (China); Zhi, Mingyu [Hangzhou Vocational & Technical College, Hangzhou, 310018 (China); Zhu, Yan, E-mail: zhuyan@zju.edu.cn [Department of Chemistry, Xixi Campus, Zhejiang University, Hangzhou 310028 (China)

    2017-06-01

    Carbonaceous stationary phases have gained much attention for their peculiar selectivity and robustness. Herein we report the fabrication and application of a graphene-coated polymeric stationary phase for anion exchange chromatography. The graphene-coated particles were fabricated by a facile evaporation-reduction method. These hydrophilic particles were proven appropriate substrates for grafting of hyperbranched condensation polymers (HBCPs) to make pellicular anion exchangers. The new phase was characterized by zeta potentials, Fourier transform infrared spectroscopy, thermogravimetry and scanning electron microscope. Frontal displacement chromatography showed that the capacities of the anion exchangers were tuned by both graphene amount and HBCPs layer count. The chromatographic performance of graphene-coated anion exchangers was demonstrated with separation of inorganic anions, organic acids, carbohydrates and amino acids. Good reproducibility was obtained by consecutive injections, indicating high chemical stability of the coating. - Highlights: • Graphene-coated polymeric particles were fabricated by a facile method. • Hyperbranched condensation polymers (HBCPs) were grafted from graphene-coated particles to make anion exchangers. • Graphene amount and HBCPs layer count had significant effects on the anion exchange capacities. • Separation of diverse anionic analytes on the anion exchangers was demonstrated. • The prepared anion exchangers exhibited high stability.

  1. Bicarbonate adsorption band of the chromatography for carbon isotope separation using anion exchangers

    International Nuclear Information System (INIS)

    Takeda, Kunihiko; Obanawa, Heiichiro; Hata, Masahisa; Sato, Katsuya

    1985-01-01

    The equilibria of bicarbonate ion between two phases were studied for the carbon isotope separation using anion exchangers. The condition of the formation of a bicarbonate adsorption band was quantitatively discussed. The formation of the adsorption band depends on the difference of S-potential which is the sum of the standard redection chemical potentials and L-potential which is the sum of the reduction chemical potential. The isotopic separation factor observed was about 1.012, independent of the concentrations of acid and alkali in the solutions. The isotopic separation factor was considered to be determined by the reaction of bicarbonate ion on anion exchangers and carbon dioxide dissolved in solutions. The enriched carbon isotope whose isotopic abundance ratio ( 13 C/ 12 C) was 1.258 was obtained with the column packed with anion exchangers. (author)

  2. Intermediate state trapping of a voltage sensor

    DEFF Research Database (Denmark)

    Lacroix, Jérôme J; Pless, Stephan Alexander; Maragliano, Luca

    2012-01-01

    Voltage sensor domains (VSDs) regulate ion channels and enzymes by undergoing conformational changes depending on membrane electrical signals. The molecular mechanisms underlying the VSD transitions are not fully understood. Here, we show that some mutations of I241 in the S1 segment of the Shaker...... Kv channel positively shift the voltage dependence of the VSD movement and alter the functional coupling between VSD and pore domains. Among the I241 mutants, I241W immobilized the VSD movement during activation and deactivation, approximately halfway between the resting and active states......, and drastically shifted the voltage activation of the ionic conductance. This phenotype, which is consistent with a stabilization of an intermediate VSD conformation by the I241W mutation, was diminished by the charge-conserving R2K mutation but not by the charge-neutralizing R2Q mutation. Interestingly, most...

  3. The mitochondrial elongation factors MIEF1 and MIEF2 exert partially distinct functions in mitochondrial dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Tong; Yu, Rong [Department of Oncology–Pathology, Karolinska Institutet, CCK R8:05, Karolinska University Hospital Solna, SE-171 76 Stockholm (Sweden); Jin, Shao-Bo [Department of Cell and Molecular Biology, Karolinska Institutet, SE-171 77 Stockholm (Sweden); Han, Liwei [Department of Oncology–Pathology, Karolinska Institutet, CCK R8:05, Karolinska University Hospital Solna, SE-171 76 Stockholm (Sweden); Lendahl, Urban [Department of Cell and Molecular Biology, Karolinska Institutet, SE-171 77 Stockholm (Sweden); Zhao, Jian, E-mail: Jian.Zhao@ki.se [Department of Oncology–Pathology, Karolinska Institutet, CCK R8:05, Karolinska University Hospital Solna, SE-171 76 Stockholm (Sweden); Nistér, Monica [Department of Oncology–Pathology, Karolinska Institutet, CCK R8:05, Karolinska University Hospital Solna, SE-171 76 Stockholm (Sweden)

    2013-11-01

    Mitochondria are dynamic organelles whose morphology is regulated by a complex balance of fission and fusion processes, and we still know relatively little about how mitochondrial dynamics is regulated. MIEF1 (also called MiD51) has recently been characterized as a key regulator of mitochondrial dynamics and in this report we explore the functions of its paralog MIEF2 (also called MiD49), to learn to what extent MIEF2 is functionally distinct from MIEF1. We show that MIEF1 and MIEF2 have many functions in common. Both are anchored in the mitochondrial outer membrane, recruit Drp1 from the cytoplasm to the mitochondrial surface and cause mitochondrial fusion, and MIEF2, like MIEF1, can interact with Drp1 and hFis1. MIEF1 and MIEF2, however, also differ in certain aspects. MIEF1 and MIEF2 are differentially expressed in human tissues during development. When overexpressed, MIEF2 exerts a stronger fusion-promoting effect than MIEF1, and in line with this, hFis1 and Mff can only partially revert the MIEF2-induced fusion phenotype, whereas MIEF1-induced fusion is reverted to a larger extent by hFis1 and Mff. MIEF2 forms high molecular weight oligomers, while MIEF1 is largely present as a dimer. Furthermore, MIEF1 and MIEF2 use distinct domains for oligomerization: in MIEF1, the region from amino acid residues 109–154 is required, whereas oligomerization of MIEF2 depends on amino acid residues 1 to 49, i.e. the N-terminal end. We also show that oligomerization of MIEF1 is not required for its mitochondrial localization and interaction with Drp1. In conclusion, our data suggest that the mitochondrial regulators MIEF1 and MIEF2 exert partially distinct functions in mitochondrial dynamics. - Highlights: • MIEF1 and MIEF2 recruit Drp1 to mitochondria and cause mitochondrial fusion. • MIEF2, like MIEF1, can interact with Drp1 and hFis1. • MIEF1 and MIEF2 are differentially expressed in human tissues during development. • MIEF2 exerts a stronger fusion

  4. The mitochondrial elongation factors MIEF1 and MIEF2 exert partially distinct functions in mitochondrial dynamics

    International Nuclear Information System (INIS)

    Liu, Tong; Yu, Rong; Jin, Shao-Bo; Han, Liwei; Lendahl, Urban; Zhao, Jian; Nistér, Monica

    2013-01-01

    Mitochondria are dynamic organelles whose morphology is regulated by a complex balance of fission and fusion processes, and we still know relatively little about how mitochondrial dynamics is regulated. MIEF1 (also called MiD51) has recently been characterized as a key regulator of mitochondrial dynamics and in this report we explore the functions of its paralog MIEF2 (also called MiD49), to learn to what extent MIEF2 is functionally distinct from MIEF1. We show that MIEF1 and MIEF2 have many functions in common. Both are anchored in the mitochondrial outer membrane, recruit Drp1 from the cytoplasm to the mitochondrial surface and cause mitochondrial fusion, and MIEF2, like MIEF1, can interact with Drp1 and hFis1. MIEF1 and MIEF2, however, also differ in certain aspects. MIEF1 and MIEF2 are differentially expressed in human tissues during development. When overexpressed, MIEF2 exerts a stronger fusion-promoting effect than MIEF1, and in line with this, hFis1 and Mff can only partially revert the MIEF2-induced fusion phenotype, whereas MIEF1-induced fusion is reverted to a larger extent by hFis1 and Mff. MIEF2 forms high molecular weight oligomers, while MIEF1 is largely present as a dimer. Furthermore, MIEF1 and MIEF2 use distinct domains for oligomerization: in MIEF1, the region from amino acid residues 109–154 is required, whereas oligomerization of MIEF2 depends on amino acid residues 1 to 49, i.e. the N-terminal end. We also show that oligomerization of MIEF1 is not required for its mitochondrial localization and interaction with Drp1. In conclusion, our data suggest that the mitochondrial regulators MIEF1 and MIEF2 exert partially distinct functions in mitochondrial dynamics. - Highlights: • MIEF1 and MIEF2 recruit Drp1 to mitochondria and cause mitochondrial fusion. • MIEF2, like MIEF1, can interact with Drp1 and hFis1. • MIEF1 and MIEF2 are differentially expressed in human tissues during development. • MIEF2 exerts a stronger fusion

  5. SK2 channels regulate mitochondrial respiration and mitochondrial Ca2+ uptake.

    Science.gov (United States)

    Honrath, Birgit; Matschke, Lina; Meyer, Tammo; Magerhans, Lena; Perocchi, Fabiana; Ganjam, Goutham K; Zischka, Hans; Krasel, Cornelius; Gerding, Albert; Bakker, Barbara M; Bünemann, Moritz; Strack, Stefan; Decher, Niels; Culmsee, Carsten; Dolga, Amalia M

    2017-05-01

    Mitochondrial calcium ([Ca 2+ ] m ) overload and changes in mitochondrial metabolism are key players in neuronal death. Small conductance calcium-activated potassium (SK) channels provide protection in different paradigms of neuronal cell death. Recently, SK channels were identified at the inner mitochondrial membrane, however, their particular role in the observed neuroprotection remains unclear. Here, we show a potential neuroprotective mechanism that involves attenuation of [Ca 2+ ] m uptake upon SK channel activation as detected by time lapse mitochondrial Ca 2+ measurements with the Ca 2+ -binding mitochondria-targeted aequorin and FRET-based [Ca 2+ ] m probes. High-resolution respirometry revealed a reduction in mitochondrial respiration and complex I activity upon pharmacological activation and overexpression of mitochondrial SK2 channels resulting in reduced mitochondrial ROS formation. Overexpression of mitochondria-targeted SK2 channels enhanced mitochondrial resilience against neuronal death, and this effect was inhibited by overexpression of a mitochondria-targeted dominant-negative SK2 channel. These findings suggest that SK channels provide neuroprotection by reducing [Ca 2+ ] m uptake and mitochondrial respiration in conditions, where sustained mitochondrial damage determines progressive neuronal death.

  6. Melatonin enhances neural stem cell differentiation and engraftment by increasing mitochondrial function.

    Science.gov (United States)

    Mendivil-Perez, Miguel; Soto-Mercado, Viviana; Guerra-Librero, Ana; Fernandez-Gil, Beatriz I; Florido, Javier; Shen, Ying-Qiang; Tejada, Miguel A; Capilla-Gonzalez, Vivian; Rusanova, Iryna; Garcia-Verdugo, José M; Acuña-Castroviejo, Darío; López, Luis Carlos; Velez-Pardo, Carlos; Jimenez-Del-Rio, Marlene; Ferrer, José M; Escames, Germaine

    2017-09-01

    Neural stem cells (NSCs) are regarded as a promising therapeutic approach to protecting and restoring damaged neurons in neurodegenerative diseases (NDs) such as Parkinson's disease and Alzheimer's disease (PD and AD, respectively). However, new research suggests that NSC differentiation is required to make this strategy effective. Several studies have demonstrated that melatonin increases mature neuronal markers, which reflects NSC differentiation into neurons. Nevertheless, the possible involvement of mitochondria in the effects of melatonin during NSC differentiation has not yet been fully established. We therefore tested the impact of melatonin on NSC proliferation and differentiation in an attempt to determine whether these actions depend on modulating mitochondrial activity. We measured proliferation and differentiation markers, mitochondrial structural and functional parameters as well as oxidative stress indicators and also evaluated cell transplant engraftment. This enabled us to show that melatonin (25 μM) induces NSC differentiation into oligodendrocytes and neurons. These effects depend on increased mitochondrial mass/DNA/complexes, mitochondrial respiration, and membrane potential as well as ATP synthesis in NSCs. It is also interesting to note that melatonin prevented oxidative stress caused by high levels of mitochondrial activity. Finally, we found that melatonin enriches NSC engraftment in the ND mouse model following transplantation. We concluded that a combined therapy involving transplantation of NSCs pretreated with pharmacological doses of melatonin could efficiently restore neuronal cell populations in PD and AD mouse models depending on mitochondrial activity promotion. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Nonlinear electrokinetics at large voltages

    Energy Technology Data Exchange (ETDEWEB)

    Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

    2009-07-15

    The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

  8. Mild mitochondrial uncoupling and calorie restriction increase fasting eNOS, akt and mitochondrial biogenesis.

    Directory of Open Access Journals (Sweden)

    Fernanda M Cerqueira

    2011-03-01

    Full Text Available Enhanced mitochondrial biogenesis promoted by eNOS activation is believed to play a central role in the beneficial effects of calorie restriction (CR. Since treatment of mice with dinitrophenol (DNP promotes health and lifespan benefits similar to those observed in CR, we hypothesized that it could also impact biogenesis. We found that DNP and CR increase citrate synthase activity, PGC-1α, cytochrome c oxidase and mitofusin-2 expression, as well as fasting plasma levels of NO• products. In addition, eNOS and Akt phosphorylation in skeletal muscle and visceral adipose tissue was activated in fasting CR and DNP animals. Overall, our results indicate that systemic mild uncoupling activates eNOS and Akt-dependent pathways leading to mitochondrial biogenesis.

  9. Dependence of mitochondrial coenzyme A uptake on the membrane electrical gradient

    International Nuclear Information System (INIS)

    Tahiliani, A.G.

    1989-01-01

    Coenzyme A (CoA) transport was studied in isolated rat heart mitochondria. Uptake of CoA was assayed by determining [3H]CoA associated with mitochondria under various conditions. Various oxidizable substrates including alpha-ketoglutarate, succinate, or malate stimulated CoA uptake. The membrane proton (delta pH) and electrical (delta psi) gradients, which dissipated with time in the absence of substrate, were maintained at their initial levels throughout the incubation in the presence of substrate. Addition of phosphate caused a concentration-dependent decrease of both delta pH and CoA uptake. Nigericin also dissipated the proton gradient and prevented CoA uptake. Valinomycin also prevented CoA uptake into mitochondria. Although the proton gradient was unaffected, the electrical gradient was completely abolished in the presence of valinomycin. Addition of 5 mM phosphate 10 min after the start of incubation prevented further uptake of CoA into mitochondria. A rapid dissipation of the proton gradient upon addition of phosphate was observed. Addition of nigericin or valinomycin 10 min after the start of incubation also resulted in no further uptake of CoA into with mitochondria; valinomycin caused an apparent efflux of CoA from mitochondria. Uptake was found to be sensitive to external pH displaying a pH optimum at pHext 8.0. Although nigericin significantly inhibited CoA uptake over the pHext range of 6.75-8, maximal transport was observed around pHext 8.0-8.25. Valinomycin, on the other hand, abolished transport over the entire pH range. The results suggest that mitochondrial CoA transport is determined by the membrane electrical gradient. The apparent dependence of CoA uptake on an intact membrane pH gradient is probably the result of modulation of CoA transport by matrix pH

  10. Superoxide anion radicals induce IGF-1 resistance through concomitant activation of PTP1B and PTEN

    Science.gov (United States)

    Singh, Karmveer; Maity, Pallab; Krug, Linda; Meyer, Patrick; Treiber, Nicolai; Lucas, Tanja; Basu, Abhijit; Kochanek, Stefan; Wlaschek, Meinhard; Geiger, Hartmut; Scharffetter-Kochanek, Karin

    2015-01-01

    The evolutionarily conserved IGF-1 signalling pathway is associated with longevity, metabolism, tissue homeostasis, and cancer progression. Its regulation relies on the delicate balance between activating kinases and suppressing phosphatases and is still not very well understood. We report here that IGF-1 signalling in vitro and in a murine ageing model in vivo is suppressed in response to accumulation of superoxide anions () in mitochondria, either by chemical inhibition of complex I or by genetic silencing of -dismutating mitochondrial Sod2. The -dependent suppression of IGF-1 signalling resulted in decreased proliferation of murine dermal fibroblasts, affected translation initiation factors and suppressed the expression of α1(I), α1(III), and α2(I) collagen, the hallmarks of skin ageing. Enhanced led to activation of the phosphatases PTP1B and PTEN, which via dephosphorylation of the IGF-1 receptor and phosphatidylinositol 3,4,5-triphosphate dampened IGF-1 signalling. Genetic and pharmacologic inhibition of PTP1B and PTEN abrogated -induced IGF-1 resistance and rescued the ageing skin phenotype. We thus identify previously unreported signature events with , PTP1B, and PTEN as promising targets for drug development to prevent IGF-1 resistance-related pathologies. PMID:25520316

  11. Anion-induced N-doping of naphthalenediimide polymer semiconductor in organic thin-film transistors

    KAUST Repository

    Han, Yang

    2018-03-13

    Molecular doping is an important strategy to improve the charge transport properties of organic semiconductors in various electronic devices. Compared to p-type dopants, the development of n-type dopants is especially challenging due to poor dopant stability against atmospheric conditions. In this article, we report the n-doping of the milestone naphthalenediimide-based conjugated polymer P(NDI2OD-T2) in organic thin film transistor devices by soluble anion dopants. The addition of the dopants resulted in the formation of stable radical anions in thin films, as confirmed by EPR spectroscopy. By tuning the dopant concentration via simple solution mixing, the transistor parameters could be readily controlled. Hence the contact resistance between the electrodes and the semiconducting polymer could be significantly reduced, which resulted in the transistor behaviour approaching the desirable gate voltage-independent model. Reduced hysteresis was also observed, thanks to the trap filling by the dopant. Under optimal doping concentrations the channel on-current was increased several fold whilst the on/off ratio was simultaneously increased by around one order of magnitude. Hence doping with soluble organic salts appears to be a promising route to improve the charge transport properties of n-type organic semiconductors.

  12. Anion-induced N-doping of naphthalenediimide polymer semiconductor in organic thin-film transistors

    KAUST Repository

    Han, Yang; Fei, Zhuping; Lin, Yen-Hung; Martin, Jaime; Tuna, Floriana; Anthopoulos, Thomas D.; Heeney, Martin

    2018-01-01

    Molecular doping is an important strategy to improve the charge transport properties of organic semiconductors in various electronic devices. Compared to p-type dopants, the development of n-type dopants is especially challenging due to poor dopant stability against atmospheric conditions. In this article, we report the n-doping of the milestone naphthalenediimide-based conjugated polymer P(NDI2OD-T2) in organic thin film transistor devices by soluble anion dopants. The addition of the dopants resulted in the formation of stable radical anions in thin films, as confirmed by EPR spectroscopy. By tuning the dopant concentration via simple solution mixing, the transistor parameters could be readily controlled. Hence the contact resistance between the electrodes and the semiconducting polymer could be significantly reduced, which resulted in the transistor behaviour approaching the desirable gate voltage-independent model. Reduced hysteresis was also observed, thanks to the trap filling by the dopant. Under optimal doping concentrations the channel on-current was increased several fold whilst the on/off ratio was simultaneously increased by around one order of magnitude. Hence doping with soluble organic salts appears to be a promising route to improve the charge transport properties of n-type organic semiconductors.

  13. Mitochondrial tRNA cleavage by tRNA-targeting ribonuclease causes mitochondrial dysfunction observed in mitochondrial disease

    Energy Technology Data Exchange (ETDEWEB)

    Ogawa, Tetsuhiro, E-mail: atetsu@mail.ecc.u-tokyo.ac.jp; Shimizu, Ayano; Takahashi, Kazutoshi; Hidaka, Makoto; Masaki, Haruhiko, E-mail: amasaki@mail.ecc.u-tokyo.ac.jp

    2014-08-15

    Highlights: • MTS-tagged ribonuclease was translocated successfully to the mitochondrial matrix. • MTS-tagged ribonuclease cleaved mt tRNA and reduced COX activity. • Easy and reproducible method of inducing mt tRNA dysfunction. - Abstract: Mitochondrial DNA (mtDNA) is a genome possessed by mitochondria. Since reactive oxygen species (ROS) are generated during aerobic respiration in mitochondria, mtDNA is commonly exposed to the risk of DNA damage. Mitochondrial disease is caused by mitochondrial dysfunction, and mutations or deletions on mitochondrial tRNA (mt tRNA) genes are often observed in mtDNA of patients with the disease. Hence, the correlation between mt tRNA activity and mitochondrial dysfunction has been assessed. Then, cybrid cells, which are constructed by the fusion of an enucleated cell harboring altered mtDNA with a ρ{sup 0} cell, have long been used for the analysis due to difficulty in mtDNA manipulation. Here, we propose a new method that involves mt tRNA cleavage by a bacterial tRNA-specific ribonuclease. The ribonuclease tagged with a mitochondrial-targeting sequence (MTS) was successfully translocated to the mitochondrial matrix. Additionally, mt tRNA cleavage, which resulted in the decrease of cytochrome c oxidase (COX) activity, was observed.

  14. Wind Power Plant Voltage Stability Evaluation: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Muljadi, E.; Zhang, Y. C.

    2014-09-01

    Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

  15. Altered Mitochondrial Dynamics and TBI Pathophysiology

    Directory of Open Access Journals (Sweden)

    Tara Diane Fischer

    2016-03-01

    novel object recognition memory and context-specific fear memory. Taken together, our results show that TBI increases mitochondrial fission and that inhibition of fission improves hippocampal-dependent learning and memory, suggesting that strategies to reduce fission may have translational value after injury.

  16. The assessment of pellicular anion-exchange resins for the determination of anions by ion chromatography

    International Nuclear Information System (INIS)

    Pohlandt, C.

    1981-01-01

    Because pellicular anion-exchange resins suitable for the determination, by ion chromatography, of anions with alkaline eluents were unavailable in South Africa at the inception of this work, an attempt was made to prepare such resins. In this study it is shown that the pellicular resins produced are more efficient than the surface-aminated resins used previously. The simultaneous separation and determination of five common anions is demonstrated. The method was applied to the analysis of uranium leach liquors, effluent samples, and a solid sample of ferric oxide (goethite)

  17. Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

    Directory of Open Access Journals (Sweden)

    William J.B. Heffernan

    2014-12-01

    Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

  18. Celastrol targets mitochondrial respiratory chain complex I to induce reactive oxygen species-dependent cytotoxicity in tumor cells

    Directory of Open Access Journals (Sweden)

    Xu Yuanji

    2011-05-01

    Full Text Available Abstract Background Celastrol is an active ingredient of the traditional Chinese medicinal plant Tripterygium Wilfordii, which exhibits significant antitumor activity in different cancer models in vitro and in vivo; however, the lack of information on the target and mechanism of action of this compound have impeded its clinical application. In this study, we sought to determine the mode of action of celastrol by focusing on the processes that mediate its anticancer activity. Methods The downregulation of heat shock protein 90 (HSP90 client proteins, phosphorylation of c-Jun NH2-terminal kinase (JNK, and cleavage of PARP, caspase 9 and caspase 3 were detected by western blotting. The accumulation of reactive oxygen species (ROS was analyzed by flow cytometry and fluorescence microscopy. Cell cycle progression, mitochondrial membrane potential (MMP and apoptosis were determined by flow cytometry. Absorption spectroscopy was used to determine the activity of mitochondrial respiratory chain (MRC complexes. Results Celastrol induced ROS accumulation, G2-M phase blockage, apoptosis and necrosis in H1299 and HepG2 cells in a dose-dependent manner. N-acetylcysteine (NAC, an antioxidative agent, inhibited celastrol-induced ROS accumulation and cytotoxicity. JNK phosphorylation induced by celastrol was suppressed by NAC and JNK inhibitor SP600125 (SP. Moreover, SP significantly inhibited celastrol-induced loss of MMP, cleavage of PARP, caspase 9 and caspase 3, mitochondrial translocation of Bad, cytoplasmic release of cytochrome c, and cell death. However, SP did not inhibit celastrol-induced ROS accumulation. Celastrol downregulated HSP90 client proteins but did not disrupt the interaction between HSP90 and cdc37. NAC completely inhibited celastrol-induced decrease of HSP90 client proteins, catalase and thioredoxin. The activity of MRC complex I was completely inhibited in H1299 cells treated with 6 μM celastrol in the absence and presence of NAC

  19. Perspective: Electrospray photoelectron spectroscopy: From multiply-charged anions to ultracold anions

    International Nuclear Information System (INIS)

    Wang, Lai-Sheng

    2015-01-01

    Electrospray ionization (ESI) has become an essential tool in chemical physics and physical chemistry for the production of novel molecular ions from solution samples for a variety of spectroscopic experiments. ESI was used to produce free multiply-charged anions (MCAs) for photoelectron spectroscopy (PES) in the late 1990 s, allowing many interesting properties of this class of exotic species to be investigated. Free MCAs are characterized by strong intramolecular Coulomb repulsions, which create a repulsive Coulomb barrier (RCB) for electron emission. The RCB endows many fascinating properties to MCAs, giving rise to meta-stable anions with negative electron binding energies. Recent development in the PES of MCAs includes photoelectron imaging to examine the influence of the RCB on the electron emission dynamics, pump-probe experiments to examine electron tunneling through the RCB, and isomer-specific experiments by coupling PES with ion mobility for biological MCAs. The development of a cryogenically cooled Paul trap has led to much better resolved PE spectra for MCAs by creating vibrationally cold anions from the room temperature ESI source. Recent advances in coupling the cryogenic Paul trap with PE imaging have allowed high-resolution PE spectra to be obtained for singly charged anions produced by ESI. In particular, the observation of dipole-bound excited states has made it possible to conduct vibrational autodetachment spectroscopy and resonant PES, which yield much richer vibrational spectroscopic information for dipolar free radicals than traditional PES

  20. Mitochondrial events responsible for morphine's cardioprotection against ischemia/reperfusion injury

    International Nuclear Information System (INIS)

    He, Haiyan; Huh, Jin; Wang, Huihua; Kang, Yi; Lou, Jianshi; Xu, Zhelong

    2016-01-01

    Morphine may induce cardioprotection by targeting mitochondria, but little is known about the exact mitochondrial events that mediate morphine's protection. We aimed to address the role of the mitochondrial Src tyrosine kinase in morphine's protection. Isolated rat hearts were subjected to 30 min ischemia and 2 h of reperfusion. Morphine was given before the onset of ischemia. Infarct size and troponin I release were measured to evaluate cardiac injury. Oxidative stress was evaluated by measuring mitochondrial protein carbonylation and mitochondrial ROS generation. HL-1 cells were subjected to simulated ischemia/reperfusion and LDH release and mitochondrial membrane potential (ΔΨm) were measured. Morphine reduced infarct size as well as cardiac troponin I release which were aborted by the selective Src tyrosine kinase inhibitors PP2 and Src-I1. Morphine also attenuated LDH release and prevented a loss of ΔΨm at reperfusion in a Src tyrosine kinase dependent manner in HL-1 cells. However, morphine failed to reduce LDH release in HL-1 cells transfected with Src siRNA. Morphine increased mitochondrial Src phosphorylation at reperfusion and this was abrogated by PP2. Morphine attenuated mitochondrial protein carbonylation and mitochondrial superoxide generation at reperfusion through Src tyrosine kinase. The inhibitory effect of morphine on the mitochondrial complex I activity was reversed by PP2. These data suggest that morphine induces cardioprotection by preventing mitochondrial oxidative stress through mitochondrial Src tyrosine kinase. Inhibition of mitochondrial complex I at reperfusion by Src tyrosine kinase may account for the prevention of mitochondrial oxidative stress by morphine. - Highlights: • Morphine induced mito-Src phosphorylation and reduced infarct size in rat hearts. • Morphine failed to reduce I/R-induced LDH release in Src-silencing HL-1 cells. • Morphine prevented mitochondria damage caused by I/R through Src. • Morphine reduced

  1. MRI appearances and diagnosis of mitochondrial encephalomyopathy in children

    International Nuclear Information System (INIS)

    Guo Binglun; Li Guiying; Gao Peng; Wang Chaofan; Huang Wenqi; Cheng Jingliang; Yang Yunjun

    2004-01-01

    Objective: To explore the MRI appearances and diagnostic value of mitochondrial encephalomyopathy in children. Methods: MRI manifestations in 16 children patients with mitochondrial encephalomyopathy, confirmed by pathology and laboratory examination from January of 1996 to December of 2002, were retrospectively analyzed. Results: Cerebral foci of mitochondrial encephalomyopathy showed as multiple and symmetrical abnormal slight long T 1 and long T 2 signals in all 16 cases. Deep grey matter was only invaded in 9 of 16 cases, both cerebral cortex and deep grey matter were involved in 6 cases, and white matter was only invaded in 1 case, respectively. Their main clinical manifestations were progressive declination of the intelligence (n=12) and muscle force (n=10). The biopsy in the skeletal muscle showed ragged red fiber and abnormal mitochondria. Conclusion: Gradual declination of intelligence and muscle force is the common clinical manifestations of mitochondrial encephalomyopathy in children. The main MRI findings were multiple symmetrical abnormal signal intensities in the deep grey matter, and MRI is an important way to show the cerebral lesions and benefit to the diagnosis of mitochondrial encephalomyopathy. But the definite diagnosis of mitochondrial encephalomyopathy depends on skeletal muscle biopsy and gene examination

  2. EPR detection of cellular and mitochondrial superoxide using cyclic hydroxylamines.

    Science.gov (United States)

    Dikalov, Sergey I; Kirilyuk, Igor A; Voinov, Maxim; Grigor'ev, Igor A

    2011-04-01

    Superoxide (O₂ⁱ⁻) has been implicated in the pathogenesis of many human diseases, but detection of the O(2)(•-) radicals in biological systems is limited due to inefficiency of O₂ⁱ⁻ spin trapping and lack of site-specific information. This work studied production of extracellular, intracellular and mitochondrial O₂ⁱ⁻ in neutrophils, cultured endothelial cells and isolated mitochondria using a new set of cationic, anionic and neutral hydroxylamine spin probes with various lipophilicity and cell permeability. Cyclic hydroxylamines rapidly react with O₂ⁱ⁻, producing stable nitroxides and allowing site-specific cO₂ⁱ⁻ detection in intracellular, extracellular and mitochondrial compartments. Negatively charged 1-hydroxy-4-phosphono-oxy-2,2,6,6-tetramethylpiperidine (PP-H) and positively charged 1-hydroxy-2,2,6,6-tetramethylpiperidin-4-yl-trimethylammonium (CAT1-H) detected only extramitochondrial O₂ⁱ⁻. Inhibition of EPR signal by SOD2 over-expression showed that mitochondria targeted mitoTEMPO-H detected intramitochondrial O₂ⁱ⁻ both in isolated mitochondria and intact cells. Both 1-hydroxy-3-carboxy-2,2,5,5-tetramethylpyrrolidine (CP-H) and 1-hydroxy-3-methoxycarbonyl-2,2,5,5-tetramethylpyrrolidine (CM-H) detected an increase in cytoplasm O₂ⁱ⁻ stimulated by PMA, but only CM-H and mitoTEMPO-H showed an increase in rotenone-induced mitochondrial O₂ⁱ⁻. These data show that a new set of hydroxylamine spin probes provide unique information about site-specific production of the O₂ⁱ⁻ radical in extracellular or intracellular compartments, cytoplasm or mitochondria.

  3. Dose Response of Endotoxin on Hepatocyte and Muscle Mitochondrial Respiration In Vitro

    Science.gov (United States)

    Brandt, Sebastian; Porta, Francesca; Jakob, Stephan M.; Takala, Jukka; Djafarzadeh, Siamak

    2015-01-01

    Introduction. Results on mitochondrial dysfunction in sepsis are controversial. We aimed to assess effects of LPS at wide dose and time ranges on hepatocytes and isolated skeletal muscle mitochondria. Methods. Human hepatocellular carcinoma cells (HepG2) were exposed to placebo or LPS (0.1, 1, and 10 μg/mL) for 4, 8, 16, and 24 hours and primary human hepatocytes to 1 μg/mL LPS or placebo (4, 8, and 16 hours). Mitochondria from porcine skeletal muscle samples were exposed to increasing doses of LPS (0.1–100 μg/mg) for 2 and 4 hours. Respiration rates of intact and permeabilized cells and isolated mitochondria were measured by high-resolution respirometry. Results. In HepG2 cells, LPS reduced mitochondrial membrane potential and cellular ATP content but did not modify basal respiration. Stimulated complex II respiration was reduced time-dependently using 1 μg/mL LPS. In primary human hepatocytes, stimulated mitochondrial complex II respiration was reduced time-dependently using 1 μg/mL LPS. In isolated porcine skeletal muscle mitochondria, stimulated respiration decreased at high doses (50 and 100 μg/mL LPS). Conclusion. LPS reduced cellular ATP content of HepG2 cells, most likely as a result of the induced decrease in membrane potential. LPS decreased cellular and isolated mitochondrial respiration in a time-dependent, dose-dependent and complex-dependent manner. PMID:25649304

  4. A mitochondrially targeted compound delays aging in yeast through a mechanism linking mitochondrial membrane lipid metabolism to mitochondrial redox biology

    Directory of Open Access Journals (Sweden)

    Michelle T. Burstein

    2014-01-01

    Full Text Available A recent study revealed a mechanism of delaying aging in yeast by a natural compound which specifically impacts mitochondrial redox processes. In this mechanism, exogenously added lithocholic bile acid enters yeast cells, accumulates mainly in the inner mitochondrial membrane, and elicits an age-related remodeling of phospholipid synthesis and movement within both mitochondrial membranes. Such remodeling of mitochondrial phospholipid dynamics progresses with the chronological age of a yeast cell and ultimately causes significant changes in mitochondrial membrane lipidome. These changes in the composition of membrane phospholipids alter mitochondrial abundance and morphology, thereby triggering changes in the age-related chronology of such longevity-defining redox processes as mitochondrial respiration, the maintenance of mitochondrial membrane potential, the preservation of cellular homeostasis of mitochondrially produced reactive oxygen species, and the coupling of electron transport to ATP synthesis.

  5. Polypeptide Translocation Through the Mitochondrial TOM Channel: Temperature-Dependent Rates at the Single-Molecule Level.

    Science.gov (United States)

    Mahendran, Kozhinjampara R; Lamichhane, Usha; Romero-Ruiz, Mercedes; Nussberger, Stephan; Winterhalter, Mathias

    2013-01-03

    The TOM protein complex facilitates the transfer of nearly all mitochondrial preproteins across outer mitochondrial membranes. Here we characterized the effect of temperature on facilitated translocation of a mitochondrial presequence peptide pF1β. Ion current fluctuations analysis through single TOM channels revealed thermodynamic and kinetic parameters of substrate binding and allowed determining the energy profile of peptide translocation. The activation energy for the on-rate and off-rate of the presequence peptide into the TOM complex was symmetric with respect to the electric field and estimated to be about 15 and 22 kT per peptide. These values are above that expected for free diffusion of ions in water (6 kT) and reflect the stronger interaction in the channel. Both values are in the range for typical enzyme kinetics and suggest one process without involving large conformational changes within the channel protein.

  6. Stabilization of Voltage Parameters of Induction Generator Excited by a Voltage Inverter

    Directory of Open Access Journals (Sweden)

    Padalko D.A.

    2017-12-01

    Full Text Available The article reveals the operational aspects of induction generator. Methods for stabilization of induction generator (IG parameters under inverter excitation are investigated. The study was carried out using mathematical description and simulation modeling in MATLAB Simulink. The paper provides analysis of causes of generated voltage amplitude and frequency displacement when the loading condition and the rate vary. Due to the parametric resonance nature of IG self-excitation, the author introduces the expression that allows estimating the capacitor capacitance required to maintain the generation process, depending on the rotor speed of electric machine, load nature and rate. Based on the studies, it was proved that it is possible to stabilize the IG voltage parameters by maintaining the magnetizing circuit inductance Lm at the constant level., and realizing a control law close to U/f = const. The study proves that using the inverter together with the voltage regulator allows ensuring the quality of electricity corresponding to modern standards. The necessity of problem solving of the required quality of the voltage by the harmonic component for the exciter - inverter with PWM is shown. The prospects of the power generation system based on induction machine (IM with a semiconductor frequency converter, which serves as an adjustable supplier of capacitive current for IM for autonomous objects, are substantiated. The use of semiconductor frequency converters makes it possible to provide high stability of the output voltage parameters and good speed of the mechatronic generation system with an asynchronous machine.

  7. Functional diversity of voltage-sensing phosphatases in two urodele amphibians.

    Science.gov (United States)

    Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi

    2014-07-16

    Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  8. Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

  9. Compartmentalized Regulation of Parkin-Mediated Mitochondrial Quality Control in the Drosophila Nervous System In Vivo

    Science.gov (United States)

    Sung, Hyun; Tandarich, Lauren C.; Nguyen, Kenny

    2016-01-01

    In neurons, the normal distribution and selective removal of mitochondria are considered essential for maintaining the functions of the large asymmetric cell and its diverse compartments. Parkin, a E3 ubiquitin ligase associated with familial Parkinson's disease, has been implicated in mitochondrial dynamics and removal in cells including neurons. However, it is not clear how Parkin functions in mitochondrial turnover in vivo, or whether Parkin-dependent events of the mitochondrial life cycle occur in all neuronal compartments. Here, using the live Drosophila nervous system, we investigated the involvement of Parkin in mitochondrial dynamics, distribution, morphology, and removal. Contrary to our expectations, we found that Parkin-deficient animals do not accumulate senescent mitochondria in their motor axons or neuromuscular junctions; instead, they contain far fewer axonal mitochondria, and these displayed normal motility behavior, morphology, and metabolic state. However, the loss of Parkin did produce abnormal tubular and reticular mitochondria restricted to the motor cell bodies. In addition, in contrast to drug-treated, immortalized cells in vitro, mature motor neurons rarely displayed Parkin-dependent mitophagy. These data indicate that the cell body is the focus of Parkin-dependent mitochondrial quality control in neurons, and argue that a selection process allows only healthy mitochondria to pass from cell bodies to axons, perhaps to limit the impact of mitochondrial dysfunction. SIGNIFICANCE STATEMENT Parkin has been proposed to police mitochondrial fidelity by binding to dysfunctional mitochondria via PTEN (phosphatase and tensin homolog)-induced putative kinase 1 (PINK1) and targeting them for autophagic degradation. However, it is unknown whether and how the PINK1/Parkin pathway regulates the mitochondrial life cycle in neurons in vivo. Using Drosophila motor neurons, we show that parkin disruption generates an abnormal mitochondrial network in cell

  10. Moringa oleifera's Nutritious Aqueous Leaf Extract Has Anticancerous Effects by Compromising Mitochondrial Viability in an ROS-Dependent Manner.

    Science.gov (United States)

    Madi, Niveen; Dany, Mohammed; Abdoun, Salah; Usta, Julnar

    2016-01-01

    Moringa oleifera (MO) is an important dietary component for many populations in West Africa and the Indian subcontinent. In addition to its highly nutritious value, almost all parts of this plant have been widely used in folk medicine in curing infectious, cardiovascular, gastrointestinal, hepatic, and other diseases. Evidence-based research supported its versatile medicinal properties; however, more rigorous research is required to establish it in cancer therapy. As such, in this study we aim to investigate the in vitro anticancerous effect of Moringa oleifera's aqueous leaf extract. Moringa extract was prepared by soaking pulverized leaves in hot water mimicking the people's mode of the leaf drink preparation. Several assays were used to study the effect of different percentage concentrations of the extract on viability of A549 cells; levels of adenosine triphosphate (ATP), reactive oxygen species (ROS), and glutathione (GSH) generated; as well as percentage of lactate dehydrogenase (LDH) released at different time points. In addition to mitochondrial membrane potential, apoptotic events were assessed using western blotting for apoptotic markers and immunoflourescent flourescent labeled inhibitor of caspases (FLICA) assay. MO extract treatment resulted in a significant decrease in mitochondrial membrane potential (1 hour) and ATP levels (3 hours), followed by an increase in (6 hours) ROS, caspase activation, proapoptotic proteins expression (p53, SMAC/Diablo, AIF), and PARP-1 cleavage. This eventually resulted in decreased GSH levels and a decrease in viability. The cytotoxic effect was prevented upon pretreatment with antioxidant N-acetyl-cysteine. MO decreased as well the viability of HepG2, CaCo2, Jurkat, and HEK293 cells. Our findings identify a plant extract with an anticancerous effect on cancer cell lines. MO extract exerts its cytotoxic effect in A549 cancer cells by affecting mitochondrial viability and inducing apoptosis in an ROS-dependent manner.

  11. Mitochondrial flash as a novel biomarker of mitochondrial respiration in the heart.

    Science.gov (United States)

    Gong, Guohua; Liu, Xiaoyun; Zhang, Huiliang; Sheu, Shey-Shing; Wang, Wang

    2015-10-01

    Mitochondrial respiration through electron transport chain (ETC) activity generates ATP and reactive oxygen species in eukaryotic cells. The modulation of mitochondrial respiration in vivo or under physiological conditions remains elusive largely due to the lack of appropriate approach to monitor ETC activity in a real-time manner. Here, we show that ETC-coupled mitochondrial flash is a novel biomarker for monitoring mitochondrial respiration under pathophysiological conditions in cultured adult cardiac myocyte and perfused beating heart. Through real-time confocal imaging, we follow the frequency of a transient bursting fluorescent signal, named mitochondrial flash, from individual mitochondria within intact cells expressing a mitochondrial matrix-targeted probe, mt-cpYFP (mitochondrial-circularly permuted yellow fluorescent protein). This mt-cpYFP recorded mitochondrial flash has been shown to be composed of a major superoxide signal with a minor alkalization signal within the mitochondrial matrix. Through manipulating physiological substrates for mitochondrial respiration, we find a close coupling between flash frequency and the ETC electron flow, as measured by oxygen consumption rate in cardiac myocyte. Stimulating electron flow under physiological conditions increases flash frequency. On the other hand, partially block or slowdown electron flow by inhibiting the F0F1 ATPase, which represents a pathological condition, transiently increases then decreases flash frequency. Limiting electron entrance at complex I by knocking out Ndufs4, an assembling subunit of complex I, suppresses mitochondrial flash activity. These results suggest that mitochondrial electron flow can be monitored by real-time imaging of mitochondrial flash. The mitochondrial flash frequency could be used as a novel biomarker for mitochondrial respiration under physiological and pathological conditions. Copyright © 2015 the American Physiological Society.

  12. Melatonin: A Mitochondrial Targeting Molecule Involving Mitochondrial Protection and Dynamics

    Science.gov (United States)

    Tan, Dun-Xian; Manchester, Lucien C.; Qin, Lilan; Reiter, Russel J.

    2016-01-01

    Melatonin has been speculated to be mainly synthesized by mitochondria. This speculation is supported by the recent discovery that aralkylamine N-acetyltransferase/serotonin N-acetyltransferase (AANAT/SNAT) is localized in mitochondria of oocytes and the isolated mitochondria generate melatonin. We have also speculated that melatonin is a mitochondria-targeted antioxidant. It accumulates in mitochondria with high concentration against a concentration gradient. This is probably achieved by an active transportation via mitochondrial melatonin transporter(s). Melatonin protects mitochondria by scavenging reactive oxygen species (ROS), inhibiting the mitochondrial permeability transition pore (MPTP), and activating uncoupling proteins (UCPs). Thus, melatonin maintains the optimal mitochondrial membrane potential and preserves mitochondrial functions. In addition, mitochondrial biogenesis and dynamics is also regulated by melatonin. In most cases, melatonin reduces mitochondrial fission and elevates their fusion. Mitochondrial dynamics exhibit an oscillatory pattern which matches the melatonin circadian secretory rhythm in pinealeocytes and probably in other cells. Recently, melatonin has been found to promote mitophagy and improve homeostasis of mitochondria. PMID:27999288

  13. m-AAA proteases, mitochondrial calcium homeostasis and neurodegeneration.

    Science.gov (United States)

    Patron, Maria; Sprenger, Hans-Georg; Langer, Thomas

    2018-03-01

    The function of mitochondria depends on ubiquitously expressed and evolutionary conserved m-AAA proteases in the inner membrane. These ATP-dependent peptidases form hexameric complexes built up of homologous subunits. AFG3L2 subunits assemble either into homo-oligomeric isoenzymes or with SPG7 (paraplegin) subunits into hetero-oligomeric proteolytic complexes. Mutations in AFG3L2 are associated with dominant spinocerebellar ataxia (SCA28) characterized by the loss of Purkinje cells, whereas mutations in SPG7 cause a recessive form of hereditary spastic paraplegia (HSP7) with motor neurons of the cortico-spinal tract being predominantly affected. Pleiotropic functions have been assigned to m-AAA proteases, which act as quality control and regulatory enzymes in m