In vitro propagation of cauliflower using curd microexplants.
Kieffer, Martin; Fuller, Michael P
2013-01-01
Cauliflower (Brassica oleracea var. botrytis) with its distinctive pre-inflorescence or curd is a remarkable member of the Brassica cabbage group. During curd development, intense and repetitive branching leads to a spectacular increase in size and the accumulation of millions of meristems at its surface. Although destined to produce flowers, most of these meristems are capable of regenerating vegetative shoots in vitro, making curd fragments an excellent material for the micropropagation of cauliflower. Most reported methods using these tissues were devised for the production of small clones of vitroplants as the true potential of curd fragments remained highly underestimated. We describe a technique exploiting fully this abundance of meristems and optimized for the large-scale in vitro propagation of cauliflower. The curd surface is first mechanically disrupted to break up the meristem clusters and generate microexplants carrying 1-3 meristems. These microexplants are then cultured at high density 1:100 (v:v) (microexplants:medium) in liquid medium containing Kinetin and indole-3-butyric acid (IBA) and produce thousands of microshoots in 12 days. After selecting the best quality microshoots on a sucrose pad, they are transferred en masse to a rooting medium supplemented with IBA. Four weeks later, rooted microshoots are carefully acclimatized before transfer to the field. This semi-automated protocol is rapid, cost effective, and well adapted for the production of clones of several thousands of plants by a single worker in a short space of time.
Methods for safety culture improvement
International Nuclear Information System (INIS)
Sivintsev, Yu.V.
1998-01-01
New IAEA publication concerning the problems of safety assurance covering different aspects beginning from terminology applied and up to concrete examples of well and poor safety culture development at nuclear facilities is discussed. The safety culture is defined as such set of characteristics and specific activities of institutions and individual persons which states that safety problems of a nuclear facility are given the attention determined by their importance as being of highest priority. The statements of the new document have recommended, not mandatory character. It is emphasized that the process of safety culture improvement at nuclear facilities should be integral component of management procedure, not a bolt on extra
The Method of Culture Contrast
DEFF Research Database (Denmark)
Hasse, Cathrine; Trentemøller, Stine; Motzkau, Johanna
2009-01-01
-cultural research can be argued to rest on what has been called implicit comparisons (Nader 1994) of such categorisations. We assume that research of local activities, such as schooling and higher education, is influenced by the researcher's emic and etic categorisations. To get beyond the risk of reproducing...... and surprising challenges of the researcher's emic categorisations. We illustrate the case with examples of different understandings of three terms, hierarchy, family, and sexual harassment, in the Understanding Puzzles in the Gendered European Map (UPGEM) project....
Culture, Interface Design, and Design Methods for Mobile Devices
Lee, Kun-Pyo
Aesthetic differences and similarities among cultures are obviously one of the very important issues in cultural design. However, ever since products became knowledge-supporting tools, the visible elements of products have become more universal so that the invisible parts of products such as interface and interaction are getting more important. Therefore, the cultural design should be extended to the invisible elements of culture like people's conceptual models beyond material and phenomenal culture. This chapter aims to explain how we address the invisible cultural elements in interface design and design methods by exploring the users' cognitive styles and communication patterns in different cultures. Regarding cultural interface design, we examined users' conceptual models while interacting with mobile phone and website interfaces, and observed cultural difference in performing tasks and viewing patterns, which appeared to agree with cultural cognitive styles known as Holistic thoughts vs. Analytic thoughts. Regarding design methods for culture, we explored how to localize design methods such as focus group interview and generative session for specific cultural groups, and the results of comparative experiments revealed cultural difference on participants' behaviors and performance in each design method and led us to suggest how to conduct them in East Asian culture. Mobile Observation Analyzer and Wi-Pro, user research tools we invented to capture user behaviors and needs especially in their mobile context, were also introduced.
In vitro culture method of powdery mildew (Oidium heveae ...
African Journals Online (AJOL)
ELOHO
2012-08-23
Aug 23, 2012 ... A method for culturing powdery mildew (Oidium heveae) from isolated leaves of ... solution; d, Colour phase leaves with nutrient solution in culture dish; e, in vitro ... Plant and fungus materials .... same change trend during whole culture period. ... consistent with the field resistance identification results of.
A method for culturing human hair follicle cells.
Weterings, P J; Vermorken, A J; Bloemendal, H
1981-01-01
For the first time a method for culturing human hair follicle cells is described. The bovine eye lens capsule, a basement membrane-like structure, is used as the substrate for the cultures. In a culture medium supplemented with hydrocortisone and insulin about 70% of the original follicles will form growing colonies of diploid keratinocytes.
Simple and convenient method for culturing anaerobic bacteria.
Behbehani, M J; Jordan, H V; Santoro, D L
1982-01-01
A simple and convenient method for culturing anaerobic bacteria is described. Cultures can be grown in commercially available flasks normally used for preparation of sterile external solutions. A special disposable rubber flask closure maintains anaerobic conditions in the flask after autoclaving. Growth of a variety of anaerobic oral bacteria was comparable to that obtained after anaerobic incubation of broth cultures in Brewer Anaerobic Jars.
Mouse cell culture - Methods and protocols
Directory of Open Access Journals (Sweden)
CarloAlberto Redi
2010-12-01
Full Text Available The mouse is, out of any doubt, the experimental animal par excellence for many many colleagues within the scientific community, notably for those working in mammalian biology (in a broad sense, from basic genetic to modeling human diseases, starting at least from 1664 Robert Hooke experiments on air’s propertyn. Not surprising then that mouse cell cultures is a well established field of research itself and that there are several handbooks devoted to this discipline. Here, Andrew Ward and David Tosh provide a necessary update of the protocols currently needed. In fact, nearly half of the book is devoted to stem cells culture protocols, mainly embryonic, from a list of several organs (kidney, lung, oesophagus and intestine, pancreas and liver to mention some........
Energy Technology Data Exchange (ETDEWEB)
Kim, Young Ga; Sung, Chan Ho; Jung, Yeon Sub [KHNP Central Research Institute, Daejeon (Korea, Republic of)
2012-10-15
After the Chernobyl nuclear accident in 1986, nuclear safety culture terminology was at first introduced emphasizing the importance of employees' attitude and organizational safety. The concept of safety culture was spread by INSAG 4 published in 1991. From that time, IAEA had provided the service of ASCOT for the safety culture assessment. However, many people still are thinking that safety culture is abstract and is not clear. It is why the systematic and reliable assessment methodology was not developed. Assessing safety culture is to identify what is the basic assumption for any organization to accept unconsciously. Therefore, it is very difficult to reach a meaningful conclusion by a superficial investigation alone. KHNP had been doing the safety culture assessment which was based on ASCOT methodology every 2 years. And this result had contributed to improving safety culture. But this result could not represent the level of organization's safety culture due to the limitation of method. So, KHNP has improved the safety culture method by benchmarking the over sea assessment techniques in 2011. The effectiveness of this improved methodology was validated through a pilot assessment. In this paper, the level of employees' safety culture awareness was analyzed by the improved method and reviewed what is necessary for the completeness and objectivity of the nuclear safety culture assessment methodology.
International Nuclear Information System (INIS)
Kim, Young Ga; Sung, Chan Ho; Jung, Yeon Sub
2012-01-01
After the Chernobyl nuclear accident in 1986, nuclear safety culture terminology was at first introduced emphasizing the importance of employees' attitude and organizational safety. The concept of safety culture was spread by INSAG 4 published in 1991. From that time, IAEA had provided the service of ASCOT for the safety culture assessment. However, many people still are thinking that safety culture is abstract and is not clear. It is why the systematic and reliable assessment methodology was not developed. Assessing safety culture is to identify what is the basic assumption for any organization to accept unconsciously. Therefore, it is very difficult to reach a meaningful conclusion by a superficial investigation alone. KHNP had been doing the safety culture assessment which was based on ASCOT methodology every 2 years. And this result had contributed to improving safety culture. But this result could not represent the level of organization's safety culture due to the limitation of method. So, KHNP has improved the safety culture method by benchmarking the over sea assessment techniques in 2011. The effectiveness of this improved methodology was validated through a pilot assessment. In this paper, the level of employees' safety culture awareness was analyzed by the improved method and reviewed what is necessary for the completeness and objectivity of the nuclear safety culture assessment methodology
Hiratsuka, Hiroyoshi; Suzuki, Hanako; Pusina, Alexis
2016-01-01
One of the current challenges in the field of intercultural education comes from the limited availability of training efficacy studies. The present study focused on explaining the effectiveness of the Contrast Culture Method (CCM) as an intercultural education method for managing interpersonal interactions across cultures between graduate…
A hanging drop culture method to study terminal erythroid differentiation.
Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak
2005-10-01
To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.
An alternative method for Plasmodium culture synchronization.
Lelièvre, J; Berry, A; Benoit-Vical, F
2005-03-01
Since the synchronization of Plasmodium falciparum has become an essential tool in research, we have investigated the use of a commercial gelatine solution, Plasmion, to replace Plasmagel, which is now difficult to obtain. This method also avoids the use of techniques based on Percoll-glucose gradients. The Plasmion-based technique proved to be a good method and could become an alternative to Plasmagel.
Suggestions on the Development of Safety Culture Assessment Method
International Nuclear Information System (INIS)
Choi, Young Sung; Choi, Kwang Sik; Kim, Woong Sik
2006-01-01
Several efforts have been made to assess safety culture of organization that operates nuclear power plants in Korea. The MOST and KINS played a major role to develop assessment methods and KHNP applied them to its NPPs. This paper explains the two methods developed by KINS briefly and presents the insights obtained from the two different applications. It concludes with some suggestions for safety culture assessment based on the insights
The effect of Montessori Method on teaching cultural and creative ...
African Journals Online (AJOL)
The Effect of the Montessori Method on teaching was investigated among children to discover their artistic development in Zaria, Kaduna State. The problem of the study is that the Montessori Method on teaching cultural and creative arts is not adequately explored in the primary schools, while other teaching methods used, ...
A simple method for multiday imaging of slice cultures.
Seidl, Armin H; Rubel, Edwin W
2010-01-01
The organotypic slice culture (Stoppini et al. A simple method for organotypic cultures of nervous tissue. 1991;37:173-182) has become the method of choice to answer a variety of questions in neuroscience. For many experiments, however, it would be beneficial to image or manipulate a slice culture repeatedly, for example, over the course of many days. We prepared organotypic slice cultures of the auditory brainstem of P3 and P4 mice and kept them in vitro for up to 4 weeks. Single cells in the auditory brainstem were transfected with plasmids expressing fluorescent proteins by way of electroporation (Haas et al. Single-cell electroporation for gene transfer in vivo. 2001;29:583-591). The culture was then placed in a chamber perfused with oxygenated ACSF and the labeled cell imaged with an inverted wide-field microscope repeatedly for multiple days, recording several time-points per day, before returning the slice to the incubator. We describe a simple method to image a slice culture preparation during the course of multiple days and over many continuous hours, without noticeable damage to the tissue or photobleaching. Our method uses a simple, inexpensive custom-built insulator constructed around the microscope to maintain controlled temperature and uses a perfusion chamber as used for in vitro slice recordings. (c) 2009 Wiley-Liss, Inc.
Comparison of Nested-PCR technique and culture method in ...
African Journals Online (AJOL)
USER
2010-04-05
Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.
Cultural adaptation and translation of measures: an integrated method.
Sidani, Souraya; Guruge, Sepali; Miranda, Joyal; Ford-Gilboe, Marilyn; Varcoe, Colleen
2010-04-01
Differences in the conceptualization and operationalization of health-related concepts may exist across cultures. Such differences underscore the importance of examining conceptual equivalence when adapting and translating instruments. In this article, we describe an integrated method for exploring conceptual equivalence within the process of adapting and translating measures. The integrated method involves five phases including selection of instruments for cultural adaptation and translation; assessment of conceptual equivalence, leading to the generation of a set of items deemed to be culturally and linguistically appropriate to assess the concept of interest in the target community; forward translation; back translation (optional); and pre-testing of the set of items. Strengths and limitations of the proposed integrated method are discussed. (c) 2010 Wiley Periodicals, Inc.
Characteristics of ovulation method acceptors: a cross-cultural assessment.
Klaus, H; Labbok, M; Barker, D
1988-01-01
Five programs of instruction in the ovulation method (OM) in diverse geographic and cultural settings are described, and characteristics of approximately 200 consecutive OM acceptors in each program are examined. Major findings include: the religious background and family size of acceptors are variable, as is the level of previous contraceptive use. Acceptors are drawn from a wide range of socioeconomic and religious backgrounds; however, family planning intention was similarly distributed in all five countries. In sum, the ovulation method is accepted by persons from a variety of backgrounds within and between cultural setting.
Improved Cell Culture Method for Growing Contracting Skeletal Muscle Models
Marquette, Michele L.; Sognier, Marguerite A.
2013-01-01
An improved method for culturing immature muscle cells (myoblasts) into a mature skeletal muscle overcomes some of the notable limitations of prior culture methods. The development of the method is a major advance in tissue engineering in that, for the first time, a cell-based model spontaneously fuses and differentiates into masses of highly aligned, contracting myotubes. This method enables (1) the construction of improved two-dimensional (monolayer) skeletal muscle test beds; (2) development of contracting three-dimensional tissue models; and (3) improved transplantable tissues for biomedical and regenerative medicine applications. With adaptation, this method also offers potential application for production of other tissue types (i.e., bone and cardiac) from corresponding precursor cells.
Simple method for culture of peripheral blood lymphocytes of Testudinidae.
Silva, T L; Silva, M I A; Venancio, L P R; Zago, C E S; Moscheta, V A G; Lima, A V B; Vizotto, L D; Santos, J R; Bonini-Domingos, C R; Azeredo-Oliveira, M T V
2011-12-06
We developed and optimized a simple, efficient and inexpensive method for in vitro culture of peripheral blood lymphocytes from the Brazilian tortoise Chelonoidis carbonaria (Testudinidae), testing various parameters, including culture medium, mitogen concentration, mitotic index, culture volume, incubation time, and mitotic arrest. Peripheral blood samples were obtained from the costal vein of four couples. The conditions that gave a good mitotic index were lymphocytes cultured at 37°C in minimum essential medium (7.5 mL), with phytohemagglutinin as a mitogen (0.375 mL), plus streptomycin/penicillin (0.1 mL), and an incubation period of 72 h. Mitotic arrest was induced by 2-h exposure to colchicine (0.1 mL), 70 h after establishing the culture. After mitotic arrest, the cells were hypotonized with 0.075 M KCl for 2 h and fixed with methanol/acetic acid (3:1). The non-banded mitotic chromosomes were visualized by Giemsa staining. The diploid chromosome number of C. carbonaria was found to be 52 in females and males, and sex chromosomes were not observed. We were able to culture peripheral blood lymphocytes of a Brazilian tortoise in vitro, for the preparation of mitotic chromosomes.
Dialectical Method and the Critical Political Economy of Culture
Directory of Open Access Journals (Sweden)
Brice Nixon
2012-05-01
Full Text Available This article argues that the quality that defines critical political economy is its critical method. Definitions of the critical political economy of culture are considered and shown to focus on specific theoretical concerns while not fully addressing the fundamental issue of method. Method is here discussed in terms of the way human reason is used to produce knowledge. A critical method for Marx is a historical materialist dialectical method, thus this paper argues for a deeper consideration of the Marxist dialectical method in relation to critical political-economic theorizing. Sources for methodological consideration from Marx to 20th-century Western Marxists are outlined. The potential contribution of the Marxist dialectical method in the continued development of the critical political economy of culture is demonstrated by showing the possibility of developing a complementary critical political economy of consciousness. Smythe’s theorizing of audiences as workers is considered as a useful starting point, and its potential development through incorporation of the work of other critical scholars of media and culture is outlined.
Cytokinesis-block micronucleus method in micro-blood cultures
International Nuclear Information System (INIS)
Liu Jinwen; Wang Lianzhi; Yang Cangzhen; Yao Yanyu
1991-01-01
This paper reports the cytokinesis-block micronucleus method in micro-blood cultures. The observations on detection induced micronuclei of different doses of 60 Co γ-rays irradiation and spontaneous micronucleus of different ages were performed with CB method in comporison with conventional micronucleus (CM) method. The results showed that with direct peripheral micro-blood cultures the cytoknesis-block micronuclei is also obtained. Using CB method, the micronuclei fequency of different ages was linear relationship, Y = 1.62 + 0.74 D, the spontaneous micronuclei frequency of different ages was 4.14%, the induced micronuclei also was a linear relationship, Y = 6.01 + 0.692 D. Using CM method, it showed that the induced micronuclei was a linear relationship, Y = 0.486 D - 1.968, but there is no significant difference between the micronuclei frequency of different ages. Comparison with CM and direct blood smear methods confirmed that the cytokinesis-block method of micro-blood cultures is more sensitive and precise
Sponge cell culture? A molecular identification method for sponge cells
Sipkema, D.; Heilig, G.H.J.; Akkermans, A.D.L.; Osinga, R.; Tramper, J.; Wijffels, R.H.
2003-01-01
Dissociated sponge cells are easily confused with unicellular organisms. This has been an obstacle in the development of sponge-cell lines. We developed a molecular detection method to identify cells of the sponge Dysidea avara in dissociated cell cultures. The 18S ribosomal RNA gene from a Dysidea
Effect of integration of cultural, botanical, and chemical methods of ...
African Journals Online (AJOL)
A field experiment was conducted from November 2011 to June 2013 to evaluate the effects of botanical, cultural, and chemical methods on termite colony survival, crop and wooden damage, and other biological activities in Ghimbi district of western Ethiopia. The termite mounds were dug and the following treatments were ...
The discussion on the qualitative and quantitative evaluation methods for safety culture
International Nuclear Information System (INIS)
Gao Kefu
2005-01-01
The fundamental methods for safely culture evaluation are described. Combining with the practice of the quantitative evaluation of safety culture in Daya Bay NPP, the quantitative evaluation method for safety culture are discussed. (author)
Ma, Zhen; Wan, Rong; Song, Xiefa; Gao, Lei
2013-09-01
Different culture methods may affect the intensive culture system of Pacific white shrimp ( Litopenaeus vannamei) regarding water quality and growth and economic performance. This study evaluated the potential effects of three culture methods through cultivation of juvenile shrimps under consistent tank management conditions for 84 d. The three methods involved shrimp cultivation in different tanks, i.e., outdoor tanks with cement bottom (mode-C), greenhouse tanks with cement bottom (mode-G) and outdoor tanks with mud-substrate (mode-M). Results showed that water temperature was significantly higher in mode-G than that in mode-C ( P shrimps. In the mid-late period, the average concentrations of TAN, NO2-N, DIP and COD were significantly lower in mode-M and mode-G compared with those in mode-C ( P shrimp weight among different treatments ( P > 0.05), mode-M had significantly higher shrimp yield, survival rate and feed conversion rate ( P < 0.05) than other modes. There were significant differences in revenue and net return among different treatments ( P < 0.05). These demonstrated that the treatments of mode-G and mode-M were conductive to the intensive culture system of L. vannamei.
Methods to Improve Cultural Communication Skills in Special Operations Forces
National Research Council Canada - National Science Library
Wise, J
1998-01-01
.... Three culture-specific templates were developed, each describing a culture and identifying culture-specific behaviors that were prioritized through focus groups of cultural informants and clustering analysis...
Directory of Open Access Journals (Sweden)
Cong Pei
2017-01-01
Full Text Available Culture-dependent and culture-independent methods were compared and evaluated in the study of the endophytic diversity of Dendrobium officinale. Culture-independent methods consisted of polymerase chain reaction–denaturing gradient gel electrophoresis (PCR-DGGE and metagenome methods. According to the results, differences were found between the three methods. Three phyla, namely Firmicutes, Proteobacteria, and Actinobacteria, were detected using the culture-dependent method, and two phyla, Firmicutes and Proteobacteria, were detected by the DGGE method. Using the metagenome method, four major phyla were determined, including Proteobacteria (76.54%, Actinobacteria (18.56%, Firmicutes (2.27%, and Bacteroidetes (1.56%. A distinct trend was obtained at the genus level in terms of the method and the corresponding number of genera determined. There were 449 genera and 16 genera obtained from the metagenome and DGGE methods, respectively, and only 7 genera were obtained through the culture-dependent method. By comparison, all the genera from the culture-dependent and DGGE methods were contained in the members determined using the metagenome method. Overall, culture-dependent methods are limited to ‘finding’ endophytic bacteria in plants. DGGE is an alternative to investigating primary diversity patterns; however, the metagenome method is still the best choice for determining the endophytic profile in plants. It is essential to use multiphasic approaches to study cultured and uncultured microbes.
Energy Technology Data Exchange (ETDEWEB)
Han, Sang Min; Seong, Poong Hyun [KAIST, Daejeon (Korea, Republic of)
2014-08-15
This study is conducted to suggest a new safety culture assessment method in nuclear power plants. Criteria with various existing safety culture analysis methods are united, and reliability analysis methods are applied. The concept of the most representative methods, Fault Tree Analysis (FTA) and Failure Mode and Effect Analysis (FMEA), are adopted to assess safety culture. Through this application, it is expected that the suggested method will bring results with convenience and objectiveness.
International Nuclear Information System (INIS)
Han, Sang Min; Seong, Poong Hyun
2014-01-01
This study is conducted to suggest a new safety culture assessment method in nuclear power plants. Criteria with various existing safety culture analysis methods are united, and reliability analysis methods are applied. The concept of the most representative methods, Fault Tree Analysis (FTA) and Failure Mode and Effect Analysis (FMEA), are adopted to assess safety culture. Through this application, it is expected that the suggested method will bring results with convenience and objectiveness
Electron microscopy methods in studies of cultural heritage sites
Energy Technology Data Exchange (ETDEWEB)
Vasiliev, A. L., E-mail: a.vasiliev56@gmail.com; Kovalchuk, M. V.; Yatsishina, E. B. [National Research Centre “Kurchatov Institute” (Russian Federation)
2016-11-15
The history of the development and application of scanning electron microscopy (SEM), transmission electron microscopy (TEM), and energy-dispersive X-ray microanalysis (EDXMA) in studies of cultural heritage sites is considered. In fact, investigations based on these methods began when electron microscopes became a commercial product. Currently, these methods, being developed and improved, help solve many historical enigmas. To date, electron microscopy combined with microanalysis makes it possible to investigate any object, from parchment and wooden articles to pigments, tools, and objects of art. Studies by these methods have revealed that some articles were made by ancient masters using ancient “nanotechnologies”; hence, their comprehensive analysis calls for the latest achievements in the corresponding instrumental methods and sample preparation techniques.
Electron microscopy methods in studies of cultural heritage sites
Vasiliev, A. L.; Kovalchuk, M. V.; Yatsishina, E. B.
2016-11-01
The history of the development and application of scanning electron microscopy (SEM), transmission electron microscopy (TEM), and energy-dispersive X-ray microanalysis (EDXMA) in studies of cultural heritage sites is considered. In fact, investigations based on these methods began when electron microscopes became a commercial product. Currently, these methods, being developed and improved, help solve many historical enigmas. To date, electron microscopy combined with microanalysis makes it possible to investigate any object, from parchment and wooden articles to pigments, tools, and objects of art. Studies by these methods have revealed that some articles were made by ancient masters using ancient "nanotechnologies"; hence, their comprehensive analysis calls for the latest achievements in the corresponding instrumental methods and sample preparation techniques.
Electron microscopy methods in studies of cultural heritage sites
International Nuclear Information System (INIS)
Vasiliev, A. L.; Kovalchuk, M. V.; Yatsishina, E. B.
2016-01-01
The history of the development and application of scanning electron microscopy (SEM), transmission electron microscopy (TEM), and energy-dispersive X-ray microanalysis (EDXMA) in studies of cultural heritage sites is considered. In fact, investigations based on these methods began when electron microscopes became a commercial product. Currently, these methods, being developed and improved, help solve many historical enigmas. To date, electron microscopy combined with microanalysis makes it possible to investigate any object, from parchment and wooden articles to pigments, tools, and objects of art. Studies by these methods have revealed that some articles were made by ancient masters using ancient “nanotechnologies”; hence, their comprehensive analysis calls for the latest achievements in the corresponding instrumental methods and sample preparation techniques.
Understanding Global / Local Cultural Leadership : Issues and Methods
Kolsteeg, Johan
2017-01-01
Cultural leaders sail between the Scylla and Charibdis of aggregated trans- and supranational cultural-political discourses and the cultural needs of local communities. How do these dynamics influence the work of cultural leaders? How can we understand the work of cultural leaders to connect
Directory of Open Access Journals (Sweden)
Alam A
2002-01-01
Full Text Available Gonococcal infection remains still a major cause of morbidity among sexually active individuals. Diagnosis of the infection in a female case is more difficult than that in a male. This was a prospective study among 269 female commercial sex workers (CSWs to screen them for gonococcal infection, comparing the rapid method of identification of gonococci by polymerase chain reaction (PCR with the selective culture method. A total of 92 (34.2% CSWs were identified positive for Neisseria gonorrhoeae by combination of the two methods. The PCR method identified 87 of the specimens to harbour cppB gene of N. gonorrhoeae, whereas culture method identified 83 specimens showing colonies of gonococci. Taking into consideration of the total positive cases (92, the PCR method showed a sensitivity of 94.57%, whereas sensitivity of culture method was 90.22%. The selective culture method appears to be the most applicable in the identification of gonococci from clinical specimens, particularly in the less resourceful countries like Bangladesh.
Del Prado, Alicia M; Church, A Timothy; Katigbak, Marcia S; Miramontes, Lilia G; Whitty, Monica; Curtis, Guy J; de Jesús Vargas-Flores, José; Ibáñez-Reyes, Joselina; Ortiz, Fernando A; Reyes, Jose Alberto S
2007-12-01
Three theoretical perspectives on cultural universals and differences in the content of self-concepts were tested in individualistic (United States, n = 178; Australia, n = 112) and collectivistic (Mexico, n = 157; Philippines, n = 138) cultures, using three methods of self-concept assessment. Support was found for both trait perspectives and the individual-self-primacy hypothesis. In contrast, support for cultural psychology hypotheses was limited because traits and other personal attributes were not more salient, or social attributes less salient, in individualistic cultures than collectivistic cultures. The salience of some aspects of self-concept depended on the method of assessment, calling into question conclusions based on monomethod studies.
A new method to culture sweetpotato in space farming
Tsuyuki, I.; Ishii, Y.; Oda, M.; Kitaya, Y.; Mori, G.
Sweetpotato production in space has many advantages over that of other crops; the plant has a higher growth rate and a higher yield with less fertilizer and less water, and functions as an efficient CO_2/O_2 converter. In a limited space in space farming, however, it is not favorable that sweetpotato shoots develop vigorously while the roots have not enlarged yet, because the sweetpotato organ of interest is not the shoot but the tuberous root. Cuttings of sweetpotato (Ipomoea batatas Lam. "Beniazuma") were used in this study. Each cutting was cut off from the 2nd - 10th nodes from the apices of mother branches and consisted of one expanded leaf, one node and five cm long stem. The cuttings were cultured suboptimally on a mixed soil (peat-moss:vermiculite=1:1 in volume) in a greenhouse under sunlight. Growth characteristics of the cuttings removed axillary buds were compared with cuttings with axillary buds in the first experiment. The cuttings without axillary buds started tuberous root bulking about 30 days after the onset of the experiment. The harvest index (tuberous root dry mass/total dry mass) was 0.5 after 70 days. Whereas, the control plant with an axillary bud developed a lateral shoot and formed no tuberous root during 70 days in the experiment. It was necessary to remove the axillary buds in order to form the tuberous roots in this method. To evaluate the effect of light intensity on tuberous root formation, cuttings without axillary buds were shaded with cheesecloth having 43% of light transmittance in the second experiment. The tuberous root formation was retarded 50 days in shaded cuttings compared with control cuttings. The tuberous roots were quickly formed and the large harvest index was ensured in this method with cuttings without axillary buds. Therefore the method is expected to be advantageous to culture sweetpotato at a high density with rapid turn over in a limited culture space in space farming.
Preservation of live cultures of basidiomycetes - recent methods.
Homolka, Ladislav
2014-02-01
Basidiomycetes are used in industrial processes, in basic or applied research, teaching, systematic and biodiversity studies. Efficient work with basidiomycete cultures requires their reliable source, which is ensured by their safe long-term storage. Repeated subculturing, frequently used for the preservation, is time-consuming, prone to contamination, and does not prevent genetic and physiological changes during long-term maintenance. Various storage methods have been developed in order to eliminate these disadvantages. Besides lyophilization (unsuitable for the majority of basidiomycetes), cryopreservation at low temperatures seems to be a very efficient way to attain this goal. Besides survival, another requirement for successful maintenance of fungal strains is the ability to preserve their features unchanged. An ideal method has not been created so far. Therefore it is highly desirable to develop new or improve the current preservation methods, combining advantages and eliminate disadvantages of individual techniques. Many reviews on preservation of microorganisms including basidiomycetes have been published, but the progress in the field requires an update. Although herbaria specimens of fungi (and of basidiomycetes in particular) are very important for taxonomic and especially typological studies, this review is limited to live fungal cultures. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Participatory Methods and UCA Project: understanding technologies as culture
Directory of Open Access Journals (Sweden)
Magda Pischetola
2015-12-01
Full Text Available Abstract In the complex and changing context of digital culture, the media become an important space of relation, as they have the crucial role of articulating new cultural logics that lead to disruptions in the school environment. To understand this change, new methods of analysis and research have been created, the so-called Participatory Methodologies. They are action research strategies aimed at intervening in a given social situation. In the analysis proposed here, such methodologies will help us to address the challenge of involving digital technologies in school culture, through the participation of different individuals involved. Two qualitative case studies about the project Um Computador por Aluno – the Brazilian One Laptop per Child -, carried out in 2012 in the schools of Santa Catarina and Bahia, are the first of two phases of the research presented. The results concern a "vertical" form of technology insertion in schools, which led to frustration and de-motivation at several levels. Starting from these considerations, the second stage of research proposes a pedagogical intervention in one of four schools in the field. The methodologies of participatory video and photography are chosen as possibilities of action-reflection-action on the sociocultural reality of students through the experience of sharing. The results show the importance of carrying out creative activities, appropriate to a social conception of learning, as well as the centrality of children and youth as agency and a broader need to redefine the relationship between teacher and student, in a more "horizontal" perspective process of teaching and learning. Keywords: Projeto UCA. Participatory Research Method. Innovative teaching-learning.
Managing Sonchus arvensis using mechanical and cultural methods
Directory of Open Access Journals (Sweden)
P. VANHALA
2008-12-01
Full Text Available Perennial sow-thistle (Sonchus arvensis L. represents an increasing problem in Finland. Options for mechanical and cultural control of S. arvensis were studied in a field experiment on clay soil under organic production. The experiment consisted of different crop sequences: spring cereal (barley, Hordeum vulgare L., in 2001, oats, Avena sativa L., in 2002 with or without inter-row hoeing and/or stubble cultivation, bare fallow, fibre hemp (Cannabis sativa L., and ley with mowing. In 2003 the entire field was sown to spring wheat. Crop plant and Sonchus shoot density and dry mass prior to cereal harvest and crop yield were assessed. The control effect was rated: bare fallow > ley > cereal with or without inter-row hoeing > poor growth fibre hemp. Bare fallow was an effective but costly way to reduce S. arvensis infestation. Introduction of a regularly mown green fallow or silage ley in the crop rotation is advisable. Mechanical weed control by inter-row hoeing in cereals limits S. arvensis growth. Infestation might also be reduced by stubble cultivation in autumn. When managing S. arvensis using mechanical and cultural methods, appropriate options, including a competitive crop, should be chosen for the specific field and rotation.;
Mixer, Sandra J
2008-04-01
As the world becomes increasingly multicultural, transcultural nursing education is critical to ensuring a culturally competent workforce. This paper presents a comprehensive review of literature and results of an ethnonursing pilot study using the Culture Care Theory (CCT) to discover how nursing faculty teach culture care. The literature revealed that despite 50 years of transcultural nursing knowledge development through theory, research and practice, there remains a lack of formal, integrated culture education in nursing. The importance of faculty providing generic and professional care to nursing students and using an organising framework to teach culture care was discovered. Additionally, care was essential for faculty health and well-being to enable faculty to teach culture care. This unique use of the theory and method demonstrates its usefulness in discovering and describing the complex nature of teaching culture care. Larger scale studies are predicted to further substantiate the CCT, building the discipline of nursing.
The Teaching Methods of Cultural Factors in The Classroom
Institute of Scientific and Technical Information of China (English)
Jia Mengyang
2014-01-01
Culture knowledge plays an important role in linguistic proficiency and currently most teaching activities are stil happened inthe traditionalclassroom. So this paper introducedsome ofthe practicalteachingmethods ofChinese culture inthe Chinese language classroom.
Nutrition and culture in professional football. A mixed method approach.
Ono, Mutsumi; Kennedy, Eileen; Reeves, Sue; Cronin, Linda
2012-02-01
An adequate diet is essential for the optimal performance of professional football (soccer) players. Existing studies have shown that players fail to consume such a diet, without interrogating the reasons for this. The aim of this study was to explore the difficulties professional football players experience in consuming a diet for optimal performance. It utilized a mixed method approach, combining nutritional intake assessment with qualitative interviews, to ascertain both what was consumed and the wider cultural factors that affect consumption. The study found a high variability in individual intake which ranged widely from 2648 to 4606 kcal/day. In addition, the intake of carbohydrate was significantly lower than that recommended. The study revealed that the main food choices for carbohydrate and protein intake were pasta and chicken respectively. Interview results showed the importance of tradition within the world of professional football in structuring the players' approach to nutrition. In addition, the players' personal eating habits that derived from their class and national habitus restricted their food choice by conflicting with the dietary choices promoted within the professional football clubs. Copyright © 2011 Elsevier Ltd. All rights reserved.
Research on fuzzy comprehensive assessment method of nuclear power plant safety culture
International Nuclear Information System (INIS)
Xiang Yuanyuan; Chen Xukun; Xu Rongbin
2012-01-01
Considering the traits of safety culture in nuclear plant, 38 safety culture assessment indexes are established from 4 aspects such as safety values, safety institution, safety behavior and safety sub- stances. Based on it, a comprehensive assessment method for nuclear power plant safety culture is constructed by using AHP (Analytic Hierarchy Process) approach and fuzzy mathematics. The comprehensive assessment method has the quality of high precision and high operability, which can support the decision making of safety culture development. (authors)
Utilizing the Project Method for Teaching Culture and Intercultural Competence
Euler, Sasha S.
2017-01-01
This article presents a detailed methodological outline for teaching culture through project work. It is argued that because project work makes it possible to gain transferrable and applicable knowledge and insight, it is the ideal tool for teaching culture with the aim of achieving real intercultural communicative competence (ICC). Preceding the…
The objective of this study was to compare the developmental competence of bovine in vitro fertilized embryos in three different culture methods; microdrop method (50 µl of medium under mineral oil in petri dishes) compared to tube methods (1 ml of medium in tubes) with or without oil overlay, and t...
Transnational Cultural Leadership as a Situated Practice : Dilemmas and Methods
Kolsteeg, Johan
2017-01-01
In a longitudinal transnational research project, a network of European research institutions and field organisations aims to understand how cultural managers mediate global and local pressures concerning creative autonomy, economy and ideology. Among the research questions are which variables
Theory and Method in Cross-Cultural Psychology
Malpass, Roy S.
1977-01-01
Cross cultural psychology is considered as a methodological strategy, as a means of evaluating hypotheses of unicultural origins with evidence of more panhuman relevance, and as a means of developing new theoretical psychological phenomena. (Author)
The evolution of chicken stem cell culture methods.
Farzaneh, M; Attari, F; Mozdziak, P E; Khoshnam, S E
2017-12-01
1. The avian embryo is an excellent model for studying embryology and the production of pharmaceutical proteins in transgenic chickens. Furthermore, chicken stem cells have the potential for proliferation and differentiation and emerged as an attractive tool for various cell-based technologies. 2. The objective of these studies is the derivation and culture of these stem cells is the production of transgenic birds for recombinant biomaterials and vaccine manufacture, drug and cytotoxicity testing, as well as to gain insight into basic science, including cell tracking. 3. Despite similarities among the established chicken stem cell lines, fundamental differences have been reported between their culture conditions and applications. Recent conventional protocols used for expansion and culture of chicken stem cells mostly depend on feeder cells, serum-containing media and static culture. 4. Utilising chicken stem cells for generation of cell-based transgenic birds and a variety of vaccines requires large-scale cell production. However, scaling up the conventional adherent chicken stem cells is challenging and labour intensive. Development of a suspension cell culture process for chicken embryonic stem cells (cESCs), chicken primordial germ cells (PGCs) and chicken induced pluripotent stem cells (ciPSCs) will be an important advance for increasing the growth kinetics of these cells. 6. This review describes various approaches and suggestions to achieve optimal cell growth for defined chicken stem cells cultures and use in future manufacturing applications.
Urdan, Tim; Munoz, Chantico
2012-01-01
Multiple methods were used to examine the academic motivation and cultural identity of a sample of college undergraduates. The children of immigrant parents (CIPs, n = 52) and the children of non-immigrant parents (non-CIPs, n = 42) completed surveys assessing core cultural identity, valuing of cultural accomplishments, academic self-concept,…
Schwab, Karen Walker
2013-01-01
This paper is a literature review using the Douglas-Widavasky Grid/Group theory as a framework to examine, from a cross cultural perspective, preferred parental disciplinary methods. The four rival cultures defined in the Grid/Group theory mirror the cultural dimensions of individualism-collectivism and power distance described by Geert Hofstede.…
Methods and Techniques of Sampling, Culturing and Identifying of Subsurface Bacteria
International Nuclear Information System (INIS)
Lee, Seung Yeop; Baik, Min Hoon
2010-11-01
This report described sampling, culturing and identifying of KURT underground bacteria, which existed as iron-, manganese-, and sulfate-reducing bacteria. The methods of culturing and media preparation were different by bacteria species affecting bacteria growth-rates. It will be possible for the cultured bacteria to be used for various applied experiments and researches in the future
Organizational Culture and the Deployment of Agile Methods: The Competing Values Model View
Iivari, Juhani; Iivari, Netta
A number of researchers have identified organizational culture as a factor that potentially affects the deployment of agile systems development methods. Inspired by the study of Iivari and Huisman (2007), which focused on the deployment of traditional systems development methods, the present paper proposes a number of hypotheses about the influence of organizational culture on the deployment of agile methods.
International Nuclear Information System (INIS)
Han, Sang Min; Kim, Ar Ryum; Seong, Poong Hyun
2016-01-01
In this study, team safety culture competency of a team was estimated through SNA, as a team safety culture index. To overcome the limit of existing safety culture evaluation methods, the concept of competency and SNA were adopted. To estimate team safety culture competency, we defined the definition, range and goal of team safety culture competencies. Derivation of core team safety culture competencies is performed and its behavioral characteristics were derived for each safety culture competency, from the procedures used in NPPs and existing criteria to assess safety culture. Then observation was chosen as a method to provide the input data for the SNA matrix of team members versus insufficient team safety culture competencies. Then through matrix operation, the matrix was converted into the two meaningful values, which are density of team members and degree centralities of each team safety culture competency. Density of tem members and degree centrality of each team safety culture competency represent the team safety culture index and the priority of team safety culture competency to be improved
Energy Technology Data Exchange (ETDEWEB)
Han, Sang Min; Kim, Ar Ryum; Seong, Poong Hyun [KAIST, Daejeon (Korea, Republic of)
2016-05-15
In this study, team safety culture competency of a team was estimated through SNA, as a team safety culture index. To overcome the limit of existing safety culture evaluation methods, the concept of competency and SNA were adopted. To estimate team safety culture competency, we defined the definition, range and goal of team safety culture competencies. Derivation of core team safety culture competencies is performed and its behavioral characteristics were derived for each safety culture competency, from the procedures used in NPPs and existing criteria to assess safety culture. Then observation was chosen as a method to provide the input data for the SNA matrix of team members versus insufficient team safety culture competencies. Then through matrix operation, the matrix was converted into the two meaningful values, which are density of team members and degree centralities of each team safety culture competency. Density of tem members and degree centrality of each team safety culture competency represent the team safety culture index and the priority of team safety culture competency to be improved.
Kesmen, Zülal; Kacmaz, Nazife
2011-01-01
In this study, we investigated the bacterial compositions of kefir grains and kefir beverages collected from different regions of Turkey by using culture-independent and culture-dependent methods. In the culture-independent detection, 10 different species of bacteria were detected in total by using the polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) analysis of the 16S rRNA gene V3 region. Among these species, Lactobacillus kefiranofaciens was the most dominant one in the kefir grains, while Lactococcus lactis was found to be significantly prevalent in the kefir beverages. In the culture-dependent detection, the primary differentiation and grouping of the isolates from kefir beverages and kefir grains were performed using repetitive sequence-based PCR (rep-PCR) fingerprinting, and the results were validated by 16S rDNA full-length sequencing. According to the results of culture-dependent methods, the most frequently isolated species were L. lactis, Leuconostoc mesenteroides, and Lactobacillus kefiri, respectively. Only 3 species, which are L. lactis, Lactobacillus acidophilus, and Streptococcus thermophilus, were detected with both culture-dependent and culture-independent methods. This study showed that the combination of both methods is necessary for a detailed and reliable investigation of microbial communities in kefir grains and kefir beverages. Due to their artisan- and region-dependent microflora, kefir products can be a source of interesting lactic acid bacteria, either new taxa or strains with specific functional properties, which might be used for the development of new starter cultures and innovative food products. Therefore, an increasing demand exists for new strains that show desirable effects on the product characteristics Artisan dairy products are a candidate source of such microorganisms. For this reason, in this study, the bacterial compositions of kefir grains and kefir beverages obtained from
A Method to Preclude Moisture Condensation in Plated Tissue Cultures
Alex M. Diner
1992-01-01
Excessive condensate normally accumulates in in vitro-illuminated petri dishes containing plant tissue cultures, causing avariety of problems. A dark-colored rubber net-mesh placed over the petri dishes prevented such condensation, even when charcoal-supplemented media are used under high light intensity in a growth chamber.
LABORATORY CULTURE METHODS FOR THE MOTTLED SCULPIN (COTTUS BAIRDI)
Fish from the family Cottidae (Sculpin Family) are being researched to determine their sensitivity to various metals in freshwater systems. The ability to culture them in the lab would facilitate species sensitivity comparisons. We collected adult mottled sculpins (C. bairdi) f...
Rapid method for culturing embryonic neuron-glial cell cocultures
DEFF Research Database (Denmark)
Svenningsen, Åsa Fex; Shan, Wei-Song; Colman, David R
2003-01-01
neurons is seen after 3 weeks (2 weeks in ascorbic acid), suggesting that basal lamina production is important even for glial ensheathment in the enteric nervous system. No overgrowth of fibroblasts or other nonneuronal cells was noted in any cultures, and myelination of the peripheral nervous system...
A new cell primo-culture method for freshwater benthic diatom communities
Debenest, Timothée; Silvestre, Jérôme; Coste, Michel; Delmas, François; Pinelli, Eric
2009-01-01
A new cell primo-culture method was developed for the benthic diatom community isolated from biofilm sampled in rivers. The approach comprised three steps: (1) scraping biofilm from river pebbles, (2) diatom isolation from biofilm, and (3) diatom community culture. With a view to designing a method able to stimulate the growth of diatoms, to limit the development of other microorganisms, and to maintain in culture a community similar to the original natural one, different factors were test...
Zapka, C; Leff, J; Henley, J; Tittl, J; De Nardo, E; Butler, M; Griggs, R; Fierer, N; Edmonds-Wilson, S
2017-03-28
Hands play a critical role in the transmission of microbiota on one's own body, between individuals, and on environmental surfaces. Effectively measuring the composition of the hand microbiome is important to hand hygiene science, which has implications for human health. Hand hygiene products are evaluated using standard culture-based methods, but standard test methods for culture-independent microbiome characterization are lacking. We sampled the hands of 50 participants using swab-based and glove-based methods prior to and following four hand hygiene treatments (using a nonantimicrobial hand wash, alcohol-based hand sanitizer [ABHS], a 70% ethanol solution, or tap water). We compared results among culture plate counts, 16S rRNA gene sequencing of DNA extracted directly from hands, and sequencing of DNA extracted from culture plates. Glove-based sampling yielded higher numbers of unique operational taxonomic units (OTUs) but had less diversity in bacterial community composition than swab-based sampling. We detected treatment-induced changes in diversity only by using swab-based samples ( P hand hygiene industry methods and for future hand microbiome studies. On the basis of our results and previously published studies, we propose recommendations for best practices in hand microbiome research. IMPORTANCE The hand microbiome is a critical area of research for diverse fields, such as public health and forensics. The suitability of culture-independent methods for assessing effects of hygiene products on microbiota has not been demonstrated. This is the first controlled laboratory clinical hand study to have compared traditional hand hygiene test methods with newer culture-independent characterization methods typically used by skin microbiologists. This study resulted in recommendations for hand hygiene product testing, development of methods, and future hand skin microbiome research. It also demonstrated the importance of inclusion of skin physiological metadata in
DEFF Research Database (Denmark)
Rudkjøbing, Vibeke Børsholt; Thomsen, Trine Rolighed; Nielsen, Per Halkjær
communities were more common by molecular methods than culture. Correspondence between findings by culture and molecular methods indicates that the latter may be an appropriate method. The advantages of using molecular methods are: 1) identification of the pathogen(s) even when antibiotics have been...... involved in the disease may add to the knowledge of NF pathogenesis and influence the administration of antibiotics, thereby potentially improving the outcome for the patients. In this study the aim was to investigate the applicability of different molecular methods as compared to standard culture......-based methods. We investigated the microbial communities in 21 samples obtained during debridement of NF patients (n=8). Samples were examined by standard bacteriological examination (culture and microscopy) at Rigshospitalet (Copenhagen, Denmark) and a range of molecular methods. The best DNA extraction...
A method for isolating identifying and culturing of rat trachea-bronchia epithelial cells
International Nuclear Information System (INIS)
Cui Fengmei; Su Shibiao; Nie Jihua; Li Bingyan; Tong Jian
2005-01-01
Objective: To explore a method for isolating identifying and culturing the rat trachea-bronchia epithelial cells. Methods: The rat trachea-bronchia epithelial cells were isolated by digestion with pronase and brushing with cell brush, identified using confocul and cultured in entire F12 media with no serum. Results: With this method, cells in high purity and high viability could be obtained, and about 10 6 cells per rat. The cells grow well in entire F12 media with no serum. Conclusion: The method is useful for isolating rate trachea-bronchia epithelial cells and the entire F12 media with no serum is effective for culturing. (authors)
Triangulation and the importance of establishing valid methods for food safety culture evaluation.
Jespersen, Lone; Wallace, Carol A
2017-10-01
The research evaluates maturity of food safety culture in five multi-national food companies using method triangulation, specifically self-assessment scale, performance documents, and semi-structured interviews. Weaknesses associated with each individual method are known but there are few studies in food safety where a method triangulation approach is used for both data collection and data analysis. Significantly, this research shows that individual results taken in isolation can lead to wrong conclusions, resulting in potentially failing tactics and wasted investments. However, by applying method triangulation and reviewing results from a range of culture measurement tools it is possible to better direct investments and interventions. The findings add to the food safety culture paradigm beyond a single evaluation of food safety culture using generic culture surveys. Copyright © 2017. Published by Elsevier Ltd.
Smith, Timothy B; Rodríguez, Melanie Domenech; Bernal, Guillermo
2011-02-01
This article summarizes the definitions, means, and research of adapting psychotherapy to clients' cultural backgrounds. We begin by reviewing the prevailing definitions of cultural adaptation and providing a clinical example. We present an original meta-analysis of 65 experimental and quasi-experimental studies involving 8,620 participants. The omnibus effect size of d = .46 indicates that treatments specifically adapted for clients of color were moderately more effective with that clientele than traditional treatments. The most effective treatments tended to be those with greater numbers of cultural adaptations. Mental health services targeted to a specific cultural group were several times more effective than those provided to clients from a variety of cultural backgrounds. We recommend a series of research-supported therapeutic practices that account for clients' culture, with culture-specific treatments being more effective than generally culture-sensitive treatments. © 2010 Wiley Periodicals, Inc.
Noa Kirschner Peretz; Sofia Segal; Limor Arbel-Ganon; Ronen Ben Jehuda; Ronen Ben Jehuda; Yuval Shemer; Yuval Shemer; Binyamin Eisen; Binyamin Eisen; Moran Davoodi; Ofer Binah; Ofer Binah; Yael Yaniv
2017-01-01
Culturing atrial cells leads to a loss in their ability to be externally paced at physiological rates and to maintain their shape. We aim to develop a culture method that sustains the shape of atrial cells along with their biophysical and bioenergetic properties in response to physiological pacing. We hypothesize that adding 2,3-Butanedione 2-monoxime (BDM), which inhibits contraction during the culture period, will preserve these biophysical and bioenergetic properties. Rabbit atrial cells w...
Choice of Appropriate Multimedia Technology and Teaching Methods for Different Culture Groups
Taratoukhina, Julia
2014-01-01
This paper describes the prerequisites for development in the area of cross-cultural multimedia didactics. This approach is based on research studies of differences between mentalities, ways of working with educational information, culturally-specific teaching methods and teaching techniques that determine differentiated approaches to the choice…
Kuster Dale, Kimberly
2012-01-01
This concurrent, mixed-methods case study analyzed perceptions of current and preferred organizational culture within a rural, multi-campus community college district. This phenomenon was examined by analyzing and comparing data collected by surveying all full-time employees utilizing the Organizational Culture Assessment Instrument (OCAI) and…
EXPLANTATION OF MESANGIAL CELL HILLOCKS - A METHOD FOR OBTAINING HUMAN MESANGIAL CELLS IN CULTURE
MULLER, EW; KIM, Y; MICHAEL, AF; VERNIER, RL; VANDERHEM, GK; VANDERWOUDE, FJ
A simple method is presented for selective cell culture of human mesangial cells using explanatation of mesangial cell hillocks. Glomeruli which had been incubated with collagenase were explanted on plastic tissue culture flasks. Three to 6 weeks after explantation, a rapidly growing multilayer of
Directory of Open Access Journals (Sweden)
Barbara Grzechocinska
2008-04-01
Full Text Available The objective of the study was to compare two different embryo culture methods in the course of in vitro fertilization program by means of fertilization rate, embryo development, total time and cost. 98 patients undergoing assisted reproduction procedures due to infertility were analyzed. The inclusion criteria for the study: first IVF-ET program, at least 10 MII oocytes, no indications for ICSI. Oocytes were divided into two study groups: group A- open culture (oocytes placed in four-well dishes together, then inseminated and cultured in successive wells and group B - a closed culture (oocytes placed in microdroplets, each embryo cultured separately. The fertilization rate was assessed around 18 hours from insemination. The embryos were classified into four classes. The best embryos were chosen for transfer. In the group A the fertilization rate obtained was lower than in group B (68% vs. 78%, respectively. The microdroplet culture required more time on the insemination day and on the second day of culture, while the four-well dish method required more time on the first day of culture and on the day of transfer. On analyzing the total cost of the above procedures (MI medium and oil costs it occurred that the microdroplet culture was more expensive than the four-well dish method (due to the intake of paraffin oil. However, the difference was of no practical importance. In the conclusion, microdroplet culture gives a higher fertilization rate than four-well dish culture, probably due to a homogenous sperm distribution. Despite the differences in time outside the incubator and laboratory expenses (which are after all insignificant microdroplet culture allows a better control over the embryo development. The embryos of best developmental potential can therefore be chosen for ET.
An Evaluation Method for Team Competencies to Enhance Nuclear Safety Culture
International Nuclear Information System (INIS)
Hang, S. M.; Seong, P. H.; Kim, A. R.
2016-01-01
Safety culture has received attention in safety-critical industries, including nuclear power plants (NPPs), due to various prominent accidents such as concealment of a Station Blackout (SBO) of Kori NPP unit 1 in 2012, the Sewol ferry accident in 2014, and the Chernobyl accident in 1986. Analysis reports have pointed out that one of the major contributors to the cause of the accidents is ‘the lack of safety culture’. The term, nuclear safety culture, was firstly defined after the Chernobyl accident by the IAEA in INSAG report no. 4, as follows “Safety culture is that assembly of characteristics and attitudes in organizations and individuals which establishes that, as an overriding priority, nuclear plant safety issues receive the attention warranted their significance.” Afterwards, a wide consensus grew among researchers and nuclear-related organizations, that safety culture should be evaluated and managed in a certain manner. Consequently, each nuclear-related organization defined and developed their own safety culture definitions and assessment methods. However, none of these methods provides a way for an individual or a team to enhance the safety culture of an organization. Especially for a team, which is the smallest working unit in NPPs, team members easily overlook their required practices to improve nuclear safety culture. Therefore in this study, we suggested a method to estimate nuclear safety culture of a team, by approaching with the ‘competency’ point of view. The competency is commonly focused on individuals, and defined as, “underlying characteristics of an individual that are causally related to effective or superior performance in a job.” Similar to safety culture, the definition of competency focuses on characteristics and attitudes of individuals. Thus, we defined ‘safety culture competency’ as “underlying characteristics and outward attitudes of individuals that are causally related to a healthy and strong nuclear safety
Leff, J.; Henley, J.; Tittl, J.; De Nardo, E.; Butler, M.; Griggs, R.; Fierer, N.
2017-01-01
ABSTRACT Hands play a critical role in the transmission of microbiota on one’s own body, between individuals, and on environmental surfaces. Effectively measuring the composition of the hand microbiome is important to hand hygiene science, which has implications for human health. Hand hygiene products are evaluated using standard culture-based methods, but standard test methods for culture-independent microbiome characterization are lacking. We sampled the hands of 50 participants using swab-based and glove-based methods prior to and following four hand hygiene treatments (using a nonantimicrobial hand wash, alcohol-based hand sanitizer [ABHS], a 70% ethanol solution, or tap water). We compared results among culture plate counts, 16S rRNA gene sequencing of DNA extracted directly from hands, and sequencing of DNA extracted from culture plates. Glove-based sampling yielded higher numbers of unique operational taxonomic units (OTUs) but had less diversity in bacterial community composition than swab-based sampling. We detected treatment-induced changes in diversity only by using swab-based samples (P hand hygiene industry methods and for future hand microbiome studies. On the basis of our results and previously published studies, we propose recommendations for best practices in hand microbiome research. PMID:28351915
Directory of Open Access Journals (Sweden)
Željko Bjeljac
2016-02-01
Full Text Available The folk artistry of Serbia is rich in spiritual values tied to customs, celebrations, music, song, dance, games, stories and legends, and this kind of cultural heritage is presented through numerous festivals, events and tourist manifestations. In 2012, the network for the safeguarding of intangible cultural heritage was formed, comprised of the National committee for intangible cultural heritage, the Commission for admission into the registry of intangible cultural heritage, a network of coordinators and the Center for intangible cultural heritage of Serbia. These institutions have chosen 6 elements of intangible cultural heritage, out of 27 suggestions: the slava, the Đurđevdan ritual, the kolo dance, singing accompanied by gusle, Slovakian naive painting, the custom of making and lighting farmers’ candles, Pirot carpet weaving, and Zlakusa pottery as elements of cultural heritage which reflect the national and cultural identity of the Serbian people, and Slavic minorities. These elements of intangible cultural heritage have a certain tourism potential and can represent an important factor in the forming of the tourist brand of Serbia. In order to determine the importance of the 27 suggestions of intangible cultural elements of Serbia, an analysis was conducted, using an adapted form of the Hilary du Cros method of tourist valorization.
Method for organotypic tissue culture in the aged animal
Directory of Open Access Journals (Sweden)
Jared Schommer
2017-01-01
• Our method permits slices from mice as old as 16 months and rabbits as old as years of age to survive ex vivo up to 8 weeks [6–9]. Such a slice system may be relevant to investigating age-related brain diseases.
Preservation of live cultures of basidiomycetes - Recent methods
Czech Academy of Sciences Publication Activity Database
Homolka, Ladislav
2014-01-01
Roč. 118, č. 2 (2014), s. 107-125 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Fungi * Maintenance methods * Long-term preservation Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014
Mei, Jun; Guo, Qizhen; Wu, Yan; Li, Yunfei
2014-01-01
The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE) analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM) methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates). Meanwhile, Kazachstania servazzii (51 isolates) represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates). However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved) cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese. PMID:25360757
Directory of Open Access Journals (Sweden)
Jun Mei
Full Text Available The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR-denaturing gradient gel electrophoresis (DGGE analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates. Meanwhile, Kazachstania servazzii (51 isolates represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates. However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese.
Mei, Jun; Guo, Qizhen; Wu, Yan; Li, Yunfei
2014-01-01
The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE) analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM) methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates). Meanwhile, Kazachstania servazzii (51 isolates) represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates). However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved) cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese.
Plant management in natural areas: balancing chemical, mechanical, and cultural control methods
Steven Manning; James. Miller
2011-01-01
After determining the best course of action for control of an invasive plant population, it is important to understand the variety of methods available to the integrated pest management professional. A variety of methods are now widely used in managing invasive plants in natural areas, including chemical, mechanical, and cultural control methods. Once the preferred...
Bacterial diversity determination using culture-dependent and culture-independent methods
Directory of Open Access Journals (Sweden)
M. Ghiasian
2017-04-01
Full Text Available Mud volcanoes are taken into consideration by geologists and oil industry experts have given their association with oil and gas reserves and methane greenhouse gas production in hydrosphere and atmosphere. Gomishan mud volcano phenomenon in the southeastern edge of the Caspian Sea, given its oil and gas resources, has been studied by some geologists in terms of geology and tectonics but not in terms of microbiology. Accordingly, it seems necessary to study this phenomenon from the perspective of microbiology in order to identify prokaryotes living in this area. Prokaryotes diversity in Mud volcano has been studied by cultivation techniques, fluorescence in situ hybridization, and denaturing gradient gel electrophoresis of PCR-amplified fragments of 16S rRNA genes. Total cell abundance in the mud volcano from 1×101-6×101per milliliter was determined by 4', 6-diamidino-2-phenylindole direct count. The detectable proportion of Archaea to Bacteria in the community by FISH was one to five. High viable counts (1 – 3 × 106 were obtained in culture media. A total of 122 isolates were obtained, 46 colonies were selected based on primarily morphological and physiological traits, and their 16S rRNA sequences were determined. The isolated genera included Halomonas (20%, Arthrobacter (5%, Kocuria (5%, Thalassobacillus (5%, Marinobacter (20%, Paracoccus (5%, Roseovarius (5%, Jeotgalicoccus (5%, Bacillus (15%, and Staphylococcus (15%. Regarding DGGE analysis, selected bands were obtained from the gels, reamplified and sequenced. Overall, 75% of the bacterial sequences were related to Rahnella and 25% related to Serratia.
A novel method for coral explant culture and micropropagation.
Vizel, Maya; Loya, Yossi; Downs, Craig A; Kramarsky-Winter, Esti
2011-06-01
We describe here a method for the micropropagation of coral that creates progeny from tissue explants derived from a single polyp or colonial corals. Coral tissue explants of various sizes (0.5-2.5 mm in diameter) were manually microdissected from the solitary coral Fungia granulosa. Explants could be maintained in an undeveloped state or induced to develop into polyps by manipulating environmental parameters such as light and temperature regimes, as well as substrate type. Fully developed polyps were able to be maintained for a long-term in a closed sea water system. Further, we demonstrate that mature explants are also amenable to this technique with the micropropagation of second-generation explants and their development into mature polyps. We thereby experimentally have established coral clonal lines that maintain their ability to differentiate without the need for chemical induction or genetic manipulation. The versatility of this method is also demonstrated through its application to two other coral species, the colonial corals Oculina patigonica and Favia favus.
In Vitro Culturing and Live Imaging of Drosophila Egg Chambers: A History and Adaptable Method.
Peters, Nathaniel C; Berg, Celeste A
2016-01-01
The development of the Drosophila egg chamber encompasses a myriad of diverse germline and somatic events, and as such, the egg chamber has become a widely used and influential developmental model. Advantages of this system include physical accessibility, genetic tractability, and amenability to microscopy and live culturing, the last of which is the focus of this chapter. To provide adequate context, we summarize the structure of the Drosophila ovary and egg chamber, the morphogenetic events of oogenesis, the history of egg-chamber live culturing, and many of the important discoveries that this culturing has afforded. Subsequently, we discuss various culturing methods that have facilitated analyses of different stages of egg-chamber development and different types of cells within the egg chamber, and we present an optimized protocol for live culturing Drosophila egg chambers.We designed this protocol for culturing late-stage Drosophila egg chambers and live imaging epithelial tube morphogenesis, but with appropriate modifications, it can be used to culture egg chambers of any stage. The protocol employs a liquid-permeable, weighted "blanket" to gently hold egg chambers against the coverslip in a glass-bottomed culture dish so the egg chambers can be imaged on an inverted microscope. This setup provides a more buffered, stable, culturing environment than previously published methods by using a larger volume of culture media, but the setup is also compatible with small volumes. This chapter should aid researchers in their efforts to culture and live-image Drosophila egg chambers, further augmenting the impressive power of this model system.
DEFF Research Database (Denmark)
Jensen, Mika Yasuoka; Nakatani, Momoko; Ohno, Takehiko
2013-01-01
Historically, Participatory Design (PD) was introduced and applied in the Scandinavian and American context as a practical design method for collective creativity and stakeholder involvement. In this paper, by fusing game elements into PD, we suggest a first step towards a culturally independent ...... imply that the introduction of game elements allows PD to be effectively utilized in culturally diverse settings.......Historically, Participatory Design (PD) was introduced and applied in the Scandinavian and American context as a practical design method for collective creativity and stakeholder involvement. In this paper, by fusing game elements into PD, we suggest a first step towards a culturally independent PD...... method called the ICT Service Design Game to ease the prevailing concern that PD has limited applicability in other cultural settings. We conduct four experiments on ICT Service Design Game in Scandinavia and Asia to evaluate its feasibility. The experiments identify some differences in the PD process...
Peretz, Avi; Geffen, Yuval; Socea, Soergiu D; Pastukh, Nina; Graffi, Shmuel
2015-08-01
Acanthamoeba keratitis (AK), a potentially blinding infection of the cornea, is caused by a free-living protozoan. Culture and microscopic examination of corneal scraping tissue material is the conventional method for identifying Acanthamoeba. In this article, we compared several methods for AK diagnosis of 32 patients: microscopic examination using fluorescent dye, specific culture on growth media-non-nutrient agar (NNA), culture on liquid growth media-peptone yeast glucose (PYG), and TYI-S-33. AK was found in 14 patients. Thirteen of the specimens were found AK positive by fluorescence microscopic examination, 11 specimens were found AK positive on PYG growth media, and 9 specimens were found AK positive on TYI-S-33 growth media. Only five specimens were found AK positive on NNA growth media. Therefore, we recommend using fluorescence microscopy technique and culture method, especially PYG liquid media. © The American Society of Tropical Medicine and Hygiene.
Chen, Hsi-Chia; Wang, Sheng-Yao; Chen, Ming-Ju
2008-05-01
Lactic acid bacteria (LAB) in different original kefir grains were first assessed using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) by a culture-dependent way, and were further confirmed by DNA sequencing techniques. Results indicated that a combined method of cultivation with PCR-DGGE and subsequent DNA sequencing could successfully identify four LAB strains from three kefir grains from Taiwan (named Hsinchu, Mongolia and Ilan). Lactobacillus kefiri accounted, in the three kefir grains, for at least half of the isolated colonies while Lb. kefiranofaciens was the second most frequently isolated species. Leuconostoc mesenteroides was less frequently found but still in the three kefir grains conversely to Lactococcus lactis which based on culture-dependent isolation was only found in two of the kefir grains. It was interesting to find that all three kefir grains contain similar LAB species. Furthermore, the DGGE as a culture-independent method was also applied to detect the LAB strains. Results indicated that Lb. kefiranofaciens was found in all three kefir grains, whereas Lb. kefiri was only observed in Hsinchu kefir grain and Lc. lactis was found in both Mongolia and Ilan samples. Two additional strains, Pseudomonas spp. and E. coli, were also detected in kefir grains.
Makonde, Huxley M; Boga, Hamadi I; Osiemo, Zipporah; Mwirichia, Romano; Stielow, J Benjamin; Göker, Markus; Klenk, Hans-Peter
2013-01-01
Fungus-cultivating termites make use of an obligate mutualism with fungi from the genus Termitomyces, which are acquired through either vertical transmission via reproductive alates or horizontally transmitted during the formation of new mounds. Termitomyces taxonomy, and thus estimating diversity and host specificity of these fungi, is challenging because fruiting bodies are rarely found. Molecular techniques can be applied but need not necessarily yield the same outcome than morphological identification. Culture-dependent and culture-independent methods were used to comprehensively assess host specificity and gut fungal diversity. Termites were identified using mitochondrial cytochrome oxidase II (COII) genes. Twenty-three Termitomyces cultures were isolated from fungal combs. Internal transcribed spacer (ITS) clone libraries were constructed from termite guts. Presence of Termitomyces was confirmed using specific and universal primers. Termitomyces species boundaries were estimated by cross-comparison of macromorphological and sequence features, and ITS clustering parameters accordingly optimized. The overall trends in coverage of Termitomyces diversity and host associations were estimated using Genbank data. Results indicate a monoculture of Termitomyces in the guts as well as the isolation sources (fungal combs). However, cases of more than one Termitomyces strains per mound were observed since mounds can contain different termite colonies. The newly found cultures, as well as the clustering analysis of GenBank data indicate that there are on average between one and two host genera per Termitomyces species. Saturation does not appear to have been reached, neither for the total number of known Termitomyces species nor for the number of Termitomyces species per host taxon, nor for the number of known hosts per Termitomyces species. Considering the rarity of Termitomyces fruiting bodies, it is suggested to base the future taxonomy of the group mainly on well
Directory of Open Access Journals (Sweden)
Huxley M Makonde
Full Text Available BACKGROUND: Fungus-cultivating termites make use of an obligate mutualism with fungi from the genus Termitomyces, which are acquired through either vertical transmission via reproductive alates or horizontally transmitted during the formation of new mounds. Termitomyces taxonomy, and thus estimating diversity and host specificity of these fungi, is challenging because fruiting bodies are rarely found. Molecular techniques can be applied but need not necessarily yield the same outcome than morphological identification. METHODOLOGY: Culture-dependent and culture-independent methods were used to comprehensively assess host specificity and gut fungal diversity. Termites were identified using mitochondrial cytochrome oxidase II (COII genes. Twenty-three Termitomyces cultures were isolated from fungal combs. Internal transcribed spacer (ITS clone libraries were constructed from termite guts. Presence of Termitomyces was confirmed using specific and universal primers. Termitomyces species boundaries were estimated by cross-comparison of macromorphological and sequence features, and ITS clustering parameters accordingly optimized. The overall trends in coverage of Termitomyces diversity and host associations were estimated using Genbank data. RESULTS AND CONCLUSION: Results indicate a monoculture of Termitomyces in the guts as well as the isolation sources (fungal combs. However, cases of more than one Termitomyces strains per mound were observed since mounds can contain different termite colonies. The newly found cultures, as well as the clustering analysis of GenBank data indicate that there are on average between one and two host genera per Termitomyces species. Saturation does not appear to have been reached, neither for the total number of known Termitomyces species nor for the number of Termitomyces species per host taxon, nor for the number of known hosts per Termitomyces species. Considering the rarity of Termitomyces fruiting bodies, it is
Directory of Open Access Journals (Sweden)
C. Zapka
2017-03-01
Full Text Available Hands play a critical role in the transmission of microbiota on one’s own body, between individuals, and on environmental surfaces. Effectively measuring the composition of the hand microbiome is important to hand hygiene science, which has implications for human health. Hand hygiene products are evaluated using standard culture-based methods, but standard test methods for culture-independent microbiome characterization are lacking. We sampled the hands of 50 participants using swab-based and glove-based methods prior to and following four hand hygiene treatments (using a nonantimicrobial hand wash, alcohol-based hand sanitizer [ABHS], a 70% ethanol solution, or tap water. We compared results among culture plate counts, 16S rRNA gene sequencing of DNA extracted directly from hands, and sequencing of DNA extracted from culture plates. Glove-based sampling yielded higher numbers of unique operational taxonomic units (OTUs but had less diversity in bacterial community composition than swab-based sampling. We detected treatment-induced changes in diversity only by using swab-based samples (P < 0.001; we were unable to detect changes with glove-based samples. Bacterial cell counts significantly decreased with use of the ABHS (P < 0.05 and ethanol control (P < 0.05. Skin hydration at baseline correlated with bacterial abundances, bacterial community composition, pH, and redness across subjects. The importance of the method choice was substantial. These findings are important to ensure improvement of hand hygiene industry methods and for future hand microbiome studies. On the basis of our results and previously published studies, we propose recommendations for best practices in hand microbiome research.
A fluorescence anisotropy method for measuring protein concentration in complex cell culture media.
Groza, Radu Constantin; Calvet, Amandine; Ryder, Alan G
2014-04-22
The rapid, quantitative analysis of the complex cell culture media used in biopharmaceutical manufacturing is of critical importance. Requirements for cell culture media composition profiling, or changes in specific analyte concentrations (e.g. amino acids in the media or product protein in the bioprocess broth) often necessitate the use of complicated analytical methods and extensive sample handling. Rapid spectroscopic methods like multi-dimensional fluorescence (MDF) spectroscopy have been successfully applied for the routine determination of compositional changes in cell culture media and bioprocess broths. Quantifying macromolecules in cell culture media is a specific challenge as there is a need to implement measurements rapidly on the prepared media. However, the use of standard fluorescence spectroscopy is complicated by the emission overlap from many media components. Here, we demonstrate how combining anisotropy measurements with standard total synchronous fluorescence spectroscopy (TSFS) provides a rapid, accurate quantitation method for cell culture media. Anisotropy provides emission resolution between large and small fluorophores while TSFS provides a robust measurement space. Model cell culture media was prepared using yeastolate (2.5 mg mL(-1)) spiked with bovine serum albumin (0 to 5 mg mL(-1)). Using this method, protein emission is clearly discriminated from background yeastolate emission, allowing for accurate bovine serum albumin (BSA) quantification over a 0.1 to 4.0 mg mL(-1) range with a limit of detection (LOD) of 13.8 μg mL(-1). Copyright © 2014. Published by Elsevier B.V.
Dyal, Jonathan; Akampurira, Andrew; Rhein, Joshua; Morawski, Bozena M; Kiggundu, Reuben; Nabeta, Henry W; Musubire, Abdu K; Bahr, Nathan C; Williams, Darlisha A; Bicanic, Tihana; Larsen, Robert A; Meya, David B; Boulware, David R
2016-05-01
Quantitative cerebrospinal fluid (CSF) cultures provide a measure of disease severity in cryptococcal meningitis. The fungal clearance rate by quantitative cultures has become a primary endpoint for phase II clinical trials. This study determined the inter-assay accuracy of three different quantitative culture methodologies. Among 91 participants with meningitis symptoms in Kampala, Uganda, during August-November 2013, 305 CSF samples were prospectively collected from patients at multiple time points during treatment. Samples were simultaneously cultured by three methods: (1) St. George's 100 mcl input volume of CSF with five 1:10 serial dilutions, (2) AIDS Clinical Trials Group (ACTG) method using 1000, 100, 10 mcl input volumes, and two 1:100 dilutions with 100 and 10 mcl input volume per dilution on seven agar plates; and (3) 10 mcl calibrated loop of undiluted and 1:100 diluted CSF (loop). Quantitative culture values did not statistically differ between St. George-ACTG methods (P= .09) but did for St. George-10 mcl loop (Pmethods was high (r≥0.88). For detecting sterility, the ACTG-method had the highest negative predictive value of 97% (91% St. George, 60% loop), but the ACTG-method had occasional (∼10%) difficulties in quantification due to colony clumping. For CSF clearance rate, St. George-ACTG methods did not differ overall (mean -0.05 ± 0.07 log10CFU/ml/day;P= .14) on a group level; however, individual-level clearance varied. The St. George and ACTG quantitative CSF culture methods produced comparable but not identical results. Quantitative cultures can inform treatment management strategies. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Utility of PCR, Culture, and Antigen Detection Methods for Diagnosis of Legionellosis.
Chen, Derrick J; Procop, Gary W; Vogel, Sherilynn; Yen-Lieberman, Belinda; Richter, Sandra S
2015-11-01
The goal of this retrospective study was to evaluate the performance of different diagnostic tests for Legionnaires' disease in a clinical setting where Legionella pneumophila PCR had been introduced. Electronic medical records at the Cleveland Clinic were searched for Legionella urinary antigen (UAG), culture, and PCR tests ordered from March 2010 through December 2013. For cases where two or more test methods were performed and at least one was positive, the medical record was reviewed for relevant clinical and epidemiologic factors. Excluding repeat testing on a given patient, 19,912 tests were ordered (12,569 UAG, 3,747 cultures, and 3,596 PCR) with 378 positive results. The positivity rate for each method was 0.4% for culture, 0.8% for PCR, and 2.7% for UAG. For 37 patients, at least two test methods were performed with at least one positive result: 10 (27%) cases were positive by all three methods, 16 (43%) were positive by two methods, and 11 (30%) were positive by one method only. For the 32 patients with medical records available, clinical presentation was consistent with proven or probable Legionella infection in 84% of the cases. For those cases, the sensitivities of culture, PCR, and UAG were 50%, 92%, and 96%, respectively. The specificities were 100% for culture and 99.9% for PCR and UAG. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Oster, Richard T; Grier, Angela; Lightning, Rick; Mayan, Maria J; Toth, Ellen L
2014-10-19
We used an exploratory sequential mixed methods approach to study the association between cultural continuity, self-determination, and diabetes prevalence in First Nations in Alberta, Canada. We conducted a qualitative description where we interviewed 10 Cree and Blackfoot leaders (members of Chief and Council) from across the province to understand cultural continuity, self-determination, and their relationship to health and diabetes, in the Alberta First Nations context. Based on the qualitative findings, we then conducted a cross-sectional analysis using provincial administrative data and publically available data for 31 First Nations communities to quantitatively examine any relationship between cultural continuity and diabetes prevalence. Cultural continuity, or "being who we are", is foundational to health in successful First Nations. Self-determination, or "being a self-sufficient Nation", stems from cultural continuity and is seriously compromised in today's Alberta Cree and Blackfoot Nations. Unfortunately, First Nations are in a continuous struggle with government policy. The intergenerational effects of colonization continue to impact the culture, which undermines the sense of self-determination, and contributes to diabetes and ill health. Crude diabetes prevalence varied dramatically among First Nations with values as low as 1.2% and as high as 18.3%. Those First Nations that appeared to have more cultural continuity (measured by traditional Indigenous language knowledge) had significantly lower diabetes prevalence after adjustment for socio-economic factors (p =0.007). First Nations that have been better able to preserve their culture may be relatively protected from diabetes.
Kowalczyk, Wojciech; Rybicki, Zbigniew; Tomaszewski, Dariusz; Truszczyński, Andrzej; Guzek, Aneta
2011-01-01
Although broncho-alveolar lavage (BAL) culture and protected specimen brush (PSB) are regarded as the most effective methods in the diagnosis of VAP, a simple endotracheal aspiration (EA) is frequently performed during routine care, because of its simplicity and low cost. We compared the effectiveness of EA with BAL and PSB in VAP patients. Sixty-one adult VAP patients, ventilated for longer than 48 h, were cultured with all three methods. Positive cultures were obtained from 63.9% of patients, with Acinetobacter baumannii being the most common pathogen. There was a high positive correlation between simple aspirates and BAL (k 0.817, CI 0.664-0.840, p aspirates and PSB (k 0.667, CI 0.483-0.871, p aspirate culturing, compared to BAL and PSB, it can be used successfully in most cases.
Directory of Open Access Journals (Sweden)
Noa Kirschner Peretz
2017-08-01
Full Text Available Culturing atrial cells leads to a loss in their ability to be externally paced at physiological rates and to maintain their shape. We aim to develop a culture method that sustains the shape of atrial cells along with their biophysical and bioenergetic properties in response to physiological pacing. We hypothesize that adding 2,3-Butanedione 2-monoxime (BDM, which inhibits contraction during the culture period, will preserve these biophysical and bioenergetic properties. Rabbit atrial cells were maintained in culture for 24 h in a medium enriched with a myofilament contraction inhibitor, BDM. The morphology and volume of the cells, including their ability to contract in response to 1–3 Hz electrical pacing, was maintained at the same level as fresh cells. Importantly, the cells could be successfully infected with a GFP adenovirus. Action potentials, Ca2+ transients, and local Ca2+ spark parameters were similar in the cultured and in fresh cells. Finally, these cultured cells' flavoprotein autofluorescence was maintained at a constant level in response to electrical pacing, a response similar to that of fresh cells. Thus, eliminating contraction during the culture period preserves the bioelectric, biophysical and bioenergetic properties of rabbit atrial myocytes. This method therefore has the potential to further improve our understanding of energetic and biochemical regulation in the atria.
Aziz, Faisal; Yang, Xuesong; Wen, Qingping; Yan, Qiu
2015-08-01
At present, biopsy specimens, cancer cell lines and tissues obtained by gastric surgery are used in the study and analysis of gastric cancer, including the molecular mechanisms and proteomics. However, fibroblasts and other tissue components may interfere with these techniques. Therefore, the present study aimed to develop a procedure for the isolation of viable human gastric epithelial cells from gastric surgical tissues. A method was developed to culture human gastric epithelial cells using fresh, surgically excised tissues and was evaluated using immunocytochemistry, periodic acid-Schiff (PAS) staining and cell viability assays. Low cell growth was observed surrounding the gastric tissue on the seventh day of tissue explant culture. Cell growth subsequently increased, and at 12 days post-explant a high number of pure epithelial cells were detected. The gastric cancer cells exhibited rapid growth with a doubling time of 13-52 h, as compared to normal cells, which had a doubling time of 20-53 h. Immunocytochemical analyses of primary gastric cells revealed positive staining for cytokeratin 18 and 19, which indicated that the culture was comprised of pure epithelial cells and contained no fibroblasts. Furthermore, PAS staining demonstrated that the cultured gastric cells produced neutral mucin. Granulin and carbohydrate antigen 724 staining confirmed the purity of gastric cancer and normal cells in culture. This method of cell culture indicated that the gastric cells in primary culture consisted of mucin-secreting gastric epithelial cells, which may be useful for the study of gastric infection with Helicobacter pylori and gastric cancer.
Directory of Open Access Journals (Sweden)
Петро Джуринський
2014-12-01
Full Text Available The paper presents the methodical approaches and recommendations on implementation of methods of future Physical Culture teachers to physical education of high school students into study process at a higher educational institution. The role of the approbated study discipline “Theory and methods of physical education at high school” has been determined in this research. It has also been defined, that future Physical Culture teacher’s training for physical education of high school students is a system of organizational and educational measures, ensuring the formation of future teacher’s professional knowledge and skills. The article presents the defined tasks, criteria, tools, forms, pedagogical conditions and stages of students’ training for teaching classes of Physical Education to high school students. Approbation of methodical approaches to future Physical Culture teachers’ training for physical education of high school students demonstrated their efficacy
The relationship between glass ceiling and power distance as a cultural variable by a new method
Naide Jahangirov; Guler Saglam Ari; Seymur Jahangirov; Nuray Guneri Tosunoglu
2015-01-01
Glass ceiling symbolizes a variety of barriers and obstacles that arise from gender inequality at business life. With this mind, culture influences gender dynamics. The purpose of this research was to examine the relationship between the glass ceiling and the power distance as a cultural variable within organizations. Gender variable is taken as a moderator variable in relationship between the concepts. In addition to conventional correlation analysis, we employed a new method to investigate ...
The bacteriology of chronic venous leg ulcer examined by culture-independent molecular methods
DEFF Research Database (Denmark)
Thomsen, Trine R; Aasholm, Martin S; Rudkjøbing, Vibeke B
2010-01-01
The bacterial microbiota plays an important role in the prolonged healing of chronic venous leg ulcers. The present study compared the bacterial diversity within ulcer material from 14 skin graft operations of chronic venous leg ulcers using culture-based methods and molecular biological methods...
Culture methods of allograft musculoskeletal tissue samples in Australian bacteriology laboratories.
Varettas, Kerry
2013-12-01
Samples of allograft musculoskeletal tissue are cultured by bacteriology laboratories to determine the presence of bacteria and fungi. In Australia, this testing is performed by 6 TGA-licensed clinical bacteriology laboratories with samples received from 10 tissue banks. Culture methods of swab and tissue samples employ a combination of solid agar and/or broth media to enhance micro-organism growth and maximise recovery. All six Australian laboratories receive Amies transport swabs and, except for one laboratory, a corresponding biopsy sample for testing. Three of the 6 laboratories culture at least one allograft sample directly onto solid agar. Only one laboratory did not use a broth culture for any sample received. An international literature review found that a similar combination of musculoskeletal tissue samples were cultured onto solid agar and/or broth media. Although variations of allograft musculoskeletal tissue samples, culture media and methods are used in Australian and international bacteriology laboratories, validation studies and method evaluations have challenged and supported their use in recovering fungi and aerobic and anaerobic bacteria.
Ishino, Ryota; Iehata, Shunpei; Nakano, Miyo; Tanaka, Reiji; Yoshimatsu, Takao; Maeda, Hiroto
2012-03-01
The bacterial communities associated with rotifers (Brachionus plicatilis sp. complex) and their culture water were determined using culture-dependent and -independent methods (16S rRNA gene clone library). The bacterial communities determined by the culture-independent method were more diverse than those determined by the culture-dependent method. Although the culture-dependent method indicated the bacterial community of rotifers was relatively similar to that of the culture water, 16S rRNA gene clone library analyses revealed a great difference between the two microbiotas. Our results suggest that most bacteria associated with rotifers are not easily cultured using conventional methods, and that the microbiota of rotifers do not correspond with that of the culture water completely.
Searching for Innovations and Methods of Using the Cultural Heritage on the Example of Upper Silesia
Wagner, Tomasz
2017-10-01
The basic subject of this paper is historical and cultural heritage of some parts of Upper Silesia, bind by common history and similar problems at present days. The paper presents some selected historical phenomena that have influenced contemporary space, mentioned above, and contemporary issues of heritage protection in Upper Silesia. The Silesian architecture interpretation, since 1989, is strongly covered with some ideological and national ideas. The last 25 years are the next level of development which contains rapidly transformation of the space what is caused by another economical transformations. In this period, we can observe landscape transformations, liquidation of objects and historical structures, loos of regional features, spontaneous adaptation processes of objects and many methods of implementation forms of protection, and using of cultural resources. Some upheaval linked to the state borders changes, system, economy and ethnic transformation caused that former Upper Silesia border area focuses phenomena that exists in some other similar European areas which are abutments of cultures and traditions. The latest period in the history of Upper Silesia gives us time to reflect the character of changes in architecture and city planning of the area and appraisal of efficiency these practices which are connected to cultural heritage perseveration. The phenomena of the last decades are: decrement of regional features, elimination of objects, which were a key feature of the regional cultural heritage, deformation of these forms that were shaped in the history and some trials of using these elements of cultural heritage, which are widely recognized as cultural values. In this situation, it is important to seek creative solutions that will neutralize bad processes resulting from bad law and practice. The most important phenomena of temporary space is searching of innovative fields and methods and use of cultural resources. An important part of the article is
International Nuclear Information System (INIS)
Sajid, Z.A.
2016-01-01
Cell suspension cultures offers an In vitro system that can be used as a tool for various studies involving mutant selection, mass propagation, protoplast isolation, gene transfer and selection of cell-lines which are resistant to various biotic or abiotic stresses. Research work on the development of cell suspension cultures was carried out to establish the most efficient method in Potato (cv. Desiree). Healthy, well-proliferating tissues from different types of callus cultures (compact, friable, embryogenic or non-embryogenic) were inoculated on various media combinations, i.e., MS, MS2 or AA liquid medium containing 18.09 micro M 2, 4-D. A fixed quantity (0.5-1.0 g) of callus tissue from 60-day-old callus cultures was transferred to 10-25 ml of liquid medium in 100 ml Erlenmeyer flask. Cultures were placed on an orbital shaker and agitated at different speeds (75, 100 or 125 rpm) under 16-h photoperiod at 25 ± 2 degree C. Medium was changed after every 3 days and fractionated tissue was filtered after every 6 days through sterile mesh (100-800 micro m) to develop a cell-line by transferring resulting suspension to fresh medium under the same conditions. Results indicated that eight-week-old translucent, friable, off-white callus cultures were an excellent starting material for the initiation of homogeneous cell suspension cultures as compared to other tested sources. Of the three tested media (MS, MS2 or AA medium containing 18.09 micro M 2, 4-D), MS2 was found to be a better medium for the initiation of cell suspension cultures. Cell suspension cultures, placed in 16-h photoperiod at 25 ± 2 degree C and agitated at 120 rpm using a gyratory shaker showed excellent results. Several other factors influencing quick establishment of cell suspension cultures in this cultivar are also discussed in this communication. (author)
Establishment of primary bovine intestinal epithelial cell culture and clone method.
Zhan, Kang; Lin, Miao; Liu, Ming-Mei; Sui, Yang-Nan; Zhao, Guo-Qi
2017-01-01
The aim of this study was to establish bovine intestinal epithelial cell (BIEC) line and provide a novel clone cell method. Although various strategies of bovine cell culture and clone techniques have been reported, these methods remain not established. Here, we culture successfully primary BIECs and establish a novel clone cell method. Our result showed that BIECs could be successfully cultured and passaged about generation 5. These cellular aggregates and clusters were adherent loosely at day 2 of culture. Cell aggregates and clusters start to proliferate after approximately 4 d. The BIECs showed positive reaction against cytokeratin 18, E-cadherin, and characteristics of epithelial-like morphology. In addition, the fatty acid-binding proteins (FABPs), villin, and intestinal peptidase (IP) band were positive in BIECs. Our results suggest that the establishment of culturing and clone BIEC methods will apply to isolate and clone other primary cells. These BIECs could therefore contribute to the study of bovine intestinal nutrient absorption and regulation, immune regulation, and the pathogenesis of the bovine intestinal disease, which will provide intestinal cell model in vitro.
A Novel Method for Culturing of Leptothrix sp. Strain OUMS1 in Natural Conditions
Directory of Open Access Journals (Sweden)
Tomoko Suzuki
2012-05-01
Full Text Available Although some strains of Leptothrix spp. isolated from aquatic environments have been characterized by culturing them in laboratory conditions, they often show morphological and chemical features distinct from those found in natural environments. To resolve this discrepancy, a novel cultivation method was devised for culturing such strains in natural groundwater. Leptothrix sp. strain OUMS1 was pre-cultured in a medium lacking Fe for 2 days, and then injected into a small dialysis tube bag and immersed in a container with continuously flowing groundwater for 1–3 and 14 days. Microscopic analysis of the initial phase of sheath formation and arbitrary comparisons with medium cultures revealed that in groundwater the surface coat of the sheath comprised much thinner fibrils, and an inner sheath wall that was much thinner and more indistinct compared with medium cultures. These differences were probably attributable to poorer secretion from the cell surface in groundwater conditions. A nutrient-rich medium likely activates cell metabolism and promotes secretion, resulting in a thicker inner sheath wall and thicker outer coat fibrils. Aqueous-phase Fe was deposited on immature sheaths in a similar manner in both cultures. These results indicate that laboratory culture of isolated microbes does not always reflect their characteristics in natural environments.
Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi
2015-10-19
We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.
Directory of Open Access Journals (Sweden)
Akiko Edagawa
2015-10-01
Full Text Available We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR, and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%. Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%. In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8% compared with real-time qPCR alone (46/68, 67.6%. Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1% compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%. Legionella was not detected in the remaining six samples (6/68, 8.8%, irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.
Comparing rapid and culture indicator bacteria methods at inland lake beaches
Francy, Donna S.; Bushon, Rebecca N.; Brady, Amie M.G.; Kephart, Christopher M.
2013-01-01
A rapid method, quantitative polymerase chain reaction (qPCR), for quantifying indicator bacteria in recreational waters is desirable for public health protection. We report that replacing current Escherichia coli standards with new US Environmental Protection Agency beach action values (BAVs) for enterococci by culture or qPCR may result in more advisories being posted at inland recreational lakes. In this study, concentrations of E. coli and enterococci by culture methods were compared to concentrations of Enterococcus spp. by qPCR at 3 inland lake beaches in Ohio. The E. coli and enterococci culture results were significantly related at all beaches; however, the relations between culture results and Enterococcus spp. qPCR results were not always significant and differed among beaches. All the qPCR results exceeded the new BAV for Enterococcus spp. by qPCR, whereas only 23.7% of culture results for E. coli and 79% of culture results for enterococci exceeded the current standard for E. coli or BAV for enterococci.
Directory of Open Access Journals (Sweden)
Franck O P Stefani
Full Text Available Bioremediation is a cost-effective and sustainable approach for treating polluted soils, but our ability to improve on current bioremediation strategies depends on our ability to isolate microorganisms from these soils. Although culturing is widely used in bioremediation research and applications, it is unknown whether the composition of cultured isolates closely mirrors the indigenous microbial community from contaminated soils. To assess this, we paired culture-independent (454-pyrosequencing of total soil DNA with culture-dependent (isolation using seven different growth media techniques to analyse the bacterial and fungal communities from hydrocarbon-contaminated soils. Although bacterial and fungal rarefaction curves were saturated for both methods, only 2.4% and 8.2% of the bacterial and fungal OTUs, respectively, were shared between datasets. Isolated taxa increased the total recovered species richness by only 2% for bacteria and 5% for fungi. Interestingly, none of the bacteria that we isolated were representative of the major bacterial OTUs recovered by 454-pyrosequencing. Isolation of fungi was moderately more effective at capturing the dominant OTUs observed by culture-independent analysis, as 3 of 31 cultured fungal strains ranked among the 20 most abundant fungal OTUs in the 454-pyrosequencing dataset. This study is one of the most comprehensive comparisons of microbial communities from hydrocarbon-contaminated soils using both isolation and high-throughput sequencing methods.
Stefani, Franck O P; Bell, Terrence H; Marchand, Charlotte; de la Providencia, Ivan E; El Yassimi, Abdel; St-Arnaud, Marc; Hijri, Mohamed
2015-01-01
Bioremediation is a cost-effective and sustainable approach for treating polluted soils, but our ability to improve on current bioremediation strategies depends on our ability to isolate microorganisms from these soils. Although culturing is widely used in bioremediation research and applications, it is unknown whether the composition of cultured isolates closely mirrors the indigenous microbial community from contaminated soils. To assess this, we paired culture-independent (454-pyrosequencing of total soil DNA) with culture-dependent (isolation using seven different growth media) techniques to analyse the bacterial and fungal communities from hydrocarbon-contaminated soils. Although bacterial and fungal rarefaction curves were saturated for both methods, only 2.4% and 8.2% of the bacterial and fungal OTUs, respectively, were shared between datasets. Isolated taxa increased the total recovered species richness by only 2% for bacteria and 5% for fungi. Interestingly, none of the bacteria that we isolated were representative of the major bacterial OTUs recovered by 454-pyrosequencing. Isolation of fungi was moderately more effective at capturing the dominant OTUs observed by culture-independent analysis, as 3 of 31 cultured fungal strains ranked among the 20 most abundant fungal OTUs in the 454-pyrosequencing dataset. This study is one of the most comprehensive comparisons of microbial communities from hydrocarbon-contaminated soils using both isolation and high-throughput sequencing methods.
Method and Apparatus for a Miniature Bioreactor System for Long-Term Cell Culture
Kleis, Stanley J. (Inventor); Geffert, Sandra K. (Inventor); Gonda, Steve R. (Inventor)
2015-01-01
A bioreactor and method that permits continuous and simultaneous short, moderate, or long term cell culturing of one or more cell types or tissue in a laminar flow configuration is disclosed, where the bioreactor supports at least two laminar flow zones, which are isolated by laminar flow without the need for physical barriers between the zones. The bioreactors of this invention are ideally suited for studying short, moderate and long term studies of cell cultures and the response of cell cultures to one or more stressors such as pharmaceuticals, hypoxia, pathogens, or any other stressor. The bioreactors of this invention are also ideally suited for short, moderate or long term cell culturing with periodic cell harvesting and/or medium processing for secreted cellular components.
Pendergrass, Kathy M; Newman, Susan D; Jones, Elaine; Jenkins, Carolyn H
2017-07-01
The purpose of this article is to provide an analysis of the concept Deaf to increase health care provider (HCP) understanding from a cultural perspective. Deaf signers, people with hearing loss who communicate primarily in American Sign Language (ASL), generally define the term Deaf as a cultural heritage. In the health care setting, the term deaf is most often defined as a pathological condition requiring medical intervention. When HCPs are unaware that there are both cultural and pathological views of hearing loss, significant barriers may exist between the HCP and the Deaf individual. The concept of Deaf is analyzed using the Wilsonian method. Essential elements of the concept "Deaf" from a cultural perspective include a personal choice to communicate primarily in ASL and identify with the Deaf community. Resources for HCPs are needed to quickly identify Deaf signers and provide appropriate communication.
Optimization of an Efficient Non-Tissue Culture Transformation Method for Brassica Juncea
International Nuclear Information System (INIS)
Naeem, I.; Munir, I.; Iqbal, A.; Ullah, F.
2016-01-01
The major hurdles in successful in vitro transformation of Brassica juncea through standard tissue culture (STC) method are: culture contamination, somaclonal variations, and lack of expertise. Moreover, the current STC method is time consuming and needs continuous electricity. In the present study, the in planta transformation method through floral dip with or without vacuum infiltration was optimized for successful transformation of B. juncea. The B. juncea CV RAYA Anmol was used for transformation through Agrobacterium tumefaciens strain GV3101 harboring the binary vector plasmid pBinGlyBar4-EADcT. Based on the resistance reaction to the herbicide Basta, 20 and 40 resistant seedlings were obtained from 2000 seed germinated from the plants transformed through floral dip and vacuum infiltration methods, respectively. The PCR analyses further confirmed the presence of transgene in 3 floral dipped plants without vacuum infiltration and 17 floral dipped plants with vacuum infiltration, giving the transformation frequencies of 1.5*10/sup -3/ and 8.5*10/sup -3/, respectively. This method, which avoids tissue culture, will reduce the somaclonal variation accompanying prolonged culture of cells in a dedifferentiated state, will facilitate functional genomics and improvement of Brassica juncea with novel desirable traits while reducing time and expense. (author)
Directory of Open Access Journals (Sweden)
Irene Kreutz
2006-01-01
Full Text Available Es un estudio cualitativo que adoptó como referencial teorico-motodológico la antropología y la etnografía. Presenta las experiencias vivenciadas por mujeres de una comunidad en el proceso salud-enfermedad, con el objetivo de comprender los determinantes sócio-culturales e históricos de las prácticas de prevención y tratamiento adoptados por el grupo cultural por medio de la entrevista semi-estructurada. Los temas que emergieron fueron: la relación entre la alimentación y lo proceso salud-enfermedad, las relaciones con el sistema de salud oficial y el proceso salud-enfermedad y lo sobrenatural. Los dados revelaron que los moradores de la comunidad investigada tienen un modo particular de explicar sus procedimientos terapéuticos. Consideramos que es papel de los profesionales de la salud en sus prácticas, la adopción de abordajes o enfoques que consideren al individuo en su dimensión sócio-cultural e histórica, considerando la enorme diversidad cultural en nuestro país.
Methods for culturing saltwater rotifers (Brachionus plicatilis) for rearing larval zebrafish.
Lawrence, Christian; Sanders, Erik; Henry, Eric
2012-09-01
The saltwater rotifer, Brachionus plicatilis, is widely used in the aquaculture industry as a prey item for first-feeding fishes due to its ease of culture, small size, rapid reproductive rate, and amenability to enrichment with nutrients. Despite the distinct advantages of this approach, rotifers have only been sporadically utilized for rearing larval zebrafish, primarily because of the common misconception that maintaining cultures of rotifers is difficult and excessively time-consuming. Here we present simple methods for maintaining continuous cultures of rotifers capable of supporting even the very largest zebrafish aquaculture facility, with minimal investments in materials, time, labor, and space. Examples of the methods' application in one large, existing facility is provided, and troubleshooting of common problems is discussed.
Transferring methods to teach business administration from one cultural context to another
Directory of Open Access Journals (Sweden)
Marie Catalo
2015-12-01
Full Text Available What happens when a teaching method is transferred from one cultural context to another? In this article we investigate this question by looking at how Computer Based Simulations (CBS were transposed from a French context to an Egyptian one. In this article we demonstrate, through the case of Egypt, how culture and the characteristics of the school system impact learning abilities. We describe what happens when Egyptian students are confronted with learning modes they have not encountered prior to University, in the context of an Egyptian-French dual-degree programme in business administration and business informatics. We show that the transfer of CBS as a teaching method revealed cultural differences between French and Egyptian students. As a consequence the teaching objectives of CBS were redefined in order to take the Egyptian context into account.
Apekey, Tanefa A; McSorley, Gerry; Tilling, Michelle; Siriwardena, A Niroshan
2011-04-01
Leadership and innovation are currently seen as essential elements for the development and maintenance of high-quality care. Little is known about the relationship between leadership and culture of innovation and the extent to which quality improvement methods are used in general practice. This study aimed to assess the relationship between leadership behaviour, culture of innovation and adoption of quality improvement methods in general practice. Self-administered postal questionnaires were sent to general practitioner quality improvement leads in one county in the UK between June and December 2007. The questionnaire consisted of background information, a 12-item scale to assess leadership behaviour, a seven-dimension self-rating scale for culture of innovation and questions on current use of quality improvement tools and techniques. Sixty-three completed questionnaires (62%) were returned. Leadership behaviours were not commonly reported. Most practices reported a positive culture of innovation, featuring relationship most strongly, followed by targets and information but rated lower on other dimensions of rewards, risk and resources. There was a significant positive correlation between leadership behaviour and the culture of innovation (r = 0.57; P improvement methods were not adopted by most participating practices. Leadership behaviours were infrequently reported and this was associated with a limited culture of innovation in participating general practices. There was little use of quality improvement methods beyond clinical and significant event audit. Practices need support to enhance leadership skills, encourage innovation and develop quality improvement skills if improvements in health care are to accelerate. © 2010 Blackwell Publishing Ltd.
International Nuclear Information System (INIS)
Han, Sang Min; Lee, Seung Min; Yim, Ho Bin; Seong, Poong Hyun
2018-01-01
Highlights: •We proposed a Probabilistic Safety Culture Healthiness Evaluation Method. •Positive relationship between the ‘success’ states of NSC and performance was shown. •The state probability profile showed a unique ratio regardless of the scenarios. •Cutset analysis provided not only root causes but also the latent causes of failures. •Pro-SCHEMe was found to be applicable to Korea NPPs. -- Abstract: The aim of this study is to propose a new quantitative evaluation method for Nuclear Safety Culture (NSC) in Nuclear Power Plant (NPP) operation teams based on the probabilistic approach. Various NSC evaluation methods have been developed, and the Korea NPP utility company has conducted the NSC assessment according to international practice. However, most of methods are conducted by interviews, observations, and the self-assessment. Consequently, the results are often qualitative, subjective, and mainly dependent on evaluator’s judgement, so the assessment results can be interpreted from different perspectives. To resolve limitations of present evaluation methods, the concept of Safety Culture Healthiness was suggested to produce quantitative results and provide faster evaluation process. This paper presents Probabilistic Safety Culture Healthiness Evaluation Method (Pro-SCHEMe) to generate quantitative inputs for Human Reliability Assessment (HRA) in Probabilistic Safety Assessment (PSA). Evaluation items which correspond to a basic event in PSA are derived in the first part of the paper through the literature survey; mostly from nuclear-related organizations such as the International Atomic Energy Agency (IAEA), the United States Nuclear Regulatory Commission (U.S.NRC), and the Institute of Nuclear Power Operations (INPO). Event trees (ETs) and fault trees (FTs) are devised to apply evaluation items to PSA based on the relationships among such items. The Modeling Guidelines are also suggested to classify and calculate NSC characteristics of
Teaching cross-cultural communication skills online: a multi-method evaluation.
Lee, Amy L; Mader, Emily M; Morley, Christopher P
2015-04-01
Cultural competency education is an important and required part of undergraduate medical education. The objective of this study was to evaluate whether an online cross-cultural communication module could increase student use of cross-cultural communication questions that assess the patient's definition of the problem, the way the problem affects their life, their concerns about the problem, and what the treatment should be (PACT). We used multi-method assessment of students assigned to family medicine clerkship blocks that were randomized to receive online cultural competency and PACT training added to their standard curriculum or to a control group receiving the standard curriculum only. Outcomes included comparison, via analysis of variance, of number of PACT questions used during an observed Standardized Patient Exercise, end-of-year OSCE scores, and qualitative analysis of student narratives. Students (n=119) who participated in the online module (n=60) demonstrated increased use of cross-cultural communication PACT questions compared to the control group (n=59) and generally had positive themes emerge from their reflective writing. The module had the biggest impact on students who later went on to match in high communication specialties. Online teaching of cross-cultural communication skills can be effective at changing medical student behavior.
a Method of 3d Measurement and Reconstruction for Cultural Relics in Museums
Zheng, S.; Zhou, Y.; Huang, R.; Zhou, L.; Xu, X.; Wang, C.
2012-07-01
Three-dimensional measurement and reconstruction during conservation and restoration of cultural relics have become an essential part of a modem museum regular work. Although many kinds of methods including laser scanning, computer vision and close-range photogrammetry have been put forward, but problems still exist, such as contradiction between cost and good result, time and fine effect. Aimed at these problems, this paper proposed a structure-light based method for 3D measurement and reconstruction of cultural relics in museums. Firstly, based on structure-light principle, digitalization hardware has been built and with its help, dense point cloud of cultural relics' surface can be easily acquired. To produce accurate 3D geometry model from point cloud data, multi processing algorithms have been developed and corresponding software has been implemented whose functions include blunder detection and removal, point cloud alignment and merge, 3D mesh construction and simplification. Finally, high-resolution images are captured and the alignment of these images and 3D geometry model is conducted and realistic, accurate 3D model is constructed. Based on such method, a complete system including hardware and software are built. Multi-kinds of cultural relics have been used to test this method and results prove its own feature such as high efficiency, high accuracy, easy operation and so on.
Whiteley, Alma
2001-01-01
Discusses the rationale for introducing anthropology into a doctoral-level international business research methods course. Describes three anthropological frameworks designed for the course: a cultural awareness model adapted from G. Morgan's (1980) idea of paradigmatic orthodoxy; key organizing principles; and a mapping model allowing researchers…
X-ray and synchrotron methods in studies of cultural heritage sites
Energy Technology Data Exchange (ETDEWEB)
Koval’chuk, M. V.; Yatsishina, E. B.; Blagov, A. E.; Tereshchenko, E. Yu., E-mail: elenatereschenko@yandex.ru; Prosekov, P. A.; Dyakova, Yu. A. [National Research Centre “Kurchatov Institute” (Russian Federation)
2016-09-15
X-ray and synchrotron methods that are most widely used in studies of cultural heritage objects (including archaeological sites)—X-ray diffraction analysis, X-ray spectroscopy, and visualization techniques— have been considered. The reported examples show high efficiency and informativeness of natural science studies when solving most diverse problems of archaeology, history, the study of art, museology, etc.
Kilburn, Daniel; Nind, Melanie; Wiles, Rose
2014-01-01
In light of calls to improve the capacity for social science research within UK higher education, this article explores the possibilities for an emerging pedagogy for research methods. A lack of pedagogical culture in this field has been identified by previous studies. In response, we examine pedagogical literature surrounding approaches for…
X-ray and synchrotron methods in studies of cultural heritage sites
International Nuclear Information System (INIS)
Koval’chuk, M. V.; Yatsishina, E. B.; Blagov, A. E.; Tereshchenko, E. Yu.; Prosekov, P. A.; Dyakova, Yu. A.
2016-01-01
X-ray and synchrotron methods that are most widely used in studies of cultural heritage objects (including archaeological sites)—X-ray diffraction analysis, X-ray spectroscopy, and visualization techniques— have been considered. The reported examples show high efficiency and informativeness of natural science studies when solving most diverse problems of archaeology, history, the study of art, museology, etc.
When Smokey says "No": Fire-less methods for growing plants adapted to cultural fire regimes
Daniela Shebitz; Justine E. James
2010-01-01
Two culturally-significant plants (sweetgrass [Anthoxanthum nitens] and beargrass [Xerophyllum tenax]) are used as case studies for investigating methods of restoring plant populations that are adapted to indigenous burning practices without using fire. Reports from tribal members that the plants of interest were declining in traditional gathering areas provided the...
Digital Storytelling: A Method for Engaging Students and Increasing Cultural Competency
Grant, Natalie S.; Bolin, Brien L.
2016-01-01
Digital storytelling is explored as a method of engaging students in the development of media literacy and cultural competency. This paper describes the perceptions and experiences of 96 undergraduate students at a large Midwestern university, after completing a digital storytelling project in a semester-long diversity course. Digital storytelling…
Directory of Open Access Journals (Sweden)
Meysam Ganjibakhsh
2017-10-01
Full Text Available Objectives: Oral Squamous Cell Carcinoma (OSCC is the most frequent oral cancer worldwide. It is known as the eighth most common cancer in men and as the fifth most common cancer in women. Cytogenetic and biochemical studies in recent decades have emphasized the necessity of providing an appropriate tool for such researches. Cancer cell culture is a useful tool for investigations on biochemical, genetic, molecular and immunological characteristics of different cancers, including oral cancer. Here, we explain the establishment process of five primary oral cancer cells derived from an Iranian population.Materials and Methods: The specimens were obtained from five oral cancer patients. Enzymatic, explant culture and magnetic-activated cell sorting (MACS methods were used for cell isolation. After quality control tests, characterization and authentication of primary oral cancer cells were performed by short tandem repeats (STR profiling, chromosome analysis, species identification, and monitoring the growth, morphology and the expression of CD326 and CD133 markers.Results: Five primary oral cancer cells were established from an Iranian population. The flow cytometry results showed that the isolated cells were positive for CD326 and CD133 markers. Furthermore, the cells were free from mycoplasma, bacterial and fungal contamination. No misidentified or cross-contaminated cells were detected by STR analysis.Conclusions: Human primary oral cancer cells provide an extremely useful platform for studying carcinogenesis pathways of oral cancer in Iranian population. They may be helpful in explaining the ethnic differences in cancer biology and the individuality in anticancer drug response in future studies.
Children's activities and their meanings for parents: a mixed-methods study in six Western cultures.
Harkness, Sara; Zylicz, Piotr Olaf; Super, Charles M; Welles-Nyström, Barbara; Bermúdez, Moisés Ríos; Bonichini, Sabrina; Moscardino, Ughetta; Mavridis, Caroline Johnston
2011-12-01
Theoretical perspectives and research in sociology, anthropology, sociolinguistics, and cultural psychology converge in recognizing the significance of children's time spent in various activities, especially in the family context. Knowing how children's time is deployed, however, only gives us a partial answer to how children acquire competence; the other part must take into account the culturally constructed meanings of activities, from the perspective of those who organize and direct children's daily lives. In this article, we report on a study of children's routine daily activities and on the meanings that parents attribute to them in six Western middle-class cultural communities located in Italy, The Netherlands, Poland, Spain, Sweden, and the United States (N = 183). Using week-long time diaries kept by parents, we first demonstrate similarities as well as significant differences in children's daily routines across the cultural samples. We then present brief vignettes--"a day in the life" --of children from each sample. Parent interviews were coded for themes in the meanings attributed to various activities. Excerpts from parent interviews, focusing on four major activities (meals, family time, play, school- or developmentally related activities), are presented to illustrate how cultural meanings and themes are woven into parents' organization and understanding of their children's daily lives. The results of this mixed-method approach provide a more reliable and nuanced picture of children's and families' daily lives than could be derived from either method alone.
Pan, Hong-Wei; Li, Wei; Li, Rong-Guo; Li, Yong; Zhang, Yi; Sun, En-Hua
2018-01-01
Rapid identification and determination of the antibiotic susceptibility profiles of the infectious agents in patients with bloodstream infections are critical steps in choosing an effective targeted antibiotic for treatment. However, there has been minimal effort focused on developing combined methods for the simultaneous direct identification and antibiotic susceptibility determination of bacteria in positive blood cultures. In this study, we constructed a lysis-centrifugation-wash procedure to prepare a bacterial pellet from positive blood cultures, which can be used directly for identification by matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS) and antibiotic susceptibility testing by the Vitek 2 system. The method was evaluated using a total of 129 clinical bacteria-positive blood cultures. The whole sample preparation process could be completed in identification was 96.49% for gram-negative bacteria and 97.22% for gram-positive bacteria. Vitek 2 antimicrobial susceptibility testing of gram-negative bacteria showed an agreement rate of antimicrobial categories of 96.89% with a minor error, major error, and very major error rate of 2.63, 0.24, and 0.24%, respectively. Category agreement of antimicrobials against gram-positive bacteria was 92.81%, with a minor error, major error, and very major error rate of 4.51, 1.22, and 1.46%, respectively. These results indicated that our direct antibiotic susceptibility analysis method worked well compared to the conventional culture-dependent laboratory method. Overall, this fast, easy, and accurate method can facilitate the direct identification and antibiotic susceptibility testing of bacteria in positive blood cultures.
Directory of Open Access Journals (Sweden)
Hong-wei Pan
2018-03-01
Full Text Available Rapid identification and determination of the antibiotic susceptibility profiles of the infectious agents in patients with bloodstream infections are critical steps in choosing an effective targeted antibiotic for treatment. However, there has been minimal effort focused on developing combined methods for the simultaneous direct identification and antibiotic susceptibility determination of bacteria in positive blood cultures. In this study, we constructed a lysis-centrifugation-wash procedure to prepare a bacterial pellet from positive blood cultures, which can be used directly for identification by matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS and antibiotic susceptibility testing by the Vitek 2 system. The method was evaluated using a total of 129 clinical bacteria-positive blood cultures. The whole sample preparation process could be completed in <15 min. The correct rate of direct MALDI-TOF MS identification was 96.49% for gram-negative bacteria and 97.22% for gram-positive bacteria. Vitek 2 antimicrobial susceptibility testing of gram-negative bacteria showed an agreement rate of antimicrobial categories of 96.89% with a minor error, major error, and very major error rate of 2.63, 0.24, and 0.24%, respectively. Category agreement of antimicrobials against gram-positive bacteria was 92.81%, with a minor error, major error, and very major error rate of 4.51, 1.22, and 1.46%, respectively. These results indicated that our direct antibiotic susceptibility analysis method worked well compared to the conventional culture-dependent laboratory method. Overall, this fast, easy, and accurate method can facilitate the direct identification and antibiotic susceptibility testing of bacteria in positive blood cultures.
International Nuclear Information System (INIS)
Justiz Mendoza, Ibrahin; Aguilera Rodriguez, Isabel; Perez Portuondo, Irasema
2014-01-01
Validation of test methods microscale is currently of great importance due to the economic and environmental advantages possessed, which constitutes a prerequisite for the performance of services and quality assurance of the results to provide customer. This paper addresses the microscale validation of 4-aminoantipyrine spectrophotometric method for the quantification of phenolic compounds in culture medium. Parameters linearity, precision, regression, accuracy, detection limits, quantification limits and robustness were evaluated, addition to the comparison test with no standardized method for determining polyphenols (Folin Ciocalteu). The results showed that both methods are feasible for determining phenols
Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M
2012-07-01
Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Two hundred nonduplicate blood cultures from cases of sepsis were analyzed using two blood culture methods concurrently for recovery of bacteria from patients diagnosed clinically with sepsis - the conventional blood culture method using trypticase soy broth and the lysis centrifugation method using saponin by centrifuging at 3000 g for 30 minutes. Overall bacteria recovered from 200 blood cultures were 17.5%. The conventional blood culture method had a higher yield of organisms, especially Gram positive cocci. The lysis centrifugation method was comparable with the former method with respect to Gram negative bacilli. The sensitivity of lysis centrifugation method in comparison to conventional blood culture method was 49.75% in this study, specificity was 98.21% and diagnostic accuracy was 89.5%. In almost every instance, the time required for detection of the growth was earlier by lysis centrifugation method, which was statistically significant. Contamination by lysis centrifugation was minimal, while that by conventional method was high. Time to growth by the lysis centrifugation method was highly significant (P value 0.000) as compared to time to growth by the conventional blood culture method. For the diagnosis of sepsis, combination of the lysis centrifugation method and the conventional blood culture method with trypticase soy broth or biphasic media is advocable, in order to achieve faster recovery and a better yield of microorganisms.
Characterization of microbes in prosthetic joint specimens by culture-independent molecular methods
DEFF Research Database (Denmark)
Xu, Yijuan; Rudkjøbing, Vibeke Børsholt; Simonsen, Ole
Prosthetic joint infection (PJI) is one of the most challenging complications of joint alloplasty. Formation of biofilm is a prominent feature of PJIs and constitutes a challenge to current sampling procedures and culture practices to obtain a reliable diagnosis. The aim of the study was to inves......Prosthetic joint infection (PJI) is one of the most challenging complications of joint alloplasty. Formation of biofilm is a prominent feature of PJIs and constitutes a challenge to current sampling procedures and culture practices to obtain a reliable diagnosis. The aim of the study...... was to investigate the microbial diversity in surgical samples (eg. synovial fluid, periprosthetic tissue, removed prosthesis) from 22 prosthetic patients using a range of culture-independent molecular methods including broad range 16S rRNA gene PCR, cloning, phylogeny, quantitative PCR (qPCR), and fluorescence...
Microbial transformation of tannin-rich substrate to gallic acid through co-culture method.
Banerjee, Rintu; Mukherjee, Gargi; Patra, Krushna Chandra
2005-05-01
Modified solid-state fermentation (MSSF) of tannin-rich substrate yielding tannase and gallic acid was carried out using a co-culture of the filamentous fungi, Rhizopus oryzae (RO IIT RB-13, NRRL 21498) and Aspergillus foetidus (GMRB013 MTCC 3557). Powdered fruits of Terminalia chebula and powdered pod cover of Caesalpinia digyna was used in the process and the different process parameters for maximum production of tannase and gallic acid by co-culture method were optimized through media engineering. MSSF was carried out at the optimum conditions of 30 degrees C and 80% relative humidity. The optimal pH and incubation period was 5.0 and 48 h respectively. Through the co-culture technique the maximum yield of tannase and gallic acid was found to be 41.3 U/ml and 94.8% respectively.
Amerson, Roxanne; Livingston, Wade G
2014-04-01
This qualitative descriptive study used reflexive photography to evaluate the learning process of cultural competence during an international service-learning project in Guatemala. Reflexive photography is an innovative qualitative research technique that examines participants' interactions with their environment through their personal reflections on images that they captured during their experience. A purposive sample of 10 baccalaureate nursing students traveled to Guatemala, where they conducted family and community assessments, engaged in home visits, and provided health education. Data collection involved over 100 photographs and a personal interview with each student. The themes developed from the photographs and interviews provided insight into the activities of an international experience that influence the cognitive, practical, and affective learning of cultural competence. Making home visits and teaching others from a different culture increased students' transcultural self-efficacy. Reflexive photography is a more robust method of self-reflection, especially for visual learners.
Directory of Open Access Journals (Sweden)
Santanu Panda
Full Text Available In farm animals, there is no suitable cell line available to understand liver-specific functions. This has limited our understanding of liver function and metabolism in farm animals. Culturing and maintenance of functionally active hepatocytes is difficult, since they survive no more than few days. Establishing primary culture of hepatocytes can help in studying cellular metabolism, drug toxicity, hepatocyte specific gene function and regulation. Here we provide a simple in vitro method for isolation and short-term culture of functionally active buffalo hepatocytes.Buffalo hepatocytes were isolated from caudate lobes by using manual enzymatic perfusion and mechanical disruption of liver tissue. Hepatocyte yield was (5.3 ± 0.66×107 cells per gram of liver tissue with a viability of 82.3 ± 3.5%. Freshly isolated hepatocytes were spherical with well contrasted border. After 24 hours of seeding onto fibroblast feeder layer and different extracellular matrices like dry collagen, matrigel and sandwich collagen coated plates, hepatocytes formed confluent monolayer with frequent clusters. Cultured hepatocytes exhibited typical cuboidal and polygonal shape with restored cellular polarity. Cells expressed hepatocyte-specific marker genes or proteins like albumin, hepatocyte nuclear factor 4α, glucose-6-phosphatase, tyrosine aminotransferase, cytochromes, cytokeratin and α1-antitrypsin. Hepatocytes could be immunostained with anti-cytokeratins, anti-albumin and anti α1-antitrypsin antibodies. Abundant lipid droplets were detected in the cytosol of hepatocytes using oil red stain. In vitro cultured hepatocytes could be grown for five days and maintained for up to nine days on buffalo skin fibroblast feeder layer. Cultured hepatocytes were viable for functional studies.We developed a convenient and cost effective technique for hepatocytes isolation for short-term culture that exhibited morphological and functional characteristics of active hepatocytes
New method for exopolysaccharide determination in culture broth using stirred ultrafiltration cells.
Bergmaier, D; Lacroix, C; Guadalupe Macedo, M; Champagne, C P
2001-10-01
A new method to remove simple carbohydrates from culture broth prior to the quantification of exopolysaccharides (EPS) was developed and validated for the EPS-producing strain, Lactobacillus rhamnosus RW-9595M. This method uses ultrafiltration (UF) in stirred cells followed by polysaccharide detection in the retentate by the phenol-sulfuric acid method. The UF method was compared with a conventional method based on ethanol extraction, dialysis, protein removal by trichloroacetic acid (TCA) and freeze-drying. EPS production during pH-controlled batch fermentations in basal minimum medium, whey permeate (WP). and whey permeate supplemented with yeast extract, minerals and Tween-80 (SWP) was determined by the new UF and conventional methods. EPS recovery by the new method ranged from 83% to 104% for EPS added in the concentration range 40-1,500 mg/l in 0.1 M NaCl solution or culture medium. The UF method was rapid (8 h), accurate and simple, and required only a small sample volume (1-5 ml). A very high maximum EPS production was measured in SWP by both the UF and conventional methods (1,718 and 1,755 mg/l).
Directory of Open Access Journals (Sweden)
Ali M. Bazzi
2017-05-01
Full Text Available Summary: Matrix-assisted laser desorption-ionization time-of-flight (MALDI-TOF mass spectrometry facilitates rapid and accurate identification of pathogens, which is critical for sepsis patients.In this study, we assessed the accuracy in identification of both Gram-negative and Gram-positive bacteria, except for Streptococcus viridans, using four rapid blood culture methods with Vitek MALDI-TOF-MS. We compared our proposed lysis centrifugation followed by washing and 30% acetic acid treatment method (method 2 with two other lysis centrifugation methods (washing and 30% formic acid treatment (method 1; 100% ethanol treatment (method 3, and picking colonies from 90 to 180 min subculture plates (method 4. Methods 1 and 2 identified all organisms down to species level with 100% accuracy, except for Streptococcus viridans, Streptococcus pyogenes, Enterobacter cloacae and Proteus vulgaris. The latter two were identified to genus level with 100% accuracy. Each method exhibited excellent accuracy and precision in terms of identification to genus level with certain limitations. Keywords: MALDI-TOF, Gram-negative, Gram-positive, Sepsis, Blood culture
Hearsay Ethnography: Conversational Journals as a Method for Studying Culture in Action.
Watkins, Susan Cotts; Swidler, Ann
2009-04-01
Social scientists have long struggled to develop methods adequate to their theoretical understanding of meaning as collective and dynamic. While culture is widely understood as an emergent property of collectivities, the methods we use keep pulling us back towards interview-situated accounts and an image of culture as located in individual experience. Scholars who seek to access supra-individual semiotic structures by studying public rituals and other collectively-produced texts then have difficulty capturing the dynamic processes through which such meanings are created and changed in situ. To try to capture more effectively the way meaning is produced and re-produced in everyday life, we focus here on conversational interactions-the voices and actions that constitute the relational space among actors. Conversational journals provide us with a method: the analysis of texts produced by cultural insiders who keep journals of who-said-what-to-whom in conversations they overhear or events they participate in during the course of their daily lives. We describe the method, distinguishing it from other approaches and noting its drawbacks. We then illustrate the methodological advantages of conversational journals with examples from our texts. We end with a discussion of the method's potential in our setting as well as in other places and times.
Haeruddin; Supriharyono; Febrianto, S.
2018-02-01
The tilapia (Oreochromis niloticus), is known as a high adaptability and brackish water tolerance fish. This fish is also has a meat with high protein content, that ranges about 65 -75%. Generally the tilapia is cultured using a conventional system with high density. It is caused degradation of water quality of media culture, and finally increase mortality rate of fish cultured. The application of tilapia cultivation with cleaner production method by giving enzyme into the feed to upgrade the efficiency of feed utilization, presumed that could improve the water quality of cultivation media. It is due to the lower of feed and feces residues. Therefore the concentration of toxic compounds, such as ammonia, nitrite and sulfide, will be lower. The experiments were conducted for 35 days with a completely factorial randomized design. The first factor was the dosage of enzyme in the feed, consisting of 4 dosages, and the second factor was the duration of the test fish maintenance (5 weeks). Water quality variables examined included ammonia, nitrite and sulfide. The results showed that enzyme dosage had no significantly impact on ammonia, nitrite and sulfide concentrations in the test media culture. However, the feeding with enzyme in low dosage, resulted less concentration of ammonia, nitrite and sulfide than it was without enzyme). The duration of fish cultured has significantly effect on the concentration of ammonia, nitrite and sulfide in the test media. While it is no significantly correlation between dosage and duration of maintenance.
Directory of Open Access Journals (Sweden)
ebrahim badparva
2010-04-01
Full Text Available Trichomonas vaginalis is a flagellate protozoan that lives in the genital tract and causes trichomoniasis in women. About 200 million people all over the world are infected with T. vaginalis. There are various methods with different sensitivity and specificity for detection of this parasite, that one of them is direct smear of vaginal secretions which is simpler, rapid and cheaper than other diagnostic methods. Materials and Methods: Demographic data was gathered by a questionnaire which contained different variables. Vaginal secretions samples were taken by spicolum and two swaps that maintained in glucose solution in separate tubes from 160 women referred to health centers of Khorramabad. One of the vaginal samples was examined by direct smear in saline solution and the other was cultured in Dorse medium. Results: Of 160 women suspected of trichomoniasis, 11.8% and 18.75% were positive by direct smear and culture respectively. The sensitivity of the direct method was 63.3%. Our findings indicated that 30% of the infected women belonged to the 31 – 35 age group, which had the most relative frequency of positive cases. Most of the patients (43% were illiterate or had elementary educational level. Conclussion: The sensivity of direct method is 63% in compare to culture ( as a Gold standard , which is ralatively low . Although the efficacy of this test could be imporved by shortening the elapsed time between sampling and examination , use of skilled microscopists , and different samples , but we recommend that more sensitive methods such as culture and PCR should be used .
Lange, Miranda; Zeng, Yan; Knight, Andrew; Windebank, Anthony; Trushina, Eugenia
2012-01-01
Changes in mitochondrial dynamics and function contribute to progression of multiple neurodegenerative diseases including peripheral neuropathies. The Seahorse Extracellular Flux XF24 analyzer provides a comprehensive assessment of the relative state of glycolytic and aerobic metabolism in live cells making this method instrumental in assessing mitochondrial function. One of the most important steps in the analysis of mitochondrial respiration using the Seahorse XF24 analyzer is plating a uniform monolayer of firmly attached cells. However, culturing of primary dorsal root ganglion (DRG) neurons is associated with multiple challenges, including their propensity to form clumps and detach from the culture plate. This could significantly interfere with proper analysis and interpretation of data. We have tested multiple cell culture parameters including coating substrates, culture medium, XF24 microplate plastics, and plating techniques in order to optimize plating conditions. Here we describe a highly reproducible method to obtain neuron-enriched monolayers of securely attached dissociated primary embryonic (E15) rat DRG neurons suitable for analysis with the Seahorse XF24 platform.
Directory of Open Access Journals (Sweden)
Miranda L. Lange
2012-12-01
Full Text Available Changes in mitochondrial dynamics and function contribute to progression of multiple neurodegenerative diseases including peripheral neuropathies. The Seahorse Extracellular Flux XF24 analyzer provides a comprehensive assessment of the relative state of glycolytic and aerobic metabolism in live cells making this method instrumental in assessing mitochondrial function. One of the most important steps in the analysis of mitochondrial respiration using the Seahorse XF24 analyzer is plating a uniform monolayer of firmly attached cells. However, culturing of primary dorsal root ganglion (DRG neurons is associated with multiple challenges, including their propensity to form clumps and detach from the culture plate. This could significantly interfere with proper analysis and interpretation of data. We have tested multiple cell culture parameters including coating substrates, culture medium, XF24 microplate plastics, and plating techniques in order to optimize plating conditions. Here we describe a highly reproducible method to obtain neuron-enriched monolayers of securely attached dissociated primary embryonic (E15 rat DRG neurons suitable for analysis with the Seahorse XF24 platform.
Safe operation of nuclear power plants - Is safety culture an adequate management method?
International Nuclear Information System (INIS)
Piirto, A.
2012-01-01
One of the characteristics of a good safety culture is a definable commitment to the improvement of safety behaviours and attitudes at all organisational levels. A second characteristic of an organisation with excellent safety culture is free and open communication. The general understanding has been that safety culture is a part of organisation culture. In addition to safety culture thinking, proactive programmes and displays of proactive work to improve safety are required. This work needs to include, qt a minimum, actions aiming at reducing human errors, the development of human error prevention tools, improvements in training, and the development of working methods and the organisation's activities. Safety depends not only on the technical systems, but also on the organisation. There is a need for better methods and tools for organisational assessment and development. Today there is universal acceptance of the significant impact that management and organisational factors have over the safety significance of complex industrial installations such as nuclear power plants. Many events with significant economic and public impact had causes that have been traced to management deficiencies. The objective of this study is development of new methods to increase safety of nuclear power plant operation. The research has been limited to commercial nuclear power plants that are intended for electrical power generation in Finland. Their production activities, especially operation and maintenance, are primarily reviewed from a safety point of view, as well as human performance and organisational factors perspective. This defines the scope and focus of the study. The research includes studies related to knowledge management and tacit knowledge in the project management context and specific studies related to transfer of tacit knowledge in the maintenance organization and transfer of tacit knowledge between workers of old generation and young generation. The empirical results
Safe operation of nuclear power plants - Is safety culture an adequate management method?
Energy Technology Data Exchange (ETDEWEB)
Piirto, A.
2012-07-01
One of the characteristics of a good safety culture is a definable commitment to the improvement of safety behaviours and attitudes at all organisational levels. A second characteristic of an organisation with excellent safety culture is free and open communication. The general understanding has been that safety culture is a part of organisation culture. In addition to safety culture thinking, proactive programmes and displays of proactive work to improve safety are required. This work needs to include, qt a minimum, actions aiming at reducing human errors, the development of human error prevention tools, improvements in training, and the development of working methods and the organisation's activities. Safety depends not only on the technical systems, but also on the organisation. There is a need for better methods and tools for organisational assessment and development. Today there is universal acceptance of the significant impact that management and organisational factors have over the safety significance of complex industrial installations such as nuclear power plants. Many events with significant economic and public impact had causes that have been traced to management deficiencies. The objective of this study is development of new methods to increase safety of nuclear power plant operation. The research has been limited to commercial nuclear power plants that are intended for electrical power generation in Finland. Their production activities, especially operation and maintenance, are primarily reviewed from a safety point of view, as well as human performance and organisational factors perspective. This defines the scope and focus of the study. The research includes studies related to knowledge management and tacit knowledge in the project management context and specific studies related to transfer of tacit knowledge in the maintenance organization and transfer of tacit knowledge between workers of old generation and young generation. The empirical
Studies of Ancient Russian Cultural Objects Using the Neutron Tomography Method
Directory of Open Access Journals (Sweden)
Sergey Kichanov
2018-01-01
Full Text Available Neutron radiography and tomography is a non-destructive method that provides detailed information about the internal structure of cultural heritage objects. The differences in the neutron attenuation coefficients of constituent elements of the studied objects, as well as the application of modern mathematical algorithms to carry out three-dimensional imaging data analysis, allow one to obtain unique information about the spatial distribution of different phases, the presence of internal defects, or the degree of structural degradation inside valuable cultural objects. The results of the neutron studies of several archaeological objects related to different epochs of the Russian history are reported in order to demonstrate the opportunities provided by the neutron tomography method. The obtained 3D structural volume data, as well as the results of the corresponding data analysis, are presented.
Directory of Open Access Journals (Sweden)
Sutini Sutini
2017-02-01
Full Text Available This study was aimed to assess flavan-3-ol biomass in C. sinensis through callus cultures and suspension cultures derived from leaf explants. Callus initiation of both cultures were using Murashige and Skoog medium were enriched with plant growth regulators Naphtha-lene Acetic Acid 3.0 mg/L and kinetin 2.0 mg/L. The procedures in this study were: (1 callus initiation by cutting the leaves of C. sinen-sis shoots then planted on Murashige and Skoog medium that were enriched with plant growth regulators, (2 sub callus culture on fresh medium that enriched with the same growth regulators, (3 suspension culture initiation of liquid callus, (4 growth examination of callus and suspension cultures in week 12, (5 examination of qualitative-quantitative content of flavan-3-olin suspension cultures at week 4. The results show that suspension cultures contain biomass flavan-3-ol that increase in the same manner of the increase of callus age and weight
Directory of Open Access Journals (Sweden)
Amir Aliramezani
2012-01-01
Full Text Available Background and Aims: Periodontitis is one of the most common oral diseases with the various incidence rates in different populations. A number of bacteria are considered as the major etiologic agents of periodontitis. The aim of the present study was to determine the prevalence of periodontopathogen bacteria in patients using both PCR and culture techniques.Materials and Methods: In this study, one-hundred patients (including 62 females and 38 males with an average age of 49±11.5 years with adult periodontitis referred to periodontics department of School of Dentistry/Tehran University of Medical Sciences were investigated. The samples were taken and sent immediately to the laboratory for culture and molecular evaluation. The PCR was performed using specific primers and the statistical analysis of data was performed using SPSS statistic software and McNemar test.Results: The results demonstrated that the total detection rate in culture method was 64%. The rate of Aggregatibacter actinomycetemcomitans (Aa was 28% which was significantly higher than that of Porphyromonas gingivalis (Pg (6% and Prevotella intermedia (Pi (3%. 27% of cases showed mixed bacterial growth. 65% of patients were positive using molecular method. The rate of Aa (30% was significantly higher than that of Pg (7% and Pi (5%. The mixed PCR positive rate containing of Aa, Pg and Pi was (23%.Conclusion: In this study, it was found that most of the bacteria isolated using culture and molecular methods were Aa, Pg and Pi, respectively. Although the detection frequencies of both techniques were similar, the specificity, sensitivity and bacterial detection speed of the PCR technique is obviously higher. Therefore, the use of molecular techniques is strongly recommended. However, both techniques seem to be suitable for microbiological diagnostics.
Bradley, Elizabeth H; Brewster, Amanda L; McNatt, Zahirah; Linnander, Erika L; Cherlin, Emily; Fosburgh, Heather; Ting, Henry H; Curry, Leslie A
2018-03-01
Quality collaboratives are widely endorsed as a potentially effective method for translating and spreading best practices for acute myocardial infarction (AMI) care. Nevertheless, hospital success in improving performance through participation in collaboratives varies markedly. We sought to understand what distinguished hospitals that succeeded in shifting culture and reducing 30-day risk-standardised mortality rate (RSMR) after AMI through their participation in the Leadership Saves Lives (LSL) collaborative. We conducted a longitudinal, mixed methods intervention study of 10 hospitals over a 2-year period; data included surveys of 223 individuals (response rates 83%-94% depending on wave) and 393 in-depth interviews with clinical and management staff most engaged with the LSL intervention in the 10 hospitals. We measured change in culture and RSMR, and key aspects of working related to team membership, turnover, level of participation and approaches to conflict management. The six hospitals that experienced substantial culture change and greater reductions in RSMR demonstrated distinctions in: (1) effective inclusion of staff from different disciplines and levels in the organisational hierarchy in the team guiding improvement efforts (referred to as the 'guiding coalition' in each hospital); (2) authentic participation in the work of the guiding coalition; and (3) distinct patterns of managing conflict. Guiding coalition size and turnover were not associated with success (p values>0.05). In the six hospitals that experienced substantial positive culture change, staff indicated that the LSL learnings were already being applied to other improvement efforts. Hospitals that were most successful in a national quality collaborative to shift hospital culture and reduce RSMR showed distinct patterns in membership diversity, authentic participation and capacity for conflict management. © Article author(s) (or their employer(s) unless otherwise stated in the text of the
A safety culture assessment by mixed methods at a public maternity and infant hospital in China
Directory of Open Access Journals (Sweden)
Listyowardojo TA
2017-07-01
Full Text Available Tita Alissa Listyowardojo,1 Xiaoling Yan,2,3 Stephen Leyshon,1 Bobbie Ray-Sannerud,1 Xin Yan Yu,4 Kai Zheng,4 Tao Duan2,3 1Life Sciences Program, Group Technology and Research, DNV GL, Hovik, Norway; 2Quality and Safety Department, Shanghai First Maternity and Infant Hospital, 3Tongji University School of Medicine, Shanghai, 4Healthcare Department, Business Assurance, DNV GL, Beijing, China Objective: To assess safety culture at a public maternity hospital in Shanghai, China, using a sequential mixed methods approach. The study was part of a bigger study looking at the application of the mixed methods approach to assess safety culture in health care in different organizations and countries.Methodology: A mixed methods approach was utilized by first distributing the Safety Attitudes Questionnaire measuring six safety culture dimensions and five independent items to all hospital staff (n=1482 working in 18 departments at a single hospital. Afterward, semistructured interviews were conducted using convenience sampling, where 48 hospital staff from nine departments at the same hospital were individually interviewed.Results: The survey received a response rate of 96%. The survey findings show significant differences between the hospital departments in almost all safety culture dimensions and independent items. Similarly, the interview findings revealed that there were different, competing priorities between departments perceived to result in a reduced quality of collaboration and bottlenecks in care delivery. Another major finding was that staff who worked more hours per week would perceive working conditions significantly more negatively. Issues related to working conditions were also the most common concerns discussed in the interviews, especially the issue on high workload. High workload was also reflected in the fact that 91.45% of survey respondents reported that they worked 40 hours or longer per week. Finally, interview findings complemented
International Nuclear Information System (INIS)
Nagatomi, Shigeki
1993-01-01
The present study was conducted to elucidate the effects of gamma ray irradiation and callus culture upon induced variation of the regeneratives. The populations regenerated from young leaf tissue of chronic irradiated plnats grown under a gamma field receiving a total dose of 300 and 100 Gy, showed rather wider variation on quantitative characters than plants from populations of the non-irradiated. This variation extended in both negative and positive directions. Analysis of variance also revealed that variation and heritability in broad sense of most agronomic characters increased significantly among the subclones as the irradiation done rose. Principal component analysis also indicated that the subclones from the irradiated population were more variable than the non-irradiated. Such variation with higher heritability could be transmitted to the following generations by clonal propagation and utilized as genetic sources in mutation breeding. The combined method with chronic irradiation followed by tissue culture is evaluated as an effective method of widening mutation spectrum and increasing mutation frequency in regenerated plants. In addition, this method is valid to improve any crop species which can regenerate plants through callus culture. (author)
Directory of Open Access Journals (Sweden)
Marilyn R. McFarland PhD, RN, FNP-BC, CTN
2012-07-01
Full Text Available Nurse anthropologist, Madeleine Leininger, developed the culture care theory and ethnonursing research method to help researchers study transcultural human care phenomena and discover the knowledge nurses need to provide care in an increasingly multicultural world. The authors propose that the ethnonursing method can be useful for research that addresses providing care in other disciplines, including education, administration, physical, occupational, and speech therapy, social work, pharmacy, medicine, and other disciplines in which research findings have implications for human care and health. The authors discuss the culture care theory and describe the ethnonursing research method's enablers, data analysis phases, and qualitative evaluation criteria. The theory is presented as a guide for using research findings to design culturally competent and congruent care to promote well-being among diverse people, groups, communities, and institutions. Resources include a reference list of key source publications, a discussion of exemplar studies, and samples of a theory-based, open-ended interview guide and data coding system.
Lemna minor (Duckweed) is commonly used in aquatic toxicity investigations. Methods for culturing and testing with reference toxicants, such as atrazine, are somewhat variable among researchers. Our goal was to develop standardized methods of culturing and testing for use with L....
Wagner, Claire; Garner, Mark; Kawulich, Barbara
2011-01-01
No formal pedagogical culture for research methods in the social sciences seems to exist and, as part of the authors' endeavour to establish such a culture, this article reviews current literature about teaching research methods and identifies the gaps in the research. Articles in academic journals spanning a 10-year period were collected by…
DEFF Research Database (Denmark)
Pellicer i Nàcher, Carles; Domingo Felez, Carlos; Mutlu, Ayten Gizem
2013-01-01
. This study presents a rigorous and critical assessment of existing physical and chemical EPS extraction methods applied to mixed-culture biomass samples (nitrifying, nitritation-anammox, and activated sludge biomass). A novel fluorescence-based method was developed and calibrated to quantify the lysis...... potential of different EPS extraction protocols. We concluded that commonly used methods to assess cell lysis (DNA concentrations or G6PDH activities in EPS extracts) do not correlate with cell viability. Furthermore, we discovered that the presence of certain chemicals in EPS extracts results in severe...... underestimation of protein and carbohydrate concentrations by using standard analytical methods. Keeping both maximum EPS extraction yields and minimal biomass lysis as criteria, it was identified a sonication-based extraction method as the best to determine and compare tightly-bound EPS fractions in different...
Irradiation as a Method of Salvation of Cultural Heritage Objects Under Massive Jeopardy
International Nuclear Information System (INIS)
Katusin-Razem, B.; Braun, M.; Jagic, R.
2013-01-01
Cultural heritage artefacts made of organic materials are susceptible to deterioration caused by the action of insects, moulds, fungi and bacteria. The problem of biodeterioration becomes especially acute after natural catastrophes and weather inclemencies, or after human activities conducive to an abrupt development of pests. Usually a large number of objects are imperilled at the same time and their sheer number aggravates any organized preservation effort. Irradiation has proven an effective method of preservation under the circumstances, e.g. for the prevention of massive proliferation of fungal infestation of books wetted by flood. War destructions in Croatia 1991 - 1995 seriously jeopardized many cultural objects. Their treatment by 60Co gamma rays in the Radiation Chemistry and Dosimetry Laboratory of the Ruðer Boškoviæ Institute played a significant role in the prevention of massive biodeterioration. In co-operation with the Croatian Conservation Institute, one third of 5000 evacuated objects, mostly polychromic wooden sculptures, were irradiated for desinsection and disinfection, enabling their joint accommodation in depots until restoration. This contribution to the preservation of jeopardized cultural heritage objects has been recognized internationally as a specially significant and successful case of the application of irradiation to cultural heritage. The presentation describes in more detail the preservation and restoration of the altar of the Holy Cross from the church of the Blessed Virgin Mary of the Snow in Kamensko.(author)
DeQuach, Jessica A; Mezzano, Valeria; Miglani, Amar; Lange, Stephan; Keller, Gordon M; Sheikh, Farah; Christman, Karen L
2010-09-27
The native extracellular matrix (ECM) consists of a highly complex, tissue-specific network of proteins and polysaccharides, which help regulate many cellular functions. Despite the complex nature of the ECM, in vitro cell-based studies traditionally assess cell behavior on single ECM component substrates, which do not adequately mimic the in vivo extracellular milieu. We present a simple approach for developing naturally derived ECM coatings for cell culture that provide important tissue-specific cues unlike traditional cell culture coatings, thereby enabling the maturation of committed C2C12 skeletal myoblast progenitors and human embryonic stem cells differentiated into cardiomyocytes. Here we show that natural muscle-specific coatings can (i) be derived from decellularized, solubilized adult porcine muscle, (ii) contain a complex mixture of ECM components including polysaccharides, (iii) adsorb onto tissue culture plastic and (iv) promote cell maturation of committed muscle progenitor and stem cells. This versatile method can create tissue-specific ECM coatings, which offer a promising platform for cell culture to more closely mimic the mature in vivo ECM microenvironment.
Bergenholtz, Heidi; Jarlbaek, Lene; Hølge-Hazelton, Bibi
2016-06-01
It can be challenging to provide generalist palliative care in hospitals, owing to difficulties in integrating disease-oriented treatment with palliative care and the influences of cultural and organisational conditions. However, knowledge on the interactions that occur is sparse. To investigate the interactions between organisation and culture as conditions for integrated palliative care in hospital and, if possible, to suggest workable solutions for the provision of generalist palliative care. A convergent parallel mixed-methods design was chosen using two independent studies: a quantitative study, in which three independent datasets were triangulated to study the organisation and evaluation of generalist palliative care, and a qualitative, ethnographic study exploring the culture of generalist palliative nursing care in medical departments. A Danish regional hospital with 29 department managements and one hospital management. Two overall themes emerged: (1) 'generalist palliative care as a priority at the hospital', suggesting contrasting issues regarding prioritisation of palliative care at different organisational levels, and (2) 'knowledge and use of generalist palliative care clinical guideline', suggesting that the guideline had not reached all levels of the organisation. Contrasting issues in the hospital's provision of generalist palliative care at different organisational levels seem to hamper the interactions between organisation and culture - interactions that appear to be necessary for the provision of integrated palliative care in the hospital. The implementation of palliative care is also hindered by the main focus being on disease-oriented treatment, which is reflected at all the organisational levels. © The Author(s) 2015.
Methods to induce primary and secondary traumatic damage in organotypic hippocampal slice cultures.
Adamchik, Y; Frantseva, M V; Weisspapir, M; Carlen, P L; Perez Velazquez, J L
2000-04-01
Organotypic brain slice cultures have been used in a variety of studies on neurodegenerative processes [K.M. Abdel-Hamid, M. Tymianski, Mechanisms and effects of intracellular calcium buffering on neuronal survival in organotypic hippocampal cultures exposed to anoxia/aglycemia or to excitotoxins, J. Neurosci. 17, 1997, pp. 3538-3553; D.W. Newell, A. Barth, V. Papermaster, A.T. Malouf, Glutamate and non-glutamate receptor mediated toxicity caused by oxygen and glucose deprivation in organotypic hippocampal cultures, J. Neurosci. 15, 1995, pp. 7702-7711; J.L. Perez Velazquez, M.V. Frantseva, P.L. Carlen, In vitro ischemia promotes glutamate mediated free radical generation and intracellular calcium accumulation in pyramidal neurons of cultured hippocampal slices, J. Neurosci. 23, 1997, pp. 9085-9094; L. Stoppini, L.A. Buchs, D. Muller, A simple method for organotypic cultures of nervous tissue, J. Neurosci. Methods 37, 1991, pp. 173-182; R.C. Tasker, J.T. Coyle, J.J. Vornov, The regional vulnerability to hypoglycemia induced neurotoxicity in organotypic hippocampal culture: protection by early tetrodotoxin or delayed MK 801, J. Neurosci. 12, 1992, pp. 4298-4308.]. We describe two methods to induce traumatic cell damage in hippocampal organotypic cultures. Primary trauma injury was achieved by rolling a stainless steel cylinder (0.9 g) on the organotypic slices. Secondary injury was followed after dropping a weight (0.137 g) on a localised area of the organotypic slice, from a height of 2 mm. The time course and extent of cell death were determined by measuring the fluorescence of the viability indicator propidium iodide (PI) at several time points after the injury. The initial localised impact damage spread 24 and 67 h after injury, cell death being 25% and 54%, respectively, when slices were kept at 37 degrees C. To validate these methods as models to assess neuroprotective strategies, similar insults were applied to slices at relatively low temperatures (30
Co-interviewing across gender and culture: expanding qualitative research methods in Melanesia.
Redman-MacLaren, Michelle L; Api, Unia K; Darius, Matupit; Tommbe, Rachael; Mafile'o, Tracie A; MacLaren, David J
2014-09-06
The social and cultural positions of both researchers and research participants influence qualitative methods and study findings. In Papua New Guinea (PNG), as in other contexts, gender is a key organising characteristic and needs to be central to the design and conduct of research. The colonial history between researcher and participant is also critical to understanding potential power differences. This is particularly relevant to public health research, much of which has emerged from a positivist paradigm. This paper describes our critical reflection of flexible researcher responses enacted during qualitative research in PNG. Led by a senior male HIV researcher from PNG, a male from a PNG university and a female from an Australian university conducted qualitative interviews about faith-based responses to HIV in PNG. The two researchers planned to conduct one-on-one interviews matching gender of participants and interviewer. However, while conducting the study, four participants explicitly requested to be interviewed by both researchers. This experience led us to critically consider socially and culturally situated ways of understanding semi-structured interviewing for public health research in Melanesia. New understandings about public health research include: (i) a challenge to the convention that the researcher holds more power than the research participant, (ii) the importance of audience in Melanesia, (iii) cultural safety can be provided when two people co-interview and (iv) the effect an esteemed leader heading the research may have on people's willingness to participate. Researchers who occupy insider-outsider roles in PNG may provide participants new possibilities to communicate key ideas. Our recent experience has taught us public health research methods that are gender sensitive and culturally situated are pivotal to successful research in Melanesia. Qualitative research requires adaptability and reflexivity. Public health research methods must continue
Directory of Open Access Journals (Sweden)
LiBing Ma
Full Text Available It was proposed that arresting nuclear donor cells in G0/G1 phase facilitates the development of embryos that are derived from somatic cell nuclear transfer (SCNT. Full confluency or serum starvation is commonly used to arrest in vitro cultured somatic cells in G0/G1 phase. However, it is controversial as to whether these two methods have the same efficiency in arresting somatic cells in G0/G1 phase. Moreover, it is unclear whether the cloned embryos have comparable developmental ability after somatic cells are subjected to one of these methods and then used as nuclear donors in SCNT. In the present study, in vitro cultured sheep skin fibroblasts were divided into four groups: (1 cultured to 70-80% confluency (control group, (2 cultured to full confluency, (3 starved in low serum medium for 4 d, or (4 cultured to full confluency and then further starved for 4 d. Flow cytometry was used to assay the percentage of fibroblasts in G0/G1 phase, and cell counting was used to assay the viability of the fibroblasts. Then, real-time reverse transcription PCR was used to determine the levels of expression of several cell cycle-related genes. Subsequently, the four groups of fibroblasts were separately used as nuclear donors in SCNT, and the developmental ability and the quality of the cloned embryos were compared. The results showed that the percentage of fibroblasts in G0/G1 phase, the viability of fibroblasts, and the expression levels of cell cycle-related genes was different among the four groups of fibroblasts. Moreover, the quality of the cloned embryos was comparable after these four groups of fibroblasts were separately used as nuclear donors in SCNT. However, cloned embryos derived from fibroblasts that were cultured to full confluency combined with serum starvation had the highest developmental ability. The results of the present study indicate that there are synergistic effects of full confluency and serum starvation on arresting fibroblasts in
Energy Technology Data Exchange (ETDEWEB)
Han, Sangmin; Lee, Seung Min; Seong, Poong Hyun [KAIST, Daejeon (Korea, Republic of)
2015-05-15
IAEA defined safety culture as follows: 'Safety Culture is that assembly of characteristics and attitudes in organizations and individuals which establishes that, as an overriding priority, nuclear plant safety issues receive the attention warranted by their significance'. Also, celebrated behavioral scientist, Cooper, defined safety culture as,'safety culture is that observable degree of effort by which all organizational members direct their attention and actions toward improving safety on a daily basis' with his internal psychological, situational, and behavioral context model. With these various definitions and criteria of safety culture, several safety culture assessment methods have been developed to improve and manage safety culture. To develop a new quantitative safety culture evaluation method for an operating team, we unified and redefined safety culture assessment items. Then we modeled a new safety culture evaluation by adopting level 1 PSA concept. Finally, we suggested the criteria to obtain nominal success probabilities of assessment items by using 'operational definition'. To validate the suggested evaluation method, we analyzed the collected audio-visual recording data collected from a full scope main control room simulator of a NPP in Korea.
International Nuclear Information System (INIS)
Han, Sangmin; Lee, Seung Min; Seong, Poong Hyun
2015-01-01
IAEA defined safety culture as follows: 'Safety Culture is that assembly of characteristics and attitudes in organizations and individuals which establishes that, as an overriding priority, nuclear plant safety issues receive the attention warranted by their significance'. Also, celebrated behavioral scientist, Cooper, defined safety culture as,'safety culture is that observable degree of effort by which all organizational members direct their attention and actions toward improving safety on a daily basis' with his internal psychological, situational, and behavioral context model. With these various definitions and criteria of safety culture, several safety culture assessment methods have been developed to improve and manage safety culture. To develop a new quantitative safety culture evaluation method for an operating team, we unified and redefined safety culture assessment items. Then we modeled a new safety culture evaluation by adopting level 1 PSA concept. Finally, we suggested the criteria to obtain nominal success probabilities of assessment items by using 'operational definition'. To validate the suggested evaluation method, we analyzed the collected audio-visual recording data collected from a full scope main control room simulator of a NPP in Korea
The Leukocyte Culture Method in the Diagnosis of Free-martinism
Kanagawa, H.; Basrur, Parvathi K.
1968-01-01
The clinical application and reliability of the leukocyte culture method for the diagnosis of freemartinism were examined and the length of time that blood samples could be held at room temperature and in the refrigerator prior to culturing, was investigated. The chromosome findings by the leukocyte culture method in 14 freemartins and 9 non-freemartin females belonging to heterosexual twins or triplets revealed that XX-XY cell chimerism exists only in the former, whereas the latter were exclusively of normal female complement. The mitotic index in bovine blood after preservation for varying periods was studied on samples from two animals. Blood samples from these two animals stored at 5°C for 6 hours in a refrigerator showed the mitotic index to be 3.8 and 5.3 per cent which gradually decreased in samples stored for longer than 12 hours. After 72 hours, a very rapid decrease in mitotic index occurred in both cases, reaching zero in samples stored for 96 and 108 hours. Samples kept at room temperature followed a similar pattern as under refrigeration but with slightly lower values throughout. ImagesFig. 1.Fig. 2. PMID:4234791
Directory of Open Access Journals (Sweden)
Timothy C. Haire
2018-03-01
Full Text Available Chlamydomonas reinhardtii (Cr, a unicellular alga, is routinely utilized to study photosynthetic biochemistry, ciliary motility, and cellular reproduction. Its minimal culture requirements, unicellular morphology, and ease of transformation have made it a popular model system. Despite its relatively slow doubling time, compared with many bacteria, it is an ideal eukaryotic system for microplate-based studies utilizing either, or both, absorbance as well as fluorescence assays. Such microplate assays are powerful tools for researchers in the areas of toxicology, pharmacology, chemical genetics, biotechnology, and more. However, while microplate-based assays are valuable tools for screening biological systems, these methodologies can significantly alter the conditions in which the organisms are cultured and their subsequent physiology or morphology. Herein we describe a novel method for the microplate culture and in vivo phenotypic analysis of growth, viability, and photosynthetic pigments of C. reinhardtii. We evaluated the utility of our assay by screening silver nanoparticles for their effects on growth and viability. These methods are amenable to a wide assortment of studies and present a significant advancement in the methodologies available for research involving this model organism.
DEFF Research Database (Denmark)
Rudkjøbing, Vibeke Børsholt; Thomsen, Trine Rolighed; Xu, Yijuan
2016-01-01
BACKGROUND: Necrotizing soft tissue infections (NSTIs) are a group of infections affecting all soft tissues. NSTI involves necrosis of the afflicted tissue and is potentially life threatening due to major and rapid destruction of tissue, which often leads to septic shock and organ failure. The gold...... to culture. Although the molecular methods generally gave concordant results, our results indicate that Microseq may misidentify or overlook microorganisms that can be detected by other molecular methods. Half of the patients were found to be infected with S. pyogenes, but several atypical findings were also...... that clinicians should be prepared to diagnose and treat any combination of microbial pathogens. Some of the tested molecular methods offer a faster turnaround time combined with a high specificity, which makes supplemental use of such methods attractive for identification of microorganisms, especially...
Features of method of medical physical culture at insufficiency of aortic valve
Directory of Open Access Journals (Sweden)
S.A. Kalmykov
2013-01-01
Full Text Available The basic approaches are considered to application of facilities of medical physical education at aortic insufficiency on the stages of physical rehabilitation. An analysis is conducted more than 20 literary sources. The mechanisms of medical action of physical exercises are specified - restorative influence, forming of temporal indemnifications, trophic action, normalization of the broken functions. It is set that task, forms, facilities, the methods of medical physical culture depend on the degree of weight of disease, degree of cardio-vascular insufficiency and stage of physical rehabilitation. Engaged in a medical physical culture conducted in form morning hygienical gymnastics, medical gymnastics, independent employments, dosed walks, walking on steps, mobile and sporting games. It is marked that sparing training and training the motive modes are instrumental in the gradual training of the cardio-vascular system. Recommended the dosed walking to lead to a to 5-8 km on the sparing training and to 8-12 km on training modes.
DEFF Research Database (Denmark)
Xu, Yijuan; Schønheyder, Henrik Carl; Ehrlich, Garth
, indicating biofilm formation. In conclusion, this study indicated that to improve the microbiological diagnosis of prosthetic joint infections molecular methods may be useful supplements to routine cultures, and the current intraoperative sampling strategy needs to be optimized.......Bacterial biofilms have been observed in many device-related infections including orthopedic implants. This mode of growth makes the infection difficult to treat and constitutes a challenge to current sampling procedures and culture practices to obtain a reliable diagnosis. The aim of the study...... uncovered many more species including known pathogens and species not previously reported in orthopedic infections, and polymicrobial communities were commonly observed. Additionally the molecular findings suggested the bacterial composition and yield varied depending on the position and type of samples...
Zecevic, Aleksandra A; Li, Alvin Ho-Ting; Ngo, Charity; Halligan, Michelle; Kothari, Anita
2017-06-01
The purpose of this study was to assess the facilitators and barriers to implementation of the Systemic Falls Investigative Method (SFIM) on selected hospital units. A cross-sectional explanatory mixed methods design was used to converge results from a standardized safety culture survey with themes that emerged from interviews and focus groups. Findings were organized by six elements of the Ottawa Model of Research Use framework. A geriatric rehabilitation unit of an acute care hospital and a neurological unit of a rehabilitation hospital were selected purposefully due to the high frequency of falls. Hospital staff who took part in: surveys (n = 39), interviews (n = 10) and focus groups (n = 12), and 38 people who were interviewed during falls investigations: fallers, family, unit staff and hospital management. Implementation of the SFIM to investigate fall occurrences. Percent of positive responses on the Modified Stanford Patient Safety Culture Survey Instrument converged with qualitative themes on facilitators and barriers for intervention implementation. Both hospital units had an overall poor safety culture which hindered intervention implementation. Facilitators were hospital accreditation, strong emphasis on patient safety, infrastructure and dedicated champions. Barriers included heavy workloads, lack of time, lack of resources and poor communication. Successful implementation of SFIM requires regulatory and organizational support, committed frontline staff and allocation of resources to identify active causes and latent contributing factors to falls. System-wide adjustments show promise for promotion of safety culture in hospitals where falls happen regularly. © The Author 2017. Published by Oxford University Press in association with the International Society for Quality in Health Care. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
Organizational culture change in U.S. hospitals: a mixed methods longitudinal intervention study.
Curry, Leslie A; Linnander, Erika L; Brewster, Amanda L; Ting, Henry; Krumholz, Harlan M; Bradley, Elizabeth H
2015-03-07
Improving outcomes for patients with acute myocardial infarction (AMI) is a priority for hospital leadership, clinicians, and policymakers. Evidence suggests links between hospital organizational culture and hospital performance; however, few studies have attempted to shift organizational culture in order to improve performance, fewer have focused on patient outcomes, and none have addressed mortality for patients with AMI. We sought to address this gap through a novel longitudinal intervention study, Leadership Saves Lives (LSL). This manuscript describes the methodology of LSL, a 2-year intervention study using a concurrent mixed methods design, guided by open systems theory and the Assess, Innovate, Develop, Engage, Devolve (AIDED) model of diffusion, implemented in 10 U.S. hospitals and their peer hospital networks. The intervention has three primary components: 1) annual convenings of the ten intervention hospitals; 2) semiannual workshops with guiding coalitions at each hospital; and 3) continuous remote support across all intervention hospitals through a web-based platform. Primary outcomes include 1) shifts in key dimensions of hospital organizational culture associated with lower mortality rates for patients with AMI; 2) use of targeted evidence-based practices associated with lower mortality rates for patients with AMI; and 3) in-hospital AMI mortality. Quantitative data include annual surveys of guiding coalition members in the intervention hospitals and peer network hospitals. Qualitative data include in-person, in-depth interviews with all guiding coalition members and selective observations of key interactions in care for patients with AMI, collected at three time points. Data integration will identify patterns and major themes in change processes across all intervention hospitals over time. LSL is novel in its use of a longitudinal mixed methods approach in a diverse sample of hospitals, its focus on objective outcome measures of mortality, and its
Tan, Mu-xiu; Zeng, Wen-wen; Wei, Peng-xiao; Mo, Qiao-cheng; Pu, Zu-ning; Cen, Xiu-fen; Shi, Feng-hua
2015-05-01
To explore the germination conditions of Lonicera hypoglauca sand culture seeds and the effects of sand culture seedlings sterilization. 0.1% HgCl2 with different sterilization time, different illumination time and temperature culture condition were adopted to study the germination conditions of sand culture seeds. Different sterilization treatments and different hardening-seedling days were used to test the sterilization effect of sand culture seedlings. The sterilization effect of the combination of 75% ethanol 30 s + 0.1% HgCl2 5 min on Lonicera hypoglauca seeds was the optimum,with the average pollution rate of 15.56%, and the average germination rate reached 51.11%. The combination of varied temperature-room temperature under light for 12 h/d was the best, with the average germination rate peaked at 75.49%, and the average germination potential reached 68.36%. The treatment of detergent liquor scrub-tap water wash on the part above the hypocotyl, which was sand cultured under the opening condition and had no root, showed the best sterilization effect, with the average pollution rate was zero, and the average survival rate peaked at 100.00%. The sterilization effect of sand culture seedlings, which was disinfected after cleaning by detergent liquor scrub-tap water wash after hardening-seeding for 30 days, was the best, with the average pollution rate of 50.00%, and the average survival rate of 100.00%. The best sterilization effect is the combination of 75% ethanol 30 s + 0.1% HgCl2 5 min; Lighting for 12 h/d of varied temperature-room temperature is regarded as the optimum culture condition. The treatment of detergent liquor scrub-tap water wash treatment on the part above the hypocotyl,which is sand cultured under the opening condition and had no root, shows the best sterilization effect. For the sand culture seedlings, before inoculated in subculture medium, should be hardening-seedling for some days and sterilized after detergent liquor scrub-tap water wash.
Bazzi, Ali M; Rabaan, Ali A; El Edaily, Zeyad; John, Susan; Fawarah, Mahmoud M; Al-Tawfiq, Jaffar A
Matrix-assisted laser desorption-ionization time-of-flight (MALDI-TOF) mass spectrometry facilitates rapid and accurate identification of pathogens, which is critical for sepsis patients. In this study, we assessed the accuracy in identification of both Gram-negative and Gram-positive bacteria, except for Streptococcus viridans, using four rapid blood culture methods with Vitek MALDI-TOF-MS. We compared our proposed lysis centrifugation followed by washing and 30% acetic acid treatment method (method 2) with two other lysis centrifugation methods (washing and 30% formic acid treatment (method 1); 100% ethanol treatment (method 3)), and picking colonies from 90 to 180min subculture plates (method 4). Methods 1 and 2 identified all organisms down to species level with 100% accuracy, except for Streptococcus viridans, Streptococcus pyogenes, Enterobacter cloacae and Proteus vulgaris. The latter two were identified to genus level with 100% accuracy. Each method exhibited excellent accuracy and precision in terms of identification to genus level with certain limitations. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.
[Application of a modified culturing method for lymphocytes in cytogenetic research].
Gao, Chaoxian; Hui, Changye; Zhang, Wen; Guo, Yan; Li, Limei; Chen, Yuting; Zhang, Liuzhuo; Yang, Xinyue; Huang, Xianqing
2016-08-01
To establish a modified method for microculturing whole human blood for cytogenetic analysis. A novel tube rack was designed to overcome the drawbacks of directly culturing the cells within centrifuge tubes. The fractions of human plasma, human serum and two commercial fetal bovine sera were analyzed with 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The influence of adding 0%, 5%, 10%, 15%, 20%, 25% and 30% autologous plasma to the culture on lymphocyte transformation rate and mitotic index (MI) was examined. The SDS-PAGE analysis showed a significant difference between commercial fetal bovine sera, and that the components of human plasma were similar to those of fetal bovine serum. The value of MI in lymphocyte was evidently increased along with addition of autologous plasma. However, this has exerted no significant effect on the transformation rate. With the addition of 10% autologous plasma, the MI value has become much higher than the conventional method. A modified method was established by application of a novel tube inclined rack and optimization of whole blood inoculation. This method is easier and cheaper, and is suitable for application in clinical practice.
Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M
2012-01-01
Introduction : Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. Objectives: To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Materials and Methods: Two hundred ...
Barnini, Simona; Brucculeri, Veronica; Morici, Paola; Ghelardi, Emilia; Florio, Walter; Lupetti, Antonella
2016-08-12
Rapid identification and antimicrobial susceptibility testing (AST) of the causative agent(s) of bloodstream infections can lead to prompt appropriate antimicrobial therapy. To shorten species identification, in this study bacteria were recovered from monomicrobial blood cultures by serum separator tubes and spotted onto the target plate for direct MALDI-TOF MS identification. Proper antibiotics were selected for direct AST based on species identification. In order to obtain rapid AST results, bacteria were recovered from positive blood cultures by two different protocols: by serum separator tubes (further referred to as PR1), or after a short-term subculture in liquid medium (further referred to as PR2). The results were compared with those obtained by the method currently used in our laboratory consisting in identification by MALDI-TOF and AST by Vitek 2 or Sensititre on isolated colonies. The direct MALDI-TOF method concordantly identified with the current method 97.5 % of the Gram-negative bacteria and 96.1 % of the Gram-positive cocci contained in monomicrobial blood cultures. The direct AST by PR1 and PR2 for all isolate/antimicrobial agent combinations was concordant/correct with the current method for 87.8 and 90.5 % of Gram-negative bacteria and for 93.1 and 93.8 % of Gram-positive cocci, respectively. In particular, 100 % categorical agreement was found with levofloxacin for Enterobacteriaceae by both PR1 and PR2, and 99.0 and 100 % categorical agreement was observed with linezolid for Gram-positive cocci by PR1 and PR2, respectively. There was no significant difference in accuracy between PR1 and PR2 for Gram-negative bacteria and Gram-positive cocci. This newly described method seems promising for providing accurate AST results. Most importantly, these results would be available in a few hours from blood culture positivity, which would help clinicians to promptly confirm or streamline an effective antibiotic therapy in patients with bloodstream
Rennie, Robert P; Turnbull, Lee-Ann; Gauchier-Pitts, Kaylee; Bennett, Tracy; Dyrland, Debbie; Blonski, Susan
2016-08-01
The ability to isolate and identify causative agents of urinary tract infections relies primarily on the quality of the urine sample that is submitted to the microbiology. The most important factors are the method of collection, the maintenance of viability of the potential pathogens during transport, and standardization of the culturing of the urine sample. This report is a composite of several investigations comparing collection and transport on urine culture paddles, with a preservative urine sponge (Uriswab), and a comparison of Uriswab with the BD preservative transport tube as methods of preservation of urinary pathogens. Primary studies showed that Uriswab maintained significantly more urinary pathogens than the urine culture paddle with fewer mixed or contaminated cultures. The two preservative transport systems were comparable for maintenance of viability of the pathogens, but there were fewer mixed cultures when samples were collected with Uriswab. This study confirms the importance of a standard volume of 1 μL of urine for culture. Copyright © 2016 Elsevier Inc. All rights reserved.
Oral rinse as a potential method to culture Candida isolate from AIDS patients
Directory of Open Access Journals (Sweden)
Desiana Radithia
2011-12-01
Full Text Available Background: Candida isolate is easily sampled from oral cavity by swabbing directly on the candidiasis lesion, to be smeared onto slides for direct examination or cultured in a growth medium. This method is by far the gold standard for defining candidiasis diagnosis. However it is difficult to apply on sensitive patients and almost impossible on patients showing no clinical appearance of oral candidiasis. AIDS patients are very prone to candida infection and have a tendency of repetitive infection involving mixed species. As many candida species show different susceptibility to anti-fungal agents, it is necessary to identify the species causing the infection in the management of oral candidiasis. Oral rinse is a suggested method to obtain candida isolate to be cultured for further analysis such as species identification. This method is simple and less risky on infection transmission as less tools are required in the procedure. Purpose: This study aimed to assess the application of oral rinse as an alternative method to culture Candida isolate from AIDS patients. Methods: A cross-sectional observative study was conducted in HIV/AIDS in-Patient Facility of Intermediate Care Unit for Infection Disease, Dr. Soetomo Hospital Surabaya. Fourteen stadium 4 AIDS patients matching criteria were swabbed on 1/3-posterior of the tongue, and then given 10 ml phosphate buffer saline to rinse vigorously for 15 seconds. Both specimens were cultured on Sabouraud’s dextrose agar and colony growth was observed. Results: Candida colonies were able to grow from all 14 isolates (100% by both methods. Qualitatively, cultures from oral rinse specimens were more populated than cultures from swab specimens. Conclusion: Oral rinse is an applicable technique to obtain Candida species isolate. This technique is safe, easy, non-invasive, and needs less tools therefore less risky for HIV transmission.Latar belakang: Isolat Candida mudah diambil dengan cara mengusap lesi
Development of an enumeration method for arsenic methylating bacteria from mixed culture samples.
Islam, S M Atiqul; Fukushi, Kensuke; Yamamoto, Kazuo
2005-12-01
Bacterial methylation of arsenic converts inorganic arsenic into volatile and non-volatile methylated species. It plays an important role in the arsenic cycle in the environment. Despite the potential environmental significance of AsMB, an assessment of their population size and activity remains unknown. This study has now established a protocol for enumeration of AsMB by means of the anaerobic-culture-tube, most probable number (MPN) method. Direct detection of volatile arsenic species is then done by GC-MS. This method is advantageous as it can simultaneously enumerate AsMB and acetate and formate-utilizing methanogens. The incubation time for this method was determined to be 6 weeks, sufficient time for AsMB growth.
ANALYSIS OF GROWTH OF LALAWAK Barbonymus balleroides (VALENCIENNES, 1842 IN THREE CULTURE METHODS
Directory of Open Access Journals (Sweden)
Deni Radona
2017-09-01
Full Text Available In fish culture, optimal growth could be influenced by various culture methods. Aim of the study was to evaluate the productivity of Barbonymus balleroides, lalawak in floating net cages, concrete ponds, and earthen ponds. Cultivation was designed with the circulation water system. Experiment was conducted using completely randomized design with three treatments and three replications for each treatment. The experimental fish, sized of 4.20 ± 0.64 cm SL and weight of 2.14 ± 0.99 g, were obtained from induced breeding. The stocking density used was 20 individuals/m3. Fish were fed 3% of total weight two times every day using commercial pellet with 35% protein content for 90 day. The result showed that lalawak reared in earthen pond was no significant difference on length, weight, and biomass compared with that one in concrete pond (P>0.05, but significantly different (P0.05 among the three different culture systems for survival rate and FCR. Lalawak reared on earthen pond system supported with optimal water quality could increase productivity value.
The double pedigree: a method for studying culturally and genetically inherited behavior in tandem.
Directory of Open Access Journals (Sweden)
Etienne Danchin
Full Text Available Transgenerational sources of biological variation have been at the center of evolutionary studies ever since Darwin and Wallace identified natural selection. This is because evolution can only operate on traits whose variation is transmitted, i.e. traits that are heritable. The discovery of genetic inheritance has led to a semantic shift, resulting in the tendency to consider that only genes are inherited across generations. Today, however, concepts of heredity are being broadened again to integrate the accruing evidence of non-genetic inheritance, and many evolutionary biologists are calling for the inclusion of non-genetic inheritance into an inclusive evolutionary synthesis. Here, we focus on social heredity and its role in the inheritance of behavioral traits. We discuss quantitative genetics methods that might allow us to disentangle genetic and non-genetic transmission in natural populations with known pedigrees. We then propose an experimental design based on cross-fostering among animal cultures, environments and families that has the potential to partition inherited phenotypic variation into socially (i.e. culturally and genetically inherited components. This approach builds towards a new conceptual framework based on the use of an extended version of the animal model of quantitative genetics to integrate genetic and cultural components of behavioral inheritance.
Cultural border crossing in three urban classrooms: A mixed methods study
Roopnarine, Rupnarain
This study examined the effects of the instruction of four youth cultural border crossing behaviors: flexibility, being at ease, playfulness, and citizenship as an intervention aimed at helping students to transition across three borders, student to student, student to science, and student to teacher. The research involved 12 ninth- and 10th-grade students in a large urban school district in three diverse classrooms, A, B, and C. Four students in each classroom volunteered for the study. The students in Groups A and B were in 9th grade Living Environment and students in Group B were in 10th grade chemistry. These students participated in this instructional intervention for three months. The study was conducted using both quantitative and qualitative methods based on participant observations, interviews, and questionnaire. The result indicated that there was no significant effect of the cultural border crossing instructions on the students' interactions across the three borders examined. However, the instructions helped Group A and Group B to be more flexible but not group C. Also, the instructions helped Group A to be more playful and at ease but not Group B and C. The instructions also helped Group A to show more citizenship but not Group B and C. In addition, there was no difference between the pretest and posttest cultural bother crossing behavior. Moreover, qualitative data analysis showed that the participants were more flexible, at ease, and playful among peers than across student to teacher and student to science borders. Also, the use of citizenship in the three groups showed no effect on the participants' interaction with peers. Although, the findings showed no effect of cultural border crossing instructions on students' interactions, it is suggested that we continue to find ways to help students feel more comfortable in science.
Nastasi, Bonnie K.; Hitchcock, John H.; Burkholder, Gary; Varjas, Kristen; Sarkar, Sreeroopa; Jayasena, Asoka
2007-01-01
This article expands on an emerging mixed-method approach for validating culturally-specific constructs (see Hitchcock et al., 2005). Previous work established an approach for dealing with cultural impacts when assessing psychological constructs and the current article extends these efforts into studying stress reactions among adolescents in Sri…
Tanner, Hannah; Evans, Jason T; Gossain, Savita; Hussain, Abid
2017-01-18
Patient mortality is significantly reduced by rapid identification of bacteria from sterile sites. MALDI-TOF can identify bacteria directly from positive blood cultures and multiple sample preparation methods are available. We evaluated three sample preparation methods and two MALDI-TOF score cut-off values. Positive blood culture bottles with organisms present in Gram stains were prospectively analysed by MALDI-TOF. Three lysis reagents (Saponin, SDS, and SepsiTyper lysis bufer) were applied to each positive culture followed by centrifugation, washing and protein extraction steps. Methods were compared using the McNemar test and 16S rDNA sequencing was used to assess discordant results. In 144 monomicrobial cultures, using ≥2.000 as the cut-off value, species level identifications were obtained from 69/144 (48%) samples using Saponin, 86/144 (60%) using SDS, and 91/144 (63%) using SepsiTyper. The difference between SDS and SepsiTyper was not statistically significant (P = 0.228). Differences between Saponin and the other two reagents were significant (P direct MALDI-TOF identification were observed in monomicrobial cultures. In 32 polymicrobial cultures, MALDI-TOF identified one organism in 34-75% of samples depending on the method. This study demonstrates two inexpensive in-house detergent lysis methods are non-inferior to a commercial kit for analysis of positive blood cultures by direct MALDI-TOF in a clinical diagnostic microbiology laboratory.
The relationship between glass ceiling and power distance as a cultural variable by a new method
Directory of Open Access Journals (Sweden)
Naide Jahangirov
2015-12-01
Full Text Available Glass ceiling symbolizes a variety of barriers and obstacles that arise from gender inequality at business life. With this mind, culture influences gender dynamics. The purpose of this research was to examine the relationship between the glass ceiling and the power distance as a cultural variable within organizations. Gender variable is taken as a moderator variable in relationship between the concepts. In addition to conventional correlation analysis, we employed a new method to investigate this relationship in detail. The survey data were obtained from 109 people working at a research center which operated as a part of the non-profit private university in Ankara, Turkey. The relationship between the variables was revealed by a new method which was developed as an addition to the correlation in survey. The analysis revealed that the female staff perceived the glass ceiling and the power distance more intensely than the male staff. In addition, the medium level relation was determined between the power distance and the glass ceiling perception among female staff.
Panosyan, Hovik; Birkeland, Nils-Kåre
2014-11-01
The phylogenetic diversity of the prokaryotic community thriving in the Arzakan hot spring in Armenia was studied using molecular and culture-based methods. A sequence analysis of 16S rRNA gene clone libraries demonstrated the presence of a diversity of microorganisms belonging to the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Epsilonproteobacteria, Firmicutes, Bacteroidetes phyla, and Cyanobacteria. Proteobacteria was the dominant group, representing 52% of the bacterial clones. Denaturing gradient gel electrophoresis profiles of the bacterial 16S rRNA gene fragments also indicated the abundance of Proteobacteria, Bacteroidetes, and Cyanobacteria populations. Most of the sequences were most closely related to uncultivated microorganisms and shared less than 96% similarity with their closest matches in GenBank, indicating that this spring harbors a unique community of novel microbial species or genera. The majority of the sequences of an archaeal 16S rRNA gene library, generated from a methanogenic enrichment, were close relatives of members of the genus Methanoculleus. Aerobic endospore-forming bacteria mainly belonging to Bacillus and Geobacillus were detected only by culture-dependent methods. Three isolates were successfully obtained having 99, 96, and 96% 16S rRNA gene sequence similarities to Arcobacter sp., Methylocaldum sp., and Methanoculleus sp., respectively. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hanson, Andrea J; Paszczynski, Andrzej J; Coats, Erik R
2016-03-01
The production of polyhydroxyalkanoates (PHA; bioplastics) from waste or surplus feedstocks using mixed microbial consortia (MMC) and aerobic dynamic feeding (ADF) is a growing field within mixed culture biotechnology. This study aimed to optimize a 2DE workflow to investigate the proteome dynamics of an MMC synthesizing PHA from fermented dairy manure. To mitigate the challenges posed to effective 2DE by this complex sample matrix, the bacterial biomass was purified using Accudenz gradient centrifugation (AGC) before protein extraction. The optimized 2DE method yielded high-quality gels suitable for quantitative comparative analysis and subsequent protein identification by LC-MS/MS. The optimized 2DE method could be adapted to other proteomic investigations involving MMC in complex organic or environmental matrices. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yokobori, Kosuke; Kobayashi, Kaoru; Azuma, Ikuko; Akita, Hidetaka; Chiba, Kan
2017-10-01
Pregnane X receptor (PXR) is localized in the cytoplasm of liver cells, whereas it is localized in the nucleus of monolayer-cultured HepG2 cells. Since cultured cells are affected by the microenvironment in which they are grown, we studied the effect of three-dimensional (3D) culture on the localization of PXR in HepG2 cells using the hanging drop method. The results showed that PXR was retained in the cytoplasm of HepG2 cells and other human hepatocarcinoma cell lines (FLC5, FLC7 and Huh7) when they were cultured by the hanging drop method. Treatment with rifampicin, a ligand of PXR, translocated PXR from the cytoplasm to nucleus and increased expression levels of CYP3A4 mRNA in HepG2 cells cultured by the hanging drop method. These findings suggest that 3D culture is a key factor determining the intracellular localization of PXR in human hepatocarcinoma cells and that PXR that becomes retained in the cytoplasm of HepG2 cells with 3D culture has functions of nuclear translocation and regulation of target genes in response to human PXR ligands. Three-dimensionally cultured hepatocarcinoma cells would be a useful tool to evaluate induction potency of drug candidates and also to study mechanisms of nuclear translocation of PXR by human PXR ligands. Copyright © 2017 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Rahul Ashok Gosavi
2018-01-01
Full Text Available 12–14 days of culturing of bone marrow (BM cells containing various growth factors is widely used method for generating dendritic cells (DCs from suspended cell population. Here we compared flask culture method and commercially available CD11c Positive Selection kit method. Immature BMDCs’ purity of adherent as well as suspended cell population was generated in the decreasing concentration of recombinant-murine granulocyte-macrophage colony-stimulating factor (rmGM-CSF in nontreated tissue culture flasks. The expression of CD11c, MHCII, CD40, and CD86 was measured by flow cytometry. We found significant difference (P<0.05 between the two methods in the adherent cells population but no significant difference was observed between the suspended cell populations with respect to CD11c+ count. However, CD11c+ was significantly higher in both adhered and suspended cell population by culture method but kit method gave more CD11c+ from suspended cells population only. On the other hand, using both methods, immature DC expressed moderate level of MHC class II molecules as well as low levels of CD40 and CD86. Our findings suggest that widely used culture method gives the best results in terms of yield, viability, and purity of BMDCs from both adherent and suspended cell population whereas kit method works well for suspended cell population.
Artioli, Gilberto
2010-01-01
Artioli provides an introduction to the methods and rationales of the scientific investigation of cultural heritage materials, with an emphasis placed on the analytical strategies, modes of operation and resulting information rather than on technicalities.
A comparative study of cultural methods for the detection of Salmonella in feed and feed ingredients
Directory of Open Access Journals (Sweden)
Haggblom Per
2009-02-01
Full Text Available Abstract Background Animal feed as a source of infection to food producing animals is much debated. In order to increase our present knowledge about possible feed transmission it is important to know that the present isolation methods for Salmonella are reliable also for feed materials. In a comparative study the ability of the standard method used for isolation of Salmonella in feed in the Nordic countries, the NMKL71 method (Nordic Committee on Food Analysis was compared to the Modified Semisolid Rappaport Vassiliadis method (MSRV and the international standard method (EN ISO 6579:2002. Five different feed materials were investigated, namely wheat grain, soybean meal, rape seed meal, palm kernel meal, pellets of pig feed and also scrapings from a feed mill elevator. Four different levels of the Salmonella serotypes S. Typhimurium, S. Cubana and S. Yoruba were added to each feed material, respectively. For all methods pre-enrichment in Buffered Peptone Water (BPW were carried out followed by enrichments in the different selective media and finally plating on selective agar media. Results The results obtained with all three methods showed no differences in detection levels, with an accuracy and sensitivity of 65% and 56%, respectively. However, Müller-Kauffmann tetrathionate-novobiocin broth (MKTTn, performed less well due to many false-negative results on Brilliant Green agar (BGA plates. Compared to other feed materials palm kernel meal showed a higher detection level with all serotypes and methods tested. Conclusion The results of this study showed that the accuracy, sensitivity and specificity of the investigated cultural methods were equivalent. However, the detection levels for different feed and feed ingredients varied considerably.
Tanner, Hannah; Evans, Jason T.; Gossain, Savita; Hussain, Abid
2017-01-01
Background Patient mortality is significantly reduced by rapid identification of bacteria from sterile sites. MALDI-TOF can identify bacteria directly from positive blood cultures and multiple sample preparation methods are available. We evaluated three sample preparation methods and two MALDI-TOF score cut-off values. Positive blood culture bottles with organisms present in Gram stains were prospectively analysed by MALDI-TOF. Three lysis reagents (Saponin, SDS, and SepsiTyper lysis bufer) w...
The comparison of two methods to obtain human oral keratinocytes in primary culture
International Nuclear Information System (INIS)
Klingbeil, Maria Fatima Guarizo
2006-01-01
The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)
DEVELOPMENT OF AN INTEGRATED CELL CULTURE/RT-PCR METHOD FOR THE DETECTION OF ENTEROVIRUS IN WATER
Virus contamination in environmental samples is believed to be underestimated due to the limitations in the methods available for detection. A major detection method is based upon the formation of cytopathic effect (CPE) in cell culture. The main limitations to this method are ...
An improved culture method for selective isolation of Campylobacter jejuni from wastewater
Directory of Open Access Journals (Sweden)
Jinyong Kim
2016-08-01
Full Text Available Campylobacter jejuni is one of the leading foodborne pathogens worldwide. C. jejuni is isolated from a wide range of foods, domestic animals, wildlife, and environmental sources. The currently-available culture-based isolation methods are not highly effective for wastewater samples due to the low number of C. jejuni in the midst of competing bacteria. To detect and isolate C. jejuni from wastewater samples, in this study, we evaluated a few different enrichment conditions using five different antibiotics (i.e., cefoperazone, vancomycin, trimethoprim, polymyxin B, and rifampicin, to which C. jejuni is intrinsically resistant. The selectivity of each enrichment condition was measured with Ct value using quantitative real-time PCR (qRT-PCR, and multiplex PCR to determine Campylobacter species. In addition, the efficacy of Campylobacter isolation on different culture media after selective enrichment was examined by growing on Bolton and Preston agar plates. The addition of polymyxin B, rifampicin, or both to the Bolton selective supplements enhanced the selective isolation of C. jejuni. In particular, rifampicin supplementation and an increased culture temperature (i.e., 42°C had a decisive effect on the selective enrichment of C. jejuni from wastewater. The results of 16S rDNA sequencing also revealed that Enterococcus spp. and Pseudomonas aeruginosa are major competing bacteria in the enrichment conditions. Although it is known to be difficult to isolate Campylobacter from samples with heavy contamination, this study well exhibited that the manipulation of antibiotic selective pressure improves the isolation efficiency of fastidious Campylobacter from wastewater.
A rapid and sensitive method for measuring N-acetylglucosaminidase activity in cultured cells.
Directory of Open Access Journals (Sweden)
Victor Mauri
Full Text Available A rapid and sensitive method to quantitatively assess N-acetylglucosaminidase (NAG activity in cultured cells is highly desirable for both basic research and clinical studies. NAG activity is deficient in cells from patients with Mucopolysaccharidosis type IIIB (MPS IIIB due to mutations in NAGLU, the gene that encodes NAG. Currently available techniques for measuring NAG activity in patient-derived cell lines include chromogenic and fluorogenic assays and provide a biochemical method for the diagnosis of MPS IIIB. However, standard protocols require large amounts of cells, cell disruption by sonication or freeze-thawing, and normalization to the cellular protein content, resulting in an error-prone procedure that is material- and time-consuming and that produces highly variable results. Here we report a new procedure for measuring NAG activity in cultured cells. This procedure is based on the use of the fluorogenic NAG substrate, 4-Methylumbelliferyl-2-acetamido-2-deoxy-alpha-D-glucopyranoside (MUG, in a one-step cell assay that does not require cell disruption or post-assay normalization and that employs a low number of cells in 96-well plate format. We show that the NAG one-step cell assay greatly discriminates between wild-type and MPS IIIB patient-derived fibroblasts, thus providing a rapid method for the detection of deficiencies in NAG activity. We also show that the assay is sensitive to changes in NAG activity due to increases in NAGLU expression achieved by either overexpressing the transcription factor EB (TFEB, a master regulator of lysosomal function, or by inducing TFEB activation chemically. Because of its small format, rapidity, sensitivity and reproducibility, the NAG one-step cell assay is suitable for multiple procedures, including the high-throughput screening of chemical libraries to identify modulators of NAG expression, folding and activity, and the investigation of candidate molecules and constructs for applications in
Terazono, Hideyuki; Kim, Hyonchol; Hayashi, Masahito; Hattori, Akihiro; Nomura, Fumimasa; Kaneko, Tomoyuki; Yasuda, Kenji
2012-01-01
A non-destructive method of collecting cultured cells after identifying their in situ functional characteristics is proposed. In this method, cells are cultivated on an alginate layer in a culture dish and released by spot application of a calcium chelate buffer that locally melts the alginate layer and enables the collection of cultured cells at the single-cell level. Primary hippocampal neurons, beating human embryonic stem (hES) cell-derived cardiomyocytes, and beating hES cell-derived cardiomyocyte clusters cultivated on an alginate layer were successfully released and collected with a micropipette. The collected cells were recultured while maintaining their physiological function, including beating, and elongated neurites. These results suggest that the proposed method may eventually facilitate the transplantation of ES- or iPS-derived cardiomyocytes and neurons differentiated in culture. PMID:22870332
Directory of Open Access Journals (Sweden)
Hideyuki Terazono
Full Text Available A non-destructive method of collecting cultured cells after identifying their in situ functional characteristics is proposed. In this method, cells are cultivated on an alginate layer in a culture dish and released by spot application of a calcium chelate buffer that locally melts the alginate layer and enables the collection of cultured cells at the single-cell level. Primary hippocampal neurons, beating human embryonic stem (hES cell-derived cardiomyocytes, and beating hES cell-derived cardiomyocyte clusters cultivated on an alginate layer were successfully released and collected with a micropipette. The collected cells were recultured while maintaining their physiological function, including beating, and elongated neurites. These results suggest that the proposed method may eventually facilitate the transplantation of ES- or iPS-derived cardiomyocytes and neurons differentiated in culture.
Directory of Open Access Journals (Sweden)
Budi Arifitama
2017-07-01
Full Text Available Research into cultural heritage which implements augmented reality technology is limited. Most recent research on cultural heritage are limited on storing data and information in the form of databases, this creates a disadvantage for people who wants to see and feel at the same moment on actual cultural heritage objects. This paper, proposes a solution which could merge the existing cultural object with people using augmented reality technology. This technology would preserve traditional instrument in the form of 3D object which can be digitally protected. The result showed that the use of augmented reality on preserving cultural heritage would benefit people who try to protect their culture.
Energy Technology Data Exchange (ETDEWEB)
Kohl, R.L.; Quay, W.B.; Perez-Polo, J.R.
1986-01-01
Methods are described for the quantitative measurement of GABA in culture. The method can be adapted to any amino acid or dansyl-chloride-reactive species. The sensitivity and selectivity of the procedure result from the double isotopic design in which (/sup 14/C)-labeled internal standard was added to the samples before reaction with (3M)-labeled dansyl chloride. Values obtained by ion-exchange amino acid analysis of cultures agree closely with the values obtained by the double isotopic method. This method is sensitive enough to measure GABA intracellularly and the condition medium.
DEFF Research Database (Denmark)
Rasmussen, Lauge Baungaard
1996-01-01
The chapter deals with different paradigms andtheories of cultural development. The problem toexplain change and methods to analyse developmentin different cultures are presented and discussed.......The chapter deals with different paradigms andtheories of cultural development. The problem toexplain change and methods to analyse developmentin different cultures are presented and discussed....
Yeast species diversity in apple juice for cider production evidenced by culture-based method.
Lorenzini, Marilinda; Simonato, Barbara; Zapparoli, Giacomo
2018-05-07
Identification of yeasts isolated from apple juices of two cider houses (one located in a plain area and one in an alpine area) was carried out by culture-based method. Wallerstein Laboratory Nutrient Agar was used as medium for isolation and preliminary yeasts identification. A total of 20 species of yeasts belonging to ten different genera were identified using both BLAST algorithm for pairwise sequence comparison and phylogenetic approaches. A wide variety of non-Saccharomyces species was found. Interestingly, Candida railenensis, Candida cylindracea, Hanseniaspora meyeri, Hanseniaspora pseudoguilliermondii, and Metschnikowia sinensis were recovered for the first time in the yeast community of an apple environment. Phylogenetic analysis revealed a better resolution in identifying Metschnikowia and Moesziomyces isolates than comparative analysis using the GenBank or YeastIP gene databases. This study provides important data on yeast microbiota of apple juice and evidenced differences between two geographical cider production areas in terms of species composition.
Directory of Open Access Journals (Sweden)
Gbenga Adedeji Adewumi
2013-01-01
Full Text Available In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the sixteen iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, Staphylococcus saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and Uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA combined with 16S-23S rRNA gene internal transcribed spacer (ITS PCR amplification, restriction analysis (ITS-PCR-RFLP and randomly amplified polymorphic DNA (RAPD-PCR. This further discriminated Bacillus subtilis and its variants from food-borne pathogens such as Bacillus cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP for iru production to achieve product consistency, safety quality and improved shelf life.
Between Contemporary Art and Cultural Analysis: Alternative Methods for Knowledge Production
Directory of Open Access Journals (Sweden)
Billy Ehn
2012-03-01
Full Text Available Artistic research suggests alternative methods for producing various kinds of knowledge, whether within or without the confines of academe. These methods may involve either the production of investigative artworks or the writing by the artist of a doctoral dissertation about his or her own work. For cultural researchers, the methods employed by artists engaged in these processes are both familiar and challenging, as conventional ethnography is mixed with more unpredictable experiments. This article presents several contemporary artworks, including sculpture, film, dance, installation and performance that explore various aspects of reality. What can be learnt from these works? And what could be achieved by an open exchange between artists and academic researchers? Four methodological approaches are highlighted as being of particular interest. The first relates to artists’ tendency to live experimentally, using themselves both as actors and as research objects. The second arises from the very tangible ways in which contemporary artworks approach the theme of materiality. The third relates to the emotional nature of much of contemporary art – even when it is categorised as conceptual – in its creation, forms of presentation, and influence on the spectator. Finally, many artists are gifted with the ability to find and communicate surprising meanings in ordinary life. How do they do this? Part of the answer seems to be that although artists are open to the implementation of “wild whims”, they exploit their spontaneity in a highly professional manner.
Kim, Mee-Hae; Matsubara, Yoshifumi; Fujinaga, Yukako; Kino-Oka, Masahiro
2018-02-01
Clinical and industrial applications of human-induced pluripotent stem cells (hiPSCs) is hindered by the lack of robust culture strategies capable of sustaining a culture in an undifferentiated state. Here, a simple and robust hiPSC-culture-propagation strategy incorporating botulinum hemagglutinin (HA)-mediated selective removal of cells deviating from an undifferentiated state is developed. After HA treatment, cell-cell adhesion is disrupted, and deviated cells detached from the central region of the colony to subsequently form tight monolayer colonies following prolonged incubation. The authors find that the temporal and dose-dependent activity of HA regulated deviated-cell removal and recoverability after disruption of cell-cell adhesion in hiPSC colonies. The effects of HA are confirmed under all culture conditions examined, regardless of hiPSC line and feeder-dependent or -free culture conditions. After routine application of our HA-treatment paradigm for serial passages, hiPSCs maintains expression of pluripotent markers and readily forms embryoid bodies expressing markers for all three germ-cell layers. This method enables highly efficient culturing of hiPSCs and use of entire undifferentiated portions without having to pick deviated cells manually. This simple and readily reproducible culture strategy is a potentially useful tool for improving the robust and scalable maintenance of undifferentiated hiPSC cultures. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Petersen, Line Hedegård; Madsen, Mogens
2000-01-01
The occurrence of Listeria monocytogenes in samples from broiler houses and cloacal swabs taken at the abattoir was investigated. An automated immunobased method (EiaFoss) was used, and 42 samples were also analysed by conventional culture; both methods were based on a two-step selective enrichment....... monocytogenes in enrichment broths may lead to an underestimation of the prevalence of L. monocytogenes. Furthermore, as L. inocua was also detected by the EiaFoss method, a significant amount of bacterial confirmation work had to be done. Of 42 samples analysed by conventional culture, four yielded L. inocua......, of which two were not positive by EiaFoss....
DEFF Research Database (Denmark)
Dirckinck-Holmfeld, Lone; Nielsen, Janni
2007-01-01
The purpose is to describe a project the aim of which is to develop and validate the scientific methodological foundation for design of user friendly and usable, flexible and configurable global Enterprise Resource Planning system for Small and Medium sized Enterprises (SMEs) which are adoptable ...... to cultural diversity and support the collaborative networking tasks embedded in 3gERP. Focus is on Human Centered Design methods and tools which must be developed to handle cultural diversity....
DEFF Research Database (Denmark)
Hoorfar, Jeffrey; Holmvig, C.B.F.
1999-01-01
In two studies, seven different culture protocols were compared to test naturally contaminated faecal samples from pigs for isolation of Y. enterocolitica serotype O; 3/biotype 4( n = 70 and n = 79). Four of the protocols were based on the Nordic Committee on Food Analysis (NMKL protocols), while...... indicate possibilities of shortening the culture methods by replacing most of the biochemical tests with an agglutination test based on a monoclonal antibody....
Directory of Open Access Journals (Sweden)
Shahrokh Bidgani
2016-03-01
Conclusion: The frequency of GBS culture from rectal samples was higher than vaginal samples. However, the detection percentage of GBS using PCR from vaginal samples was higher than rectal samples. By contrast, the culture is a time-consuming method requiring at least 48 hours for GBS fully identification but PCR is a sensitive and rapid technique in detection of GBS, with the result was acquired during 3 hours.
Eyns, Hanneke; De Wachter, Elke; Malfroot, Anne; Vaes, Peter
2018-03-01
Reliable identification of lower respiratory tract pathogens is crucial in the management of cystic fibrosis (CF). The multitude of treatments and clinical procedures are a considerable burden and are potentially provoking pain. As part of another study (NCT02363764), investigating the bacterial yield of three sampling methods, nasal swabs (NSs), cough swabs (CSs), and (induced) sputum samples ([I]SSs), in both expectorating patients (EPs) and non-expectorating patients (NEPs) with CF, the present study aimed to explore the prevalence of respiratory culture sampling-related pain as assessed by self-report within a cohort of children and adults. Literate patients with CF (aged six years or older) completed a questionnaire on pain perception related to the three aforementioned sampling methods (No/Yes; visual analogue scale for pain [VAS-Pain] [0-10 cm]). In addition, patients were asked to rank these methods by their own preference without taking into account the presumed bacterial yield. In total, 119 questionnaires were returned. In the EPs-group, CS was most frequently (n%; mean VAS-Pain if pain [range]) reported as painful method: overall (n = 101; 12.9%; 1.8 [0.2-4.8]), children (n = 41; 22.0%; 1.4 [0.2-2.7]), and adults (n = 60; 6.7%; 2.5 [0.5-4.8]). Highest pain intensity scores were observed with NS overall (3.0%; 2.4 [0.3-6.2]) and in children (4.9%; 3.3 [0.3-6.2]), but not in adults (1.7%; 0.6 [-]).NEPs-children (n = 17) reported ISS most frequently and as most painful sampling method (17.6%; 2.0 [1.0-4.0]). The only NEP-adult did not perceive pain. NEPs preferred NS > CS > ISS (61.1%, 33.3%, 5.6%, respectively [P = 0.001]) as primary sampling method, whereas EPs preferred SS > NS > CS (65.7%, 26.3%, 8.1%, respectively [P method inversely correlated to pain perception and intensity in EPs (φ = -0.155 [P = 0.007] and ρ = -0.926 [P = 0.008], respectively), but not in NEPs (φ = -0.226 [P = 0.097] and ρ = -0.135 [P = 0
Morren, M.H.; Gelissen, J.P.T.M.; Vermunt, J.K.
2013-01-01
This article presents a mixed methods approach that integrates quantitative and qualitative methods to analyze why the four largest minorities in the Netherlands-Turks, Moroccans, Antilleans, and Surinamese-respond differently to items treating cultural topics. First, we conducted latent class
Directory of Open Access Journals (Sweden)
Elhamnia, F.
2010-07-01
Full Text Available Mycoplasma synoviae (MS is an important avian pathogen that can cause both respiratory disease and joint inflammation synovitis in poultry, inducing economic losses to the Iranian chicken industry especially breeder farms. The aim of this study was to use the MS specific PCR and culture methods in order to detect of M. synoviae from breeder farms where located in Tehran province. A total of 475 samples including choanal cleft, trachea, ovary and /or joint cavities from 23 broiler breeder farms of Tehran area were collected. Samples were cultured in PPLO broth media supplemented for MS isolation. The bacteria DNAs were extracted by phenol/chloroform method. Specific published primers amplify a 207 bp region of the 16S rRNA gene of MS were used for PCR method. Out of 475 samples, 146 cultures were shown positive and typical Mycoplasma colonies, 85 samples were also identified MS based on agglutination test with specific MS antiserum and the PCR method. A total of 122 samples, a band with 207 bp was shown as MS specific PCR product in electrophoresis. In addition to these 85 samples that were positives in both culture and PCR, 37 samples that had not grown in Mycoplasma media were positive in MS specific PCR. A total of 292 samples were negatives in both culture and PCR methods. 122 positive samples out of 475 samples (25.7% were belonged to 7 breeder farms (30.4%. On conclusions, the MS infection of broiler breeder farms of Tehran area was confirmed truly. From the results, as the PCR method reduces the time consuming, an effectiveness and efficient for detection of M. synoviae infection of chicken breeder. It is then suggested that the PCR method could be an alternative method for culturing.
Directory of Open Access Journals (Sweden)
Chanaweerawan, S.
2004-01-01
Full Text Available To rehabilitate the fruit orchards exposed to flooding crisis that occurred in year 2000 in Songkhla province, an investigation of the effects of cultural practice methods was done in the farmers’ orchards at 2 experimental sites (at Tumbol Kho Hong and Tumbol Kuan Lang, Amphur Hat Yai. The first site, at Tumbol Kho Hong, was mixed cropping (durian, longkong and mangosteen. The second site, at Tumbol Kuan Lang, was a monocrop of pummelo orchard. The experiment was comprised a stratified sampling method with 3 treatments: 1 control, 2 fertilization (15-15-15, 8-24-24 and 13-13-21 and soil improvement with humic acid (S and 3 foliar application (glucose was applied with 16-12-0+micronutrients+extracted seaweed and 7-13-34+12.5Zn+extracted seaweed+Ca-B spraying with fertilization and soil improvement (F+S. The results from the both experimental sites showed that the F+S treatment exhibited the best result. This promoted the plant growth and yield of fruit trees. In addition, the other orchards surrounding the experimental sites were surveyed. It was noticeable that fruit trees grown in raising-beds could recover and exhibit normal fruit bearing. This pointed out that the impact of flooding on fruit orchards would be possibly alleviated by a drainage system.
Yonetani, Shota; Ohnishi, Hiroaki; Ohkusu, Kiyofumi; Matsumoto, Tetsuya; Watanabe, Takashi
2016-11-01
Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is a fast and reliable method for the identification of bacteria. A MALDI Sepsityper kit is generally used to prepare samples obtained directly from culture bottles. However, the relatively high cost of this kit is a major obstacle to introducing this method into routine clinical use. In this study, the accuracies of three different preparation methods for rapid direct identification of bacteria from positive blood culture bottles by MALDI-TOF MS analysis were compared. In total, 195 positive bottles were included in this study. Overall, 78.5%, 68.7%, and 76.4% of bacteria were correctly identified to the genus level (score ≥1.7) directly from positive blood cultures using the Sepsityper, centrifugation, and saponin methods, respectively. The identification rates using the Sepsityper and saponin methods were significantly higher than that using the centrifugation method (Sepsityper vs. centrifugation, pdirectly from blood culture bottles, and could be a less expensive alternative to the Sepsityper method. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Stefani, Franck O. P.; Bell, Terrence H.; Marchand, Charlotte; de la Providencia, Ivan E.; El Yassimi, Abdel; St-Arnaud, Marc; Hijri, Mohamed
2015-01-01
Bioremediation is a cost-effective and sustainable approach for treating polluted soils, but our ability to improve on current bioremediation strategies depends on our ability to isolate microorganisms from these soils. Although culturing is widely used in bioremediation research and applications, it is unknown whether the composition of cultured isolates closely mirrors the indigenous microbial community from contaminated soils. To assess this, we paired culture-independent (454-pyrosequenci...
Hautefeuille, Mathieu; Vázquez-Victorio, Genaro; Cruz-Ramírez, Aaron; Cabriales, Lucia; Jiménez-Diaz, Edgar; Escutia-Guadarrama, Lidia; López-Aparicio, Jehú; Pérez-Calixto, Daniel; Cano-Jorge, Mariel; Nieto-Rivera, Brenda; Sánchez-Olvera, Raúl
2018-02-01
The development of organ-on-chip and biological scaffolds is currently requiring simpler methods to microstructure biocompatible materials in three dimensions, fabricate structural and functional elements in biomaterials or modify the physicochemical properties of desired substrates. With the aim of creating simple, cost-effective alternatives to conventional existing techniques to produce such platforms with very specific properties, a low-power CD-DVD laser pickup head was recycled and mounted on a programmable three-axis micro-displacement system in order to modify the surface of polymeric materials in a local fashion. Thanks to a specially-designed method using a strongly absorbing additive coating the materials of interest, it has been possible to establish and precisely control processes useful in microtechnology for biomedical applications and normally restricted to much less affordable high-power lasers. In this work, we present our latest progress regarding the application of our fabrication technique to the development of organ-on-chip platforms thanks to the simple integration of several biomimetic characteristics typically achieved with traditional, less cost-effective microtechnology methods in one step or through replica-molding. Our straightforward approach indeed enables great control of local laser microablation for true on-demand biomimetic micropatterned designs in several transparent polymers and hydrogels of tunable stiffness and is allowing integration of microfluidics, microelectronics, optical waveguides, surface microstructuring and even transfer of superficial protein micropatterns on a variety of biocompatible materials. The results presented here were validated using hepatic and fibroblasts cell lines to demonstrate the viability of our procedure for organ-on-chip development and show the impact of such features in cell culture.
Lyall, Catherine; King, Emma
2016-05-11
Qualitative research has a key role to play in biomedical innovation projects. This article focuses on the appropriate use of robust social science methodologies (primarily focus group studies) for identifying the public's willingness and preference for emerging medical technologies. Our study was part of the BloodPharma project (now known as the Novosang project) to deliver industrially generated red blood cells for transfusion. Previous work on blood substitutes shows that the public prefers donated human blood. However, no research has been conducted concerning attitudes to stem cell derived red blood cells. Qualitative research methods including interviews and focus groups provide the methodological context for this paper. Focus groups were used to elicit views from sub-sections of the UK population about the potential use of such cultured red blood cells. We reflect on the appropriateness of that methodology in the context of the BloodPharma project. Findings are in the form of lessons transferable to other interdisciplinary, science-led teams about what a social science dimension can bring; why qualitative research should be included; and how it can be used effectively. Qualitative data collection offers the strength of exploring ambivalence and investigating the reasons for views, but not necessarily their prevalence in wider society. The inherent value of a qualitative method, such as focus groups, therefore lies in its ability to uncover new information. This contrasts with a quantitative approach to simply 'measuring' public opinion on a topic about which participants may have little prior knowledge. We discuss a number of challenges including: appropriate roles for embedded social scientists and the intricacies of doing upstream engagement as well as some of the design issues and limitations associated with the focus group method.
Pigna, Gaia; Dhillon, Taniya; Dlugosz, Elizabeth M; Yuan, Joshua S; Gorman, Connor; Morandini, Piero; Lenaghan, Scott C; Stewart, C Neal
2016-12-01
Arundo donax L. is a promising biofuel feedstock in the Mediterranean region. Despite considerable interest in its genetic improvement, Arundo tissue culture and transformation remains arduous. The authors developed methodologies for cell- and tissue culture and genetic engineering in Arundo. A media screen was conducted, and a suspension culture was established using callus induced from stem axillary bud explants. DBAP medium, containing 9 µM 2,4-D and 4.4 µM BAP, was found to be the most effective medium among those tested for inducing cell suspension cultures, which resulted in a five-fold increase in tissue mass over 14 days. In contrast, CIM medium containing 13 µM 2,4-D, resulted in just a 1.4-fold increase in mass over the same period. Optimized suspension cultures were superior to previously-described solidified medium-based callus culture methods for tissue mass increase. Suspension cultures proved to be very effective for subsequent protoplast isolation. Protoplast electroporation resulted in a 3.3 ± 1.5% transformation efficiency. A dual fluorescent reporter gene vector enabled the direct comparison of the CAMV 35S promoter with the switchgrass ubi2 promoter in single cells of Arundo. The switchgrass ubi2 promoter resulted in noticeably higher reporter gene expression compared with that conferred by the 35S promoter in Arundo. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Gannotti, Mary E; Handwerker, W Penn
2002-12-01
Validating the cultural context of health is important for obtaining accurate and useful information from standardized measures of child health adapted for cross-cultural applications. This paper describes the application of ethnographic triangulation for cultural validation of a measure of childhood disability, the Pediatric Evaluation of Disability Inventory (PEDI) for use with children living in Puerto Rico. The key concepts include macro-level forces such as geography, demography, and economics, specific activities children performed and their key social interactions, beliefs, attitudes, emotions, and patterns of behavior surrounding independence in children and childhood disability, as well as the definition of childhood disability. Methods utilize principal components analysis to establish the validity of cultural concepts and multiple regression analysis to identify intracultural variation. Findings suggest culturally specific modifications to the PEDI, provide contextual information for informed interpretation of test scores, and point to the need to re-standardize normative values for use with Puerto Rican children. Without this type of information, Puerto Rican children may appear more disabled than expected for their level of impairment or not to be making improvements in functional status. The methods also allow for cultural boundaries to be quantitatively established, rather than presupposed. Copyright 2002 Elsevier Science Ltd.
Directory of Open Access Journals (Sweden)
N S Ozen
2011-01-01
Full Text Available Purpose: Differentiation of Staphylococcus aureus (S. aureus from coagulase-negative staphylococci is very important in blood stream infections. Identification of S. aureus and coagulase-negative staphylococci (CoNS from blood cultures takes generally 18-24 h after positive signaling on continuously monitored automated blood culture system. In this study, we evaluated the performance of tube coagulase test (TCT, slide agglutination test (Dry Spot Staphytect Plus, conventional polymerase chain reaction (PCR and LightCycler Staphylococcus MGrade kit directly from blood culture bottles to achieve rapid identification of S. aureus by using the BACTEC 9240 blood culture system. Materials and Methods: A total of 129 BACTEC 9240 bottles growing gram-positive cocci suggesting Staphylococci were tested directly from blood culture broths (BCBs with TCT, Dry Spot Staphytect Plus, conventional PCR and LightCycler Staphylococcus MGrade kit for rapid identification of S. aureus. Results: The sensitivities of the tests were 99, 68, 99 and 100%, respectively. Conclusion: Our results suggested that 2 h TCT was found to be simple and inexpensive method for the rapid identification of S. aureus directly from positive blood cultures.
Whitcombe, Anne; Cooper, Kay; Palmer, Emma
2016-06-01
The objective of this mixed methods systematic review is to examine the relationship between organizational culture and the health and wellbeing of hospital nurses, and to develop an aggregated synthesis of quantitative and qualitative systematic reviews to derive recommendations for policy and practice.Organizational culture comprises factors such as leadership, management and support, a health and safety oriented workplace climate and job characteristics.The quantitative component of this review will explore the relationship between organizational culture and the following outcomes in hospital nurses which may be indicators of health and wellbeing: work-related injury such as needlestick or sharp injuries, musculoskeletal injuries and conditions such as low back pain, burnout and general wellbeing.The qualitative component of this review will explore the perceptions of hospital nurses in relation to the impact of organizational culture on their own health and wellbeing and those of their nursing colleagues.
Directory of Open Access Journals (Sweden)
Zhou Liqing
2010-04-01
Full Text Available Abstract Background Salmonella Typhi causes an estimated 21 million new cases of typhoid fever and 216,000 deaths every year. Blood culture is currently the gold standard for diagnosis of typhoid fever, but it is time-consuming and takes several days for isolation and identification of causative organisms. It is then too late to initiate proper antibiotic therapy. Serological tests have very low sensitivity and specificity, and no practical value in endemic areas. As early diagnosis of the disease and prompt treatment are essential for optimal management, especially in children, a rapid sensitive detection method for typhoid fever is urgently needed. Although PCR is sensitive and rapid, initial research indicated similar sensitivity to blood culture and lower specificity. We developed a fast and highly sensitive blood culture PCR method for detection of Salmonella Typhi, allowing same-day initiation of treatment after accurate diagnosis of typhoid. Methods An ox bile tryptone soy broth was optimized for blood culture, which allows the complete lysis of blood cells to release intracellular bacteria without inhibiting the growth of Salmonella Typhi. Using the optimised broth Salmonella Typhi bacteria in artificial blood samples were enriched in blood culture and then detected by a PCR targeting the fliC-d gene of Salmonella Typhi. Results Tests demonstrated that 2.4% ox bile in blood culture not only lyzes blood cells completely within 1.5 hours so that the intracellular bacteria could be released, but also has no inhibiting effect on the growth of Salmonella Typhi. Three hour enrichment of Salmonella Typhi in tryptone soya broth containing 2.4% ox bile could increase the bacterial number from 0.75 CFU per millilitre of blood which is similar to clinical typhoid samples to the level which regular PCR can detect. The whole blood culture PCR assay takes less than 8 hours to complete rather than several days for conventional blood culture
Directory of Open Access Journals (Sweden)
G. S. Abdellrazeq
2014-08-01
Full Text Available Background: Johne's disease (JD caused by Mycobacterium avium subsp. paratuberculosis (MAP represents a real threat to the agriculture and dairy food industries and believed to be a potential public health problem. Signs of infection in ruminant include weight loss, diarrhea, decreased milk production, and eventually death. The definition of an infected animal based either on the presence of anti-MAP antibodies, or positive bacterial culture. No treatment for the disease exists and controlling the disease is difficult due to its long latent period. JD is a worldwide problem and multiple studies in many countries have been carried out to determine the prevalence of MAP infections. Although some primary non intensive studies confirm presence of JD in Egypt, the disease is currently neglected by the official Egyptian veterinary agencies. There is no official data, no national control program, and no used vaccine. Aim: This study aimed to evaluate three conventional diagnostic methods for MAP under the Egyptian circumstances with a general aim to determine the appropriate strategy to develop a JD control program. These methods were pooled fecal culture, humoral response and insertion sequence IS900 targets polymerase chain reaction (IS900 PCR. Materials and Methods: Fecal and serum samples (500 each were collected from Holstein-Friesian cattle and buffaloes housed in five Egyptian governorates. Fecal samples were examined for MAP on the basis of a strategic pooling procedure and performed on Herrold's Egg Yolk Agar Medium (HEYM. Smears were prepared from developed colonies and stained using a Ziehl-Neelsen (ZN technique. The identity of developed colonies was further confirmed by PCR analysis of IS900 sequence. Sera from both culture-positive and culture-negative animals were evaluated individually for humoral response. Results: Out of 50 pooled specimens, 34 (68% fecal cultures were positive for MAP. Serum positive samples of culture
Cultural responses to pain in UK children of primary school age: a mixed-methods study.
Azize, Pary M; Endacott, Ruth; Cattani, Allegra; Humphreys, Ann
2014-06-01
Pain-measurement tools are often criticized for not addressing the influence of culture and ethnicity on pain. This study examined how children who speak English as a primary or additional language discuss pain. Two methods were used in six focus group interviews with 34 children aged 4-7 years: (i) use of drawings from the Pediatric Pain Inventory to capture the language used by children to describe pain; and (ii) observation of the children's placing of pain drawings on red/amber/green paper to denote perceived severity of pain. The findings demonstrated that children with English as an additional language used less elaborate language when talking about pain, but tended to talk about the pictures prior to deciding where they should be placed. For these children, there was a positive significant relationship between language, age, and length of stay in the UK. The children's placement of pain drawings varied according to language background, sex, and age. The findings emphasize the need for sufficient time to assess pain adequately in children who do not speak English as a first language. © 2013 Wiley Publishing Asia Pty Ltd.
Though This be Madness: Heritage Methods for Working in Culturally Diverse Communities
Directory of Open Access Journals (Sweden)
John Petersen
2010-12-01
Full Text Available In 1998, the NSW Migration Heritage Centre was conceived by the NSW Government as a virtual heritage centre to help ageing former migrants tell their stories. Migration museums and other organisations interested in heritage are grappling with how to identify, record, preserve and interpret the heritage legacy of migration and settlement in their communities. The distinctions between museum and environmental heritage practices have diminished during the past decade in Australia. The Centre’s methodologies are based on historic method and thematic and typology studies, better known for their application to heritage place identification and archaeological artefact studies than for their more recent use by some Australian museum curators for the survey and documentation of collections and community participation in heritage. The ‘virtual museum’ has enabled the Centre to break away from the centralised museum concept, with the associated trappings of venue management, to pioneer a decentralised and dispersed museum model that works almost entirely in collaborative community history research partnerships to document culturally significant collections, and associated migration memories, held by communities and private individuals. The work is centralised on the Centre’s website as a virtual collection of objects, places and associated memories. They are presented in online exhibitions for student research and as a destination for the mass audiences of the worldwide web.
A method for quantitative measurement of safety culture based on ISO 26262
Khabbaz Saberi, A.; Benders, F.; Koch, R.; Lukkien, J.J.; van den Brand, M.G.J.; Parsons, M.; Kelly, T.
2018-01-01
Safety culture is the collective attitude of members of an organization regarding safety issues: awareness, communication, knowledge, etc. In the automotive industry, specifically in its Research and Development (R&D) environments, safety culture is relatively new. Recent incidents related to
Modularized substrate culture:a new method for green leafy vegetable planting
Directory of Open Access Journals (Sweden)
WANG Quanxi
2015-10-01
Full Text Available On the basis of analyzing general situation of green leafy vegetable production and main difficulty,we introduce the characteristics of modularized substrate culture for green leafy vegetable,and point out the important issues of modularized substrate culture which urgently need be solved in the coming future.
The repertory grid technique as method for the study of cultural differences
Tomico Plasencia, O.; Karapanos, E.; Levy, P.D.; Mizutani, N.; Yamanaka, T.
2009-01-01
Culture is typically approached in the field of design through generic, cross-domain constructs. In this paper we provide an alternative methodological approach to exploring cross-cultural differences by studying the idiosyncratic views of individuals with regard to existing products. We
Cultural cognition in the thinking-aloud method for usability evaluation
DEFF Research Database (Denmark)
Clemmensen, Torkil; Hertzum, Morten; Hornbæk, Kasper
2008-01-01
) and Easterners (people from China and the countries heavily influenced by its culture). We illustrate the impact of cultural cognition on four central elements of TA: (1) instructions and tasks, (2) the user's verbalizations, (3) the evaluator's reading of the user, and (4) the overall relationship between user...
Is Acculturation a Dynamic Construct?: The Influence of Method of Priming Culture on Acculturation
Lechuga, Julia
2008-01-01
Recent evidence suggests that culture is a dynamic construct activated in response to cues encountered in a given situation. Research on acculturation indicates that this is a complex construct that might be domain specific. Two studies were undertaken to investigate the effect of two ways of priming culture on acculturation and enculturation…
Research on Basis and Method of Fujian-Taiwan Cultural Creative Industry Connection
Directory of Open Access Journals (Sweden)
Li Hao
2016-01-01
Full Text Available deepening Fujian-Taiwan cultural creative industry connection cooperation is of great importance to close Fujian-Taiwan relationship, forge new economic growth points, optimize and adjust industrial structure. In this paper, the opportunities, potential, basis and conditions for Fujian-Taiwan cultural creative industry connection cooperation are analyzed, and countermeasures and suggestions to deepen the connection cooperation are proposed.
Diagnosis of Neisseria gonorrhoeae among pregnant women by culture method and PCR on cppB gene
Directory of Open Access Journals (Sweden)
Jalal Mardaneh
2013-11-01
Full Text Available Background: Neisseria gonorrhoeae is a human obligate pathogen and the etiological agent of gonorrhea. Health irreparable complications resulting from gonorrhea disease occur mainly in pregnant women and neonates. Aim of this study was diagnosis of Neisseria gonorrhoeae among pregnant women with using culture and molecular method by amplification of cppB gene with PCR. Material and Methods: In this cross-sectional study, two endocervical swab specimens were obtained from 1100 pregnant women who referred to Shiraz Hospitals. Culture on nonselective and selective media and nucleic acid amplification test (NAAT were performed for detection of Neisseria gonorrhoeae cppB gene. Results: All endocervical swabs cultures on selective and nonselective media were negative for Neisseria gonorrhoeae. Among examined endocervical swabs, 13samples (1.18% were positive by nucleic acid amplification of Neisseria gonorrgoeae cppB gene. Conclusion: Negative results of culture and positive results of PCR in this study indicate that however culture is gold standard method for detection of Neisseria gonorrhoeae but due to bacterial autolysis, poor sampling techniques and improper specimen storage and transport, its value decline as compared with Nucleic acid amplification test (NAAT.
A METHOD OF INCREASING THE NUMBER OF TOURISTS IN ROMANIA: SIBIU – EUROPEAN CAPITAL OF CULTURE
Directory of Open Access Journals (Sweden)
Gabriela Cecilia STĂNCIULESCU
2016-06-01
Full Text Available The title of European Capital of Culture could help immensely a city and its surrounding region from cultural, social and economic pointd of view. Cultural activity in the city is gaining momentum and new categories of tourists are attracted here. To determine if being a cultural capital influenced or not the growth and/or decrease trend as regards the number of tourists that came to Sibiu in a consecutive period of 23 years, the starting point was that this event had a major impact on tourists. The present paper is a quantitative research based on the number of Romanian and foreign tourists accommodated in structures of tourist receptions with functions of tourist accommodation. The conclusions of this article respond to these questions: Being a European Capital of Culture attracts or not more tourists than usual? The increase in the number of tourists was proportional with the effort of the authorities involved in the project?
Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz
2018-02-01
Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug screening and many other aspects of virus research under more in vivo-like conditions. In consequence, it may contribute to a more targeted realization of necessary in vivo experiments. Copyright © 2017 Elsevier B.V. All rights reserved.
Ditommaso, Savina; Giacomuzzi, Monica; Ricciardi, Elisa; Zotti, Carla M
2016-02-06
Legionella spp. are ubiquitous in aquatic habitats and water distribution systems, including dental unit waterlines (DUWLs). The aim of the present study was to determine the prevalence of Legionella in DUWLs and tap water samples using PMA-qPCR and standard culture methods. The total viable counts (TVCs) of aerobic heterotrophic bacteria in the samples were also determined. Legionella spp. were detected and quantified using the modified ISO 11731 culture method. Extracted genomic DNA was analysed using the iQ-Check Quanti Legionella spp. kit, and the TVCs were determined according to the ISO protocol 6222. Legionella spp. were detected in 100% of the samples using the PMA-qPCR method, whereas these bacteria were detected in only 7% of the samples using the culture method. The number of colony forming units (CFUs) of the TVCs in the DUWL and tap water samples differed, with the bacterial load being significantly lower in the tap water samples (p-value = 0). The counts obtained were within the Italian standard range established for potable water in only 5% of the DUWL water samples and in 77% of the tap water samples. Our results show that the level of Legionella spp. contamination determined using the culture method does not reflect the true scale of the problem, and consequently we recommend testing for the presence of aerobic heterotrophic bacteria based on the assumption that Legionella spp. are components of biofilms.
Theory and method at the intersection of anthropology and cultural neuroscience
Brown, Ryan A.
2010-01-01
Anthropologists have become increasingly interested in embodiment—that is, the ways that socio-cultural factors influence the form, behavior and subjective experience of human bodies. At the same time, social cognitive neuroscience has begun to reveal the mechanisms of embodiment by investigating the neural underpinnings and consequences of social experience. Despite this overlap, the two fields have barely engaged one another. We suggest three interconnected domains of inquiry in which the intersection of neuroscience and anthropology can productively inform our understanding of the relationship between human brains and their socio-cultural contexts. These are: the social construction of emotion, cultural psychiatry, and the embodiment of ritual. We build on both current research findings in cultural neuroscience and ethnographic data on cultural differences in thought and behavior, to generate novel, ecologically informed hypotheses for future study. In addition, we lay out a specific suggestion for operationalizing insights from anthropology in the context of cultural neuroscience research. Specifically, we advocate the development of field studies that use portable measurement technologies to connect individual patterns of biological response with socio-cultural processes. We illustrate the potential of such an approach with data from a study of psychophysiology and religious devotion in Northeastern Brazil. PMID:19965815
Kubota, Kenta; Seno, Takeshi; Konishi, Yoshiyuki
2013-11-20
Cerebellar granule neuronal cultures have been used to study the molecular mechanisms underlying neuronal functions, including neuronal morphogenesis. However, a limitation of this system is the difficulty to analyze isolated neurons because these are required to be maintained at a high density. Therefore, in the present study, we aimed to develop a simple and cost-effective method for culturing low-density cerebellar granule neurons. Cerebellar granule cells at two different densities (low- and high-density) were co-cultivated in order for the low-density culture to be supported by the paracrine signals from the high-density culture. This method enabled morphology analysis of isolated cerebellar granule neurons without astrocytic feeder cultures or supplements such as B27. Using this method, we investigated the function of a polarity factor. Studies using hippocampal neurons suggested that glycogen synthase kinase-3 (GSK-3) is an essential regulator of neuronal polarity, and inhibition of GSK-3 results in the formation of multiple axons. Pharmacological inhibitors for GSK-3 (6-bromoindirubin-3'-oxime and lithium chloride) did not cause the formation of multiple axons of cerebellar granule neurons but significantly reduced their length. Consistent results were obtained by introducing kinase-dead form of GSK-3 beta (K85A). These results indicated that GSK-3 is not directly involved in the control of neuronal polarity in cerebellar granule neurons. Overall, this study provides a simple method for culturing low-density cerebellar granule neurons and insights in to the neuronal-type dependent function of GSK-3 in neuronal morphogenesis. © 2013 Elsevier B.V. All rights reserved.
Shri, Meena; Agrawal, Himanshu; Rani, Payal; Singh, Dheer; Onteru, Suneel Kumar
2017-04-26
Livestock, having close resemblance to humans, could be a better source of primary hepatocytes than rodents. Herein, we successfully developed three-dimensional (3D) culturing system for primary sheep and buffalo hepatocytes. The 3D-structures of sheep hepatocytes were formed on the fifth-day and maintained until the tenth-day on polyHEMA-coated plates and in hanging drops with William's E media (HDW). Between the cultured and fresh cells, we observed a similar expression of GAPDH, HNF4α, ALB, CYP1A1, CK8 and CK18. Interestingly, a statistically significant increase was noted in the TAT, CPS, AFP, AAT, GSP and PCNA expression. In buffalo hepatocytes culture, 3D-like structures were formed on the third-day and maintained until the sixth-day on polyHEMA and HDW. The expression of HNF4α, GSP, CPS, AFP, AAT, PCNA and CK18 was similar between cultured and fresh cells. Further, a statistically significant increase in the TAT and CK8 expression, and a decrease in the GAPDH, CYP1A1 and ALB expression were noted. Among the culture systems, HDW maintained the liver transcript markers more or less similar to the fresh hepatocytes of the sheep and buffalo for ten and six days, respectively. Taken together, hanging drop is an efficient method for 3D culturing of primary sheep and buffalo hepatocytes.
Ozen, N S; Ogunc, D; Mutlu, D; Ongut, G; Baysan, B O; Gunseren, F
2011-01-01
Differentiation of Staphylococcus aureus (S. aureus) from coagulase-negative staphylococci is very important in blood stream infections. Identification of S. aureus and coagulase-negative staphylococci (CoNS) from blood cultures takes generally 18-24 h after positive signaling on continuously monitored automated blood culture system. In this study, we evaluated the performance of tube coagulase test (TCT), slide agglutination test (Dry Spot Staphytect Plus), conventional polymerase chain reaction (PCR) and LightCycler Staphylococcus MGrade kit directly from blood culture bottles to achieve rapid identification of S. aureus by using the BACTEC 9240 blood culture system. A total of 129 BACTEC 9240 bottles growing gram-positive cocci suggesting Staphylococci were tested directly from blood culture broths (BCBs) with TCT, Dry Spot Staphytect Plus, conventional PCR and LightCycler Staphylococcus MGrade kit for rapid identification of S. aureus. The sensitivities of the tests were 99, 68, 99 and 100%, respectively. Our results suggested that 2 h TCT was found to be simple and inexpensive method for the rapid identification of S. aureus directly from positive blood cultures.
A COMPARISON OF TEACHING METHODS BUILDING CULTURAL COMPETENCY INFORMED BY CONTACT THEORY.
Stough-Hunter, Anjel; Guinan, Jill; Hart, Julie P
2016-01-01
This study examines students' levels of cultural competency before and after taking three different semester-long courses dealing with diversity and cultural competence with each course representing a different teaching methodology. A new 20-item survey, designed for students across disciplines, was used to measure cultural competency among 226 students from the fall of2012 to the spring of2 015. Differences were examined between scores before and after taking each class, as well as differences between classes. There were significant improvements in all three groups, and a significant difference between two of the three classes in the improvement of scores.
Pitkäranta, Miia; Meklin, Teija; Hyvärinen, Anne; Nevalainen, Aino; Paulin, Lars; Auvinen, Petri; Lignell, Ulla; Rintala, Helena
2011-10-21
Indoor microbial contamination due to excess moisture is an important contributor to human illness in both residential and occupational settings. However, the census of microorganisms in the indoor environment is limited by the use of selective, culture-based detection techniques. By using clone library sequencing of full-length internal transcribed spacer region combined with quantitative polymerase chain reaction (qPCR) for 69 fungal species or assay groups and cultivation, we have been able to generate a more comprehensive description of the total indoor mycoflora. Using this suite of methods, we assessed the impact of moisture damage on the fungal community composition of settled dust and building material samples (n = 8 and 16, correspondingly). Water-damaged buildings (n = 2) were examined pre- and post- remediation, and compared with undamaged reference buildings (n = 2). Culture-dependent and independent methods were consistent in the dominant fungal taxa in dust, but sequencing revealed a five to ten times higher diversity at the genus level than culture or qPCR. Previously unknown, verified fungal phylotypes were detected in dust, accounting for 12% of all diversity. Fungal diversity, especially within classes Dothideomycetes and Agaricomycetes tended to be higher in the water damaged buildings. Fungal phylotypes detected in building materials were present in dust samples, but their proportion of total fungi was similar for damaged and reference buildings. The quantitative correlation between clone library phylotype frequencies and qPCR counts was moderate (r = 0.59, p environments. However, making conclusions concerning the effect of building conditions on building mycobiota using this methodology was complicated by the wide natural diversity in the dust samples, the incomplete knowledge of material-associated fungi fungi and the semiquantitative nature of sequencing based methods.
Rafferty, Anne Marie; Philippou, Julia; Fitzpatrick, Joanne M; Pike, Geoff; Ball, Jane
2017-08-18
Concerns about care quality have prompted calls to create workplace cultures conducive to high-quality, safe and compassionate care and to provide a supportive environment in which staff can operate effectively. How healthcare organisations assess their culture of care is an important first step in creating such cultures. This article reports on the development and validation of a tool, the Culture of Care Barometer, designed to assess perceptions of a caring culture among healthcare workers preliminary to culture change. An exploratory mixed methods study designed to develop and test the validity of a tool to measure 'culture of care' through focus groups and questionnaires. Questionnaire development was facilitated through: a literature review, experts generating items of interest and focus group discussions with healthcare staff across specialities, roles and seniority within three types of public healthcare organisations in the UK. The tool was designed to be multiprofessional and pilot tested with a sample of 467 nurses and healthcare support workers in acute care and then validated with a sample of 1698 staff working across acute, mental health and community services in England. Exploratory factor analysis was used to identify dimensions underlying the Barometer. Psychometric testing resulted in the development of a 30-item questionnaire linked to four domains with retained items loading to four factors: organisational values (α=0.93, valid n=1568, M=3.7), team support (α=0.93, valid n=1557, M=3.2), relationships with colleagues (α=0.84, valid n=1617, M=4.0) and job constraints (α=0.70, valid n=1616, M=3.3). The study developed a valid and reliable instrument with which to gauge the different attributes of care culture perceived by healthcare staff with potential for organisational benchmarking. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless
Siaki, Leilani A; Loescher, Lois J; Trego, Lori L
2013-03-01
This article presents a discussion of development of a mid-range theory of risk perception. Unhealthy behaviours contribute to the development of health inequalities worldwide. The link between perceived risk and successful health behaviour change is inconclusive, particularly in vulnerable populations. This may be attributed to inattention to culture. The synthesis strategy of theory building guided the process using three methods: (1) a systematic review of literature published between 2000-2011 targeting perceived risk in vulnerable populations; (2) qualitative and (3) quantitative data from a study of Samoan Pacific Islanders at high risk of cardiovascular disease and diabetes. Main concepts of this theory include risk attention, appraisal processes, cognition, and affect. Overarching these concepts is health-world view: cultural ways of knowing, beliefs, values, images, and ideas. This theory proposes the following: (1) risk attention varies based on knowledge of the health risk in the context of health-world views; (2) risk appraisals are influenced by affect, health-world views, cultural customs, and protocols that intersect with the health risk; (3) strength of cultural beliefs, values, and images (cultural identity) mediate risk attention and risk appraisal influencing the likelihood that persons will engage in health-promoting behaviours that may contradict cultural customs/protocols. Interventions guided by a culturally sensitive mid-range theory may improve behaviour-related health inequalities in vulnerable populations. The synthesis strategy is an intensive process for developing a culturally sensitive mid-range theory. Testing of the theory will ascertain its usefulness for reducing health inequalities in vulnerable groups. © 2012 Blackwell Publishing Ltd.
Adams, Stephen S.; Scott, Syrona; Ko, Ching-Whan
2015-05-19
The present invention relates to methods for sustaining microorganism culture in a syngas fermentation reactor in decreased concentration or absence of various substrates comprising: adding carbon dioxide and optionally alcohol; maintaining free acetic acid concentrations; and performing the above mentioned steps within specified time.
Directory of Open Access Journals (Sweden)
N. N. Ulasiuk
2006-01-01
Full Text Available The executed researches of studying historical manors of Belarus, the analysis of domestic and foreign experience of restoration and modem use of manors have allowed to formulate purposes, principles, conceptual approaches and methods of restoration and adaptation of historical manors for cultural and tourist use.
Murphy, Joel P.; Murphy, Shirley A.
2016-01-01
A convergent mixed methods research design addressed the extent of benefit obtained from reading culturally inclusive prompts (i.e., four brief essays written by Latino authors) to improve essay writing in a developmental (pre-college) English course. Participants were 45 Latino students who provided quantitative data. Chi square analysis showed…
Cao, Yanru; Jiang, Yi; Li, Youlong; Chen, Xiu; Jin, Rongxian; He, Wenxiang
2012-07-04
We studied the isolation methods and diversity of culturable fecal actinobacteria associated with Panthera tigris tigris by using culture-dependent approaches. Fresh fecal samples of healthy Panthera tigris tigris were collected from Yunnan Safari Park. Pretreatment of the samples, isolation media and inhibitors were tested for actinobacteria isolation. 16S rRNA genes of actinobacteria were sequenced and subjected to phylogenetic analysis. The abundance of culturable actinobacteria was 1.10 x 10(8) cfu/g colony forming units (CFU) per gram of feces (wet weight). We obtained 110 purified cultural actinobacterium strains. The analysis based on 16S rRNA gene sequences showed that these strains were distributed in 10 different families and 12 genera of actinobacteria at least, and most of them were non-filamentous, such as Arthrobacter, Dietzia, Kocuria, Corynebacterium and Microbacterium. Streptomyces was the mainly classical filamentous actinobacteria, and up to 64% of total. Drying and heating up the fecal samples can greatly increase the rate of the actinobacteria. Many kinds of inhibitors and chemical defined media are suitable for isolation of fecal actinobacteria. The culturable actinobacteria are abundant in Panthera tigris tigris feces. Our study found an effective method to isolate animals' fecal actinobacteria and it's useful for studying and exploiting animals' fecal actinobacteria.
Integrating cultural control methods for tomato late blight (Phytophthora infestans) in Uganda
Tumwine, J.; Frinking, H.D.; Jeger, M.J.
2002-01-01
Cultural control measures against tomato late blight (Phytophthora infestans) were evaluated in six field experiments over 3 years in Uganda. Each experiment included sanitation (removal of diseased plant tissues), fungicide (mancozeb) application, and an untreated control, as standard treatments.
Wilhelm, Dalit; Zlotnick, Cheryl
2014-07-01
Two tools were created to help international students to better understand culture by becoming more astute observers of nonverbal behaviors, particularly behaviors depicting emotions among Norwegian students. The two tools were a trilingual list of words illustrating emotions and an exercise with images to practice verbalizing their observations of emotional expression. Students compared the subdued behaviors of Norwegians to the Israelis' very vivid behaviors. The intense emotional expression of Israelis influenced their interpretations. By making comparisons and through the experiences with Israelis, they learned more about culture and their own emotional expression. Creative strategies can contribute to students understanding and reflection of patients in a different culture. Encouraging students to grasp the nuances of emotional expression is part of understanding a different culture. Students, like faculty, learn that self-exploration is an evolving process that requires checking out one's assumptions and interpretations. © The Author(s) 2013.
A mixed methods study of culturally responsive teaching in science and math classrooms
Holocker, Angela Y.
Through the dawn of education, student achievement has always been the primary focus of educators. The United States has not changed the structure of their educational institutions since the Industrial Revolution. With the achievement gap between mainstream and non-mainstream students continually growing, it is the responsibility of every educator to contribute to student success. However, teachers cannot be held accountable for teaching what they do not know. This study investigates the correlation between Culturally Responsive Teaching professional development and the effects on minority students. The yearlong professional development models as well as culturally responsive strategies are discussed in great length. The study reflects the attitudes of teachers before and after participation in the culturally responsive professional development. Student growth was tracked over the school year as well as teacher implementation of the culturally responsive strategies. The final teacher survey and overall student growth was analyzed for correlation.
Evaluation of PCR methods for detection of Brucella strains from culture and tissues.
Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar
2017-04-01
The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.
Drifter technique: a new method to obtain metaphases in Hep-2 cell line cultures
Directory of Open Access Journals (Sweden)
Eleonidas Moura Lima
2005-07-01
Full Text Available The Hep-2 cell line is derived from laryngeal carcinoma cells and is often utilized as a model in carcinogenesis and mutagenesis tests. To evaluate the proliferative potential of this line, we developed a cytogenetic methodology (drifter technique to obtain metaphases from cells that loose cellular adhesion when they underwent mitosis in culture. By this procedure, 2000 cells were counted, resulting in a mitotic index (MI of 22.2%. Although this MI was not statistically different from the one obtained using either a classical cytogenetic method or a cell synchronization technique, the drifter technique has the advantage of not requiring the use of some reagents for the obtention of metaphases and also of diminishing the consumption of maintenance reagents for this cell line.A linhagem celular Hep-2 é formada por células de carcinoma da laringe e é muito utilizada em modelos de carcinogênese e mutagenêse. Para avaliar o potencial proliferativo desta linhagem, desenvolvemos uma metodologia citogenética (técnica do sobrenadante para obtenção de metáfases a partir de células que, ao entrarem em mitose, perdem adesão celular, ficando em suspensão no meio de cultura. Através deste procedimento, foram contadas 2000 células, correspondendo a um índice mitótico (IM de 22.2% . Apesar de o IM obtido por esta técnica não ter sido estatisticamente diferente do IM obtido por outras metodologias citogenéticas clássicas, a técnica do sobrenadante é vantajosa porque elimina o uso de alguns reagentes utilizados na obtenção de metáfases e também diminui o consumo de reagentes de manutenção desta linhagem.
Survey on Heterotrophic Bacterial Contamination in Bottled Mineral Water by Culture Method
Directory of Open Access Journals (Sweden)
Essmaeel Ghorbanalinezhad
2014-12-01
Full Text Available Background and Aim: This project focuses on the level of heterotrophic baceria in bottled mineral water which could be a health concern for the elderly, infants, pregnant women and immuno-compromised patients. Materials and Methods: Different brands of bottled water samples were selected randomly and evaluated for their bacteriological quality, using different specific culture media and biochemical tests. Water samples were analyzed within 24 hours of their purchase/collection. Samples were filtered with 0.45 micron and filters were plated in different media. Then media were incubated at 37˚C for 24-48 hours. Results: Morphological study and biochemical tests revealed a number of bacteria in different brands of bottled water. Heterotrophic bacteria(Gram positive cocci, Spore forming gram positive bacilli, non spore forming gram positive bacilli, gram negative bacilli, and gram negative coccobacilli; Pseudomonas and Stenotrophomonas counted in 70% of bottled water samples. There were no cases of fecal contamination or the presence of E.coli. Conclusions: Bottled water is not sterile and contains trace amounts of bacteria naturally present or introduced during processing. Testing drinking water for all possible pathogens is complex, time-consuming, and expensive. If only total coliform bacteria are detected in drinking water, the source is probably environmental. Since the significance of non-pathogenic heterotrophic bacteria in relation to health and diseases is not understood, there is an urgent need to establish a maximum limit for the heterotrophic count in the bottled mineral water. Growth conditions play a critical role in the recovery of heterotrophic bacteria in bottled drinking water.
Ovseiko, Pavel V; Melham, Karen; Fowler, Jan; Buchan, Alastair M
2015-01-22
Around the world, the last two decades have been characterised by an increase in the numbers of mergers between healthcare providers, including some of the most prestigious university hospitals and academic health centres. However, many mergers fail to bring the anticipated benefits, and successful post-merger integration in university hospitals and academic health centres is even harder to achieve. An increasing body of literature suggests that organisational culture affects the success of post-merger integration and academic-clinical collaboration. This paper reports findings from a mixed-methods single-site study to examine 1) the perceptions of organisational culture in academic and clinical enterprises at one National Health Service (NHS) trust, and 2) the major cultural issues for its post-merger integration with another NHS trust and strategic partnership with a university. From the entire population of 72 clinician-scientists at one of the legacy NHS trusts, 38 (53%) completed a quantitative Competing Values Framework survey and 24 (33%) also provided qualitative responses. The survey was followed up by semi-structured interviews with six clinician-scientists and a group discussion including five senior managers. The cultures of two legacy NHS trusts differed and were primarily distinct from the culture of the academic enterprise. Major cultural issues were related to the relative size, influence, and history of the legacy NHS trusts, and the implications of these for respective identities, clinical services, and finances. Strategic partnership with a university served as an important ameliorating consideration in reaching trust merger. However, some aspects of university entrepreneurial culture are difficult to reconcile with the NHS service delivery model and may create tension. There are challenges in preserving a more desirable culture at one of the legacy NHS trusts, enhancing cultures in both legacy NHS trusts during their post-merger integration, and
Rahimi, Ebrahim; Momtaz, Hassan; Behzadnia, Asma; Baghbadorani, Zeinab Torki
2014-01-01
Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. R...
Dehnugara, Tushna; Dhar, Surbhi; Rao, M R Satyanarayana
2012-01-01
Extensive chromatin remodeling is a characteristic feature of mammalian spermiogenesis. To date, methods for the molecular manipulation of haploid spermatids are not available as there is a lack of a well-established culture system. Biochemical experiments and knockout studies reveal only the final outcome; studying the incremental details of the intricate mechanisms involved is still a challenge. We have established an in vitro culture system for pure haploid round spermatids isolated from rat testes that can be maintained with good viability for up to 72 hr. Changes in cell morphology and flagellar growth were also studied in the cultured spermatids. Further, we have demonstrated that upon treatment of cells with specific histone deacetylase inhibitors, sodium butyrate and trichostatin A, there is an increase in the hyperacetylation status of histone H4, mimicking an important event characteristic of histone replacement process that occurs during later stages of spermiogenesis. We have also tried various methods for introducing DNA and protein into these round spermatids in culture, and report that while DNA transfection is still a challenging task, protein transfection could be achieved using Chariot™ peptide as a transfection reagent. Thus, the method described here sets a stage to study the molecular roles of spermatid-specific proteins and chromatin remodelers in the cellular context. Copyright © 2011 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Cowen, D; Richaud, P; Landriau, S; Lagarde, P; Gualde, N [Fondation Bergonie, 33 - Bordeaux (France); Boiron, J M [Hopital du Haut-Leveque, 33 - Pessac (France); Mahon, F X; Belloc, F [Hopital Regional, 33 - Bordeaux (France); Reiffers, J [Hopital du Haut-Leveque, 33 - Pessac (France) Hopital Regional, 33 - Bordeaux (France)
1993-01-01
The progenitor cells of acute myeloblastic leukaemia (AML) are usually cultured in methylcellulose which selects for terminal dividing cells. Suspension cultures have been developed because they reflect self-renewal: the exponential growth of the progenitors of AML cultured in suspension is due to self-renewal. We have compared the radiosensitivity of the progenitors of AML grown either in methylcellulose alone or first in suspension for 7 days before being plated in methylcellulose. Cells were harvested from leukaemic bone marrows at the moment of diagnosis. The myeloblastic lineage of the colonies was assessed by morphological, cytochemical and immunophenotypic analysis and by the use of growth factors which do not stimulate T-lymphocytes. The cell-cycle distribution of leukaemic blasts was comparable for all the samples. This method enabled aggressive leukaemias to be selected. The radiosensitivity showed wide variations from one patient to another (Do ranging from 0.35 to 2.6 Gy) whichever culture method used. The progenitor cells capable of self-renewal were more radiosensitive (Mean Do 0.9[+-]0.4 Gy) than terminal dividing cells (Mean Do = 1.35[+-]0.5 Gy). In two cases, a shoulder was found in the initial part of the cell-survival curves of cells capable of self-renewal. The shape of the curves was better fitted by the linear quadratic model with very low values of [alpha]/[beta], suggesting a reduced antileukaemic effect in case of fractionation.
Latief, Yusuf; Machfudiyanto, Rossy A.; Arifuddin, Rosmariani; Yogiswara, Yoko
2017-03-01
Based on the data, 32% of accidental cases in Indonesia occurs on constructional sectors. It is supported by the data from Public Work and Housing Department that 27.43% of the implementation level of Safety Management System policy at construction companies in Indonesia remains unsafe categories. Moreover, there are dimensions of occupational safety culture formed including leadership, behavior, strategy, policy, process, people, safety cost, value and contract system. The aim of this study is to determine the model of an effective safety culture and know the relationship between dimensions in construction industry. The method used in this research was questionnaire survey which was distributed to the sample of construction companies either in a national private one in Indonesia. The result of this research is supposed to be able to illustrate the development of the relationship among occupational safety culture dimensions which have influences to the performances of constructional companies in Indonesia.
A new and efficient culture method for porcine bone marrow-derived M1- and M2-polarized macrophages.
Gao, Jiye; Scheenstra, Maaike R; van Dijk, Albert; Veldhuizen, Edwin J A; Haagsman, Henk P
2018-06-01
Macrophages play an important role in the innate immune system as part of the mononuclear phagocyte system (MPS). They have a pro-inflammatory signature (M1-polarized macrophages) or anti-inflammatory signature (M2-polarized macrophages) based on expression of surface receptors and secretion of cytokines. However, very little is known about the culture of macrophages from pigs and more specific about the M1 and M2 polarization in vitro. Porcine monocytes or mononuclear bone marrow cells were used to culture M1- and M2-polarized macrophages in the presence of GM-CSF and M-CSF, respectively. Surface receptor expression was measured with flow cytometry and ELISA was used to quantify cytokine secretion in response to LPS and PAM 3 CSK 4 stimulation. Human monocyte-derived macrophages were used as control. Porcine M1- and M2-polarized macrophages were cultured best using porcine GM-CSF and murine M-CSF, respectively. Cultures from bone marrow cells resulted in a higher yield M1- and M2-polarized macrophages which were better comparable to human monocyte-derived macrophages than cultures from porcine monocytes. Porcine M1-polarized macrophages displayed the characteristic fried egg shape morphology, lower CD163 expression and low IL-10 production. Porcine M2-polarized macrophages contained the spindle-like morphology, higher CD163 expression and high IL-10 production. Porcine M1- and M2-polarized macrophages can be most efficiently cultured from mononuclear bone marrow cells using porcine GM-CSF and murine M-CSF. The new culture method facilitates more refined studies of porcine macrophages in vitro, important for both porcine and human health since pigs are increasingly used as model for translational research. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Integrating cross-cultural psychology research methods into ethnic minority psychology.
Leong, Frederick T L; Leung, Kwok; Cheung, Fanny M
2010-10-01
Multicultural psychology has 2 related but often disconnected streams, namely cross-cultural psychology and racial and ethnic minority psychology (Hall & Maramba, 2001). We propose that advances in both fields will be facilitated if there is greater cross-fertilization, especially in methodological approaches given that proponents in both fields are interested in studying and understanding the role and impact of culture on human behavior. To facilitate this cross-fertilization, we present 3 methodological approaches that would be of value in racial and ethnic minority psychology. First, we present an overview of the importance of and the approaches to evaluating and establishing measurement equivalence. Second, we discuss recent advances in the understanding of conceptual equivalence in light of indigenous approaches, cultural manipulation, and multilevel analysis. Third, we present a combined etic-emic approach to cross-cultural personality research as illustrated by the Cross-Cultural Personality Assessment Inventory developed by Fanny Cheung and her colleagues. PsycINFO Database Record (c) 2010 APA, all rights reserved.
Directory of Open Access Journals (Sweden)
Natalia Nikula
2017-03-01
Full Text Available One of the main conditions of formation of methodological culture of primary school teacher, a factor that encourages the assimilation of effective models of professional and methodical activity is value-motivational component. In order to clearly understand the content of the phenomenon appointed its author selected criteria: system values orientation and professional and personal motivation. The value orientation as a set of values focus on professional and methodological activities which manifest themselves in individual positive attitude of students to it is determined on the base of the analysis of scientific and pedagogical sources. The indicators of value orientations are: human values (truth, goodness, beauty, life and health; personal values of teachers (humanity, justice, diligence, responsibility; teacher professional values (commitment, independence, initiative, organization, value orientation on professional and methodical activities. The essence of professional and personal motivation as individual education teacher's personality, which includes professional and personal motives, interests, needs, formation of which is a clear reference and internal impetus for the formation of methodological culture. The indicators of this criterion are: professional and methodical motivation; methodically-focused orientation teacher; interest in the success in professional and methodical work of the teacher; the need for professional self-realization and self-affirmation; desire career advancement; focus on student mastery of methodological culture. The system measure of the formation of values and motivational component: discussions, exercises, training exercises, collective creative discussion, a role play, a workshop is analysed.
Yeung, Marie
2012-12-01
Enhancing the quality and safety of dairy food is critical to maintaining the competitiveness of dairy products in the food and beverage market and in reinforcing consumer confidence in the dairy industry. Raw milk quality has a significant effect on finished product quality. Several microbial groups found in raw milk have been shown to adversely affect the shelf life of pasteurized milk. Current microbiological criteria used to define milk quality are based primarily on culture-dependent methods, some of which are perceived to lack the desired sensitivity and specificity. To supplement traditional methods, culture-independent methods are increasingly being used to identify specific species or microbial groups, and to detect indicator genes or proteins in raw milk or dairy products. Some molecular subtyping techniques have been developed to track the transmission of microbes in dairy environments. The burgeoning "-omics" technologies offer new and exciting opportunities to enhance our understanding of food quality and safety in relation to microbes. Metagenomics has the potential to characterize microbial diversity, detect nonculturable microbes, and identify unique sequences or other factors associated with dairy product quality and safety. In this review, fluid milk will be used as the primary example to examine the adequacy and validity of conventional methods, the current trend of culture-independent methods, and the potential applications of metagenomics in dairy food research. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Li, Zhijian; Li, Haifeng; Bian, Ke
2016-10-03
In this study, the microbial composition of two types of Jiaozi (a dough fermentation starter in making steamed bread) was investigated using both culture-dependent and culture-independent (PCR-DGGE) methods. The numbers of the cultivable bacteria on MRS at 30°C and yeast on YPD at 28°C in the maize flour Jiaozi (MFJ) were 9.21±0.16 Log CFU/g and 9.18±0.05 Log CFU/g, respectively, which were higher than that in the rice flour Jiaozi (RFJ) (Pyeasts were isolated and identified on the basis of the sequences of their 16S rRNA gene and ITS region. The culture-dependent method showed that Acetobacter tropicalis and Enterococcus durans were the predominant bacteria strains in MFJ, and accounted for 45.7% and 25.7% of the bacteria, and Lactobacillus plantarum and Pediococcus pentosaceus represented 12.8% and 8.6%. In the RFJ sample, the most prominent isolate was P. pentosaceus (38.6%), followed by L. plantarum (24.3%), A. tropicalis (22.8%), and E. durans (5.7%). P. pentosaceus and L. plantarum were also detected in both starters by PCR-DGGE, while some bacteria species such as A. tropicalis and E. durans, recovered as pure cultures, were not detected by direct PCR-DGGE. On the other hand, Lactobacillus brevis, Weissella sp. and Lactobacillus alimentarius detected by PCR-DGGE were not recovered in any of the media and conditions used. In the MFJ sample, the isolated main yeast species were identified as Wickerhamomyces anomalus (67.2%), Saccharomyces cerevisiae (27.9%) and Torulaspora delbrueckii (4.9%). In addition to S. cerevisiae (42.9%), W. anomalus (27.0%) and T. delbrueckii (7.9%), Saccharomycopsis fibuligera was also identified as the predominant isolate in RFJ samples and accounted for 22.2%. PCR-DGGE also indicated the presence of W. anomalus and S. cerevisiae in both MFJ and RFJ starters and S. fibuligera was also detected in RFJ, but T. delbrueckii was not detected in both samples. Copyright © 2016 Elsevier B.V. All rights reserved.
A method for additive bias correction in cross-cultural surveys
DEFF Research Database (Denmark)
Scholderer, Joachim; Grunert, Klaus G.; Brunsø, Karen
2001-01-01
additive bias from cross-cultural data. The procedure involves four steps: (1) embed a potentially biased item in a factor-analytic measurement model, (2) test for the existence of additive bias between populations, (3) use the factor-analytic model to estimate the magnitude of the bias, and (4) replace......Measurement bias in cross-cultural surveys can seriously threaten the validity of hypothesis tests. Direct comparisons of means depend on the assumption that differences in observed variables reflect differences in the underlying constructs, and not an additive bias that may be caused by cultural...... differences in the understanding of item wording or response category labels. However, experience suggests that additive bias can be found more often than not. Based on the concept of partial measurement invariance (Byrne, Shavelson and Muthén, 1989), the present paper develops a procedure for eliminating...
The Islamic Orient and the Development of Material Culture of Muscovy: Evaluation Methods
Directory of Open Access Journals (Sweden)
Belyaev Leonid A.
2016-06-01
Full Text Available The author discusses approaches to archaeological analysis of the Muslim contribution to the development of Muscovy, as well as the mere possibility of such analysis. So far, the studies focused on identifi cation of some interpenetrating elements of the material and artistic culture, which is necessary, but not quite suffi cient. New tasks must be formulated: to outline and characterize areas of intersection of various cultural streams; to identify forms and stages of such contacts; to understand ways for primary perception of impulses, which gave birth to distinctive national cultures in the Middle Ages and in the Modern era; to trace processing of such impulses further on; to try and understand whether there was a monocultural archaeological environment that existed in the past and belonged to the coexisting groups speaking different languages and belonging to different confessions.
Group Music Therapy Methods in Cross-Cultural Aged Care Practice in Australia
DEFF Research Database (Denmark)
Ridder, Hanne Mette Ochsner
2011-01-01
When I worked as a music therapist in a Danish nursing home ten years ago there were no residents with an ethnic or cultural background other than Danish. There were 24 residents at this geronto-psychiatric unit and all had lived their lives in Denmark, most of them in the local area. It was often....... This situation, with a nursing home population who mainly are rooted in the same local area, is very different from the situation described by Ip & Grocke’s article where an “ever-increasing diversity of ethnic, cultural and religious backgrounds” in elderly Australians is seen. It has changed in Denmark as well...... as in the other European countries in the last decade, though. Now ten percent of school children in Denmark have a mother tongue other than Danish, and a growing number of the aged population has a CALD-background (Culturally And Linguistically Diverse). One percent of the population in Denmark +60 years has...
An efficient 3D cell culture method on biomimetic nanostructured grids.
Directory of Open Access Journals (Sweden)
Maria Wolun-Cholewa
Full Text Available Current techniques of in vitro cell cultures are able to mimic the in vivo environment only to a limited extent, as they enable cells to grow only in two dimensions. Therefore cell culture approaches should rely on scaffolds that provide support comparable to the extracellular matrix. Here we demonstrate the advantages of novel nanostructured three-dimensional grids fabricated using electro-spinning technique, as scaffolds for cultures of neoplastic cells. The results of the study show that the fibers allow for a dynamic growth of HeLa cells, which form multi-layer structures of symmetrical and spherical character. This indicates that the applied scaffolds are nontoxic and allow proper flow of oxygen, nutrients, and growth factors. In addition, grids have been proven to be useful in in situ examination of cells ultrastructure.
A Method to Culture GABAergic Interneurons Derived from the Medial Ganglionic Eminence
Directory of Open Access Journals (Sweden)
Sira A. Franchi
2018-01-01
Full Text Available Understanding the mechanisms guiding interneuron development is a central aspect of the current research on cortical/hippocampal interneurons, which is highly relevant to brain function and pathology. In this methodological study we have addressed the setup of protocols for the reproducible culture of dissociated cells from murine medial ganglionic eminences (MGEs, to provide a culture system for the analysis of interneurons in vitro. This study includes the detailed protocols for the preparation of the dissociated cells, and for their culture on optimal substrates for cell migration or differentiation. These cultures enriched in interneurons may allow the investigation of the migratory behavior of interneuron precursors and their differentiation in vitro, up to the formation of morphologically identifiable GABAergic synapses. Live imaging of MGE–derived cells plated on proper substrates shows that they are useful to study the migratory behavior of the precursors, as well as the behavior of growth cones during the development of neurites. Most MGE-derived precursors develop into polarized GABAergic interneurons as determined by axonal, dendritic, and GABAergic markers. We present also a comparison of cells from WT and mutant mice as a proof of principle for the use of these cultures for the analysis of the migration and differentiation of GABAergic cells with different genetic backgrounds. The culture enriched in interneurons described here represents a useful experimental system to examine in a relatively easy and fast way the morpho-functional properties of these cells under physiological or pathological conditions, providing a powerful tool to complement the studies in vivo.
Directory of Open Access Journals (Sweden)
Auvinen Petri
2011-10-01
Full Text Available Abstract Background Indoor microbial contamination due to excess moisture is an important contributor to human illness in both residential and occupational settings. However, the census of microorganisms in the indoor environment is limited by the use of selective, culture-based detection techniques. By using clone library sequencing of full-length internal transcribed spacer region combined with quantitative polymerase chain reaction (qPCR for 69 fungal species or assay groups and cultivation, we have been able to generate a more comprehensive description of the total indoor mycoflora. Using this suite of methods, we assessed the impact of moisture damage on the fungal community composition of settled dust and building material samples (n = 8 and 16, correspondingly. Water-damaged buildings (n = 2 were examined pre- and post- remediation, and compared with undamaged reference buildings (n = 2. Results Culture-dependent and independent methods were consistent in the dominant fungal taxa in dust, but sequencing revealed a five to ten times higher diversity at the genus level than culture or qPCR. Previously unknown, verified fungal phylotypes were detected in dust, accounting for 12% of all diversity. Fungal diversity, especially within classes Dothideomycetes and Agaricomycetes tended to be higher in the water damaged buildings. Fungal phylotypes detected in building materials were present in dust samples, but their proportion of total fungi was similar for damaged and reference buildings. The quantitative correlation between clone library phylotype frequencies and qPCR counts was moderate (r = 0.59, p Conclusions We examined a small number of target buildings and found indications of elevated fungal diversity associated with water damage. Some of the fungi in dust were attributable to building growth, but more information on the material-associated communities is needed in order to understand the dynamics of microbial communities between
Production of D-xylanases by thermophilic fungi using different methods of culture
Energy Technology Data Exchange (ETDEWEB)
Grajek, W
1986-01-01
Seven thermophilic strains of fungi were examined for their ability to produce D-xylanase in liquid and solid-state fermentations. It was confirmed that the best producers of xylanase, among microorganisms used, were H. lanuginosa and S. thermophile in liquid fermentation, and T. aurantiacus and H. lanuginosa in solid-state fermentations. The higher productivity of xylanase, namely 18,72 IU/ml, was obtained in liquid culture of H. lanuginosa. The pH and temperature optima of enzymes from liquid and solid-state cultures of fungi used were also presented.
Qiu, Tianlong; Zhang, Libin; Zhang, Tao; Bai, Yucen; Yang, Hongsheng
2014-07-01
There is substantial individual variation in the growth rates of sea cucumber Apostichopus japonicus individuals. This necessitates additional work to grade the seed stock and lengthens the production period. We evaluated the influence of three culture methods (free-mixed, isolated-mixed, isolated-alone) on individual variation in growth and assessed the relationship between feeding, energy conversion efficiency, and individual growth variation in individually cultured sea cucumbers. Of the different culture methods, animals grew best when reared in the isolated-mixed treatment (i.e., size classes were held separately), though there was no difference in individual variation in growth between rearing treatment groups. The individual variation in growth was primarily attributed to genetic factors. The difference in food conversion efficiency caused by genetic differences among individuals was thought to be the origin of the variance. The level of individual growth variation may be altered by interactions among individuals and environmental heterogeneity. Our results suggest that, in addition to traditional seed grading, design of a new kind of substrate that changes the spatial distribution of sea cucumbers would effectively enhance growth and reduce individual variation in growth of sea cucumbers in culture.
International Nuclear Information System (INIS)
Oh, Seunghan; Brammer, Karla S.; Moon, Kyung-Suk; Bae, Ji-Myung; Jin, Sungho
2011-01-01
We investigated the adhesion, proliferation and osteogenic functionality of osteoblasts cultured on titanium dioxide (TiO 2 ) nanotubes in response to different sterilization methods (dry autoclaving vs. wet autoclaving). We prepared various sizes (30-100 nm diameter) of TiO 2 nanotubes on titanium substrates by anodization, sterilized nanotubes by different conditions, and seeded osteoblast cells onto the nanotube surfaces with two different cell seeding densities (10,000 vs. 50,000 cells/well in 12-culture well). The result of this study indicates that the adhesion, proliferation and alkaline phosphatase activity of osteoblasts cultured on only the larger 70 and 100 nm TiO 2 nanotube arrays were dramatically changed by the different sterilization conditions at a low cell seeding density. However, with a higher cell seeding density (50,000 cells/well in 12-cell culture well), the results revealed no significant difference among altered nanotube geometry, 30-100 nm diameters, nor sterilization methods. Next, it was revealed that the nanofeatures of proteins adhered on nanotubular TiO 2 morphology are altered by the sterilization method. It was determined that this protein adhesion effect, in combination with the cell density of osteoblasts seeded onto such TiO 2 nanotube surfaces, has profound effects on cell behavior. This study clearly shows that these are some of the important in vitro culture factors that need to be taken into consideration, as well as TiO 2 nanotube diameters which play an important role in the improvement of cell behavior and functionality.
Directory of Open Access Journals (Sweden)
Ebrahim Rahimi
2014-02-01
Full Text Available Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. Results: Using cultural method, 19 samples (7.3% were positive for Listeria spp. The highest prevalence of Listeria was found in raw water buffalo milk (11.8%, followed by raw bovine milk (10.6%, raw ovine milk (7.1%, and raw caprine milk (4.2% samples. All 37 camel milk samples from 20 camel breeding farms were negative for Listeria spp. The overall prevalence of Listeria was 7.3%, in which Listeria innocua was the most recovered species (4.2%; the remaining isolates were Listeria monocytogenes (1.9%, Listeria ivanovii (0.08% and Listeria seeligari (0.04%. The PCR assay could identify 8 Listeria-contaminated milk samples that were negative using the cultural method. Conclusions: The results presented in this study indicate the potential risk of infection with Listeria in people consuming raw and unpasteurized milk.
Directory of Open Access Journals (Sweden)
S Farnia
2009-05-01
Full Text Available "nBackground: The aim was to compare three different methods (direct examination, culture and PCR methods for the diagnosis of Acanthamoeba keratitis (AK in corneal scrapes."nMethods: Twenty eight corneal scrapes and contact lenses were collected from keratitis patients and referred to the Department of Medical Parasitology and Mycology, School of Public Health, Tehran University of Medical Sciences. Corneal scrapes were divided in three parts for direct examination, culture on non-nutrient agar and PCR analysis. PCR analysis was also performed using a 18S rRNA gene primer pair (DF3 region. DF3 (Diagnostic fragment 3 is a region of the nuclear small subunit ribosomal RNA gene which is specific for detecting Acanthamoeba strains."nResults: Acanthamoeba was the causative agent of keratitis in 50% of the patients. Direct smear of all prepared corneal scrapes in AK patients was negative and culture was positive in only 14.3% of the isolates. PCR analysis was positive in 71.4% of AK patients. These three methods were negative in corneal scrapes of non-AK patients. The sensitivity and specificity of PCR technique for the detection of Acanthamoeba sp. were calculated as 71.4% and 100%, respectively."nConclusion: According to high sensitivity and specificity of PCR-based method, this study confirmed that PCR using 18S rRNA gene primers (DF3 region is more useful for detecting AK cases compare to culture and direct microscopy methods.
Keskustalo, H.; Kettunen, K.; Kumpulainen, S.; Ferro, N.; Silvello, G.; Järvelin, A.; Kekäläinen, J.; Arvola, P.; Saastamoinen, M.; Sormunen, E.; Järvelin, K.
2015-01-01
Digitization of cultural heritage is a huge ongoing effort in many countries. In digitized historical documents, words may occur in different surface forms due to three types of variation - morphological variation, historical variation, and errors in optical character recognition (OCR). Because
In vitro mouse spermatogenesis with an organ culture method in chemically defined medium.
Directory of Open Access Journals (Sweden)
Hiroyuki Sanjo
Full Text Available We previously reported the successful induction and completion of mouse spermatogenesis by culturing neonatal testis tissues. The culture medium consisted of α-minimum essential medium (α-MEM, supplemented with Knockout serum replacement (KSR or AlbuMAX, neither of which were defined chemically. In this study, we formulated a chemically defined medium (CDM that can induce mouse spermatogenesis under organ culture conditions. It was found that bovine serum albumin (BSA purified through three different procedures had different effects on spermatogenesis. We also confirmed that retinoic acid (RA played crucial roles in the onset of spermatogonial differentiation and meiotic initiation. The added lipids exhibited weak promoting effects on spermatogenesis. Lastly, luteinizing hormone (LH, follicle stimulating hormone (FSH, triiodothyronine (T3, and testosterone (T combined together promoted spermatogenesis until round spermatid production. The CDM, however, was not able to produce elongated spermatids. It was also unable to induce spermatogenesis from the very early neonatal period, before 2 days postpartum, leaving certain factors necessary for spermatogenic induction in mice unidentified. Nonetheless, the present study provided important basic information on testis organ culture and spermatogenesis in vitro.
Food safety culture assessment using a comprehensive mixed-methods approach
Nyarugwe, Shingai P.; Linnemann, Anita; Nyanga, Loveness K.; Fogliano, Vincenzo; Luning, Pieternel A.
2018-01-01
Food safety challenges are a global concern especially in emerging economies, which are in the midst of developmental changes. The challenges are directly or indirectly related to the behaviour and decision-making of personnel, and to an organisation's food safety culture. This study evaluated the
Directory of Open Access Journals (Sweden)
Leyfa A.V.
2009-12-01
Full Text Available The value of theoretical knowledge, methodical, practical studies, skills in forming physical activity of students is rotined. The level of mastering of components of physical activity is closely associate with the basic blocks of professional preparation of students and their future professional activity. Theoretical knowledge on discipline the «Physical culture» assist the certain affecting depth and breadth of mastering of knowledge of professional preparation.
International Nuclear Information System (INIS)
Qasem, J.A.; Al-Mouqati, S.; Rajkumar, G.
2005-01-01
The identification of Salmonella spp. from poultry meat was studied by comparing bacterial detection using the Gene-Trak colorimetric hybridization method, a PCR amplification kit and an Enzyme Linked Immunosorbent Assay (ELISA), and these methods were compared with the conventional methodology proposed by the United States Food and Drug Administration (US FDA) for detection of Salmonella in food samples. Forty positive and negative samples were studied. The three methods yielded similar results with levels of Salmonella greater than 10 CFU per sample, even when the samples were highly contaminated with competing bacteria. In contrast, 20 CFU of seed inoculum per sample was the lowest level of Salmonella detectable with all three methods and the standard culture method. The detection limits of the PCR and ELISA assays were 5 CFU/g after enrichment at 37 deg. C for 6 and 9 hours, respectively. Compared with conventional bacteriology, all three methods here demonstrated high sensitivity and specificity for Salmonella. (author)
Vergara, M Natalia; Gutierrez, Christian; O'Brien, David R; Canto-Soler, M Valeria
2013-04-01
Primary retinal cultures constitute valuable tools not only for basic research on retinal cell development and physiology, but also for the identification of factors or drugs that promote cell survival and differentiation. In order to take full advantage of the benefits of this system it is imperative to develop efficient and reliable techniques for the manipulation of gene expression. However, achieving appropriate transfection efficiencies in these cultures has remained challenging. The purpose of this work was to develop and optimize a technique that would allow the transfection of chick retinal cells with high efficiency and reproducibility for multiple applications. We developed an ex vivo electroporation method applied to dissociated retinal cell cultures that offers a significant improvement over other currently available transfection techniques, increasing efficiency by five-fold. In this method, eyes were enucleated, devoid of RPE, and electroporated with GFP-encoding plasmids using custom-made electrodes. Electroporated retinas were then dissociated into single cells and plated in low density conditions, to be analyzed after 4 days of incubation. Parameters such as voltage and number of electric pulses, as well as plasmid concentration and developmental stage of the animal were optimized for efficiency. The characteristics of the cultures were assessed by morphology and immunocytochemistry, and cell viability was determined by ethidium homodimer staining. Cell imaging and counting was performed using an automated high-throughput system. This procedure resulted in transfection efficiencies in the order of 22-25% of cultured cells, encompassing both photoreceptors and non-photoreceptor neurons, and without affecting normal cell survival and differentiation. Finally, the feasibility of the technique for cell-autonomous studies of gene function in a biologically relevant context was tested by carrying out gain and loss-of-function experiments for the
Directory of Open Access Journals (Sweden)
Endang Susianingsih
2017-09-01
Full Text Available Several ways have been done to encounter shrimp disease affecting cultured shrimp in Indonesian ponds in the last two decades. This research was aimed to find out the effect of different application of probiotic RICA4, RICA5, and RICA3 method on survival rate and production of white-leg shrimp (Litopenaeus vannamei cultured in ponds aerated with supercharge blower. RICA probiotics are bacteria probiotics produced by the Research and Development Institute for Coastal Aquaculture, originally isolated from seaweed and sea sediment. This experiment was carried out in completely randomized design using nine 250-m2 experimental ponds stocked with 15 shrimp fries/m2. There were three treatments namely: A=alternate use of three probiotics RICA4, RICA5, and RICA3; B=combination use of three probiotics RICA4, RICA5, and RICA3; and C=control (without probiotic, each treatment with three replications and cultured with supercharge blower. Variables observed in this study were survival rate and production of the shrimp calculated at the end of experiment, total vibrio count (TBV and total plate count of common bacteria (TPC of the pond waters and sediments monitored every two weeks. The results showed that application of probiotic RICA4, RICA5, and RICA3 applied either in alteration or in combination significantly increased survival rate (P0.05 of the white-leg shrimp. TBV/TPC ratio in the control pond waters after 10-weeks culture (over than 10% was relatively dangerous for the cultured white-leg shrimp. This shows that application of probiotic could prevent the growth of Vibrio spp in the cultured shrimp pond water.
International Nuclear Information System (INIS)
Ninomiya, Yuichi; Sugahara-Yamashita, Yzumi; Nakachi, Yutaka; Tokuzawa, Yoshimi; Okazaki, Yasushi; Nishiyama, Masahiko
2010-01-01
Human mesenchymal stem cells (hMSCs) derived from bone marrow are multipotent stem cells that can regenerate mesenchymal tissues such as adipose, bone or muscle. It is thought that hMSCs can be utilized as a cell resource for tissue engineering and as human models to study cell differentiation mechanisms, such as adipogenesis, osteoblastogenesis and so on. Since it takes 2-3 weeks for hMSCs to differentiate into adipocytes using conventional culture methods, the development of methods to induce faster differentiation into adipocytes is required. In this study we optimized the culture conditions for adipocyte induction to achieve a shorter cultivation time for the induction of adipocyte differentiation in bone marrow-derived hMSCs. Briefly, we used a cocktail of dexamethasone, insulin, methylisobutylxanthine (DIM) plus a peroxisome proliferator-activated receptor γ agonist, rosiglitazone (DIMRo) as a new adipogenic differentiation medium. We successfully shortened the period of cultivation to 7-8 days from 2-3 weeks. We also found that rosiglitazone alone was unable to induce adipocyte differentiation from hMSCs in vitro. However, rosiglitazone appears to enhance hMSC adipogenesis in the presence of other hormones and/or compounds, such as DIM. Furthermore, the inhibitory activity of TGF-β1 on adipogenesis could be investigated using DIMRo-treated hMSCs. We conclude that our rapid new culture method is very useful in measuring the effect of molecules that affect adipogenesis in hMSCs.
Cutler, Timothy D.; Wang, Chong; Hoff, Steven J.; Zimmerman, Jeffrey J.
2013-01-01
In aerobiology, dose-response studies are used to estimate the risk of infection to a susceptible host presented by exposure to a specific dose of an airborne pathogen. In the research setting, host- and pathogen-specific factors that affect the dose-response continuum can be accounted for by experimental design, but the requirement to precisely determine the dose of infectious pathogen to which the host was exposed is often challenging. By definition, quantification of viable airborne pathogens is based on the culture of micro-organisms, but some airborne pathogens are transmissible at concentrations below the threshold of quantification by culture. In this paper we present an approach to the calculation of exposure dose at microbiologically unquantifiable levels using an application of the “continuous-stirred tank reactor (CSTR) model” and the validation of this approach using rhodamine B dye as a surrogate for aerosolized microbial pathogens in a dynamic aerosol toroid (DAT). PMID:24082399
Directory of Open Access Journals (Sweden)
Aaron H Fronk
2016-07-01
Full Text Available The retinal pigment epithelium is an important part of the vertebrate eye, particularly in studying the causes and possible treatment of age-related macular degeneration. The retinal pigment epithelium is difficult to access in vivo due to its location at the back of the eye, making experimentation with age-related macular degeneration treatments problematic. An alternative to in vivo experimentation is cultivating the retinal pigment epithelium in vitro, a practice that has been going on since the 1970s, providing a wide range of retinal pigment epithelial culture protocols, each producing cells and tissue of varying degrees of similarity to natural retinal pigment epithelium. The purpose of this review is to provide researchers with a ready list of retinal pigment epithelial protocols, their effects on cultured tissue, and their specific possible applications. Protocols using human and animal retinal pigment epithelium cells, derived from tissue or cell lines, are discussed, and recommendations for future researchers included.
Theory and method at the intersection of anthropology and cultural neuroscience
Seligman, Rebecca; Brown, Ryan A.
2009-01-01
Anthropologists have become increasingly interested in embodiment—that is, the ways that socio-cultural factors influence the form, behavior and subjective experience of human bodies. At the same time, social cognitive neuroscience has begun to reveal the mechanisms of embodiment by investigating the neural underpinnings and consequences of social experience. Despite this overlap, the two fields have barely engaged one another. We suggest three interconnected domains of inquiry in which the i...
Hitchcock, John H.; Sarkar, Sreeroopa; Nastasi, Bonnie; Burkholder, Gary; Varjas, Kristen; Jayasena, Asoka
2006-01-01
Despite on-going calls for developing cultural competency among mental health practitioners, few assessment instruments consider cultural variation in psychological constructs. To meet the challenge of developing measures for minority and international students, it is necessary to account for the influence culture may have on the latent constructs…
New method for rapid Susceptibility Testing on blood culture with HB&L system: preliminary data
Directory of Open Access Journals (Sweden)
Vincenzo Rondinelli
2010-12-01
Full Text Available Blood culture, although represents the gold standard in detecting the ethiological agent of sepsis, is rather rarely required in relation to the real diagnostic importance. The result of this test depends in fact on many factors (sample volume, time of collection, accuracy, antibiotic therapy, contamination, number of drawings, drawing site, interpretation difficulties, etc. that are often considered by many clinicians so limited as to doubt about their actual value. The disadvantages are therefore represented by the lack of standardization but also by the low sensitivity and above all by the technical times too long for the clinical needs. Blood culture begins with the drawing of samples from the “septic” patient followed incubation of the bottles in automatic thermostated systems. In case of positive result (36 hours, the culture is Gram stained and streaked on solid media in order to obtain isolated colonies for the identification and the susceptibility testing (48 hours from positive result. The long time required for pathogen identification and susceptibility testing involves empirical broad spectrum antibiotic therapy that can promote the increase of bacterial resistance but also patient management costs. A clinically useful report should be available on short notice in order to guide the clinician to choose the most appropriate antibiotic. The microbiologist has therefore the hard work of reviewing the organization and the management of the procedures.We have therefore started to consider the possibility of treating the blood as an biological liquid in order to quickly determine the susceptibility of bacteria to antibiotics.
Jaccard, Nicolas; Griffin, Lewis D; Keser, Ana; Macown, Rhys J; Super, Alexandre; Veraitch, Farlan S; Szita, Nicolas
2014-01-01
The quantitative determination of key adherent cell culture characteristics such as confluency, morphology, and cell density is necessary for the evaluation of experimental outcomes and to provide a suitable basis for the establishment of robust cell culture protocols. Automated processing of images acquired using phase contrast microscopy (PCM), an imaging modality widely used for the visual inspection of adherent cell cultures, could enable the non-invasive determination of these characteristics. We present an image-processing approach that accurately detects cellular objects in PCM images through a combination of local contrast thresholding and post hoc correction of halo artifacts. The method was thoroughly validated using a variety of cell lines, microscope models and imaging conditions, demonstrating consistently high segmentation performance in all cases and very short processing times (image). Based on the high segmentation performance, it was possible to precisely determine culture confluency, cell density, and the morphology of cellular objects, demonstrating the wide applicability of our algorithm for typical microscopy image processing pipelines. Furthermore, PCM image segmentation was used to facilitate the interpretation and analysis of fluorescence microscopy data, enabling the determination of temporal and spatial expression patterns of a fluorescent reporter. We created a software toolbox (PHANTAST) that bundles all the algorithms and provides an easy to use graphical user interface. Source-code for MATLAB and ImageJ is freely available under a permissive open-source license. Biotechnol. Bioeng. 2014;111: 504–517. © 2013 Wiley Periodicals, Inc. PMID:24037521
Directory of Open Access Journals (Sweden)
Izmaylov Iskander L.
2014-09-01
Full Text Available Problems related to archaeological culture and ethnos comparison in the case of medieval Bulgaria are discussed in the article. According to the author, in recent years it has become evident that the traditional concept and methodology of the study of the Bulgars’ ethnogenesis and ethnic history are in contradiction with the facts accumulated. The methods of “archaeological ethno-genetics”, which dictated solving problems of ethnogenesis of the ancient population belonging to an archaeological culture in direct correlation with ethnicity, are currently being criticized. According to modern ideas about ethnos and ethnicity, ethnicity is based upon identity with a complex hierarchical nature. Contemporary methodology requires proceeding with the integrated study of the problems of ethnogenesis on the basis of archaeology and ethnology. This kind of analysis is based upon the study of the medieval Bulgar mentality as a source of information on key aspects of ethno-political ideas. The analysis of authentic historical sources, historiographical tradition elements and folklore materials makes it possible to reconstruct the basic ideas that were significant for an ethnic group. The archaeological culture of the population of Bulgaria is characterized by two clearly distinguished and interconnected elements – the common Muslim culture and that of the elite military “druzhina” (squad. These elements directly characterize the Bulgar ethno-political community. These theoretical conclusions and empirical research concerning the case of the medieval Bulgars’ ethnogenesis attest to the productivity of ethnological synthesis techniques on an interdisciplinary basis.
Viacheslav, Ilyin; Lana, Moukhamedieva; Georgy, Osipov; Aleksey, Batov; Zoya, Soloviova; Robert, Mardanov; Yana, Panina; Anna, Gegenava
2011-05-01
Current control of human microflora is a great problem not only for the space medicine but also for practical health care. Due to many reasons its realization by classical bacteriological method is difficult in practical application or cannot be done. To evaluate non-cultural methods of microbial control of crews in a confined habitat we evaluated two different methods. The first method is based on digital treatment of microbial visual images, appearing after gram staining of microbial material from natural sample. This way the rate between gram-positive and gram-negative microbe could be gained as well as differentiation of rods and cocci could be attained, which is necessary for primary evaluation of human microbial cenosis in remote confined habitats. The other non-culture method of human microflora evaluation is gas chromatomass spectrometry (gcms) analysis of swabs gathered from different body sites. Gc-ms testing of swabs allows one to validate quantitative and special microflora based on specific lipid markers analysis.
A safety culture assessment by mixed methods at a public maternity and infant hospital in China
Listyowardojo, Tita Alissa; Yan, Xiaoling; Leyshon, Stephen; Ray-Sannerud, Bobbie; Yu, Xin Yan; Zheng, Kai; Duan, Tao
2017-01-01
Tita Alissa Listyowardojo,1 Xiaoling Yan,2,3 Stephen Leyshon,1 Bobbie Ray-Sannerud,1 Xin Yan Yu,4 Kai Zheng,4 Tao Duan2,3 1Life Sciences Program, Group Technology and Research, DNV GL, Hovik, Norway; 2Quality and Safety Department, Shanghai First Maternity and Infant Hospital, 3Tongji University School of Medicine, Shanghai, 4Healthcare Department, Business Assurance, DNV GL, Beijing, China Objective: To assess safety culture at a public maternity hospital in Shanghai, China, using a sequenti...
Cultural visions of technology. Paradoxes of panoptic and interactive perspectives and methods
DEFF Research Database (Denmark)
Rasmussen, Lauge Baungaard
2013-01-01
The essential premise of the human-centered technology paradigm was clearly formulated by Howard Rosenbrock in the 1970s: technology should enrich rather than impoverish people’s work and life conditions. The increasing influence of technology in modern societies has been seen by some as offering...... great promise for the future, but by others as creating the electronic surveillance and/or manipulation of human genes, minds and beliefs. This paper approaches technological worlds as cultural visions in order to discuss and reflect the paradoxical process of viewing technology as part of a hope...
Eberlein, B; Baur, A; Neundorfer, M; Jahn, G
1991-05-01
Peripheral blood mononuclear cells (PBMCs) from 29 patients infected with human immunodeficiency virus (HIV) were cultured by two different methods. One was the standard co-culture technique, the other a newly developed microculture method. In this assay 10(6) PBMCs were cultivated in 250 microliters medium, no activating agents or allogeneic cells were present. P24 antigen production measured by this method was found in 7 out of 11 PBMC cultures of patients in the Walter Reed (WR) stage 1 or 2, whereas only 4 samples were positive by the co-culture procedure. Cultures from patients in the later stages of the disease (WR 5/6) showed a higher p24 production by the co-culture method than by the microculture assay. It is assumed that rapidly growing HIV strains can be better assessed by the co-culture method which may select for these strains. P24 expression can be more easily obtained by the microculture technique even in cases where slowly replicating strains may be present. In conclusion, results from the microculture procedure described may be a useful supplementation to findings observed by the co-culture method.
A scientist's voice in American culture. Simon Newcomb and the rhetoric of scientific method.
Moyer, A. E.
Through close readings of Newcomb's (1835 - 1909) published and unpublished works, the author illuminates the ways this eminent astronomer used the "rhetoric of scientific method" to great effect. The book devides into three sections: an introduction to the rhetoric of scientific method, a core of ten central chapters on Newcomb's life and thought, and the concluding commentary on pragmatism and scientific method.
Nübling, Simone; Schmidt, Herbert; Weiss, Agnes
2016-01-04
The genus Pseudomonas plays an important role in the lettuce leaf microbiota and certain species can induce spoilage. The aim of this study was to investigate the occurrence and diversity of Pseudomonas spp. on oak leaf lettuce and to follow their community shift during a six day cold storage with culture-dependent and culture-independent methods. In total, 21 analysed partial Pseudomonas 16S rRNA gene sequences matched closely (> 98.3%) to the different reference strain sequences, which were distributed among 13 different phylogenetic groups or subgroups within the genus Pseudomonas. It could be shown that all detected Pseudomonas species belonged to the P. fluorescens lineage. In the culture-dependent analysis, 73% of the isolates at day 0 and 79% of the isolates at day 6 belonged to the P. fluorescens subgroup. The second most frequent group, with 12% of the isolates, was the P. koreensis subgroup. This subgroup was only detected at day 0. In the culture-independent analysis the P. fluorescens subgroup and P. extremaustralis could not be differentiated by RFLP. Both groups were most abundant and amounted to approximately 46% at day 0 and 79% at day 6. The phytopathogenic species P. salmonii, P. viridiflava and P. marginalis increased during storage. Both approaches identified the P. fluorescens group as the main phylogenetic group. The results of the present study suggest that pseudomonads found by plating methods indeed represent the most abundant part of the Pseudomonas community on oak leaf lettuce. Copyright © 2015 Elsevier B.V. All rights reserved.
Slobodova, N V; Kolganova, T V; Bulygina, E S; Kuznetsov, B B; Turova, T P; Kravchenko, I K
2006-01-01
Three stable methane-oxidizing enrichment cultures, SB26, SB31, and SB31A were analyzed by transmission electron microscopy and by serological and molecular techniques. Electron microscopy revealed the presence of both type I and type II methanotrophs in SB31 and SB31A enrichments; only type II methanotrophs were found in SB26 enrichment. Methylosinus trichosporium was detected in all three enrichments by the application of species-specific antibodies. Additionally, Methylocystis echinoides was found in SB26 culture; Methylococcus capsulatus, in SB31 and SB31A; and Methylomonas methanica, in SB31. The analysis with pmoA and nifH gene sequences as phylogenetic markers revealed the presence of Methylosinus/Methylocystis group in all communities. Moreover, the analysis of pmoA sequences revealed the presence of Methylomonas in SB31. Methylocella was detected in SB31 and SB31A enrichments only by nifH analysis. It was concluded that the simultaneous application of different approaches reveals more reliable information on the diversity of methanotrophs.
The effect of thallus spreading method on productivity of Gracilaria sp. culture
Hidayatulbaroroh, R.; Nurhudah, M.; Edy, M. H.; Suharyadi
2018-04-01
The aim of this study was to determine growth of (Gracilaria sp.) with different spreading time of thallus. The study was conducted from March to April 2017 in pond located in Domas Village, Serang Region, Banten Province. The experiment followed completely randomized design with the treatment of different time on spreading of seaweed thallus during the culture period (45 days). Treatments were without spreading (as control), spreading every 2 weeks, and spreading every 3 weeks. The observed variables were weight of seaweed thallus and several water quality parameters. Analysis of seaweed weight used ANOVA test and Tukey HSD test. The results showed that the spread seaweed thallus had a significant effect on weight gain in 0.05 level. It used 100 gram Gracilaria sp. as initial weight, treatment without spreading thallus produced 508 gram, spreading every 2 weeks produced 906 gram and spreading every 3 weeks produced 790 gram. Based on the weight gain of thallus, seaweed culture by spreading thallus every 3 weeks and 2 weeks seem to be able to increase productivity by 56 % and 78 %, respectively.
Kendall, Elizabeth; Barnett, Leda
2015-01-01
To increase Aboriginal participation in mainstream health services, it is necessary to understand the factors that influence health service usage. This knowledge can contribute to the development of culturally appropriate health services that respect Aboriginal ways of being. We used a community-based participatory approach to examine the reasons for underutilization of health services by Aboriginal Australians. Based on three focus groups and 18 interviews with Aboriginal health professionals, leaders, and community members in rural, regional, and urban settings, we identified five factors that influenced usage, including (1) negative historical experiences, (2) cultural incompetence, (3) inappropriate communication, (4) a collective approach to health, and (5) a more holistic approach to health. Given that these factors have shaped negative Aboriginal responses to health interventions, they are likely to be principles by which more appropriate solutions are generated. Although intuitively sensible and well known, these principles remain poorly understood by non-Aboriginal health systems and even less well implemented. We have conceptualized these principles as the foundation of an empathic health system. Without empathy, health systems in Australia, and internationally, will continue to face the challenge of building effective services to improve the state of health for all minority populations.
Wiegmann, Vincent; Martinez, Cristina Bernal; Baganz, Frank
2018-04-24
Establish a method to indirectly measure evaporation in microwell-based cell culture systems and show that the proposed method allows compensating for liquid losses in fed-batch processes. A correlation between evaporation and the concentration of Na + was found (R 2 = 0.95) when using the 24-well-based miniature bioreactor system (micro-Matrix) for a batch culture with GS-CHO. Based on these results, a method was developed to counteract evaporation with periodic water additions based on measurements of the Na + concentration. Implementation of this method resulted in a reduction of the relative liquid loss after 15 days of a fed-batch cultivation from 36.7 ± 6.7% without volume corrections to 6.9 ± 6.5% with volume corrections. A procedure was established to indirectly measure evaporation through a correlation with the level of Na + ions in solution and deriving a simple formula to account for liquid losses.
Osuna, Diego; Barrera, Manuel; Strycker, Lisa A; Toobert, Deborah J; Glasgow, Russell E; Geno, Cristy R; Almeida, Fabio; Perdomo, Malena; King, Diane; Doty, Alyssa Tinley
2011-05-01
Because Latinas experience a high prevalence of type 2 diabetes and its complications, there is an urgent need to reach them with interventions that promote healthful lifestyles. This article illustrates a sequential approach that took an effective multiple-risk-factor behavior-change program and adapted it for Latinas with type 2 diabetes. Adaptation stages include (a) information gathering from literature and focus groups, (b) preliminary adaptation design, and (c) preliminary adaptation test. In this third stage, a pilot study finds that participants were highly satisfied with the intervention and showed improvement across diverse outcomes. Key implications for applications include the importance of a model for guiding cultural adaptations, and the value of procedures for obtaining continuous feedback from staff and participants during the preliminary adaptation test.
Balancing Culture, Ethics, and Methods in Qualitative Health Research with Aboriginal Peoples
Directory of Open Access Journals (Sweden)
L. M. Meadows
2003-12-01
Full Text Available Including Aboriginal women in qualitative health research expands our understanding of factors that contribute to their health and well-being. As part of the larger WHEALTH study, we gathered qualitative health data on midlife Aboriginal women living both on and off reserves. Despite careful planning and a commitment to methodological congruence and purposiveness we encountered a number of challenges that raised ethical questions. We present how we addressed these issues as we attempted to produce ethical, culturally sensitive, and sound research in a timely fashion. This article provides important considerations for other researchers and funding bodies while illustrating the benefits of working with Aboriginal women as an under researched population.
Method of forming psychomotor skills during the process of physical culture in general school.
Directory of Open Access Journals (Sweden)
Artyushenko O.F.
2012-12-01
Full Text Available The essence of the concept of "psychomotor skills" as a component of preparedness for managing voluntary movements is considered. In experiment took part 690 pupils among them were 362 pupils of middle school age and 328 senior pupils. It is proved that the essence of the problem of formation of psychomotor abilities is to increase the influence of psychological factors on the efficiency of motor activity of schoolchildren. Systematized, and developed new test psychomotor task and special games for the formation of students' readiness for playing time, power and spatial characteristics of movements. Shown that this is significantly update and enrich the methodological arsenal of physical culture and greatly improved psychomotor qualities students of secondary schools.
DEFF Research Database (Denmark)
Madsen, Jacob Østergaard
The aim of this study was thus to explore cultural probes (Gaver, Boucher et al. 2004), as a possible methodical approach, supporting knowledge production on situated and contextual aspects of occupation.......The aim of this study was thus to explore cultural probes (Gaver, Boucher et al. 2004), as a possible methodical approach, supporting knowledge production on situated and contextual aspects of occupation....
International Nuclear Information System (INIS)
Hale, T.W.; Wenzel, D.G.
1978-01-01
A method is described for measuring the latency of lysomal acid phosphatase in cultured rat heart endotheloid cells. 210 Pb was added to a medium used to demonstrate acid phosphatase activity by the Gomori lead method, and the amount of lead deposited was measured with a liquid scintillation counter. Deposition rates were measured after enzyme activation pretreatments with acetate buffer (pH 5.0) at various osmolalities, and after formaldehyde fixation. Formaldehyde, alloxan, or fluoride in the Gomori medium were evaluated for their differential effects on lysosomal and non-lysosomal acid phosphatase The method was found to provide a sensitive, rapid and quantitative evaluation of acid phosphatase latency and should be useful for studying the integrity of lysosomes within cells. (author)
A simple and rapid cultural method for detection of Enterobacter sakazakii in environmental samples
Guillaume-Gentil, O.; Sonnard, V.; Kandhai, M.C.; Marugg, J.; Joosten, H.
2005-01-01
A method was developed to detect and identify Enterobacter sakazakii in environmental samples. The method is based on selective enrichment at 45 ± 0.5°C in lauryl sulfate tryptose broth supplemented with 0.5 M NaCl and 10 mg/liter vancomycin (mLST) for 22 to 24 h followed by streaking on tryptone
Hales, Patrick Dean
2016-01-01
Mixed methods research becomes more utilized in education research every year. As this pluralist paradigm begins to take hold, it becomes more and more necessary to take a critical eye to studies making use of different mixed methods approaches. An area of education research that has yet struggled to find a foothold with mixed methodology is…
International Nuclear Information System (INIS)
Morgan, M.A.; Horstmeier, C.D.; DeYoung, D.R.; Roberts, G.D.
1983-01-01
The BACTEC system and three conventional media (Middlebrook 7H10, selective Middlebrook 7H11 [S7H11], and Lowenstein-Jensen [LJ] were compared for their mean recovery times and recovery rates of mycobacteria from acid-fast, smear-negative clinical specimens. Of the 71 smear-negative, culture-positive specimens recovered from 2,165 submitted smear-negative cultures, the BACTEC system detected 71.8%, compared with 88.7% for the conventional three-medium system. When media were individually compared, BACTEC medium (Middlebrook 7H12) was more successful in recovering mycobacteria (71.8%) than was LJ (62%), Middlebrook medium 7H10 (55.9%), or Middlebrook S7H11 medium (52.1%). Middlebrook 7H11 medium containing sodium selenate was also evaluated and did not increase the recovery rate or decrease the recovery time of mycobacterial species when compared with LJ, Middlebrook 7H10, S7H11, and 7H12 media. The mean detection time for the BACTEC system was less than that by conventional methods for the seven species of mycobacteria recovered. Detection times for Mycobacterium tuberculosis on the BACTEC system and conventional cultural systems were 13.7 and 26.3 days, respectively
Papas, Rebecca K; Sidle, John E; Wamalwa, Emmanuel S; Okumu, Thomas O; Bryant, Kendall L; Goulet, Joseph L; Maisto, Stephen A; Braithwaite, R Scott; Justice, Amy C
2010-08-01
Traditional homemade brew is believed to represent the highest proportion of alcohol use in sub-Saharan Africa. In Eldoret, Kenya, two types of brew are common: chang'aa, spirits, and busaa, maize beer. Local residents refer to the amount of brew consumed by the amount of money spent, suggesting a culturally relevant estimation method. The purposes of this study were to analyze ethanol content of chang'aa and busaa; and to compare two methods of alcohol estimation: use by cost, and use by volume, the latter the current international standard. Laboratory results showed mean ethanol content was 34% (SD = 14%) for chang'aa and 4% (SD = 1%) for busaa. Standard drink unit equivalents for chang'aa and busaa, respectively, were 2 and 1.3 (US) and 3.5 and 2.3 (Great Britain). Using a computational approach, both methods demonstrated comparable results. We conclude that cost estimation of alcohol content is more culturally relevant and does not differ in accuracy from the international standard.
Zhang, Binbin; Li, Yang; Wang, Gaoshang; Jia, Zhidong; Li, Haiyan; Peng, Qing; Gao, Yi
2018-04-19
Liver is one of the most important organ in the body. But there are many limitations about liver transplantation for liver failure. It is quite important to develop the xenogeneic biological liver for providing an alternation to transplantation or liver regeneration. In this paper, we proposed a method to construct a novel kind of agarose 3D-culture concave microwell array for spheroids formation of hepatic cells. Using the 3D printing method, the microwell array was fabricated with an overall size of 6.4 mm × 6.4 mm, containing 121 microwells with 400 μm width/400 μm thickness. By exploiting the Polydimethylsiloxane (PDMS) membranes as a bridge, we finally fabricated the agarose one. We co-cultured three types of liver cells with bionics design in the microwell arrays. Using the methods described above, the resulting co-formed hepatocyte spheroids maintained the high viability and stable liver-specific functions. This engineered agarose concave microwell array could be a potentially useful tool for forming the elements for biological liver support. After developing the complete system, we also would consider to scale up the application of this system. It will be not only applied to the therapy of human organ damage, but also to the development of disease models and drug screening models.
Fuegemann, Christopher J; Samraj, Ajoy K; Walsh, Stuart; Fleischmann, Bernd K; Jovinge, Stefan; Breitbach, Martin
2010-12-01
Herein, we describe two protocols for the in vitro differentiation of mouse embryonic stem cells (mESCs) into cardiomyocytes. mESCs are pluripotent and can be differentiated into cells of all three germ layers, including cardiomyocytes. The methods described here facilitate the differentiation of mESCs into the different cardiac subtypes (atrial-, ventricular-, nodal-like cells). The duration of cell culture determines whether preferentially early- or late-developmental stage cardiomyocytes can be obtained preferentially. This approach allows the investigation of cardiomyocyte development and differentiation in vitro, and also allows for the enrichment and isolation of physiologically intact cardiomyocytes for transplantation purposes. © 2010 by John Wiley & Sons, Inc.
DEFF Research Database (Denmark)
McCloskey, Douglas; Utrilla, Jose; Naviaux, Robert K.
2015-01-01
, we develop a fast-filtration method using pressuredriven Swinnex filters. We show that the method is fast enough to provide an accurate snapshot of intracellular metabolism, reduces matrix interference from the media to improve the number of compounds that can be detected, and is applicable...... to anaerobic and aerobic liquid cultures grown in a variety of culturing systems. Furthermore, we apply the fast filtration method to investigate differences in the absolute intracellular metabolite levels of anaerobic cultures grown in minimal and complex media....
Hamet, Maria Fernanda; Londero, Alejandra; Medrano, Micaela; Vercammen, Elisabeth; Van Hoorde, Koenraad; Garrote, Graciela L; Huys, Geert; Vandamme, Peter; Abraham, Analía G
2013-12-01
The biological and technological characteristics of kefiran as well as its importance in grain integrity led us to analyze the microbial kefir grain consortium with focus on Lactobacillus kefiranofaciens. The presence of L. kefiranofaciens in the nine kefir grains studied was demonstrated by denaturing gradient gel electrophoresis. By culture dependent methods applying a methodology focused on the search of this species, 22 isolates with typical morphology were obtained and identified applying a combination of SDS-PAGE of whole cell proteins, (GTG)5-PCR and sequence analysis of the housekeeping gene encoding the α-subunit of bacterial phenylalanyl-tRNA synthase (pheS). This polyphasic approach allowed the reliable identification of 11 L. kefiranofaciens, 5 Lactobacillus paracasei, 4 Lactobacillus kefiri and 2 Lactobacillus parakefiri isolates. Isolated L. kefiranofaciens strains produced polysaccharide in strain-dependent concentrations and EPS produced by them also differed in the degree of polymerization. The isolation and accurate identification of L. kefiranofaciens is relevant taking into account the important role of this microorganism in the grain ecosystem as well as its potential application as starter in food fermentations. Copyright © 2013 Elsevier Ltd. All rights reserved.
Sudhinaraset, May; Treleaven, Emily; Melo, Jason; Singh, Kanksha; Diamond-Smith, Nadia
2016-10-28
Mistreatment of women in healthcare settings during childbirth has been gaining attention globally. Mistreatment during childbirth directly and indirectly affects health outcomes, patient satisfaction, and the likelihood of delivering in a facility currently or in the future. It is important that we study patients' reports of mistreatment and abuse to develop a deeper understanding of how it is perpetrated, its consequences, and to identify potential points of intervention. Patients' perception of the quality of care is dependent, not only on the content of care, but importantly, on women's expectations of care. This study uses rich, mixed-methods data to explore women's characteristics and experiences of mistreatment during childbirth among slum-resident women in Uttar Pradesh, India. To understand the ways in which women's social and cultural factors influence their expectations of care and consequently their perceptions of respectful care, we adopt a Cultural Health Capital (CHC) framework. The quantitative sample includes 392 women, and the qualitative sample includes 26 women. Quantitative results suggest high levels of mistreatment (over 57 % of women reported any form of mistreatment). Qualitative findings suggest that lack of cultural health capital disadvantages patients in their patient-provider relationships, and that women use resources to improve care they receive. Participants articulated how providers set expectations and norms regarding behaviors in facilities; patients with lower social standing may not always understand standard practices and are likely to suffer poor health outcomes as a result. Of importance, however, patients also blame themselves for their own lack of knowledge. Lack of cultural health capital disadvantages women during delivery care in India. Providers set expectations and norms around behaviors during delivery, while women are often misinformed and may have low expectations of care.
Aggarwal, Neil Krishan; Balaji, Madhumitha; Kumar, Shuba; Mohanraj, Rani; Rahman, Atif; Verdeli, Helena; Araya, Ricardo; Jordans, M J D; Chowdhary, Neerja; Patel, Vikram
2014-07-01
Integrating consumer perspectives in developing and adapting psychological treatments (PTs) can enhance their acceptability in diverse cultural contexts. To describe the explanatory models (EMs) of depression in South Asia with the goal of informing the content of culturally appropriate PTs for this region. Two methods were used: a systematic review of published literature on the EMs of depression in South Asia; and in-depth interviews with persons with depression and family caregivers in two sites in India. Findings from both were analysed independently and then triangulated. There were 19 studies meeting our inclusion criteria. Interviews were conducted with 27 patients and 10 caregivers. Findings were grouped under four broad categories: illness descriptions, perceived impact, causal beliefs and self-help forms of coping. Depression was characterised predominantly by somatic complaints, stress, low mood, and negative and ruminative thoughts. Patients experienced disturbances in interpersonal relationships occupational functioning, and stigma. Negative life events, particularly relationship difficulties, were perceived as the main cause. Patients mostly engaged in distracting activities, religious practices, and received support from family and friends to cope with the illness. The primary data are entirely from India but the studies from the literature review covering South Asia are consistent with these findings. This study also does not include literature in local languages or explore how consumer perspectives change over time. EMs can inform cultural adaptations to PTs for depression in South Asia by defining target outcomes, content for psycho-education, and culturally appropriate treatment strategies. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Janosch Peter Heller
2015-11-01
Full Text Available Diseases such as age-related macular degeneration (AMD affect the retinal pigment epithelium (RPE and lead to the death of the epithelial cells and ultimately blindness. RPE transplantation is currently a major focus of eye research and clinical trials using human stem cell-derived RPE cells are ongoing. However, it remains to be established to which extent the source of RPE cells for transplantation affects their therapeutic efficacy and this needs to be explored in animal models. Autotransplantation of RPE cells has attractions as a therapy, but existing protocols to isolate adult RPE cells from rodents are technically difficult, time-consuming, have a low yield and are not optimized for long-term cell culturing. Here, we report a newly devised protocol which facilitates reliable and simple isolation and culture of RPE cells from adult rats. Incubation of a whole rat eyeball in 20 U/ml papain solution for 50 minutes yielded 4 x 104 viable RPE cells. These cells were hexagonal and pigmented upon culture. Using immunostaining, we demonstrated that the cells expressed RPE cell-specific marker proteins including cytokeratin 18 and RPE65, similar to RPE cells in vivo. Additionally, the cells were able to produce and secrete Bruch’s membrane matrix components similar to in vivo situation. Similarly, the cultured RPE cells adhered to isolated Bruch’s membrane as has previously been reported. Therefore, the protocol described in this article provides an efficient method for the rapid and easy isolation of high quantities of adult rat RPE cells. This provides a reliable platform for studying the therapeutic targets, testing the effects of drugs in a preclinical setup and to perform in vitro and in vivo transplantation experiments to study retinal diseases.
Ferreira, L; Sánchez-Juanes, F; Muñoz-Bellido, J L; González-Buitrago, J M
2011-07-01
Matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (MS) is a fast and reliable technology for the identification of microorganisms with proteomics approaches. Here, we compare an intact cell method and a protein extraction method before application on the MALDI plate for the direct identification of microorganisms in both urine and blood culture samples from clinical microbiology laboratories. The results show that the intact cell method provides excellent results for urine and is a good initial method for blood cultures. The extraction method complements the intact cell method, improving microorganism identification from blood culture. Thus, we consider that MALDI-TOF MS performed directly on urine and blood culture samples, with the protocols that we propose, is a suitable technique for microorganism identification, as compared with the routine methods used in the clinical microbiology laboratory. © 2010 The Authors. Clinical Microbiology and Infection © 2010 European Society of Clinical Microbiology and Infectious Diseases.
Directory of Open Access Journals (Sweden)
Grigorieva I.A.
2017-01-01
Full Text Available Physical and chemical methods of analysis are indispensable for restoration, study of painting techniques, examination and attribution of works of art. Development of new directions of investigations as well as improvements in sample preparation allow applying non-destructive analysis methods, minimizing amount of matter used to obtain informative spectra, preventing alteration and destruction of samples in the course of investigation. This paper observes the examples of applying optical and spectral methods, including molecular spectral analysis and electron microscopy, for study of binding media and pigments of painting and archaeological artifacts.
DEFF Research Database (Denmark)
Nielsen, Kristian Fog; Thrane, Ulf
2001-01-01
The paper presents a fast method for trichothecene profiling and chemotaxonomic studies in species of Fusarium, Stachybotrys, Trichoderma and Memnoniella. Micro scale extracted crude Fusarium extracts were derivatised using pentafluoropropionic anhydride and analysed by gas chromatography...
AN INTEGRATED CELL CULTURE/RT-PCR METHOD FOR DETECTING ENTEROVIRUS IN WATER
Echovirus and coxsackievirus can cause mild to severe disease following consumption of contaminated drinking water. However, comprehensive occurrence studies of enteroviruses in drinking water matrices are limited, in part because of the lack of available methods that are rapid, ...
DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools
Godsell, P. M.; Balls, M.
1973-01-01
Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)
Exum, Natalie G; Kosek, Margaret N; Davis, Meghan F; Schwab, Kellogg J
2017-08-22
Empiric quantification of environmental fecal contamination is an important step toward understanding the impact that water, sanitation, and hygiene interventions have on reducing enteric infections. There is a need to standardize the methods used for surface sampling in field studies that examine fecal contamination in low-income settings. The dry cloth method presented in this manuscript improves upon the more commonly used swabbing technique that has been shown in the literature to have a low sampling efficiency. The recovery efficiency of a dry electrostatic cloth sampling method was evaluated using Escherichia coli and then applied to household surfaces in Iquitos, Peru, where there is high fecal contamination and enteric infection. Side-by-side measurements were taken from various floor locations within a household at the same time over a three-month period to compare for consistency of quantification of E. coli bacteria. The dry cloth sampling method in the laboratory setting showed 105% (95% Confidence Interval: 98%, 113%) E. coli recovery efficiency off of the cloths. The field application demonstrated strong agreement of side-by-side results (Pearson correlation coefficient for dirt surfaces was 0.83 ( p samples (Pearson (0.53, p method can be utilized in households with high bacterial loads using either continuous (quantitative) or categorical (semi-quantitative) data. The standardization of this low-cost, dry electrostatic cloth sampling method can be used to measure differences between households in intervention and non-intervention arms of randomized trials.
Coton, Monika; Pawtowski, Audrey; Taminiau, Bernard; Burgaud, Gaëtan; Deniel, Franck; Coulloumme-Labarthe, Laurent; Fall, Abdoulaye; Daube, Georges; Coton, Emmanuel
2017-05-01
Kombucha, historically an Asian tea-based fermented drink, has recently become trendy in Western countries. Producers claim it bears health-enhancing properties that may come from the tea or metabolites produced by its microbiome. Despite its long history of production, microbial richness and dynamics have not been fully unraveled, especially at an industrial scale. Moreover, the impact of tea type (green or black) on microbial ecology was not studied. Here, we compared microbial communities from industrial-scale black and green tea fermentations, still traditionally carried out by a microbial biofilm, using culture-dependent and metabarcoding approaches. Dominant bacterial species belonged to Acetobacteraceae and to a lesser extent Lactobacteriaceae, while the main identified yeasts corresponded to Dekkera, Hanseniaspora and Zygosaccharomyces during all fermentations. Species richness decreased over the 8-day fermentation. Among acetic acid bacteria, Gluconacetobacter europaeus, Gluconobacter oxydans, G. saccharivorans and Acetobacter peroxydans emerged as dominant species. The main lactic acid bacteria, Oenococcus oeni, was strongly associated with green tea fermentations. Tea type did not influence yeast community, with Dekkera bruxellensis, D. anomala, Zygosaccharomyces bailii and Hanseniaspora valbyensis as most dominant. This study unraveled a distinctive core microbial community which is essential for fermentation control and could lead to Kombucha quality standardization. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Sandra Patricia Ospina Álvarez
2014-01-01
Full Text Available The chitin was isolated from the Ganoderma lucidum submerged cultures mycelium as potential source of chitin under biotechnological processes. The extraction of chitin was carried out through 5 different assays which involved mainly three phases: pulverization of the mushroom, deproteinization of the mycelia with NaOH solution, and a process of decolorization with potassium permanganate and oxalic acid. The chitin contents extracted from 9-day mycelia were 413, 339, 87, 78, and 144 mg/g−1 (milligrams of chitin/grams of dry biomass for A1, A2, A3, A4, and A5, respectively. Obtained chitin was characterized by X-Ray Diffraction (XRD, by Fourier transform infrared spectroscopy (FTIR, and by thermal analysis (TGA. The results showed that Ganoderma lucidum chitin has similar characteristic of chitin from different fonts. The advantage of the biotechnological processes and the fact that Ganoderma lucidum fungus may be used as a potential raw material for chitin production were demonstrated.
A novel method to immobilize collagen on polypropylene film as substrate for hepatocyte culture
International Nuclear Information System (INIS)
Zhang Yong; Wang Wenjie; Feng Qingling; Cui Fuzhai; Xu Yingxin
2006-01-01
To improve the biocompatibility of polypropylene membrane with hepatocytes, film was firstly allowed to generate peroxide groups by ammonium peroxydisulfate (APS) thermal decomposition and was then carboxylated by free radical grafting polymerization using acrylic acid as the monomer and ferrous(II) ions as redox initiator. Collagen was then covalently immobilized through amide bonds between the residue amine groups and carboxylic ones in the presence of water-soluble carbodiimide. The film was characterized by Fourier transformed infrared spectroscopy in attenuated total reflection mode (ATR-FTIR), X-photoelectron spectroscopy (XPS) and confocal laser scanning microscopy (CLSM), etc. The experimental results show that there exist hydroperoxide groups after APS aqueous thermal decomposition, which are subsequently converted into the polymeric free radicals initiating the vinyl monomers to subject grafting polymerization. The maximum collagen immobilization content is about 10.5 μg/cm 2 by ninhydrin assay. Hepatocytes cultured on collagen immobilized film show stable phenotype and normal liver-specific functions more than 20 days as observed by scanning electronic microscopy (SEM) and biochemical parameters determination
Ospina Álvarez, Sandra Patricia; Ramírez Cadavid, David Alexander; Ossa Orozco, Claudia Patricia; Zapata Ocampo, Paola; Atehortúa, Lucía
2014-01-01
The chitin was isolated from the Ganoderma lucidum submerged cultures mycelium as potential source of chitin under biotechnological processes. The extraction of chitin was carried out through 5 different assays which involved mainly three phases: pulverization of the mushroom, deproteinization of the mycelia with NaOH solution, and a process of decolorization with potassium permanganate and oxalic acid. The chitin contents extracted from 9-day mycelia were 413, 339, 87, 78, and 144 mg/g−1 (milligrams of chitin/grams of dry biomass) for A1, A2, A3, A4, and A5, respectively. Obtained chitin was characterized by X-Ray Diffraction (XRD), by Fourier transform infrared spectroscopy (FTIR), and by thermal analysis (TGA). The results showed that Ganoderma lucidum chitin has similar characteristic of chitin from different fonts. The advantage of the biotechnological processes and the fact that Ganoderma lucidum fungus may be used as a potential raw material for chitin production were demonstrated. PMID:24551839
A novel method to immobilize collagen on polypropylene film as substrate for hepatocyte culture
Energy Technology Data Exchange (ETDEWEB)
Zhang Yong [Biomaterials Laboratory, Department of Material Science and Engineering, Tsinghua University, Beijing 100084 (China); Wang Wenjie [Biomaterials Laboratory, Department of Material Science and Engineering, Tsinghua University, Beijing 100084 (China); Feng Qingling [Biomaterials Laboratory, Department of Material Science and Engineering, Tsinghua University, Beijing 100084 (China)]. E-mail: biomater@mail.tsinghua.edu.cn; Cui Fuzhai [Biomaterials Laboratory, Department of Material Science and Engineering, Tsinghua University, Beijing 100084 (China); Xu Yingxin [Institute of General Surgery, Chinese PLA General Hospital, Beijing 100853 (China)
2006-05-15
To improve the biocompatibility of polypropylene membrane with hepatocytes, film was firstly allowed to generate peroxide groups by ammonium peroxydisulfate (APS) thermal decomposition and was then carboxylated by free radical grafting polymerization using acrylic acid as the monomer and ferrous(II) ions as redox initiator. Collagen was then covalently immobilized through amide bonds between the residue amine groups and carboxylic ones in the presence of water-soluble carbodiimide. The film was characterized by Fourier transformed infrared spectroscopy in attenuated total reflection mode (ATR-FTIR), X-photoelectron spectroscopy (XPS) and confocal laser scanning microscopy (CLSM), etc. The experimental results show that there exist hydroperoxide groups after APS aqueous thermal decomposition, which are subsequently converted into the polymeric free radicals initiating the vinyl monomers to subject grafting polymerization. The maximum collagen immobilization content is about 10.5 {mu}g/cm{sup 2} by ninhydrin assay. Hepatocytes cultured on collagen immobilized film show stable phenotype and normal liver-specific functions more than 20 days as observed by scanning electronic microscopy (SEM) and biochemical parameters determination.
International Nuclear Information System (INIS)
Diaz, S.; Varki, A.
1985-01-01
The parent sialic acid N-acetylneuraminic acid can be modified or substituted in various ways, giving rise to a family of more than 25 compounds. The definitive identification of these compounds has previously required isolation of nanomole amounts for mass spectrometry or NMR. We have explored the possibility of using the known metabolic precursors of the sialic acids, particularly N-acetyl-[6-3H]mannosamine, to label and identify various forms of sialic acids in tissue culture cells. Firstly, we defined several variables that affect the labeling of sialic acids with N-acetyl-[6-3H]mannosamine. Secondly, we have devised a simple screening method to identify cell lines that synthesize substituted or modified sialic acids. We next demonstrate that it is possible to definitively identify the natures of the various labeled sialic acids without the use of mass spectrometry, even though they are present only in tracer amounts. The methods used include paper chromatography, analytical de-O-acetylation, periodate release of the 9-3H as [3H]formaldehyde (which is subsequently converted to a specific 3H-labeled chromophore), acylneuraminate pyruvate lyase treatment with identification of [3H]acylmannosamines, gas-liquid chromatography with radioactive detection, and two new high-pressure liquid chromatography methods utilizing the amine-adsorption:ion suppression and ion-pair principles. The use of an internal N-acetyl-[4-14C]neuraminic acid standard in each of these methods assures precision and accuracy. The combined use of these methods now allows the identification of radioactive tracer amounts of the various types of sialic acids in well-defined populations of tissue culture cells; it may also allow the identification of hitherto unknown forms of sialic acids
Application of Computer Vision Methods and Algorithms in Documentation of Cultural Heritage
Directory of Open Access Journals (Sweden)
David Káňa
2012-12-01
Full Text Available The main task of this paper is to describe methods and algorithms used in computer vision for fully automatic reconstruction of exterior orientation in ordered and unordered sets of images captured by digital calibrated cameras without prior informations about camera positions or scene structure. Attention will be paid to the SIFT interest operator for finding key points clearly describing the image areas with respect to scale and rotation, so that these areas could be compared to the regions in other images. There will also be discussed methods of matching key points, calculation of the relative orientation and strategy of linking sub-models to estimate the parameters entering complex bundle adjustment. The paper also compares the results achieved with above system with the results obtained by standard photogrammetric methods in processing of project documentation for reconstruction of the Žinkovy castle.
Coggon, David; Ntani, Georgia; Palmer, Keith T.; Felli, Vanda E.; Harari, Raul; Barrero, Lope H.; Felknor, Sarah A.; Gimeno, David; Cattrell, Anna; Serra, Consol; Bonzini, Matteo; Solidaki, Eleni; Merisalu, Eda; Habib, Rima R.; Sadeghian, Farideh; Kadir, Masood; Warnakulasuriya, Sudath S. P.; Matsudaira, Ko; Nyantumbu, Busisiwe; Sim, Malcolm R.; Harcombe, Helen; Cox, Ken; Marziale, Maria H.; Sarquis, Leila M.; Harari, Florencia; Freire, Rocio; Harari, Natalia; Monroy, Magda V.; Quintana, Leonardo A.; Rojas, Marianela; Salazar Vega, Eduardo J.; Harris, E. Clare; Vargas-Prada, Sergio; Martinez, J. Miguel; Delclos, George; Benavides, Fernando G.; Carugno, Michele; Ferrario, Marco M.; Pesatori, Angela C.; Chatzi, Leda; Bitsios, Panos; Kogevinas, Manolis; Oha, Kristel; Sirk, Tuuli; Sadeghian, Ali; Peiris-John, Roshini J.; Sathiakumar, Nalini; Wickremasinghe, A. Rajitha; Yoshimura, Noriko; Kielkowski, Danuta; Kelsall, Helen L.; Hoe, Victor C. W.; Urquhart, Donna M.; Derett, Sarah; McBride, David; Gray, Andrew
2012-01-01
Background The CUPID (Cultural and Psychosocial Influences on Disability) study was established to explore the hypothesis that common musculoskeletal disorders (MSDs) and associated disability are importantly influenced by culturally determined health beliefs and expectations. This paper describes the methods of data collection and various characteristics of the study sample. Methods/Principal Findings A standardised questionnaire covering musculoskeletal symptoms, disability and potential risk factors, was used to collect information from 47 samples of nurses, office workers, and other (mostly manual) workers in 18 countries from six continents. In addition, local investigators provided data on economic aspects of employment for each occupational group. Participation exceeded 80% in 33 of the 47 occupational groups, and after pre-specified exclusions, analysis was based on 12,426 subjects (92 to 1018 per occupational group). As expected, there was high usage of computer keyboards by office workers, while nurses had the highest prevalence of heavy manual lifting in all but one country. There was substantial heterogeneity between occupational groups in economic and psychosocial aspects of work; three- to five-fold variation in awareness of someone outside work with musculoskeletal pain; and more than ten-fold variation in the prevalence of adverse health beliefs about back and arm pain, and in awareness of terms such as “repetitive strain injury” (RSI). Conclusions/Significance The large differences in psychosocial risk factors (including knowledge and beliefs about MSDs) between occupational groups should allow the study hypothesis to be addressed effectively. PMID:22792189
Directory of Open Access Journals (Sweden)
Betty Sri Laksmi Jenie, . Nuratifa, . Suliantari
2001-04-01
Full Text Available This study was carried out to improve the safety and shelf life of cooked kembung fish (Rastrelliger sp, a traditional food called pindang fish. Fresh eviscerated fish was fisrt soaked in 2% NaCl solution for 15 minutes, drained, washed with tap water and drained again. Sodium chloride at 12% concentration (w/w was distributed on the whole surface of the fish. Fish was then laid on a wooden basket inside a clay pot, steamed for 30 minutes, and then cooled. Combine method applied to the steamed fish (pindang was soaking in a mixed culture of Lactobacillus plantarum kik and Lactococcus lactis subsp. cremoris in the ratio of 2 : 1 (v/v containing 4% Na-acetate for 2 hrs and after draining, the product was vacuum packed. The result showed that the combine method using mixed culture of lactic acid bacteria containing 4% Na-acetate could reduce the growth of Staphylococcus aureus by 3-6 log units, decrease the TMA (Trimethylamine content and maintain the organoleptic properties (texture, appearance and odor of pindang fish during 6 days storage at room temperature. Control treatment without 4% Na-acetate could only keep the pindang fish for 4 days. Vacuum and nonvacuum packaging did not show any significant difference.
Directory of Open Access Journals (Sweden)
T. R. Jordana
2016-06-01
Full Text Available Documentation of the three-dimensional (3D cultural landscape has traditionally been conducted during site visits using conventional photographs, standard ground surveys and manual measurements. In recent years, there have been rapid developments in technologies that produce highly accurate 3D point clouds, including aerial LiDAR, terrestrial laser scanning, and photogrammetric data reduction from unmanned aerial systems (UAS images and hand held photographs using Structure from Motion (SfM methods. These 3D point clouds can be precisely scaled and used to conduct measurements of features even after the site visit has ended. As a consequence, it is becoming increasingly possible to collect non-destructive data for a wide variety of cultural site features, including landscapes, buildings, vegetation, artefacts and gardens. As part of a project for the U.S. National Park Service, a variety of data sets have been collected for the Wormsloe State Historic Site, near Savannah, Georgia, USA. In an effort to demonstrate the utility and versatility of these methods at a range of scales, comparisons of the features mapped with different techniques will be discussed with regards to accuracy, data set completeness, cost and ease-of-use.
Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S
2017-06-01
Accurate quantitative measurement of viable hookworm ova from environmental samples is the key to controlling hookworm re-infections in the endemic regions. In this study, the accuracy of three quantitative detection methods [culture-based, vital stain and propidium monoazide-quantitative polymerase chain reaction (PMA-qPCR)] was evaluated by enumerating 1,000 ± 50 Ancylostoma caninum ova in the laboratory. The culture-based method was able to quantify an average of 397 ± 59 viable hookworm ova. Similarly, vital stain and PMA-qPCR methods quantified 644 ± 87 and 587 ± 91 viable ova, respectively. The numbers of viable ova estimated by the culture-based method were significantly (P methods. Therefore, both PMA-qPCR and vital stain methods appear to be suitable for the quantitative detection of viable hookworm ova. However, PMA-qPCR would be preferable over the vital stain method in scenarios where ova speciation is needed.
DEFF Research Database (Denmark)
Nakano, Yukiko; Rehm, Matthias
2009-01-01
In this paper we propose the method of multimodal corpus analysis to collect enough empirical data for modeling the behavior of embodied conversational agents. This is a prerequisite to ensure the usability of such complex interactive systems. So far, the development of embodied agents suffers fr...
Takahashi, M; Kita, Y; Kusaka, K; Mizuno, A; Goto-Yamamoto, N
2015-02-01
In the brewing industry, microbial management is very important for stabilizing the quality of the product. We investigated the detailed microbial community of beer during fermentation and maturation, to manage beer microbiology in more detail. We brewed a beer (all-malt) and two beerlike beverages (half- and low-malt) in pilot-scale fermentation and investigated the microbial community of them using a next-generation sequencer (454 GS FLX titanium), quantitative PCR, flow cytometry and a culture-dependent method. From 28 to 88 genera of bacteria and from 9 to 38 genera of eukaryotic micro-organisms were detected in each sample. Almost all micro-organisms died out during the boiling process. However, bacteria belonging to the genera Acidovorax, Bacillus, Brevundimonas, Caulobacter, Chryseobacterium, Methylobacterium, Paenibacillus, Polaromonas, Pseudomonas, Ralstonia, Sphingomonas, Stenotrophomonas, Tepidimonas and Tissierella were detected at the early and middle stage of fermentation, even though their cell densities were low (below approx. 10(3) cells ml(-1) ) and they were not almost detected at the end of fermentation. We revealed that the microbial community of beer during fermentation and maturation is very diverse and several bacteria possibly survive during fermentation. In this study, we revealed the detailed microbial communities of beer using next-generation sequencing. Some of the micro-organisms detected in this study were found in beer brewing process for the first time. Additionally, the possibility of growth of several bacteria at the early and middle stage of fermentation was suggested. © 2014 The Society for Applied Microbiology.
Single Cell Electroporation Method for Mammalian CNS Neurons in Organotypic Slice Cultures
Uesaka, Naofumi; Hayano, Yasufumi; Yamada, Akito; Yamamoto, Nobuhiko
Axon tracing is an essential technique to study the projection pattern of neurons in the CNS. Horse radish peroxidase and lectins have contributed to revealing many neural connection patterns in the CNS (Itaya and van Hoesen, 1982; Fabian and Coulter, 1985; Yoshihara, 2002). Moreover, a tracing method with fluorescent dye has enabled the observation of growing axons in living conditions, and demon strated a lot of developmental aspects in axon growth and guidance (Harris et al., 1987; O'Rourke and Fraser, 1990; Kaethner and Stuermer, 1992; Halloran and Kalil, 1994; Yamamoto et al., 1997). More recently, genetically encoded fluores cent proteins can be used as a powerful tool to observe various biological events. Several gene transfer techniques such as microinjection, biolistic gene gun, viral infection, lipofection and transgenic technology have been developed (Feng et al., 2000; Ehrengruber et al., 2001; O'Brien et al., 2001; Ma et al., 2002; Sahly et al., 2003). In particular, the electroporation technique was proved as a valuable tool, since it can be applied to a wide range of tissues and cell types with little toxicity and can be performed with relative technical easiness. Most methods, including a stand ard electroporation technique, are suitable for gene transfer to a large number of cells. However, this is not ideal for axonal tracing, because observation of individ ual axons is occasionally required. To overcome this problem, we have developed an electroporation method using glass micropipettes containing plasmid solutions and small current injection. Here we introduce the method in detail and exemplified results with some example applications and discuss its usefulness.
Methods Development for the Isolation and Culture of Primary Corneal Endothelial Cells
2017-02-01
a cell population particularly suitable for low serum propagation, provided that appropriate growth factors are available. A low serum medium...of MGK. 15. SUBJECT TERMS Cornea, chemical warfare agent, corneal endothelial cell, endothelium, growth , isolation, mouse, rabbit, porcine, in...with corneal SM exposure.2 A primary requirement in achieving this goal is to develop methods that enable the isolation of a pure CEC population and
Limbago, Brandi; Thompson, Angela D; Greene, Sharon A; MacCannell, Duncan; MacGowan, Charles E; Jolbitado, Beverly; Hardin, Henrietta D; Estes, Stephanie R; Weese, J Scott; Songer, J Glenn; Gould, L Hannah
2012-12-01
Three previously described methods for culture of Clostridium difficile from meats were evaluated by microbiologists with experience in C. difficile culture and identification. A consensus protocol using BHI broth enrichment followed by ethanol shock and plating to selective and non-selective media was selected for use, and all participating laboratories received hands-on training in the use of this method prior to study initiation. Retail meat products (N = 1755) were cultured for C. difficile over 12 months during 2010-2011 at 9 U.S. FoodNet sites. No C. difficile was recovered, although other clostridia were isolated. Published by Elsevier Ltd.
Jenderny, Jutta; Goldmann, Claudia; Thede, Rebekka; Ebrecht, Monika; Korioth, Frank
2014-01-01
There are only a few cytogenetic analysis (CA) studies that directly compare the novel cultivation technique using immunostimulatory CpG-oligonucleotide DSP30/interleukin-2 (DSP30/IL2) with other culture methods. Therefore, parallel cultures of peripheral blood of 129 chronic lymphocytic leukemia (CLL) patients were set up in unstimulated cultures, in the presence of pokeweed medium (PWM), and with DSP30/IL2. Furthermore, CA results were compared with data obtained by FISH. Clonal aberrations were observed by CA in 6% of the cases in unstimulated cultures, in 27% of the cases with PWM, and in 40% of the cases with DSP30/IL2. Some clonal aberrations were detected by CA only with one culture method. Using 3 different culture methods, clonal aberrations were detected in 41% of the cases by CA and in 71% of the cases by FISH. Altogether, 78% of the cases exhibited clonal aberrations discovered by CA and FISH. Also, CA detected clonal aberrations not targeted by FISH in 7% of the cases, and FISH identified clonal aberrations not detected by CA in 36% of the cases. Our study demonstrates that the combined use of CA with different culture methods together with FISH increases our knowledge of the genetic complexity and heterogeneity in CLL pathogenesis. © 2014 S. Karger AG, Basel.
The Screening of Culture Method for Lemna%浮萍培养方法的筛选
Institute of Scientific and Technical Information of China (English)
孙源; 曹凯文; 王仁君; 丁宁; 曹泰; 张萍; 李青竹; 赵熙宇; 崔萍; 李亚琪; 赵翔宇
2017-01-01
Under laboratory conditions,duckweed as the research obj ect,we tested 3 common ways to culture Lemna-6-well plates,culture dishes and glass beakers.With laboratory experiments of batch cul-ture,the growth curves of Lemna were gotten and fitted by Logistic model.Specifically we examinated bio-mass、the content of protein、the content of chlorophyll and Fv/Fm .This results showed that:(1 )The growth curve has characteristic of sigmoidal shape and the growth rate has density-dependent characteris-tic.The value of r and k of Lemna in glass beakers is above 6-well plates and culture dishes.(2)In culture dishes of duckweed Fv/Fm is greater than glass beakers is greater than 6-well plates.(3)In glass beakers of duckweed chlorophyll is greater than 6-well plates is greater than culture dishes .(4)In glass beakers of duckweed protein is greater than 6-well plates is greater than culture dishes .So the beaker cultivation method of duckweed works best under laboratory conditions.It suggests that how to culture duckweed un-der laboratory.%在实验室条件下,以青萍为研究对象,比较了3种较为常见的室内浮萍培养方法———六孔板培养法,培养皿培养法,烧杯培养法。该研究采用序批式培养方式培养青萍,利用单种种群增长的 Logistic 模型对生物量的增长曲线进行了分析,同时测定了青萍的生物量、蛋白质含量、叶绿素含量、PSII 最大光化学效率(Fv/Fm )等生理指标。结果表明:(1)青萍的生物量随时间变化的增长曲线呈典型的“S”型,在特定的环境和营养条件下,单位面积上青萍生物量的增长受密度的制约。其中,烧杯培养的青萍的 r值和K值>六孔板>培养皿。(2)烧杯培养的青萍的Fv/Fm 值>六孔板>培养皿。(3)烧杯培养的青萍叶绿素含量>六孔板>培养皿。(4)烧杯培养的青萍的蛋白质含量>六孔板>培养皿。因此烧杯培养法室内培养浮萍效果最好。上述培养方式
Feng, Xiaomin; Dong, Honghong; Yang, Pan; Yang, Ruijuan; Lu, Jun; Lv, Jie; Sheng, Jun
2016-08-01
The fermentation process of Yunnan arabica coffee is a typical wet fermentation. Its excellent quality is closely related to microbes in the process of fermentation. The purpose of this study was to isolate and identify the microorganisms in the wet method of coffee processing in Yunnan Province, China. Microbial community structure and dominant bacterial species were evaluated by traditional cultivated separation method and PCR-DGGE technology, and were further analyzed in combination with the changes of organic acid content, activity of pectinase, and physical parameters (pH and temperature). A large number of microorganisms which can produce pectinase were found. Among them, Enterobacter cowanii, Pantoea agglomerans, Enterobacteriaceae bacterium, and Rahnella aquatilis were the predominant gram-negative bacteria, Bacillus cereus was the predominant gram-positive bacterium, Pichia kluyveri, Hanseniaspora uvarum, and Pichia fermentans were the predominant yeasts, and all those are pectinase-producing microorganisms. As for the contents of organic acids, oxalic was the highest, followed by acetic and lactic acids. Butyrate and propionate, which were unfavorable during the fermentation period, were barely discovered.
Parker, Dianne; Wensing, Michel; Esmail, Aneez; Valderas, Jose M
2015-01-01
ABSTRACT Background: There is little guidance available to healthcare practitioners about what tools they might use to assess the patient safety culture. Objective: To identify useful tools for assessing patient safety culture in primary care organizations in Europe; to identify those aspects of performance that should be assessed when investigating the relationship between safety culture and performance in primary care. Methods: Two consensus-based studies were carried out, in which subject matter experts and primary healthcare professionals from several EU states rated (a) the applicability to their healthcare system of several existing safety culture assessment tools and (b) the appropriateness and usefulness of a range of potential indicators of a positive patient safety culture to primary care settings. The safety culture tools were field-tested in four countries to ascertain any challenges and issues arising when used in primary care. Results: The two existing tools that received the most favourable ratings were the Manchester patient safety framework (MaPsAF primary care version) and the Agency for healthcare research and quality survey (medical office version). Several potential safety culture process indicators were identified. The one that emerged as offering the best combination of appropriateness and usefulness related to the collection of data on adverse patient events. Conclusion: Two tools, one quantitative and one qualitative, were identified as applicable and useful in assessing patient safety culture in primary care settings in Europe. Safety culture indicators in primary care should focus on the processes rather than the outcomes of care. PMID:26339832
A new LC-ESI-MS/MS method to measure long-chain acylcarnitine levels in cultured cells
International Nuclear Information System (INIS)
Jauregui, Olga; Sierra, Adriana Y.; Carrasco, Patricia; Gratacos, Esther; Hegardt, Fausto G.; Casals, Nuria
2007-01-01
The quantitative evaluation of long-chain acylcarnitines in lipid extracts from cultured cells or tissues is a prerequisite to study carnitine palmitoyltransferase (CPT) activity. There is thus a need for the accurate measurement of the concentration of long-chain acylcarnitines at the lowest concentration present in lipid extracts. Here we report a fast and reliable quantitative method based on the use of weak acid extraction and liquid chromatography-electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) to quantify acylcarnitines through hydrophilic interaction chromatography. The method was validated using isotopic dilution and the results allow the analysis of a large number of samples at low concentration levels (down to 0.35 nmol L -1 for palmitoylcarnitine) with good inter- and intra-day precision. The method was used for the quantitative study of changes in concentration of palmitoylcarnitine and other acylcarnitines in PC-12 cells over-expressing CPT1a gene. It was also used to measure CPT1 activity in mitochondria isolated from transfected cells, giving similar results to the more common radiometric method, but with higher sensitivity
A new LC-ESI-MS/MS method to measure long-chain acylcarnitine levels in cultured cells
Energy Technology Data Exchange (ETDEWEB)
Jauregui, Olga [Scientific and Technical Services, University of Barcelona (Spain); Sierra, Adriana Y.; Carrasco, Patricia; Gratacos, Esther [Molecular and Cellular Unit, School of Health Sciences, International University of Catalonia (Spain); Hegardt, Fausto G. [Department of Biochemistry and Molecular Biology, University of Barcelona, School of Pharmacy (Spain); Casals, Nuria [Molecular and Cellular Unit, School of Health Sciences, International University of Catalonia (Spain)], E-mail: ncasals@csc.uic.es
2007-09-05
The quantitative evaluation of long-chain acylcarnitines in lipid extracts from cultured cells or tissues is a prerequisite to study carnitine palmitoyltransferase (CPT) activity. There is thus a need for the accurate measurement of the concentration of long-chain acylcarnitines at the lowest concentration present in lipid extracts. Here we report a fast and reliable quantitative method based on the use of weak acid extraction and liquid chromatography-electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) to quantify acylcarnitines through hydrophilic interaction chromatography. The method was validated using isotopic dilution and the results allow the analysis of a large number of samples at low concentration levels (down to 0.35 nmol L{sup -1} for palmitoylcarnitine) with good inter- and intra-day precision. The method was used for the quantitative study of changes in concentration of palmitoylcarnitine and other acylcarnitines in PC-12 cells over-expressing CPT1a gene. It was also used to measure CPT1 activity in mitochondria isolated from transfected cells, giving similar results to the more common radiometric method, but with higher sensitivity.
Santiago, Axel Rodolfo; Hernández, Betsy; Rodríguez, Marina; Romero, Hilda
2004-12-01
The purpose of this work was to compare the efficacy of blood culture conventional method vs. a modified lysis/centrifugation technique. Out of 450 blood specimens received in one year, 100 where chosen for this comparative study: 60 from patients with AIDS, 15 from leukemic patients, ten from febrile neutropenic patients, five from patients with respiratory infections, five from diabetics and five from septicemic patients. The specimens were processed, simultaneously, according to the above mentioned methodologies with daily inspections searching for fungal growth in order to obtain the final identification of the causative agent. The number (40) of isolates recovered was the same using both methods, which included; 18 Candida albicans (45%), ten Candida spp. (25%), ten Histoplasma capsulatum (25%), and two Cryptococcus neoformans (5%). When the fungal growth time was compared by both methods, growth was more rapid when using the modified lysis/centrifugation technique than when using the conventional method. Statistical analysis revealed a significant difference (pcentrifugation technique showed to be more efficacious than the conventional one, and therefore the implementation of this methodology is highly recommended for the isolation of fungi from blood.
Enomoto, Junko; Kageyama, Tatsuto; Myasnikova, Dina; Onishi, Kisaki; Kobayashi, Yuka; Taruno, Yoko; Kanai, Takahiro; Fukuda, Junji
2018-05-01
Self-assembled monolayers (SAMs) have been used to elucidate interactions between cells and material surface chemistry. Gold surfaces modified with oligopeptide SAMs exhibit several unique characteristics, such as cell-repulsive surfaces, micropatterns of cell adhesion and non-adhesion regions for control over cell microenvironments, and dynamic release of cells upon external stimuli under culture conditions. However, basic procedures for the preparation of oligopeptide SAMs, including appropriate cleaning methods of the gold surface before modification, have not been fully established. Because gold surfaces are readily contaminated with organic compounds in the air, cleaning methods may be critical for SAM formation. In this study, we examined the effects of four gold cleaning methods: dilute aqua regia, an ozone water, atmospheric plasma, and UV irradiation. Among the methods, UV irradiation most significantly improved the formation of oligopeptide SAMs in terms of repulsion of cells on the surfaces. We fabricated an apparatus with a UV light source, a rotation table, and HEPA filter, to treat a number of gold substrates simultaneously. Furthermore, UV-cleaned gold substrates were capable of detaching cell sheets without serious cell injury. This may potentially provide a stable and robust approach to oligopeptide SAM-based experiments for biomedical studies. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Liu, Mingyue; Oyarzabal, Esteban; Yang, Rui; Murphy, Stephanie J; Hurn, Patricia D.
2008-01-01
Female astrocytes sustain less cell death from oxygen-glucose deprivation (OGD) than male astrocytes. Arimidex, an aromatase inhibitor, abolishes these sex differences. To verify sex-dependent differences in P450 aromatase function in astrocyte cell death following OGD, we developed a novel method that uses sex-specific and genotype-specific single pup primary astrocyte cultures from wild-type (WT) and aromatase-knockout (ArKO) mice. After determining sex by external and internal examination as well as PCR and genotype by PCR amplification of tail cDNA, we established cultures from 1−3 day-old male and female, WT and ArKO mice pups and grew them to confluence in estrogen-free media. Cell death was measured by lactate dehydrogenase (LDH) assay. Our study shows that, while WT female astrocytes are more resistant to OGD than WT male cells, sex differences disappear in ArKO cells. Cell death is significantly increased in ArKO compared to WT in female astrocytes but not male cells. Therefore, P450 aromatase appears to be essential in endogenous neuroprotection in females, and this finding may have clinical implications. This innovative technique may also be applied to other in vitro studies of sex-related functional differences. PMID:18436308
Directory of Open Access Journals (Sweden)
David Coggon
Full Text Available The CUPID (Cultural and Psychosocial Influences on Disability study was established to explore the hypothesis that common musculoskeletal disorders (MSDs and associated disability are importantly influenced by culturally determined health beliefs and expectations. This paper describes the methods of data collection and various characteristics of the study sample.A standardised questionnaire covering musculoskeletal symptoms, disability and potential risk factors, was used to collect information from 47 samples of nurses, office workers, and other (mostly manual workers in 18 countries from six continents. In addition, local investigators provided data on economic aspects of employment for each occupational group. Participation exceeded 80% in 33 of the 47 occupational groups, and after pre-specified exclusions, analysis was based on 12,426 subjects (92 to 1018 per occupational group. As expected, there was high usage of computer keyboards by office workers, while nurses had the highest prevalence of heavy manual lifting in all but one country. There was substantial heterogeneity between occupational groups in economic and psychosocial aspects of work; three- to five-fold variation in awareness of someone outside work with musculoskeletal pain; and more than ten-fold variation in the prevalence of adverse health beliefs about back and arm pain, and in awareness of terms such as "repetitive strain injury" (RSI.The large differences in psychosocial risk factors (including knowledge and beliefs about MSDs between occupational groups should allow the study hypothesis to be addressed effectively.
Novel method to dynamically load cells in 3D-hydrogels culture for blast injury studies
Sory, David R.; Areias, Anabela C.; Overby, Darryl R.; Proud, William G.
2017-01-01
For at least a century explosive devices have been one of the most important causes of injuries in military conflicts as well as in terrorist attacks. Although significant experimental and modelling efforts have been focussed on blast injuries at the organ or tissue level, few studies have investigated the mechanisms of blast injuries at the cellular level. This paper introduces an in vitro method compatible with living cells to examine the effects of high stress and short-duration pulses relevant to blast loadings and blunt trauma. The experimental phase involves high strain-rate axial compression of cylindrical specimens within an hermetically sealed chamber made of biocompatible polymer. Numerical simulations were performed in order to verify the experimental loading conditions and to characterize the loading path within the sample. A proof of concept is presented so as to establish a new window to address fundamental questions regarding blast injury at the cellular level.
DEFF Research Database (Denmark)
van der Valk, J; Brunner, D; De Smet, K
2010-01-01
with an undefined and variable composition. Defined media supplements are commercially available for some cell types. However, information on the formulation by the companies is often limited and such supplements can therefore not be regarded as completely defined. The development of defined media is difficult......, reproducible and reduce the use of experimental animals. Good cell culture practice (GCCP) is an attempt to develop a common standard for in vitro methods. The implementation of the use of chemically defined media is part of the GCCP. This will decrease the dependence on animal serum, a supplement...... and often takes place in isolation. A workshop was organised in 2009 in Copenhagen to discuss strategies to improve the development and use of serum-free defined media. In this report, the results from the meeting are discussed and the formulation of a basic serum-free medium is suggested. Furthermore...
Directory of Open Access Journals (Sweden)
A. A. Al-Sulami
2012-01-01
Full Text Available Helicobacter pylori is recognized by the World Health Organization to be the primary cause of peptic ulcers, chronic gastritis, and stomach cancer, though the source of human infection is not well understood. One of the problems in understanding the source of human contamination is the difficulty in isolating the organism from the environment. However, the combination of PCR results with those of culturing of 471 drinking water samples can provide a more accurate picture of H. pylori detection. In this method 78 presumptive H. pylori colonies out of 266 tap water samples were obtained in the preliminary detection on modified Columbia agar (MCUA slant relying on urease positivity with a rate of 29.3%. However, only 11 out of them were confirmed by Gram staining and biochemical tests reducing the rate to 4.13% whereas only 3 (1.46% from 205 reverse osmosis (RO water samples. Furthermore, only 6 (54.5% out of the 11 isolates from tap water and 1 (33.3% of the 3 RO isolates were confirmed by 16SrRNA PCR. Thus PCR confirmation reduced the rate to 2.2%. In addition, only 4 (4% of 100 tap water samples negative for H. pylori by culture method were H. pylori positive by 16SrRNA. Water samples were collected from 24 districts of Basrah Governorate from February–December 2009. The direct recovery of H. pylori from drinking water is both alarming and scientifically exciting in terms of the investigation of its epidemiology.
Wolk, D M; Johnson, C H; Rice, E W; Marshall, M M; Grahn, K F; Plummer, C B; Sterling, C R
2000-04-01
The microsporidia have recently been recognized as a group of pathogens that have potential for waterborne transmission; however, little is known about the effects of routine disinfection on microsporidian spore viability. In this study, in vitro growth of Encephalitozoon syn. Septata intestinalis, a microsporidium found in the human gut, was used as a model to assess the effect of chlorine on the infectivity and viability of microsporidian spores. Spore inoculum concentrations were determined by using spectrophotometric measurements (percent transmittance at 625 nm) and by traditional hemacytometer counting. To determine quantitative dose-response data for spore infectivity, we optimized a rabbit kidney cell culture system in 24-well plates, which facilitated calculation of a 50% tissue culture infective dose (TCID(50)) and a minimal infective dose (MID) for E. intestinalis. The TCID(50) is a quantitative measure of infectivity and growth and is the number of organisms that must be present to infect 50% of the cell culture wells tested. The MID is as a measure of a system's permissiveness to infection and a measure of spore infectivity. A standardized MID and a standardized TCID(50) have not been reported previously for any microsporidian species. Both types of doses are reported in this paper, and the values were used to evaluate the effects of chlorine disinfection on the in vitro growth of microsporidia. Spores were treated with chlorine at concentrations of 0, 1, 2, 5, and 10 mg/liter. The exposure times ranged from 0 to 80 min at 25 degrees C and pH 7. MID data for E. intestinalis were compared before and after chlorine disinfection. A 3-log reduction (99.9% inhibition) in the E. intestinalis MID was observed at a chlorine concentration of 2 mg/liter after a minimum exposure time of 16 min. The log(10) reduction results based on percent transmittance-derived spore counts were equivalent to the results based on hemacytometer-derived spore counts. Our data
Isaksson, Sven; Funcke, Alexander; Envall, Ida; Enquist, Magnus; Lindenfors, Patrik
2015-01-01
Here we present an analytical technique for the measurement and evaluation of changes in chronologically sequenced assemblages. To illustrate the method, we studied the cultural evolution of European cooking as revealed in seven cook books dispersed over the past 800 years. We investigated if changes in the set of commonly used ingredients were mainly gradual or subject to fashion fluctuations. Applying our method to the data from the cook books revealed that overall, there is a clear continuity in cooking over the ages--cooking is knowledge that is passed down through generations, not something (re-)invented by each generation on its own. Looking at three main categories of ingredients separately (spices, animal products and vegetables), however, disclosed that all ingredients do not change according to the same pattern. While choice of animal products was very conservative, changing completely sequentially, changes in the choices of spices, but also of vegetables, were more unbounded. We hypothesize that this may be due a combination of fashion fluctuations and changes in availability due to contact with the Americas during our study time period. The presented method is also usable on other assemblage type data, and can thus be of utility for analyzing sequential archaeological data from the same area or other similarly organized material.
International Nuclear Information System (INIS)
Perdue, S.W.; Kimball, R.F.; Hsie, A.W.
1977-01-01
A single-gelatin expanded film method for double-isotope autoradiography is described. A preliminary classification based upon silver-grain distribution is used to assign labeled cells to 3 H only or with 14 C classes. Optical sectioning combined with grain counting is employed to obtain ratios for classifying cells labeled with 14 C into 14 C only and 3 H + 14 C classes. The method has been tested with CHO-K1 cells in plateau-phase cultures using two 24-h labeling periods. The experimental design allowed for independent estimation of the expected frequencies of label classes under conditions that provided a wide range of possible label levels and combinations. Previous methods have used time-consuming applications of two emulsion layers and exposures to distinguish between cells labeled with 3 H only or with 14 C and do not identify the 3 H + 14 C class. A single-gelatin expanded film requires only one exposure and permits all label classes to be determined by an objective grain-counting procedure
Directory of Open Access Journals (Sweden)
Sven Isaksson
Full Text Available Here we present an analytical technique for the measurement and evaluation of changes in chronologically sequenced assemblages. To illustrate the method, we studied the cultural evolution of European cooking as revealed in seven cook books dispersed over the past 800 years. We investigated if changes in the set of commonly used ingredients were mainly gradual or subject to fashion fluctuations. Applying our method to the data from the cook books revealed that overall, there is a clear continuity in cooking over the ages--cooking is knowledge that is passed down through generations, not something (re-invented by each generation on its own. Looking at three main categories of ingredients separately (spices, animal products and vegetables, however, disclosed that all ingredients do not change according to the same pattern. While choice of animal products was very conservative, changing completely sequentially, changes in the choices of spices, but also of vegetables, were more unbounded. We hypothesize that this may be due a combination of fashion fluctuations and changes in availability due to contact with the Americas during our study time period. The presented method is also usable on other assemblage type data, and can thus be of utility for analyzing sequential archaeological data from the same area or other similarly organized material.
Isaksson, Sven; Funcke, Alexander; Envall, Ida; Enquist, Magnus; Lindenfors, Patrik
2015-01-01
Here we present an analytical technique for the measurement and evaluation of changes in chronologically sequenced assemblages. To illustrate the method, we studied the cultural evolution of European cooking as revealed in seven cook books dispersed over the past 800 years. We investigated if changes in the set of commonly used ingredients were mainly gradual or subject to fashion fluctuations. Applying our method to the data from the cook books revealed that overall, there is a clear continuity in cooking over the ages – cooking is knowledge that is passed down through generations, not something (re-)invented by each generation on its own. Looking at three main categories of ingredients separately (spices, animal products and vegetables), however, disclosed that all ingredients do not change according to the same pattern. While choice of animal products was very conservative, changing completely sequentially, changes in the choices of spices, but also of vegetables, were more unbounded. We hypothesize that this may be due a combination of fashion fluctuations and changes in availability due to contact with the Americas during our study time period. The presented method is also usable on other assemblage type data, and can thus be of utility for analyzing sequential archaeological data from the same area or other similarly organized material. PMID:25970578
Morita, Masakazu; Shimamura, Hiroko; Ishida, Natsuko; Imamura, Koreyoshi; Sakiyama, Takaharu; Nakanishi, Kazuhiro
2004-01-01
alpha-Glucosidase was produced using recombinant Aspergillus oryzae by membrane-surface liquid culture (MSLC), a method previously developed by the authors and the results compared with other methods, including shaking flask culture (SFC), agar-plate culture (APC), culture on urethane sponge supports (USC), and liquid surface culture (LSC) to determine possible reasons for the advantageous features of MSLC. When yeast extract was used as a nitrogen source, the amount of enzyme produced by MSLC was 5 or more times higher than those for SFC and LSC, but similar to that using APC. Enzyme production in USC was slightly lower than in MSLC and APC. Cell growth was similar irrespective of the cultivation method used. When NaNO3, a typical inorganic nitrogen source was used, enzyme production in all the cultures was lower than that using yeast extract. However, even using NaNO3, the amount of the enzyme produced by MSLC was 8 to 20 times higher than those by SFC, APC, USC, and LSC. Although cell growth using NaNO3 was similar to that for yeast extract in MSLC, it was markedly decreased in SFC, APC, and LSC. The reason for the difference in enzyme productivity for various cultivation methods using yeast extract and NaNO3 as a nitrogen source is discussed, on the basis of the experimental findings. The role of the oxygen transfer effect and gene expression levels in enzyme production were also examined.
Directory of Open Access Journals (Sweden)
Zhengqi Chang
Full Text Available To date, various types of cells for seeding regenerative scaffolds have been used for bone tissue engineering. Among seed cells, the mesenchymal stem cells derived from human umbilical cord Wharton's jelly (hUCMSCs represent a promising candidate and hold potential for bone tissue engineering due to the the lack of ethical controversies, accessibility, sourced by non-invasive procedures for donors, a reduced risk of contamination, osteogenic differentiation capacities, and higher immunomodulatory capacity. However, the current culture methods are somewhat complicated and inefficient and often fail to make the best use of the umbilical cord (UC tissues. Moreover, these culture processes cannot be performed on a large scale and under strict quality control. As a result, only a small quantity of cells can be harvested using the current culture methods. To solve these problems, we designed and evaluated an UC Wharton's jelly repeated culture device. Using this device, hUCMSCs were obtained from the repeated cultures and their quantities and biological characteristics were compared. We found that using our culture device, which retained all tissue blocks on the bottom of the dish, the total number of obtained cells increased 15-20 times, and the time required for the primary passage was reduced. Moreover, cells harvested from the repeated cultures exhibited no significant difference in their immunophenotype, potential for multilineage differentiation, or proliferative, osteoinductive capacities, and final osteogenesis. The application of the repeated culture frame (RCF not only made full use of the Wharton's jelly but also simplified and specified the culture process, and thus, the culture efficiency was significantly improved. In summary, abundant hUCMSCs of dependable quality can be acquired using the RCF.
Zheng, X.; Zheng, Y.; Han, B.; Zwietering, M.H.; Samson, R.A.; Boekhout, T.; Nout, M.J.R.
2012-01-01
Daqu is a traditional fermentation starter that is used for Chinese liquor production. Although partly mechanized, its manufacturing process has remained traditional. We investigated the microbial diversity of Fen-Daqu, a starter for light-flavour liquor, using combined culture-dependent and
Directory of Open Access Journals (Sweden)
Sílvia C. Gonçalves
2014-06-01
Full Text Available The gonads of sea urchins have increased interest for human consumption, as a culinary delicacy worldwide. In Europe, the species Paracentrotus lividus was identified as an ideal candidate to meet the growing demand for this product, due to its high gonadosomatic index and easy access. However, the current commercial model, based on the exploitation its natural populations, may be unsustainable. Therefore, its production in aquaculture would be beneficial to avoid depletion of natural stocks of these organisms. The present study sought to develop a culture system for Paracentrotus lividus in aquaculture, which would allow maintaining the early embryonic and larval stages of this animal. A trial was set using 3 gametal release methods (due to stress induced by capture and by injecting 0.125M and 0.250M of potassium chloride and 3 densities of sea urchin embryos (530 embryos/L, 1000 embryos/L and 2000 embryos/L, using 5 replicate individual culture tanks for each combined factor. The embryos were obtained by adding gametes to sea water, in a proportion 1 egg : 100 spermatozoids, and by discarding unfertilized floating eggs by decantation. Afterwards, the embryos were transferred to a culture system composed by cylindrical-conical plastic tanks of 2L. These were decontaminated and filled with 0.750L of sea water, continuously aerated through a sterile pipette of 3mL. These tanks were placed on metal shelves, artificially illuminated with daylight fluorescent lamps (18w/765, 400Lux and maintained at 22°C. The larvae were fed each 2 days, with a mixture of microalgae Tetraselmis chuii, Phaeodactylum tricornumtum and Thalassiosira weliflogii at a concentration of 800-1000 microalgae/mL, adding 15µL, 50µL and 30µL to each individual tank, respectively for each of the initial larval densities introduced. There was an influence of the factor initial larval density in the mortality rate, wherein the number of larvae that died during the trial was much
Teramura, H; Sota, K; Iwasaki, M; Ogihara, H
2017-07-01
Sanita-kun™ CC (coliform count) and EC (Escherichia coli/coliform count), sheet quantitative culture systems which can avoid chromogenic interference by lactase in food, were evaluated in comparison with conventional methods for these bacteria. Based on the results of inclusivity and exclusivity studies using 77 micro-organisms, sensitivity and specificity of both Sanita-kun™ met the criteria for ISO 16140. Both media were compared with deoxycholate agar, violet red bile agar, Merck Chromocult™ coliform agar (CCA), 3M Petrifilm™ CC and EC (PEC) and 3-tube MPN, as reference methods, in 100 naturally contaminated food samples. The correlation coefficients of both Sanita-kun™ for coliform detection were more than 0·95 for all comparisons. For E. coli detection, Sanita-kun™ EC was compared with CCA, PEC and MPN in 100 artificially contaminated food samples. The correlation coefficients for E. coli detection of Sanita-kun™ EC were more than 0·95 for all comparisons. There were no significant differences in all comparisons when conducting a one-way analysis of variance (anova). Both Sanita-kun™ significantly inhibited colour interference by lactase when inhibition of enzymatic staining was assessed using 40 natural cheese samples spiked with coliform. Our results demonstrated Sanita-kun™ CC and EC are suitable alternatives for the enumeration of coliforms and E. coli/coliforms, respectively, in a variety of foods, and specifically in fermented foods. Current chromogenic media for coliforms and Escherichia coli/coliforms have enzymatic coloration due to breaking down of chromogenic substrates by food lactase. The novel sheet culture media which have film layer to avoid coloration by food lactase have been developed for enumeration of coliforms and E. coli/coliforms respectively. In this study, we demonstrated these media had comparable performance with reference methods and less interference by food lactase. These media have a possibility not only
Directory of Open Access Journals (Sweden)
Carolyn M Higuchi
Full Text Available In vitro growth of follicles is a promising technology to generate large quantities of competent oocytes from immature follicles and could expand the potential of assisted reproductive technologies (ART. Isolated follicle culture is currently the primary method used to develop and mature follicles in vitro. However, this procedure typically requires complicated, time-consuming procedures, as well as destruction of the normal ovarian microenvironment. Here we describe a simplified 3-D ovarian culture system that can be used to mature multilayered secondary follicles into antral follicles, generating developmentally competent oocytes in vitro. Ovaries recovered from mice at 14 days of age were cut into 8 pieces and placed onto a thick Matrigel drop (3-D culture for 10 days of culture. As a control, ovarian pieces were cultured on a membrane filter without any Matrigel drop (Membrane culture. We also evaluated the effect of activin A treatment on follicle growth within the ovarian pieces with or without Matrigel support. Thus we tested four different culture conditions: C (Membrane/activin-, A (Membrane/activin+, M (Matrigel/activin-, and M+A (Matrigel/activin+. We found that the cultured follicles and oocytes steadily increased in size regardless of the culture condition used. However, antral cavity formation occurred only in the follicles grown in the 3-D culture system (M, M+A. Following ovarian tissue culture, full-grown GV oocytes were isolated from the larger follicles to evaluate their developmental competence by subjecting them to in vitro maturation (IVM and in vitro fertilization (IVF. Maturation and fertilization rates were higher using oocytes grown in 3-D culture (M, M+A than with those grown in membrane culture (C, A. In particular, activin A treatment further improved 3-D culture (M+A success. Following IVF, two-cell embryos were transferred to recipients to generate full-term offspring. In summary, this simple and easy 3-D ovarian
Directory of Open Access Journals (Sweden)
Pedro R. Portes
2016-07-01
Full Text Available This study validates a new tool for assessing differences in cultural adaptation for both majority and less dominant minority/immigrant adults in college in general. The Cultural Adaptation and Development Inventory (CADI is a self-report measure validated across multi-ethnic groups. The reliability and validity of a four factor model are adequate based several replication studies. Overall, the CADI provided evidence for a culturally valid measurement that shows both convergent and discriminant validity. Predicted ethnic group and gender differences were replicated with new groups of respondents for factors measuring Inter-Cultural Stress, Helplessness/Optimism, Positive Inter-cultural Adaptation and Inter-cultural Insensitivity. The study’s socio-cultural and usual types of validity is discussed in relation Berry’s (2003, Portes (1999 and Vygotski’s (1978 views regarding sociogenesis.
DEFF Research Database (Denmark)
Wegener, Henrik Caspar; Baggesen, Dorte Lau
1997-01-01
Two commercial enzyme immunoassays, designated EIA-1 and EIA-2, for the detection of salmonella in feces and cecal contents were compared to conventional culture methods. Out of 362 cecal content samples, 35 were positive by EIA-1 and 30 were positive by EIA-2 and conventional methods. Out of 189...
Okeyo, Kennedy Omondi; Kurosawa, Osamu; Yamazaki, Satoshi; Oana, Hidehiro; Kotera, Hidetoshi; Nakauchi, Hiromitsu; Washizu, Masao
2015-10-01
Mechanical methods for inducing differentiation and directing lineage specification will be instrumental in the application of pluripotent stem cells. Here, we demonstrate that minimization of cell-substrate adhesion can initiate and direct the differentiation of human pluripotent stem cells (hiPSCs) into cyst-forming trophoblast lineage cells (TLCs) without stimulation with cytokines or small molecules. To precisely control cell-substrate adhesion area, we developed a novel culture method where cells are cultured on microstructured mesh sheets suspended in a culture medium such that cells on mesh are completely out of contact with the culture dish. We used microfabricated mesh sheets that consisted of open meshes (100∼200 μm in pitch) with narrow mesh strands (3-5 μm in width) to provide support for initial cell attachment and growth. We demonstrate that minimization of cell adhesion area achieved by this culture method can trigger a sequence of morphogenetic transformations that begin with individual hiPSCs attached on the mesh strands proliferating to form cell sheets by self-assembly organization and ultimately differentiating after 10-15 days of mesh culture to generate spherical cysts that secreted human chorionic gonadotropin (hCG) hormone and expressed caudal-related homeobox 2 factor (CDX2), a specific marker of trophoblast lineage. Thus, this study demonstrates a simple and direct mechanical approach to induce trophoblast differentiation and generate cysts for application in the study of early human embryogenesis and drug development and screening.
Schmetzer, Oliver; Valentin, Patricia; Smorodchenko, Anna; Domenis, Rossana; Gri, Giorgia; Siebenhaar, Frank; Metz, Martin; Maurer, Marcus
2014-11-01
The identification and characterization of human mast cell (MC) functions are hindered by the shortage of MC populations suitable for investigation. Here, we present a novel technique for generating large numbers of well differentiated and functional human MCs from peripheral stem cells (=peripheral stem cell-derived MCs, PSCMCs). Innovative and key features of this technique include 1) the use of stem cell concentrates, which are routinely discarded by blood banks, as the source of CD34+ stem cells, 2) cell culture in serum-free medium and 3) the addition of LDL as well as selected cytokines. In contrast to established and published protocols that use CD34+ or CD133+ progenitor cells from full blood, we used a pre-enriched cell population obtained from stem cell concentrates, which yielded up to 10(8) differentiated human MCs per batch after only three weeks of culture starting with 10(6) total CD34+ cells. The total purity on MCs (CD117+, FcεR1+) generated by this method varied between 55 and 90%, of which 4-20% were mature MCs that contain tryptase and chymase and show expression of FcεRI and CD117 in immunohistochemistry. PSCMCs showed robust histamine release in response to stimulation with anti-FcεR1 or IgE/anti-IgE, and increased proliferation and differentiation in response to IL-1β or IFN-γ. Taken together, this new protocol of the generation of large numbers of human MCs provides for an innovative and suitable option to investigate the biology of human MCs. Copyright © 2014 Elsevier B.V. All rights reserved.
M.Sc. A. Jansz; Dr. A.J.C. van den Brule, van den; Dr. P.F.G. Wolffs; Ing J. Stalpers; Drs A.J.M. Loonen
2011-01-01
Matrix-assisted laser desorption/ionisation time of-flight mass spectrometry (MALDI-TOF MS) is a fast and reliable method for the identification of bacteria from agar media. Direct identification from positive blood cultures should decrease the time to obtaining the result. In this study, three
International Nuclear Information System (INIS)
Hogetsu, Daisuke; Koyama, Motoko; Minami, Harufumi
1990-01-01
In the creation of useful mutant plants using cell culture techniques, the examination on the effectiveness of selecting useful mutation at cell level and the possibility of raising the selection efficiency by irradiation was aimed at. The experimental method is described. The young plants which accumulate proline were obtained. The cells which showed the resistance to hydroxyproline also showed the resistance to salt. In the improvement of redifferentiation ability by irradiation, the method of fixing IAA in the tissues of azuki plants was examined. The possibility of examining the change of IAA due to irradiation by microautoradiography was obtained. It is intended to examine the distribution of IAA in the formation of adventitious roots from the epicotyl of azuki plants. In the introduction of cell engineering techniques in radiation breeding, it is the objective to introduce the genes which resist sour rot that Brassica campestris, Brassica napus, Brassica oleracea and so on have by utilizing cell fusion process. The fusion of the reproduction cells of Brassica napus pollens and the cell protoplasts of Brassica campestris was successfully carried out. The possibility of new asymmetric fusion in Brassica napus was shown. (K.I.)
Buket Özdemir Işık; Sara Demir
2017-01-01
Unsustainable urban growth has put pressure on urban coastal areas and historical–cultural structures. As such, the important role of coastline sustainability has been revealed, and planners must protect historical–cultural coast characteristics in order to increase the quality of life of citizens. For this reason, this present study investigated the effects of existing coast characteristics and historical–cultural structure changes in recreation and tourism with respect to the Trabzon coastl...
Directory of Open Access Journals (Sweden)
Verhelst Rita
2010-09-01
Full Text Available Abstract Background Streptococcus agalactiae (group B streptococcus; GBS is a significant cause of perinatal and neonatal infections worldwide. To detect GBS colonization in pregnant women, the CDC recommends isolation of the bacterium from vaginal and anorectal swab samples by growth in a selective enrichment medium, such as Lim broth (Todd-Hewitt broth supplemented with selective antibiotics, followed by subculture on sheep blood agar. However, this procedure may require 48 h to complete. We compared different sampling and culture techniques for the detection of GBS. Methods A total of 300 swabs was taken from 100 pregnant women at 35-37 weeks of gestation. For each subject, one rectovaginal, one vaginal and one rectal ESwab were collected. Plating onto Columbia CNA agar (CNA, group B streptococcus differential agar (GBSDA (Granada Medium and chromID Strepto B agar (CA, with and without Lim broth enrichment, were compared. The isolates were confirmed as S. agalactiae using the CAMP test on blood agar and by molecular identification with tDNA-PCR or by 16S rRNA gene sequence determination. Results The overall GBS colonization rate was 22%. GBS positivity for rectovaginal sampling (100% was significantly higher than detection on the basis of vaginal sampling (50%, but not significantly higher than for rectal sampling (82%. Direct plating of the rectovaginal swab on CNA, GBSDA and CA resulted in detection of 59, 91 and 95% of the carriers, respectively, whereas subculturing of Lim broth yielded 77, 95 and 100% positivity, respectively. Lim broth enrichment enabled the detection of only one additional GBS positive subject. There was no significant difference between GBSDA and CA, whereas both were more sensitive than CNA. Direct culture onto GBSDA or CA (91 and 95% detected more carriers than Lim broth enrichment and subculture onto CNA (77%. One false negative isolate was observed on GBSDA, and three false positives on CA. Conclusions In
Raupach-Rosin, Heike; Duddeck, Arne; Gehrlich, Maike; Helmke, Charlotte; Huebner, Johannes; Pletz, Mathias W; Mikolajczyk, Rafael; Karch, André
2017-08-01
Blood culture (BC) sampling rates in Germany are considerably lower than recommended. Aim of our study was to assess knowledge, attitudes, and practice of physicians in Germany regarding BC diagnostics. We conducted a cross-sectional mixed-methods study among physicians working in inpatient care in Germany. Based on the results of qualitative focus groups, a questionnaire-based quantitative study was conducted in 2015-2016. In total, 706 medical doctors and final-year medical students from 11 out of 16 federal states in Germany participated. BC sampling was considered an important diagnostic tool by 95% of the participants. However, only 23% of them would collect BCs in three scenarios for which BC ordering is recommended by present guidelines in Germany; almost one out of ten physicians would not have taken blood cultures in any of the three scenarios. The majority of participants (74%) reported not to adhere to the guideline recommendation that blood culture sampling should include at least two blood culture sets from two different injection sites. High routine in blood culture sampling, perceived importance of blood culture diagnostics, the availability of an in-house microbiological lab, and the department the physician worked in were identified as predictors for good blood culture practice. Our study suggests that there are substantial deficits in BC ordering and the application of guidelines for good BC practice in Germany. Based on these findings, multimodal interventions appear necessary for improving BC diagnostics.
International Nuclear Information System (INIS)
Guimaraes, Denise O.; Pupo, Monica T.; Borges, Keyller B.; Bonato, Pierina S.
2009-01-01
Tyrosol is a possible quorum sensing molecule in endophytic fungi. High-performance liquid chromatography (HPLC) coupled with diode array detector (DAD) was used for the analysis of tyrosol in liquid Czapek fungal cultures. The optimized conditions were gradient mobile phase, in linear mode, consisting initially of acetonitrile/water (1:9 v/v) and increasing up to acetonitrile (100%) in 30 minutes at a flow rate of 1 mL min -1 . The column used was a Zorbax ODS (250 x 4.6 mm, 5 μm) at 25 deg C. Liquid-liquid extraction of 0.5 mL medium (pH 7.0) with ethyl acetate and injection of 20 μL after solvent evaporation under air flow gave good results. Some validation parameters obtained were: linearity 0.0125-5.0 μg mL -1 medium (r = 0.9967), quantification limit of 0.0125 μg mL -1 medium, %CV (precision) and %E (accuracy) bellow 15% and recovery around 80%. Therefore, the developed method presented satisfactory validation parameters and it was efficient for the analysis of tyrosol in Czapek medium. (author)
New method for culture of zona-included or zona-free embryos: the Well of the Well (WOW) system.
Vajta, G; Peura, T T; Holm, P; Páldi, A; Greve, T; Trounson, A O; Callesen, H
2000-03-01
Culture of mammalian zygotes individually and in small groups results in lower developmental rates than culture of large groups. Zona-free zygotes also have impaired developmental potential in current culture systems. This paper describes a new approach to resolve the problems, the Well of the Well (WOW) system. Small wells (WOWs) were formed in four-well dishes by melting the bottom with heated steel rods. The WOWs were then rinsed, the wells were filled with medium, and the embryos were placed into the WOWs. To test the value of the WOW system a 3 x 3 factorial experiment was performed. Bovine presumptive zygotes were cultured from day 1 to day 7 (day 0: day of insemination) using three modules (single embryos, embryo groups of five, or single zona-digested embryos) and three different culture systems (400 microl medium, 200 microl drops, or WOWs). An additional control group consisted of 40 to 50 embryos cultured in 400 microl medium. The WOW system resulted in higher blastocyst/oocyte rates for all three modules (single: 59%; group of five: 61%; single zona-digested: 53%) than the culture in drops or in wells (P WOWs per well. The cell number of blastocysts cultured in the WOW system did not differ from that of the controls. Apart from its theoretical value in revealing the role of different factors influencing embryo development in vitro, the WOW system may have immediate practical consequences in certain areas of mammalian embryo production. Copyright 2000 Wiley-Liss, Inc.
Loonen, A J M; Jansz, A R; Stalpers, J; Wolffs, P F G; van den Brule, A J C
2012-07-01
Matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF MS) is a fast and reliable method for the identification of bacteria from agar media. Direct identification from positive blood cultures should decrease the time to obtaining the result. In this study, three different processing methods for the rapid direct identification of bacteria from positive blood culture bottles were compared. In total, 101 positive aerobe BacT/ALERT bottles were included in this study. Aliquots from all bottles were used for three bacterial processing methods, i.e. the commercially available Bruker's MALDI Sepsityper kit, the commercially available Molzym's MolYsis Basic5 kit and a centrifugation/washing method. In addition, the best method was used to evaluate the possibility of MALDI application after a reduced incubation time of 7 h of Staphylococcus aureus- and Escherichia coli-spiked (1,000, 100 and 10 colony-forming units [CFU]) aerobe BacT/ALERT blood cultures. Sixty-six (65%), 51 (50.5%) and 79 (78%) bottles were identified correctly at the species level when the centrifugation/washing method, MolYsis Basic 5 and Sepsityper were used, respectively. Incorrect identification was obtained in 35 (35%), 50 (49.5%) and 22 (22%) bottles, respectively. Gram-positive cocci were correctly identified in 33/52 (64%) of the cases. However, Gram-negative rods showed a correct identification in 45/47 (96%) of all bottles when the Sepsityper kit was used. Seven hours of pre-incubation of S. aureus- and E. coli-spiked aerobe BacT/ALERT blood cultures never resulted in reliable identification with MALDI-TOF MS. Sepsityper is superior for the direct identification of microorganisms from aerobe BacT/ALERT bottles. Gram-negative pathogens show better results compared to Gram-positive bacteria. Reduced incubation followed by MALDI-TOF MS did not result in faster reliable identification.
Morgan Consoli, Melissa L; Llamas, Jasmin D
2013-10-01
The current study investigated the role of cultural values in the resilience of Mexican American college students. Utilizing mixed methodology, 124 self-identified Mexican American college students were asked to complete an online survey, including a demographic questionnaire, the Resilience Scale, Mexican American Cultural Values Scale, and 2 open-ended questions concerning overcoming adversity and cultural values. As hypothesized, Mexican American traditional cultural values (Familismo, Respeto, Religiosidad, and Traditional Gender Roles) predicted resilience, with Familismo accounting for the majority of the variance. Consensual qualitative research (Hill, Thompson, & Nutt Williams, 1997) was used to identify emergent domains and themes within the open-ended question responses. Traditional Mexican American Value themes included Familismo, Ethnic Identity, Religiosidad, Perseverance, and Respeto. Results highlight the important role that certain Mexican American cultural values play in providing strength for overcoming adversities.
Lister, Michelle; Stevenson, Emma; Heeg, Daniela; Minton, Nigel P; Kuehne, Sarah A
2014-08-01
Effective isolation of Clostridium difficile from stool samples is important in the research setting, especially where low numbers of spores/vegetative cells may be present within a sample. In this study, three protocols for stool culture were investigated to find a sensitive, cost effective and timely method of C. difficile isolation. For the initial enrichment step, the effectiveness of two different rich media, cycloserine-cefoxitin fructose broth (CCFB) and cycloserine-cefoxitin mannitol broth with taurocholate and lysozyme (CCMB-TAL) were compared. For the comparison of four different, selective solid media; Cycloserine-cefoxitin fructose agar (CCFA), Cycloserine-cefoxitin egg yolk agar (CCEY), ChromID C. difficile and tryptone soy agar (TSA) with 5% sheep's blood with and without preceding broth enrichment were used. As a means to enable differentiation between C. difficile and other fecal flora, the effectiveness of the inclusion of a pH indictor (1% Neutral Red), was also evaluated. The data derived indicated that CCFB is more sensitive than CCMB-TAL, however, the latter had an improved recovery rate. A broth enrichment step had a reduced sensitivity over direct plating. ChromID C. difficile showed the best recovery rate whereas CCEY egg yolk agar was the most sensitive of the four. The addition of 1% Neutral Red did not show sufficient colour change when added to CCEY egg yolk agar to be used as a differential medium. For a low cost, timely and sensitive method of isolating C. difficile from stool samples we recommend direct plating onto CCEY egg yolk agar after heat shock. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Directory of Open Access Journals (Sweden)
Man Xiao
2017-01-01
Full Text Available Background Platinum-based agents are widely used in chemotherapy against solid tumors and insufficient intracellular drug accumulation is one of the leading causes of platinum resistance which is associated with poor survival of tumor patients. Thus, the detection of intracellular platinum is pivotal for studies aiming to overcome platinum resistance. In the present study, we aimed to establish a reliable graphite furnace atomic absorption spectrometry (GFAAS-based assay to quantify the intracellular platinum content for cultured cells. Methods Several most commonly applied cell preparation methods, including 0.2% HNO3, 0.2% Triton X-100, concentrated nitric acid, RIPA combined with concentrated nitric acid and hydroxide, followed by GFAAS for platinum detection were compared in ovarian, cervical and liver cancer cell lines to obtain the optimal one, and parameters regarding linearity, accuracy, precision and sensitivity were evaluated. Influence of other metals on platinum detection and the storage conditions of samples were also determined. Results The treatment of cells with 0.2% HNO3 was superior to other approaches with fewer platinum loss and better repeatability. The recovery rate and precision of this method were 97.3%–103.0% and 1.4%–3.8%, respectively. The average recoveries in the presence of other metals were 95.1%–103.1%. The detection limit was 13.23 ug/L. The recovery rate of platinum remained acceptable even in cell samples stored in −20 °C or −80 °C for two months. Discussion After comparison, we found that 0.2% HNO3 was optimal for intracellular platinum quantification based on GFAAS, which presented values compatible with that of inductively-coupled plasma mass-spectrometry (ICP-MS, and this is partially attributed to the simplicity of this method. Moreover, the assay was proved to be accurate, sensitive, cost-effective and suitable for the research of platinum-based antitumor therapy.
Directory of Open Access Journals (Sweden)
J.A. Khan
2013-09-01
Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four
Stachelska, M A
2017-09-26
The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.
DEFF Research Database (Denmark)
Shi, Qingxin
2007-01-01
Culture has already played an important role in the global market. It not only affects products, but also impacts on usability evaluation methods. This project aims to examine in the established thinking aloud usability evaluation method (TA UEM), how does the evaluator build a supportive...
Canevese, E. P.; De Gottardo, T.
2017-05-01
The morphometric and photogrammetric knowledge, combined with the historical research, are the indispensable prerequisites for the protection and enhancement of historical, architectural and cultural heritage. Nowadays the use of BIM (Building Information Modeling) as a supporting tool for restoration and conservation purposes is becoming more and more popular. However this tool is not fully adequate in this context because of its simplified representation of three-dimensional models, resulting from solid modelling techniques (mostly used in virtual reality) causing the loss of important morphometric information. One solution to this problem is imagining new advanced tools and methods that enable the building of effective and efficient three-dimensional representations backing the correct geometric analysis of the built model. Twenty-year of interdisciplinary research activities implemented by Virtualgeo focused on developing new methods and tools for 3D modeling that go beyond the simplified digital-virtual reconstruction used in standard solid modeling. Methods and tools allowing the creation of informative and true to life three-dimensional representations, that can be further used by various academics or industry professionals to carry out diverse analysis, research and design activities. Virtualgeo applied research activities, in line with the European Commission 2013's directives of Reflective 7 - Horizon 2020 Project, gave birth to GeomaticsCube Ecosystem, an ecosystem resulting from different technologies based on experiences garnered from various fields, metrology in particular, a discipline used in the automotive and aviation industry, and in general mechanical engineering. The implementation of the metrological functionality is only possible if the 3D model is created with special modeling techniques, based on surface modeling that allow, as opposed to solid modeling, a 3D representation of the manufact that is true to life. The advantages offered by
Directory of Open Access Journals (Sweden)
E. P. Canevese
2017-05-01
Full Text Available The morphometric and photogrammetric knowledge, combined with the historical research, are the indispensable prerequisites for the protection and enhancement of historical, architectural and cultural heritage. Nowadays the use of BIM (Building Information Modeling as a supporting tool for restoration and conservation purposes is becoming more and more popular. However this tool is not fully adequate in this context because of its simplified representation of three-dimensional models, resulting from solid modelling techniques (mostly used in virtual reality causing the loss of important morphometric information. One solution to this problem is imagining new advanced tools and methods that enable the building of effective and efficient three-dimensional representations backing the correct geometric analysis of the built model. Twenty-year of interdisciplinary research activities implemented by Virtualgeo focused on developing new methods and tools for 3D modeling that go beyond the simplified digital-virtual reconstruction used in standard solid modeling. Methods and tools allowing the creation of informative and true to life three-dimensional representations, that can be further used by various academics or industry professionals to carry out diverse analysis, research and design activities. Virtualgeo applied research activities, in line with the European Commission 2013’s directives of Reflective 7 – Horizon 2020 Project, gave birth to GeomaticsCube Ecosystem, an ecosystem resulting from different technologies based on experiences garnered from various fields, metrology in particular, a discipline used in the automotive and aviation industry, and in general mechanical engineering. The implementation of the metrological functionality is only possible if the 3D model is created with special modeling techniques, based on surface modeling that allow, as opposed to solid modeling, a 3D representation of the manufact that is true to life. The
A standardized method is required when national studies on virus occurrence in environmental and drinking waters utilize multiple analytical laboratories. The U.S Environmental Protection Agency’s (USEPA) Method 1615 was developed with the goal of providing such a standard ...
Lin, Jung-Fu; Ge, Mao-Cheng; Liu, Tsui-Ping; Chang, Shih-Cheng; Lu, Jang-Jih
2017-06-30
Rapid identification of microbes in the bloodstream is crucial in managing septicemia because of its high disease severity, and direct identification from positive blood culture bottles through matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) can shorten the turnaround time. Therefore, we developed a simple method for rapid microbiological identification from positive blood cultures by using MALDI-TOF MS. We modified previously developed methods to propose a faster, simpler and more economical method, which includes centrifugation and hemolysis. Specifically, our method comprises two-stage centrifugation with gravitational acceleration (g) at 600g and 3000g, followed by the addition of a lysis buffer and another 3000g centrifugation. In total, 324 monomicrobial bacterial cultures were identified. The success rate of species identification was 81.8%, which is comparable with other complex methods. The identification success rate was the highest for Gram-negative aerobes (85%), followed by Gram-positive aerobes (78.2%) and anaerobes (67%). The proposed method requires less than 10 min, costs less than US$0.2 per usage, and facilitates batch processing. We conclude that this method is feasible for clinical use in microbiology laboratories, and can serve as a reference for treatments or further complementary diagnostic testing. Copyright © 2017. Published by Elsevier B.V.
Rafferty, Anne Marie; Philippou, Julia; Fitzpatrick, Joanne M; Pike, Geoff; Ball, Jane
2017-01-01
Objective Concerns about care quality have prompted calls to create workplace cultures conducive to high-quality, safe and compassionate care and to provide a supportive environment in which staff can operate effectively. How healthcare organisations assess their culture of care is an important first step in creating such cultures. This article reports on the development and validation of a tool, the Culture of Care Barometer, designed to assess perceptions of a caring culture among healthcare workers preliminary to culture change. Design/setting/participants An exploratory mixed methods study designed to develop and test the validity of a tool to measure ‘culture of care’ through focus groups and questionnaires. Questionnaire development was facilitated through: a literature review, experts generating items of interest and focus group discussions with healthcare staff across specialities, roles and seniority within three types of public healthcare organisations in the UK. The tool was designed to be multiprofessional and pilot tested with a sample of 467 nurses and healthcare support workers in acute care and then validated with a sample of 1698 staff working across acute, mental health and community services in England. Exploratory factor analysis was used to identify dimensions underlying the Barometer. Results Psychometric testing resulted in the development of a 30-item questionnaire linked to four domains with retained items loading to four factors: organisational values (α=0.93, valid n=1568, M=3.7), team support (α=0.93, valid n=1557, M=3.2), relationships with colleagues (α=0.84, valid n=1617, M=4.0) and job constraints (α=0.70, valid n=1616, M=3.3). Conclusions The study developed a valid and reliable instrument with which to gauge the different attributes of care culture perceived by healthcare staff with potential for organisational benchmarking. PMID:28821526
Prof. Dr. C.A. Bruggeman; Drs H. Kreeftenberg; Dr. Ir. P.F.G. Wolffs; Drs A.J.M. Loonen; Dr. A.J.C. van den Brule, van den; Drs A.R. Jansz
2010-01-01
To accelerate differentiation between Staphylococcus aureus and Coagulase Negative Staphylococci (CNS), this study aimed to compare six different DNA extraction methods from 2 commonly used blood culture materials, i.e. BACTEC and Bact/ALERT. Furthermore, we analyzed the effect of reduced blood
Directory of Open Access Journals (Sweden)
Samira Rahmani-Nezhad
Full Text Available Seed germination and plant cell cultures provide an alternative mean for producing secondary metabolites. The present study is an attempt to evaluate the effect of seed dark germination and some elicitors and precursors on the production of L-DOPA in Phaseolus vulgaris L. Callus cultured on Murashige and Skoog medium supplemented with various concentrations of different plant growth regulators. L-DOPA produced was quantified by UV-spectrophotometric method. In this study, a user-friendly, quick, and economical UV-spectrophotometric method was described to determine L-DOPA content in extracts from 33 biotypes of Phaseolus vulgaris L. The method is based on the nitrosation of L-DOPA to form a yellow solution and then formation of a red solution by adding base which is measurable at 470 nm. According to our statistical studies, this method showed high efficiency and selectivity for quantitative determination of L-DOPA in herbal extracts from dried plant seeds, dark-germinated seeds and callus cultures. L-DOPA content in dark-germinated seeds and suspension cultures increased significantly to approximately several-fold compared to the control. The implication from this study is that elicitor treatment and precursor feeding of Phaseolus vulgaris L. can significantly improve the parkinson’s relevant L-DOPA content.
Directory of Open Access Journals (Sweden)
Мария Владимировна Морозова
2012-09-01
Full Text Available This article contains structural elements of the methodology for formation of personal information culture in the study of mathematics for the specialty «State and municipal management» (on the subject «Methods of decision-making».
Mayeaux, Amanda Shuford
2013-01-01
The purpose of this sequential mixed-methods research was to discover the impact school culture, internal factors, and the state of flow has upon motivating a teacher to develop teaching expertise. This research was designed to find answers concerning why and how individual teachers can nurture their existing internal factors to increase their…
Jamal, Wafaa; Saleem, Rola; Rotimi, Vincent O
2013-08-01
The use of matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) for identification of microorganisms directly from blood culture is an exciting dimension to the microbiologists. We evaluated the performance of Bruker SepsiTyper kit™ (STK) for direct identification of bacteria from positive blood culture. This was done in parallel with conventional methods. Nonrepetitive positive blood cultures from 160 consecutive patients were prospectively evaluated by both methods. Of 160 positive blood cultures, the STK identified 114 (75.6%) isolates and routine conventional method 150 (93%). Thirty-six isolates were misidentified or not identified by the kit. Of these, 5 had score of >2.000 and 31 had an unreliable low score of <1.7. Four of 8 yeasts were identified correctly. The average turnaround time using the STK was 35 min, including extraction steps and 30:12 to 36:12 h with routine method. The STK holds promise for timely management of bacteremic patients. Copyright © 2013 Elsevier Inc. All rights reserved.
Melnyk, Bernadette Mazurek; Kelly, Stephanie; Jacobson, Diana; Belyea, Michael; Shaibi, Gabriel; Small, Leigh; O’Haver, Judith; Marsiglia, Flavio Francisco
2014-01-01
Obesity and mental health disorders remain significant public health problems in adolescents. Substantial health disparities exist with minority youth experiencing higher rates of these problems. Schools are an outstanding venue to provide teens with skills needed to improve their physical and mental health, and academic performance. In this paper, the authors describe the design, intervention, methods and baseline data for a randomized controlled trial with 779 culturally diverse high-school adolescents in the southwest United States. Aims for this prevention study include testing the efficacy of the COPE TEEN program versus an attention control program on the adolescents’ healthy lifestyle behaviors, Body Mass Index (BMI) and BMI%, mental health, social skills and academic performance immediately following the intervention programs, and at six and 12 months post interventions. Baseline findings indicate that greater than 40% of the sample is either overweight (n = 148, 19.00%) or obese (n = 182, 23.36%). The predominant ethnicity represented is Hispanic (n = 526, 67.52%). At baseline, 15.79%(n = 123) of the students had above average scores on the Beck Youth Inventory Depression subscale indicating mildly (n = 52, 6.68%), moderately (n = 47, 6.03%), or extremely (n = 24, 3.08%) elevated scores (see 1). Anxiety scores were slightly higher with 21.56% (n = 168) reporting responses suggesting mildly (n = 81, 10.40%), moderately (n = 58, 7.45%) or extremely (n = 29, 3.72%) elevated scores. If the efficacy of the COPE TEEN program is supported, it will offer schools a curriculum that can be easily incorporated into high school health courses to improve adolescent healthy lifestyle behaviors, psychosocial outcomes and academic performance. PMID:23748156
Tsubota, Yoshiaki; Frey, Jeremy M; Raines, Elaine W
2014-01-01
Monocyte recruitment to inflammatory sites and their transendothelial migration into tissues are critical to homeostasis and pathogenesis of chronic inflammatory diseases. However, even short-term suspension culture of primary human monocytes leads to phenotypic changes. In this study, we characterize the functional effects of ex vivo monocyte culture on the steps involved in monocyte transendothelial migration. Our data demonstrate that monocyte diapedesis is impaired by as little as 4 h culture, and the locomotion step is subsequently compromised. After 16 h in culture, monocyte diapedesis is irreversibly reduced by ∼90%. However, maintenance of monocytes under conditions mimicking physiological flow (5-7.5 dyn/cm²) is sufficient to reduce diapedesis impairment significantly. Thus, through the application of shear during ex vivo culture of monocytes, our study establishes a novel protocol, allowing functional analyses of monocytes not currently possible under static culture conditions. These data further suggest that monocyte-based therapeutic applications may be measurably improved by alteration of ex vivo conditions before their use in patients.
Kaspar, A; Pfister, K; Nielsen, M K; Silaghi, C; Fink, H; Scheuerle, M C
2017-01-11
Strongylus vulgaris has become a rare parasite in Germany during the past 50 years due to the practice of frequent prophylactic anthelmintic therapy. To date, the emerging development of resistance in Cyathostominae and Parascaris spp. to numerous equine anthelmintics has changed deworming management and the frequency of anthelmintic usage. In this regard, reliable detection of parasitic infections, especially of the highly pathogenic S. vulgaris is essential. In the current study, two diagnostic methods for the detection of infections with S. vulgaris were compared and information on the occurrence of this parasite in German horses was gained. For this purpose, faecal samples of 501 horses were screened for S. vulgaris with real-time PCR and an additional larval culture was performed in samples of 278 horses. A subset of 26 horses underwent multiple follow-up examinations with both methods in order to evaluate both the persistence of S. vulgaris infections and the reproducibility of each diagnostic method. The real-time PCR revealed S. vulgaris-DNA in ten of 501 investigated equine samples (1.9%). The larval culture demonstrated larvae of S. vulgaris in three of the 278 samples (1.1%). A direct comparison of the two methods was possible in 321 samples including 43 follow-up examinations with the result of 11 S. vulgaris-positive samples by real-time PCR and 4 S. vulgaris-positive samples by larval culture. The McNemar's test (p-value = 0.016) revealed a significant difference and the kappa values (0.525) showed a moderate agreement between real-time PCR and larval culture. The real-time PCR detected a significantly higher proportion of positives of S. vulgaris compared to larval culture and should thus be considered as a routine diagnostic method for the detection of S. vulgaris in equine samples.
DEFF Research Database (Denmark)
Tanner, V A; Ploug, Thorkil; Tao-Cheng, J H
1996-01-01
substantially improved the efficiency of the preembedding EM ICC procedures for cell cultures. The advantages and related caveats of this method are discussed. SV2 was distinctly localized on dusters of synaptic vesicles and large dense-cored vesicles (LDCV). The distribution of SV2 on these two types...... of secretory vesicles was compared quantitatively to that of another secretory vesicle-associated transmembrane protein, synaptophysin. In cultures under similar experimental conditions, the ratio of SV2 vs synaptophysin ICC staining on synaptic vesicle dusters was about 1:1, whereas it was about 9:1 on LDCV...
Koczkodaj, Dorota; Popek, Sylwia; Zmorzyński, Szymon; Wąsik-Szczepanek, Ewa; Filip, Agata A
2016-04-01
One of the research methods of prognostic value in chronic lymphocytic leukemia (CLL) is cytogenetic analysis. This method requires the presence of appropriate B-cell mitogens in cultures in order to obtain a high mitotic index. The aim of our research was to determine the most effective methods of in vitro B-cell stimulation to maximize the number of metaphases from peripheral blood cells of patients with CLL for classical cytogenetic examination, and then to correlate the results with those obtained using fluorescence in situ hybridization (FISH). The study group involved 50 consecutive patients with CLL. Cell cultures were maintained with the basic composition of culture medium and addition of respective stimulators. We used the following stimulators: Pokeweed Mitogen (PWM), 12-O-tetradecanoylphorbol 13-acetate (TPA), ionophore, lipopolysaccharide (LPS), and CpG-oligonucleotide DSP30. We received the highest mitotic index when using the mixture of PWM+TPA+I+DSP30. With classical cytogenetic tests using banding techniques, numerical and structural aberrations of chromosomes were detected in 46 patients, and no change was found in only four patients. Test results clearly confirmed the legitimacy of using cell cultures enriched with the mixture of cell stimulators and combining classical cytogenetic techniques with the FISH technique in later patient diagnosing. Copyright © 2016 American Federation for Medical Research.
Thein-Lemelson, Seinenu M
2015-02-01
Grooming behaviours are thought to be a crucial aspect of parenting and integral to the sociality of non-human mammals, but there have been few empirical studies on how grooming might be relevant to parenting and socialization processes in humans. Study 1 is a quantitative cross-cultural comparison of grooming practices in two cultural settings: an urban centre in Burma (Myanmar) and an urban centre in the United States. The study uses naturalistic video data of 57 families to analyse grooming behaviours directed at children. A broad range of ages was sampled in each culture to examine the developmental trajectory of grooming behaviours. Results indicate that significant cultural differences exist between Burma and the United States, with Burmese children being groomed by their caregivers more often than U.S. children. Results also indicate that cultural differences in grooming practices begin early and remain constant across age. An unexpected finding was that Burmese families were more variable in their behaviour than U.S. families. Study 2 attempts to explain this variability by using ethnography to describe how sociodemographic changes in Burma are leading to changes in parental values and socialization practices in the schools, but how embodied primary care in the homes appear resistant to change. © 2014 The Authors. International Journal of Psychology published by John Wiley & Sons Ltd on behalf of International Union of Psychological Science.
Thein-Lemelson, Seinenu M
2015-01-01
Grooming behaviours are thought to be a crucial aspect of parenting and integral to the sociality of non-human mammals, but there have been few empirical studies on how grooming might be relevant to parenting and socialization processes in humans. Study 1 is a quantitative cross-cultural comparison of grooming practices in two cultural settings: an urban centre in Burma (Myanmar) and an urban centre in the United States. The study uses naturalistic video data of 57 families to analyse grooming behaviours directed at children. A broad range of ages was sampled in each culture to examine the developmental trajectory of grooming behaviours. Results indicate that significant cultural differences exist between Burma and the United States, with Burmese children being groomed by their caregivers more often than U.S. children. Results also indicate that cultural differences in grooming practices begin early and remain constant across age. An unexpected finding was that Burmese families were more variable in their behaviour than U.S. families. Study 2 attempts to explain this variability by using ethnography to describe how sociodemographic changes in Burma are leading to changes in parental values and socialization practices in the schools, but how embodied primary care in the homes appear resistant to change. PMID:25530498
Graves, Christina L; Harden, Scott W; LaPato, Melissa; Nelson, Michael; Amador, Byron; Sorenson, Heather; Frazier, Charles J; Wallet, Shannon M
2014-12-01
Intestinal epithelial cells (IECs) serve as an important physiologic barrier between environmental antigens and the host intestinal immune system. Thus, IECs serve as a first line of defense and may act as sentinel cells during inflammatory insults. Despite recent renewed interest in IEC contributions to host immune function, the study of primary IEC has been hindered by lack of a robust culture technique, particularly for small intestinal and adult tissues. Here, a novel adaptation for culture of primary IEC is described for human duodenal organ donor tissue as well as duodenum and colon of adult mice. These epithelial cell cultures display characteristic phenotypes and are of high purity. In addition, the innate immune function of human primary IEC, specifically with regard to Toll-like receptor (TLR) expression and microbial ligand responsiveness, is contrasted with a commonly used intestinal epithelial cell line (HT-29). Specifically, TLR expression at the mRNA level and production of cytokine (IFNγ and TNFα) in response to TLR agonist stimulation is assessed. Differential expression of TLRs as well as innate immune responses to ligand stimulation is observed in human-derived cultures compared to that of HT-29. Thus, use of this adapted method to culture primary epithelial cells from adult human donors and from adult mice will allow for more appropriate studies of IECs as innate immune effectors. Published by Elsevier B.V.
Curry, Leslie A; Brault, Marie A; Linnander, Erika L; McNatt, Zahirah; Brewster, Amanda L; Cherlin, Emily; Flieger, Signe Peterson; Ting, Henry H; Bradley, Elizabeth H
2018-03-01
Hospital organisational culture affects patient outcomes including mortality rates for patients with acute myocardial infarction; however, little is known about whether and how culture can be positively influenced. This is a 2-year, mixed-methods interventional study in 10 US hospitals to foster improvements in five domains of organisational culture: (1) learning environment, (2) senior management support, (3) psychological safety, (4) commitment to the organisation and (5) time for improvement. Outcomes were change in culture, uptake of five strategies associated with lower risk-standardised mortality rates (RSMR) and RSMR. Measures included a validated survey at baseline and at 12 and 24 months (n=223; average response rate 88%); in-depth interviews (n=393 interviews with 197 staff); and RSMR data from the Centers for Medicare and Medicaid Services. We observed significant changes (porganisational culture that supports high performance may help hospitals in their efforts to improve clinical outcomes. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Energy Technology Data Exchange (ETDEWEB)
Akporiaye, E T; Stewart, S; Stewart, C C
1984-01-01
Various investigators have cultured murine bone marrow or peritoneal cells in vitro on glass or plastic surfaces with the ultimate aim of retrieving adherent macrophages for morphologic and functional evaluation. The removal of these adherent macrophages by conventional techniques has been consistently accompanied by low yield and significant cell damage. The authors report here a simple technique for culturing murine bone marrow cells in gelatin sponges (Spongostan and Gelfoam) in growth medium containing 10% fetal bovine serum and 10% L-cell conditioned medium. Viable cells were retrieved from the sponges in 10 min by digestion with collagenase. The in situ growth kinetics were similar to those found for cells cultured on plastic dishes. The recovered cells were adherent, phagocytic, positive for Fc ..gamma.. receptors, and had esterase activity. 23 references, 1 figure, 1 table.
Ferreira, Jair C; Gomes, Marilia S; Bonsaglia, Erika C R; Canisso, Igor F; Garrett, Edgar F; Stewart, Jamie L; Zhou, Ziyao; Lima, Fabio S
2018-01-01
Several multiple-media culture systems have become commercially available for on-farm identification of mastitis-associated pathogens. However, the accuracy of these systems has not been thoroughly and independently validated against microbiological evaluations performed by referral laboratories. Therefore, the purpose of the present study was to evaluate the performance of commercially available culture plates (Accumast, Minnesota Easy System, SSGN and SSGNC Quad plates) to identify pathogens associated with clinical mastitis in dairy cows. Milk samples from the affected quarter with clinical mastitis were aerobically cultured with the on-farm culture systems and by two additional reference laboratories. Agreeing results from both standard laboratories were denoted as the reference standard (RS). Accuracy (Ac), sensitivity (Se), specificity (Sp), positive and negative predictive values (PPV and NPV, respectively) and Cohen's kappa coefficient (k) of on-farm plates were determined based on the RS culture of 211 milk samples. All four plate-systems correctly identified ≥ 84.9% of milk samples with no bacterial growth. Accumast had greater values for all overall predictive factors (Ac, Se, Sp, PPV and NPV) and a substantial agreement (k = 0.79) with RS. The inter-rater agreements of Minnesota, SSGN, and SSGNC with RS were moderate (0.45 ≤ k ≤ 0.55). The effectiveness to categorize bacterial colonies at the genus and species was numerically different amongst the commercial plates. Our findings suggest that Accumast was the most accurate on-farm culture system for identification of mastitis-associated pathogens of the four systems included in the analysis.
Palla, Michela; Cristani, Caterina; Giovannetti, Manuela; Agnolucci, Monica
2017-06-05
Sourdough fermentation has been increasingly used worldwide, in accordance with the demand of consumers for tasty, natural and healthy food. The high diversity of lactic acid bacteria (LAB) and yeast species, detected in sourdoughs all over the world, may affect nutritional, organoleptic and technological traits of leavened baked goods. A wide regional variety of traditional sourdough breads, over 200 types, has been recorded in Italy, including special types selected as worthy of either Protected Geographical Indication (PGI) or Protected Designation of Origin (PDO), whose sourdough microbiota has been functionally and molecularly characterized. As, due to the very recent designation, the microbiota of Tuscan bread sourdough has not been investigated so far, the aim of the present work was to isolate and characterize the species composition of LAB and yeasts of PDO Tuscan bread sourdough by culture-independent and dependent methods. A total of 130 yeasts from WLN medium and 193 LAB from both mMRS and SDB media were isolated and maintained to constitute the germplasm bank of PDO Tuscan bread. Ninety six LAB from mMRS medium and 68 yeasts from WLN medium were randomly selected and molecularly identified by ARDRA (Amplified Ribosomal DNA Restriction Analysis) and PCR-RFLP analysis of the ITS region, respectively, and sequencing. The yeast identity was confirmed by 26S D1/D2 sequencing. All bacterial isolates showed 99% identity with Lactobacillus sanfranciscensis, 65 yeast isolates were identified as Candida milleri, and 3 as Saccharomyces cerevisiae. Molecular characterization of PDO Tuscan bread sourdough by PCR-DGGE confirmed such data. The distinctive tripartite species association, detected as the microbiota characterizing the sourdough used to produce PDO Tuscan bread, encompassed a large number of L. sanfranciscensis and C. milleri strains, along with a few of S. cerevisiae. The relative composition and specific physiological characteristics of such microbiota
Chen, Nai-Dong; You, Tao; Li, Jun; Bai, Li-Tao; Hao, Jing-Wen; Xu, Xiao-Yuan
2016-10-01
Plant tissue culture technique is widely used in the conservation and utilization of rare and endangered medicinal plants and it is crucial for tissue culture stocks to obtain the ability to produce similar bioactive components as their wild correspondences. In this paper, a headspace gas chromatography-mass spectrometry method combined with chemometric methods was applied to analyze and evaluate the volatile compounds in tissue-cultured and wild Dendrobium huoshanense Cheng and Tang, Dendrobium officinale Kimura et Migo and Dendrobium moniliforme (Linn.) Sw. In total, 63 volatile compounds were separated, with 53 being identified from the three Dendrobium spp. Different provenances of Dendrobiums had characteristic chemicals and showed remarkable quantity discrepancy of common compositions. The similarity evaluation disclosed that the accumulation of volatile compounds in Dendrobium samples might be affected by their provenance. Principal component analysis showed that the first three components explained 85.9% of data variance, demonstrating a good discrimination between samples. Gas chromatography-mass spectrometry techniques, combined with chemometrics, might be an effective strategy for identifying the species and their provenance, especially in the assessment of tissue-cultured Dendrobium quality for use in raw herbal medicines. Copyright © 2016. Published by Elsevier B.V.
Loonen, A J M; Jansz, A R; Kreeftenberg, H; Bruggeman, C A; Wolffs, P F G; van den Brule, A J C
2011-03-01
To accelerate differentiation between Staphylococcus aureus and coagulase-negative staphylococci (CNS), this study aimed to compare six different DNA extraction methods from two commonly used blood culture materials, i.e. BACTEC and BacT/ALERT. Furthermore, we analysed the effect of reduced blood culture incubation for the detection of staphylococci directly from blood culture material. A real-time polymerase chain reaction (PCR) duplex assay was used to compare the six different DNA isolation protocols on two different blood culture systems. Negative blood culture material was spiked with methicillin-resistant S. aureus (MRSA). Bacterial DNA was isolated with automated extractor easyMAG (three protocols), automated extractor MagNA Pure LC (LC Microbiology Kit M(Grade)), a manual kit MolYsis Plus and a combination of MolYsis Plus and the easyMAG. The most optimal isolation method was used to evaluate reduced bacterial incubation times. Bacterial DNA isolation with the MolYsis Plus kit in combination with the specific B protocol on the easyMAG resulted in the most sensitive detection of S. aureus, with a detection limit of 10 CFU/ml, in BacT/ALERT material, whereas using BACTEC resulted in a detection limit of 100 CFU/ml. An initial S. aureus or CNS load of 1 CFU/ml blood can be detected after 5 h of incubation in BacT/ALERT 3D by combining the sensitive isolation method and the tuf LightCycler assay.
Ghaziani, Amin; Baldassarri, Delia
2013-01-01
Social scientists describe culture as either coherent or incoherent and political dissent as either unifying or divisive. This article moves beyond such dichotomies. Content, historical, and network analyses of public debates on how to organize four lesbian, gay, bisexual, and transgender (LGBT) Washington marches provide evidence for an integrative position. Rather than just describe consistencies or contradictions, we contend that the key analytic challenge is to explain the organization of differences. We propose one way of doing this using the mechanism of a cultural anchor. Within and across marches, a small collection of ideas remains fixed in the national conversation, yet in a way that allows activists to address their internal diversity and respond to unfolding historical events. These results suggest that activists do not simply organize around their similarities but, through cultural anchors, they use their commonalities to build a thinly coherent foundation that can also support their differences. Situated at the nexus of culture, social movements, sexualities, and networks, this article demonstrates how the anchoring mechanism works in the context of LGBT political organizing. PMID:23661809
Lindsay, Ana Cristina; Sussner, Katrina Mucha; Greaney, Mary; Wang, Monica L; Davis, Rachel; Peterson, Karen E
2012-05-01
Obesity rates remain high among children in the United States (US), but children of low-income, minority families are at particularly high risk. Latinos are the largest and most rapidly growing US population group. Effective strategies will require attention to a wide array of culturally mediated variables that influence child feeding practices through the social contexts in which behaviors take place. This paper presents the design and implementation of a qualitative study examining low-income, Latina mothers' perceptions of child weight status and feeding practices, and their associations with the development of overweight in children. Guided by the social ecologic model and social contextual model on the role of the family in mediating health behavior, the Latina Mother Child Feeding Practices (LMCFP) study provided a systematic exploration of the influence of social class, culture, and environmental factors associated with mothers' perceptions of child overweight on feeding practices and behaviors. The design for this qualitative study consisted of three sequential phases: focus groups, in-depth interviews and cognitive interviews with Latina mothers conducted by Spanish-speaking researchers. Results showed the important role of socio-cultural factors in influencing Latina mothers' child feeding practices. In the short-term, this research yielded information to develop a child-feeding questionnaire appropriate for low-income, Latina mothers. Findings have important implications in developing nutrition education strategies for child health promotion that account for the social and cultural context of minority, low-income caregivers.
O'Brien, Mark; Varga-Atkins, Tunde; Umoquit, Muriah; Tso, Peggy
2012-01-01
This article addresses the under-theorization of visual techniques for social science research applications through the cultural-historical activity theory (CHAT). The "problem" of "the visual" in research is given an ontological framing by highlighting the ways in which the use of visual techniques as research tools--designed…
Chang, EunJung; Lim, Maria; Kim, Minam
2012-01-01
In this article, three art educators reflect on their ideas and experiences in developing and implementing innovative projects for their courses focusing on art for elementary education majors. They explore three different approaches. The three areas that are discussed in depth include: (1) understanding child art; (2) visual culture; and (3)…
Maxisorp RAST. A sensitive method for detection of antigen-specific human IgE in culture fluids
DEFF Research Database (Denmark)
Poulsen, L K; Pedersen, M F; Malling, H J
1989-01-01
For determination of allergen-specific IgE in cell culture supernatants and other highly diluted IgE preparations a radioallergosorbent test (RAST) based on high adsorption polystyrene test tubes has been developed ("Maxisorp RAST"). Cladosporium herbarum extract was used as a model allergen...
Directory of Open Access Journals (Sweden)
Luz María Ortega Villa
2007-07-01
Full Text Available In this work, a brief of the methodology used in the study of cultural goods consumption among popular sector of Mexicali is presented. It includes three phases: a survey (quantitative method, a typology established from a multivariate analysis (data mining, and interviews with selected type-cases (qualitative method all of which are analyzed from a multidimensional perspective whose categories retrieve marketing findings such as consumption visions (Phillips, Olson and Baumgartner, 1995 and conflict resolution strategies (Kwai-Choi and Collins, 2000 applied in the process of decision-making. It also draws from sociology (Thompson, 1990; Bourdieu, 1984 in order to identify reproductive aspects of consumption related to educative capital and social origin, and to deal with symbolic evaluation strategies of legitimate cultural goods.
Indian Academy of Sciences (India)
Admin
Plant tissue culture is a technique of culturing plant cells, tissues and organs on ... working methods (Box 2) and discovery of the need for B vita- mins and auxins for ... Kotte (Germany) reported some success with growing isolated root tips.
Tung, Min-Che; Chang, Tien-Yu; Hsu, Bing-Mu; Shen, Shu-Min; Huang, Jen-Te; Kao, Po-Min; Chiu, Yi-Chou; Fan, Cheng-Wei; Huang, Yu-Li
2013-07-01
In this study, we evaluated the presence and amount of Legionella in along a river in Taiwan, and the relations between seasonal distribution of Legionella spp. and geographic characteristics in the watershed were also evaluated. Water samples were pre-treated and analyzed with culture-confirmed and direct DNA extraction methods. For culture-confirmed method, water samples were cultivated through a series of selective media, and candidate colonies were confirmed by PCR. For direct DNA extraction method, direct DNA extraction was performed from pre-treated water samples. The DNA extracts were analyzed with PCR and DNA sequence analysis for species determination, quantitative PCR (qPCR) was performed to quantify Legionella concentration in the water sample. In all, 150 water samples were included in this study, with 73 (48.6%) water samples detected with Legionella spp., and 17 with L. pneumophila. Over 80% Legionella spp. detections were through direct DNA extraction method, but more than 80% L. pneumophila detections were through culture-confirmed method. While detection of Legionella spp. was done with two methods, positive results were found through only one method. Legionella spp. was detected in all seasons with detection rate ranging between 34.3-58.8% and seasonal average concentration from 1.9 × 102 to 7.1 × 103 CFU/L. Most of the L. pneumophila detections were from samples collected in fall (38.2%) and summer (6.0%), which also coincided with increased cases of Legionellosis reported through Center of Disease Control in Taiwan. The high prevalence and concentration of Legionella spp. and L. pneumophila in the surface waters should be further evaluated for potential health risks.
Adamski,Tadeusz; Krystkowiak,Karolina; Kuczynska,Anetta; Mikolajczak,Krzysztof; Ogrodowicz,Piotr; Ponitka,Aleksandra; Surma,Maria; Slusarkiewicz-Jarzina,Aurelia
2014-01-01
Background: The quality of wheat grain depends on several characteristics, among which the composition of high molecular weight glutenin subunits, encoded by Glu-1 loci, are the most important. Application of biotechnological tools to accelerate the attainment of homozygous lines may influence the proportion of segregated genotypes. The objective was to determine, whether the selection pressure generated by the methods based on in vitro cultures, may cause a loss of genotypes with desirable G...
McMahon, Tanis C.; Blais, Burton W.; Wong, Alex; Carrillo, Catherine D.
2017-01-01
Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin (stx) and intimin (eae)]. However, false positives arise when complex food matrices, such as beef, contain mixtu...
Bilbrey, Ann Choryan; Humber, Marika B; Plowey, Edward D; Garcia, Iliana; Chennapragada, Lakshmi; Desai, Kanchi; Rosen, Allyson; Askari, Nusha; Gallagher-Thompson, Dolores
2018-01-01
Increasing the number of Latino persons with dementia who consent to brain donation (BD) upon death is an important public health goal that has not yet been realized. This study identified the need for culturally sensitive materials to answer questions and support the decision-making process for the family. Information about existing rates of BD was obtained from the Alzheimer's Disease Centers. Several methods of data collection (query NACC database, contacting Centers, focus groups, online survey, assessing current protocol and materials) were used to give the needed background to create culturally appropriate BD materials. A decision was made that a brochure for undecided enrollees would be beneficial to discuss BD with family members. For those needing further details, a step-by-step handout would provide additional information. Through team collaboration and engagement of others in the community who work with Latinos with dementia, we believe this process allowed us to successfully create culturally appropriate informational materials that address a sensitive topic for Hispanic/Latino families. Brain tissue is needed to further knowledge about underlying biological mechanism of neurodegenerative diseases, however it is a sensitive topic. Materials assist with family discussion and facilitate the family's follow-through with BD.
Kim, So-Jung; Jung, Ji-Won; Ha, Hye-Yeong; Koo, Soo Kyung; Kim, Eung-Gook; Kim, Jung-Hyun
2017-03-01
Embryonic stem cells (ESCs) can be expanded infinitely in vitro and have the potential to differentiate into hematopoietic stem cells (HSCs); thus, they are considered a useful source of cells for HSC production. Although several technical in vitro methods for engineering HSCs from pluripotent stem cells have been developed, clinical application of HSCs engineered from pluripotent stem cells is restricted because of the possibility of xenogeneic contamination resulting from the use of murine materials. Human ESCs (CHA-hES15) were cultured on growth factor-reduced Matrigel-coated dishes in the mTeSR1 serum-free medium. When the cells were 70% confluent, we initiated HSC differentiation by three methods involving (1) knockout serum replacement (KSR), cytokines, TGFb1, EPO, and FLT3L; (2) KSR, cytokines, and bFGF; or (3) cytokines and bFGF. Among the three differentiation methods, the minimal number of cytokines without KSR resulted in the greatest production of HSCs. The optimized method resulted in a higher proportion of CD34 + CD43 + hematopoietic progenitor cells (HPCs) and CD34 + CD45 + HPCs compared to the other methods. In addition, the HSCs showed the potential to differentiate into multiple lineages of hematopoietic cells in vitro . In this study, we optimized a two-step, serum-free, animal protein-free, KSR-free, feeder-free, chemically defined monolayer culture method for generation of HSCs and hematopoietic stem and progenitor cells (HSPCs) from human ESCs.
Montesinos, I.; Argudín, M. A.; Hites, M.; Ahajjam, F.; Dodémont, M.; Dagyaran, C.; Bakkali, M.; Etienne, I.; Jacobs, F.; Knoop, C.; Patteet, S.; Lagrou, K.
2017-01-01
Azole-resistant Aspergillus fumigatus is an increasing worldwide problem with major clinical implications. Surveillance is warranted to guide clinicians to provide optimal treatment to patients. To investigate azole resistance in clinical Aspergillus isolates in our institution, a Belgian university hospital, we conducted a laboratory-based surveillance between June 2015 and October 2016. Two different approaches were used: a prospective culture-based surveillance using VIPcheck on unselected...
Avcıoğlu, Gamze Gizem; Avcıoğlu, Gürcan Şevket
2018-01-01
The purpose of this study is to make a comparative sociological analysis of Iranian and Turkish food cultures in terms of food preparation, distribution and consumption. Moreover, contribution is intended to be made to the field of applied food sociology. The research design carries features of a qualitative research. Of the qualitative research techniques, observation and interview form were used in the study. Research findings were obtained through observations made in Tehran, the capital c...
Dao, Diane K; Goss, Adeline L; Hoekzema, Andrew S; Kelly, Lauren A; Logan, Alexander A; Mehta, Sanjiv D; Sandesara, Utpal N; Munyikwa, Michelle R; DeLisser, Horace M
2017-03-01
Many efforts to design introductory "cultural competence" courses for medical students rely on an information delivery (competence) paradigm, which can exoticize patients while obscuring social context, medical culture, and power structures. Other approaches foster a general open-minded orientation, which can remain nebulous without clear grounding principles. Medical educators are increasingly recognizing the limitations of both approaches and calling for strategies that reenvision cultural competence training. Successfully realizing such alternative strategies requires the development of comprehensive models that specify and integrate theoretical frameworks, content, and teaching principles.In this article, the authors present one such model: Introduction to Medicine and Society (IMS), a required cultural competence course launched in 2013 for first-year medical students at the Perelman School of Medicine at the University of Pennsylvania. Building on critical pedagogy, IMS is centered on a novel specification of "critical consciousness" in clinical practice as an orientation to understanding and pragmatic action in three relational domains: internal, interpersonal, and structural. Instead of transmitting discrete "facts" about patient "types," IMS content provokes students to engage with complex questions bridging the three domains. Learning takes place in a small-group space specifically designed to spur transformation toward critical consciousness. After discussing the three key components of the course design and describing a representative session, the authors discuss the IMS model's implications, reception by students and faculty, and potential for expansion. Their early experience suggests the IMS model successfully engages students and prepares future physicians to critically examine experiences, manage interpersonal dynamics, and structurally contextualize patient encounters.
Czech Academy of Sciences Publication Activity Database
Day, J. G.; Lorenz, M.; Wilding, T.A.; Friedl, T.; Harding, K.; Pröschold, T.; Brennan, D.; Müller, J.; Santos, L. M. A.; Santos, M. F.; Osório, H.C.; Amaral, R.; Lukešová, Alena; Hrouzek, Pavel; Lukeš, Martin; Elster, Josef; Lukavský, Jaromír; Probert, I.; Ryan, M.J.; Benson, E. E.
2007-01-01
Roč. 28, č. 5 (2007), s. 359-376 ISSN 0143-2044 Grant - others:Evropská unie(XE) QLRT-2000-01645 (Cobra) Institutional research plan: CEZ:AV0Z60660521; CEZ:AV0Z60050516 Source of funding: V - iné verejné zdroje Keywords : cryopreservation * storage * culture collections Subject RIV: EH - Ecology, Behaviour Impact factor: 1.141, year: 2007
International Nuclear Information System (INIS)
Tahchy, A. E.; Boisbrun, M.; Chretien, F.; Henry, M.; Chapleur, Y.; Laurain-Mattar, D.; Ptak, A.; Dupire, F.
2010-01-01
Biotransformation of deuterated-4'-O-methylnorbelladine into alkaloids galanthamine and lycorine in tissue cultures of Leucojum aestivum was demonstrated using HPLC coupled to mass spectrometry. GC-MS screening was also carried to investigate other native and deuterated alkaloids. A total of six labeled alkaloids were identified indicating that 4'-O-methyl-d3-norbelladine is incorporated into three different groups of Amaryllidaceae alkaloids that are biosynthesized by three modes of intramolecular oxidative phenol coupling. (authors)
Roger-Estrade, Jean; Boizard, Hubert; Peigné, Josephine; Sasal, Maria Carolina; Guimaraes, Rachel; Piron, Denis; Tomis, Vincent; Vian, Jean-François; Cadoux, Stephane; Ralisch, Ricardo; Filho, Tavares; Heddadj, Djilali; de Battista, Juan; Duparque, Annie
2016-04-01
In France, agronomists have studied the effects of cropping systems on soil structure, using a field method based on a visual description of soil structure. The "profil cultural" method (Manichon and Gautronneau, 1987) has been designed to perform a field diagnostic of the effects of tillage and compaction on soil structure dynamics. This method is of great use to agronomists improving crop management for a better preservation of soil structure. However, this method was developed and mainly used in conventional tillage systems, with ploughing. As several forms of reduced, minimum and no tillage systems are expanding in many parts of the world, it is necessary to re-evaluate the ability of this method to describe and interpret soil macrostructure in unploughed situations. In unploughed fields, soil structure dynamics of untilled layers is mainly driven by compaction and regeneration by natural agents (climatic conditions, root growth and macrofauna) and it is of major importance to evaluate the importance of these natural processes on soil structure regeneration. These concerns have led us to adapt the standard method and to propose amendments based on a series of field observations and experimental work in different situations of cropping systems, soil types and climatic conditions. We improved the description of crack type and we introduced an index of biological activity, based on the visual examination of clods. To test the improved method, a comparison with the reference method was carried out and the ability of the "profil cultural" method to make a diagnosis was tested on five experiments in France, Brazil and Argentina. Using the improved method, the impact of cropping systems on soil functioning was better assessed when natural processes were integrated into the description.
Doğan, Özlem; İnkaya, Ahmet Çağkan; Gülmez, Dolunay; Uzun, Ömrüm; Akova, Murat; Arıkan Akdağlı, Sevtap
2016-10-01
Early antifungal therapy has a major influence on survival in candidemia. Rapid identification of the species has importance for the treatment, prediction of the species-specific primary resistance and variable antifungal susceptibility. Recently, molecular-based methods attempt to reduce the time between the positive signal of a blood culture and identification of the fungus. PNA-FISH (Peptide nucleic acid fluorescence in situ hybridization) assay distinguishes a number of frequently isolated Candida species in groups following the growth in blood culture. The aim of this study was to investigate the correlation of the species identified by PNA-FISH with conventional identification methods in yeast positive blood cultures and its influence on the selection of antifungal therapy. Specimens of adult patients diagnosed as yeast with Gram stain in signal-positive blood cultures between August to December 2013, were included in the study. The strains were concomitantly cultivated by subculturing from the blood culture bottles onto solid media and identified by conventional methods (germ tube test, ID32C and morphology on cornmeal Tween 80 agar). Rapid species identification was performed by Yeast Traffic Light PNA-FISH, which generates green flourescence for Candida albicans and Candida parapsilosis, yellow for Candida tropicalis, and red for Candida krusei and Candida glabrata. C.tropicalis was identified as a single species whereas the others were identified in pairs. The time points when the yeast positive blood culture bottle was received by the mycology laboratory and reporting of the species identification results by PNA-FISH and the conventional methods were recorded. Seven C.albicans, six C.glabrata, three C.parapsilosis, one C.tropicalis, one C.krusei, one Cryptococcus neoformans, one Saprochaete capitata (Blastoschizomyces capitatus), one C.albicans and Candida dubliniensis, one C.krusei and C.dubliniensis, and one C.glabrata and C.parapsilosis were
Stachelska, Milena Alicja
2017-01-01
Yersiniosis is believed to be the third most common intestinal zoonosis in the European Union, after campylobacteriosis and salmonellosis. Yersinia enterocolitica is the most common species responsible for human infections. Pigs are regarded as the biggest reservoir of pathogenic Y. enterocolitica strains, which are mainly isolated from pig tonsils. The aim of this paper is to examine the prevalence of inv-positive and ail-positive Y. enterocolitica in pigs which were slaughtered in a Polish abattoir. Real-time PCR and culture methods were used to assess the prevalence of patho- genic Y. enterocolitica strains in pig tonsils. Real-time PCR was applied to detect inv-positive and ail-positive Y. enterocolitica. Y. enterocolitica was also isolated by applying direct plating, unselective (tryptic soy broth) and selective (irgasan-ticarcillin-potassium chlorate bouillon) enrichment. A total of 180 pigs were studied, of which 85% and 32% respectively were found to be infected with inv-positive and ail-positive Y. enterocolitica. The 92 inv-positive and ail-positive isolates, from 57 culture- positive tonsils, underwent bio- and serotyping. The most common was bioserotype 4/O:3, which was found in 53 (93%) out of 57 culture-positive tonsils. Strains of bioserotypes 2/O:5, 2/O:9 and 2/O:5.27 occurred in significantly lower numbers. The prevalence of inv-positive and ail-positive Y. enterocolitica was found to be high in the ton- sils of slaughtered pigs, using real-time PCR. The real-time PCR method for the detection and identification of pathogenic Y. enterocolitica is sensitive and specific, which has been verified by specificity and sensitivity tests using the pure cultures. Serotypes were distinguished from each other using PCR serotyping. The PCR method was essential in forming our conclusions.
Lenihan, Catherine; Rogers, Caroline; Metcalfe, Anthony D; Martin, Yella H
2014-12-01
The use of cultured epithelial keratinocytes in the treatment of burns and skin graft donor sites is well established in clinical practice. The most widely used culture method for clinical use was originally developed by Rheinwald and Green 40 years ago. This system uses irradiated mouse dermal fibroblasts as a feeder cell layer to promote keratinocyte growth, a process that is costly and labor-intensive for health care providers. The medium formulation contains several components of animal origin, which pose further safety risks for patients. Improvements and simplification in the culturing process would lead to clear advantages: improved safety through reduction of xenobiotic components and reduction in cost for health care providers by dispensing with feeder cells. We compared the Rheinwald and Green method to culture in three commercially available, feeder-free media systems with defined/absent components of animal origin. During the isolation process, short incubation times in high-strength trypsin resulted in increased numbers of liberated keratinocyte stem cells compared with longer incubation times. All three commercially available media tested in this study could support the expansion of keratinocytes, with phenotypes comparable to cells expanded using the established Rheinwald and Green method. Growth rates varied, with two of the media displaying comparable growth rates, whereas the third was significantly slower. Our study demonstrates the suitability of such feeder-free media systems in clinical use. It further outlines a range of techniques to evaluate keratinocyte phenotype when assessing the suitability of cells for clinical application. Copyright © 2014 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
Muhammed, Musemma K; Kot, Witold; Neve, Horst; Mahony, Jennifer; Castro-Mejía, Josué L; Krych, Lukasz; Hansen, Lars H; Nielsen, Dennis S; Sørensen, Søren J; Heller, Knut J; van Sinderen, Douwe; Vogensen, Finn K
2017-10-01
Despite being potentially highly useful for characterizing the biodiversity of phages, metagenomic studies are currently not available for dairy bacteriophages, partly due to the lack of a standard procedure for phage extraction. We optimized an extraction method that allows the removal of the bulk protein from whey and milk samples with losses of less than 50% of spiked phages. The protocol was applied to extract phages from whey in order to test the notion that members of Lactococcus lactis 936 (now Sk1virus ), P335, c2 (now C2virus ) and Leuconostoc phage groups are the most frequently encountered in the dairy environment. The relative abundance and diversity of phages in eight and four whey mixtures from dairies using undefined mesophilic mixed-strain cultures containing Lactococcus lactis subsp. lactis biovar diacetylactis and Leuconostoc species (i.e., DL starter cultures) and defined cultures, respectively, were assessed. Results obtained from transmission electron microscopy and high-throughput sequence analyses revealed the dominance of Lc. lactis 936 phages (order Caudovirales , family Siphoviridae ) in dairies using undefined DL starter cultures and Lc. lactis c2 phages (order Caudovirales , family Siphoviridae ) in dairies using defined cultures. The 936 and Leuconostoc phages demonstrated limited diversity. Possible coinduction of temperate P335 prophages and satellite phages in one of the whey mixtures was also observed. IMPORTANCE The method optimized in this study could provide an important basis for understanding the dynamics of the phage community (abundance, development, diversity, evolution, etc.) in dairies with different sizes, locations, and production strategies. It may also enable the discovery of previously unknown phages, which is crucial for the development of rapid molecular biology-based methods for phage burden surveillance systems. The dominance of only a few phage groups in the dairy environment signifies the depth of knowledge
Cao, Xiaolin; Stimpfl, Gregory; Wen, Zai-Qing; Frank, Gregory; Hunter, Glenn
2013-01-01
High-temperature/short-time (HTST) treatment of cell culture media is one of the proven techniques used in the biopharmaceutical manufacturing industry for the prevention and mitigation of media viral contamination. With the HTST method, the formulated media is pasteurized (virus-deactivated) by heating and pumping the media continuously through the preset high-temperature holding tubes to achieve a specified period of time at a specific temperature. Recently, during the evaluation and implementation of HTST method in multiple Amgen, Inc. manufacturing facilities, media precipitates were observed in the tests of HTST treatments. The media precipitates may have adverse consequences such as clogging the HTST system, altering operating conditions and compromising the efficacy of viral deactivation, and ultimately affecting the media composition and cell growth. In this study, we report the identification of the composition of media precipitates from multiple media HTST runs using combined microspectroscopic methods including Raman, Fourier transform infrared spectroscopy, and scanning electron microscopy with energy-dispersive X-ray spectroscopy. The major composition in the precipitates was determined to be metal phosphates, including calcium phosphate, magnesium phosphate, and iron (III) phosphate. Based on the composition, stoichiometry, and root-cause study of media precipitations, methods were implemented for the mitigation and prevention of the occurrence of the media precipitation. Viral contamination in cell culture media is an important issue in the biopharmaceutical manufacturing industry and may have serious consequences on product quality, efficacy, and safety. High-temperature/short-time (HTST) treatment of cell culture media is one of the proven techniques used in the industry for the prevention and mitigation of media viral contamination. With the HTST method, the formulated media is pasteurized (virus-deactivated) by heating at preset conditions. This
Lu, Qian; You, Jin; Man, Jenny; Loh, Alice; Young, Lucy
2014-11-01
To evaluate a social support intervention that was culturally tailored for Chinese Americans who face many challenges because of cultural and linguistic barriers. Intervention with a one-group pre- or post-test design, mixed methods, and a community-based participatory research (CBPR) approach. Southern California. 14 Chinese American breast cancer survivors post-treatment and eight breast cancer peer mentors. The intervention was a 10-week program to provide emotional and informational support through peer mentoring and education. Health outcomes were assessed before and after the intervention. Eight weekly process evaluations and two focus group interviews also were conducted. Depressive and anxiety symptoms. The program was associated with a decrease in depressive symptoms. Participants valued the program highly. Inductive analysis suggested possible mechanisms for effectiveness, such as reducing stigma, empowerment, and increased sense of belonging. The peer-mentoring and education program has the potential to serve as a model intervention for ethnic minorities. Mixed methods and CBPR are valuable in evaluating pilot interventions with minorities. Focusing on relationships may be fruitful for designing novel interventions for cancer survivors from collectivistic cultures. Peer-mentoring and education programs can be integrated into communities and clinics to improve care for underserved minority cancer survivors and to reduce health disparities.
Directory of Open Access Journals (Sweden)
Arturo Levican
2016-01-01
Full Text Available The genus Arcobacter includes species considered emerging food and waterborne pathogens. Despite Arcobacter has been linked to the presence of faecal pollution, few studies have investigated its prevalence in wastewater, and the only isolated species were Arcobacter butzleri and Arcobacter cryaerophilus. This study aimed to establish the prevalence of Arcobacter spp. at a WWTP using in parallel two culturing methods (direct plating and culturing after enrichment and a direct detection by m-PCR. In addition, the genetic diversity of the isolates was established using the ERIC-PCR genotyping method. Most of the wastewater samples (96.7% were positive for Arcobacter and a high genetic diversity was observed among the 651 investigated isolates that belonged to 424 different ERIC genotypes. However, only few strains persisted at different dates or sampling points. The use of direct plating in parallel with culturing after enrichment allowed recovering the species A. butzleri, A. cryaerophilus, Arcobacter thereius, Arcobacter defluvii, Arcobacter skirrowii, Arcobacter ellisii, Arcobacter cloacae, and Arcobacter nitrofigilis, most of them isolated for the first time from wastewater. The predominant species was A. butzleri, however, by direct plating predominated A. cryaerophilus. Therefore, the overall predominance of A. butzleri was a bias associated with the use of enrichment.
Riley, Donna M; Newby, C Alison; Leal-Almeraz, Tomás O
2006-10-01
The potential risk from cultural and religious practices involving mercury in Latino and Caribbean communities raises central methodological and ethical questions for risk assessment and risk communication. Here, specific cultural practices unfamiliar to most risk professionals carry significant inherent risks in the eyes of those professionals but not necessarily in the eyes of practitioners. Practitioners' past experience and history as targets of religious suppression and anti-immigrant sentiment create a reluctance to engage with researchers or public health officials in risk assessment or preventive risk communication efforts. The potential for the risk--in this case mercury contamination in dwellings--to extend beyond the practicing community to future occupants adds to public health concern. Understanding the risks of these practices requires both an understanding of the cultural and political context, beliefs, and behaviors of mercury users and an understanding of the fate and transport of mercury in typical use scenarios. In this study, we employed ethnographic methods (interviews and participant observation) to understand beliefs and behavior about mercury use as well as quantitative modeling and measurement to estimate and assess potential exposures. This represents a new methodology tailored to situations in which traditional activities or observances that are integral components of cultural identity pose risks in and of themselves. Our findings indicate that there are different types of mercury use stemming from different cultural and religious traditions that result in different levels of exposure. Many of the mercury uses that can result in the highest exposures to mercury vapors have previously been attributed to the religious tradition of Santeria, but appear instead to have their roots outside of the religion.
Wutich, Amber; Budds, Jessica; Eichelberger, Laura; Geere, Jo; Harris, Leila; Horney, Jennifer; Jepson, Wendy; Norman, Emma; O'Reilly, Kathleen; Pearson, Amber; Shah, Sameer; Shinn, Jamie; Simpson, Karen; Staddon, Chad; Stoler, Justin; Teodoro, Manuel P; Young, Sera
2017-11-01
Household water insecurity has serious implications for the health, livelihoods and wellbeing of people around the world. Existing methods to assess the state of household water insecurity focus largely on water quality, quantity or adequacy, source or reliability, and affordability. These methods have significant advantages in terms of their simplicity and comparability, but are widely recognized to oversimplify and underestimate the global burden of household water insecurity. In contrast, a broader definition of household water insecurity should include entitlements and human capabilities, sociocultural dynamics, and political institutions and processes. This paper proposes a mix of qualitative and quantitative methods that can be widely adopted across cultural, geographic, and demographic contexts to assess hard-to-measure dimensions of household water insecurity. In doing so, it critically evaluates existing methods for assessing household water insecurity and suggests ways in which methodological innovations advance a broader definition of household water insecurity.
DEFF Research Database (Denmark)
Liu, Yu; Wang, Shouxian; Yin, Yonggang
2012-01-01
habitat to facilitate its large-scale cultivation. A culture-independent molecular approach—a powerful technology for microbiological ecology studies—was used to investigate the diversity of soil fungal communities in samples surrounding C. rutilus from the Beijing region of China. Metagenomic DNA...... was isolated from soil samples collected around C. rutilus, and an internal transcribed spacer (ITS) gene library was constructed. Subsequently, polymerase chain reaction products were digested with HinfI, HaeIII, MspI, TaqI, or MboI. Clones were selected and sequenced based on their restriction fragment...... length polymorphisms. The diversity of the fungi represented by their ITS sequences was analyzed. Our results indicate the presence of numerous fungi in the C. rutilus habitat. This study is the first demonstration of the fungal ecology surrounding C. rutilus using a culture independent method...
International Nuclear Information System (INIS)
Tron'ko, M.D.; Paster, Yi.P.; Vojtenko, L.M.; Donyich, S.F.
1999-01-01
The aim of the present study was to evaluate the reestablishment of the thyroid function in rats with radiation-induced hypothyroidism. The serum total thyroxine (TT4) and total triiodothyronine (TT3) values in male Wistar rats, weighing of 100-150 g, fell to low levels by 2 weeks after 2.775 MBq 131-iodine administration. The values of serum TT4 in rats were generally in the euthyroid range by the 17th day after xenotransplantation (XTP) of 3-day old newborn pig thyroid organ culture by injection into the fat tissue of anterior abdominal wall. The serum TT3 values rose rapidly and reached normal levels by the 7th day after XTP. 7 days after XTP, all newborn pig thyroid xenografts showed 131-iodine uptake, and four of five xenografts were still functional bu the 17th day. These results indicate that the xenografted newborn pig thyroid organ culture allows a restoration of the thyroid function in rats with post radioiodine hypothyroidism
Srivastava, Priyanka; Chaturvedi, Rakhi
2011-07-01
Present report is the first direct evidence of azadirachtin production in androgenic haploid cultures of Azadirachta indica, a woody medicinal tree. Anther cultures at early-late-uninucleate stage of microspores were established on MS medium with BAP (5 μM), 2,4-D (1 μM) and NAA (1 μM) containing 12% sucrose. The calli, induced, were further multiplied on 2,4-D and Kinetin media. Shoots, differentiated on BAP (2.2 μM) + NAA (0.05 μM) medium, were elongated on MS + BAP (0.5 μM) and multiplied on MS + BAP (1 μM) + CH (250 mg/l). Thereafter, the shoots were rooted on ¼ MS + IBA (0.5 μM). Cytological analysis of the calli and regenerants have confirmed their haploid status with the chromosome number as 2n = x = 12. The haploid cell lines and leaves from in vitro grown plantlets were analyzed for azadirachtin by RP-HPLC and mass spectroscopy. Maximum azadirachtin (728.41 μg/g DW) was detected in calli supporting best shoot proliferation while least (49 μg/g DW) was observed in an undifferentiated line from maintenance medium. This study has brought us a step closer to develop genetically pure lines that could serve as new and attractive alternative ways of homogeneous controlled production of high value compounds, round the year, independent of geographical and climatic barrier.
Directory of Open Access Journals (Sweden)
Adak Tridibesh
2009-05-01
Full Text Available Abstract Background Mosquitoes are intermediate hosts for numerous disease causing organisms. Vector control is one of the most investigated strategy for the suppression of mosquito-borne diseases. Anopheles stephensi is one of the vectors of malaria parasite Plasmodium vivax. The parasite undergoes major developmental and maturation steps within the mosquito midgut and little is known about Anopheles-associated midgut microbiota. Identification and characterization of the mosquito midgut flora is likely to contribute towards better understanding of mosquito biology including longevity, reproduction and mosquito-pathogen interactions that are important to evolve strategies for vector control mechanisms. Results Lab-reared and field-collected A. stephensi male, female and larvae were screened by "culture-dependent and culture-independent" methods. Five 16S rRNA gene library were constructed form lab and field-caught A. stephensi mosquitoes and a total of 115 culturable isolates from both samples were analyzed further. Altogether, 68 genera were identified from midgut of adult and larval A. stephensi, 53 from field-caught and 15 from lab-reared mosquitoes. A total of 171 and 44 distinct phylotypes having 85 to 99% similarity with the closest database matches were detected among field and lab-reared A. stephensi midgut, respectively. These OTUs had a Shannon diversity index value of 1.74–2.14 for lab-reared and in the range of 2.75–3.49 for field-caught A. stephensi mosquitoes. The high species evenness values of 0.93 to 0.99 in field-collected adult and larvae midgut flora indicated the vastness of microbial diversity retrieved by these approaches. The dominant bacteria in field-caught adult male A. stephensi were uncultured Paenibacillaceae while in female and in larvae it was Serratia marcescens, on the other hand in lab-reared mosquitoes, Serratia marcescens and Cryseobacterium meninqosepticum bacteria were found to be abundant. Conclusion
Park, Eunyoung; Lee, Cheonghoon; Bisesi, Michael; Lee, Jiyoung
2014-03-01
The disinfection efficiency of peracetic acid (PAA) was investigated on three microbial types using three different methods (filtration-based ATP (adenosine-triphosphate) bioluminescence, quantitative polymerase chain reaction (qPCR), culture-based method). Fecal indicator bacteria (Enterococcus faecium), virus indicator (male-specific (F(+)) coliphages (coliphages)), and protozoa disinfection surrogate (Bacillus subtilis spores (spores)) were tested. The mode of action for spore disinfection was visualized using scanning electron microscopy. The results indicated that PAA concentrations of 5 ppm (contact time: 5 min), 50 ppm (10 min), and 3,000 ppm (5 min) were needed to achieve 3-log reduction of E. faecium, coliphages, and spores, respectively. Scanning electron microscopy observation showed that PAA targets the external layers of spores. The lower reduction rates of tested microbes measured with qPCR suggest that qPCR may overestimate the surviving microbes. Collectively, PAA showed broad disinfection efficiency (susceptibility: E. faecium > coliphages > spores). For E. faecium and spores, ATP bioluminescence was substantially faster (∼5 min) than culture-based method (>24 h) and qPCR (2-3 h). This study suggests PAA as an effective alternative to inactivate broad types of microbial contaminants in water. Together with the use of rapid detection methods, this approach can be useful for urgent situations when timely response is needed for ensuring water quality.
Cullen, John J; MacIntyre, Hugh L
2016-01-01
Discharge standards for ballast water treatment (BWT) systems are based on concentrations of living cells, for example, as determined with vital stains. Ultraviolet radiation (UV) stops the reproduction of microorganisms without killing them outright; they are living, but not viable, and ecologically as good as dead. Consequently, UV-treated discharge can be compliant with the intent of regulation while failing a live/dead test. An alternative evaluation of BWT can be proposed based on the assessment of viable, rather than living, cells in discharge water. In principle, the serial dilution culture-most probable number (SDC-MPN) method provides the appropriate measure for phytoplankton. But, the method has been criticized, particularly because it is thought that many phytoplankton species cannot be cultured. A review of the literature shows that although SDC-MPN has been used for more than 50 years-generally to identify and count phytoplankton species that cannot be preserved-its application to enumerate total viable phytoplankton seems to be new, putting past criticisms of the method in a different light. Importantly, viable cells need to grow only enough to be detected, not to be brought into sustained culture, and competition between species in a dilution tube is irrelevant as long as the winner is detectable. Thorough consideration of sources of error leads to recommendations for minimizing and quantifying uncertainties by optimizing growth conditions and conducting systematic comparisons. We conclude that with careful evaluation, SDC-MPN is potentially an effective method for assessing the viability of phytoplankton after BWT.
International Nuclear Information System (INIS)
Chen Zigen
1996-01-01
The paper mainly expounds the personal safety culture, including the following aspects: the attitude to exploration, strict methods and the habit of exchange etc. It points out that straightening the education of safety culture and heightening the level of personal safety culture can get not only high-level safety but also high-level quality
Lee, Othelia E; Ryu, Seungah
2018-03-01
Pride and regret are self-conscious emotions that develop later in life and become a source of emotional struggle. This cross-cultural study examined the effect of the content and intensity of self-conscious emotions on Geriatric Depression Scale (GDS) scores. Among a convenience sample of 234 older adults (130 in the United States and 104 in South Korea), the contents and intensities of both life regrets and pride were examined. Although a greater variety of regrets was cited by Americans, overall Korean respondents reported higher intensity of regret. Regrets that were related to leisure and addiction among Americans and health and career among Koreans were predictors of the GDS scores. Pride in leisure activities for Americans and altruism among Koreans could alleviate depression. While regrets and pride explained a small amount of the variance in the GDS scores, current life stressors greatly contributed to geriatric depression.
Directory of Open Access Journals (Sweden)
Grace Donoho
2015-09-01
Full Text Available Little is known about the health status of Marshallese, a Pacific Islander subpopulation living in the United States. The Marshallese have established a growing community in Northwest Arkansas, providing a unique opportunity for increasing knowledge regarding the health of this minority group. This article describes how a community-based participatory research process was used by a community and university coalition to identify and refine questionnaires and recruit study participants. Questionnaires were self-administered on computers during a one-week traditional cultural event. A total of 874 Marshallese from Arkansas completed the questionnaire, exceeding the goal of 600 respondents. Lessons learned, including the level and timing of involvement of both the leadership and the community at large, are discussed in detail. This approach enhanced communication and collaboration between the Marshallese community, service providers and researchers, resulting in higher participation and interest among the Marshallese community. Keywords: participatory research, minority populations, community health assessment, community coalition, Marshallese
DEFF Research Database (Denmark)
Sørensen, Tina Møller; Jensen, A.B.; Damborg, Peter Panduro
2016-01-01
)/mL. Voided specimens were compared to cystocentesis using: (1) the veterinary cut-off of ≥100,000 CFU/mL; and (2) various cut-offs depending on qualitative criteria (sex, clinical signs and complicating factors), adapted from human guidelines. Ninety-four dogs with suspected urinary tract infection (UTI...... and specificity of 97% (95% CI 0.86, 1.00) and 86% (95% CI 0.77, 0.92), respectively. The veterinary cut-off value of ≥100,000 CFU/mL for voided urine is appropriate for determining significant bacteriuria in the majority of dogs with suspected UTI if specimens are refrigerated and cultured on the day...
Lycett, Stephen J; Collard, Mark; McGrew, William C
2010-07-01
Over the last 30 years it has become increasingly apparent that there are many behavioral differences among wild communities of Pan troglodytes. Some researchers argue these differences are a consequence of the behaviors being socially learned, and thus may be considered cultural. Others contend that the available evidence is too weak to discount the alternative possibility that the behaviors are genetically determined. Previous phylogenetic analyses of chimpanzee behavior have not supported the predictions of the genetic hypothesis. However, the results of these studies are potentially problematic because the behavioral sample employed did not include communities from central Africa. Here, we present the results of a study designed to address this shortcoming. We carried out cladistic analyses of presence/absence data pertaining to 19 tool-use behaviors in 10 different P. troglodytes communities plus an outgroup (P. paniscus). Genetic data indicate that chimpanzee communities in West Africa are well differentiated from those in eastern and central Africa, while the latter are not reciprocally monophyletic. Thus, we predicted that if the genetic hypothesis is correct, the tool-use data should mirror the genetic data in terms of structure. The three measures of phylogenetic structure we employed (the Retention Index, the bootstrap, and the Permutation Tail Probability Test) did not support the genetic hypothesis. They were all lower when all 10 communities were included than when the three western African communities are excluded. Hence, our study refutes the genetic hypothesis and provides further evidence that patterns of behavior in chimpanzees are the product of social learning and therefore meet the main condition for culture. (c) 2010 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Stalis Norma Ethica
2013-12-01
Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.
Miyazaki, Tatsuya; Miyauchi, Satoshi; Matsuzaka, Satoshi; Yamagishi, Chie; Kobayashi, Kohei
2010-05-01
Tissue-engineered cartilage may be expected to serve as an alternative to autologous chondrocyte transplantation treatment. Several methods for producing cartilaginous tissue have been reported. In this study, we describe the production of scaffold-free stiff cartilaginous tissue of pig and human, using allogeneic serum and growth factors. The tissue was formed in a mold using chondrocytes recovered from alginate bead culture and maintained in a medium with transforming growth factor-beta and several other additives. In the case of porcine tissue, the tear strength of the tissue and the contents of proteoglycan (PG) and collagen per unit of DNA increased dose-dependently with transforming growth factor-beta. The length of culture was significantly and positively correlated with thickness, tear strength, and PG and collagen contents. Tear strength showed positive high correlations with both PG and collagen contents. A positive correlation was also seen between PG content and collagen content. Similar results were obtained with human cartilaginous tissue formed from chondrocytes expanded in monolayer culture. Further, an in vivo pilot study using pig articular cartilage defect model demonstrated that the cartilaginous tissue was well integrated with surrounding tissue at 13 weeks after the implantation. In conclusion, we successfully produced implantable scaffold-free stiff cartilaginous tissue, which characterized high PG and collagen contents.
Directory of Open Access Journals (Sweden)
Wen-Jong Chen
2016-04-01
Full Text Available This article combined Taguchi method and analysis of variance with the culture-based quantum-behaved particle swarm optimization to determine the optimal models of gating system for aluminium (Al A356 sand casting part. First, the Taguchi method and analysis of variance were, respectively, applied to establish an L27(38 orthogonal array and determine significant process parameters, including riser diameter, pouring temperature, pouring speed, riser position and gating diameter. Subsequently, a response surface methodology was used to construct a second-order regression model, including filling time, solidification time and oxide ratio. Finally, the culture-based quantum-behaved particle swarm optimization was used to determine the multi-objective Pareto optimal solutions and identify corresponding process conditions. The results showed that the proposed method, compared with initial casting model, enabled reducing the filling time, solidification time and oxide ratio by 68.14%, 50.56% and 20.20%, respectively. A confirmation experiment was verified to be able to effectively reduce the defect of casting and improve the casting quality.
McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D
2017-01-01
Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and
Endoparasites must breach host barriers to establish infection and then must survive host internal defenses to cause disease. Such barriers may frustrate attempts to experimentally transmit parasites by ?natural' methods. In addition, the host's condition may affect a study's out...
International Nuclear Information System (INIS)
Silverman, J.A.
1984-01-01
In this study, it was shown that standard techniques for cell recovery and sample preparation for liquid scintillation counting led to underestimation of the radioactivity present in cell proteins by 20-40%. These techniques involved labeling with 3 He leucine or 14 C leucine, scraping the cells from the dish in a buffer, TCA precipitation of the cell proteins, solubilization in NaOH and counting in a liquid scintillation counter. Hydrolysis of the proteins with HCl or Pronase significantly increased the recovery of the labeled proteins. Also, solubilization in situ with NaOH or hydrolysis in situ with Pronase recovered 5-10% additional labeled proteins. The techniques developed here allow the accurate measurement of radioactivity in cell proteins. In addition, these techniques were used to study protein turnover in rat hepatoma cells grown in culture. These cells regulated their growth rate through changes in the protein synthesis rate as opposed to changes in the protein degradation rate. These data support the hypothesis that neoplastic cells, unlike normal cells, do not regulate proteolysis in growth control; normal cells under similar conditions have been shown to activate lysosomal proteolysis as they reach confluence. The physiologic implications of this observation are discussed
Lee, Wai-Yung; Nakamura, Shin-Ichi; Chung, Moon Ja; Chun, Young Ju; Fu, Meng; Liang, Shu-Chuan; Liu, Cui-Lian
2013-09-01
The purpose of this study was to explore variations in how contemporary couples from five different Asian regions negotiate disagreements. Video recordings of 50 couples (10 each from Japan, Korea, Mainland China, Taiwan, and Hong Kong) discussing unresolved disagreements provided raw data for quantitative and qualitative analyses. First, teams of coders from each region used a common protocol to make quantitative ratings of content themes and interaction patterns for couples from their own region. An interregional panel of investigators then performed in-depth qualitative reviews for half of these cases, noting cultural differences not only in observed patterns of couple behavior but also in their own perceptions of these patterns. Both quantitative and qualitative analyses revealed clear regional differences on dimensions such as overt negativity, demand-withdraw interaction, and collaboration. The qualitative results also provided a richer, more nuanced view of other (e.g., gender-linked) conflict management patterns that the quantitative analyses did not capture. Inconsistencies between qualitative and quantitative data and between the qualitative observations of investigators from different regions were most pronounced for couples from Korea and Japan, whose conflict styles were subtler and less direct than those of couples from the other regions. © FPI, Inc.
Directory of Open Access Journals (Sweden)
Sergio Frugoni
2008-03-01
Full Text Available The purpose of blood cultures in the septic patient is to address a correct therapeutic approach. Identification and antibiotic susceptibility test carried out directly from the bottle may give important information in short time.The introduction of the automatic instrumentation has improved the discovering of pathogens in the blood, however the elapsing time between the positive detection and the microbiological report is still along. Is the evaluation of this study a fast, easy, cheap method to be applied to the routine, which could reduce the response time in the bacteraemia diagnosis.The automatic systems Vitek Senior (bioMérieux, and Vitek 2 (bioMérieux were used at Pio Albergo Trivulzio (Centre1 and at Istituto dei Tumori (Centre2 respectivetly.To remove blood cells, 7 ml. of the culture has been moved by vacuum sampling in a test tube and centrifuged for 10 minutes at 1000 rpm the supernatant has been further centrifuged for 10 minutes at 3000 rpm.0.5 ml. of BHI has been added to the pellet o sediment.The concentration of bacterial suspension has been fit for the inoculation. At the same time has been prepared standard cultures in suitable culture media were carried out for comparison. In the centro1 and centro2 have been isolated and identify respectively 63 and 31 Gram negative, and, 32 and 40 gram positive microorganisms have been isolated and identify in the Centre1 and Centre2 respectively.The identification Gram-negative and Gram positive microorganisms showed an agreement of 100% and 86.2% and 93.3% and 65.78% respectively between the direct and the standard method. For antibiotic susceptibility tests, 903 (Centre1 and 491 (Centre2 and 396 and 509 compounds were totally assessed in Gram negative and Gram positive bacteria respectively.The analysis has highlighted that: Centre1 has reported 0.30% very major errors (GE, 0.92% major errors (EM, 1.23% minor errors (Em. Centre 2 showed 0.57% very major errors (GE, 0.09% major errors
Directory of Open Access Journals (Sweden)
Dehghan fatemeh
2014-05-01
Conclusions: Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN.
The U.S.EPA has published recommendations for calibrator cell equivalent (CCE) densities of enterococci in recreational waters determined by a qPCR method in its 2012 Recreational Water Quality Criteria (RWQC). The CCE quantification unit stems from the calibration model used to ...
Lin, Xiao-Li; Pan, Qin-Jian; Tian, Hong-Gang; Douglas, Angela E; Liu, Tong-Xian
2015-03-01
Microbial abundance and diversity of different life stages (fourth instar larvae, pupae and adults) of the diamondback moth, Plutella xylostella L., collected from field and reared in laboratory, were investigated using bacteria culture-dependent method and PCR-DGGE analysis based on the sequence of bacteria 16S rRNA V3 region gene. A large quantity of bacteria was found in all life stages of P. xylostella. Field population had higher quantity of bacteria than laboratory population, and larval gut had higher quantity than pupae and adults. Culturable bacteria differed in different life stages of P. xylostella. Twenty-five different bacterial strains were identified in total, among them 20 strains were presented in larval gut, only 8 strains in pupae and 14 strains in adults were detected. Firmicutes bacteria, Bacillus sp., were the most dominant species in every life stage. 15 distinct bands were obtained from DGGE electrophoresis gel. The sequences blasted in GenBank database showed these bacteria belonged to six different genera. Phylogenetic analysis showed the sequences of the bacteria belonged to the Actinobacteri, Proteobacteria and Firmicutes. Serratia sp. in Proteobacteria was the most abundant species in larval gut. In pupae, unculturable bacteria were the most dominant species, and unculturable bacteria and Serratia sp. were the most dominant species in adults. Our study suggested that a combination of molecular and traditional culturing methods can be effectively used to analyze and to determine the diversity of gut microflora. These known bacteria may play important roles in development of P. xylostella. © 2013 Institute of Zoology, Chinese Academy of Sciences.
Directory of Open Access Journals (Sweden)
S. Tavajohi
2005-06-01
Full Text Available Vaccination against mumps is included in world Health Organization (WHO program of global immunization. Safety and efficacy of vaccines must be confirmed by control units in charge of public health. In Iran, the secondary control on potency of vaccine has not been set up yet. We decided to overcome this problem by developing WHO and NIBSC methods in Food and Drug Control Lab. Nine dilutions of vaccine from 10-1 to 10-5 in 0.5log10 steps were mixed with Vero cell suspension. In WHO method, the cell suspension was seeded in octaplicate (8 wells of each dilution in 24-well plate and incubated at 36°C for 10 days, during which the cells were checked for cytopathic changes everyday and positive wells were recorded. We used 5% serum and 1 × 105 cells for the assays. The test was repeated with six different vaccines produced in one batch. The mean potency was 10 4.475±0.134 CCID50/vial for each ten-dose vial. For NIBSC method the dilutions of vaccine were added to hexaplicate (6 well per dilution in 24-wells plate. After 3 hours, the medium was removed and overlay was added. Then the plates were incubated at 35°C for 10 days. After incubation period, the plaques were stained with methyl violet and counted. This assay was repeated three times and the mean of results was 5.93 log10 PFU/dose. Results indicate that the potency of the vaccine is in acceptable range in either method. WHO method is simple and less time consuming compared to NIBSC method.
Wei, Zi-Zhong; Zhao, Wen
2014-01-01
The effects of light intensity (0, 1000, 2000 and 3000 1x) on the growth and digestive enzyme activity of juvenile sea cucumber Apostichopus japonicus under two kinds of culture methods (compound Chinese medicine preparation and microbial preparation) were studied. Results showed that the relative mass gain rate (WGR) and the specific growth rate (SGR) of juvenile sea cucumber were significantly affected by light intensity (P sea cucumber under different light intensities were 2000 1x > 1000 1x > 3000 1x > 0 1x. Under the same light intensity, the growth of juvenile sea cucumber under the two kinds of culture methods were significantly different (P sea cucumber. The order of amylase and lipase activity was 2000 1x > 1000 1x > 3000 1x > 0 1x, while that of protease activity was 1000 1x > 2000 1x > 0 1x > 3000 1x. Under the same light intensity, the digestive enzyme activities of the Chinese medicine treatment were generally higher than those of the microbial treatment.
Kaur, Ravinder; Wischmeyer, Jareth; Morris, Matthew; Pichichero, Michael E
2017-11-01
We compared the recovery of potential respiratory bacterial pathogens and normal flora from nasopharyngeal specimens collected from children during health and at the onset of acute otitis media (AOM) by selective direct-plating and overnight broth-enrichment. Overall, 3442 nasal wash (NW) samples collected from young children were analysed from a 10-year prospective study. NWs were cultured by (1) direct-plating to TSAII/5 % sheep blood agar and chocolate agar plates and (2) overnight broth-enrichment in BacT/ALERT SA-broth followed by plating. Standard microbiology techniques were applied to identify three dominant respiratory bacterial pathogens: Streptococcus pneumoniae (Spn), Haemophilus influenzae (Hflu) and Moraxella catarrhalis (Mcat) as well as two common nasal flora, Staphylococcus aureus (SA) and alpha-haemolytic Streptococci (AHS).Results/Key findings. Direct-plating of NW resulted in isolation of Spn from 37.8 %, Hflu from 13.6 % and Mcat from 33.2 % of samples. In comparison, overnight broth-enrichment isolated fewer Spn (30.1 %), Hflu (6.2 %) and Mcat (16.2 %) (Penrichment resulted in significant increased isolation of SA (6.0 %) and AHS (30.1 %) (Penrichment when samples were collected from healthy children but not during AOM. In middle ear fluids (MEF) at the onset of AOM, broth-enrichment resulted in higher recovery of Spn (+10.4 %, Penrichment significantly reduces the accurate detection of bacterial respiratory pathogens and increases identification of SA and AHS in NW. Broth-enrichment improves detection of bacterial respiratory pathogens in MEF samples.
Fasli, Mukaddes; Hassanpour, Badiossadat
2017-01-01
In this century, all educational efforts strive to achieve quality assurance standards. Therefore, it will be naive to deny the existence of problems in architectural education. The current design studio critique method has been developed upon generations of students and educators. Architectural education is changing towards educating critical…
El Fiky, U.; Hamdy, I.; Fikry, M.
2006-01-01
This paper is concerned with evaluating and testing the application process of green architecture design strategies using a tool-box as a built environment educating method and a pre-design reminder. Understanding the suggested green design strategies, testing the tool-box effectiveness,
Moriguchi, Hiroyuki; Yasuda, Kenji
2006-08-01
We have developed a new three-dimensional (3D) microfabrication method for agarose gel, photothermal microneedle etching (PTMNE), by means of an improved photothermal spot heating using a focused 1064 nm laser beam for melting a portion of the agarose layer at the tip of the microneedle, where a photoabsorbent chromium layer is coated to be heated. The advantage of this method is that it allows the 3D control of the melting topography within the thick agarose layer with a 2 μm resolution, whereas conventional photothermal etching can enable only two-dimensional (2D) control on the surface of the chip. By this method, we can form the spheroid clusters of particular cells from isolated single cells without any physical contact with other cells in other chambers, which is important for measuring the community effect of the cell group from isolated single cells. When we set single cancer cells in microchambers of 100 μm in diameter, formed in a 50-μm-thick agarose layer, we observed that they grew, divided, and formed spheroid clusters of cells in each microchamber. The result indicates the potential of this method to be a fundamental technique in the research of multicellular spherical clusters of cells for checking the community effect of cells in 3D structures, such as the permeabilities of chemicals and substrates into the cluster, which is complementary to conventional 2D dish cultivation and can contribute to the cell-based screening of drugs.
Lindert, A. te; Korzilius, H.P.L.M.
2008-01-01
In this study we explored the most important topics of acculturation experiences among Iranian refugees in the Netherlands, using the Self-Confrontation Method (Hermans & Hermans-Jansen, 1995). We discussed the Dialogical Self Theory reffering to the multiple selves of people who have to deal with
International Nuclear Information System (INIS)
Liu, H.S.; Lin, Y.L.; Chen, C.C.
1997-01-01
In this report, the sensitivity of various methods of detection of dengue virus type 2 (DEN-2) sense, antisense, replicative intermediate (RI) and replicative form (RF) RNAs in infected mosquito Aedes pseudoscutellaris AP-61 and mammalian baby hamster kidney BHK-21 cells is compared. LiCl precipitation was used for separation of viral RF RNA from RI RNA. Our results show that reverse transcription-polymerase chain reaction (RT-PCR) followed by Southern blot analysis and slot blot hybridisation of LiCl-fractionated RNA were the most sensitive methods of detection of viral RNA and determination of its single-stranded form. Northern blot analysis was the least sensitive method of detection of any form of viral RNA. U sing slot blot hybridisation of LiCl-precipitated RNA, viral RI RNA containing de novo synthesised negative strand viral RNA was first detected 30 min after virus inoculation in both cell lines. This is the earliest time of detection of DEN viral RNA synthesis in host cells so far reported. However, RF RNA could not be detected until 24 hrs post infection (p.i.) in AP-61 and 2 days p.i. in BHK-21 cells, respectively. The sequential order of individual forms of viral RNA detected in the infected cells was RI, RF and genomic RNAs. Viral RNA was detected in AP-61 cells always earlier than in BHK-21 cells. Moreover, the level of viral RNA in AP-61 cells was higher than that in BHK-21 cells, suggesting that the virus replicated more actively in AP-61 cells. In conclusion, the LiCl separation of viral RNA followed by slot blot hybridisation was found to be the most sensitive and reliable method of detection of DEN virus RI, RF and genomic RNAs in the infected cells. Moreover, this method can be applied to determine the replication status of any single-stranded RNA virus in the host. (authors)
Jeddi, Fakhri; Yapo-Kouadio, Gisèle Cha; Normand, Anne-Cécile; Cassagne, Carole; Marty, Pierre; Piarroux, Renaud
2017-02-01
In cases of fungal infection of the bloodstream, rapid species identification is crucial to provide adapted therapy and thereby ameliorate patient outcome. Currently, the commercial Sepsityper kit and the sodium-dodecyl sulfate (SDS) method coupled with MALDI-TOF mass spectrometry are the most commonly reported lysis protocols for direct identification of fungi from positive blood culture vials. However, the performance of these two protocols has never been compared on clinical samples. Accordingly, we performed a two-step survey on two distinct panels of clinical positive blood culture vials to identify the most efficient protocol, establish an appropriate log score (LS) cut-off, and validate the best method. We first compared the performance of the Sepsityper and the SDS protocols on 71 clinical samples. For 69 monomicrobial samples, mass spectrometry LS values were significantly higher with the SDS protocol than with the Sepsityper method (P < .0001), especially when the best score of four deposited spots was considered. Next, we established the LS cut-off for accurate identification at 1.7, based on specimen DNA sequence data. Using this LS cut-off, 66 (95.6%) and 46 (66.6%) isolates were correctly identified at the species level with the SDS and the Sepsityper protocols, respectively. In the second arm of the survey, we validated the SDS protocol on an additional panel of 94 clinical samples. Ninety-two (98.9%) of 93 monomicrobial samples were correctly identified at the species level (median LS = 2.061). Overall, our data suggest that the SDS method yields more accurate species identification of yeasts, than the Sepsityper protocol. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Developing cultural sensitivity
DEFF Research Database (Denmark)
Ruddock, Heidi; Turner, deSalle
2007-01-01
. Background. Many countries are becoming culturally diverse, but healthcare systems and nursing education often remain mono-cultural and focused on the norms and needs of the majority culture. To meet the needs of all members of multicultural societies, nurses need to develop cultural sensitivity......Title. Developing cultural sensitivity: nursing students’ experiences of a study abroad programme Aim. This paper is a report of a study to explore whether having an international learning experience as part of a nursing education programme promoted cultural sensitivity in nursing students...... and incorporate this into caregiving. Method. A Gadamerian hermeneutic phenomenological approach was adopted. Data were collected in 2004 by using in-depth conversational interviews and analysed using the Turner method. Findings. Developing cultural sensitivity involves a complex interplay between becoming...
Nishikawa, Keizo; Iwamoto, Yoriko; Ishii, Masaru
2014-05-01
The development of methods for differentiation of embryonic stem cells (ESCs) and induced pluripotent stem cell (iPSCs) into functional cells have helped to analyze the mechanism regulating cellular processes and to explore cell-based assays for drug discovery. Although several reports have demonstrated methods for differentiation of mouse ESCs into osteoclast-like cells, it remains unclear whether these methods are applicable for differentiation of iPSCs to osteoclasts. In this study, we developed a simple method for stepwise differentiation of mouse ESCs and iPSCs into bone-resorbing osteoclasts based upon a monoculture approach consisting of three steps. First, based on conventional hanging-drop methods, embryoid bodies (EBs) were produced from mouse ESCs or iPSCs. Second, EBs were cultured in medium supplemented with macrophage colony-stimulating factor (M-CSF), and differentiated to osteoclast precursors, which expressed CD11b. Finally, ESC- or iPSC-derived osteoclast precursors stimulated with receptor activator of nuclear factor-B ligand (RANKL) and M-CSF formed large multinucleated osteoclast-like cells that expressed tartrate-resistant acid phosphatase and were capable of bone resorption. Molecular analysis showed that the expression of osteoclast marker genes such as Nfatc1, Ctsk, and Acp5 are increased in a RANKL-dependent manner. Thus, our procedure is simple and easy and would be helpful for stem cell-based bone research.
Energy Technology Data Exchange (ETDEWEB)
Klingbeil, Maria Fatima Guarizo
2006-07-01
The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)
Yaguchi, A; Nagase, K; Ishikawa, M; Iwasaka, T; Odagaki, M; Hosaka, H
2006-01-01
Computer simulation and myocardial cell models were used to evaluate a low-energy defibrillation technique. A generated spiral wave, considered to be a mechanism of fibrillation, and fibrillation were investigated using two myocardial sheet models: a two-dimensional computer simulation model and a two-dimensional experimental model. A new defibrillation technique that has few side effects, which are induced by the current passing into the patient's body, on cardiac muscle is desired. The purpose of the present study is to conduct a basic investigation into an efficient defibrillation method. In order to evaluate the defibrillation method, the propagation of excitation in the myocardial sheet is measured during the normal state and during fibrillation, respectively. The advantages of the low-energy defibrillation technique are then discussed based on the stimulation timing.
Directory of Open Access Journals (Sweden)
M. Kedzierski
2015-08-01
Full Text Available When documenting historical structures and objects, especially delicate artefacts such as pieces of sacred art, only techniques that allow remote, non-contact methods that enable the most precise measurements should be used to obtain data. TLS can be considered as such a technique however in order to obtain complete information for the entire structure, there is usually a need to acquire data from more than one measuring station. In this case, the most important and essential step of processing TLS data is the registration of scans. The paper contains a description of research and analyses concerning the registration of point clouds using three methods: manual, automatic and a combination of the two. The research was carried on measurement data from a historical synagogue. The structure was divided into three parts – three scans. The accuracy with which these scans were registered was assessed and a 3D model of the interior was created.
Ho-Lastimosa, Ilima; Hwang, Phoebe W; Lastimosa, Bob
2014-01-01
Historical trauma occurs across generations and is evidenced by indigenous disparities. Efforts made to address this issue commonly utilize European ethnocentric methods. Rather, a community-based approach should be used to empower indigenous communities. God's Country Waimanalo (GCW) is a grassroots organization developed by Native Hawaiians for Native Hawaiians. Its wa‘a (canoe) project, Ho‘omana‘o Mau (everlasting memories; abbreviated Ho‘o) is meant to perpetuate pre-colonial Hawaiian pra...
Alvarado-Kristensson, Maria
2018-01-01
When using fluorescence microscope techniques to study cells, it is essential that the cell structure and contents are preserved after preparation of the samples, and that the preparation method employed does not create artefacts that can be perceived as cellular structure/components. γ-Tubulin forms filaments that in some cases are immunostained with an anti-γ-tubulin antibody, but this immunostaining is not reproducible [[1], [2
zahra Esfandiari; Mohammad Jalali; Hamid Ezzatpanah; Scott Weese; Mohammad Chamani
2014-01-01
Introduction: With regard to increasing of community associated Clostridium difficile infection in recent years, the probable transmission of Clostridium difficile from food to human was supposed. Most of reports on this issue were allocated to examine the prevalence of Clostridium difficile in red meat. The current study aimed at examination of the prevalence of Clostridium difficile in beef meat. Materials and methods: A total of 100 beef meat samples includi...
Culture Analysis: The Interaction of Organizational and National Culture
Marina Arnoldovna Makarchenko
2015-01-01
The article is devoted to the interaction between organizational culture factors. A comparative analysis of the Russian and Argentine companies culture using different methods shows the impact of the national mentality in organizational culture. The thesis is the need to introduce the term "regional culture" in relation to modern Russia.
Culture and sensitivity - urine ... when urinating. You also may have a urine culture after you have been treated for an infection. ... when bacteria or yeast are found in the culture. This likely means that you have a urinary ...
Jribi, Hela; Sellami, Hanen; Mariam, Siala; Smaoui, Salma; Ghorbel, Asma; Hachicha, Salma; Benejat, Lucie; Messadi-Akrout, Feriel; Mégraud, Francis; Gdoura, Radhouane
2017-10-01
Thermophilic Campylobacter spp. are one of the primary causes of bacterial human diarrhea. The consumption of poultry meats, by-products, or both is suspected to be a major cause of human campylobacteriosis. The aims of this study were to determine the prevalence of thermophilic Campylobacter spp. in fresh poultry meat and poultry by-products by conventional culture methods and to confirm Campylobacter jejuni and Campylobacter coli isolates by using the multiplex PCR assay. Two hundred fifty fresh poultry samples were collected from a variety of supermarkets and slaughterhouses located in Sfax, Tunisia, including chicken (n =149) and turkey (n =101). The samples were analyzed using conventional microbiological examinations according to the 2006 International Organization for Standardization method (ISO 10272-1) for Campylobacter spp. Concurrently, a real-time PCR was used for identification of C. jejuni and C. coli . Of the 250 samples of poultry meat and poultry by-products, 25.6% (n = 64) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in chicken meat (26.8%) followed by turkey meat (23.7%). Among the different products, poultry breasts showed the highest contamination (36.6%) followed by poultry by-products (30%), poultry wings (28%) and poultry legs (26%) showed the lowest contamination, and no contamination was found on neck skin. Of the 64 thermophilic Campylobacter isolates, C. jejuni (59.7%) was the most frequently isolated species and 10.9% of the isolates were identified as C. coli . All of the 64 Campylobacter isolates identified by the conventional culture methods were further confirmed by PCR. The seasonal peak of Campylobacter spp. contamination was in the warm seasons (spring and summer). The study concluded that high proportions of poultry meat and poultry by-products marketed in Tunisia are contaminated by Campylobacter spp. Furthermore, to ensure food safety, poultry meats must be properly cooked
Devlin, Shauna; Meneely, Julie P; Greer, Brett; Campbell, Katrina; Vasconcelos, Vitor; Elliott, Christopher T
2014-05-01
A highly sensitive broad specificity monoclonal antibody was produced and characterised for microcystin detection through the development of a rapid surface plasmon resonance (SPR) optical biosensor based immunoassay. The antibody displayed the following cross-reactivity: MC-LR 100%; MC-RR 108%; MC-YR 68%; MC-LA 69%; MC-LW 71%; MC-LF 68%; and Nodularin 94%. Microcystin-LR was covalently attached to a CM5 chip and with the monoclonal antibody was employed in a competitive 4 min injection assay to detect total microcystins in water samples below the WHO recommended limit (1 µg/L). A 'total microcystin' level was determined by measuring free and intracellular concentrations in cyanobacterial culture samples as this toxin is an endotoxin. Glass bead beating was used to lyse the cells as a rapid extraction procedure. This method was validated according to European Commission Decision 96/23/EC criteria. The method was proven to measure intracellular microcystin levels, the main source of the toxin, which often goes undetected by other analytical procedures and is advantageous in that it can be used for the monitoring of blooms to provide an early warning of toxicity. It was shown to be repeatable and reproducible, with recoveries from spiked samples ranging from 74 to 123%, and had % CVs below 10% for intra-assay analysis and 15% for inter-assay analysis. The detection capability of the assay was calculated as 0.5 ng/mL for extracellular toxins and 0.05 ng/mL for intracellular microcystins. A comparison of the SPR method with LC-MS/MS was achieved by testing six Microcystis aeruginosa cultures and this study yielded a correlation R(2) value of 0.9989. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Keiko Tano
Full Text Available Innovative applications of cell therapy products (CTPs derived from human pluripotent stem cells (hPSCs in regenerative medicine are currently being developed. The presence of residual undifferentiated hPSCs in CTPs is a quality concern associated with tumorigencity. However, no simple in vitro method for direct detection of undifferentiated hPSCs that contaminate CTPs has been developed. Here, we show a novel approach for direct and sensitive detection of a trace amount of undifferentiated human induced pluripotent stem cells (hiPSCs using a highly efficient amplification method in combination with laminin-521 and Essential 8 medium. Essential 8 medium better facilitated the growth of hiPSCs dissociated into single cells on laminin-521 than in mTeSR1 medium. hiPSCs cultured on laminin-521 in Essential 8 medium were maintained in an undifferentiated state and they maintained the ability to differentiate into various cell types. Essential 8 medium allowed robust hiPSC proliferation plated on laminin-521 at low cell density, whereas mTeSR1 did not enhance the cell growth. The highly efficient culture system using laminin-521 and Essential 8 medium detected hiPSCs spiked into primary human mesenchymal stem cells (hMSCs or human neurons at the ratio of 0.001%-0.01% as formed colonies. Moreover, this assay method was demonstrated to detect residual undifferentiated hiPSCs in cell preparations during the process of hMSC differentiation from hiPSCs. These results indicate that our highly efficient amplification system using a combination of laminin-521 and Essential 8 medium is able to detect a trace amount of undifferentiated hPSCs contained as impurities in CTPs and would contribute to quality assessment of hPSC-derived CTPs during the manufacturing process.
Energy Technology Data Exchange (ETDEWEB)
Frazar, Sarah L.; Mladineo, Stephen V.
2012-07-01
The concepts of nuclear safety and security culture are well established; however, a common understanding of safeguards culture is not internationally recognized. Supported by the National Nuclear Security Administration, the authors prepared this report, an analysis of the concept of safeguards culture, and gauged its value to the safeguards community. The authors explored distinctions between safeguards culture, safeguards compliance, and safeguards performance, and evaluated synergies and differences between safeguards culture and safety/security culture. The report concludes with suggested next steps.
Schein, Edgar H.
1988-01-01
Cultural orientations of an organization can be its greatest strength, providing the basis for problem solving, cooperation, and communication. Culture, however, can also inhibit needed changes. Cultural changes typically happen slowly – but without cultural change, many other organizational changes are doomed to fail. The dominant culture of an organization is a major contributor to its success. But, of course, no organizational culture is purely one type or another. And the existence of sec...
Rajasingh, Sheeja; Isai, Dona Greta; Samanta, Saheli; Zhou, Zhi-Gang; Dawn, Buddhadeb; Kinsey, William H; Czirok, Andras; Rajasingh, Johnson
2018-04-05
Induced pluripotent stem cell (iPSC)-based cardiac regenerative medicine requires the efficient generation, structural soundness and proper functioning of mature cardiomyocytes, derived from the patient's somatic cells. The most important functional property of cardiomyocytes is the ability to contract. Currently available methods routinely used to test and quantify cardiomyocyte function involve techniques that are labor-intensive, invasive, require sophisticated instruments or can adversely affect cell vitality. We recently developed optical flow imaging method analyses and quantified cardiomyocyte contractile kinetics from video microscopic recordings without compromising cell quality. Specifically, our automated particle image velocimetry (PIV) analysis of phase-contrast video images captured at a high frame rate yields statistical measures characterizing the beating frequency, amplitude, average waveform and beat-to-beat variations. Thus, it can be a powerful assessment tool to monitor cardiomyocyte quality and maturity. Here we demonstrate the ability of our analysis to characterize the chronotropic responses of human iPSC-derived cardiomyocytes to a panel of ion channel modulators and also to doxorubicin, a chemotherapy agent with known cardiotoxic side effects. We conclude that the PIV-derived beat patterns can identify the elongation or shortening of specific phases in the contractility cycle, and the obtained chronotropic responses are in accord with known clinical outcomes. Hence, this system can serve as a powerful tool to screen the new and currently available pharmacological compounds for cardiotoxic effects.
Bisset, S A; Knight, J S; Bouchet, C L G
2014-02-24
A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible
Vyzantiadis, Timoleon-Achilleas A; Johnson, Elizabeth M; Kibbler, Christopher C
2012-06-01
The identification of fungi relies mainly on morphological criteria. However, there is a need for robust and definitive phenotypic identification procedures in order to evaluate continuously evolving molecular methods. For the future, there is an emerging consensus that a combined (phenotypic and molecular) approach is more powerful for fungal identification, especially for moulds. Most of the procedures used for phenotypic identification are based on experience rather than comparative studies of effectiveness or performance and there is a need for standardisation among mycology laboratories. This review summarises and evaluates the evidence for the major existing phenotypic identification procedures for the predominant causes of opportunistic mould infection. We have concentrated mainly on Aspergillus, Fusarium and mucoraceous mould species, as these are the most important clinically and the ones for which there are the most molecular taxonomic data.
Directory of Open Access Journals (Sweden)
Ana Amélia Rodrigues
2013-02-01
Full Text Available Implant materials used in orthopedics surgery have demonstrated some disadvantages, such as metallic corrosion processes, generation of wear particles, inflammation reactions and bone reabsorption in the implant region. The diamond produced through hot-filament chemical vapour deposition method is a new potential biomedical material due to its chemical inertness, extreme hardness and low coefficient of friction. In the present study we analysis two samples: the microcrystalline diamond and the nanocrystalline diamond. The aim of this study was to evaluate the surface properties of the diamond samples by scanning electron microscopy, Raman spectroscopy and atomic force microscopy. Cell viability and morphology were assessed using thiazolyl blue tetrazolium bromide, cytochemical assay and scanning electron microscopy, respectively. The results revealed that the two samples did not interfere in the cell viability, however the proliferation of fibroblasts cells observed was comparatively higher with the nanocrystalline diamond.
International Nuclear Information System (INIS)
Ita Dwimahyani
2007-01-01
Jatropha curcas has a high potential as an alternative energy source, since it can produce natural oil which could be processed into fuel replacing fossil energy. Increasing demand of biodiesel has resulted in increasing demand for high quality of Jatropha germplasm. Cell suspension method is expected to assure the production of a homogeneous germplasm of Jatropha. A laboratory experiment was conducted to evaluate the effectiveness cell suspension method in of Jatropha curcas cotyledon. The explant used in this experiment was Jatropha curcas seed mutant line (JH-38) which has superiority in plant height, early maturity and unseasonable fruiting. Two kinds of in-vitro medium were used for callus induction, i.e. medium A (MS + 2,4-D 2.0 mg/l + BAP 0.5 mg/l + malt extract 0.1 g + agar 8.0 g/l) and medium B (MS + 2,4-D 3.0 mg/l + BAP 0,5 mg/l + malt extract 0,1 g + agar 8.0 g/l). The same medium composition without agar was used for cell generating, and medium ECS (MS + glutamine 0.5 g + casein hydrolysate 0.5 g + IAA 0.5 mg/l + BAP 3.0 mg/l + agar 8.0 g/l for cell growth. Results of the experiment showed that the optimum growth of calli was obtained by explant JH-38/3 in medium A. The growth level of embryonic cell ranged from 0 to 130 %. The optimum percentage green spot is shown by JH-38/1 explant in medium A. (author)
Macherera, Margaret; Moyo, Lindani; Ncube, Mkhanyiseli; Gumbi, Angella
2012-01-01
Objectives Despite the advent of antiretroviral therapy (ART), many children, particularly in the rural communities of Zimbabwe, remain vulnerable. The purpose of this study was to determine the factors and challenges facing children on antiretroviral therapy (ART) in Brunapeg area of Mangwe District, Zimbabwe. Methods A mixed-method approach involving interviewer-guided focus group discussions and piloted semi-structured questionnaires was utilized to collect data from different key population groups. The data obtained were analyzed through content coding procedures based on a set of predetermined themes of interest. Results A number of challenges emerged as barriers to the success of antiretroviral therapy for children. Primary care givers were less informed about HIV and AIDS issues for people having direct impact on the success of antiretroviral therapy in children whilst some were found to be taking the antiretroviral drugs meant for the children. It also emerged that some primary care givers were either too young or too old to care for the children while others had failed to disclose to the children why they frequently visited the Opportunistic Infections (OI) clinic. Most primary care givers were not the biological parents of the affected children. Other challenges included inadequate access to health services, inadequate food and nutrition and lack of access to clean water, good hygiene and sanitation. The lack of community support and stigma and discrimination affected their school attendance and hospital visits. All these factors contributed to non-adherence to antiretroviral drugs. Conclusions and Public Health Implications Children on ART in rural communities in Zimbabwe remain severely compromised and have unique problems that need multi-intervention strategies both at policy and programmatic levels. Effective mitigating measures must be fully established and implemented in rural communities of developing countries in the fight for universal
Directory of Open Access Journals (Sweden)
Margaret Macherera, MSc
2012-11-01
Full Text Available Objectives:Despite the advent of antiretroviral therapy (ART, many children, particularly in the rural communities of Zimbabwe, remain vulnerable. The purpose of this study was to determine the factors and challenges facing children on antiretroviral therapy (ART in Brunapeg area of Mangwe District, Zimbabwe.Methods:A mixed-method approach involving interviewer-guided focus group discussions and piloted semi-structured questionnaires was utilized to collect data from different key population groups. The data obtained were analyzed through content coding procedures based on a set of predetermined themes of interest.Results:A number of challenges emerged as barriers to the success of antiretroviral therapy for children. Primary care givers were less informed about HIV and AIDS issues for people having direct impact on the success of antiretroviral therapy in children whilst some were found to be taking the antiretroviral drugs meant for the children. It also emerged that some primary care givers were either too young or too old to care for the children while others had failed to disclose to the children why they frequently visited the Opportunistic Infections (OI clinic. Most primary care givers were not the biological parents of the affected children. Other challenges included inadequate access to health services, inadequate food and nutrition and lack of access to clean water, good hygiene and sanitation. The lack of community support and stigma and discrimination affected their school attendance and hospital visits. All these factors contributed to non-adherence to antiretroviral drugs.Conclusions and Public Health Implications:Children on ART in rural communities in Zimbabwe remain severely compromised and have unique problems that need multi-intervention strategies both at policy and programmatic levels. Effective mitigating measures must be fully established and implemented in rural communities of developing countries in the fight for
Directory of Open Access Journals (Sweden)
R.J. Burgdorf
2014-09-01
Full Text Available Extraneous DNA interferes with PCR studies of endophytic fungi. A procedure was developed with which to evaluate the removal of extraneous DNA. Wheat (Triticum aestivum leaves were sprayed with Saccharomyces cerevisiae and then subjected to physical and chemical surface treatments. The fungal ITS1 products were amplified from whole tissue DNA extractions. ANOVA was performed on the DNA bands representing S. cerevisiae on the agarose gel. Band profile comparisons using permutational multivariate ANOVA (PERMANOVA and non-metric multidimensional scaling (NMDS were performed on DGGE gel data, and band numbers were compared between treatments. Leaf surfaces were viewed under variable pressure scanning electron microscopy (VPSEM. Yeast band analysis of the agarose gel showed that there was no significant difference in the mean band DNA quantity after physical and chemical treatments, but they both differed significantly (p < 0.05 from the untreated control. PERMANOVA revealed a significant difference between all treatments (p < 0.05. The mean similarity matrix showed that the physical treatment results were more reproducible than those from the chemical treatment results. The NMDS showed that the physical treatment was the most consistent. VPSEM indicated that the physical treatment was the most effective treatment to remove surface microbes and debris. The use of molecular and microscopy methods for the post-treatment detection of yeast inoculated onto wheat leaf surfaces demonstrated the effectiveness of the surface treatment employed, and this can assist researchers in optimizing their surface sterilization techniques in DNA-based fungal endophyte studies.
Burgdorf, R J; Laing, M D; Morris, C D; Jamal-Ally, S F
2014-01-01
Extraneous DNA interferes with PCR studies of endophytic fungi. A procedure was developed with which to evaluate the removal of extraneous DNA. Wheat (Triticum aestivum) leaves were sprayed with Saccharomyces cerevisiae and then subjected to physical and chemical surface treatments. The fungal ITS1 products were amplified from whole tissue DNA extractions. ANOVA was performed on the DNA bands representing S. cerevisiae on the agarose gel. Band profile comparisons using permutational multivariate ANOVA (PERMANOVA) and non-metric multidimensional scaling (NMDS) were performed on DGGE gel data, and band numbers were compared between treatments. Leaf surfaces were viewed under variable pressure scanning electron microscopy (VPSEM). Yeast band analysis of the agarose gel showed that there was no significant difference in the mean band DNA quantity after physical and chemical treatments, but they both differed significantly (p PERMANOVA revealed a significant difference between all treatments (p < 0.05). The mean similarity matrix showed that the physical treatment results were more reproducible than those from the chemical treatment results. The NMDS showed that the physical treatment was the most consistent. VPSEM indicated that the physical treatment was the most effective treatment to remove surface microbes and debris. The use of molecular and microscopy methods for the post-treatment detection of yeast inoculated onto wheat leaf surfaces demonstrated the effectiveness of the surface treatment employed, and this can assist researchers in optimizing their surface sterilization techniques in DNA-based fungal endophyte studies.
Novel method to dynamically load cells in 3D-gel culture for primary blast injury studies
Sory, David; Cepa-Areias, Anabela; Overby, Darryl; Proud, William; Institute of Shock Physics, Department of Bioengineering; Royal British Legion CentreBlast I Collaboration
2015-06-01
For at least a century explosive devices have been reported as one of the most important causes of injuries on battlefield in military conflicts as well as in terrorist attacks. Although significant experimental and modelling efforts have been focussed on blast injury at the organ or tissue level, few studies have investigated the mechanism of blast injury at the cellular level. This paper introduces an in vitro method compatible with living cells to examine the effects of high stress and short-duration pulses similar to those observed in blast waves. The experimental phase involved high strain rate axial compression of biological cylindrical specimens within a hermetically sealed sample holder made of a biocompatible polymer. Numerical simulations were performed in order to characterize the loading path within the sample and assess the loading conditions. A proof of concept is presented so as to establish a new window to address fundamental questions regarding primary blast injury at the cellular level. The Institute of Shock Physics acknowledges the support of AWE, Aldermaston, UK and Imperial College London. The Centre for Blast Injury Studies acknowledges the support of the Royal British Legion and Imperial College London.
Using the PhotoStory Method to understand the cultural context of youth victimisation in the Punjab
Directory of Open Access Journals (Sweden)
Grace Skrzypiec
2015-04-01
Full Text Available Bullying is an international issue that is only just beginning to be researched in India and anecdotal evidence in Punjab, India, has suggested that most schools in the Punjab are in denial about bullying on campus. Our aim was to investigate the nature of bullying in this region using the PhotoStory Method. We sought to discover how young people in India perceived and experienced incidents of bullying. Three Punjabi schools were issued with ipads that students could use to email the researchers their illustrated stories about bullying. Using the Pic Collage App, 33 students aged 12-15 sent PhotoStories about experiences of victimization. Many stories described incidents of physical harassment, name calling and ‘Eve teasing’, which left students feeling sad, embarrassed, depressed and helpless. However, only four PhotoStories described incidents that met the definition of bullying i.e. that involved repetitive, hurtful behaviour perpetrated by a person or persons that could be considered more ‘powerful’ than the victim. Nonetheless, the stories, while not lengthy and overly descriptive, did indicate that physical acts of aggression between peers were common in and outside school. The findings are discussed in relation to definitional issues and the need to implement anti-violence programs in Indian schools.
Gucciardi, Enza; Demelo, Margaret; Lee, Ruth N; Grace, Sherry L
2007-04-01
To examine the impact of two culturally competent diabetes education methods, individual counselling and individual counselling in conjunction with group education, on nutrition adherence and glycemic control in Portuguese Canadian adults with type 2 diabetes over a three-month period. The Diabetes Education Centre is located in the urban multicultural city of Toronto, Ontario, Canada. We used a three-month randomized controlled trial design. Eligible Portuguese-speaking adults with type 2 diabetes were randomly assigned to receive either diabetes education counselling only (control group) or counselling in conjunction with group education (intervention group). Of the 61 patients who completed the study, 36 were in the counselling only and 25 in the counselling with group education intervention. We used a per-protocol analysis to examine the efficacy of the two educational approaches on nutrition adherence and glycemic control; paired t-tests to compare results within groups and analysis of covariance (ACOVA) to compare outcomes between groups adjusting for baseline measures. The Theory of Planned Behaviour was used to describe the behavioural mechanisms that influenced nutrition adherence. Attitudes, subjective norms, perceived behaviour control, and intentions towards nutrition adherence, self-reported nutrition adherence and glycemic control significantly improved in both groups, over the three-month study period. Yet, those receiving individual counselling with group education showed greater improvement in all measures with the exception of glycemic control, where no significant difference was found between the two groups at three months. Our study findings provide preliminary evidence that culturally competent group education in conjunction with individual counselling may be more efficacious in shaping eating behaviours than individual counselling alone for Canadian Portuguese adults with type 2 diabetes. However, larger longitudinal studies are needed to
Jaremicz, Zbigniew; Luczkiewicz, Maria; Kisiel, Mariusz; Zárate, Rafael; El Jaber-Vazdekis, Nabil; Migas, Piotr
2014-01-01
Hyoscyamine and scopolamine, anti-cholinergic agents widely used in medicine, are typically obtained from plants grown under natural conditions. Since field cultivation entails certain difficulties (changeable weather, pests, etc.), attempts have been made to develop a plant in vitro culture system as an alternative source for the production of these compounds. During experiments to locate the limiting steps in the biotechnological procedure, it is important to monitor not only the levels of the final products but also the changes in the concentration of their precursors. To develop a HPTLC method for the separation and quantitation of the main tropane alkaloids hyoscyamine and scopolamine, their respective direct precursors littorine and anisodamine, and cuscohygrine, a product of a parallel biosynthetic pathway that shares a common precursor (N-methyl-∆(1) -pyrrolium cation) with tropane alkaloids. Using alkaloid extracts from Atropa baetica hairy roots, different TLC chromatographic systems and developing procedures were investigated. Full separation of all compounds was obtained on HPTLC Si60 F254 plates preconditioned with mobile phase vapours (chloroform:methanol:acetone:25% ammonia ratios of 75:15:10:1.8, v/v/v/v). The chromatograms were developed twice (at distances of 4.0 and 3.0 cm) in a Camag twin trough chamber and visualised with Dragendorff's reagent. Densitometric detection (λ = 190 and 520 nm) was used for quantitative analyses of the different plant samples. This method can be recommended for quantitation of hyoscyamine, scopolamine, anisodamine, littorine and cuscohygrine in different plant material (field grown vs. in vitro cultures). Copyright © 2013 John Wiley & Sons, Ltd.
A. Klamer (Arjo)
2011-01-01
textabstractCultural entrepreneurship is a new character in the cultural sector. This paper characterizes the cultural entrepreneur paying homage to the hermeneutic approach of Don Lavoie and others. The challenge is to render the "cultural" meaningful. An invention is the highlighting of the
Riederer, Kathleen; Cruz, Kristian; Shemes, Stephen; Szpunar, Susan; Fishbain, Joel T
2015-06-01
Matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry has dramatically altered the way microbiology laboratories identify clinical isolates. Direct blood culture (BC) detection may be hampered, however, by the presence of charcoal in BC bottles currently in clinical use. This study evaluates an in-house process for extraction and MALDI-TOF identification of Gram-negative bacteria directly from BC bottles containing charcoal. Three hundred BC aliquots were extracted by a centrifugation-filtration method developed in our research laboratory with the first 96 samples processed in parallel using Sepsityper® kits. Controls were colonies from solid media with standard phenotypic and MALDI-TOF identification. The identification of Gram-negative bacteria was successful more often via the in-house method compared to Sepsityper® kits (94.7% versus 78.1%, P≤0.0001). Our in-house centrifugation-filtration method was further validated for isolation and identification of Gram-negative bacteria (95%; n=300) directly from BC bottles containing charcoal. Copyright © 2015 Elsevier Inc. All rights reserved.
Culture-sensitive psychotraumatology
Directory of Open Access Journals (Sweden)
Ulrich Schnyder
2016-07-01
Full Text Available Background: Although there is some evidence of the posttraumatic stress disorder (PTSD construct's cross cultural validity, trauma-related disorders may vary across cultures, and the same may be true for treatments that address such conditions. Experienced therapists tailor psychotherapy to each patient's particular situation, to the nature of the patient's psychopathology, to the stage of therapy, and so on. In addition, culture-sensitive psychotherapists try to understand how culture enhances the meaning of their patient's life history, the cultural components of their illness and help-seeking behaviors, as well as their expectations with regard to treatment. We cannot take for granted that all treatment-seeking trauma survivors speak our language or share our cultural values. Therefore, we need to increase our cultural competencies. Methods: The authors of this article are clinicians and/or researchers from across the globe, working with trauma survivors in various settings. Each author focused on one or more specific cultural aspects of working with trauma survivors and highlighted the following aspects. Results: As a result of culture-specific individual and collective meanings linked to trauma and trauma-related disorders survivors may be exposed to (self-stigma in the aftermath of trauma. Patients who are reluctant to talk about their traumatic experiences may instead be willing to write or use other ways of accessing the painful memories such as drawing. In other cultures, community and family cohesion are crucial elements of recovery. While awareness of culture-specific aspects is important, we also need to beware of premature cultural stereotyping. When disseminating empirically supported psychotherapies for PTSD across cultures, a number of additional challenges need to be taken into account: many low and middle income countries have very limited resources available and suffer from a poor health infrastructure. Conclusions: In summary