WorldWideScience

Sample records for microbial pathogen infections

  1. Microbial Community Composition Impacts Pathogen Iron Availability during Polymicrobial Infection.

    Directory of Open Access Journals (Sweden)

    Apollo Stacy

    2016-12-01

    Full Text Available Iron is an essential nutrient for bacterial pathogenesis, but in the host, iron is tightly sequestered, limiting its availability for bacterial growth. Although this is an important arm of host immunity, most studies examine how bacteria respond to iron restriction in laboratory rather than host settings, where the microbiome can potentially alter pathogen strategies for acquiring iron. One of the most important transcriptional regulators controlling bacterial iron homeostasis is Fur. Here we used a combination of RNA-seq and chromatin immunoprecipitation (ChIP-seq to characterize the iron-restricted and Fur regulons of the biofilm-forming opportunistic pathogen Aggregatibacter actinomycetemcomitans. We discovered that iron restriction and Fur regulate 4% and 3.5% of the genome, respectively. While most genes in these regulons were related to iron uptake and metabolism, we found that Fur also directly regulates the biofilm-dispersing enzyme Dispersin B, allowing A. actinomycetemcomitans to escape from iron-scarce environments. We then leveraged these datasets to assess the availability of iron to A. actinomycetemcomitans in its primary infection sites, abscesses and the oral cavity. We found that A. actinomycetemcomitans is not restricted for iron in a murine abscess mono-infection, but becomes restricted for iron upon co-infection with the oral commensal Streptococcus gordonii. Furthermore, in the transition from health to disease in human gum infection, A. actinomycetemcomitans also becomes restricted for iron. These results suggest that host iron availability is heterogeneous and dependent on the infecting bacterial community.

  2. Assessing the Consequences of Microbial Infection in Field Trials: Seen, Unseen, Beneficial, Parasitic and Pathogenic

    Directory of Open Access Journals (Sweden)

    Mark E. Looseley

    2014-06-01

    Full Text Available Microbial infections of crop plants present an ongoing threat to agricultural production. However, in recent years, we have developed a more nuanced understanding of the ecological role of microbes and how they interact with plants. This includes an appreciation of the influence of crop physiology and environmental conditions on the expression of disease symptoms, the importance of non-pathogenic microbes on host plants and pathogens, and the capacity for plants to act as hosts for human pathogens. Alongside this we now have a variety of tools available for the identification and quantification of microbial infections on crops grown under field conditions. This review summarises some of the consequences of microbial infections in crop plants, and discusses how new and established assessment tools can be used to understand these processes. It challenges our current assumptions in yield loss relationships and offers understanding of the potential for more resilient crops.

  3. Evolution of microbial pathogens

    National Research Council Canada - National Science Library

    DiRita, Victor J; Seifert, H. Steven

    2006-01-01

    ... A. Hogan vvi ■ CONTENTS 8. Evolution of Pathogens in Soil Rachel Muir and Man-Wah Tan / 131 9. Experimental Models of Symbiotic Host-Microbial Relationships: Understanding the Underpinnings of ...

  4. Microbial Pathogens Implicated in Reproductive Health Infections in a Special Treatment Clinic in Ibadan, Nigeria

    Directory of Open Access Journals (Sweden)

    Adenike Ogunshe

    2009-03-01

    Full Text Available Objective: The lack of adequate recognition of health importance of non-HIV reproductive health infections (RHIs in Nigeria has led into this study, which was to determine clinical pathogens in non-HIV RHI in Nigeria using a tertiary health facility as case study.Materials and Methods: A nine-year investigation was carried out between 1997 and 2005 on 4047 (n = 1626 males; n = 2421 females patients presenting at Special Treatment Clinic (STC of University College Hospital (UCH Ibadan, Nigeria. Routine laboratory procedures using appropriate culture media, culture conditions, and current phenotypic taxonomic tools for classification of isolated pathogens were employed.Results: Age (p = 0.019 and gender (p<0.0001 were related to the recovery rates of pathogens Candida species (55.6 %, Neisseria gonorrhoae (11.1%, Gardenella vaginalis (10.3%, Escherichia coli (9.2 %, Klebsiella sp. (4.2%, streptococci (4.0%, Staphylococcus aureus (2.3%, Proteus sp., (1.8%, Haemophilus ducreyi (0.5%, Trichomonas vaginalis (0.44% and Pseudomonas aeruginosa (0.18%. Candida and Gardenella vaginalis species were mostly recovered from female patients, while N.gonorrhoeae were mostly isolated from male patients. Age brackets for the recovery of pathogens were Neisseria gonorrhoeae (16-30 years; Gardenella vaginalis (21-25 and 31-35 years and C.albicans (21-30 years.Conclusion: Candida, Neisseria gonorrhoea and Gadrenella vaginalis were the most recovered pathogens from patients presenting at Special Treatment Clinic of a tertiary health institution in Nigeria, and the relationship between age, gender and the aetiological agents was statistically significant.

  5. Human neutrophil clearance of bacterial pathogens triggers anti-microbial γδ T cell responses in early infection.

    Directory of Open Access Journals (Sweden)

    Martin S Davey

    2011-05-01

    Full Text Available Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8. In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN-γ and tumor necrosis factor (TNF-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP, requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1, and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD-associated bacterial peritonitis--characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity--show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in

  6. Human Neutrophil Clearance of Bacterial Pathogens Triggers Anti-Microbial γδ T Cell Responses in Early Infection

    Science.gov (United States)

    Roberts, Gareth W.; Heuston, Sinéad; Brown, Amanda C.; Chess, James A.; Toleman, Mark A.; Gahan, Cormac G. M.; Hill, Colin; Parish, Tanya; Williams, John D.; Davies, Simon J.; Johnson, David W.; Topley, Nicholas; Moser, Bernhard; Eberl, Matthias

    2011-01-01

    Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8). In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN)-γ and tumor necrosis factor (TNF)-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1), and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD)-associated bacterial peritonitis – characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity – show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in early

  7. Evolution of microbial pathogens.

    OpenAIRE

    Morschhäuser, J; Köhler, G; Ziebuhr, W; Blum-Oehler, G; Dobrindt, U; Hacker, J

    2000-01-01

    Various genetic mechanisms including point mutations, genetic rearrangements and lateral gene transfer processes contribute to the evolution of microbes. Long-term processes leading to the development of new species or subspecies are termed macroevolution, and short-term developments, which occur during days or weeks, are considered as microevolution. Both processes, macro- and microevolution need horizontal gene transfer, which is particularly important for the development of pathogenic micr...

  8. Adaptive value of sex in microbial pathogens.

    Science.gov (United States)

    Michod, Richard E; Bernstein, Harris; Nedelcu, Aurora M

    2008-05-01

    Explaining the adaptive value of sex is one of the great outstanding problems in biology. The challenge comes from the difficulty in identifying the benefits provided by sex, which must outweigh the substantial costs of sex. Here, we consider the adaptive value of sex in viruses, bacteria and fungi, and particularly the information available on the adaptive role of sex in pathogenic microorganisms. Our general theme is that the varied aspects of sex in pathogens illustrate the varied issues surrounding the evolution of sex generally. These include, the benefits of sex (in the short- and long-term), as well as the costs of sex (both to the host and to the pathogen). For the benefits of sex (that is, its adaptive value), we consider three hypotheses: (i) sex provides for effective and efficient recombinational repair of DNA damages, (ii) sex provides DNA for food, and (iii) sex produces variation and reduces genetic associations among alleles under selection. Although the evolution of sex in microbial pathogens illustrates these general issues, our paper is not a general review of theories for the evolution of sex in all organisms. Rather, we focus on the adaptive value of sex in microbial pathogens and conclude that in terms of short-term benefits, the DNA repair hypothesis has the most support and is the most generally applicable hypothesis in this group. In particular, recombinational repair of DNA damages may substantially benefit pathogens when challenged by the oxidative defenses of the host. However, in the long-term, sex may help get rid of mutations, increase the rate of adaptation of the population, and, in pathogens, may infrequently create new infective strains. An additional general issue about sex illustrated by pathogens is that some of the most interesting consequences of sex are not necessarily the reasons for which sex evolved. For example, antibiotic resistance may be transferred by bacterial sex, but this transfer is probably not the reason sex

  9. Microbial and viral pathogens in colorectal cancer.

    LENUS (Irish Health Repository)

    Collins, Danielle

    2011-05-01

    The heterogenetic and sporadic nature of colorectal cancer has led to many epidemiological associations with causes of this disease. As our understanding of the underlying molecular processes in colorectal-cancer develops, the concept of microbial-epithelial interactions as an oncogenic trigger might provide a plausible hypothesis for the pathogenesis of colorectal cancer. By contrast with other cancers of the gastrointestinal tract (gastric carcinoma, mucosa-associated lymphoid-tissue lymphoma), a direct causal link between microbial infection (bacteria and viruses) and colorectal carcinoma has not been established. Studies support the involvement of these organisms in oncogenesis, however, in colorectal cancer, clinical data are lacking. Here, we discuss current evidence (both in vitro and clinical studies), and focus on a putative role for bacterial and viral pathogens as a cause of colorectal cancer.

  10. Microbial and viral pathogens in colorectal cancer.

    LENUS (Irish Health Repository)

    Collins, Danielle

    2012-02-01

    The heterogenetic and sporadic nature of colorectal cancer has led to many epidemiological associations with causes of this disease. As our understanding of the underlying molecular processes in colorectal-cancer develops, the concept of microbial-epithelial interactions as an oncogenic trigger might provide a plausible hypothesis for the pathogenesis of colorectal cancer. By contrast with other cancers of the gastrointestinal tract (gastric carcinoma, mucosa-associated lymphoid-tissue lymphoma), a direct causal link between microbial infection (bacteria and viruses) and colorectal carcinoma has not been established. Studies support the involvement of these organisms in oncogenesis, however, in colorectal cancer, clinical data are lacking. Here, we discuss current evidence (both in vitro and clinical studies), and focus on a putative role for bacterial and viral pathogens as a cause of colorectal cancer.

  11. Antimicrobial activity of ceftaroline and other anti-infective agents against microbial pathogens recovered from the surgical intensive care patient population: a prevalence analysis.

    Science.gov (United States)

    Edmiston, Charles E; Krepel, Candace J; Leaper, David; Ledeboer, Nathan A; Mackey, Tami-Lea; Graham, Mary Beth; Lee, Cheong; Rossi, Peter J; Brown, Kellie R; Lewis, Brian D; Seabrook, Gary R

    2014-12-01

    Ceftaroline is a new parenteral cephalosporin agent with excellent activity against methicillin-sensitive (MSSA) and resistant strains of Staphylococcus aureus (MRSA). Critically ill surgical patients are susceptible to infection, often by multi-drug-resistant pathogens. The activity of ceftaroline against such pathogens has not been described. Three hundred thirty-five consecutive microbial isolates were collected from surgical wounds or abscesses, respiratory, urine, and blood cultures from patients in the surgical intensive care unit (SICU) of a major tertiary medical center. Using Clinical and Laboratory Standards Institute (CLSI) standard methodology and published breakpoints, all aerobic, facultative anaerobic isolates were tested against ceftaroline and selected comparative antimicrobial agents. All staphylococcal isolates were susceptible to ceftaroline at a breakpoint of ≤1.0 mcg/mL. In addition, ceftaroline exhibited excellent activity against all streptococcal clinical isolates and non-ESBL-producing strains of Enterobacteriaceae (93.5%) recovered from SICU patients. Ceftaroline was inactive against ESBL-producing Enterobacteriaceae, Pseudomonas aeruginosa, vancomycin-resistant enterococci, and selective gram-negative anaerobic bacteria. At present, ceftaroline is the only cephalosporin agent that is active against community and healthcare-associated MRSA. Further studies are needed to validate the benefit of this novel broad-spectrum anti-infective agent for the treatment of susceptible serious infections in the SICU patient population.

  12. Sexual reproduction and the evolution of microbial pathogens.

    Science.gov (United States)

    Heitman, Joseph

    2006-09-05

    Three common systemic human fungal pathogens--Cryptococcus neoformans, Candida albicans and Aspergillus fumigatus--have retained all the machinery to engage in sexual reproduction, and yet their populations are often clonal with limited evidence for recombination. Striking parallels have emerged with four protozoan parasites that infect humans: Toxoplasma gondii, Trypanosoma brucei, Trypanosoma cruzi and Plasmodium falciparum. Limiting sexual reproduction appears to be a common virulence strategy, enabling generation of clonal populations well adapted to host and environmental niches, yet retaining the ability to engage in sexual or parasexual reproduction and respond to selective pressure. Continued investigation of the sexual nature of microbial pathogens should facilitate both laboratory investigation and an understanding of the complex interplay between pathogens, hosts, vectors, and their environments.

  13. Machine learning for the meta-analyses of microbial pathogens' volatile signatures.

    Science.gov (United States)

    Palma, Susana I C J; Traguedo, Ana P; Porteira, Ana R; Frias, Maria J; Gamboa, Hugo; Roque, Ana C A

    2018-02-20

    Non-invasive and fast diagnostic tools based on volatolomics hold great promise in the control of infectious diseases. However, the tools to identify microbial volatile organic compounds (VOCs) discriminating between human pathogens are still missing. Artificial intelligence is increasingly recognised as an essential tool in health sciences. Machine learning algorithms based in support vector machines and features selection tools were here applied to find sets of microbial VOCs with pathogen-discrimination power. Studies reporting VOCs emitted by human microbial pathogens published between 1977 and 2016 were used as source data. A set of 18 VOCs is sufficient to predict the identity of 11 microbial pathogens with high accuracy (77%), and precision (62-100%). There is one set of VOCs associated with each of the 11 pathogens which can predict the presence of that pathogen in a sample with high accuracy and precision (86-90%). The implemented pathogen classification methodology supports future database updates to include new pathogen-VOC data, which will enrich the classifiers. The sets of VOCs identified potentiate the improvement of the selectivity of non-invasive infection diagnostics using artificial olfaction devices.

  14. Efferocytosis of Pathogen-Infected Cells

    Directory of Open Access Journals (Sweden)

    Niloofar Karaji

    2017-12-01

    Full Text Available The prompt and efficient clearance of unwanted and abnormal cells by phagocytes is termed efferocytosis and is crucial for organism development, maintenance of tissue homeostasis, and regulation of the immune system. Dying cells are recognized by phagocytes through pathways initiated via “find me” signals, recognition via “eat me” signals and down-modulation of regulatory “don’t eat me” signals. Pathogen infection may trigger cell death that drives phagocytic clearance in an immunologically silent, or pro-inflammatory manner, depending on the mode of cell death. In many cases, efferocytosis is a mechanism for eliminating pathogens and pathogen-infected cells; however, some pathogens have subverted this process and use efferocytic mechanisms to avoid innate immune detection and assist phagocyte infection. In parallel, phagocytes can integrate signals received from infected dying cells to elicit the most appropriate effector response against the infecting pathogen. This review focuses on pathogen-induced cell death signals that drive infected cell recognition and uptake by phagocytes, and the outcomes for the infected target cell, the phagocyte, the pathogen and the host.

  15. Overcoming antibiotic resistance: Is siderophore Trojan horse conjugation an answer to evolving resistance in microbial pathogens?

    Science.gov (United States)

    Dhusia, Kalyani; Bajpai, Archana; Ramteke, P W

    2018-01-10

    Comparative study of siderophore biosynthesis pathway in pathogens provides potential targets for antibiotics and host drug delivery as a part of computationally feasible microbial therapy. Iron acquisition using siderophore models is an essential and well established model in all microorganisms and microbial infections a known to cause great havoc to both plant and animal. Rapid development of antibiotic resistance in bacterial as well as fungal pathogens has drawn us at a verge where one has to get rid of the traditional way of obstructing pathogen using single or multiple antibiotic/chemical inhibitors or drugs. 'Trojan horse' strategy is an answer to this imperative call where antibiotic are by far sneaked into the pathogenic cell via the siderophore receptors at cell and outer membrane. This antibiotic once gets inside, generates a 'black hole' scenario within the opportunistic pathogens via iron scarcity. For pathogens whose siderophore are not compatible to smuggle drug due to their complex conformation and stiff valence bonds, there is another approach. By means of the siderophore biosynthesis pathways, potential targets for inhibition of these siderophores in pathogenic bacteria could be achieved and thus control pathogenic virulence. Method to design artificial exogenous siderophores for pathogens that would compete and succeed the battle of intake is also covered with this review. These manipulated siderophore would enter pathogenic cell like any other siderophore but will not disperse iron due to which iron inadequacy and hence pathogens control be accomplished. The aim of this review is to offer strategies to overcome the microbial infections/pathogens using siderophore. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Disease induction by human microbial pathogens in plant-model systems: potential, problems and prospects.

    Science.gov (United States)

    van Baarlen, Peter; van Belkum, Alex; Thomma, Bart P H J

    2007-02-01

    Relatively simple eukaryotic model organisms such as the genetic model weed plant Arabidopsis thaliana possess an innate immune system that shares important similarities with its mammalian counterpart. In fact, some human pathogens infect Arabidopsis and cause overt disease with human symptomology. In such cases, decisive elements of the plant's immune system are likely to be targeted by the same microbial factors that are necessary for causing disease in humans. These similarities can be exploited to identify elementary microbial pathogenicity factors and their corresponding targets in a green host. This circumvents important cost aspects that often frustrate studies in humans or animal models and, in addition, results in facile ethical clearance.

  17. Microbial minimalism: genome reduction in bacterial pathogens.

    Science.gov (United States)

    Moran, Nancy A

    2002-03-08

    When bacterial lineages make the transition from free-living or facultatively parasitic life cycles to permanent associations with hosts, they undergo a major loss of genes and DNA. Complete genome sequences are providing an understanding of how extreme genome reduction affects evolutionary directions and metabolic capabilities of obligate pathogens and symbionts.

  18. Emerging microbial biocontrol strategies for plant pathogens.

    Science.gov (United States)

    Syed Ab Rahman, Sharifah Farhana; Singh, Eugenie; Pieterse, Corné M J; Schenk, Peer M

    2018-02-01

    To address food security, agricultural yields must increase to match the growing human population in the near future. There is now a strong push to develop low-input and more sustainable agricultural practices that include alternatives to chemicals for controlling pests and diseases, a major factor of heavy losses in agricultural production. Based on the adverse effects of some chemicals on human health, the environment and living organisms, researchers are focusing on potential biological control microbes as viable alternatives for the management of pests and plant pathogens. There is a growing body of evidence that demonstrates the potential of leaf and root-associated microbiomes to increase plant efficiency and yield in cropping systems. It is important to understand the role of these microbes in promoting growth and controlling diseases, and their application as biofertilizers and biopesticides whose success in the field is still inconsistent. This review focusses on how biocontrol microbes modulate plant defense mechanisms, deploy biocontrol actions in plants and offer new strategies to control plant pathogens. Apart from simply applying individual biocontrol microbes, there are now efforts to improve, facilitate and maintain long-term plant colonization. In particular, great hopes are associated with the new approaches of using "plant-optimized microbiomes" (microbiome engineering) and establishing the genetic basis of beneficial plant-microbe interactions to enable breeding of "microbe-optimized crops". Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Investigating the Swimming of Microbial Pathogens Using Digital Holography.

    Science.gov (United States)

    Thornton, K L; Findlay, R C; Walrad, P B; Wilson, L G

    2016-01-01

    To understand much of the behaviour of microbial pathogens, it is necessary to image living cells, their interactions with each other and with host cells. Species such as Escherichia coli are difficult subjects to image: they are typically microscopic, colourless and transparent. Traditional cell visualisation techniques such as fluorescent tagging or phase-contrast microscopy give excellent information on cell behaviour in two dimensions, but no information about cells moving in three dimensions. We review the use of digital holographic microscopy for three-dimensional imaging at high speeds, and demonstrate its use for capturing the shape and swimming behaviour of three important model pathogens: E. coli, Plasmodium spp. and Leishmania spp.

  20. Childhood urinary tract infection in Benin City: pathogens and ...

    African Journals Online (AJOL)

    Childhood urinary tract infection in Benin City: pathogens and antimicrobial ... of bacterial isolates implicated in urinary tract infection (UTI) amongst children was ... There is also an emerging resistance of common pathogens to azithromycin ...

  1. Microbial antagonism as a potential solution for controlling selected root pathogens of crops

    Science.gov (United States)

    Cooper, Sarah; Agnew, Linda; Pereg, Lily

    2016-04-01

    Root pathogens of crops can cause large reduction in yield, however, there is a limited range of effective methods to control such pathogens. Soilborne pathogens that infect roots often need to survive in the rhizosphere, where there is high competition from other organisms. In such hot spots of microbial activity and growth, supported by root exudates, microbes have evolved antagonistic mechanisms that give them competitive advantages in winning the limited resources. Among these mechanisms is antibiosis, with production of some significant antifungal compounds including, antibiotics, volatile organic compounds, hydrogen cyanide and lytic enzymes. Some of these mechanisms may suppress disease through controlling the growth of root pathogens. In this project we isolated various fungi and bacteria that suppress the growth of cotton pathogens in vitro. The pathogen-suppressive microbes were isolated from cotton production soils that are under different management strategies, with and without the use of organic amendments. The potential of pathogen-suppressing microbes for controlling the black root rot disease, caused by the soilborne pathogen Thielaviopsis basicola, was confirmed using soil assays. We identified isolates with potential use as inoculant for cotton production in Australia. Having isolated a diverse group of antagonistic microbes enhances the probability that some would survive well in the soil and provide an alternative approach to address the problem of root disease affecting agricultural crops.

  2. Sequestered Alkaloid Defenses in the Dendrobatid Poison Frog Oophaga pumilio Provide Variable Protection from Microbial Pathogens.

    Science.gov (United States)

    Hovey, Kyle J; Seiter, Emily M; Johnson, Erin E; Saporito, Ralph A

    2018-03-01

    Most amphibians produce their own defensive chemicals; however, poison frogs sequester their alkaloid-based defenses from dietary arthropods. Alkaloids function as a defense against predators, and certain types appear to inhibit microbial growth. Alkaloid defenses vary considerably among populations of poison frogs, reflecting geographic differences in availability of dietary arthropods. Consequently, environmentally driven differences in frog defenses may have significant implications regarding their protection against pathogens. While natural alkaloid mixtures in dendrobatid poison frogs have recently been shown to inhibit growth of non-pathogenic microbes, no studies have examined the effectiveness of alkaloids against microbes that infect these frogs. Herein, we examined how alkaloid defenses in the dendrobatid poison frog, Oophaga pumilio, affect growth of the known anuran pathogens Aeromonas hydrophila and Klebsiella pneumoniae. Frogs were collected from five locations throughout Costa Rica that are known to vary in their alkaloid profiles. Alkaloids were isolated from individual skins, and extracts were assayed against both pathogens. Microbe subcultures were inoculated with extracted alkaloids to create dose-response curves. Subsequent spectrophotometry and cell counting assays were used to assess growth inhibition. GC-MS was used to characterize and quantify alkaloids in frog extracts, and our results suggest that variation in alkaloid defenses lead to differences in inhibition of these pathogens. The present study provides the first evidence that alkaloid variation in a dendrobatid poison frog is associated with differences in inhibition of anuran pathogens, and offers further support that alkaloid defenses in poison frogs confer protection against both pathogens and predators.

  3. Unraveling the role of membrane microdomains during microbial infections.

    Science.gov (United States)

    Bagam, Prathyusha; Singh, Dhirendra P; Inda, Maria Eugenia; Batra, Sanjay

    2017-10-01

    Infectious diseases pose major socioeconomic and health-related threats to millions of people across the globe. Strategies to combat infectious diseases derive from our understanding of the complex interactions between the host and specific bacterial, viral, and fungal pathogens. Lipid rafts are membrane microdomains that play important role in life cycle of microbes. Interaction of microbial pathogens with host membrane rafts influences not only their initial colonization but also their spread and the induction of inflammation. Therefore, intervention strategies aimed at modulating the assembly of membrane rafts and/or regulating raft-directed signaling pathways are attractive approaches for the. management of infectious diseases. The current review discusses the latest advances in terms of techniques used to study the role of membrane microdomains in various pathological conditions and provides updated information regarding the role of membrane rafts during bacterial, viral and fungal infections.

  4. Microbial flora in orodental infections

    Directory of Open Access Journals (Sweden)

    Saini S

    2003-01-01

    Full Text Available The present study was carried out to compare the normal aerobic and anaerobic bacterial oral flora with flora from deep seated dental caries, gingivitis and adult periodontitis. All the samples belonging to both the control and study groups yielded microbes. Aerobe / Anaerobe ratio was high in normal flora (1.48 as compared to dental caries (0.9, gingivitis (0.72 and periodontitis (0.56. Ninety seven percent of orodental infections were polymicrobial and three or more microbes were found in 84% cases of study group as compared to 28% in controls. Streptococcus mutans and anaerobic lactobacilli were common in dental caries, Actinomyces and Peptostreptococcus spp. in gingivitis, Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis in periodontitis.

  5. The role of autophagy in microbial infection and immunity

    Directory of Open Access Journals (Sweden)

    Desai M

    2015-01-01

    Full Text Available Mayura Desai,1 Rong Fang,2 Jiaren Sun11Department of Microbiology and Immunology, 2Department of Pathology, University of Texas Medical Branch at Galveston, Galveston, TX, USAAbstract: The autophagy pathway represents an evolutionarily conserved cell recycling process that is activated in response to nutrient deprivation and other stress signals. Over the years, it has been linked to an array of cellular functions. Equally, a wide range of cell-intrinsic, as well as extracellular, factors have been implicated in the induction of the autophagy pathway. Microbial infections represent one such factor that can not only activate autophagy through specific mechanisms but also manipulate the response to the invading microbe's advantage. Moreover, in many cases, particularly among viruses, the pathway has been shown to be intricately involved in the replication cycle of the pathogen. Conversely, autophagy also plays a role in combating the infection process, both through direct destruction of the pathogen and as one of the key mediating factors in the host defense mechanisms of innate and adaptive immunity. Further, the pathway also plays a role in controlling the pathogenesis of infectious diseases by regulating inflammation. In this review, we discuss various interactions between pathogens and the cellular autophagic response and summarize the immunological functions of the autophagy pathway.Keywords: autophagy, xenophagy, antiviral, antibacterial

  6. The role of hyperparasitism in microbial pathogen ecology and evolution.

    Science.gov (United States)

    Parratt, Steven R; Laine, Anna-Liisa

    2016-08-01

    Many micro-organisms employ a parasitic lifestyle and, through their antagonistic interactions with host populations, have major impacts on human, agricultural and natural ecosystems. Most pathogens are likely to host parasites of their own, that is, hyperparasites, but how nested chains of parasites impact on disease dynamics is grossly neglected in the ecological and evolutionary literature. In this minireview we argue that the diversity and dynamics of micro-hyperparasites are an important component of natural host-pathogen systems. We use the current literature from a handful of key systems to show that observed patterns of pathogen virulence and disease dynamics may well be influenced by hyperparasites. Exploring these factors will shed light on many aspects of microbial ecology and disease biology, including resistance-virulence evolution, apparent competition, epidemiology and ecosystem stability. Considering the importance of hyperparasites in natural populations will have applied consequences for the field of biological control and therapeutic science, where hyperparastism is employed as a control mechanism but not necessarily ecologically understood.

  7. A quantitative microbial risk assessment for meatborne Toxoplasma gondii infection in The Netherlands

    NARCIS (Netherlands)

    Opsteegh, M.; Prickaerts, S.; Frankena, K.; Evers, E.G.

    2011-01-01

    Toxoplasma gondii is an important foodborne pathogen, and the cause of a high disease burden due to congenital toxoplasmosis in The Netherlands. The aim of this study was to quantify the relative contribution of sheep, beef and pork products to human T. gondii infections by Quantitative Microbial

  8. Molecular diagnostics for the detection and characterization of microbial pathogens.

    Science.gov (United States)

    Procop, Gary W

    2007-09-01

    New and advanced methods of molecular diagnostics are changing the way we practice clinical microbiology, which affects the practice of medicine. Signal amplification and real-time nucleic acid amplification technologies offer a sensitive and specific result with a more rapid turnaround time than has ever before been possible. Numerous methods of postamplification analysis afford the simultaneous detection and differentiation of numerous microbial pathogens, their mechanisms of resistance, and the construction of disease-specific assays. The technical feasibility of these assays has already been demonstrated. How these new, often more expensive tests will be incorporated into routine practice and the impact they will have on patient care remain to be determined. One of the most attractive uses for such techniques is to achieve a more rapid characterization of the infectious agent so that a narrower-spectrum antimicrobial agent may be used, which should have an impact on resistance patterns.

  9. A Novel Prosthetic Joint Infection Pathogen, Mycoplasma salivarium, Identified by Metagenomic Shotgun Sequencing.

    Science.gov (United States)

    Thoendel, Matthew; Jeraldo, Patricio; Greenwood-Quaintance, Kerryl E; Chia, Nicholas; Abdel, Matthew P; Steckelberg, James M; Osmon, Douglas R; Patel, Robin

    2017-07-15

    Defining the microbial etiology of culture-negative prosthetic joint infection (PJI) can be challenging. Metagenomic shotgun sequencing is a new tool to identify organisms undetected by conventional methods. We present a case where metagenomics was used to identify Mycoplasma salivarium as a novel PJI pathogen in a patient with hypogammaglobulinemia. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  10. Plastic potential: how the phenotypes and adaptations of pathogens are influenced by microbial interactions within plants.

    Science.gov (United States)

    O'Keeffe, Kayleigh R; Carbone, Ignazio; Jones, Corbin D; Mitchell, Charles E

    2017-08-01

    Predicting the effects of plant-associated microbes on emergence, spread, and evolution of plant pathogens demands an understanding of how pathogens respond to these microbes at two levels of biological organization: that of an individual pathogen and that of a pathogen population across multiple individual plants. We first examine the plastic responses of individual plant pathogens to microbes within a shared host, as seen through changes in pathogen growth and multiplication. We then explore the limited understanding of how within-plant microbial interactions affect pathogen populations and discuss the need to incorporate population-level observations with population genomic techniques. Finally, we suggest that integrating across levels will further our understanding of the ecological and evolutionary impacts of within-plant microbial interactions on pathogens. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. The response of CD1d-restricted invariant NKT cells to microbial pathogens and their products

    Directory of Open Access Journals (Sweden)

    Luc eVan Kaer

    2015-05-01

    Full Text Available Invariant natural killer T (iNKT cells become activated during a wide variety of infections. This includes organisms lacking cognate CD1d-binding glycolipid antigens recognized by the semi-invariant T cell receptor of iNKT cells. Additional studies have shown that iNKT cells also become activated in vivo in response to microbial products such as bacterial lipopolysaccharide, a potent inducer of cytokine production in antigen-presenting cells (APCs. Other studies have shown that iNKT cells are highly responsive to stimulation by cytokines such as interleukin-12. These findings have led to the concept that microbial pathogens can activate iNKT cells either directly via glycolipids, or indirectly by inducing cytokine production in APCs. iNKT cells activated in this manner produce multiple cytokines that can influence the outcome of infection, usually in favor of the host, although potent iNKT cell activation may contribute to an uncontrolled cytokine storm and sepsis. One aspect of the response of iNKT cells to microbial pathogens is that it is short-lived and followed by an extended time period of unresponsiveness to reactivation. This refractory period may represent a means to avoid chronic activation and cytokine production by iNKT cells, thus protecting the host against some of the negative effects of iNKT cell activation, but potentially putting the host at risk for secondary infections. These effects of microbial pathogens and their products on iNKT cells are not only important for understanding the role of these cells in immune responses against infections but also for the development of iNKT cell-based therapies.

  12. Microbial Threats to Health. Emerging Infections: Microbial Threats to Health in the United States.

    Science.gov (United States)

    1992-10-01

    and HIV in- fection. Although in the United States, HIV infection occurs predominately in male homosexuals and intravenous substance abusers, the rate...Davis. W. A., J. G. Kane, and V. G. Garagusi. 1978. Human Aerononas infections : a review of the literature and a case report of endocarditis ...AD-A257 841 AD____ GRANT NO: DAMD17-90-Z-0047 TITLE: MICROBIAL THREATS TO HEALTH SUBTITLE: REmerging Infections - Microbial Threats to Health in the

  13. Microbial Inhibition of Fusarium Pathogens and Biological Modification of Trichothecenes in Cereal Grains

    Directory of Open Access Journals (Sweden)

    Urszula Wachowska

    2017-12-01

    Full Text Available Fungi of the genus Fusarium infect cereal crops during the growing season and cause head blight and other diseases. Their toxic secondary metabolites (mycotoxins contaminate grains. Several dozen toxic compounds produced by fungal pathogens have been identified to date. Type B trichothecenes—deoxynivalenol, its acetyl derivatives and nivalenol (produced mainly by F. graminearum and F. culmorum—are most commonly detected in cereal grains. “T-2 toxin” (produced by, among others, F. sporotrichioides belongs to type-A trichothecenes which are more toxic than other trichothecenes. Antagonistic bacteria and fungi can affect pathogens of the genus Fusarium via different modes of action: direct (mycoparasitism or hyperparasitism, mixed-path (antibiotic secretion, production of lytic enzymes and indirect (induction of host defense responses. Microbial modification of trichothecenes involves acetylation, deacetylation, oxidation, de-epoxidation, and epimerization, and it lowers the pathogenic potential of fungi of the genus Fusarium. Other modifing mechanisms described in the paper involve the physical adsorption of mycotoxins in bacterial cells and the conjugation of mycotoxins to glucose and other compounds in plant and fungal cells. The development of several patents supports the commercialization and wider application of microorganisms biodegrading mycotoxins in grains and, consequently, in feed additives.

  14. 77 FR 45350 - Notice of Availability of Microbial Risk Assessment Guideline: Pathogenic Microorganisms With...

    Science.gov (United States)

    2012-07-31

    ... ENVIRONMENTAL PROTECTION AGENCY Notice of Availability of Microbial Risk Assessment Guideline: Pathogenic Microorganisms With Focus on Food and Water AGENCY: Environmental Protection Agency (EPA). ACTION... risk assessment and also promote consistency in approaches and methods. The MRA Guideline can be...

  15. C. elegans germline-deficient mutants respond to pathogen infection using shared and distinct mechanisms.

    Directory of Open Access Journals (Sweden)

    Michael TeKippe

    2010-07-01

    Full Text Available Reproduction extracts a cost in resources that organisms are then unable to utilize to deal with a multitude of environmental stressors. In the nematode C. elegans, development of the germline shortens the lifespan of the animal and increases its susceptibility to microbial pathogens. Prior studies have demonstrated germline-deficient nematodes to have increased resistance to gram negative bacteria. We show that germline-deficient strains display increased resistance across a broad range of pathogens including gram positive and gram negative bacteria, and the fungal pathogen Cryptococcus neoformans. Furthermore, we show that the FOXO transcription factor DAF-16, which regulates longevity and immunity in C. elegans, appears to be crucial for maintaining longevity in both wild-type and germline-deficient backgrounds. Our studies indicate that germline-deficient mutants glp-1 and glp-4 respond to pathogen infection using common and different mechanisms that involve the activation of DAF-16.

  16. Recent Updates on Treatment of Ocular Microbial Infections by Stem Cell Therapy: A Review

    Directory of Open Access Journals (Sweden)

    Seoh Wei Teh

    2018-02-01

    Full Text Available Ocular microbial infection has emerged as a major public health crisis during the past two decades. A variety of causative agents can cause ocular microbial infections; which are characterized by persistent and destructive inflammation of the ocular tissue; progressive visual disturbance; and may result in loss of visual function in patients if early and effective treatments are not received. The conventional therapeutic approaches to treat vision impairment and blindness resulting from microbial infections involve antimicrobial therapy to eliminate the offending pathogens or in severe cases; by surgical methods and retinal prosthesis replacing of the infected area. In cases where there is concurrent inflammation, once infection is controlled, anti-inflammatory agents are indicated to reduce ocular damage from inflammation which ensues. Despite advances in medical research; progress in the control of ocular microbial infections remains slow. The varying level of ocular tissue recovery in individuals and the incomplete visual functional restoration indicate the chief limitations of current strategies. The development of a more extensive therapy is needed to help in healing to regain vision in patients. Stem cells are multipotent stromal cells that can give rise to a vast variety of cell types following proper differentiation protocol. Stem cell therapy shows promise in reducing inflammation and repairing tissue damage on the eye caused by microbial infections by its ability to modulate immune response and promote tissue regeneration. This article reviews a selected list of common infectious agents affecting the eye; which include fungi; viruses; parasites and bacteria with the aim of discussing the current antimicrobial treatments and the associated therapeutic challenges. We also provide recent updates of the advances in stem cells studies on sepsis therapy as a suggestion of optimum treatment regime for ocular microbial infections.

  17. Recent Updates on Treatment of Ocular Microbial Infections by Stem Cell Therapy: A Review.

    Science.gov (United States)

    Teh, Seoh Wei; Mok, Pooi Ling; Abd Rashid, Munirah; Bastion, Mae-Lynn Catherine; Ibrahim, Normala; Higuchi, Akon; Murugan, Kadarkarai; Mariappan, Rajan; Subbiah, Suresh Kumar

    2018-02-13

    Ocular microbial infection has emerged as a major public health crisis during the past two decades. A variety of causative agents can cause ocular microbial infections; which are characterized by persistent and destructive inflammation of the ocular tissue; progressive visual disturbance; and may result in loss of visual function in patients if early and effective treatments are not received. The conventional therapeutic approaches to treat vision impairment and blindness resulting from microbial infections involve antimicrobial therapy to eliminate the offending pathogens or in severe cases; by surgical methods and retinal prosthesis replacing of the infected area. In cases where there is concurrent inflammation, once infection is controlled, anti-inflammatory agents are indicated to reduce ocular damage from inflammation which ensues. Despite advances in medical research; progress in the control of ocular microbial infections remains slow. The varying level of ocular tissue recovery in individuals and the incomplete visual functional restoration indicate the chief limitations of current strategies. The development of a more extensive therapy is needed to help in healing to regain vision in patients. Stem cells are multipotent stromal cells that can give rise to a vast variety of cell types following proper differentiation protocol. Stem cell therapy shows promise in reducing inflammation and repairing tissue damage on the eye caused by microbial infections by its ability to modulate immune response and promote tissue regeneration. This article reviews a selected list of common infectious agents affecting the eye; which include fungi; viruses; parasites and bacteria with the aim of discussing the current antimicrobial treatments and the associated therapeutic challenges. We also provide recent updates of the advances in stem cells studies on sepsis therapy as a suggestion of optimum treatment regime for ocular microbial infections.

  18. Environmental Persistence Influences Infection Dynamics for a Butterfly Pathogen.

    Directory of Open Access Journals (Sweden)

    Dara A Satterfield

    Full Text Available Many pathogens, including those infecting insects, are transmitted via dormant stages shed into the environment, where they must persist until encountering a susceptible host. Understanding how abiotic conditions influence environmental persistence and how these factors influence pathogen spread are crucial for predicting patterns of infection risk. Here, we explored the consequences of environmental transmission for infection dynamics of a debilitating protozoan parasite (Ophryocystis elektroscirrha that infects monarch butterflies (Danaus plexippus. We first conducted an experiment to observe the persistence of protozoan spores exposed to natural conditions. Experimental results showed that, contrary to our expectations, pathogen doses maintained high infectivity even after 16 days in the environment, although pathogens did yield infections with lower parasite loads after environmental exposure. Because pathogen longevity exceeded the time span of our experiment, we developed a mechanistic model to better explore environmental persistence for this host-pathogen system. Model analysis showed that, in general, longer spore persistence led to higher infection prevalence and slightly smaller monarch population sizes. The model indicated that typical parasite doses shed onto milkweed plants must remain viable for a minimum of 3 weeks for prevalence to increase during the summer-breeding season, and for 11 weeks or longer to match levels of infection commonly reported from the wild, assuming moderate values for parasite shedding rate. Our findings showed that transmission stages of this butterfly pathogen are long-lived and indicated that this is a necessary condition for the protozoan to persist in local monarch populations. This study provides a modeling framework for future work examining the dynamics of an ecologically important pathogen in an iconic insect.

  19. Major Trends in the Microbial Etiiology of Nosocomial Infection

    NARCIS (Netherlands)

    D.R. Schaberg; D.H. Culver; R.P. Gaynes

    1991-01-01

    textabstractTo determine trends in the microbial etiology of nosocomial infections in the 1980s, surveillance data on the microbiology of documented nosocomial infection reported to the National Nosocomial Infections Surveillance System and from the University of Michigan Hospital were analyzed.

  20. Volatile-mediated suppression of plant pathogens is related to soil properties and microbial community composition

    NARCIS (Netherlands)

    Van Agtmaal, M.; Straathof, A.L.; Termorshuizen, Aad J; Lievens, Bart; Hoffland, Ellis; De Boer, W.

    2018-01-01

    There is increasing evidence that the soil microbial community produces a suite of volatile organic compounds that suppress plant pathogens. However, it remains unknown which soil properties and management practices influence volatile-mediated pathogen suppression. The aim of this study was to

  1. Volatile-mediated suppression of plant pathogens is related to soil properties and microbial community composition

    NARCIS (Netherlands)

    Agtmaal, van Maaike; Straathof, Angela L.; Termorshuizen, Aad; Lievens, Bart; Hoffland, Ellis; Boer, de Wietse

    2018-01-01

    There is increasing evidence that the soil microbial community produces a suite of volatile organic compounds that suppress plant pathogens. However, it remains unknown which soil properties and management practices influence volatile-mediated pathogen suppression. The aim of this study was to

  2. Sieve analysis using the number of infecting pathogens.

    Science.gov (United States)

    Follmann, Dean; Huang, Chiung-Yu

    2017-12-14

    Assessment of vaccine efficacy as a function of the similarity of the infecting pathogen to the vaccine is an important scientific goal. Characterization of pathogen strains for which vaccine efficacy is low can increase understanding of the vaccine's mechanism of action and offer targets for vaccine improvement. Traditional sieve analysis estimates differential vaccine efficacy using a single identifiable pathogen for each subject. The similarity between this single entity and the vaccine immunogen is quantified, for example, by exact match or number of mismatched amino acids. With new technology, we can now obtain the actual count of genetically distinct pathogens that infect an individual. Let F be the number of distinct features of a species of pathogen. We assume a log-linear model for the expected number of infecting pathogens with feature "f," f=1,…,F. The model can be used directly in studies with passive surveillance of infections where the count of each type of pathogen is recorded at the end of some interval, or active surveillance where the time of infection is known. For active surveillance, we additionally assume that a proportional intensity model applies to the time of potentially infectious exposures and derive product and weighted estimating equation (WEE) estimators for the regression parameters in the log-linear model. The WEE estimator explicitly allows for waning vaccine efficacy and time-varying distributions of pathogens. We give conditions where sieve parameters have a per-exposure interpretation under passive surveillance. We evaluate the methods by simulation and analyze a phase III trial of a malaria vaccine. © 2017, The International Biometric Society.

  3. TLR-dependent human mucosal epithelial cell responses to microbial pathogens.

    Directory of Open Access Journals (Sweden)

    Paola eMassari

    2014-08-01

    Full Text Available AbstractToll-Like Receptor (TLR signaling represents one of the best studied pathways to implement defense mechanisms against invading microbes in humans as well as in animals. TLRs respond to specific microbial ligands and to danger signals produced by the host during infection, and initiate downstream cascades that activate both innate and adaptive immunity. TLRs are expressed by professional immune cells and by the large majority of non-hematopoietic cells, including epithelial cells. In epithelial tissues, TLR functions are particularly important because these sites are constantly exposed to microorganisms, due to their location at the host interface with the environment. While at these sites, specific defense mechanisms and inflammatory responses are initiated via TLR signaling against pathogens, suppression or lack of TLR activation is also observed in response to the commensal microbiota. The mechanisms by which TLR signaling is regulated in mucosal epithelial cells include differential expression and levels of TLRs (and their signaling partners, their cellular localization and positioning within the tissue in a fashion that favors responses to pathogens while dampening responses to commensals and maintaining tissue homeostasis in physiologic conditions. In this review, the expression and activation of TLRs in mucosal epithelial cells of several sites of the human body are examined. Specifically, the oral cavity, the ear canal and eye, the airways, the gut and the reproductive tract are discussed, along with how site-specific host defense mechanisms are implemented via TLR signaling.

  4. Competition of pathogen strains leading to infection with variable infectivity and the effect of treatment

    NARCIS (Netherlands)

    Xiridou, Maria; Kretzschmar, Mirjam; Geskus, Ronald

    2005-01-01

    A model for the spread of two strains of a pathogen leading to an infection with variable infectivity is considered. The course of infection is described by two stages with different infectivity levels. The model is extended to account for treatment by including a third stage with different

  5. Oral and dental infections with anaerobic bacteria: clinical features, predominant pathogens, and treatment.

    Science.gov (United States)

    Tanner, A; Stillman, N

    1993-06-01

    Microbial populations colonizing the teeth are a major source of pathogens responsible for oral and dental infections, including periodontal diseases, gingivitis, pericoronitis, endodontitis, peri-implantitis, and postextraction infections. Each entity has distinct clinical and microbial features. Bacterial species associated with oral infections include Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, Bacteroides forsythus, Campylobacter rectus, Eubacterium species, Fusobacterium nucleatum, Eikenella corrodens, and Peptostreptococcus micros. Treponema pallidum-related spirochetes have been associated with acute necrotizing ulcerative gingivitis. Porphyromonas endodontalis appears to be specifically related to endodontic infections. Oral infections in medically compromised patients, including those with AIDS, are associated with similar species and are usually complicated by superinfection with enteric and Candida species. Isolation of species causing oral infections requires the collection of appropriate samples and the use of strictly anaerobic techniques. Rapid selective culture, immunofluorescence, and DNA probe methods have been developed for the identification of these oral species. The varied measures required in the management of oral and dental infections may include antimicrobial therapy. Accurate microbiological diagnosis, including antibiotic susceptibility testing, is indicated for cases that do not respond to therapy.

  6. Microbial transformation of (-)-isolongifolol by plant pathogenic fungus Glomerella cingulata.

    Science.gov (United States)

    Miyazawa, Mitsuo; Sakata, Kazuki; Ueda, Masashi

    2010-01-01

    The biotransformation of terpenoids using the plant pathogenic fungus as a biocatalyst to produce useful novel organic compounds was investigated. The biotransformation of sesquiterpen alcohol, (-)-isolongifolol (1) was investigated using plant pathogenic fungus Glomerella cingulata as a biocatalyst. Compound 1 was converted to (-)-(3R)-3-hydroxy-isolongifolol and (-)-(9R)-9-hydroxy-isolongifolol by G. cingulata.

  7. IPM potentials of microbial pathogens and diseases of mites

    NARCIS (Netherlands)

    van der Geest, L.P.S.; Ciancio, A.; Mukerji, K.G.

    2010-01-01

    An overview is given of diseases in mites, caused by infectious microorganisms. Many pathogens play an important role in the regulation of natural populations of mite populations and are for this reason subject of research on the feasibility to develop such pathogens to biological control agents.

  8. Pathogenic microbial ancient DNA: a problem or an opportunity?

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2006-01-01

    cloning. Yet these studies have used mobile insertion elements (e.g. IS 6110 in tuberculosis) or conserved loci (e.g. 16S) to detect the presence of pathogens, and very similar or identical sequences have been reported from environmental bacteria (Gilbert et al. 2004). For example, Rollo & Marota (1999......We agree with Donoghue & Spigelman (2005) that, although pathogen studies hold great potential, any discussion requires a critical assessment of the results to date. However, we did note, as did Pääbo et al. (2004), that the field of ancient pathogen DNA still lacks a series of well......-controlled and rigorous studies that address technical issues and reliability criteria. This is unfortunate, as the rapid evolutionary rate of many pathogens offers a unique means to establish the authenticity of ancient pathogen sequences-since they should clearly be ancestral to modern genetic diversity (e.g. Reid et...

  9. Current knowledge on groundwater microbial pathogens and their control

    Science.gov (United States)

    Macler, Bruce A.; Merkle, Jon C.

    Those who drink groundwater that has not been disinfected are at increased risk of infection and disease from pathogenic microorganisms. Recent studies have shown that up to half of all US drinking-water wells tested had evidence of fecal contamination. A significant fraction of all waterborne disease outbreaks is associated with groundwater. An estimated 750,000 to 5.9million illnesses per year result from contaminated groundwaters in the US. Mortality from these illnesses may be 1400-9400 deaths per year. Control of these pathogens starts with source-water protection activities to prevent fecal contamination of aquifers and wells. These include assessment of wellhead vulnerability to fecal contamination and correction of identified deficiencies. Correction may include control of sources or rehabilitation of the well itself. Disinfection can serve as a useful barrier and is recommended as a prudent public-health policy for all groundwater systems. Ceux qui boivent une eau souterraine non désinfectée présentent un risque accru d'infection et de maladie par des germes pathogènes. De récentes études ont montré que près de la moitié de tous les puits américains testés, captés pour l'eau potable, sont soumis à une contamination fécale. Une fraction significative de l'ensemble des premières manifestations de maladies liées à l'eau est associée aux eaux souterraines. On estime qu'entre 750 000 et 5,9millions de personnes sont malades chaque année aux États-Unis à cause d'eaux souterraines polluées. La mortalité parmi ces malades doit ètre de l'ordre de 1400 à 9400 décès par an. La protection contre ces germes pathogènes commence avec des mesures prises au niveau du captage pour empècher la pollution des aquifères et des puits. Celles-ci comprennent une évaluation de la vulnérabilité des tètes de puits à la pollution fécale et une correction des insuffisances mises en évidence. Cette correction peut comprendre une maîtrise des sources

  10. Multidrug-resistant opportunistic pathogens challenging veterinary infection control.

    Science.gov (United States)

    Walther, Birgit; Tedin, Karsten; Lübke-Becker, Antina

    2017-02-01

    Although the problems associated with healthcare-associated infections (HAI) and the emergence of zoonotic and multidrug-resistant pathogens in companion animal (dogs, cats and horses) medicine have been well-known for decades, current progress with respect to practical implementation of infection control programs in veterinary clinics has been limited. Clinical outbreak events reported for methicillin-resistant Staphylooccus aureus (MRSA) and Staphylococcus pseudintermedius (MRSP), extended spectrum beta-lactamase (ESBL)-producing Escherichia coli and multidrug-resistant (MDR) Salmonella Serovars indicate the necessity of infection control strategies for protecting animal patients at risk as well as veterinary personnel. The close bond between humans and their companion animals provides opportunities for exchange of microorganisms, including MDR pathogens. This particular aspect of the "One Health" idea requires more representative surveillance efforts and infection control strategies with respect to animal-species specific characters. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Pathogen self defense: mechanisms to counteract microbial antagonism

    NARCIS (Netherlands)

    Duffy, B.K.; Schouten, A.; Raaijmakers, J.M.

    2003-01-01

    Natural and agricultural ecosystems harbor a wide variety of microorganisms that play an integral role in plant health, crop productivity, and preservation of multiple ecosystem functions. Interactions within and among microbial communities are numerous and range from synergistic and mutualistic to

  12. Cross inoculation of anthracnose pathogens infecting various tropical fruits

    Science.gov (United States)

    Suparman; Rahmiyah, M.; Pujiastuti, Y.; Gunawan, B.; Arsi

    2018-01-01

    Anthracnose disease is very important disease of tropical fruits causing significant yield losses. The disease is caused by Colletotrichum spp. and infects almost all tropical fruit species, especially the succulent ones. Various species of Colletotrichum infect various tropical fruits and there are possibilities for cross inoculation to occur among tropical fruits which might cause severe infection. An experimental research was conducted to examine the effect of cross inoculation of anthracnose pathogen among papaya, eggplant, chili and common bean on the infection development and severity of the disease on each inoculated fruit species. Colletotrichum spp. were isolated from naturally infected papaya, eggplant, chili and common bean. Each fungal isolate was purified and identified to determine the species name. The spores of each isolate were then used to separately inoculate healthy and sterilized papaya, eggplant, chili and common bean. The results showed that cross infection developed on chili, eggplant and papaya but not on bean. Chili showed the highest susceptibility to all Colletotrichum isolates and significantly different from eggplant and papaya. The anthracnose pathogen isolated from common bean showed no pathogenicity to other hosts and might be used as cross protection inoculant to the disease in the other hosts.

  13. Pathogenicity of Cryptosporidium parvum - evaluation of an animal infection model

    DEFF Research Database (Denmark)

    Enemark, Heidi L.; Bille-Hansen, Vivi; Lind, Peter

    2003-01-01

    and rectum. The unintended presence of rotavirus in some of the experimental animals revealed an additive or synergistic effect between rotavirus and C. parvum as indicated by prolonged diarrhoea, increased oocyst shedding, decreased weight gain and elevated levels of serum haptoglobin and serum amyloid...... A (SAA) in piglets infected simultaneously with both pathogens. The difference in daily weight gain between infected and control animals was significant only for piglets co-infected with rotavirus. The acute phase response of haptoglobin and SAA was characterised by a large individual variation....... In piglets, co-infected with rotavirus, the levels of serum haptoglobin were 3.5 and 4.6 times higher in the infected versus the controls 6 and 9 dpi, respectively (mean values: 2411 mug/ml +/- S.D. 2023 and 1840 mug/ml +/- S.D. 1697). In the controls infected with rotavirus, peak haptoglobin concentration...

  14. Microbial Flora and Food Borne Pathogens on Minced Meat and ...

    African Journals Online (AJOL)

    BACKGROUND: Food-borne pathogens are the leading cause of illness and death in developing countries. Changes in eating habits, mass catering, unsafe food storage conditions and poor hygiene practices are major contributing factors to food associated illnesses. In Ethiopia, the widespread habit of raw beef ...

  15. CONDUCTING-POLYMER NANOWIRE IMMUNOSENSOR ARRAYS FOR MICROBIAL PATHOGENS

    Science.gov (United States)

    The lack of methods for routine rapid and sensitive detection and quantification of specific pathogens has limited the amount of information available on their occurrence in drinking water and other environmental samples. The nanowire biosensor arrays developed in this study w...

  16. Screening for Sexually Transmitted Infection Pathogens in Semen Samples

    Directory of Open Access Journals (Sweden)

    RW Peeling

    2005-01-01

    Full Text Available The transmission of sexually transmitted infection (STI pathogens from an infected donor to the recipient of a semen donation in assisted conception may result not only in acute infection but also in long-term reproductive complications or adverse outcomes of pregnancy, including infection of the offspring. Screening for bacterial STI pathogens, Chlamydia trachomatis and Neisseria gonorrhoeae is strongly recommended because these pathogens can cause serious reproductive complications in the recipients of semen donations and infection in their offspring. Screening for these pathogens should be performed using the most sensitive methods, such as nucleic acid amplified tests. False-negative results due to inhibitory substances in the semen sample should be monitored using amplification controls. Where specimen transport is not a problem and culture facilities are available, N gonorrhoeae can also be detected by culture. Laboratories performing screening should subscribe to proficiency programs and have strict quality controls. Although Trichomonas vaginalis, group B streptococcus and genital mycoplasmas have been associated with adverse outcomes of pregnancy, the frequent finding of these organisms in healthy individuals brings into question the validity of mandatory inclusion of these organisms in the screening panel. Although viral STI pathogens and Treponema pallidum -- the causative agent of syphilis -- may be detected in semen, their presence may be more sensitively detected through antibody testing of the donor. Screening donors for HIV, hepatitis B and syphilis by serology is uniformly recommended in all of the guidelines, but the value of screening either donors or semen samples for cytomegalovirus, herpes simplex viruses and human papilloma viruses is less clear.

  17. The Microbial DNA Index System (MiDIS): A tool for microbial pathogen source identification

    Energy Technology Data Exchange (ETDEWEB)

    Velsko, S. P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2010-08-09

    The microbial DNA Index System (MiDIS) is a concept for a microbial forensic database and investigative decision support system that can be used to help investigators identify the sources of microbial agents that have been used in a criminal or terrorist incident. The heart of the proposed system is a rigorous method for calculating source probabilities by using certain fundamental sampling distributions associated with the propagation and mutation of microbes on disease transmission networks. This formalism has a close relationship to mitochondrial and Y-chromosomal human DNA forensics, and the proposed decision support system is somewhat analogous to the CODIS and SWGDAM mtDNA databases. The MiDIS concept does not involve the use of opportunistic collections of microbial isolates and phylogenetic tree building as a basis for inference. A staged approach can be used to build MiDIS as an enduring capability, beginning with a pilot demonstration program that must meet user expectations for performance and validation before evolving into a continuing effort. Because MiDIS requires input from a a broad array of expertise including outbreak surveillance, field microbial isolate collection, microbial genome sequencing, disease transmission networks, and laboratory mutation rate studies, it will be necessary to assemble a national multi-laboratory team to develop such a system. The MiDIS effort would lend direction and focus to the national microbial genetics research program for microbial forensics, and would provide an appropriate forensic framework for interfacing to future national and international disease surveillance efforts.

  18. Biological activity of the non-microbial fraction of kefir: antagonism against intestinal pathogens.

    Science.gov (United States)

    Iraporda, Carolina; Abatemarco Júnior, Mário; Neumann, Elisabeth; Nunes, Álvaro Cantini; Nicoli, Jacques R; Abraham, Analía G; Garrote, Graciela L

    2017-08-01

    Kefir is a fermented milk obtained by the activity of kefir grains which are composed of lactic and acetic acid bacteria, and yeasts. Many beneficial health effects have been associated with kefir consumption such as stimulation of the immune system and inhibition of pathogenic microorganisms. The biological activity of kefir may be attributed to the presence of a complex microbiota as well as the microbial metabolites that are released during fermentation. The aim of this work was to characterise the non-microbial fraction of kefir and to study its antagonism against Escherichia coli, Salmonella spp. and Bacillus cereus. During milk fermentation there was a production of organic acids, mainly lactic and acetic acid, with a consequent decrease in pH and lactose content. The non-microbial fraction of kefir added to nutrient broth at concentrations above 75% v/v induced a complete inhibition of pathogenic growth that could be ascribed to the presence of un-dissociated lactic acid. In vitro assays using an intestinal epithelial cell model indicated that pre-incubation of cells with the non-microbial fraction of kefir did not modify the association/invasion of Salmonella whereas pre-incubation of Salmonella with this fraction under conditions that did not affect their viability significantly decreased the pathogen's ability to invade epithelial cells. Lactate exerted a protective effect against Salmonella in a mouse model, demonstrating the relevance of metabolites present in the non-microbial fraction of kefir produced during milk fermentation.

  19. Global Warming and Trans-Boundary Movement of Waterborne Microbial Pathogens - Book Chapter

    Science.gov (United States)

    Subtle increases in temperature can have profound impacts on the prevalence of various waterborne microbial pathogens. Such impacts may be seen in three major areas, 1) fecally contaminated drinking water, 2) fresh produce that has been irrigated or processed with contaminated wa...

  20. Nucleic acid probes in the diagnosis of human microbial pathogens

    International Nuclear Information System (INIS)

    Hyypia, T.; Huovinen, P.; Holmberg, M.; Pettersson, U.

    1989-01-01

    The development of effective vaccines and antimicrobial drugs against infectious diseases has been among the most successful achievements in modern medicine. The control of these diseases requires efficient diagnostic methods for the evaluation of the prevalence of diseases and for initiation of specific treatment. Virtually all known microbes can be specifically identified today but in many cases further development is needed for more accurate, rapid, easy-to-use, and inexpensive diagnostic assays. Cell culture facilities are needed for the isolation of viruses in clinical specimens. Any gene of any known microorganism can be cloned in a vector and produced in large amounts economically and then used in diagnostic assays for the identification of the pathogen. The application of the nucleic acid hybridization methods in detection of human pathogens has received considerable attention during the past few years. This paper presents examples of this application of gene technology

  1. Microbial diversity and putative opportunistic pathogens in dishwasher biofilm communities

    DEFF Research Database (Denmark)

    Raghupathi, Prem Krishnan; Zupančič, Jerneja; Brejnrod, Asker Daniel

    2018-01-01

    impact the abundance of microbial groups, and investigated on the inter- and intra-kingdom interactions that shape these biofilms. The age, the usage frequency and hardness of incoming tap water of dishwashers had significant impact on bacterial and fungal composition. Representatives ofCandidaspp. were...... and interactions were vital in the process of biofilm formation, where mixed complexes of the two, bacteria and fungi, could provide a preliminary biogenic structure for the establishment of these biofilms.IMPORTANCEWorldwide demand for household appliances, such as dishwashers and washing machines, is increasing...

  2. The alternative Medicago truncatula defense proteome of ROS – defective transgenic roots during early microbial infection

    Directory of Open Access Journals (Sweden)

    Leonard Muriithi Kiirika

    2014-07-01

    Full Text Available ROP-type GTPases of plants function as molecular switches within elementary signal transduction pathways such as the regulation of ROS synthesis via activation of NADPH oxidases (RBOH-respiratory burst oxidase homologue in plants. Previously, we reported that silencing of the Medicago truncatula GTPase MtROP9 led to reduced ROS production and suppressed induction of ROS-related enzymes in transgenic roots (MtROP9i infected with pathogenic (Aphanomyces euteiches and symbiotic microorganisms (Glomus intraradices, Sinorhizobium meliloti. While fungal infections were enhanced, S. meliloti infection was drastically impaired. In this study, we investigate the temporal proteome response of M. truncatula MtROP9i transgenic roots during the same microbial interactions under conditions of deprived potential to synthesize ROS. In comparison with control roots (Mtvector, we present a comprehensive proteomic analysis using sensitive MS protein identification. For four early infection time-points (1, 3, 5, 24 hpi, 733 spots were found to be different in abundance: 213 spots comprising 984 proteins (607 unique were identified after S. meliloti infection, 230 spots comprising 796 proteins (580 unique after G. intraradices infection, and 290 spots comprising 1240 proteins (828 unique after A. euteiches infection. Data evaluation by GelMap in combination with a heatmap tool allowed recognition of key proteome changes during microbial interactions under conditions of hampered ROS synthesis. Overall, the number of induced proteins in MtROP9i was low as compared with controls, indicating a dual function of ROS in defense signaling as well as alternative response patterns activated during microbial infection. Qualitative analysis of induced proteins showed that enzymes linked to ROS production and scavenging were highly induced in control roots, while in MtROP9i the majority of proteins were involved in alternative defense pathways such as cell wall and protein

  3. Evaluation of Nucleic Acid Isothermal Amplification Methods for Human Clinical Microbial Infection Detection

    Directory of Open Access Journals (Sweden)

    Brett E. Etchebarne

    2017-12-01

    Full Text Available Battling infection is a major healthcare objective. Untreated infections can rapidly evolve toward the condition of sepsis in which the body begins to fail and resuscitation becomes critical and tenuous. Identification of infection followed by rapid antimicrobial treatment are primary goals of medical care, but precise identification of offending organisms by current methods is slow and broad spectrum empirical therapy is employed to cover most potential pathogens. Current methods for identification of bacterial pathogens in a clinical setting typically require days of time, or a 4- to 8-h growth phase followed by DNA extraction, purification and PCR-based amplification. We demonstrate rapid (70–120 min genetic diagnostics methods utilizing loop-mediated isothermal amplification (LAMP to test for 15 common infection pathogen targets, called the Infection Diagnosis Panel (In-Dx. The method utilizes filtration to rapidly concentrate bacteria in sample matrices with lower bacterial loads and direct LAMP amplification without DNA purification from clinical blood, urine, wound, sputum and stool samples. The In-Dx panel was tested using two methods of detection: (1 real-time thermocycler fluorescent detection of LAMP amplification and (2 visual discrimination of color change in the presence of Eriochrome Black T (EBT dye following amplification. In total, 239 duplicate samples were collected (31 blood, 122 urine, 73 mucocutaneous wound/swab, 11 sputum and two stool from 229 prospectively enrolled hospital patients with suspected clinical infection and analyzed both at the hospital and by In-Dx. Sensitivity (Se of the In-Dx panel targets pathogens from urine samples by In-Dx was 91.1% and specificity (Sp was 97.3%, with a positive predictive value (PPV of 53.7% and a negative predictive value (NPV of 99.7% as compared to clinical microbial detection methods. Sensitivity of detection of the In-Dx panel from mucocutaneous swab samples was 65.5% with a

  4. Rearing Water Treatment Induces Microbial Selection Influencing the Microbiota and Pathogen Associated Transcripts of Cod (Gadus morhua Larvae

    Directory of Open Access Journals (Sweden)

    Ragnhild I. Vestrum

    2018-05-01

    Full Text Available We have previously shown that K-selection and microbial stability in the rearing water increases survival and growth of Atlantic cod (Gadus morhua larvae, and that recirculating aquaculture systems (RAS are compatible with this. Here, we have assessed how water treatment influenced the larval microbiota and host responses at the gene expression level. Cod larvae were reared with two different rearing water systems: a RAS and a flow-through system (FTS. The water microbiota was examined using a 16S rDNA PCR/DGGE strategy. RNA extracted from larvae at 8, 13, and 17 days post hatching was used for microbiota and microarray gene expression analysis. Bacterial cDNA was synthesized and used for 16S rRNA amplicon 454 pyrosequencing of larval microbiota. Both water and larval microbiota differed significantly between the systems, and the larval microbiota appeared to become more dissimilar between systems with time. In total 4 phyla were identified for all larvae: Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria. The most profound difference in larval microbiota was a high abundance of Arcobacter (Epsilonproteobacteria in FTS larvae (34 ± 9% of total reads. Arcobacter includes several species that are known pathogens for humans and animals. Cod larval transcriptome responses were investigated using an oligonucleotide gene expression microarray covering approximately 24,000 genes. Interestingly, FTS larvae transcriptional profiles revealed an overrepresentation of upregulated transcripts associated with responses to pathogens and infections, such as c1ql3-like, pglyrp-2-like and zg16, compared to RAS larvae. In conclusion, distinct water treatment systems induced differences in the larval microbiota. FTS larvae showed up-regulation of transcripts associated with responses to microbial stress. These results are consistent with the hypothesis that RAS promotes K-selection and microbial stability by maintaining a microbial load close to the

  5. Characteristic features of intracellular pathogenic Leptospira in infected murine macrophages.

    Science.gov (United States)

    Toma, Claudia; Okura, Nobuhiko; Takayama, Chitoshi; Suzuki, Toshihiko

    2011-11-01

    Leptospira interrogans is a spirochaete responsible for a zoonotic disease known as leptospirosis. Leptospires are able to penetrate the abraded skin and mucous membranes and rapidly disseminate to target organs such as the liver, lungs and kidneys. How this pathogen escape from innate immune cells and spread to target organs remains poorly understood. In this paper, the intracellular trafficking undertaken by non-pathogenic Leptospira biflexa and pathogenic L. interrogans in mouse bone marrow-derived macrophages was compared. The delayed in the clearance of L. interrogans was observed. Furthermore, the acquisition of lysosomal markers by L. interrogans-containing phagosomes lagged behind that of L. biflexa-containing phagosomes, and although bone marrow-derived macrophages could degrade L. biflexa as well as L. interrogans, a population of L. interrogans was able to survive and replicate. Intact leptospires were found within vacuoles at 24 h post infection, suggesting that bacterial replication occurs within a membrane-bound compartment. In contrast, L. biflexa were completely degraded at 24 h post infection. Furthermore, L. interrogans but not L. biflexa, were released to the extracellular milieu. These results suggest that pathogenic leptospires are able to survive, replicate and exit from mouse macrophages, enabling their eventual spread to target organs. © 2011 Blackwell Publishing Ltd.

  6. Appraisal of Microbial Evolution to Commensalism and Pathogenicity in Humans

    Directory of Open Access Journals (Sweden)

    Asit Ranjan Ghosh

    2013-01-01

    Full Text Available The human body is host to a number of microbes occurring in various forms of host-microbe associations, such as commensals, mutualists, pathogens and opportunistic symbionts. While this association with microbes in certain cases is beneficial to the host, in many other cases it seems to offer no evident benefit or motive. The emergence and re-emergence of newer varieties of infectious diseases with causative agents being strains that were once living in the human system makes it necessary to study the environment and the dynamics under which this host microbe relationship thrives. The present discussion examines this interaction while tracing the origins of this association, and attempts to hypothesize a possible framework of selective pressures that could have lead microbes to inhabit mammalian host systems.

  7. Model-Based Analysis of the Potential of Macroinvertebrates as Indicators for Microbial Pathogens in Rivers

    Directory of Open Access Journals (Sweden)

    Rubén Jerves-Cobo

    2018-03-01

    Full Text Available The quality of water prior to its use for drinking, farming or recreational purposes must comply with several physicochemical and microbiological standards to safeguard society and the environment. In order to satisfy these standards, expensive analyses and highly trained personnel in laboratories are required. Whereas macroinvertebrates have been used as ecological indicators to review the health of aquatic ecosystems. In this research, the relationship between microbial pathogens and macrobenthic invertebrate taxa was examined in the Machangara River located in the southern Andes of Ecuador, in which 33 sites, according to their land use, were chosen to collect physicochemical, microbiological and biological parameters. Decision tree models (DTMs were used to generate rules that link the presence and abundance of some benthic families to microbial pathogen standards. The aforementioned DTMs provide an indirect, approximate, and quick way of checking the fulfillment of Ecuadorian regulations for water use related to microbial pathogens. The models built and optimized with the WEKA package, were evaluated based on both statistical and ecological criteria to make them as clear and simple as possible. As a result, two different and reliable models were obtained, which could be used as proxy indicators in a preliminary assessment of pollution of microbial pathogens in rivers. The DTMs can be easily applied by staff with minimal training in the identification of the sensitive taxa selected by the models. The presence of selected macroinvertebrate taxa in conjunction with the decision trees can be used as a screening tool to evaluate sites that require additional follow up analyses to confirm whether microbial water quality standards are met.

  8. Differential Microbial Diversity in Drosophila melanogaster: Are Fruit Flies Potential Vectors of Opportunistic Pathogens?

    Directory of Open Access Journals (Sweden)

    Luis A. Ramírez-Camejo

    2017-01-01

    Full Text Available Drosophila melanogaster has become a model system to study interactions between innate immunity and microbial pathogens, yet many aspects regarding its microbial community and interactions with pathogens remain unclear. In this study wild D. melanogaster were collected from tropical fruits in Puerto Rico to test how the microbiota is distributed and to compare the culturable diversity of fungi and bacteria. Additionally, we investigated whether flies are potential vectors of human and plant pathogens. Eighteen species of fungi and twelve species of bacteria were isolated from wild flies. The most abundant microorganisms identified were the yeast Candida inconspicua and the bacterium Klebsiella sp. The yeast Issatchenkia hanoiensis was significantly more common internally than externally in flies. Species richness was higher in fungi than in bacteria, but diversity was lower in fungi than in bacteria. The microbial composition of flies was similar internally and externally. We identified a variety of opportunistic human and plant pathogens in flies such as Alcaligenes faecalis, Aspergillus flavus, A. fumigatus, A. niger, Fusarium equiseti/oxysporum, Geotrichum candidum, Klebsiella oxytoca, Microbacterium oxydans, and Stenotrophomonas maltophilia. Despite its utility as a model system, D. melanogaster can be a vector of microorganisms that represent a potential risk to plant and public health.

  9. Porphyromonas gingivalis and Treponema denticola Mixed Microbial Infection in a Rat Model of Periodontal Disease

    Directory of Open Access Journals (Sweden)

    Raj K. Verma

    2010-01-01

    Full Text Available Porphyromonas gingivalis and Treponema denticola are periodontal pathogens that express virulence factors associated with the pathogenesis of periodontitis. In this paper we tested the hypothesis that P. gingivalis and T. denticola are synergistic in terms of virulence; using a model of mixed microbial infection in rats. Groups of rats were orally infected with either P. gingivalis or T. denticola or mixed microbial infections for 7 and 12 weeks. P. gingivalis genomic DNA was detected more frequently by PCR than T. denticola. Both bacteria induced significantly high IgG, IgG2b, IgG1, IgG2a antibody levels indicating a stimulation of Th1 and Th2 immune response. Radiographic and morphometric measurements demonstrated that rats infected with the mixed infection exhibited significantly more alveolar bone loss than shaminfected control rats. Histology revealed apical migration of junctional epithelium, rete ridge elongation, and crestal alveolar bone resorption; resembling periodontal disease lesion. These results showed that P. gingivalis and T. denticola exhibit no synergistic virulence in a rat model of periodontal disease.

  10. Activation of Natural Killer cells during microbial infections

    Directory of Open Access Journals (Sweden)

    Amir eHorowitz

    2012-01-01

    Full Text Available Natural killer (NK cells are large granular lymphocytes that express a diverse array of germline encoded inhibitory and activating receptors for MHC Class I and Class I-like molecules, classical co-stimulatory ligands and cytokines. The ability of NK cells to be very rapidly activated by inflammatory cytokines, to secrete effector cytokines and to kill infected or stressed host cells, suggests that they may be among the very early responders during infection. Recent studies have also identified a small number of pathogen-derived ligands that can bind to NK cell surface receptors and directly induce their activation. Here we review recent studies that have begun to elucidate the various pathways by which viral, bacterial and parasite pathogens activate NK cells. We also consider two emerging themes of NK cell-pathogen interactions, namely their contribution to adaptive immune responses and their potential to take on regulatory and immunomodulatory functions.

  11. Daphnia magna shows reduced infection upon secondary exposure to a pathogen.

    Science.gov (United States)

    McTaggart, Seanna J; Wilson, Philip J; Little, Tom J

    2012-12-23

    Previous pathogen exposure is an important predictor of the probability of becoming infected. This is deeply understood for vertebrate hosts, and increasingly so for invertebrate hosts. Here, we test if an initial pathogen exposure changes the infection outcome to a secondary pathogen exposure in the natural host-pathogen system Daphnia magna and Pasteuria ramosa. Hosts were initially exposed to an infective pathogen strain, a non-infective pathogen strain or a control. The same hosts underwent a second exposure, this time to an infective pathogen strain, either immediately after the initial encounter or 48 h later. We observed that an initial encounter with a pathogen always conferred protection against infection compared with controls.

  12. Influence of secondary water supply systems on microbial community structure and opportunistic pathogen gene markers.

    Science.gov (United States)

    Li, Huan; Li, Shang; Tang, Wei; Yang, Yang; Zhao, Jianfu; Xia, Siqing; Zhang, Weixian; Wang, Hong

    2018-06-01

    Secondary water supply systems (SWSSs) refer to the in-building infrastructures (e.g., water storage tanks) used to supply water pressure beyond the main distribution systems. The purpose of this study was to investigate the influence of SWSSs on microbial community structure and the occurrence of opportunistic pathogens, the latter of which are an emerging public health concern. Higher numbers of bacterial 16S rRNA genes, Legionella and mycobacterial gene markers were found in public building taps served by SWSSs relative to the mains, regardless of the flushing practice (P water retention time, warm temperature and loss of disinfectant residuals promoted microbial growth and colonization of potential pathogens in SWSSs. Varied levels of microbial community shifts were found in different types of SWSSs during water transportation from the distribution main to taps, highlighting the critical role of SWSSs in shaping the drinking water microbiota. Overall, the results provided insight to factors that might aid in controlling pathogen proliferation in real-world water systems using SWSSs. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Metagenomic approach for discovering new pathogens in infection disease outbreaks

    Directory of Open Access Journals (Sweden)

    Emanuela Giombini

    2011-09-01

    Full Text Available Viruses represent the most abundant biological components on earth.They can be found in every environment, from deep layers of oceans to animal bodies.Although several viruses have been isolated and sequenced, in each environment there are millions of different types of viruses that have not been identified yet.The advent of nextgeneration sequencing technologies with their high throughput capabilities make possible to study in a single experiment all the community of microorganisms present in a particular sample “microbioma”.They made more feasible the application of the metagenomic approach, by which it is also possible to discover and identify new pathogens, that may pose a threat to public health.This paper summarizes the most recent applications of nextgeneration sequencing to discover new viral pathogens during the occurrence of infection disease outbreaks.

  14. Biomimicry of volatile-based microbial control for managing emerging fungal pathogens.

    Science.gov (United States)

    Gabriel, K T; Joseph Sexton, D; Cornelison, C T

    2018-05-01

    Volatile organic compounds (VOCs) are known to be produced by a wide range of micro-organisms and for a number of purposes. Volatile-based microbial inhibition in environments such as soil is well-founded, with numerous antimicrobial VOCs having been identified. Inhibitory VOCs are of interest as microbial control agents, as low concentrations of gaseous VOCs can elicit significant antimicrobial effects. Volatile organic compounds are organic chemicals typically characterized as having low molecular weight, low solubility in water, and high vapour pressure. Consequently, VOCs readily evaporate to the gaseous phase at standard temperature and pressure. This contact-independent antagonism presents unique advantages over traditional, contact-dependent microbial control methods, including increased surface exposure and reduced environmental persistence. This approach has been the focus of our recent research, with positive results suggesting it may be particularly promising for the management of emerging fungal pathogens, such as the causative agents of white-nose syndrome of bats and snake fungal disease, which are difficult or impossible to treat using traditional approaches. Here, we review the history of volatile-based microbial control, discuss recent progress in formulations that mimic naturally antagonistic VOCs, outline the development of a novel treatment device, and highlight areas where further work is needed to successfully deploy VOCs against existing and emerging fungal pathogens. © 2017 The Society for Applied Microbiology.

  15. Molecular methods for pathogen and microbial community detection and characterization: current and potential application in diagnostic microbiology.

    Science.gov (United States)

    Sibley, Christopher D; Peirano, Gisele; Church, Deirdre L

    2012-04-01

    Clinical microbiology laboratories worldwide have historically relied on phenotypic methods (i.e., culture and biochemical tests) for detection, identification and characterization of virulence traits (e.g., antibiotic resistance genes, toxins) of human pathogens. However, limitations to implementation of molecular methods for human infectious diseases testing are being rapidly overcome allowing for the clinical evaluation and implementation of diverse technologies with expanding diagnostic capabilities. The advantages and limitation of molecular techniques including real-time polymerase chain reaction, partial or whole genome sequencing, molecular typing, microarrays, broad-range PCR and multiplexing will be discussed. Finally, terminal restriction fragment length polymorphism (T-RFLP) and deep sequencing are introduced as technologies at the clinical interface with the potential to dramatically enhance our ability to diagnose infectious diseases and better define the epidemiology and microbial ecology of a wide range of complex infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Multiple infections of rodents with zoonotic pathogens in Austria.

    Science.gov (United States)

    Schmidt, Sabrina; Essbauer, Sandra S; Mayer-Scholl, Anne; Poppert, Sven; Schmidt-Chanasit, Jonas; Klempa, Boris; Henning, Klaus; Schares, Gereon; Groschup, Martin H; Spitzenberger, Friederike; Richter, Dania; Heckel, Gerald; Ulrich, Rainer G

    2014-07-01

    Rodents are important reservoirs for a large number of zoonotic pathogens. We examined the occurrence of 11 viral, bacterial, and parasitic agents in rodent populations in Austria, including three different hantaviruses, lymphocytic choriomeningitis virus, orthopox virus, Leptospira spp., Borrelia spp., Rickettsia spp., Bartonella spp., Coxiella burnetii, and Toxoplasma gondii. In 2008, 110 rodents of four species (40 Clethrionomys glareolus, 29 Apodemus flavicollis, 26 Apodemus sylvaticus, and 15 Microtus arvalis) were trapped at two rural sites in Lower Austria. Chest cavity fluid and samples of lung, spleen, kidney, liver, brain, and ear pinna skin were collected. We screened selected tissue samples for hantaviruses, lymphocytic choriomeningitis virus, orthopox viruses, Leptospira, Borrelia, Rickettsia, Bartonella spp., C. burnetii, and T. gondii by RT-PCR/PCR and detected nucleic acids of Tula hantavirus, Leptospira spp., Borrelia afzelii, Rickettsia spp., and different Bartonella species. Serological investigations were performed for hantaviruses, lymphocytic choriomeningitis virus, orthopox viruses, and Rickettsia spp. Here, Dobrava-Belgrade hantavirus-, Tula hantavirus-, lymphocytic choriomeningitis virus-, orthopox virus-, and rickettsia-specific antibodies were demonstrated. Puumala hantavirus, C. burnetii, and T. gondii were neither detected by RT-PCR/PCR nor by serological methods. In addition, multiple infections with up to three pathogens were shown in nine animals of three rodent species from different trapping sites. In conclusion, these results show that rodents in Austria may host multiple zoonotic pathogens. Our observation raises important questions regarding the interactions of different pathogens in the host, the countermeasures of the host's immune system, the impact of the host-pathogen interaction on the fitness of the host, and the spread of infectious agents among wild rodents and from those to other animals or humans.

  17. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Science.gov (United States)

    Furuse, Yuki; Finethy, Ryan; Saka, Hector A; Xet-Mull, Ana M; Sisk, Dana M; Smith, Kristen L Jurcic; Lee, Sunhee; Coers, Jörn; Valdivia, Raphael H; Tobin, David M; Cullen, Bryan R

    2014-01-01

    MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  18. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    Full Text Available MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  19. Microbial transformation from normal oral microbiota to acute endodontic infections

    Directory of Open Access Journals (Sweden)

    Hsiao William WL

    2012-07-01

    Full Text Available Abstract Background Endodontic infections are a leading cause of oro-facial pain and tooth loss in western countries, and may lead to severe life-threatening infections. These infections are polymicrobial with high bacterial diversity. Understanding the spatial transition of microbiota from normal oral cavities through the infected root canal to the acute periapical abscess can improve our knowledge of the pathogenesis of endodontic infections and lead to more effective treatment. We obtained samples from the oral cavity, infected root canal and periapical abscess of 8 patients (5 with localized and 3 with systemic infections. Microbial populations in these samples were analyzed using next-generation sequencing of 16S rRNA amplicons. Bioinformatics tools and statistical tests with rigorous criteria were used to elucidate the spatial transition of the microbiota from normal to diseased sites. Results On average, 10,000 partial 16S rRNA gene sequences were obtained from each sample. All sequences fell into 11 different bacterial phyla. The microbial diversity in root canal and abscess samples was significantly lower than in the oral samples. Streptococcus was the most abundant genus in oral cavities while Prevotella and Fusobacterium were most abundant in diseased samples. The microbiota community structures of root canal and abscess samples were, however, more similar to each other than to the oral cavity microbiota. Using rigorous criteria and novel bioinformatics tools, we found that Granulicatella adiacens, Eubacterium yurii, Prevotella melaninogenica, Prevotella salivae, Streptococcus mitis, and Atopobium rimae were over-represented in diseased samples. Conclusions We used a novel approach and high-throughput methodologies to characterize the microbiota associated normal and diseased oral sites in the same individuals.

  20. Microbial Translocation in HIV Infection is Associated with Dyslipidemia, Insulin Resistance, and Risk of Myocardial Infarction

    DEFF Research Database (Denmark)

    Pedersen, Karin Kaereby; Pedersen, Maria; Trøseid, Marius

    2013-01-01

    Microbial translocation has been suggested to be a driver of immune activation and inflammation. We hypothesized that microbial translocation may be related to dyslipidemia, insulin resistance, and the risk of coronary heart disease in HIV-infected individuals.......Microbial translocation has been suggested to be a driver of immune activation and inflammation. We hypothesized that microbial translocation may be related to dyslipidemia, insulin resistance, and the risk of coronary heart disease in HIV-infected individuals....

  1. The race between infection and immunity - how do pathogens set the pace?

    Energy Technology Data Exchange (ETDEWEB)

    Ribiero, Ruy M [Los Alamos National Laboratory

    2009-01-01

    Infection is often referred to as a race between pathogen and immune response. This metaphor suggests that slower growing pathogens should be more easily controlled. However, a growing body ofevidence shows that many chronic infections are caused by failure to control slow growing pathogens. The slow growth of pathogens appears to directly affect the kinetics of the immune response. Compared with the response to fast growing pathogens, the T cell response to slow pathogens is delayed in its initiation, lymphocyte expansion is slow and the response often fails to clear the pathogen, leading to chronic infection. Understanding the 'rules ofthe race' for slow growing pathogens has important implications for vaccine design and immune control of many chronic infections.

  2. Climate change and the potential spreading of marine mucilage and microbial pathogens in the Mediterranean Sea.

    Directory of Open Access Journals (Sweden)

    Roberto Danovaro

    2009-09-01

    Full Text Available Marine snow (small amorphous aggregates with colloidal properties is present in all oceans of the world. Surface water warming and the consequent increase of water column stability can favour the coalescence of marine snow into marine mucilage, large marine aggregates representing an ephemeral and extreme habitat. Marine mucilage characterize aquatic systems with altered environmental conditions.We investigated, by means of molecular techniques, viruses and prokaryotes within the mucilage and in surrounding seawater to examine the potential of mucilage to host new microbial diversity and/or spread marine diseases. We found that marine mucilage contained a large and unexpectedly exclusive microbial biodiversity and hosted pathogenic species that were absent in surrounding seawater. We also investigated the relationship between climate change and the frequency of mucilage in the Mediterranean Sea over the last 200 years and found that the number of mucilage outbreaks increased almost exponentially in the last 20 years. The increasing frequency of mucilage outbreaks is closely associated with the temperature anomalies.We conclude that the spreading of mucilage in the Mediterranean Sea is linked to climate-driven sea surface warming. The mucilage can act as a controlling factor of microbial diversity across wide oceanic regions and could have the potential to act as a carrier of specific microorganisms, thereby increasing the spread of pathogenic bacteria.

  3. Beneficial and Harmful Interactions of Antibiotics with Microbial Pathogens and the Host Innate Immune System

    Directory of Open Access Journals (Sweden)

    Ronald Anderson

    2010-05-01

    Full Text Available In general antibiotics interact cooperatively with host defences, weakening and decreasing the virulence of microbial pathogens, thereby increasing vulnerability to phagocytosis and eradication by the intrinsic antimicrobial systems of the host. Antibiotics, however, also interact with host defences by several other mechanisms, some harmful, others beneficial. Harmful activities include exacerbation of potentially damaging inflammatory responses, a property of cell-wall targeted agents, which promotes the release of pro-inflammatory microbial cytotoxins and cell-wall components. On the other hand, inhibitors of bacterial protein synthesis, especially macrolides, possess beneficial anti-inflammatory/cytoprotective activities, which result from interference with the production of microbial virulence factors/cytotoxins. In addition to these pathogen-directed, anti-inflammatory activities, some classes of antimicrobial agent possess secondary anti-inflammatory properties, unrelated to their conventional antimicrobial activities, which target cells of the innate immune system, particularly neutrophils. This is a relatively uncommon, potentially beneficial property of antibiotics, which has been described for macrolides, imidazole anti-mycotics, fluoroquinolones, and tetracyclines. Although of largely unproven significance in the clinical setting, increasing awareness of the pro-inflammatory and anti-inflammatory properties of antibiotics may contribute to a more discerning and effective use of these agents.

  4. Prevention of pathogenic Escherichia coli infection in mice and stimulation of macrophage activation in rats by an oral administration of probiotic Lactobacillus casei I-5.

    Science.gov (United States)

    Ishida-Fujii, Keiko; Sato, Rieko; Goto, Shingo; Yang, Xiao-Ping; Kuboki, Hiroshi; Hirano, Shin-Ichi; Sato, Michikatsu

    2007-04-01

    Lactobacillus casei I-5 isolated from an alcohol fermentation broth enhanced immunity and prevented pathogenic infection as a probiotic. Mice fed with I-5 cells for 11 days prior to an intraperitoneal challenge with pathogenic Escherichia coli Juhl exhibited a high survival rate compared with the control group. Rats fed with I-5 cells for 10 days significantly increased the phagocytosis of peritoneal macrophages. In a cell culture system employing peritoneal macrophages from rats, the I-5 administration activated NF-kappaB stimulated by LPS. It also enhanced LPS-stimulated IL-12 and TNF-alpha production, but not IL-6 production. These results show that L. casei I-5 effectively prevented infection by pathogenic E. coli possibly through the activation of peritoneal macrophages. The strain would be useful to prevent pathogenic microbial infections in humans and farm animals.

  5. The rhizosphere microbial community in a multiple parallel mineralization system suppresses the pathogenic fungus Fusarium oxysporum

    Science.gov (United States)

    Fujiwara, Kazuki; Iida, Yuichiro; Iwai, Takashi; Aoyama, Chihiro; Inukai, Ryuya; Ando, Akinori; Ogawa, Jun; Ohnishi, Jun; Terami, Fumihiro; Takano, Masao; Shinohara, Makoto

    2013-01-01

    The rhizosphere microbial community in a hydroponics system with multiple parallel mineralization (MPM) can potentially suppress root-borne diseases. This study focused on revealing the biological nature of the suppression against Fusarium wilt disease, which is caused by the fungus Fusarium oxysporum, and describing the factors that may influence the fungal pathogen in the MPM system. We demonstrated that the rhizosphere microbiota that developed in the MPM system could suppress Fusarium wilt disease under in vitro and greenhouse conditions. The microbiological characteristics of the MPM system were able to control the population dynamics of F. oxysporum, but did not eradicate the fungal pathogen. The roles of the microbiological agents underlying the disease suppression and the magnitude of the disease suppression in the MPM system appear to depend on the microbial density. F. oxysporum that survived in the MPM system formed chlamydospores when exposed to the rhizosphere microbiota. These results suggest that the microbiota suppresses proliferation of F. oxysporum by controlling the pathogen's morphogenesis and by developing an ecosystem that permits coexistence with F. oxysporum. PMID:24311557

  6. The rhizosphere microbial community in a multiple parallel mineralization system suppresses the pathogenic fungus Fusarium oxysporum.

    Science.gov (United States)

    Fujiwara, Kazuki; Iida, Yuichiro; Iwai, Takashi; Aoyama, Chihiro; Inukai, Ryuya; Ando, Akinori; Ogawa, Jun; Ohnishi, Jun; Terami, Fumihiro; Takano, Masao; Shinohara, Makoto

    2013-12-01

    The rhizosphere microbial community in a hydroponics system with multiple parallel mineralization (MPM) can potentially suppress root-borne diseases. This study focused on revealing the biological nature of the suppression against Fusarium wilt disease, which is caused by the fungus Fusarium oxysporum, and describing the factors that may influence the fungal pathogen in the MPM system. We demonstrated that the rhizosphere microbiota that developed in the MPM system could suppress Fusarium wilt disease under in vitro and greenhouse conditions. The microbiological characteristics of the MPM system were able to control the population dynamics of F. oxysporum, but did not eradicate the fungal pathogen. The roles of the microbiological agents underlying the disease suppression and the magnitude of the disease suppression in the MPM system appear to depend on the microbial density. F. oxysporum that survived in the MPM system formed chlamydospores when exposed to the rhizosphere microbiota. These results suggest that the microbiota suppresses proliferation of F. oxysporum by controlling the pathogen's morphogenesis and by developing an ecosystem that permits coexistence with F. oxysporum. © 2013 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  7. Laboratory simulation reveals significant impacts of ocean acidification on microbial community composition and host-pathogen interactions between the blood clam and Vibrio harveyi.

    Science.gov (United States)

    Zha, Shanjie; Liu, Saixi; Su, Wenhao; Shi, Wei; Xiao, Guoqiang; Yan, Maocang; Liu, Guangxu

    2017-12-01

    It has been suggested that climate change may promote the outbreaks of diseases in the sea through altering the host susceptibility, the pathogen virulence, and the host-pathogen interaction. However, the impacts of ocean acidification (OA) on the pathogen components of bacterial community and the host-pathogen interaction of marine bivalves are still poorly understood. Therefore, 16S rRNA high-throughput sequencing and host-pathogen interaction analysis between blood clam (Tegillarca granosa) and Vibrio harveyi were conducted in the present study to gain a better understanding of the ecological impacts of ocean acidification. The results obtained revealed a significant impact of ocean acidification on the composition of microbial community at laboratory scale. Notably, the abundance of Vibrio, a major group of pathogens to many marine organisms, was significantly increased under ocean acidification condition. In addition, the survival rate and haemolytic activity of V. harveyi were significantly higher in the presence of haemolymph of OA treated T. granosa, indicating a compromised immunity of the clam and enhanced virulence of V. harveyi under future ocean acidification scenarios. Conclusively, the results obtained in this study suggest that future ocean acidification may increase the risk of Vibrio pathogen infection for marine bivalve species, such as blood clams. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Influence of Novel Highly Pathogenic Avian Influenza A (H5N1 Virus Infection on Migrating Whooper Swans Fecal Microbiota

    Directory of Open Access Journals (Sweden)

    Na Zhao

    2018-02-01

    Full Text Available The migration of wild birds plays an important role in the transmission and spread of H5 highly pathogenic avian influenza (HPAI virus, posing a severe risk to animal and human health. Substantial evidence suggests that altered gut microbial community is implicated in the infection of respiratory influenza virus. However, the influence of H5N1 infection in gut microbiota of migratory birds remains unknown. In January 2015, a novel recombinant H5N1 virus emerged and killed about 100 migratory birds, mainly including whooper swans in Sanmenxia Reservoir Area of China. Here, we describe the first fecal microbiome diversity study of H5N1-infected migratory birds. By investigating the influence of H5N1 infection on fecal bacterial communities in infected and uninfected individuals, we found that H5N1 infection shaped the gut microbiota composition by a difference in the dominance of some genera, such as Aeromonas and Lactobacillus. We also found a decreased α diversity and increased β diversity in infectious individuals. Our results highlight that increases in changes in pathogen-containing gut communities occur when individuals become infected with H5N1. Our study may provide the first evidence that there are statistical association among H5N1 presence and fecal microbiota compositional shifts, and properties of the fecal microbiota may serve as the risk of gut-linked disease in migrates with H5N1 and further aggravate the disease transmission.

  9. Influence of Novel Highly Pathogenic Avian Influenza A (H5N1) Virus Infection on Migrating Whooper Swans Fecal Microbiota.

    Science.gov (United States)

    Zhao, Na; Wang, Supen; Li, Hongyi; Liu, Shelan; Li, Meng; Luo, Jing; Su, Wen; He, Hongxuan

    2018-01-01

    The migration of wild birds plays an important role in the transmission and spread of H5 highly pathogenic avian influenza (HPAI) virus, posing a severe risk to animal and human health. Substantial evidence suggests that altered gut microbial community is implicated in the infection of respiratory influenza virus. However, the influence of H5N1 infection in gut microbiota of migratory birds remains unknown. In January 2015, a novel recombinant H5N1 virus emerged and killed about 100 migratory birds, mainly including whooper swans in Sanmenxia Reservoir Area of China. Here, we describe the first fecal microbiome diversity study of H5N1-infected migratory birds. By investigating the influence of H5N1 infection on fecal bacterial communities in infected and uninfected individuals, we found that H5N1 infection shaped the gut microbiota composition by a difference in the dominance of some genera, such as Aeromonas and Lactobacillus . We also found a decreased α diversity and increased β diversity in infectious individuals. Our results highlight that increases in changes in pathogen-containing gut communities occur when individuals become infected with H5N1. Our study may provide the first evidence that there are statistical association among H5N1 presence and fecal microbiota compositional shifts, and properties of the fecal microbiota may serve as the risk of gut-linked disease in migrates with H5N1 and further aggravate the disease transmission.

  10. Differential lung NK cell responses in avian influenza virus infected chickens correlate with pathogenicity

    OpenAIRE

    Jansen, C.A.; de Geus, E.D.; van Haarlem, D.A.; van de Haar, P.M.; Löndt, B.Z; Graham, S.P.; Göbel, T.W.; van Eden, W.; Brookes, S.M.; Vervelde, L.

    2013-01-01

    Infection of chickens with low pathogenicity avian influenza (LPAI) virus results in mild clinical signs while infection with highly pathogenic avian influenza (HPAI) viruses causes death of the birds within 36–48 hours. Since natural killer (NK) cells have been shown to play an important role in influenza-specific immunity, we hypothesise that NK cells are involved in this difference in pathogenicity. To investigate this, the role of chicken NK-cells in LPAI virus infection was studied. Next...

  11. Microbial Murders Crime Scene Investigation: An Active Team-Based Learning Project that Enhances Student Enthusiasm and Comprehension of Clinical Microbial Pathogens.

    Science.gov (United States)

    Steel, J Jordan

    2017-01-01

    Microbial disease knowledge is a critical component of microbiology courses and is beneficial for many students' future careers. Microbiology courses traditionally cover core concepts through lectures and labs, but specific instruction on microbial diseases varies greatly depending on the instructor and course. A common project involves students researching and presenting a disease to the class. This method alone is not very effective, and course evaluations have consistently indicated that students felt they lacked adequate disease knowledge; therefore, a more hands-on and interactive disease project was developed called Microbial Murders. For this team-based project, a group of students chooses a pathogen, researches the disease, creates a "mugshot" of the pathogen, and develops a corresponding "crime scene," where a hypothetical patient has died from the microbe. Each group gives a presentation introducing the microbial pathogen, signs/symptoms, treatments, and overall characteristics. The students then visit each other's crime scenes to match the pathogen with the correct crime scene by critically thinking through the clues. This project has shown remarkable success. Surveys indicate that 73% of students thought the project helped them understand the material and 84% said it was worth their time. Student participation, excitement, understanding, and application of microbial disease knowledge have increased and are evident through an increase in course evaluations and in student assessment scores. This project is easy to implement and can be used in a wide variety of biology, microbiology, or health classes for any level (middle school through college).

  12. Transmutation of Personal Glucose Meters into Portable and Highly Sensitive Microbial Pathogen Detection Platform.

    Science.gov (United States)

    Wang, Zhenzhen; Chen, Zhaowei; Gao, Nan; Ren, Jinsong; Qu, Xiaogang

    2015-10-07

    Herein, for the first time, we presented a simple and general approach by using personal glucose meters (PGM) for portable and ultrasensitive detection of microbial pathogens. Upon addition of pathogenic bacteria, glucoamylase-quaternized magnetic nanoparticles (GA-QMNPS) conjugates were disrupted by the competitive multivalent interactions between bacteria and QMNPS, resulting in the release of GA. After magnetic separation, the free GA could catalyze the hydrolysis of amylose into glucose for quantitative readout by PGM. In such way, PGM was transmuted into a bacterial detection device and extremely low detection limits down to 20 cells mL(-1) was achieved. More importantly, QMNPS could inhibit the growth of the bacteria and destroy its cellular structure, which enabled bacteria detection and inhibition simultaneously. The simplicity, portability, sensitivity and low cost of presented work make it attractive for clinical applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Haemophilus ducreyi: from sexually transmitted infection to skin ulcer pathogen.

    Science.gov (United States)

    Lewis, David A; Mitjà, Oriol

    2016-02-01

    This article provides an overview of the biology, epidemiology, clinical features, diagnostic tests, and treatment of Haemophilus ducreyi infection, with special reference to the decline of chancroid and the recent emergence of H. ducreyi as a pathogen responsible for chronic limb ulceration clinically similar to yaws. Chancroid has declined in importance as a sexually transmitted infection in most countries where it was previously endemic. Chancroid may be caused by either class I or class II H. ducreyi isolates; these two classes diverged from each other approximately 1.95 million years ago. H. ducreyi has recently emerged as a cause of chronic skin ulceration in the Pacific region and Africa. Based on sequencing of whole genomes and defined genetic loci, it appears that the cutaneous H. ducreyi strains diverged from the class I genital strains relatively recently. H. ducreyi should be considered as a major cause of chronic limb ulceration in both adults and children and appropriate molecular diagnostic assays are required to determine ulcer aetiology. The high prevalence of H. ducreyi-related cutaneous ulceration in yaws-endemic countries has challenged the validity of observational surveys to monitor the effectiveness of the WHO's yaws eradication campaign.

  14. Mixed infections reveal virulence differences between host-specific bee pathogens.

    Science.gov (United States)

    Klinger, Ellen G; Vojvodic, Svjetlana; DeGrandi-Hoffman, Gloria; Welker, Dennis L; James, Rosalind R

    2015-07-01

    Dynamics of host-pathogen interactions are complex, often influencing the ecology, evolution and behavior of both the host and pathogen. In the natural world, infections with multiple pathogens are common, yet due to their complexity, interactions can be difficult to predict and study. Mathematical models help facilitate our understanding of these evolutionary processes, but empirical data are needed to test model assumptions and predictions. We used two common theoretical models regarding mixed infections (superinfection and co-infection) to determine which model assumptions best described a group of fungal pathogens closely associated with bees. We tested three fungal species, Ascosphaera apis, Ascosphaera aggregata and Ascosphaera larvis, in two bee hosts (Apis mellifera and Megachile rotundata). Bee survival was not significantly different in mixed infections vs. solo infections with the most virulent pathogen for either host, but fungal growth within the host was significantly altered by mixed infections. In the host A. mellifera, only the most virulent pathogen was present in the host post-infection (indicating superinfective properties). In M. rotundata, the most virulent pathogen co-existed with the lesser-virulent one (indicating co-infective properties). We demonstrated that the competitive outcomes of mixed infections were host-specific, indicating strong host specificity among these fungal bee pathogens. Published by Elsevier Inc.

  15. Control of Clostridium difficile infection by defined microbial communities

    Science.gov (United States)

    Collins, James

    2017-01-01

    Summary Each year in the United States, billions of dollars are spent combating almost half a million Clostridium difficile infections (CDI) and trying to reduce the ~29,000 patient deaths where C. difficile has an attributed role (1). In Europe, disease prevalence varies by country and level of surveillance, though yearly costs are estimated at €3 billion (2). One factor contributing to the significant healthcare burden of C. difficile is the relatively high frequency of recurrent C. difficile infections(3). Recurrent C. difficile infection (rCDI), i.e., a second episode of symptomatic CDI occurring within eight weeks of successful initial CDI treatment, occurs in ~25% of patients with 35-65% of these patients experiencing multiple episodes of recurrent disease(4, 5). Using microbial communities to treat rCDI, either as whole fecal transplants or as defined consortia of bacterial isolates have shown great success (in the case of fecal transplants) or potential promise (in the case of defined consortia of isolates). This review will briefly summarize the epidemiology and physiology of C. difficile infection, describe our current understanding of how fecal microbiota transplants treat recurrent CDI, and outline potential ways through which that knowledge can be used to rationally-design and test alternative microbe-based therapeutics. PMID:28936948

  16. Quantitative proteomic profiling for clarification of the crucial roles of lysosomes in microbial infections.

    Science.gov (United States)

    Xu, Benhong; Gao, Yanpan; Zhan, Shaohua; Ge, Wei

    2017-07-01

    Lysosomes play vital roles in both innate and adaptive immunity. It is widely accepted that lysosomes do not function exclusively as a digestive organelle. It is also involved in the process of immune cells against pathogens. However, the changes in the lysosomal proteome caused by infection with various microbes are still largely unknown, and our understanding of the proteome of the purified lysosome is another obstacle that needs to be resolved. Here, we performed a proteomic study on lysosomes enriched from THP1 cells after infection with Listeria monocytogenes (L.m), Herpes Simplex Virus 1 (HSV-1) and Vesicular Stomatitis Virus (VSV). In combination with the gene ontology (GO) analysis, we identified 284 lysosomal-related proteins from a total of 4560 proteins. We also constructed the protein-protein interaction networks for the differentially expressed proteins and revealed the core lysosomal proteins, including SRC in the L. m treated group, SRC, GLB1, HEXA and HEXB in the HSV-1 treated group and GLB1, CTSA, CTSB, HEXA and HEXB in the VSV treated group, which are involved in responding to diverse microbial infections. This study not only reveals variable lysosome responses depending on the bacterial or virus infection, but also provides the evidence based on which we propose a novel approach to proteome research for investigation of the function of the enriched organelles. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Anatomy and Physiology of the Urinary Tract: Relation to Host Defense and Microbial Infection.

    Science.gov (United States)

    Hickling, Duane R; Sun, Tung-Tien; Wu, Xue-Ru

    2015-08-01

    The urinary tract exits to a body surface area that is densely populated by a wide range of microbes. Yet, under most normal circumstances, it is typically considered sterile, i.e., devoid of microbes, a stark contrast to the gastrointestinal and upper respiratory tracts where many commensal and pathogenic microbes call home. Not surprisingly, infection of the urinary tract over a healthy person's lifetime is relatively infrequent, occurring once or twice or not at all for most people. For those who do experience an initial infection, the great majority (70% to 80%) thankfully do not go on to suffer from multiple episodes. This is a far cry from the upper respiratory tract infections, which can afflict an otherwise healthy individual countless times. The fact that urinary tract infections are hard to elicit in experimental animals except with inoculum 3-5 orders of magnitude greater than the colony counts that define an acute urinary infection in humans (105 cfu/ml), also speaks to the robustness of the urinary tract defense. How can the urinary tract be so effective in fending off harmful microbes despite its orifice in a close vicinity to that of the microbe-laden gastrointestinal tract? While a complete picture is still evolving, the general consensus is that the anatomical and physiological integrity of the urinary tract is of paramount importance in maintaining a healthy urinary tract. When this integrity is breached, however, the urinary tract can be at a heightened risk or even recurrent episodes of microbial infections. In fact, recurrent urinary tract infections are a significant cause of morbidity and time lost from work and a major challenge to manage clinically. Additionally, infections of the upper urinary tract often require hospitalization and prolonged antibiotic therapy. In this chapter, we provide an overview of the basic anatomy and physiology of the urinary tract with an emphasis on their specific roles in host defense. We also highlight the

  18. Opportunistic Pathogens and Microbial Communities and Their Associations with Sediment Physical Parameters in Drinking Water Storage Tank Sediments

    Science.gov (United States)

    Qin, Ke; Struewing, Ian; Domingo, Jorge Santo; Lytle, Darren

    2017-01-01

    The occurrence and densities of opportunistic pathogens (OPs), the microbial community structure, and their associations with sediment elements from eight water storage tanks in Ohio, West Virginia, and Texas were investigated. The elemental composition of sediments was measured through X-ray fluorescence (XRF) spectra. The occurrence and densities of OPs and amoeba hosts (i.e., Legionella spp. and L. pneumophila, Mycobacterium spp., P. aeruginosa, V. vermiformis, Acanthamoeba spp.) were determined using genus- or species-specific qPCR assays. Microbial community analysis was performed using next generation sequencing on the Illumina Miseq platform. Mycobacterium spp. were most frequently detected in the sediments and water samples (88% and 88%), followed by Legionella spp. (50% and 50%), Acanthamoeba spp. (63% and 13%), V. vermiformis (50% and 25%), and P. aeruginosa (0 and 50%) by qPCR method. Comamonadaceae (22.8%), Sphingomonadaceae (10.3%), and Oxalobacteraceae (10.1%) were the most dominant families by sequencing method. Microbial communities in water samples were mostly separated with those in sediment samples, suggesting differences of communities between two matrices even in the same location. There were associations of OPs with microbial communities. Both OPs and microbial community structures were positively associated with some elements (Al and K) in sediments mainly from pipe material corrosions. Opportunistic pathogens presented in both water and sediments, and the latter could act as a reservoir of microbial contamination. There appears to be an association between potential opportunistic pathogens and microbial community structures. These microbial communities may be influenced by constituents within storage tank sediments. The results imply that compositions of microbial community and elements may influence and indicate microbial water quality and pipeline corrosion, and that these constituents may be important for optimal storage tank management

  19. Evaluation of minor pathogen intramammary infection, susceptibility parameters, and somatic cell counts on the development of new intramammary infections with major mastitis pathogens.

    Science.gov (United States)

    Reyher, K K; Dohoo, I R; Scholl, D T; Keefe, G P

    2012-07-01

    Major mastitis pathogens such as Staphylococcus aureus, Streptococcus uberis, Streptococcus dysgalactiae, and coliforms are usually considered more virulent and damaging to the udder than minor mastitis pathogens such as Corynebacterium spp. and coagulase-negative staphylococci (CNS). The current literature comprises several studies (n=38) detailing analyses with conflicting results as to whether intramammary infections (IMI) with the minor pathogens decrease, increase, or have no effect on the risk of a quarter acquiring a new IMI (NIMI) with a major pathogen. The Canadian Bovine Mastitis Research Network has a large mastitis database derived from a 2-yr data collection on a national cohort of dairy farms, and data from this initiative were used to further investigate the effect of IMI with minor pathogens on the acquisition of new major pathogen infections (defined as a culture-positive quarter sample in a quarter that had been free of that major pathogen in previous samples in the sampling period). Longitudinal milk samplings of clinically normal udders taken over several 6-wk periods as well as samples from cows pre-dry-off and postcalving were used to this end (n=80,397 quarter milk samples). The effects of CNS and Corynebacterium spp. on the major mastitis pathogens Staph. aureus, Strep. uberis, Strep. dysgalactiae, and coliform bacteria (Escherichia coli and Klebsiella spp.) were investigated using risk ratio analyses and multilevel logistic regression models. Quarter-, cow- and herd-level susceptibility parameters were also evaluated and were able to account for the increased susceptibility that exists within herds, cows and quarters, removing it from estimates for the effects of the minor pathogens. Increased quarter-level susceptibility was associated with increased risk of major pathogen NIMI for all pathogens except the coliforms. Increased somatic cell count was consistently associated with elevated risk of new major pathogen infections, but this was

  20. Antimicrobial effect of Calotropis procera active principles against aquatic microbial pathogens isolated from shrimp and fishes

    Institute of Scientific and Technical Information of China (English)

    Subramanian Velmurugan; Vijayaragavan Thanga Viji; Mariavincent Michael Babu; Mary Josephine Punitha; Thavasimuthu Citarasu

    2012-01-01

    Objective: To study the influence of Calotropis procera (C. procera) active principles against aquatic microbial pathogens isolated from shrimp and fishes. Methods: C. procera leaf powder was serially extracted with hexane, ethyl acetate and methanol and screened by antibacterial, antifungal and antiviral activity against aquatic pathogens which isolated from shrimp/fish. After initial screening, the active extract was purified through column chromatography and again screened. Finally the active fractions were characterized by phytochemical analysis and GC-MS analysis. Results: In vitro antibacterial, antifungal and antiviral screening revealed that, the ethyl acetate extracts were effectively suppressed the bacterial pathogens Pseudomonas aeruginosa (P. aeruginosa), Vibrio harveyi (V. harveyi) and Aeromons hydrophila (A. hydrophila) of more than 20 mm zone of inhibition; the fungi Fusarium sp and the killer virus WSSV. The ethyl acetate extracts of C. procera incubated WSSV was failed to multiply its progeny in the in vivo system of shrimp P. monodon. The shrimp had 80% survival after WSSV challenge from the control group significantly (P<0.001) and also PCR detection confirmed that no WSSV transcription found in shrimp haemolymph. After purified the ethyl acetate extracts again antimicrobial screening performed and it concluded that the fraction namely F-II was effectively suppressed the bacterial growth and WSSV due to its enriched active principles such as cardiac glycosides, Phenols, alkaloids, Tannin and quinines. Surprisingly this fraction, F-II was effectively controlled the WSSV at 90% level at a highest significant level (P<0.001). Finally the structural characterization by GC-MS analysis revealed that, the F-II fraction contained Phenols including several other compounds such as 2,4-bis(1,1-dimethylethyl)-, Methyl tetradecanoate, Bicyclo[3.1.1] heptane, 2,6,6-trimethyl-, (1α,2β,5α)-and Hexadecanoic acid etc. Conclusions: The present study revealed

  1. Unfolding Role of a Danger Molecule Adenosine Signaling in Modulation of Microbial Infection and Host Cell Response

    Directory of Open Access Journals (Sweden)

    Jaden S. Lee

    2018-01-01

    Full Text Available Ectonucleotidases CD39 and CD73, specific nucleotide metabolizing enzymes located on the surface of the host, can convert a pro-inflammatory environment driven by a danger molecule extracellular-ATP to an adenosine-mediated anti-inflammatory milieu. Accordingly, CD39/CD73 signaling has been strongly implicated in modulating the intensity, duration, and composition of purinergic danger signals delivered to host. Recent studies have eluted potential roles for CD39 and CD73 in selective triggering of a variety of host immune cells and molecules in the presence of pathogenic microorganisms or microbial virulence molecules. Growing evidence also suggests that CD39 and CD73 present complimentary, but likely differential, actions against pathogens to shape the course and severity of microbial infection as well as the associated immune response. Similarly, adenosine receptors A2A and A2B have been proposed to be major immunomodulators of adenosine signaling during chronic inflammatory conditions induced by opportunistic pathogens, such as oral colonizer Porphyromonas gingivalis. Therefore, we here review the recent studies that demonstrate how complex network of molecules in the extracellular adenosine signaling machinery and their interactions can reshape immune responses and may also be targeted by opportunistic pathogens to establish successful colonization in human mucosal tissues and modulate the host immune response.

  2. DMPD: Toll-like receptors and the host defense against microbial pathogens: bringingspecificity to the innate-immune system. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 15075354 Toll-like receptors and the host defense against microbial pathogens: brin...oc Biol. 2004 May;75(5):749-55. Epub 2004 Jan 14. (.png) (.svg) (.html) (.csml) Show Toll-like receptors and the host defense again...immune system. PubmedID 15075354 Title Toll-like receptors and the host defense against microbial pathogens:

  3. Bovine mastitis disease/pathogenicity: evidence of the potential role of microbial biofilms.

    Science.gov (United States)

    Gomes, Fernanda; Saavedra, Maria José; Henriques, Mariana

    2016-04-01

    Bovine mastitis (BM) is a disease with high incidence worldwide and one of the most relevant bovine pathologies and the most costly to the dairy industry. BM is an inflammation of the udder and represents one of the most difficult veterinary diseases to control. Biofilm formation is considered a selective advantage for pathogens causing mastitis, facilitating bacterial persistence in the udder. In fact, recently some authors drew attention to the biofilm formation ability presented by several mastitis causing pathogens and to its possible relation with recurrent mastitis infections and with the increased resistance to antimicrobial agents and host immune defence system. Actually, up to now, several researchers reported the potential role of cells in this mode of growth in the previous facts mentioned. As a consequence of the presence of biofilms, the infection here focused is more difficult to treat and eradicate, making this problem a more relevant pressing issue. Thus, we believe that a deeper knowledge of these structures in mastitis can help to determine the best control strategy to be used in veterinary practice in order to reduce losses in the dairy industry and to ensure milk safety and quality. The aim of this paper was to review the existing research and consequently to provide an overview of the role of biofilms in BM infections. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Microbial Diseases of Bivalve Mollusks: Infections, Immunology and Antimicrobial Defense.

    Science.gov (United States)

    Zannella, Carla; Mosca, Francesco; Mariani, Francesca; Franci, Gianluigi; Folliero, Veronica; Galdiero, Marilena; Tiscar, Pietro Giorgio; Galdiero, Massimiliano

    2017-06-17

    A variety of bivalve mollusks (phylum Mollusca, class Bivalvia) constitute a prominent commodity in fisheries and aquacultures, but are also crucial in order to preserve our ecosystem's complexity and function. Bivalve mollusks, such as clams, mussels, oysters and scallops, are relevant bred species, and their global farming maintains a high incremental annual growth rate, representing a considerable proportion of the overall fishery activities. Bivalve mollusks are filter feeders; therefore by filtering a great quantity of water, they may bioaccumulate in their tissues a high number of microorganisms that can be considered infectious for humans and higher vertebrates. Moreover, since some pathogens are also able to infect bivalve mollusks, they are a threat for the entire mollusk farming industry. In consideration of the leading role in aquaculture and the growing financial importance of bivalve farming, much interest has been recently devoted to investigate the pathogenesis of infectious diseases of these mollusks in order to be prepared for public health emergencies and to avoid dreadful income losses. Several bacterial and viral pathogens will be described herein. Despite the minor complexity of the organization of the immune system of bivalves, compared to mammalian immune systems, a precise description of the different mechanisms that induce its activation and functioning is still missing. In the present review, a substantial consideration will be devoted in outlining the immune responses of bivalves and their repertoire of immune cells. Finally, we will focus on the description of antimicrobial peptides that have been identified and characterized in bivalve mollusks. Their structural and antimicrobial features are also of great interest for the biotechnology sector as antimicrobial templates to combat the increasing antibiotic-resistance of different pathogenic bacteria that plague the human population all over the world.

  5. Models of Caenorhabditis elegans infection by bacterial and fungal pathogens.

    Science.gov (United States)

    Powell, Jennifer R; Ausubel, Frederick M

    2008-01-01

    The nematode Caenorhabditis elegans is a simple model host for studying the relationship between the animal innate immune system and a variety of bacterial and fungal pathogens. Extensive genetic and molecular tools are available in C. elegans, facilitating an in-depth analysis of host defense factors and pathogen virulence factors. Many of these factors are conserved in insects and mammals, indicating the relevance of the nematode model to the vertebrate innate immune response. Here, we describe pathogen assays for a selection of the most commonly studied bacterial and fungal pathogens using the C. elegans model system.

  6. Mass spectrometry-based bacterial proteomics: focus on dermatological associated microbial pathogens

    Directory of Open Access Journals (Sweden)

    Youcef eSoufi

    2016-02-01

    Full Text Available The composition of human skin acts as a natural habitat for various bacterial species that function in a commensal and symbiotic fashion. In a healthy individual, bacterial flora serves to protect the host. Under certain conditions such as minor trauma, impaired host immunity, or environmental factors, the risk of developing skin infections is increased. Although a large majority of bacterial associated skin infections are common, a portion can potentially manifest into clinically significant morbidity. For example, Gram positive species that typically reside on the skin such as Staphylococcus and Streptococcus can cause numerous epidermal (impetigo, ecthyma and dermal (cellulitis, necrotizing fasciitis, erysipelas skin infections. Moreover, the increasing incidence of bacterial antibiotic resistance represents a serious challenge to modern medicine and threatens the health care system. Therefore, it is critical to develop tools and strategies that can allow us to better elucidate the nature and mechanism of bacterial virulence. To this end, mass spectrometry (MS-based proteomics has been revolutionizing biomedical research, and has positively impacted the microbiology field. Advances in MS technologies have paved the way for numerous bacterial proteomes and their respective post translational modifications (PTMs to be accurately identified and quantified in a high throughput and robust fashion. This technological platform offers critical information with regards to signal transduction, adherence, and microbial-host interactions associated with bacterial pathogenesis. This mini-review serves to highlight the current progress proteomics has contributed towards the understanding of bacteria that are associated with skin related diseases, infections, and antibiotic resistance.

  7. Assessment and impact of microbial fecal pollution and human enteric pathogens in a coastal community.

    Science.gov (United States)

    Lipp, E K; Farrah, S A; Rose, J B

    2001-04-01

    The goals of this study were to assess watersheds impacted by high densities of OSDS (onsite sewage disposal systems) for evidence of fecal contamination and evaluate the occurrence of human pathogens in coastal waters off west Florida. Eleven stations (representing six watersheds) were intensively sampled for microbial indicators of fecal pollution (fecal coliform bacteria, enterococci, Clostridium perfringens and coliphage) and the human enteric pathogens, Cryptosporidium, Giardia, and enteroviruses during the summer rainy season (May-September 1996). Levels of all indicators ranged between 4000 CFU/100 ml. Cryptosporidium and Giardia were detected infrequently (6.8% and 2.3% of samples tested positive, respectively). Conversely, infectious enteroviruses were detected at low levels in 5 of the 6 watersheds sampled. Using cluster analysis, sites were grouped into two categories, high and low risks, based on combined levels of indicators. These results suggest that stations of highest pollution risk were located within areas of high OSDS densities. Furthermore, data indicate a subsurface transport of contaminated water to surface waters. The high prevalence of enteroviruses throughout the study area suggests a chronic pollution problem and potential risk to recreational swimmers in and around Sarasota Bay.

  8. Evaluation of Pathogen Removal in a Solar Sludge Drying Facility Using Microbial Indicators

    Directory of Open Access Journals (Sweden)

    D. İpek Kurtböke

    2010-02-01

    Full Text Available South East Queensland is one of the fastest growing regions in Australia with a correspondingly rapid increase in sewage production. In response, local councils are investing in more effective and sustainable options for the treatment and reuse of domestic and industrial effluents. A novel, evaporative solar dryer system has been installed on the Sunshine Coast to convert sewage sludge into a drier, usable form of biosolids through solar radiation exposure resulting in decreased moisture concentration and pathogen reduction. Solar-dried biosolids were analyzed for selected pathogenic microbial, metal and organic contaminants at the end of different drying cycles in a collaborative study conducted with the Regional Council. Although fecal coliforms were found to be present, enteroviruses, parasites, E. coli, and Salmonella sp. were not detected in the final product. However, elevated levels of zinc and copper were still present which restricted public use of the biosolids. Dilution of the dried biosolids with green waste as well as composting of the biosolids is likely to lead to the production of an environmentally safe, Class A end-product.

  9. Microbial translocation and cardiometabolic risk factors in HIV infection

    DEFF Research Database (Denmark)

    Trøseid, Marius; Manner, Ingjerd W; Pedersen, Karin K

    2014-01-01

    of microbial translocation are closely associated with several cardiovascular risk factors such as dyslipidemia, insulin resistance, hypertension, coagulation abnormalities, endothelial dysfunction, and carotid atherosclerosis. Future studies should investigate whether associations between microbial...

  10. Enhancement of host defense against pathogens by antimicrobial peptides : a new approach to combat microbial drug resistance

    NARCIS (Netherlands)

    Does, Anne Margaretha van der

    2011-01-01

    Due to their abilities to eliminate pathogens and modulate host’s immune responses, antimicrobial peptides are considered as potential alternatives for the treatment of infections with (multi-drug resistant) pathogens. In this thesis the immunomodulatory actions of two peptides have been

  11. Unraveling the relationship between microbial translocation and systemic immune activation in HIV infection

    Science.gov (United States)

    Shan, Liang; Siliciano, Robert F.

    2014-01-01

    Chronic immune activation is a key factor in HIV-1 disease progression. The translocation of microbial products from the intestinal lumen into the systemic circulation occurs during HIV-1 infection and is associated closely with immune activation; however, it has not been determined conclusively whether microbial translocation drives immune activation or occurs as a consequence of HIV-1 infection. In an important study in this issue of the JCI, Kristoff and colleagues describe the role of microbial translocation in producing immune activation in an animal model of HIV-1 infection, SIV infection of pigtailed macaques. Blocking translocation of intestinal bacterial LPS into the circulation dramatically reduced T cell activation and proliferation, production of proinflammatory cytokines, and plasma SIV RNA levels. This study directly demonstrates that microbial translocation promotes the systemic immune activation associated with HIV-1/SIV infection. PMID:24837427

  12. Peracetic Acid (PAA Disinfection: Inactivation of Microbial Indicators and Pathogenic Bacteria in a Municipal Wastewater Plant

    Directory of Open Access Journals (Sweden)

    Silvia Bonetta

    2017-06-01

    Full Text Available Several studies have noted that treated and untreated wastewaters are primary contributors of a variety of pathogenic microorganisms to the aquatic ecosystem. Conventional wastewater treatment may not be sufficient to achieve microbiologically safe effluent to be discharged into natural waters or reused, thus requiring wastewater effluents to be disinfected. In recent years, peracetic acid (PAA has been adopted as a disinfectant for wastewater effluents. The aim of this study was to evaluate the disinfection efficiency of PAA at low doses (range 0.99–2.10 mg/L against microbial indicators and pathogenic bacteria in a municipal wastewater plant. Samples of untreated sewage and effluents before and after PAA treatment were collected seasonally for 1 year and were analysed for pathogenic Campylobacter, Salmonella spp., E. coli O157:H7 and E. coli virulence genes using molecular methods; moreover, the detection of specific microbial indicators (E. coli, faecal coliforms, enterococci, C. perfringens and Salmonella spp. were carried out using culturing methods. Salmonella spp. DNA was found in all untreated sewage and effluent before PAA treatment, whereas it was recovered in 50% of the samples collected after PAA treatment. Although E. coli O157:H7 was never identified, the occurrence of Shiga-like toxin I amplicons was identified in 75% of the untreated sewage samples, in 50% of the effluents assayed before PAA treatment, and in 25% of the effluents assayed after PAA treatment, whereas the stx2 gene was never found. Campylobacter coli was only detected in one effluent sample before PAA treatment. In the effluents after PAA treatment, a lower load of indicator bacteria was observed compared to the effluents before treatment. The results of this study highlight that the use of low doses of PAA seems to lead to an improvement of the microbiological quality of the effluent, although it is not sufficient to guarantee its suitability for irrigation

  13. Strategies for targeting tetraspanin proteins: potential therapeutic applications in microbial infections.

    Science.gov (United States)

    Hassuna, Noha; Monk, Peter N; Moseley, Gregory W; Partridge, Lynda J

    2009-01-01

    The identification of novel targets and strategies for therapy of microbial infections is an area of intensive research due to the failure of conventional vaccines or antibiotics to combat both newly emerging diseases (e.g. viruses such as severe acute respiratory syndrome (SARS) and new influenza strains, and antibiotic-resistant bacteria) and entrenched, pandemic diseases exemplified by HIV. One clear approach to this problem is to target processes of the host organism rather than the microbe. Recent data have indicated that members of the tetraspanin superfamily, proteins with a widespread distribution in eukaryotic organisms and 33 members in humans, may provide such an approach. Tetraspanins traverse the membrane four times, but are distinguished from other four-pass membrane proteins by the presence of conserved charged residues in the transmembrane domains and a defining 'signature' motif in the larger of the two extracellular domains (the EC2). They characteristically form promiscuous associations with one another and with other membrane proteins and lipids to generate a specialized type of microdomain: the tetraspanin-enriched microdomain (TEM). TEMs are integral to the main role of tetraspanins as 'molecular organizers' involved in functions such as membrane trafficking, cell-cell fusion, motility, and signaling. Increasing evidence demonstrates that tetraspanins are used by intracellular pathogens as a means of entering and replicating within human cells. Although previous investigations focused mainly on viruses such as hepatitis C and HIV, it is now becoming clear that other microbes associate with tetraspanins, using TEMs as a 'gateway' to infection. In this article we review the properties and functions of tetraspanins/TEMs that are relevant to infective processes and discuss the accumulating evidence that shows how different pathogens exploit these properties in infection and in the pathogenesis of disease. We then investigate the novel and exciting

  14. Antimicrobial resistance in pathogens causing urinary tract infections in a rural community of Odisha, India

    Directory of Open Access Journals (Sweden)

    Muktikesh Dash

    2013-01-01

    Full Text Available Background: Antimicrobial resistance of urinary tract pathogens has increased worldwide. Empiric treatment of community-acquired urinary tract infection (CA-UTI is determined by antimicrobial resistance patterns of uropathogens in a population of specific geographical location. Objectives: This study was conducted to determine the prevalence of CA-UTI in rural Odisha, India, and the effect of gender and age on its prevalence as well as etiologic agents and the resistance profile of the bacterial isolates. Materials and Methods: Consecutive clean-catch mid-stream urine samples were collected from 1670 adult patients. The urine samples were processed and microbial isolates were identified by conventional methods. Antimicrobial susceptibility testing was performed on all bacterial isolates by Kirby Bauer′s disc diffusion method. Results: The prevalence of UTI was significantly higher in females compared with males (females 45.2%, males 18.4%, OR = 2.041, 95% CI = 1.64-2.52, P ≤ 0.0001. Young females within the age group of 18-37 years and elderly males (≥68 years showed high prevalence of UTI. Escherichia coli (68.8% was the most prevalent isolate followed by Enterococcus spp. (9.7%. Amikacin and nitrofurantoin were the most active antimicrobial agents which showed low resistance rate of 5.8% and 9.8%, respectively. Conclusion: Our study revealed E. coli as the pre-dominant bacterial pathogen. Nitrofurantoin should be used as empirical therapy for uncomplicated CA-UTIs. In the Indian setting, routine urine cultures may be advisable, since treatment failure is likely to occur with commonly used antimicrobials. Therefore, development of regional surveillance programs is necessary for implementation of national CA-UTI guidelines.

  15. Bioeconomic modeling of lactational antimicrobial treatment of new bovine subclinical intramammary infections caused by contagious pathogens

    NARCIS (Netherlands)

    Borne, van den B.H.P.; Halasa, T.; Schaik, van G.; Hogeveen, H.; Nielen, M.

    2010-01-01

    This study determined the direct and indirect epidemiologic and economic effects of lactational treatment of new bovine subclinical intramammary infections (IMI) caused by contagious pathogens using an existing bioeconomic model. The dynamic and stochastic model simulated the dynamics of

  16. The efficacy of different anti-microbial metals at preventing the formation of, and eradicating bacterial biofilms of pathogenic indicator strains.

    Science.gov (United States)

    Gugala, Natalie; Lemire, Joe A; Turner, Raymond J

    2017-06-01

    The emergence of multidrug-resistant pathogens and the prevalence of biofilm-related infections have generated a demand for alternative anti-microbial therapies. Metals have not been explored in adequate detail for their capacity to combat infectious disease. Metal compounds can now be found in textiles, medical devices and disinfectants-yet, we know little about their efficacy against specific pathogens. To help fill this knowledge gap, we report on the anti-microbial and antibiofilm activity of seven metals: silver, copper, titanium, gallium, nickel, aluminum and zinc against three bacterial strains, Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli. To evaluate the capacity of metal ions to prevent the growth of, and eradicate biofilms and planktonic cells, bacterial cultures were inoculated in the Calgary Biofilm Device (minimal biofilm eradication concentration) in the presence of the metal salts. Copper, gallium and titanium were capable of preventing planktonic and biofilm growth, and eradicating established biofilms of all tested strains. Further, we observed that the efficacies of the other tested metal salts displayed variable efficacy against the tested strains. Further, contrary to the enhanced resistance anticipated from bacterial biofilms, particular metal salts were observed to be more effective against biofilm communities versus planktonic cells. In this study, we have demonstrated that the identity of the bacterial strain must be considered before treatment with a particular metal ion. Consequent to the use of metal ions as anti-microbial agents to fight multidrug-resistant and biofilm-related infections increases, we must aim for more selective deployment in a given infectious setting.

  17. Genomic Microbial Epidemiology Is Needed to Comprehend the Global Problem of Antibiotic Resistance and to Improve Pathogen Diagnosis.

    Science.gov (United States)

    Wyrsch, Ethan R; Roy Chowdhury, Piklu; Chapman, Toni A; Charles, Ian G; Hammond, Jeffrey M; Djordjevic, Steven P

    2016-01-01

    Contamination of waste effluent from hospitals and intensive food animal production with antimicrobial residues is an immense global problem. Antimicrobial residues exert selection pressures that influence the acquisition of antimicrobial resistance and virulence genes in diverse microbial populations. Despite these concerns there is only a limited understanding of how antimicrobial residues contribute to the global problem of antimicrobial resistance. Furthermore, rapid detection of emerging bacterial pathogens and strains with resistance to more than one antibiotic class remains a challenge. A comprehensive, sequence-based genomic epidemiological surveillance model that captures essential microbial metadata is needed, both to improve surveillance for antimicrobial resistance and to monitor pathogen evolution. Escherichia coli is an important pathogen causing both intestinal [intestinal pathogenic E. coli (IPEC)] and extraintestinal [extraintestinal pathogenic E. coli (ExPEC)] disease in humans and food animals. ExPEC are the most frequently isolated Gram negative pathogen affecting human health, linked to food production practices and are often resistant to multiple antibiotics. Cattle are a known reservoir of IPEC but they are not recognized as a source of ExPEC that impact human or animal health. In contrast, poultry are a recognized source of multiple antibiotic resistant ExPEC, while swine have received comparatively less attention in this regard. Here, we review what is known about ExPEC in swine and how pig production contributes to the problem of antibiotic resistance.

  18. Human infection with highly pathogenic H5N1 influenza virus

    NARCIS (Netherlands)

    Gambotto, Andrea; Barratt-Boyes, Simon M.; de Jong, Menno D.; Neumann, Gabriele; Kawaoka, Yoshihiro

    2008-01-01

    Highly pathogenic H5N1 influenza A viruses have spread relentlessly across the globe since 2003, and they are associated with widespread death in poultry, substantial economic loss to farmers, and reported infections of more than 300 people with a mortality rate of 60%. The high pathogenicity of

  19. Clinical data and CT findings of pulmonary infection caused by different pathogens after kidney transplantation

    International Nuclear Information System (INIS)

    Jiang Tao; Xue Feng; Zheng Xuan; Yu Hong; Tao Xiaofeng; Xiao Xiangsheng; Liu Shiyuan

    2012-01-01

    Purpose: The overall objective was to review clinical data and CT findings of pulmonary infection caused by different pathogens after kidney transplantation in an attempt to help early clinical qualitative diagnosis. Materials and methods: 446 cases of clinically confirmed pulmonary infection after kidney transplantation in recent 10 years were evaluated with respect to the time of occurrence and 89 cases with complete CT data and pathogenic diagnosis were further analyzed for pathogen types and CT manifestations. Statistical analysis was performed using Fisher's exact test. Results: Pulmonary infection reached the peak in 3 months after transplantation. Bacterial infection and mixed infection were predominant between 1 and 6 months. And most tuberculosis occurred after one year. Bacterial (38.2%) and mixed infections (38.2%) were the common types. The next was fungal infection, tuberculosis and viral infection (10.1%, 7.9% and 5.6%, respectively). CT manifestations of pulmonary infections after kidney transplantation were diverse and complex, lacking characteristic signs. Conclusion: More than 3/4 of pulmonary infections after kidney transplantation can be attributed to bacteria and mixed pathogens. The combination of time course, clinical data and CT manifestations plays an important role in the early clinical qualitative diagnosis.

  20. Cross-modulation of pathogen-specific pathways enhances malnutrition during enteric co-infection with Giardia lamblia and enteroaggregative Escherichia coli.

    Science.gov (United States)

    Bartelt, Luther A; Bolick, David T; Mayneris-Perxachs, Jordi; Kolling, Glynis L; Medlock, Gregory L; Zaenker, Edna I; Donowitz, Jeffery; Thomas-Beckett, Rose Viguna; Rogala, Allison; Carroll, Ian M; Singer, Steven M; Papin, Jason; Swann, Jonathan R; Guerrant, Richard L

    2017-07-01

    Diverse enteropathogen exposures associate with childhood malnutrition. To elucidate mechanistic pathways whereby enteric microbes interact during malnutrition, we used protein deficiency in mice to develop a new model of co-enteropathogen enteropathy. Focusing on common enteropathogens in malnourished children, Giardia lamblia and enteroaggregative Escherichia coli (EAEC), we provide new insights into intersecting pathogen-specific mechanisms that enhance malnutrition. We show for the first time that during protein malnutrition, the intestinal microbiota permits persistent Giardia colonization and simultaneously contributes to growth impairment. Despite signals of intestinal injury, such as IL1α, Giardia-infected mice lack pro-inflammatory intestinal responses, similar to endemic pediatric Giardia infections. Rather, Giardia perturbs microbial host co-metabolites of proteolysis during growth impairment, whereas host nicotinamide utilization adaptations that correspond with growth recovery increase. EAEC promotes intestinal inflammation and markers of myeloid cell activation. During co-infection, intestinal inflammatory signaling and cellular recruitment responses to EAEC are preserved together with a Giardia-mediated diminishment in myeloid cell activation. Conversely, EAEC extinguishes markers of host energy expenditure regulatory responses to Giardia, as host metabolic adaptations appear exhausted. Integrating immunologic and metabolic profiles during co-pathogen infection and malnutrition, we develop a working mechanistic model of how cumulative diet-induced and pathogen-triggered microbial perturbations result in an increasingly wasted host.

  1. Linking social and pathogen transmission networks using microbial genetics in giraffe (Giraffa camelopardalis).

    Science.gov (United States)

    VanderWaal, Kimberly L; Atwill, Edward R; Isbell, Lynne A; McCowan, Brenda

    2014-03-01

    Although network analysis has drawn considerable attention as a promising tool for disease ecology, empirical research has been hindered by limitations in detecting the occurrence of pathogen transmission (who transmitted to whom) within social networks. Using a novel approach, we utilize the genetics of a diverse microbe, Escherichia coli, to infer where direct or indirect transmission has occurred and use these data to construct transmission networks for a wild giraffe population (Giraffe camelopardalis). Individuals were considered to be a part of the same transmission chain and were interlinked in the transmission network if they shared genetic subtypes of E. coli. By using microbial genetics to quantify who transmits to whom independently from the behavioural data on who is in contact with whom, we were able to directly investigate how the structure of contact networks influences the structure of the transmission network. To distinguish between the effects of social and environmental contact on transmission dynamics, the transmission network was compared with two separate contact networks defined from the behavioural data: a social network based on association patterns, and a spatial network based on patterns of home-range overlap among individuals. We found that links in the transmission network were more likely to occur between individuals that were strongly linked in the social network. Furthermore, individuals that had more numerous connections or that occupied 'bottleneck' positions in the social network tended to occupy similar positions in the transmission network. No similar correlations were observed between the spatial and transmission networks. This indicates that an individual's social network position is predictive of transmission network position, which has implications for identifying individuals that function as super-spreaders or transmission bottlenecks in the population. These results emphasize the importance of association patterns in

  2. Middle East Desert Dust Exposure: Health Risks from Metals and Microbial Pathogens

    Science.gov (United States)

    Lyles, M. B.

    2014-12-01

    In the Middle East, dust and sand storms are a persistent problem and can deliver significant amounts of micro-particulates via inhalation into the mouth, nasal pharynx, & lungs due to the fine size and abundance of these micro-particulates. The chronic and acute health risks of this dust inhalation have not been well studied nor has the dust been effectively characterized as to its chemical composition, mineral content, or microbial flora. Scientific experiments were designed to study the Kuwaiti and Iraqi dust as to its physical, chemical, and biological characteristics and for its potential to cause adverse health effects. First, dust samples from different locations were collected and processed and exposure data collected. Initial chemical and physical characterization of each sample including particle size distribution and inorganic analysis was conducted, followed by characterization of biologic flora of the dust, including bacteria, fungi and viruses. Data indicates that the mineralized dust is composed of calcium carbonate over a matrix of metallic silicate nanocrystals containing a variety of trace and heavy metals constituting ~3 % of the PM10 particles by weight, of which ~1% is bioaccessible aluminum and reactive iron, each. The particles also consist of ~1% bioavailable aluminum and reactive iron each. Microbial analysis reveals a significant biodiversity of bacterial, fungi, and viruses of which ~30% are known pathogens. Of the microbes identified, several have hemolytic properties and most have significant antibiotic resistance. Viral analysis indicates a tremendous amount of virons with a large percent of RNA viruses. The level of total suspended particle mass at PM 10 along with environmental & physiological conditions present constitute an excessive exposure to micro-particulates including PM 2.5 and the potential for adverse health effects. Reported data on cell culture and animal studies have indicated a high level of toxicity to these dust

  3. Microbial Characteristics of Nosocomial Infections and Their Association with the Utilization of Hand Hygiene Products: A Hospital-Wide Analysis of 78,344 Cases.

    Science.gov (United States)

    Liu, Song; Wang, Meng; Wang, Gefei; Wu, Xiuwen; Guan, Wenxian; Ren, Jianan

    Nosocomial infections are the main adverse events during health care delivery. Hand hygiene is the fundamental strategy for the prevention of nosocomial infections. Microbial characteristics of nosocomial infections in the Asia-Pacific region have not been investigated fully. Correlation between the use of hand hygiene products and the incidence of nosocomial infections is still unknown. This study investigates the microbial characteristics of nosocomial infections in the Asia-Pacific region and analyzes the association between the utilization of hand hygiene products and the incidence of nosocomial infections. A total of 78,344 patients were recruited from a major tertiary hospital in China. Microbial characteristics of major types of nosocomial infections were described. The association between the utilization of hand hygiene products and the incidence of nosocomial infections was analyzed using correlation and regression models. The overall incidence of nosocomial infections was 3.04%, in which the incidence of surgical site infection was 1%. Multi-drug resistance was found in 22.8% of all pathogens, in which multi-drug-resistant Acinetobacter baumannii and methicillin-resistant Staphylococcus aureus were 56.6% and 54.9%, respectively. The utilization of hand hygiene products (including hand sanitizer, soap and paper towel) was associated negatively with the incidence of surgical site infection in surgical departments and the incidence of nosocomial infections in non-intensive care unit (ICU) departments (especially in surgical departments). Regression analysis further identified that higher utilization of hand hygiene products correlated with decreased incidence of major types of nosocomial infections. Multi-drug-resistant organisms are emerging in Asia-Pacific health care facilities. Utilization of hand hygiene products is associated with the incidence of nosocomial infections.

  4. Changes in microbial ecology after fecal microbiota transplantation for recurrent C. difficile infection affected by underlying inflammatory bowel disease.

    Science.gov (United States)

    Khanna, Sahil; Vazquez-Baeza, Yoshiki; González, Antonio; Weiss, Sophie; Schmidt, Bradley; Muñiz-Pedrogo, David A; Rainey, John F; Kammer, Patricia; Nelson, Heidi; Sadowsky, Michael; Khoruts, Alexander; Farrugia, Stefan L; Knight, Rob; Pardi, Darrell S; Kashyap, Purna C

    2017-05-15

    Gut microbiota play a key role in maintaining homeostasis in the human gut. Alterations in the gut microbial ecosystem predispose to Clostridium difficile infection (CDI) and gut inflammatory disorders such as inflammatory bowel disease (IBD). Fecal microbiota transplantation (FMT) from a healthy donor can restore gut microbial diversity and pathogen colonization resistance; consequently, it is now being investigated for its ability to improve inflammatory gut conditions such as IBD. In this study, we investigated changes in gut microbiota following FMT in 38 patients with CDI with or without underlying IBD. There was a significant change in gut microbial composition towards the donor microbiota and an overall increase in microbial diversity consistent with previous studies after FMT. FMT was successful in treating CDI using a diverse set of donors, and varying degrees of donor stool engraftment suggesting that donor type and degree of engraftment are not drivers of a successful FMT treatment of CDI. However, patients with underlying IBD experienced an increased number of CDI relapses (during a 24-month follow-up) and a decreased growth of new taxa, as compared to the subjects without IBD. Moreover, the need for IBD therapy did not change following FMT. These results underscore the importance of the existing gut microbial landscape as a decisive factor to successfully treat CDI and potentially for improvement of the underlying pathophysiology in IBD. FMT leads to a significant change in microbial diversity in patients with recurrent CDI and complete resolution of symptoms. Stool donor type (related or unrelated) and degree of engraftment are not the key for successful treatment of CDI by FMT. However, CDI patients with IBD have higher proportion of the original community after FMT and lack of improvement of their IBD symptoms and increased episodes of CDI on long-term follow-up.

  5. Transcriptomic analysis reveals the potential of highly pathogenic PRRS virus to modulate immune system activation related to host-pathogen and damage associated signaling in infected porcine monocytes

    Science.gov (United States)

    One of the largest risks to the continued stability of the swine industry is by pathogens like porcine reproductive and respiratory syndrome virus (PRRSV) that can decimate production as it spreads among individuals. These infections can be low or highly pathogenic, and because it infects monocytic ...

  6. A neonatal murine model for evaluation of enterovirus E HY12 virus infection and pathogenicity.

    Directory of Open Access Journals (Sweden)

    Xiaochun Gai

    Full Text Available HY12 viruses are enteroviruses recently isolated from cattle characterized by severe respiratory and digestive disease with high morbidity and mortality in China. While the viruses exhibit unique biological and molecular characters distinct from known enterovirus E, the pathogenicity and viral pathogenesis remains largely unknown.Neonatal mice of Balb/C, ICR, and Kunming strain are infected with HY12 to determine the susceptible mouse strain. The minimal infection dose, the virus infection routes, the pathogenicity and tissue tropism for HY12 were determined by infecting susceptible mice with HY12 viruses, and confirmed by different approaches including virus isolation and recovery, virus detection, histopathology, and immunohistochemistry.A murine model for HY12 infection was successfully established and employed to investigate the pathogenicity of HY12 viruses. ICR mouse strain is the most susceptible strain for HY12 infection with a minimal infective dose as 2×106TCID50/mouse. HY12 viruses have the capability of infecting ICR suckling mice via all infection routes including intranasal administration, oral administration, intraperitoneal injection, subcutaneous injection, and intramuscular injection, which are confirmed by the isolation and recovery of viruses from HY12-infected mice; detection of viruses by RT-PCR; observations of pathological lesions and inflammatory cell infiltrations in the intestine, lung, liver, and brain; uncovering of HY12 virus antigens in majority of tissues, especially in intestine, lung, and infected brain of mice by immunohistochemistry assay.A neonatal murine model for HY12 infection is successfully established for determining the susceptible mouse strain, the minimal infective dose, the infection route, the viral pathogenicity and the tropism of HY12, thus providing an invaluable model system for elucidating the pathogenesis of HY12 viruses and the elicited immunity.

  7. Microbial diversity and prevalence of foodborne pathogens in cheap and junk foods consumed by primary schoolchildren.

    Science.gov (United States)

    Kim, M J; Kim, S A; Kang, Y S; Hwang, I G; Rhee, M S

    2013-07-01

    Aerobic plate counts (APC), coliforms, Bacillus cereus, Escherichia coli and eight foodborne pathogens were tested in 1008 cheap and junk foods, including candies, dried cakes, chewing gum, chocolate, dried and seasoned seafood, ice cream, and sugary foods. APCs were positive for 342 samples (33·9%), and the majority of the counts were 2-3 log CFU g(-1) or ml(-1) (average: 1·10 log CFU g(-1) or ml(-1) ). Most samples (97·3%) contained no coliforms (average: 0·07 log CFU g(-1) or ml(-1) ). Bacillus cereus was detected in 68 samples (average: 0·14 log CFU g(-1) or ml(-1) ). Escherichia coli and Listeria monocytogenes were detected in 6 and 1 samples, respectively, whereas other foodborne pathogens were not isolated. The highest bacterial counts were associated with dried and seasoned seafood products and dried cakes, suggesting that appropriate regulations of these food types should be considered. Cheap and junk foods were produced mainly in developing countries, but there were no significant differences in the bacterial counts among different countries of origin. The presence of foodborne pathogens may pose a risk for children. These results suggest that there is cause for deeper concern about the safety of these foods and that effective countermeasures should be established to improve their microbiological safety. Food safety is especially important for children, but only limited information is available about the microbiological quality of cheap and junk foods that are consumed frequently by primary schoolchildren (e.g. dried cakes, candies and chocolates). The present study investigated the microbial quality of cheap and junk foods, and our results indicate that these foods are a potential health risk for children, therefore, deeper concern about the safety of these foods and effective countermeasures should be established to improve their microbiological safety. The present study may contribute to the development of an appropriate child food

  8. Severity of bovine tuberculosis is associated with co-infection with common pathogens in wild boar.

    Directory of Open Access Journals (Sweden)

    David Risco

    Full Text Available Co-infections with parasites or viruses drive tuberculosis dynamics in humans, but little is known about their effects in other non-human hosts. This work aims to investigate the relationship between Mycobacterium bovis infection and other pathogens in wild boar (Sus scrofa, a recognized reservoir of bovine tuberculosis (bTB in Mediterranean ecosystems. For this purpose, it has been assessed whether contacts with common concomitant pathogens are associated with the development of severe bTB lesions in 165 wild boar from mid-western Spain. The presence of bTB lesions affecting only one anatomic location (cervical lymph nodes, or more severe patterns affecting more than one location (mainly cervical lymph nodes and lungs, was assessed in infected animals. In addition, the existence of contacts with other pathogens such as porcine circovirus type 2 (PCV2, Aujeszky's disease virus (ADV, swine influenza virus, porcine reproductive and respiratory syndrome virus, Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, Haemophilus parasuis and Metastrongylus spp, was evaluated by means of serological, microbiological and parasitological techniques. The existence of contacts with a structured community of pathogens in wild boar infected by M. bovis was statistically investigated by null models. Association between this community of pathogens and bTB severity was examined using a Partial Least Squares regression approach. Results showed that adult wild boar infected by M. bovis had contacted with some specific, non-random pathogen combinations. Contact with PCV2, ADV and infection by Metastrongylus spp, was positively correlated to tuberculosis severity. Therefore, measures against these concomitant pathogens such as vaccination or deworming, might be useful in tuberculosis control programmes in the wild boar. However, given the unexpected consequences of altering any community of organisms, further research should evaluate the impact of such measures

  9. Severity of Bovine Tuberculosis Is Associated with Co-Infection with Common Pathogens in Wild Boar

    Science.gov (United States)

    Risco, David; Serrano, Emmanuel; Fernández-Llario, Pedro; Cuesta, Jesús M.; Gonçalves, Pilar; García-Jiménez, Waldo L.; Martínez, Remigio; Cerrato, Rosario; Velarde, Roser; Gómez, Luis; Segalés, Joaquím; Hermoso de Mendoza, Javier

    2014-01-01

    Co-infections with parasites or viruses drive tuberculosis dynamics in humans, but little is known about their effects in other non-human hosts. This work aims to investigate the relationship between Mycobacterium bovis infection and other pathogens in wild boar (Sus scrofa), a recognized reservoir of bovine tuberculosis (bTB) in Mediterranean ecosystems. For this purpose, it has been assessed whether contacts with common concomitant pathogens are associated with the development of severe bTB lesions in 165 wild boar from mid-western Spain. The presence of bTB lesions affecting only one anatomic location (cervical lymph nodes), or more severe patterns affecting more than one location (mainly cervical lymph nodes and lungs), was assessed in infected animals. In addition, the existence of contacts with other pathogens such as porcine circovirus type 2 (PCV2), Aujeszky's disease virus (ADV), swine influenza virus, porcine reproductive and respiratory syndrome virus, Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, Haemophilus parasuis and Metastrongylus spp, was evaluated by means of serological, microbiological and parasitological techniques. The existence of contacts with a structured community of pathogens in wild boar infected by M. bovis was statistically investigated by null models. Association between this community of pathogens and bTB severity was examined using a Partial Least Squares regression approach. Results showed that adult wild boar infected by M. bovis had contacted with some specific, non-random pathogen combinations. Contact with PCV2, ADV and infection by Metastrongylus spp, was positively correlated to tuberculosis severity. Therefore, measures against these concomitant pathogens such as vaccination or deworming, might be useful in tuberculosis control programmes in the wild boar. However, given the unexpected consequences of altering any community of organisms, further research should evaluate the impact of such measures under

  10. Host-pathogen interactions in specific pathogen-free chickens following aerogenous infection with Chlamydia psittaci and Chlamydia abortus.

    Science.gov (United States)

    Kalmar, Isabelle; Berndt, Angela; Yin, Lizi; Chiers, Koen; Sachse, Konrad; Vanrompay, Daisy

    2015-03-15

    Although Chlamydia (C.) psittaci infections are recognized as an important factor causing economic losses and impairing animal welfare in poultry production, the specific mechanisms leading to severe clinical outcomes are poorly understood. In the present study, we comparatively investigated pathology and host immune response, as well as systemic dissemination and expression of essential chlamydial genes in the course of experimental aerogeneous infection with C. psittaci and the closely related C. abortus, respectively, in specific pathogen-free chicks. Clinical signs appeared sooner and were more severe in the C. psittaci-infected group. Compared to C. abortus infection, more intense systemic dissemination of C. psittaci correlated with higher and faster infiltration of immune cells, as well as more macroscopic lesions and epithelial pathology, such as hyperplasia and erosion. In thoracic air sac tissue, mRNA expression of immunologically relevant factors, such as IFN-γ, IL-1β, IL-6, IL-17, IL-22, LITAF and iNOS was significantly stronger up-regulated in C. psittaci- than in C. abortus-infected birds between 3 and 14 days post-infection. Likewise, transcription rates of the chlamydial genes groEL, cpaf and ftsW were consistently higher in C. psittaci during the acute phase. These findings illustrate that the stronger replication of C. psittaci in its natural host also evoked a more intense immune response than in the case of C. abortus infection. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Host-pathogen interactions mediating pain of urinary tract infection.

    Science.gov (United States)

    Rudick, Charles N; Billips, Benjamin K; Pavlov, Vladimir I; Yaggie, Ryan E; Schaeffer, Anthony J; Klumpp, David J

    2010-04-15

    Pelvic pain is a major component of the morbidity associated with urinary tract infection (UTI), yet the molecular mechanisms underlying UTI-induced pain remain unknown. UTI pain mechanisms probably contrast with the clinical condition of asymptomatic bacteriuria (ASB), characterized by significant bacterial loads without lack symptoms. A murine UTI model was used to compare pelvic pain behavior elicited by infection with uropathogenic Escherichia coli strain NU14 and ASB strain 83972. NU14-infected mice exhibited pelvic pain, whereas mice infected with 83972 did not exhibit pain, similar to patients infected with 83972. NU14-induced pain was not dependent on mast cells, not correlated with bacterial colonization or urinary neutrophils. UTI pain was not influenced by expression of type 1 pili, the bacterial adhesive appendages that induce urothelial apoptosis. However, purified NU14 lipopolysaccharide (LPS) induced Toll-like receptor 4 (TLR4)-dependent pain, whereas 83972 LPS induced no pain. Indeed, 83972 LPS attenuated the pain of NU14 infection, suggesting therapeutic potential. These data suggest a novel mechanism of infection-associated pain that is dependent on TLR4 yet independent of inflammation. Clinically, these findings also provide the rational for probiotic therapies that would minimize the symptoms of infection without reliance on empirical therapies that contribute to antimicrobial resistance.

  12. Cryptosporidium parvum: infectivity and pathogenicity of the 'porcine' genotype

    DEFF Research Database (Denmark)

    Enemark, Heidi L.; Ahrens, Peter; Bille-Hansen, Vivi

    2003-01-01

    mild clinical signs in piglets despite the excretion of high numbers of oocysts. Concomitant infection with rotavirus, however, caused a dramatic aggravation of the clinical signs, and 5 of 6 experimentally infected piglets died. CPP-13 appeared to be adapted to porcine hosts as illustrated by the lack...

  13. Pathogenic lower genital tract organisms in HIV-infected and ...

    African Journals Online (AJOL)

    Trichomonas vaginalis and group B streptococci were significantly associated with sepsis (p=0.023 and <0.001, respectively), whereas the presence of Candida species seemed to be protective (relative risk 0.69, p=0.014). Conclusion. The study shows that a high proportion of pregnant women have pathogenic organisms ...

  14. Biological characteristics and pathogenicity of a highly pathogenic Shewanella marisflavi infected sea cucumber (Apostichopus uaponicus)

    Science.gov (United States)

    Shewanella marisflavi isolate AP629 was characterized as a novel pathogen of sea cucumber. The LD50 values (14 days) in sea cucumber and swordtail fish were 3.89 × 106 and 4.85 × 104 CFU g-1 body weight, respectively. Studies on S. marisflavi had been conducted, including morphology, physiological a...

  15. Mycobacterium Szulgai Pulmonary Infection: Case Report of an Uncommon Pathogen in Korea

    International Nuclear Information System (INIS)

    Kim, Jeong Jae; Lee, Jae Chun; Jeong, Sun Young

    2014-01-01

    Mycobacterium szulgai (M. szulgai) is an unusual pathogen in a human non-tuberculous mycobacterial infection. Pulmonary infection due to M. szulgai may be clinically and radiologically confused with active pulmonary tuberculosis. In contrast to other non-tuberculous mycobacteria, M. szulgai infection is well controlled by combination antimycobacterial therapy. Most of the previously reported cases of M. szulgai pulmonary infection showed cavitary upper lobe infiltrates. We herein describe a case of pulmonary M. szulgai infection that shows clinical and radiological presentations similar to active pulmonary tuberculosis.

  16. Mycobacterium Szulgai Pulmonary Infection: Case Report of an Uncommon Pathogen in Korea

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jeong Jae; Lee, Jae Chun; Jeong, Sun Young [Jeju National University School of Medicine, Jeju (Korea, Republic of)

    2014-10-15

    Mycobacterium szulgai (M. szulgai) is an unusual pathogen in a human non-tuberculous mycobacterial infection. Pulmonary infection due to M. szulgai may be clinically and radiologically confused with active pulmonary tuberculosis. In contrast to other non-tuberculous mycobacteria, M. szulgai infection is well controlled by combination antimycobacterial therapy. Most of the previously reported cases of M. szulgai pulmonary infection showed cavitary upper lobe infiltrates. We herein describe a case of pulmonary M. szulgai infection that shows clinical and radiological presentations similar to active pulmonary tuberculosis.

  17. QMRAcatch: Microbial Quality Simulation of Water Resources including Infection Risk Assessment.

    Science.gov (United States)

    Schijven, Jack; Derx, Julia; de Roda Husman, Ana Maria; Blaschke, Alfred Paul; Farnleitner, Andreas H

    2015-09-01

    Given the complex hydrologic dynamics of water catchments and conflicts between nature protection and public water supply, models may help to understand catchment dynamics and evaluate contamination scenarios and may support best environmental practices and water safety management. A catchment model can be an educative tool for investigating water quality and for communication between parties with different interests in the catchment. This article introduces an interactive computational tool, QMRAcatch, that was developed to simulate concentrations in water resources of , a human-associated microbial source tracking (MST) marker, enterovirus, norovirus, , and as target microorganisms and viruses (TMVs). The model domain encompasses a main river with wastewater discharges and a floodplain with a floodplain river. Diffuse agricultural sources of TMVs that discharge into the main river are not included in this stage of development. The floodplain river is fed by the main river and may flood the plain. Discharged TMVs in the river are subject to dilution and temperature-dependent degradation. River travel times are calculated using the Manning-Gauckler-Strickler formula. Fecal deposits from wildlife, birds, and visitors in the floodplain are resuspended in flood water, runoff to the floodplain river, or infiltrate groundwater. Fecal indicator and MST marker data facilitate calibration. Infection risks from exposure to the pathogenic TMVs by swimming or drinking water consumption are calculated, and the required pathogen removal by treatment to meet a health-based quality target can be determined. Applicability of QMRAcatch is demonstrated by calibrating the tool for a study site at the River Danube near Vienna, Austria, using field TMV data, including a sensitivity analysis and evaluation of the model outcomes. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  18. Lactoferrin: Balancing Ups and Downs of Inflammation Due to Microbial Infections

    Directory of Open Access Journals (Sweden)

    Maria Elisa Drago-Serrano

    2017-03-01

    Full Text Available Lactoferrin (Lf is a glycoprotein of the primary innate immune-defense system of mammals present in milk and other mucosal secretions. This protein of the transferrin family has broad antimicrobial properties by depriving pathogens from iron, or disrupting their plasma membranes through its highly cationic charge. Noteworthy, Lf also exhibits immunomodulatory activities performing up- and down-regulation of innate and adaptive immune cells, contributing to the homeostasis in mucosal surfaces exposed to myriad of microbial agents, such as the gastrointestinal and respiratory tracts. Although the inflammatory process is essential for the control of invasive infectious agents, the development of an exacerbated or chronic inflammation results in tissue damage with life-threatening consequences. In this review, we highlight recent findings in in vitro and in vivo models of the gut, lung, oral cavity, mammary gland, and liver infections that provide experimental evidence supporting the therapeutic role of human and bovine Lf in promoting some parameters of inflammation and protecting against the deleterious effects of bacterial, viral, fungal and protozoan-associated inflammation. Thus, this new knowledge of Lf immunomodulation paves the way to more effective design of treatments that include native or synthetic Lf derivatives, which may be useful to reduce immune-mediated tissue damage in infectious diseases.

  19. The membrane as the gatekeeper of infection: Cholesterol in host-pathogen interaction.

    Science.gov (United States)

    Kumar, G Aditya; Jafurulla, Md; Chattopadhyay, Amitabha

    2016-09-01

    The cellular plasma membrane serves as a portal for the entry of intracellular pathogens. An essential step for an intracellular pathogen to gain entry into a host cell therefore is to be able to cross the cell membrane. In this review, we highlight the role of host membrane cholesterol in regulating the entry of intracellular pathogens using insights obtained from work on the interaction of Leishmania and Mycobacterium with host cells. The entry of these pathogens is known to be dependent on host membrane cholesterol. Importantly, pathogen entry is inhibited either upon depletion (or complexation), or enrichment of membrane cholesterol. In other words, an optimum level of host membrane cholesterol is necessary for efficient infection by pathogens. In this overall context, we propose a general mechanism, based on cholesterol-induced conformational changes, involving cholesterol binding sites in host cell surface receptors that are implicated in this process. A therapeutic strategy targeting modulation of membrane cholesterol would have the advantage of avoiding the commonly encountered problem of drug resistance in tackling infection by intracellular pathogens. Insights into the role of host membrane cholesterol in pathogen entry would be instrumental in the development of novel therapeutic strategies to effectively tackle intracellular pathogenesis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  20. QMRA (quantitative microbial risk assessment) and HACCP (hazard analysis and critical control points) for management of pathogens in wastewater and sewage sludge treatment and reuse.

    Science.gov (United States)

    Westrell, T; Schönning, C; Stenström, T A; Ashbolt, N J

    2004-01-01

    Hazard Analysis and Critical Control Points (HACCP) was applied for identifying and controlling exposure to pathogenic microorganisms encountered during normal sludge and wastewater handling at a 12,500 m3/d treatment plant utilising tertiary wastewater treatment and mesophilic sludge digestion. The hazardous scenarios considered were human exposure during treatment, handling, soil application and crop consumption, and exposure via water at the wetland-area and recreational swimming. A quantitative microbial risk assessment (QMRA), including rotavirus, adenovirus, haemorrhagic E. coli, Salmonella, Giardia and Cryptosporidium, was performed in order to prioritise pathogen hazards for control purposes. Human exposures were treated as individual risks but also related to the endemic situation in the general population. The highest individual health risk from a single exposure was via aerosols for workers at the belt press for sludge dewatering (virus infection risk = 1). The largest impact on the community would arise if children ingested sludge at the unprotected storage site, although in the worst-case situation the largest number of infections would arise through vegetables fertilised with sludge and eaten raw (not allowed in Sweden). Acceptable risk for various hazardous scenarios, treatment and/or reuse strategies could be tested in the model.

  1. Effect of ozonation on microbial fish pathogens, ammonia, nitrate, nitrite, and bod in simulated reuse hatchery water

    Energy Technology Data Exchange (ETDEWEB)

    Colberg, P.J.; Lingg, A.J.

    1978-10-01

    The effectiveness of ozone for eliminating fish pathogens and reducing nitrite, ammonia, and BOD associated with reuse hatchery systems was evaluated. Comparative survival rates of four bacterial fish pathogens and a bacterium-protozoan population during batch and continuous flow ozonation indicated a specific microbial ozone demand during batch treatment and 99% mortality of pathogens during continuous flow treatment. Oxidation of carbon and nitrite by ozone was rapid at low ozone concentrations; carbon and ammonia oxidation rates were pH dependent. The oxidation capacity of ozone in water was greatest at elevated pH even though lower ozone concentrations were used. Ozone treatment appears to be successful for disinfecting hatchery makeup water for recycling. However, the economics of such treatment are yet to be determined. (10 graphs, 28 references, 1 table)

  2. Distinct Trajectories of Massive Recent Gene Gains and Losses in Populations of a Microbial Eukaryotic Pathogen.

    Science.gov (United States)

    Hartmann, Fanny E; Croll, Daniel

    2017-11-01

    Differences in gene content are a significant source of variability within species and have an impact on phenotypic traits. However, little is known about the mechanisms responsible for the most recent gene gains and losses. We screened the genomes of 123 worldwide isolates of the major pathogen of wheat Zymoseptoria tritici for robust evidence of gene copy number variation. Based on orthology relationships in three closely related fungi, we identified 599 gene gains and 1,024 gene losses that have not yet reached fixation within the focal species. Our analyses of gene gains and losses segregating in populations showed that gene copy number variation arose preferentially in subtelomeres and in proximity to transposable elements. Recently lost genes were enriched in virulence factors and secondary metabolite gene clusters. In contrast, recently gained genes encoded mostly secreted protein lacking a conserved domain. We analyzed the frequency spectrum at loci segregating a gene presence-absence polymorphism in four worldwide populations. Recent gene losses showed a significant excess in low-frequency variants compared with genome-wide single nucleotide polymorphism, which is indicative of strong negative selection against gene losses. Recent gene gains were either under weak negative selection or neutral. We found evidence for strong divergent selection among populations at individual loci segregating a gene presence-absence polymorphism. Hence, gene gains and losses likely contributed to local adaptation. Our study shows that microbial eukaryotes harbor extensive copy number variation within populations and that functional differences among recently gained and lost genes led to distinct evolutionary trajectories. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Pathogenic characteristics of persistent feline enteric coronavirus infection in cats

    Science.gov (United States)

    Vogel, Liesbeth; Van der Lubben, Mariken; Te Lintelo, Eddie G.; Bekker, Cornelis P.J.; Geerts, Tamara; Schuijff, Leontine S.; Grinwis, Guy C.M.; Egberink, Herman F.; Rottier, Peter J.M.

    2010-01-01

    Feline coronaviruses (FCoV) comprise two biotypes: feline enteric coronaviruses (FECV) and feline infectious peritonitis viruses (FIPV). FECV is associated with asymptomatic persistent enteric infections, while FIPV causes feline infectious peritonitis (FIP), a usually fatal systemic disease in domestic cats and some wild Felidae. FIPV arises from FECV by mutation. FCoV also occur in two serotypes, I and II, of which the serotype I viruses are by far the most prevalent in the field. Yet, most of our knowledge about FCoV infections relates to serotype II viruses, particularly about the FIPV, mainly because type I viruses grow poorly in cell culture. Hence, the aim of the present work was the detailed study of the epidemiologically most relevant viruses, the avirulent serotype I viruses. Kittens were inoculated oronasally with different doses of two independent FECV field strains, UCD and RM. Persistent infection could be reproducibly established. The patterns of clinical symptoms, faecal virus shedding and seroconversion were monitored for up to 10 weeks revealing subtle but reproducible differences between the two viruses. Faecal virus, i.e. genomic RNA, was detected during persistent FECV infection only in the large intestine, downstream of the appendix, and could occasionally be observed also in the blood. The implications of our results, particularly our insights into the persistently infected state, are discussed. PMID:20663472

  4. Mechanistic investigation on microbial toxicity of nano hydroxyapatite on implant associated pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Baskar, K. [Department of Biotechnology, University of Madras, Guindy Campus, Chennai, Tamil Nadu (India); Anusuya, T. [Department of Nanotechnology, SRM University, Kattankulathur, Tamil Nadu (India); Devanand Venkatasubbu, G., E-mail: gdevanandvenkatasubbu@gmail.com [Department of Nanotechnology, SRM University, Kattankulathur, Tamil Nadu (India)

    2017-04-01

    The use of atomic scale inorganic nanoparticles (NPs) to fight against pathogenic microorganisms is a recent trend in biomedical area which overcomes the limitations of organic compounds in terms of stability, shelf life and bioactivity. One such Calcium phosphate based biomaterial is hydroxyapatite (HA), considered as potential bioactive compound with excellent biocompatibility, osteointegrity and biodegradability. Osteomyelitis, the implant associated infection, is the major problem worldwide responsible for the majority of implant failure cases. Since HA is used as a coating material of implants, only few reports were available on its antimicrobial activity and cytotoxicity whereas no reports on its possible antimicrobial mechanism. In this present study, the HA-NPs were synthesized by wet chemical precipitation and were characterized using X-ray diffraction (XRD), Transmission Electron Microscopy (TEM) and Fourier transform infrared spectroscopy (FTIR). The synthesized HA-NPs were evaluated for antimicrobial activity against implant associated bacterial pathogens. The study also explores the mechanistic action of HA-NPs in killing of bacteria by determining the reactive oxygen species (ROS) generation, DNA fragmentation, Lactate dehydrogenase (LDH) leakage and cellular interaction. In addition the cytotoxicity of HA-NPs was determined by MTT assay and Fluorescence Microscopic analysis. The results revealed that, the synthesized HA-NPs showed good antibacterial activity for tested bacterial species and the possible antibacterial mechanism were due to the lack of membrane integrity and cytotoxic studies shows the concentration dependent changes in cell viability. - Highlights: • Antibacterial activity against Gram − ve bacterium • Mechanism of antibacterial activity is analyzed. • DNA fragmentation, growth curve, LDH, ROS are analyzed. • The mechanism is by damaging cell membrane. • Hydroxyapatite is biocompatible.

  5. Mining Host-Pathogen Protein Interactions to Characterize Burkholderia mallei Infectivity Mechanisms

    Science.gov (United States)

    2015-03-04

    the cytoskeleton, in lysosomes , and in the nuclear lumen. These results were consistent with the experimentally observed pathogen interference with...RESEARCH ARTICLE Mining Host- Pathogen Protein Interactions to Characterize Burkholderia mallei Infectivity Mechanisms Vesna Memišević1, Nela...Bacteriology Division, U.S. Army Medical Research Institute of Infectious Diseases , Fort Detrick, Maryland, United States of America * jaques.reifman.civ

  6. Orientia, rickettsia, and leptospira pathogens as causes of CNS infections in Laos

    DEFF Research Database (Denmark)

    Dittrich, Sabine; Rattanavong, Sayaphet; Lee, Sue J

    2015-01-01

    BACKGROUND: Scrub typhus (caused by Orientia tsutsugamushi), murine typhus (caused by Rickettsia typhi), and leptospirosis are common causes of febrile illness in Asia; meningitis and meningoencephalitis are severe complications. However, scarce data exist for the burden of these pathogens......, Neisseria meningitidis, Haemophilus influenzae, S suis) and O tsutsugamushi, Rickettsia typhi/Rickettsia spp, and Leptospira spp infections in blood or cerebrospinal fluid (CSF). We analysed and compared causes and clinical and CSF characteristics between patient groups. FINDINGS: 1051 (95%) of 1112...... patients who presented had CSF available for analysis, of whom 254 (24%) had a CNS infection attributable to a bacterial or fungal pathogen. 90 (35%) of these 254 infections were caused by O tsutsugamushi, R typhi/Rickettsia spp, or Leptospira spp. These pathogens were significantly more frequent than...

  7. Innate scavenger receptor-A regulates adaptive T helper cell responses to pathogen infection

    Science.gov (United States)

    Xu, Zhipeng; Xu, Lei; Li, Wei; Jin, Xin; Song, Xian; Chen, Xiaojun; Zhu, Jifeng; Zhou, Sha; Li, Yong; Zhang, Weiwei; Dong, Xiaoxiao; Yang, Xiaowei; Liu, Feng; Bai, Hui; Chen, Qi; Su, Chuan

    2017-01-01

    The pattern recognition receptor (PRR) scavenger receptor class A (SR-A) has an important function in the pathogenesis of non-infectious diseases and in innate immune responses to pathogen infections. However, little is known about the role of SR-A in the host adaptive immune responses to pathogen infection. Here we show with mouse models of helminth Schistosoma japonicum infection and heat-inactivated Mycobacterium tuberculosis stimulation that SR-A is regulated by pathogens and suppresses IRF5 nuclear translocation by direct interaction. Reduced abundance of nuclear IRF5 shifts macrophage polarization from M1 towards M2, which subsequently switches T-helper responses from type 1 to type 2. Our study identifies a role for SR-A as an innate PRR in regulating adaptive immune responses. PMID:28695899

  8. Additional risk factors for infection by multidrug-resistant pathogens in healthcare-associated infection: a large cohort study

    Directory of Open Access Journals (Sweden)

    Cardoso Teresa

    2012-12-01

    Full Text Available Abstract Background There is a lack of consensus regarding the definition of risk factors for healthcare-associated infection (HCAI. The purpose of this study was to identify additional risk factors for HCAI, which are not included in the current definition of HCAI, associated with infection by multidrug-resistant (MDR pathogens, in all hospitalized infected patients from the community. Methods This 1-year prospective cohort study included all patients with infection admitted to a large, tertiary care, university hospital. Risk factors not included in the HCAI definition, and independently associated with MDR pathogen infection, namely MDR Gram-negative (MDR-GN and ESKAPE microorganisms (vancomycin-resistant Enterococcus faecium, methicillin-resistant Staphylococcus aureus, extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella species, carbapenem-hydrolyzing Klebsiella pneumonia and MDR Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter species, were identified by logistic regression among patients admitted from the community (either with community-acquired or HCAI. Results There were 1035 patients with infection, 718 from the community. Of these, 439 (61% had microbiologic documentation; 123 were MDR (28%. Among MDR: 104 (85% had MDR-GN and 41 (33% had an ESKAPE infection. Independent risk factors associated with MDR and MDR-GN infection were: age (adjusted odds ratio (OR = 1.7 and 1.5, p = 0.001 and p = 0.009, respectively, and hospitalization in the previous year (between 4 and 12 months previously (adjusted OR = 2.0 and 1,7, p = 0.008 and p = 0.048, respectively. Infection by pathogens from the ESKAPE group was independently associated with previous antibiotic therapy (adjusted OR = 7.2, p p = 0.003. Patients with infection by MDR, MDR-GN and pathogens from the ESKAPE group had significantly higher rates of inadequate antibiotic therapy than those without (46% vs 7%, 44% vs 10%, 61% vs 15%, respectively, p

  9. Interferon production and immune response induction in pathogenic rabies virus-infected mice

    Energy Technology Data Exchange (ETDEWEB)

    Marcovistz, R; Leal, E C; De Souza Matos, D C [Departamento de Immunologia, Instituto Oswaldo Cruz, Caixa Postal 926, 21045 Rio de Janeiro (Brazil); Tsiang, H [Service Rage, Istitut Pasteur, Paris (France)

    1994-08-01

    Pathogenic parental rabies virus strain CVS (challenge virus standard) and its apathogenic variant RV194-2 were shown to differ in their ability to induce interferon (IFN) and immune response of the host. After intracerebral inoculation. IFN and antibody production was higher in the RV194-2 virus-infected mice than in the CVS infection. The enhancement of 2-5A synthetase activity, an IFN-mediated enzyme marker, showed biochemical evidence that IFN is active in both apathogenic and pathogenic infections. On the other hand, spontaneous proliferation in vitro of thymocytes and splenocytes from CVS virus-infected mice was strongly inhibited in contrast to the RV194-2 infection. In the CVS infection, the thymocyte proliferation However, in the RV194-2 infection, the thymocyte proliferation was higher than of the splenocytes. These results suggest a better performance of T-cell response to the RV194-2 infection. This fact can be critical for an enhancement of antibody production in the apathogenic infection and subsequent virus clearance from the brain of RV194-2 virus-infected mice. (author) 1 fig., 3 tabs., 32 refs.

  10. Infection of an Insect Vector with a Bacterial Plant Pathogen Increases Its Propensity for Dispersal

    Science.gov (United States)

    Coy, Monique R.; Stelinski, Lukasz L.; Pelz-Stelinski, Kirsten S.

    2015-01-01

    The spread of vector-transmitted pathogens relies on complex interactions between host, vector and pathogen. In sessile plant pathosystems, the spread of a pathogen highly depends on the movement and mobility of the vector. However, questions remain as to whether and how pathogen-induced vector manipulations may affect the spread of a plant pathogen. Here we report for the first time that infection with a bacterial plant pathogen increases the probability of vector dispersal, and that such movement of vectors is likely manipulated by a bacterial plant pathogen. We investigated how Candidatus Liberibacter asiaticus (CLas) affects dispersal behavior, flight capacity, and the sexual attraction of its vector, the Asian citrus psyllid (Diaphorina citri Kuwayama). CLas is the putative causal agent of huanglongbing (HLB), which is a disease that threatens the viability of commercial citrus production worldwide. When D. citri developed on CLas-infected plants, short distance dispersal of male D. citri was greater compared to counterparts reared on uninfected plants. Flight by CLas-infected D. citri was initiated earlier and long flight events were more common than by uninfected psyllids, as measured by a flight mill apparatus. Additionally, CLas titers were higher among psyllids that performed long flights than psyllid that performed short flights. Finally, attractiveness of female D. citri that developed on infected plants to male conspecifics increased proportionally with increasing CLas bacterial titers measured within female psyllids. Our study indicates that the phytopathogen, CLas, may manipulate movement and mate selection behavior of their vectors, which is a possible evolved mechanism to promote their own spread. These results have global implications for both current HLB models of disease spread and control strategies. PMID:26083763

  11. Infection of an Insect Vector with a Bacterial Plant Pathogen Increases Its Propensity for Dispersal.

    Directory of Open Access Journals (Sweden)

    Xavier Martini

    Full Text Available The spread of vector-transmitted pathogens relies on complex interactions between host, vector and pathogen. In sessile plant pathosystems, the spread of a pathogen highly depends on the movement and mobility of the vector. However, questions remain as to whether and how pathogen-induced vector manipulations may affect the spread of a plant pathogen. Here we report for the first time that infection with a bacterial plant pathogen increases the probability of vector dispersal, and that such movement of vectors is likely manipulated by a bacterial plant pathogen. We investigated how Candidatus Liberibacter asiaticus (CLas affects dispersal behavior, flight capacity, and the sexual attraction of its vector, the Asian citrus psyllid (Diaphorina citri Kuwayama. CLas is the putative causal agent of huanglongbing (HLB, which is a disease that threatens the viability of commercial citrus production worldwide. When D. citri developed on CLas-infected plants, short distance dispersal of male D. citri was greater compared to counterparts reared on uninfected plants. Flight by CLas-infected D. citri was initiated earlier and long flight events were more common than by uninfected psyllids, as measured by a flight mill apparatus. Additionally, CLas titers were higher among psyllids that performed long flights than psyllid that performed short flights. Finally, attractiveness of female D. citri that developed on infected plants to male conspecifics increased proportionally with increasing CLas bacterial titers measured within female psyllids. Our study indicates that the phytopathogen, CLas, may manipulate movement and mate selection behavior of their vectors, which is a possible evolved mechanism to promote their own spread. These results have global implications for both current HLB models of disease spread and control strategies.

  12. Induced release of a plant-defense volatile 'deceptively' attracts insect vectors to plants infected with a bacterial pathogen.

    Directory of Open Access Journals (Sweden)

    Rajinder S Mann

    Full Text Available Transmission of plant pathogens by insect vectors is a complex biological process involving interactions between the plant, insect, and pathogen. Pathogen-induced plant responses can include changes in volatile and nonvolatile secondary metabolites as well as major plant nutrients. Experiments were conducted to understand how a plant pathogenic bacterium, Candidatus Liberibacter asiaticus (Las, affects host preference behavior of its psyllid (Diaphorina citri Kuwayama vector. D. citri were attracted to volatiles from pathogen-infected plants more than to those from non-infected counterparts. Las-infected plants were more attractive to D. citri adults than non-infected plants initially; however after feeding, psyllids subsequently dispersed to non-infected rather than infected plants as their preferred settling point. Experiments with Las-infected and non-infected plants under complete darkness yielded similar results to those recorded under light. The behavior of psyllids in response to infected versus non-infected plants was not influenced by whether or not they were carriers of the pathogen. Quantification of volatile release from non-infected and infected plants supported the hypothesis that odorants mediate psyllid preference. Significantly more methyl salicylate, yet less methyl anthranilate and D-limonene, was released by infected than non-infected plants. Methyl salicylate was attractive to psyllids, while methyl anthranilate did not affect their behavior. Feeding on citrus by D. citri adults also induced release of methyl salicylate, suggesting that it may be a cue revealing location of conspecifics on host plants. Infected plants were characterized by lower levels of nitrogen, phosphorus, sulfur, zinc, and iron, as well as, higher levels of potassium and boron than non-infected plants. Collectively, our results suggest that host selection behavior of D. citri may be modified by bacterial infection of plants, which alters release of

  13. Determination of Pathogens in Postoperative Wound Infection After Surgically Reduced Calcaneal Fractures and Implications for Prophylaxis and Treatment

    NARCIS (Netherlands)

    Backes, Manouk; Spijkerman, Ingrid J.; de Muinck-Keizer, Robert-Jan O.; Goslings, J. Carel; Schepers, Tim

    2018-01-01

    High rates of postoperative wound infection (POWI) have been reported after surgery for calcaneal fractures. This is a retrospective cohort study to determine the causative pathogens of these infections and subsequent treatment strategies. In addition, microbacterial growth from superficial wound

  14. Highly pathogenic avian influenza virus (H5N1) in experimentally infected adult mute swans.

    Science.gov (United States)

    Kalthoff, Donata; Breithaupt, Angele; Teifke, Jens P; Globig, Anja; Harder, Timm; Mettenleiter, Thomas C; Beer, Martin

    2008-08-01

    Adult, healthy mute swans were experimentally infected with highly pathogenic avian influenza virus A/Cygnus cygnus/Germany/R65/2006 subtype H5N1. Immunologically naive birds died, whereas animals with preexisting, naturally acquired avian influenza virus-specific antibodies became infected asymptomatically and shed virus. Adult mute swans are highly susceptible, excrete virus, and can be clinically protected by preexposure immunity.

  15. Rapid qualitative urinary tract infection pathogen identification by SeptiFast real-time PCR.

    Directory of Open Access Journals (Sweden)

    Lutz E Lehmann

    2011-02-01

    Full Text Available Urinary tract infections (UTI are frequent in outpatients. Fast pathogen identification is mandatory for shortening the time of discomfort and preventing serious complications. Urine culture needs up to 48 hours until pathogen identification. Consequently, the initial antibiotic regimen is empirical.To evaluate the feasibility of qualitative urine pathogen identification by a commercially available real-time PCR blood pathogen test (SeptiFast® and to compare the results with dipslide and microbiological culture.Pilot study with prospectively collected urine samples.University hospital.82 prospectively collected urine samples from 81 patients with suspected UTI were included. Dipslide urine culture was followed by microbiological pathogen identification in dipslide positive samples. In parallel, qualitative DNA based pathogen identification (SeptiFast® was performed in all samples.61 samples were SeptiFast® positive, whereas 67 samples were dipslide culture positive. The inter-methodological concordance of positive and negative findings in the gram+, gram- and fungi sector was 371/410 (90%, 477/492 (97% and 238/246 (97%, respectively. Sensitivity and specificity of the SeptiFast® test for the detection of an infection was 0.82 and 0.60, respectively. SeptiFast® pathogen identifications were available at least 43 hours prior to culture results.The SeptiFast® platform identified bacterial DNA in urine specimens considerably faster compared to conventional culture. For UTI diagnosis sensitivity and specificity is limited by its present qualitative setup which does not allow pathogen quantification. Future quantitative assays may hold promise for PCR based UTI pathogen identification as a supplementation of conventional culture methods.

  16. Determinants of Infectivity of Pathogens in Vector Ticks

    Science.gov (United States)

    1990-11-15

    of group 1. Perhaps with i’,creased age , group 2 nymphs developed a systemic infection. We plan to follow group 1 as it ages , to see if this might be...may facilitate the formation of the unusual forms of Borrelia that we observed. The large swollen forms have been seen in spirochetes in aged cultures...Helminthol. 40:337-342. Lees, A.D. (1948). The sensory phisiology of the sheep Ixodes ricinus L. J. Exp. Biol. 25:145-207. Lemaux, P.G., Herendeen, S.L

  17. Effects of Mycotoxins on Mucosal Microbial Infection and Related Pathogenesis

    Science.gov (United States)

    Park, Seong-Hwan; Kim, Dongwook; Kim, Juil; Moon, Yuseok

    2015-01-01

    Mycotoxins are fungal secondary metabolites detected in many agricultural commodities and water-damaged indoor environments. Susceptibility to mucosal infectious diseases is closely associated with immune dysfunction caused by mycotoxin exposure in humans and other animals. Many mycotoxins suppress immune function by decreasing the proliferation of activated lymphocytes, impairing phagocytic function of macrophages, and suppressing cytokine production, but some induce hypersensitive responses in different dose regimes. The present review describes various mycotoxin responses to infectious pathogens that trigger mucosa-associated diseases in the gastrointestinal and respiratory tracts of humans and other animals. In particular, it focuses on the effects of mycotoxin exposure on invasion, pathogen clearance, the production of cytokines and immunoglobulins, and the prognostic implications of interactions between infectious pathogens and mycotoxin exposure. PMID:26529017

  18. Evolution of Drosophila resistance against different pathogens and infection routes entails no detectable maintenance costs.

    Science.gov (United States)

    Faria, Vítor G; Martins, Nelson E; Paulo, Tânia; Teixeira, Luís; Sucena, Élio; Magalhães, Sara

    2015-11-01

    Pathogens exert a strong selective pressure on hosts, entailing host adaptation to infection. This adaptation often affects negatively other fitness-related traits. Such trade-offs may underlie the maintenance of genetic diversity for pathogen resistance. Trade-offs can be tested with experimental evolution of host populations adapting to parasites, using two approaches: (1) measuring changes in immunocompetence in relaxed-selection lines and (2) comparing life-history traits of evolved and control lines in pathogen-free environments. Here, we used both approaches to examine trade-offs in Drosophila melanogaster populations evolving for over 30 generations under infection with Drosophila C Virus or the bacterium Pseudomonas entomophila, the latter through different routes. We find that resistance is maintained after up to 30 generations of relaxed selection. Moreover, no differences in several classical life-history traits between control and evolved populations were found in pathogen-free environments, even under stresses such as desiccation, nutrient limitation, and high densities. Hence, we did not detect any maintenance costs associated with resistance to pathogens. We hypothesize that extremely high selection pressures commonly used lead to the disproportionate expression of costs relative to their actual occurrence in natural systems. Still, the maintenance of genetic variation for pathogen resistance calls for an explanation. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.

  19. Utilizing Bacillus to inhibit the growth and infection by sheath blight pathogen, Rhizoctoniasolani in rice

    Science.gov (United States)

    Margani, R.; Hadiwiyono; Widadi, S.

    2018-03-01

    Rhizoctonia solani Kuhn is a common pathogen of rice. The pathogen causes sheath blight of rice. The pathogen can cause loss in the production of rice up to 45%. So far, the disease however is still poorly taken care of by the farmers and researchers, so the control measures is nearly never practiced by the farmers in the fields. It due to the unavailability of effective control method of the disease. Therefore, development to control the disease is important. Bacillus is one of popular bacteria which is effective as biological control agent of a lot of pathogens in plants, but it has not been used for control sheath blight in rice yet. The current researches were aimed to study the potential of Bacillus collected from healthy rice as candidates of biological control agent of the disease. The results showed that some isolates showed indications to inhibit significantly the growth and infection of the pathogen. We obtained at least five isolates of Bacillus collected from leaves, sheath, and stem of healthy rice fields. All of the isolates could effectively inhibit the growth of R. solani in vitro on potato dextrose medium at range 30.33-58.00%, whereas in vivo B05 isolate was the most effective in inhibiting the infection of pathogen at 30.43%. It was not significantly different (P≥0.05) to application of hexaconazol with dosage of 2 ml L-1.

  20. Pathogenicity of Highly Pathogenic Avian Influenza Virus H5N1 in Naturally Infected Poultry in Egypt.

    Directory of Open Access Journals (Sweden)

    Ibrahim Thabet Hagag

    Full Text Available Highly pathogenic avian influenza virus (HPAIV H5N1 has been endemic in Egypt since 2006, and there is increasing concern for its potential to become highly transmissible among humans. Infection by HPAIV H5N1 has been described in experimentally challenged birds. However, the pathogenicity of the H5N1 isolated in Egypt has never been reported in naturally infected chickens and ducks. Here we report a 2013 outbreak of HPAIV H5N1 in commercial poultry farms and backyards in Sharkia Province, Egypt. The main symptoms were ecchymosis on the shanks and feet, cyanosis of the comb and wattles, subcutaneous edema of the head and neck for chickens, and nervous signs (torticollis for ducks. Within 48-72 hrs of the onset of illness, the average mortality rates were 22.8-30% and 28.5-40% in vaccinated chickens and non-vaccinated ducks, respectively. Tissue samples of chickens and ducks were collected for analyses with cross-section immunohistochemistry and real-time RT-PCR for specific viral RNA transcripts. While viral RNA was detected in nearly all tissues and sera collected, viral nucleoprotein was detected almost ubiquitously in all tissues, including testis. Interestingly, viral antigen was also observed in endothelial cells of most organs in chickens, and clearly detected in the trachea and brain in particular. Viral nucleoprotein was also detected in mononuclear cells of various organs, especially pulmonary tissue. We performed phylogenetic analyses and compared the genomic sequences of the hemagglutinin (HA and nonstructural proteins (NS among the isolated viruses, the HPAIV circulated in Egypt in the past and currently, and some available vaccine strains. Further analysis of deduced amino acids of both HA and NS1 revealed that our isolates carried molecular determinants of HPAIV, including the multibasic amino acids (PQGERRRK/KR*GLF in the cleavage site in HA and glutamate at position 92 (D92E in NS1. This is the first report of the pathogenicity

  1. Quantification of pathogenic microorganisms and microbial indicators in three wastewater reclamation and managed aquifer recharge facilities in Europe.

    Science.gov (United States)

    Levantesi, Caterina; La Mantia, Rosanna; Masciopinto, Costantino; Böckelmann, Uta; Ayuso-Gabella, M Neus; Salgot, Miquel; Tandoi, Valter; Van Houtte, Emmanuel; Wintgens, Thomas; Grohmann, Elisabeth

    2010-10-01

    Managed Aquifer Recharge (MAR) is becoming an attractive option for water storage in water reuse processes as it provides an additional treatment barrier to improve recharged water quality and buffers seasonal variations of water supply and demand. To achieve a better understanding about the level of pathogenic microorganisms and their relation with microbial indicators in these systems, five waterborne pathogens and four microbial indicators were monitored over one year in three European MAR sites operated with reclaimed wastewater. Giardia and Cryptosporidium (oo)cysts were found in 63.2 and 36.7% of the samples respectively. Salmonella spp. and helminth eggs were more rarely detected (16.3% and 12.5% of the samples respectively) and Campylobacter cells were only found in 2% of samples. At the Belgian site advanced tertiary treatment technology prior to soil aquifer treatment (SAT) produced effluent of drinking water quality, with no presence of the analysed pathogens. At the Spanish and Italian sites amelioration of microbiological water quality was observed between the MAR injectant and the recovered water. In particular Giardia levels decreased from 0.24-6.14 cysts/L to 0-0.01 cysts/L and from 0.4-6.2 cysts/L to 0-0.07 cysts/L in the Spanish and Italian sites respectively. Salmonella gene copies and Giardia cysts were however found in the water for final use and/or the recovered groundwater water at the two sites. Significant positive Spearman correlations (p<0.05, r(s) range: 0.45-0.95) were obtained, in all the three sites, between Giardia cysts and the most resistant microbial markers, Clostridium spores and bacteriophages. Copyright 2010 Elsevier B.V. All rights reserved.

  2. Phage inhibit pathogen dissemination by targeting bacterial migrants in a chronic infection model

    DEFF Research Database (Denmark)

    Darch, Sophie E.; Kragh, Kasper N.; Abbott, Evelyn A.

    2017-01-01

    The microbial communities inhabiting chronic infections are often composed of spatially organized micrometer-sized, highly dense aggregates. It has recently been hypothesized that aggregates are responsible for the high tolerance of chronic infections to host immune functions and antimicrobial...... production; however, seeding of new aggregates by dispersed migrants was inhibited. We propose a model in which aggregates provide a mechanism that allows P. aeruginosa to tolerate phage therapy during chronic infection without the need for genetic mutation. IMPORTANCE Bacteria in chronic infections often...... reside in communities composed of micrometer-sized, highly dense aggregates. A primary challenge for studying aggregates has been the lack of laboratory systems that promote natural aggregate formation in relevant environments. Here, we developed a growth medium that mimics chronic lung infection...

  3. Infectivity, transmission and pathogenicity of avian influenza viruses for domestic and wild birds

    Science.gov (United States)

    Individual avian influenza (AI) virus strains vary in their ability to infect, transmit and cause disease and death in different bird species. Low pathogenicity AI (LPAI) viruses are maintained in wild birds, and must be adapted to pass to domestic poultry, where they replicate in respiratory and in...

  4. Infectivity and pathogenicity of Cryptosporidium andersoni to a novel host, southern multimammate mouse (Mastomys coucha)

    Czech Academy of Sciences Publication Activity Database

    Kváč, Martin; Ondráčková, Z.; Květoňová, Dana; Sak, Bohumil; Vítovec, J.

    2007-01-01

    Roč. 143, 3/4 (2007), s. 229-233 ISSN 0304-4017 R&D Projects: GA ČR GA524/05/0992 Institutional research plan: CEZ:AV0Z60220518 Keywords : Cryptosporidium andersoni * Mastomys coucha * infectivity * pathogenicity * 18S rRNA gene Subject RIV: EG - Zoology Impact factor: 2.016, year: 2007

  5. Dissemination of a highly virulent pathogen: tracking the early events that define infection.

    Directory of Open Access Journals (Sweden)

    Rodrigo J Gonzalez

    2015-01-01

    Full Text Available The series of events that occurs immediately after pathogen entrance into the body is largely speculative. Key aspects of these events are pathogen dissemination and pathogen interactions with the immune response as the invader moves into deeper tissues. We sought to define major events that occur early during infection of a highly virulent pathogen. To this end, we tracked early dissemination of Yersinia pestis, a highly pathogenic bacterium that causes bubonic plague in mammals. Specifically, we addressed two fundamental questions: (1 do the bacteria encounter barriers in disseminating to draining lymph nodes (LN, and (2 what mechanism does this nonmotile bacterium use to reach the LN compartment, as the prevailing model predicts trafficking in association with host cells. Infection was followed through microscopy imaging in addition to assessing bacterial population dynamics during dissemination from the skin. We found and characterized an unexpected bottleneck that severely restricts bacterial dissemination to LNs. The bacteria that do not pass through this bottleneck are confined to the skin, where large numbers of neutrophils arrive and efficiently control bacterial proliferation. Notably, bottleneck formation is route dependent, as it is abrogated after subcutaneous inoculation. Using a combination of approaches, including microscopy imaging, we tested the prevailing model of bacterial dissemination from the skin into LNs and found no evidence of involvement of migrating phagocytes in dissemination. Thus, early stages of infection are defined by a bottleneck that restricts bacterial dissemination and by neutrophil-dependent control of bacterial proliferation in the skin. Furthermore, and as opposed to current models, our data indicate an intracellular stage is not required by Y. pestis to disseminate from the skin to draining LNs. Because our findings address events that occur during early encounters of pathogen with the immune response

  6. Microbial Indicators, Pathogens, and Antibiotic Resistance in Groundwater Impacted by Animal Farming: Field Scale to Basin Scale

    Science.gov (United States)

    Harter, T.; Li, X.; Atwill, E. R.; Packman, A. I.

    2015-12-01

    Several surveys of microbial indicators and pathogens were conducted to determine the impact of confined animal farming operations (CAFOs) on shallow, local, and regional groundwater quality in the Central Valley aquifer system, California. The aquifer system consists of highly heterogeneous, alluvial, unconsolidated coarse- to fine-grained sediments and is among the largest aquifers in the U.S.. Overlying landuse includes 3 million ha of irrigated agriculture and 1.7 million mature dairy cows in nearly 1,500 CAFOs. A multi-scale survey of water-borne indicator pathogens (Enterococcus spp. and generic E. coli) and of three water-borne pathogens (Campylobacter, Salmonella, and E. coli O157:H7) was conducted at five different spatial scales, increasing with distance from animal sources of these enteric microbial organisms: moist surfaces within individual CAFO sub-systems (calf-hutches, heifer corrals, mature cow stalls, hospital barn etc.), first encountered (shallow) groundwater immediately below these sub-systems, production aquifer below CAFOs, production aquifer near CAFOs, and production aquifer away from CAFOs. Where found, indicator pathogens were tested for antibiotic resistance. Hundreds of samples were collected at each scale: continuously during irrigation events and seasonally over a multi-year period at the three smaller site-scales; and in a one-time survey at the two larger, regional scales. All three pathogens were frequently detected in moist surface samples across CAFO sub-systems, albeit at concentrations several orders of magnitude lower than enteric indicators. Two of the three pathogens (but not Campylobacter) were also detected in first encountered groundwater, at 3-9 m below ground surface, in 1% of samples. No pathogens were found at the production aquifer scales. Generic E. coli was detected in ¼ of first encountered groundwater samples, and in 4% of production aquifer samples, while Enterococcus spp. was ubiquitously present across the

  7. The microbiology of oral lichen planus: Is microbial infection the cause of oral lichen planus?

    Science.gov (United States)

    Baek, K; Choi, Y

    2018-02-01

    Oral lichen planus (OLP) is a variant of lichen planus (LP), a common chronic mucocutaneous inflammatory disease. Cutaneous lesions of LP are self-limiting, but OLP lesions are non-remissive, alternating periods of exacerbation and quiescence, and only symptomatic treatments exist for OLP. The precise etiology and pathogenesis of OLP are hardly understood, which is a major obstacle to the development of new therapeutics for this disease. OLP is considered a T-cell-mediated inflammatory disease. Although various antigens have been considered, what actually triggers the inflammatory response of T cells is unknown. Suggested predisposing factors include genetic factors, stress, trauma, and infection. The aim of this review was to determine whether microbial infection can cause OLP. We first reviewed the association between OLP and microbial factors, including viral, fungal, and bacterial infections. In addition, each microbial factor associated with OLP was assessed by modified guidelines of Fredricks and Relman to determine whether it establishes a causal relationship. In conclusion, no microbial factor yet fulfills the guidelines to establish the causality of OLP. By focusing on the unclarified issues, however, the potential roles of microbial factors in the pathogenesis of OLP will be soon elucidated. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Epidemiology of pathogen-specific respiratory infections among three US populations.

    Directory of Open Access Journals (Sweden)

    Jennifer M Radin

    Full Text Available Diagnostic tests for respiratory infections can be costly and time-consuming. Improved characterization of specific respiratory pathogens by identifying frequent signs, symptoms and demographic characteristics, along with improving our understanding of coinfection rates and seasonality, may improve treatment and prevention measures.Febrile respiratory illness (FRI and severe acute respiratory infection (SARI surveillance was conducted from October 2011 through March 2013 among three US populations: civilians near the US-Mexico border, Department of Defense (DoD beneficiaries, and military recruits. Clinical and demographic questionnaire data and respiratory swabs were collected from participants, tested by PCR for nine different respiratory pathogens and summarized. Age stratified characteristics of civilians positive for influenza and recruits positive for rhinovirus were compared to other and no/unknown pathogen. Seasonality and coinfection rates were also described.A total of 1444 patients met the FRI or SARI case definition and were enrolled in this study. Influenza signs and symptoms varied across age groups of civilians. Recruits with rhinovirus had higher percentages of pneumonia, cough, shortness of breath, congestion, cough, less fever and longer time to seeking care and were more likely to be male compared to those in the no/unknown pathogen group. Coinfections were found in 6% of all FRI/SARI cases tested and were most frequently seen among children and with rhinovirus infections. Clear seasonal trends were identified for influenza, rhinovirus, and respiratory syncytial virus.The age-stratified clinical characteristics associated with influenza suggest that age-specific case definitions may improve influenza surveillance and identification. Improving identification of rhinoviruses, the most frequent respiratory infection among recruits, may be useful for separating out contagious individuals, especially when larger outbreaks occur

  9. Infections and Coinfections of Questing Ixodes ricinus Ticks by Emerging Zoonotic Pathogens in Western Switzerland

    Science.gov (United States)

    Lommano, Elena; Bertaiola, Luce; Dupasquier, Christèle

    2012-01-01

    In Europe, Ixodes ricinus is the vector of many pathogens of medical and veterinary relevance, among them Borrelia burgdorferi sensu lato and tick-borne encephalitis virus, which have been the subject of numerous investigations. Less is known about the occurrence of emerging tick-borne pathogens like Rickettsia spp., Babesia spp., “Candidatus Neoehrlichia mikurensis,” and Anaplasma phagocytophilum in questing ticks. In this study, questing nymph and adult I. ricinus ticks were collected at 11 sites located in Western Switzerland. A total of 1,476 ticks were analyzed individually for the simultaneous presence of B. burgdorferi sensu lato, Rickettsia spp., Babesia spp., “Candidatus Neoehrlichia mikurensis,” and A. phagocytophilum. B. burgdorferi sensu lato, Rickettsia spp., and “Candidatus Neoehrlichia mikurensis” were detected in ticks at all sites with global prevalences of 22.5%, 10.2%, and 6.4%, respectively. Babesia- and A. phagocytophilum-infected ticks showed a more restricted geographic distribution, and their prevalences were lower (1.9% and 1.5%, respectively). Species rarely reported in Switzerland, like Borrelia spielmanii, Borrelia lusitaniae, and Rickettsia monacensis, were identified. Infections with more than one pathogenic species, involving mostly Borrelia spp. and Rickettsia helvetica, were detected in 19.6% of infected ticks. Globally, 34.2% of ticks were infected with at least one pathogen. The diversity of tick-borne pathogens detected in I. ricinus in this study and the frequency of coinfections underline the need to take them seriously into consideration when evaluating the risks of infection following a tick bite. PMID:22522688

  10. Infectious tenosynovitis with bloodstream infection caused by Erysipelothrix rhusiopathiae, a case report on an occupational pathogen.

    Science.gov (United States)

    Hofseth, Kristine; Dalen, Håvard; Kibsgaard, Leif; Nebb, Solrun; Kümmel, Angela; Mehl, Arne

    2017-01-05

    Erysipelothrix rhusiopathiae is an established animal pathogen, which may cause infections in humans. It is a gram-positive rod and found in the tonsils or the digestive tracts of animals. The bacterium is occupationally related, as usually only people with frequent animal contacts are infected. We report a case of a patient who was admitted with an infectious tenosynovitis with bloodstream infection due to E. rhusiopathiae, and to our knowledge, this is the first report of a tenosynovitis with systemic manifestation associated with this bacterium. A 52-year old Norwegian man, who worked with transportation of swine cadavers, was admitted to the local hospital with sepsis and unknown focus of infection. A few days earlier he had an injury to the skin of one of his fingers that later proved to be infected with E. rhusiopathiae. There were no other causes for his symptoms than the infectious tenosynovitis with systemic manifestation. The infection resolved on treatment with antibiotics and surgery. A transoesophageal echocardiogram was performed to exclude endocarditis, which may be associated with this pathogen. This case report highlights the importance of clinicians being aware of this bacterium, and we describe risk factors for infection, differences in the clinical manifestations of the disease, challenges with diagnosing the bacterium and adverse effects of immunosuppressive drugs. Recommended treatment is appropriate antibiotic therapy and adequate debridement and surgical drainage of the tendon sheath.

  11. Are pathogenic bacteria just looking for food? Metabolism and microbial pathogenesis

    Science.gov (United States)

    Rohmer, Laurence; Hocquet, Didier; Miller, Samuel I.

    2011-01-01

    It is interesting to speculate that the evolutionary drive of microbes to develop pathogenic characteristics was to access the nutrient resources that animals provided. Environments in animals that pathogens colonize have also driven the evolution of new bacterial characteristics to maximize these new nutritional opportunities. This review focuses on genomic and functional aspects of pathogen metabolism that allow efficient utilization of nutrient resources provided by animals. Similar to genes encoding specific virulence traits, some genes encoding metabolic functions have been horizontally acquired by pathogens to provide a selective advantage in host tissues. Selective advantage in host tissues can also be gained in some circumstances by loss of function due to mutations that alter metabolic capabilities. Greater understanding of bacterial metabolism within host tissues should be important for increased understanding of host-pathogen interactions and the development of future therapeutic strategies. PMID:21600774

  12. Deep sequencing-based transcriptome analysis of chicken spleen in response to avian pathogenic Escherichia coli (APEC infection.

    Directory of Open Access Journals (Sweden)

    Qinghua Nie

    Full Text Available Avian pathogenic Escherichia coli (APEC leads to economic losses in poultry production and is also a threat to human health. The goal of this study was to characterize the chicken spleen transcriptome and to identify candidate genes for response and resistance to APEC infection using Solexa sequencing. We obtained 14422935, 14104324, and 14954692 Solexa read pairs for non-challenged (NC, challenged-mild pathology (MD, and challenged-severe pathology (SV, respectively. A total of 148197 contigs and 98461 unigenes were assembled, of which 134949 contigs and 91890 unigenes match the chicken genome. In total, 12272 annotated unigenes take part in biological processes (11664, cellular components (11927, and molecular functions (11963. Summing three specific contrasts, 13650 significantly differentially expressed unigenes were found in NC Vs. MD (6844, NC Vs. SV (7764, and MD Vs. SV (2320. Some unigenes (e.g. CD148, CD45 and LCK were involved in crucial pathways, such as the T cell receptor (TCR signaling pathway and microbial metabolism in diverse environments. This study facilitates understanding of the genetic architecture of the chicken spleen transcriptome, and has identified candidate genes for host response to APEC infection.

  13. A teleost CD46 is involved in the regulation of complement activation and pathogen infection.

    Science.gov (United States)

    Li, Mo-Fei; Sui, Zhi-Hai; Sun, Li

    2017-11-03

    In mammals, CD46 is involved in the inactivation of complement by factor I (FI). In teleost, study on the function of CD46 is very limited. In this study, we examined the immunological property of a CD46 molecule (CsCD46) from tongue sole, a teleost species with important economic value. We found that recombinant CsCD46 (rCsCD46) interacted with FI and inhibited complement activation in an FI-dependent manner. rCsCD46 also interacted with bacterial pathogens via a different mechanism to that responsible for the FI interaction, involving different rCsCD46 sites. Cellular study showed that CsCD46 was expressed on peripheral blood leukocytes (PBL) and protected the cells against the killing effect of complement. When the CsCD46 on PBL was blocked by antibody before incubation of the cells with bacterial pathogens, cellular infection was significantly reduced. Consistently, when tongue sole were infected with bacterial pathogens in the presence of rCsCD46, tissue dissemination and survival of the pathogens were significantly inhibited. These results provide the first evidence to indicate that CD46 in teleosts negatively regulates complement activation via FI and protects host cells from complement-induced damage, and that CD46 is required for optimal bacterial infection probably by serving as a receptor for the bacteria.

  14. [Cefazolin efficacy and antibiotic sensitivity against pathogenic bacteria in pediatric with acute upper urinary tract infection].

    Science.gov (United States)

    Fuke, Toshiya; Abe, Yoshifusa; Hoshino, Akihiro; Oto, Hideyasu; Sakai, Naho; Murayama, Junichiro; Yoshida, Koichiro; Itabashi, Kazuo

    2010-05-01

    Acute upper urinary tract infection may cause sepsis, especially in neonates and infants, mandating the choice of appropriate, effective antibacterials minimizing increasing bacterial resistance. Frequently prescribing broad-spectrum cephalosporinin is one such example. Different antibacterial therapies are initiated clinically due to treatment protocol differences among institutions, disease severity, etc. We studied the efficacy of cefazolin (CEZ), a first-generation cephalosporin, as first-line parenteral treatment in acute upper urinary tract infection. We found that 88.9% of microbial infections have indications for CEZ. CEZ efficacy is 91.3%, and 97.2% of urine cultures show negative results. Escherichia coli sensitivity to antibacterial agents is 90.9% of the minimal inhibitory concentration (MIC) pediatric therapy in acute upper urinary tract infection.

  15. Effect of Probiotic Bacteria on Microbial Host Defense, Growth, and Immune Function in Human Immunodeficiency Virus Type-1 Infection

    Directory of Open Access Journals (Sweden)

    Stig Bengmark

    2011-12-01

    Full Text Available The hypothesis that probiotic administration protects the gut surface and could delay progression of Human Immunodeficiency Virus type1 (HIV-1 infection to the Acquired Immunodeficiency Syndrome (AIDS was proposed in 1995. Over the last five years, new studies have clarified the significance of HIV-1 infection of the gut associated lymphoid tissue (GALT for subsequent alterations in the microflora and breakdown of the gut mucosal barrier leading to pathogenesis and development of AIDS. Current studies show that loss of gut CD4+ Th17 cells, which differentiate in response to normal microflora, occurs early in HIV-1 disease. Microbial translocation and suppression of the T regulatory (Treg cell response is associated with chronic immune activation and inflammation. Combinations of probiotic bacteria which upregulate Treg activation have shown promise in suppressing pro inflammatory immune response in models of autoimmunity including inflammatory bowel disease and provide a rationale for use of probiotics in HIV-1/AIDS. Disturbance of the microbiota early in HIV-1 infection leads to greater dominance of potential pathogens, reducing levels of bifidobacteria and lactobacillus species and increasing mucosal inflammation. The interaction of chronic or recurrent infections, and immune activation contributes to nutritional deficiencies that have lasting consequences especially in the HIV-1 infected child. While effective anti-retroviral therapy (ART has enhanced survival, wasting is still an independent predictor of survival and a major presenting symptom. Congenital exposure to HIV-1 is a risk factor for growth delay in both infected and non-infected infants. Nutritional intervention after 6 months of age appears to be largely ineffective. A meta analysis of randomized, controlled clinical trials of infant formulae supplemented with Bifidobacterium lactis showed that weight gain was significantly greater in infants who received B. lactis compared to

  16. Evaluation of methyl bromide alternatives efficacy against soil-borne pathogens, nematodes and soil microbial community.

    Directory of Open Access Journals (Sweden)

    Hongwei Xie

    Full Text Available Methyl bromide (MB and other alternatives were evaluated for suppression of Fusarium spp., Phytophthora spp., and Meloidogyne spp. and their influence on soil microbial communities. Both Fusarium spp. and Phytophthora spp. were significantly reduced by the MB (30.74 mg kg-1, methyl iodide (MI: 45.58 mg kg-1, metham sodium (MS: 53.92 mg kg-1 treatments. MS exhibited comparable effectiveness to MB in controlling Meloidogyne spp. and total nematodes, followed by MI at the tested rate. By contrast, sulfuryl fluoride (SF: 33.04 mg kg-1 and chloroform (CF: 23.68 mg kg-1 showed low efficacy in controlling Fusarium spp., Phytophthora spp., and Meloidogyne spp. MB, MI and MS significantly lowered the abundance of different microbial populations and microbial biomass in soil, whereas SF and CF had limited influence on them compared with the control. Diversity indices in Biolog studies decreased in response to fumigation, but no significant difference was found among treatments in PLFA studies. Principal component and cluster analyses of Biolog and PLFA data sets revealed that MB and MI treatments greatly influenced the soil microbial community functional and structural diversity compared with SF treatment. These results suggest that fumigants with high effectiveness in suppressing soil-borne disease could significantly influence soil microbial community.

  17. Animals devoid of pulmonary system as infection models in the study of lung bacterial pathogens

    Science.gov (United States)

    López Hernández, Yamilé; Yero, Daniel; Pinos-Rodríguez, Juan M.; Gibert, Isidre

    2015-01-01

    Biological disease models can be difficult and costly to develop and use on a routine basis. Particularly, in vivo lung infection models performed to study lung pathologies use to be laborious, demand a great time and commonly are associated with ethical issues. When infections in experimental animals are used, they need to be refined, defined, and validated for their intended purpose. Therefore, alternative and easy to handle models of experimental infections are still needed to test the virulence of bacterial lung pathogens. Because non-mammalian models have less ethical and cost constraints as a subjects for experimentation, in some cases would be appropriated to include these models as valuable tools to explore host–pathogen interactions. Numerous scientific data have been argued to the more extensive use of several kinds of alternative models, such as, the vertebrate zebrafish (Danio rerio), and non-vertebrate insects and nematodes (e.g., Caenorhabditis elegans) in the study of diverse infectious agents that affect humans. Here, we review the use of these vertebrate and non-vertebrate models in the study of bacterial agents, which are considered the principal causes of lung injury. Curiously none of these animals have a respiratory system as in air-breathing vertebrates, where respiration takes place in lungs. Despite this fact, with the present review we sought to provide elements in favor of the use of these alternative animal models of infection to reveal the molecular signatures of host–pathogen interactions. PMID:25699030

  18. Reduction in infection risk through treatment of microbially contaminated surfaces with a novel, portable, saturated steam vapor disinfection system.

    Science.gov (United States)

    Tanner, Benjamin D

    2009-02-01

    Surface-mediated infectious disease transmission is a major concern in various settings, including schools, hospitals, and food-processing facilities. Chemical disinfectants are frequently used to reduce contamination, but many pose significant risks to humans, surfaces, and the environment, and all must be properly applied in strict accordance with label instructions to be effective. This study set out to determine the capability of a novel chemical-free, saturated steam vapor disinfection system to kill microorganisms, reduce surface-mediated infection risks, and serve as an alternative to chemical disinfectants. High concentrations of Escherichia coli, Shigella flexneri, vancomycin-resistant Enterococcus faecalis (VRE), methicillin-resistant Staphylococcus aureus (MRSA), Salmonella enterica, methicillin-sensitive Staphylococcus aureus, MS2 coliphage (used as a surrogate for nonenveloped viruses including norovirus), Candida albicans, Aspergillus niger, and the endospores of Clostridium difficile were dried individually onto porous clay test surfaces. Surfaces were treated with the saturated steam vapor disinfection system for brief periods and then numbers of surviving microorganisms were determined. Infection risks were calculated from the kill-time data using microbial dose-response relationships published in the scientific literature, accounting for surface-to-hand and hand-to-mouth transfer efficiencies. A diverse assortment of pathogenic microorganisms was rapidly killed by the steam disinfection system; all of the pathogens tested were completely inactivated within 5 seconds. Risks of infection from the contaminated surfaces decreased rapidly with increasing periods of treatment by the saturated steam vapor disinfection system. The saturated steam vapor disinfection system tested for this study is chemical-free, broadly active, rapidly efficacious, and therefore represents a novel alternative to liquid chemical disinfectants.

  19. Evidence of an increased pathogenic footprint in the lingual microbiome of untreated HIV infected patients

    Directory of Open Access Journals (Sweden)

    Dang Angeline T

    2012-07-01

    Full Text Available Abstract Background Opportunistic oral infections can be found in over 80% of HIV + patients, often causing debilitating lesions that also contribute to deterioration in nutritional health. Although appreciation for the role that the microbiota is likely to play in the initiation and/or enhancement of oral infections has grown considerably in recent years, little is known about the impact of HIV infection on host-microbe interactions within the oral cavity. In the current study, we characterize modulations in the bacterial composition of the lingual microbiome in patients with treated and untreated HIV infection. Bacterial species profiles were elucidated by microarray assay and compared between untreated HIV infected patients, HIV infected patients receiving antiretroviral therapy, and healthy HIV negative controls. The relationship between clinical parameters (viral burden and CD4+ T cell depletion and the loss or gain of bacterial species was evaluated in each HIV patient group. Results In untreated HIV infection, elevated viremia was associated with significantly higher proportions of potentially pathogenic Veillonella, Prevotella, Megasphaera, and Campylobacter species in the lingual microbiome than observed in healthy controls. The upsurge in the prevalence of potential pathogens was juxtaposed by diminished representation of commensal Streptococcus and Veillonella species. Colonization of Neisseria flavescens was lower in the lingual microbiome of HIV infected patients receiving antiretroviral therapy than in uninfected controls. Conclusions Our findings provide novel insights into the potential impact of HIV infection and antiretroviral therapy on the community structure of the oral microbiome, and implicate potential mechanisms that may increase the capacity of non-commensal species to gain a stronger foothold.

  20. Multiplex identification of sepsis-causing Gram-negative pathogens from the plasma of infected blood.

    Science.gov (United States)

    Chung, Boram; Park, Chulmin; Cho, Sung-Yeon; Shin, Juyoun; Shin, Sun; Yim, Seon-Hee; Lee, Dong-Gun; Chung, Yeun-Jung

    2018-02-01

    Early and accurate detection of bacterial pathogens in the blood is the most crucial step for sepsis management. Gram-negative bacteria are the most common organisms causing severe sepsis and responsible for high morbidity and mortality. We aimed to develop a method for rapid multiplex identification of clinically important Gram-negative pathogens and also validated whether our system can identify Gram-negative pathogens with the cell-free plasm DNA from infected blood. We designed five MLPA probe sets targeting the genes specific to major Gram-negative pathogens (uidA and lacY for E. coli, ompA for A. baumannii, phoE for K. pneumoniae, and ecfX for P. aeruginosa) and one set targeting the CTX-M group 1 to identify the ESBL producing Gram-negative pathogens. All six target-specific peaks were clearly separated without any non-specific peaks in a multiplex reaction condition. The minimum detection limit was 100 fg of pathogen DNA. When we tested 28 Gram-negative clinical isolates, all of them were successfully identified without any non-specific peaks. To evaluate the clinical applicability, we tested seven blood samples from febrile patients. Three blood culture positive cases showed E. coli specific peaks, while no peak was detected in the other four culture negative samples. This technology can be useful for detection of major sepsis-causing, drug-resistant Gram-negative pathogens and also the major ESBL producing Gram-negatives from the blood of sepsis patients in a clinical setting. This system can help early initiation of effective antimicrobial treatment against Gram-negative pathogens for sepsis patients, which is very crucial for better treatment outcomes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Incidence of Surgical Site Infections and Microbial Pattern at ...

    African Journals Online (AJOL)

    The ANNALS of AFRICAN SURGERY. January ... morbidity and death. ... Four patients had culture negative results. ... contaminated and dirty wounds had infection rates of ... In the United States of America (USA) ... wounds from day three post operative. ... (Breast cancer, teratoma, lipoma, mandibular tumors excisions).

  2. Genes expressed in grapevine leaves reveal latent wood infection by the fungal pathogen Neofusicoccum parvum.

    Directory of Open Access Journals (Sweden)

    Stefan Czemmel

    Full Text Available Some pathogenic species of the Botryosphaeriaceae have a latent phase, colonizing woody tissues while perennial hosts show no apparent symptoms until conditions for disease development become favorable. Detection of these pathogens is often limited to the later pathogenic phase. The latent phase is poorly characterized, despite the need for non-destructive detection tools and effective quarantine strategies, which would benefit from identification of host-based markers in leaves. Neofusicoccum parvum infects the wood of grapevines and other horticultural crops, killing the fruit-bearing shoots. We used light microscopy and high-resolution computed tomography (HRCT to examine the spatio-temporal relationship between pathogen colonization and anatomical changes in stem sections. To identify differentially-expressed grape genes, leaves from inoculated and non-inoculated plants were examined using RNA-Seq. The latent phase occurred between 0 and 1.5 months post-inoculation (MPI, during which time the pathogen did not spread significantly beyond the inoculation site nor were there differences in lesion lengths between inoculated and non-inoculated plants. The pathogenic phase occurred between 1.5 and 2 MPI, when recovery beyond the inoculation site increased and lesion lengths of inoculated plants tripled. By 2 MPI, inoculated plants also had decreased starch content in xylem fibers and rays, and increased levels of gel-occluded xylem vessels, the latter of which HRCT revealed at a higher frequency than microscopy. RNA-Seq and screening of 21 grape expression datasets identified 20 candidate genes that were transcriptionally-activated by infection during the latent phase, and confirmed that the four best candidates (galactinol synthase, abscisic acid-induced wheat plasma membrane polypeptide-19 ortholog, embryonic cell protein 63, BURP domain-containing protein were not affected by a range of common foliar and wood pathogens or abiotic stresses

  3. Development of a chick bioassay for determination of infectivity of viral pathogens in poultry litter.

    Science.gov (United States)

    Islam, A F M F; Walkden-Brown, S W; Groves, P J; Wells, B

    2013-01-01

    To develop a chicken bioassay to detect infective viral pathogens in poultry litter and to determine the effects of type of chicken and age of exposure, as well as the effect of simulated litter transportation, on the level of viral infectivity detected. A 5 × 2 × 2 factorial design, plus negative controls. Five chicken litters, including two with deliberate contamination (one transported and one not), two chicken types (specific-pathogen-free (SPF) Leghorns and Cobb broilers) and two ages at initial exposure (days 1 and 8). Two replicates of each treatment combination. The 10 chickens in each of 22 isolators were either exposed (20 isolators) or not (2 isolators) to 8 L of previously used or deliberately contaminated poultry litter in two deep scratch trays. At day 35 post-exposure, sera were assayed for antibodies against chicken anaemia virus (CAV), infectious bronchitis virus (IBV), infectious bursal disease virus (IBDV), Newcastle disease virus (NDV) and fowl adenovirus (FAV). Spleen samples were tested for Marek's disease virus (MDV) using real-time polymerase chain reaction. The bioassay detected CAV, IBDV and FAV, but not NDV, IBV or MDV, in chickens exposed to infected litters. Infection in SPF chickens was detected with greater sensitivity than in the broiler chickens. Sensitivity increased with age at exposure in broiler but not SPF chickens. Simulated transportation for 24 h had little effect on pathogen detection. A bioassay based on the exposure of day-old SPF chickens to poultry litter and measurement of seroconversion at day 35 post-exposure is a useful semi-quantitative assay for viral infectivity in poultry litter, with overnight transportation of litter having little effect on the level of viral infectivity detected. This bioassay has applications in research on litter treatment protocols. © 2013 The Authors. Australian Veterinary Journal © 2013 Australian Veterinary Association.

  4. Stress exacerbates infectivity and pathogenicity of Blastocystis hominis: in vitro and in vivo evidences.

    Directory of Open Access Journals (Sweden)

    Samudi Chandramathi

    Full Text Available BACKGROUND: Stress alters the oxidant-antioxidant state and immune cell responses which disrupts its function to combat infection. Blastocystis hominis, a common intestinal protozoan has been reported to be opportunistic in immunocompromised patients namely cancer. B. hominis infectivity in other altered immune system conditions especially stress is unknown. We aimed to demonstrate the stress effects towards the susceptibility and pathogenicity of B. hominis infection. METHODS/FINDINGS: Three-week-old Wistar rats were divided into four groups: (acontrol; (bstress-induced; (cB. hominis infected; (dstress-induced with B. hominis infection; (n = 20 respectively. Stress was induced for an hour daily (30 days using a Belly Dancer Shaker. Weight gain was monitored, stool samples were collected for B. hominis screening and blood for the determination of differential count, levels of immunoglobulin, oxidative damage, and peripheral blood mononuclear cell (PBMC proliferation upon induction with solubilized antigen of B. hominis (Blasto-Ag. Group (b exhibited the highest level of weight gain. Group (d had higher levels of parasite cyst count in stools, serum IgE, oxidized protein and lipid compared to the group (c. Levels of monocyte and antioxidant in group (d were decreased and their PBMCs showed highest inhibition of proliferation level when exposed to Blasto-Ag. Monocyte level in Group (b showed insignificant difference compared to group (a but was significantly lower compared to group (c. Antioxidant levels in group (c were generally lower compared to group (a and (b. Inhibition level exhibited by Blasto-Ag treated PBMCs of group (c was higher compared to group (a and (b. CONCLUSION: The pathogenicity and augmentation of B. hominis infection is enhanced when stress is present. Lifestyles today are becoming increasingly stressed and the present findings suggest that the parasite which has been reported to be one of the most common organisms seen in

  5. Three pathogens in sympatric populations of pumas, bobcats, and domestic cats: Implications for infections disease transmission

    Science.gov (United States)

    Bevins, Sarah N.; Carver, Scott; Boydston, Erin E.; Lyren, Lisa M.; Alldredge, Mat; Logan, Kenneth A.; Riley, Seth P.D.; Fisher, Robert N.; Vickers, T. Winston; Boyce, Walter; Salman, Mo; Lappin, Michael R.; Crooks, Kevin R.; VandeWoude, Sue

    2012-01-01

    Anthropogenic landscape change can lead to increased opportunities for pathogen transmission between domestic and non-domestic animals. Pumas, bobcats, and domestic cats are sympatric in many areas of North America and share many of the same pathogens, some of which are zoonotic. We analyzed bobcat, puma, and feral domestic cat samples collected from targeted geographic areas. We examined exposure to three pathogens that are taxonomically diverse (bacterial, protozoal, viral), that incorporate multiple transmission strategies (vector-borne, environmental exposure/ingestion, and direct contact), and that vary in species-specificity. Bartonella spp., Feline Immunodeficiency Virus (FIV), and Toxoplasma gondii IgG were detected in all three species with mean respective prevalence as follows: puma 16%, 41% and 75%; bobcat 31%, 22% and 43%; domestic cat 45%, 10% and 1%. Bartonella spp. were highly prevalent among domestic cats in Southern California compared to other cohort groups. Feline Immunodeficiency Virus exposure was primarily associated with species and age, and was not influenced by geographic location. Pumas were more likely to be infected with FIV than bobcats, with domestic cats having the lowest infection rate. Toxoplasma gondii seroprevalence was high in both pumas and bobcats across all sites; in contrast, few domestic cats were seropositive, despite the fact that feral, free ranging domestic cats were targeted in this study. Interestingly, a directly transmitted species-specific disease (FIV) was not associated with geographic location, while exposure to indirectly transmitted diseases – vector-borne for Bartonella spp. and ingestion of oocysts via infected prey or environmental exposure for T. gondii – varied significantly by site. Pathogens transmitted by direct contact may be more dependent upon individual behaviors and intra-specific encounters. Future studies will integrate host density, as well as landscape features, to better

  6. Culture-dependent approaches to explore the prevalence of root canal pathogens from endodontic infections

    Directory of Open Access Journals (Sweden)

    Maryam Pourhajibagher

    2017-12-01

    Full Text Available Abstract: Endodontic infections are considered to be caused by the presence of various microorganisms within the root canal system. Recognition of this microbiota contributes to the successful treatment of infected root canals. This study investigated the microorganisms associated with primary and secondary endodontic infections via culture methods, biochemical tests, and molecular approaches in an Iranian population. Microbial specimens were collected from 36 patients with primary endodontic infection and 14 patients with a history of root canal therapy. Advanced microbiological culture techniques were used to isolate microbiota; subsequently, biochemical tests and 16S ribosomal RNA gene sequencing were performed to identify the microorganisms. Within the total 218 cultivable isolates, Veillonella parvula (20.6% was found to occur with the highest frequency in primary endodontic infection, followed by Porphyromonas gingivalis (14.1%, and Aggregatibacter actinomycetemcomitans (9.2%. Enterococcus faecalis (36.6% was the most predominant microorganism in secondary endodontic infections, followed by Candida albicans, Propionibacterium acnes, and V. parvula with frequencies of 20%, 2%, and 2%, respectively. It was concluded that V. parvula and E. faecalis was most frequently found in primary and secondary endodontic infections, respectively.

  7. Hampered foraging and migratory performance in swans infected with low-pathogenic avian influenza A virus.

    Directory of Open Access Journals (Sweden)

    Jan A van Gils

    Full Text Available It is increasingly acknowledged that migratory birds, notably waterfowl, play a critical role in the maintenance and spread of influenza A viruses. In order to elucidate the epidemiology of influenza A viruses in their natural hosts, a better understanding of the pathological effects in these hosts is required. Here we report on the feeding and migratory performance of wild migratory Bewick's swans (Cygnus columbianus bewickii Yarrell naturally infected with low-pathogenic avian influenza (LPAI A viruses of subtypes H6N2 and H6N8. Using information on geolocation data collected from Global Positioning Systems fitted to neck-collars, we show that infected swans experienced delayed migration, leaving their wintering site more than a month after uninfected animals. This was correlated with infected birds travelling shorter distances and fuelling and feeding at reduced rates. The data suggest that LPAI virus infections in wild migratory birds may have higher clinical and ecological impacts than previously recognised.

  8. Short-term parasite-infection alters already the biomass, activity and functional diversity of soil microbial communities

    Science.gov (United States)

    Li, Jun-Min; Jin, Ze-Xin; Hagedorn, Frank; Li, Mai-He

    2014-11-01

    Native parasitic plants may be used to infect and control invasive plants. We established microcosms with invasive Mikania micrantha and native Coix lacryma-jobi growing in mixture on native soils, with M. micrantha being infected by parasitic Cuscuta campestris at four intensity levels for seven weeks to estimate the top-down effects of plant parasitism on the biomass and functional diversity of soil microbial communities. Parasitism significantly decreased root biomass and altered soil microbial communities. Soil microbial biomass decreased, but soil respiration increased at the two higher infection levels, indicating a strong stimulation of soil microbial metabolic activity (+180%). Moreover, a Biolog assay showed that the infection resulted in a significant change in the functional diversity indices of soil microbial communities. Pearson correlation analysis indicated that microbial biomass declined significantly with decreasing root biomass, particularly of the invasive M. micrantha. Also, the functional diversity indices of soil microbial communities were positively correlated with soil microbial biomass. Therefore, the negative effects on the biomass, activity and functional diversity of soil microbial community by the seven week long plant parasitism was very likely caused by decreased root biomass and root exudation of the invasive M. micrantha.

  9. Comparison of filters for concentrating microbial indicators and pathogens in lake-water samples

    Science.gov (United States)

    Francy, Donna S.; Stelzer, Erin A.; Brady, Amie M.G.; Huitger, Carrie; Bushon, Rebecca N.; Ip, Hon S.; Ware, Michael W.; Villegas, Eric N.; Gallardo, Vincent; Lindquist, H.D. Alan

    2013-01-01

    Bacterial indicators are used to indicate increased health risk from pathogens and to make beach closure and advisory decisions; however, beaches are seldom monitored for the pathogens themselves. Studies of sources and types of pathogens at beaches are needed to improve estimates of swimming-associated health risks. It would be advantageous and cost-effective, especially for studies conducted on a regional scale, to use a method that can simultaneously filter and concentrate all classes of pathogens from the large volumes of water needed to detect pathogens. In seven recovery experiments, stock cultures of viruses and protozoa were seeded into 10-liter lake water samples, and concentrations of naturally occurring bacterial indicators were used to determine recoveries. For the five filtration methods tested, the highest median recoveries were as follows: glass wool for adenovirus (4.7%); NanoCeram for enterovirus (14.5%) and MS2 coliphage (84%); continuous-flow centrifugation (CFC) plus Virocap (CFC+ViroCap) for Escherichia coli (68.3%) and Cryptosporidium (54%); automatic ultrafiltration (UF) for norovirus GII (2.4%); and dead-end UF for Enterococcus faecalis (80.5%), avian influenza virus (0.02%), and Giardia (57%). In evaluating filter performance in terms of both recovery and variability, the automatic UF resulted in the highest recovery while maintaining low variability for all nine microorganisms. The automatic UF was used to demonstrate that filtration can be scaled up to field deployment and the collection of 200-liter lake water samples.

  10. Zoonotic pathogens in Atlantic Forest wild rodents in Brazil: Bartonella and Coxiella infections.

    Science.gov (United States)

    Rozental, Tatiana; Ferreira, Michelle Santos; Guterres, Alexandro; Mares-Guia, Maria Angélica; Teixeira, Bernardo R; Gonçalves, Jonathan; Bonvicino, Cibele Rodrigues; D'Andrea, Paulo Sergio; de Lemos, Elba Regina Sampaio

    2017-04-01

    Zoonotic pathogens comprise a significant and increasing fraction of all emerging and re-emerging infectious diseases that plague humans. Identifying host species is one of the keys to controlling emerging infectious diseases. From March 2007 until April 2012, we collected a total of 131 wild rodents in eight municipalities of Rio de Janeiro, Brazil. We investigated these rodents for infection with Coxiella burnetii, Bartonella spp. and Rickettsia spp. In total, 22.1% (29/131) of the rodents were infected by at least one pathogen; co-infection was detected in 1.5% (2/131) of rodents. Coxiella burnetii was detected in 4.6% (6/131) of the wild animals, 17.6% of the rodents harbored Bartonella spp. No cases of Rickettsia were identified. Bartonella doshiae and Bartonella vinsonii were the species found on the wild mammals. This report is the first to note C. burnetii, B. doshiae and B. vinsonii natural infections in Atlantic Forest wild rodents in Brazil. Our work highlights the potential risk of transmission to humans, since most of the infected specimens belong to generalist species that live near human dwellings. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Senescence as a Factor in Latent Pathogen Infection in Eurasian Watermilfoil

    Science.gov (United States)

    2009-09-01

    organisms that colonize plant tissues at some time in their life without causing harm to their host (Petrini 1991). They include micro - organisms...declines including nutrient depletion, shading by phytoplankton and algae , attack by parasites and pathogens, long-term effects of harvesting and/or...Center (ERDC), Environmental Laboratory, Vicksburg, MS. Endophyte-infected plants were collected from a culture pond at the Lewisville Aquatic

  12. The Bacterial Pathogen Xylella fastidiosa Affects the Leaf Ionome of Plant Hosts during Infection

    Science.gov (United States)

    De La Fuente, Leonardo; Parker, Jennifer K.; Oliver, Jonathan E.; Granger, Shea; Brannen, Phillip M.; van Santen, Edzard; Cobine, Paul A.

    2013-01-01

    Xylella fastidiosa is a plant pathogenic bacterium that lives inside the host xylem vessels, where it forms biofilm believed to be responsible for disrupting the passage of water and nutrients. Here, Nicotiana tabacum was infected with X. fastidiosa, and the spatial and temporal changes in the whole-leaf ionome (i.e. the mineral and trace element composition) were measured as the host plant transitioned from healthy to diseased physiological status. The elemental composition of leaves was used as an indicator of the physiological changes in the host at a specific time and relative position during plant development. Bacterial infection was found to cause significant increases in concentrations of calcium prior to the appearance of symptoms and decreases in concentrations of phosphorous after symptoms appeared. Field-collected leaves from multiple varieties of grape, blueberry, and pecan plants grown in different locations over a four-year period in the Southeastern US showed the same alterations in Ca and P. This descriptive ionomics approach characterizes the existence of a mineral element-based response to X. fastidiosa using a model system suitable for further manipulation to uncover additional details of the role of mineral elements during plant-pathogen interactions. This is the first report on the dynamics of changes in the ionome of the host plant throughout the process of infection by a pathogen. PMID:23667547

  13. Increased TLR4 expression in murine placentas after oral infection with periodontal pathogens

    Science.gov (United States)

    Arce, R.M.; Barros, S.P.; Wacker, B.; Peters, B.; Moss, K.; Offenbacher, S.

    2009-01-01

    Maternal periodontitis has emerged as a putative risk factor for preterm births in humans. The periodontitis-associated dental biofilm is thought to serve as an important source of oral bacteria and related virulence factors that hematogenously disseminate and affect the fetoplacental unit; however the underlying biological mechanisms are yet to be fully elucidated. This study hypothesized that an oral infection with the human periodontal pathogens Campylobacter rectus and Porphyromonas gingivalis is able to induce fetal growth restriction, placental inflammation and enhance Toll-like receptors type 4 (TLR4) expression in a murine pregnancy model. Female Balb/C mice (n=40) were orally infected with C. rectus and/or P. gingivalis over a 16-week period and mated once per week. Pregnant mice were sacrificed at embryonic day (E) 16.5 and placentas were collected and analyzed for TLR4 mRNA levels and qualitative protein expression by real time PCR and immunofluorescence. TLR4 mRNA expression was found to be increased in C. rectus-infected group (1.98±0.886 fold difference, Pperiodontal pathogens. The TLR4 pathway has been implicated in the pathogenesis of preterm births; therefore the abnormal regulation of placental TLR4 may give new insights into how maternal periodontitis and periodontal pathogens might be linked to placental inflammation and preterm birth pathogenesis. PMID:19101032

  14. The bacterial pathogen Xylella fastidiosa affects the leaf ionome of plant hosts during infection.

    Directory of Open Access Journals (Sweden)

    Leonardo De La Fuente

    Full Text Available Xylella fastidiosa is a plant pathogenic bacterium that lives inside the host xylem vessels, where it forms biofilm believed to be responsible for disrupting the passage of water and nutrients. Here, Nicotiana tabacum was infected with X. fastidiosa, and the spatial and temporal changes in the whole-leaf ionome (i.e. the mineral and trace element composition were measured as the host plant transitioned from healthy to diseased physiological status. The elemental composition of leaves was used as an indicator of the physiological changes in the host at a specific time and relative position during plant development. Bacterial infection was found to cause significant increases in concentrations of calcium prior to the appearance of symptoms and decreases in concentrations of phosphorous after symptoms appeared. Field-collected leaves from multiple varieties of grape, blueberry, and pecan plants grown in different locations over a four-year period in the Southeastern US showed the same alterations in Ca and P. This descriptive ionomics approach characterizes the existence of a mineral element-based response to X. fastidiosa using a model system suitable for further manipulation to uncover additional details of the role of mineral elements during plant-pathogen interactions. This is the first report on the dynamics of changes in the ionome of the host plant throughout the process of infection by a pathogen.

  15. Recent insights into host-pathogen interaction in white spot syndrome virus infected penaeid shrimp.

    Science.gov (United States)

    Shekhar, M S; Ponniah, A G

    2015-07-01

    Viral disease outbreaks are a major concern impeding the development of the shrimp aquaculture industry. The viral disease due to white spot syndrome virus (WSSV) observed in early 1990s still continues unabated affecting the shrimp farms and cause huge economic loss to the shrimp aquaculture industry. In the absence of effective therapeutics to control WSSV, it is important to understand viral pathogenesis and shrimp response to WSSV at the molecular level. Identification and molecular characterization of WSSV proteins and receptors may facilitate in designing and development of novel therapeutics and antiviral drugs that may inhibit viral replication. Investigations into host-pathogen interactions might give new insights to viral infectivity, tissue tropism and defence mechanism elicited in response to WSSV infection. However, due to the limited information on WSSV gene function and host immune response, the signalling pathways which are associated in shrimp pathogen interaction have also not been elucidated completely. In the present review, the focus is on those shrimp proteins and receptors that are potentially involved in virus infection or in the defence mechanism against WSSV. In addition, the major signalling pathways involved in the innate immune response and the role of apoptosis in host-pathogen interaction is discussed. © 2014 John Wiley & Sons Ltd.

  16. Predictors of Antimicrobial Resistance among Pathogens Causing Urinary Tract Infection in Children.

    Science.gov (United States)

    Shaikh, Nader; Hoberman, Alejandro; Keren, Ron; Ivanova, Anastasia; Gotman, Nathan; Chesney, Russell W; Carpenter, Myra A; Moxey-Mims, Marva; Wald, Ellen R

    2016-04-01

    To determine which children with urinary tract infection are likely to have pathogens resistant to narrow-spectrum antimicrobials. Children, 2-71 months of age (n = 769) enrolled in the Randomized Intervention for Children with Vesicoureteral Reflux or Careful Urinary Tract Infection Evaluation studies were included. We used logistic regression models to test the associations between demographic and clinical characteristics and resistance to narrow-spectrum antimicrobials. Of the included patients, 91% were female and 76% had vesicoureteral reflux. The risk of resistance to narrow-spectrum antibiotics in uncircumcised males was approximately 3 times that of females (OR 3.1; 95% CI 1.4-6.7); in children with bladder bowel dysfunction, the risk was 2 times that of children with normal function (OR 2.2; 95% CI 1.2-4.1). Children who had received 1 course of antibiotics during the past 6 months also had higher odds of harboring resistant organisms (OR 1.6; 95% CI 1.1-2.3). Hispanic children had higher odds of harboring pathogens resistant to some narrow-spectrum antimicrobials. Uncircumcised males, Hispanic children, children with bladder bowel dysfunction, and children who received 1 course of antibiotics in the past 6 months were more likely to have a urinary tract infection caused by pathogens resistant to 1 or more narrow-spectrum antimicrobials. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. The immune strategies of mosquito Aedes aegypti against microbial infection.

    Science.gov (United States)

    Wang, Yan-Hong; Chang, Meng-Meng; Wang, Xue-Li; Zheng, Ai-Hua; Zou, Zhen

    2018-06-01

    Yellow fever mosquito Aedes aegypti transmits many devastating arthropod-borne viruses (arboviruses), such as dengue virus, yellow fever virus, Chikungunya virus, and Zika virus, which cause great concern to human health. Mosquito control is an effective method to block the spread of infectious diseases. Ae. aegypti uses its innate immune system to fight against arboviruses, parasites, and fungi. In this review, we briefly summarize the recent findings in the immune response of Ae. aegypti against arboviral and entomopathogenic infections. This review enriches our understanding of the mosquito immune system and provides evidence to support the development of novel mosquito control strategies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Simulation of enteric pathogen concentrations in locally-collected greywater and wastewater for microbial risk assessments

    Science.gov (United States)

    As decentralized water reuse continues to gain popularity, risk-based treatment guidance is increasingly sought for the protection of public health. However, efforts to evaluate pathogen risks and log-reduction requirements have been hindered by an incomplete understanding of pat...

  19. Microbial pathogens in source and treated waters from drinking water treatment plants in the US

    Science.gov (United States)

    An occurrence survey was conducted on selected pathogens in source and treated drinking water collected from 25 drinking water treatment plants (DWTPs) in the United States. Water samples were analyzed for the protozoa Giardia and Cryptosporidium (EPA Method 1623); the fungi Asp...

  20. Microbial Assessment and Prevalence of Foodborne Pathogens in Natural Cheeses in Japan

    Directory of Open Access Journals (Sweden)

    Firew Kassa Esho

    2013-01-01

    Full Text Available The production and consumption of domestic natural cheese in Japan is increasing year by year. More than ninety percent of domestic natural cheese is produced in Hokkaido region of Japan, while information on its quality and safety related to foodborne pathogens is limited. To assess the microbiological safety of domestic natural cheese, a total of 126 natural cheese samples produced in Hokkaido were collected from December, 2012, to July, 2013. In addition to standard plate count (SPC and coliform counts, the prevalence study of three pathogens (Listeria monocytogenes, pathogenic Escherichia coli, and Salmonella spp. was performed on each sample. Real-time PCR and matrix-assisted laser desorption-ionization time-of-flight mass spectrometer methods were employed for identification of presumptive pathogens. Coliform was detected in 25 samples (19.8% with a minimum of 25 cfu/g and a maximum of more than 3.0 × 106 cfu/g. Salmonella spp. and L. monocytogenes were not isolated from any of the samples. Only one sample (0.80% showed positive PCR amplification for ipaH gene suggesting possible contamination of enteroinvasive E. coli or Shigella in this product. Overall results indicate that natural cheeses produced in Hokkaido region were satisfactory microbiological quality according to existing international standards.

  1. Microbial Biosensor for the Detection of Protease-Virulent Factors from Pathogens

    Science.gov (United States)

    2017-04-28

    pathogen signalling molecules. With that goal in mind , researchers have developed various types of biosensors that detect infectious determinants...life to boost their capability for rapid determination of clean water sources during field deployment. Despite the promising results of these studies

  2. Genome analysis of multiple pathogenic isolates of Streptococcus agalactiae : Implications for the microbial "pan-genome"

    NARCIS (Netherlands)

    Tettelin, H; Masignani, [No Value; Cieslewicz, MJ; Donati, C; Medini, D; Ward, NL; Angiuoli, SV; Crabtree, J; Jones, AL; Durkin, AS; DeBoy, RT; Davidsen, TM; Mora, M; Scarselli, M; Ros, IMY; Peterson, JD; Hauser, CR; Sundaram, JP; Nelson, WC; Madupu, R; Brinkac, LM; Dodson, RJ; Rosovitz, MJ; Sullivan, SA; Daugherty, SC; Haft, DH; Selengut, J; Gwinn, ML; Zhou, LW; Zafar, N; Khouri, H; Radune, D; Dimitrov, G; Watkins, K; O'Connor, KJB; Smith, S; Utterback, TR; White, O; Rubens, CE; Grandi, G; Madoff, LC; Kasper, DL; Telford, JL; Wessels, MR; Rappuoli, R; Fraser, CM

    2005-01-01

    The development of efficient and inexpensive genome sequencing methods has revolutionized the study of human bacterial pathogens and improved vaccine design. Unfortunately, the sequence of a single genome does not reflect how genetic variability drives pathogenesis within a bacterial species and

  3. Correlations between Microbial Indicators, Pathogens, and Environmental Factors in a Subtropical Estuary

    Science.gov (United States)

    Ortega, Cristina; Solo-Gabriele, Helena M.; Abdelzaher, Amir; Wright, Mary; Deng, Yang; Stark, Lillian M.

    2009-01-01

    The objective of this study was to evaluate whether indicator microbes and physical-chemical parameters were correlated with pathogens within a tidally influenced estuary. Measurements included the analysis of physical-chemical parameters (pH, salinity, temperature, and turbidity), measurements of bacterial indicators (enterococci, fecal coliform, E. coli, and total coliform), viral indicators (somatic and MS2 coliphage), viral pathogens (enterovirus by culture), and protozoan pathogens (Cryptosporidium and Giardia). All pathogen results were negative with the exception of one sample which tested positive for culturable reovirus (8.5 MPN/100 L).. Notable physical-chemical parameters for this sample included low salinity (<1 ppt) and high water temperature (31 °C). Indicator bacteria and indicator virus levels for this sample were within average values typically measured within the study site and were low in comparison with levels observed in other freshwater environments. Overall results suggest that high levels of bacterial and viral indicators were associated with low salinity sites. PMID:19464704

  4. Thymus transcriptome reveals novel pathways in response to avian pathogenic Escherichia coli infection.

    Science.gov (United States)

    Sun, H; Liu, P; Nolan, L K; Lamont, S J

    2016-12-01

    Avian pathogenic Escherichia coli (APEC) can cause significant morbidity in chickens. The thymus provides the essential environment for T cell development; however, the thymus transcriptome has not been examined for gene expression in response to APEC infection. An improved understanding of the host genomic response to APEC infection could inform future breeding programs for disease resistance and APEC control. We therefore analyzed the transcriptome of the thymus of birds challenged with APEC, contrasting susceptible and resistant phenotypes. Thousands of genes were differentially expressed in birds of the 5-day post infection (dpi) challenged-susceptible group vs. 5 dpi non-challenged, in 5 dpi challenged-susceptible vs. 5 dpi challenged-resistant birds, as well as in 5 dpi vs. one dpi challenged-susceptible birds. The Toll-like receptor signaling pathway was the major innate immune response for birds to respond to APEC infection. Moreover, lysosome and cell adhesion molecules pathways were common mechanisms for chicken response to APEC infection. The T-cell receptor signaling pathway, cell cycle, and p53 signaling pathways were significantly activated in resistant birds to resist APEC infection. These results provide a comprehensive assessment of global gene networks and biological functionalities of differentially expressed genes in the thymus under APEC infection. These findings provide novel insights into key molecular genetic mechanisms that differentiate host resistance from susceptibility in this primary lymphoid tissue, the thymus. © The Author 2016. Published by Oxford University Press on behalf of Poultry Science Association.

  5. Activation of type III interferon genes by pathogenic bacteria in infected epithelial cells and mouse placenta.

    Directory of Open Access Journals (Sweden)

    Hélène Bierne

    Full Text Available Bacterial infections trigger the expression of type I and II interferon genes but little is known about their effect on type III interferon (IFN-λ genes, whose products play important roles in epithelial innate immunity against viruses. Here, we studied the expression of IFN-λ genes in cultured human epithelial cells infected with different pathogenic bacteria and in the mouse placenta infected with Listeria monocytogenes. We first showed that in intestinal LoVo cells, induction of IFN-λ genes by L. monocytogenes required bacterial entry and increased further during the bacterial intracellular phase of infection. Other Gram-positive bacteria, Staphylococcus aureus, Staphylococcus epidermidis and Enterococcus faecalis, also induced IFN-λ genes when internalized by LoVo cells. In contrast, Gram-negative bacteria Salmonella enterica serovar Typhimurium, Shigella flexneri and Chlamydia trachomatis did not substantially induce IFN-λ. We also found that IFN-λ genes were up-regulated in A549 lung epithelial cells infected with Mycobacterium tuberculosis and in HepG2 hepatocytes and BeWo trophoblastic cells infected with L. monocytogenes. In a humanized mouse line permissive to fetoplacental listeriosis, IFN-λ2/λ3 mRNA levels were enhanced in placentas infected with L. monocytogenes. In addition, the feto-placental tissue was responsive to IFN-λ2. Together, these results suggest that IFN-λ may be an important modulator of the immune response to Gram-positive intracellular bacteria in epithelial tissues.

  6. Pathogenic bacteria and microbial-source tracking markers in Brandywine Creek Basin, Pennsylvania and Delaware, 2009-10

    Science.gov (United States)

    Duris, Joseph W.; Reif, Andrew G.; Olson, Leif E.; Johnson, Heather E.

    2011-01-01

    virulent type of pathogenic E. coli, was found only in the West Branch and main stem at high flow but was not found in the East Branch under similar conditions. However, it must be noted that throughout the entire year of sampling there were occasions, during both high and normal flows, when both the East and West Branches were potential contributors of pathogen and microbial-source tracking markers to the main stem. Therefore, this study indicates that under selected conditions (high flow, October through March), West Branch Brandywine Creek Basin was the most likely source of elevated FIB densities in the main stem. These elevated densities are associated with more frequent detection of selected pathogenic E. coli markers (rfbO157 stx1) and are associated with MST markers of bovine source. However, during other times of the year, both the West Branch and East Branch Basins are acting as potential sources of FIB and fecally derived pathogens.

  7. Effect of low-pathogenicity influenza virus H3N8 infection on Mycoplasma gallisepticum infection of chickens.

    Science.gov (United States)

    Stipkovits, Laszlo; Egyed, Laszlo; Palfi, Vilmos; Beres, Andrea; Pitlik, Ervin; Somogyi, Maria; Szathmary, Susan; Denes, Bela

    2012-01-01

    Mycoplasma infection is still very common in chicken and turkey flocks. Several low-pathogenicity avian influenza (LPAI) viruses are circulating in wild birds that can be easily transmitted to poultry flocks. However, the effect of LPAI on mycoplasma infection is not well understood. The aim of the present study was to investigate the infection of LPAI virus H3N8 (A/mallard/Hungary/19616/07) in chickens challenged with Mycoplasma gallisepticum. Two groups of chickens were aerosol challenged with M. gallisepticum. Later one of these groups and one mycoplasma-free group were aerosol challenged with the LPAI H3N8 virus. The birds were observed for clinical signs for 8 days, then euthanized, and examined for the presence of M. gallisepticum in the trachea, lung, air sac, liver, spleen, kidney and heart, and for developing anti-mycoplasma and anti-viral antibodies. The LPAI H3N8 virus did not cause any clinical signs but M. gallisepticum infection caused clinical signs, reduction of body weight gain and colonization of the inner organs. These parameters were more severe in the birds co-infected with M. gallisepticum and LPAI H3N8 virus than in the group challenged with M. gallisepticum alone. In addition, in the birds infected with both M. gallisepticum and LPAI H3N8 virus, the anti-mycoplasma antibody response was reduced significantly when compared with the group challenged with M. gallisepticum alone. Co-infection with LPAI H3N8 virus thus enhanced pathogenesis of M. gallisepticum infection significantly.

  8. Determination of human pathogen profiles in food by quality assured microbial assays. Proceedings of a final Research Coordination Meeting

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-01-15

    This publication includes the results of a Coordinated Research Project (CRP). Major food microbial contaminants were identified in some of the main foods exported in the international food market. Thousands of samples in a wide variety of foods were selected to be studied during different points of the food chain: meat (chicken, beef and pork), seafood (shellfish such as shrimp, prawns, scampi, squid, and lobsters, and different types of fish such as salmon, cuttle fish, rohu, fin herring, catfish, milkfish, and tilapia), spices (pepper, paprika), frozen vegetables (asparagus, peas and corn) and other products (coconut and dairy products). The analysis included pathogenic bacteria such as Salmonella spp. (several serotypes), Escherichia coli, E. coli 0157:H7, Staphylococcus aureus, Clostridium perfringens, Bacillus cereus, Vibrio choleare, Vibrio parahaemolitycus and Yersinia enterolítica. This publication includes data that may be used to conduct better risk assessments on food by importing as well as exporting countries.

  9. Inflammasome and Fas-Mediated IL-1β Contributes to Th17/Th1 Cell Induction in Pathogenic Bacterial Infection In Vivo.

    Science.gov (United States)

    Uchiyama, Ryosuke; Yonehara, Shin; Taniguchi, Shun'ichiro; Ishido, Satoshi; Ishii, Ken J; Tsutsui, Hiroko

    2017-08-01

    CD4 + Th cells play crucial roles in orchestrating immune responses against pathogenic microbes, after differentiating into effector subsets. Recent research has revealed the importance of IFN-γ and IL-17 double-producing CD4 + Th cells, termed Th17/Th1 cells, in the induction of autoimmune and inflammatory diseases. In addition, Th17/Th1 cells are involved in the regulation of infection caused by the intracellular bacterium Mycobacterium tuberculosis in humans. However, the precise mechanism of Th17/Th1 induction during pathogen infection is unclear. In this study, we showed that the inflammasome and Fas-dependent IL-1β induces Th17/Th1 cells in mice, in response to infection with the pathogenic intracellular bacterium Listeria monocytogenes In the spleens of infected wild-type mice, Th17/Th1 cells were induced, and expressed T-bet and Rorγt. In Pycard -/- mice, which lack the adaptor molecule of the inflammasome (apoptosis-associated speck-like protein containing a caspase recruitment domain), Th17/Th1 induction was abolished. In addition, the Fas-mediated IL-1β production was required for Th17/Th1 induction during bacterial infection: Th17/Th1 induction was abolished in Fas -/- mice, whereas supplementation with recombinant IL-1β restored Th17/Th1 induction via IL-1 receptor 1 (IL-1R1), and rescued the mortality of Fas -/- mice infected with Listeria IL-1R1, but not apoptosis-associated speck-like protein containing a caspase recruitment domain or Fas on T cells, was required for Th17/Th1 induction, indicating that IL-1β stimulates IL-1R1 on T cells for Th17/Th1 induction. These results indicate that IL-1β, produced by the inflammasome and Fas-dependent mechanisms, contributes cooperatively to the Th17/Th1 induction during bacterial infection. This study provides a deeper understanding of the molecular mechanisms underlying Th17/Th1 induction during pathogenic microbial infections in vivo. Copyright © 2017 by The American Association of Immunologists

  10. Enhancement of microbial quality and inactivation of pathogenic bacteria by gamma irradiation of ready-to-cook Iranian barbecued chicken

    Science.gov (United States)

    Fallah, Aziz A.; Siavash Saei-Dehkordi, S.; Rahnama, Mohammad

    2010-10-01

    Ready-to-cook Iranian barbecued chicken consists of cubed chicken breast, lemon juice, salt, red pepper, onion, saffron and vegetable oil with an overall pH value of about 5.5. This product is sometimes consumed under-cooked, hence it may pose health hazards to consumers when contaminated with food-borne pathogens. In this study, the effect of gamma irradiation (0, 1.5, 3 and 4.5 kGy) on the microbial quality of ready-to-cook (RTC) barbecued chicken samples stored at 4 °C for 15 days was investigated. Moreover, the effectiveness of irradiation for inactivating Listeria monocytogenes, Escherichia coli O157:H7 and Salmonella typhimurium inoculated into the samples was also studied. Irradiation of the samples resulted in dose dependent reduction in counts of aerobic mesophilic bacteria, yeasts and molds, Enterobacteriaceae and lactic acid bacteria. Among the microbial flora, yeasts and molds and Enterobacteriaceae were more sensitive to irradiation and got completely eliminated at dose of 3 kGy. D10 values of L. monocytogenes, E. coli O157:H7 and S. typhimurium inoculated into the samples were 0.680, 0.397 and 0.601 kGy, respectively. An irradiation dose of 3 kGy reduced the counts of E. coli O157:H7 to an undetectable level in RTC barbecued chicken but was ineffective on elimination of L. monocytogenes and S. typhimurium. However, none of the food-borne pathogens were detected in the samples irradiated at 4.5 kGy. This study showed that irradiation had no undesirable effects on the initial sensory attributes of barbecued chicken. At the end of the storage period, irradiated samples were more acceptable compared to non-irradiated ones.

  11. Enhancement of microbial quality and inactivation of pathogenic bacteria by gamma irradiation of ready-to-cook Iranian barbecued chicken

    International Nuclear Information System (INIS)

    Fallah, Aziz A.; Siavash Saei-Dehkordi, S.; Rahnama, Mohammad

    2010-01-01

    Ready-to-cook Iranian barbecued chicken consists of cubed chicken breast, lemon juice, salt, red pepper, onion, saffron and vegetable oil with an overall pH value of about 5.5. This product is sometimes consumed under-cooked, hence it may pose health hazards to consumers when contaminated with food-borne pathogens. In this study, the effect of gamma irradiation (0, 1.5, 3 and 4.5 kGy) on the microbial quality of ready-to-cook (RTC) barbecued chicken samples stored at 4 o C for 15 days was investigated. Moreover, the effectiveness of irradiation for inactivating Listeria monocytogenes, Escherichia coli O157:H7 and Salmonella typhimurium inoculated into the samples was also studied. Irradiation of the samples resulted in dose dependent reduction in counts of aerobic mesophilic bacteria, yeasts and molds, Enterobacteriaceae and lactic acid bacteria. Among the microbial flora, yeasts and molds and Enterobacteriaceae were more sensitive to irradiation and got completely eliminated at dose of 3 kGy. D 10 values of L. monocytogenes, E. coli O157:H7 and S. typhimurium inoculated into the samples were 0.680, 0.397 and 0.601 kGy, respectively. An irradiation dose of 3 kGy reduced the counts of E. coli O157:H7 to an undetectable level in RTC barbecued chicken but was ineffective on elimination of L. monocytogenes and S. typhimurium. However, none of the food-borne pathogens were detected in the samples irradiated at 4.5 kGy. This study showed that irradiation had no undesirable effects on the initial sensory attributes of barbecued chicken. At the end of the storage period, irradiated samples were more acceptable compared to non-irradiated ones.

  12. Enhancement of microbial quality and inactivation of pathogenic bacteria by gamma irradiation of ready-to-cook Iranian barbecued chicken

    Energy Technology Data Exchange (ETDEWEB)

    Fallah, Aziz A., E-mail: a_a_falah@yahoo.co [Department of Food Hygiene and Quality Control, Faculty of Veterinary Medicine, Shahre-Kord University, Shahre-Kord 34141 (Iran, Islamic Republic of); Research Institute of Zoonotic Diseases, Shahre-Kord University, Shahre-Kord 34141 (Iran, Islamic Republic of); Siavash Saei-Dehkordi, S. [Department of Food Hygiene and Quality Control, Faculty of Veterinary Medicine, Shahre-Kord University, Shahre-Kord 34141 (Iran, Islamic Republic of); Research Institute of Zoonotic Diseases, Shahre-Kord University, Shahre-Kord 34141 (Iran, Islamic Republic of); Rahnama, Mohammad [Department of Food Hygiene and Quality Control, Faculty of Veterinary Medicine, University of Zabol, Zabol 98615 (Iran, Islamic Republic of)

    2010-10-15

    Ready-to-cook Iranian barbecued chicken consists of cubed chicken breast, lemon juice, salt, red pepper, onion, saffron and vegetable oil with an overall pH value of about 5.5. This product is sometimes consumed under-cooked, hence it may pose health hazards to consumers when contaminated with food-borne pathogens. In this study, the effect of gamma irradiation (0, 1.5, 3 and 4.5 kGy) on the microbial quality of ready-to-cook (RTC) barbecued chicken samples stored at 4 {sup o}C for 15 days was investigated. Moreover, the effectiveness of irradiation for inactivating Listeria monocytogenes, Escherichia coli O157:H7 and Salmonella typhimurium inoculated into the samples was also studied. Irradiation of the samples resulted in dose dependent reduction in counts of aerobic mesophilic bacteria, yeasts and molds, Enterobacteriaceae and lactic acid bacteria. Among the microbial flora, yeasts and molds and Enterobacteriaceae were more sensitive to irradiation and got completely eliminated at dose of 3 kGy. D{sub 10} values of L. monocytogenes, E. coli O157:H7 and S. typhimurium inoculated into the samples were 0.680, 0.397 and 0.601 kGy, respectively. An irradiation dose of 3 kGy reduced the counts of E. coli O157:H7 to an undetectable level in RTC barbecued chicken but was ineffective on elimination of L. monocytogenes and S. typhimurium. However, none of the food-borne pathogens were detected in the samples irradiated at 4.5 kGy. This study showed that irradiation had no undesirable effects on the initial sensory attributes of barbecued chicken. At the end of the storage period, irradiated samples were more acceptable compared to non-irradiated ones.

  13. Chytrid fungus acts as a generalist pathogen infecting species-rich amphibian families in Brazilian rainforests.

    Science.gov (United States)

    Valencia-Aguilar, Anyelet; Ruano-Fajardo, Gustavo; Lambertini, Carolina; da Silva Leite, Domingos; Toledo, Luís Felipe; Mott, Tamí

    2015-05-11

    The fungus Batrachochytrium dendrobatidis (Bd) is among the main causes of declines in amphibian populations. This fungus is considered a generalist pathogen because it infects several species and spreads rapidly in the wild. To date, Bd has been detected in more than 100 anuran species in Brazil, mostly in the southern portion of the Atlantic forest. Here, we report survey data from some poorly explored regions; these data considerably extend current information on the distribution of Bd in the northern Atlantic forest region. In addition, we tested the hypothesis that Bd is a generalist pathogen in this biome. We also report the first positive record for Bd in an anuran caught in the wild in Amazonia. In total, we screened 90 individuals (from 27 species), of which 39 individuals (from 22 species) were Bd-positive. All samples collected in Bahia (2 individuals), Pernambuco (3 individuals), Pará (1 individual), and Minas Gerais (1 individual) showed positive results for Bd. We found a positive correlation between anuran richness per family and the number of infected species in the Atlantic forest, supporting previous observations that Bd lacks strong host specificity; of 38% of the anuran species in the Atlantic forest that were tested for Bd infection, 25% showed positive results. The results of our study exemplify the pandemic and widespread nature of Bd infection in amphibians.

  14. Endodontic pathogens causing deep neck space infections: clinical impact of different sampling techniques and antibiotic susceptibility.

    Science.gov (United States)

    Poeschl, Paul W; Crepaz, Valentina; Russmueller, Guenter; Seemann, Rudolf; Hirschl, Alexander M; Ewers, Rolf

    2011-09-01

    The aims of the present study were to compare microbial populations in patients suffering from deep neck space abscesses caused by primary endodontic infections by sampling the infections with aspiration or swabbing techniques and to determine the susceptibility rates of the isolated bacteria to commonly used antibiotics. A total of 89 patients with deep neck space abscesses caused by primary endodontic infections requiring extraoral incision and drainage under general anesthesia were included. Either aspiration or swabbing was used to sample microbial pus specimens. The culture of the microbial specimens and susceptibility testing were performed following standard procedures. A total of 142 strains were recovered from 76 patients. In 13 patients, no bacteria were found. The predominant bacteria observed were streptococci (36%), staphylococci (13%), Prevotella (8%), and Peptostreptococcus (6%). A statistically significant greater number of obligate anaerobes were found in the aspiration group. The majority of patients presented a mixed aerobic-anaerobic population of bacterial flora (62%). The antibiotic resistance rates for the predominant bacteria were 10% for penicillin G, 9% for amoxicillin, 0% for amoxicillin clavulanate, 24% for clindamycin, and 24% for erythromycin. The results of our study indicated that a greater number of anaerobes were found when sampling using the aspiration technique. Penicillin G and aminopenicillins alone are not always sufficient for the treatment of severe deep neck space abscesses; beta-lactamase inhibitor combinations are more effective. Bacteria showed significant resistant rates to clindamycin. Thus, its single use in penicillin-allergic patients has to be carefully considered. Copyright © 2011 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  15. Identification and Expression Profiles of Six Transcripts Encoding Carboxylesterase Protein in Vitis flexuosa Infected with Pathogens

    Directory of Open Access Journals (Sweden)

    Md. Zaherul Islam

    2016-08-01

    Full Text Available Plants protect themselves from pathogen attacks via several mechanisms, including hypersensitive cell death. Recognition of pathogen attack by the plant resistance gene triggers expression of carboxylesterase genes associated with hypersensitive response. We identified six transcripts of carboxylesterase genes, Vitis flexuosa carboxylesterase 5585 (VfCXE5585, VfCXE12827, VfCXE13132, VfCXE17159, VfCXE18231, and VfCXE47674, which showed different expression patterns upon transcriptome analysis of V. flexuosa inoculated with Elsinoe ampelina. The lengths of genes ranged from 1,098 to 1,629 bp, and their encoded proteins consisted of 309 to 335 amino acids. The predicted amino acid sequences showed hydrolase like domains in all six transcripts and contained two conserved motifs, GXSXG of serine hydrolase characteristics and HGGGF related to the carboxylesterase family. The deduced amino acid sequence also contained a potential catalytic triad consisted of serine, aspartic acid and histidine. Of the six transcripts, VfCXE12827 showed upregulated expression against E. ampelina at all time points. Three genes (VfCXE5585, VfCXE12827, and VfCXE13132 showed upregulation, while others (VfCXE17159, VfCXE18231, and VfCXE47674 were down regulated in grapevines infected with Botrytis cinerea. All transcripts showed upregulated expression against Rhizobium vitis at early and later time points except VfCXE12827, and were downregulated for up to 48 hours post inoculation (hpi after upregulation at 1 hpi in response to R. vitis infection. All tested genes showed high and differential expression in response to pathogens, indicating that they all may play a role in defense pathways during pathogen infection in grapevines.

  16. Characterization of the cell surface properties of drinking water pathogens by microbial adhesion to hydrocarbon and electrophoretic mobility measurements.

    Science.gov (United States)

    Popovici, Jonathan; White, Colin P; Hoelle, Jill; Kinkle, Brian K; Lytle, Darren A

    2014-06-01

    The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregation, adhesion to surfaces, and stability of the cells within the aqueous environments. These cell characteristics are unique to the bacterial species and are a reflection of the large diversity of surface structures, proteins, and appendages of microorganisms. CSH and EPM of bacterial cells contribute substantially to the effectiveness of drinking water treatment to remove them, and therefore an investigation of these properties will be useful in predicting their removal through drinking water treatment processes and transport through drinking water distribution systems. EPM and CSH measurements of six microbiological pathogen or surrogate species suspended in phosphate-buffered water are reported in this work. Two strains of Vibrio cholerae were hydrophobic, while three strains of Escherichia coli were hydrophilic. Bacillus cereus was categorized as moderately hydrophobic. The strains of E. coli had the highest (most negative) EPM. Based on the measurements, E. coli species is predicted to be most difficult to remove from water while V. cholerae will be the easiest to remove. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Cervical precancerous changes and selected cervical microbial infections, Kiambu County, Kenya, 2014: a cross sectional study.

    Science.gov (United States)

    Kanyina, Evalyne Wambui; Kamau, Lucy; Muturi, Margaret

    2017-09-25

    Cervical cancer is the predominant cancer among women in Kenya and second most common in women in developing regions. Population-based cytological screening and early treatment reduces morbidity and mortality associated with the cancer. We determined the occurrence of cervical precancerous changes and cervical microbial infections (Trichomonas vaginalis, Candida albicans, Neisseria gonorrhea and Actinomyces) among women attending Family Health Option Kenya (FHOK) clinic in Thika. This was a hospital based cross sectional study among women attending reproductive health screening clinic from November 2013 to January 2014. Cervical Intraepithelial Neoplasia (CIN) I, II, III, cervical cancer and microbial infection (Actinomyces, Trichomonas vaginalis and Yeast cells) diagnosis was based on Pap smear screening test and High Vaginal Swab wet preparation microscopy. Neisseria gonorrhea was diagnosed through Gram staining. Socio-demographic and reproductive health data was collected using a structured questionnaire administered to the study participants and analyzed using Epi Info version 3.5.1. Of the 244 women screened, 238 (97.5%) presented with cervical inflammation, 80 (32.8%) cervical microbial infections and 12 (4.9%) cervical precancerous changes; 10 (83.3%) with CIN I and 2 (16.7%) CIN II. Of the 80 cervical microbial infections, 62 (77.5%) were yeast cell and 18 (22.5%) T. vaginalis. One thirty four (55%) participants had no history of Pap smear screening of which 84 (62.7%) were 20-40 years. Use of IUCDs (OR: 2.47, 95% CI 1.3-4.6) was associated with cervical inflammation. CIN I was the predominant cervical precancerous change. There is need to scale up cervical screening test to capture all categories of women.

  18. A novel approach to probe host-pathogen interactions of bovine digital dermatitis, a model of a complex polymicrobial infection

    DEFF Research Database (Denmark)

    Marcatili, Paolo; Weiss Nielsen, Martin; Sicheritz-Pontén, Thomas

    2016-01-01

    Polymicrobial infections represent a great challenge for the clarification of disease etiology and the development of comprehensive diagnostic or therapeutic tools, particularly for fastidious and difficult-to-cultivate bacteria. Using bovine digital dermatitis (DD) as a disease model, we introduce...... a novel strategy to study the pathogenesis of complex infections. The strategy combines meta-transcriptomics with high-density peptide-microarray technology to screen for in vivo-expressed microbial genes and the host antibody response at the site of infection. Bacterial expression patterns supported....... The extraordinary diversity observed in bacterial expression, antigens and host antibody responses between individual cows pointed toward microbial variability as a hallmark of DD. Persistence of infection and DD reinfection in the same individual is common; thus, high microbial diversity may undermine the host...

  19. Microbial ecology, bacterial pathogens, and antibiotic resistant genes in swine manure wastewater as influenced by three swine management systems.

    Science.gov (United States)

    Brooks, John P; Adeli, Ardeshir; McLaughlin, Michael R

    2014-06-15

    The environmental influence of farm management in concentrated animal feeding operations (CAFO) can yield vast changes to the microbial biota and ecological structure of both the pig and waste manure lagoon wastewater. While some of these changes may not be negative, it is possible that CAFOs can enrich antibiotic resistant bacteria or pathogens based on farm type, thereby influencing the impact imparted by the land application of its respective wastewater. The purpose of this study was to measure the microbial constituents of swine-sow, -nursery, and -finisher farm manure lagoon wastewater and determine the changes induced by farm management. A total of 37 farms were visited in the Mid-South USA and analyzed for the genes 16S rRNA, spaQ (Salmonella spp.), Camp-16S (Campylobacter spp.), tetA, tetB, ermF, ermA, mecA, and intI using quantitative PCR. Additionally, 16S rRNA sequence libraries were created. Overall, it appeared that finisher farms were significantly different from nursery and sow farms in nearly all genes measured and in 16S rRNA clone libraries. Nearly all antibiotic resistance genes were detected in all farms. Interestingly, the mecA resistance gene (e.g. methicillin resistant Staphylococcus aureus) was below detection limits on most farms, and decreased as the pigs aged. Finisher farms generally had fewer antibiotic resistance genes, which corroborated previous phenotypic data; additionally, finisher farms produced a less diverse 16S rRNA sequence library. Comparisons of Camp-16S and spaQ GU (genomic unit) values to previous culture data demonstrated ratios from 10 to 10,000:1 depending on farm type, indicating viable but not cultivatable bacteria were dominant. The current study indicated that swine farm management schemes positively and negatively affect microbial and antibiotic resistant populations in CAFO wastewater which has future "downstream" implications from both an environmental and public health perspective. Published by Elsevier Ltd.

  20. Early immune response patterns to pathogenic bacteria are associated to increased risk of lower respiratory infections in children

    DEFF Research Database (Denmark)

    Vissing, N. H.; Larsen, Jeppe Madura; Rasmussen, Mette Annelie

    2014-01-01

    Neonatal colonisation of the airways with respiratory pathogens is associated with increased risk of lower respiratory infections (LRI) in early childhood (1). Therefore, we hypothesized that children developing LRI have an abnormal immune response to pathogenic bacteria in infancy. We aimed...... to characterise the systemic immune response to pathogenic bacteria at the age of 6 months and study the association with incidence of LRI during the first 3 years of life....

  1. Experimental infection of macaques with a wild water bird-derived highly pathogenic avian influenza virus (H5N1.

    Directory of Open Access Journals (Sweden)

    Tomoko Fujiyuki

    Full Text Available Highly pathogenic avian influenza virus (HPAIV continues to threaten human health. Non-human primate infection models of human influenza are desired. To establish an animal infection model with more natural transmission and to determine the pathogenicity of HPAIV isolated from a wild water bird in primates, we administered a Japanese isolate of HPAIV (A/whooper swan/Hokkaido/1/2008, H5N1 clade 2.3.2.1 to rhesus and cynomolgus monkeys, in droplet form, via the intratracheal route. Infection of the lower and upper respiratory tracts and viral shedding were observed in both macaques. Inoculation of rhesus monkeys with higher doses of the isolate resulted in stronger clinical symptoms of influenza. Our results demonstrate that HPAIV isolated from a water bird in Japan is pathogenic in monkeys by experimental inoculation, and provide a new method for HPAIV infection of non-human primate hosts, a good animal model for investigation of HPAIV pathogenicity.

  2. Characterizing relationships among fecal indicator bacteria, microbial source tracking markers, and associated waterborne pathogen occurrence in stream water and sediments in a mixed land use watershed

    Science.gov (United States)

    Bed sediments of streams and rivers may store high concentrations of fecal indicator bacteria (FIB) and pathogens. Due to resuspension events, these contaminants can be mobilized into the water column and affect overall water quality. Other bacterial indicators such as microbial ...

  3. Brain transcriptomes of honey bees (Apis mellifera experimentally infected by two pathogens: Black queen cell virus and Nosema ceranae

    Directory of Open Access Journals (Sweden)

    Vincent Doublet

    2016-12-01

    Full Text Available Regulation of gene expression in the brain plays an important role in behavioral plasticity and decision making in response to external stimuli. However, both can be severely affected by environmental factors, such as parasites and pathogens. In honey bees, the emergence and re-emergence of pathogens and potential for pathogen co-infection and interaction have been suggested as major components that significantly impaired social behavior and survival. To understand how the honey bee is affected and responds to interacting pathogens, we co-infected workers with two prevalent pathogens of different nature, the positive single strand RNA virus Black queen cell virus (BQCV, and the Microsporidia Nosema ceranae, and explored gene expression changes in brains upon single infections and co-infections. Our data provide an important resource for research on honey bee diseases, and more generally on insect host-pathogen and pathogen-pathogen interactions. Raw and processed data are publicly available in the NCBI/GEO database: (http://www.ncbi.nlm.nih.gov/geo/ under accession number GSE81664.

  4. Pathogen group specific risk factors at herd, heifer and quarter levels for intramammary infections in early lactating dairy heifers

    NARCIS (Netherlands)

    Piepers, S.; Peeters, K.; Opsomer, G.; Barkema, H.W.; Frankena, K.; Vliegher, de S.

    2011-01-01

    Risk factors for intramammary infections caused by coagulase-negative staphylococci, contagious major pathogens and environmental major pathogens in early lactating heifers were evaluated at the herd, heifer and quarter levels. In total, 764 quarters of 191 dairy heifers in 20 randomly selected

  5. Panax ginseng has anti-infective activity against opportunistic pathogen Pseudomonas aeruginosa by inhibiting quorum sensing, a bacterial communication process critical for establishing infection

    DEFF Research Database (Denmark)

    Song, Z; Kong, K F; Wu, H

    2010-01-01

    Virulent factors produced by pathogens play an important role in the infectious process, which is regulated by a cell-to-cell communication mechanism called quorum sensing (QS). Pseudomonas aeruginosa is an important opportunistic human pathogen, which causes infections in patients with compromis...

  6. The nonstructural proteins of Nipah virus play a key role in pathogenicity in experimentally infected animals.

    Directory of Open Access Journals (Sweden)

    Misako Yoneda

    Full Text Available Nipah virus (NiV P gene encodes P protein and three accessory proteins (V, C and W. It has been reported that all four P gene products have IFN antagonist activity when the proteins were transiently expressed. However, the role of those accessory proteins in natural infection with NiV remains unknown. We generated recombinant NiVs lacking V, C or W protein, rNiV(V-, rNiV(C-, and rNiV(W-, respectively, to analyze the functions of these proteins in infected cells and the implications in in vivo pathogenicity. All the recombinants grew well in cell culture, although the maximum titers of rNiV(V- and rNiV(C- were lower than the other recombinants. The rNiV(V-, rNiV(C- and rNiV(W- suppressed the IFN response as well as the parental rNiV, thereby indicating that the lack of each accessory protein does not significantly affect the inhibition of IFN signaling in infected cells. In experimentally infected golden hamsters, rNiV(V- and rNiV(C- but not the rNiV(W- virus showed a significant reduction in virulence. These results suggest that V and C proteins play key roles in NiV pathogenicity, and the roles are independent of their IFN-antagonist activity. This is the first report that identifies the molecular determinants of NiV in pathogenicity in vivo.

  7. Metabolic investigation of host/pathogen interaction using MS2-infected Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jain Rishi

    2009-12-01

    Full Text Available Abstract Background RNA viruses are responsible for a variety of illnesses among people, including but not limited to the common cold, the flu, HIV, and ebola. Developing new drugs and new strategies for treating diseases caused by these viruses can be an expensive and time-consuming process. Mathematical modeling may be used to elucidate host-pathogen interactions and highlight potential targets for drug development, as well providing the basis for optimizing patient treatment strategies. The purpose of this work was to determine whether a genome-scale modeling approach could be used to understand how metabolism is impacted by the host-pathogen interaction during a viral infection. Escherichia coli/MS2 was used as the host-pathogen model system as MS2 is easy to work with, harmless to humans, but shares many features with eukaryotic viruses. In addition, the genome-scale metabolic model of E. coli is the most comprehensive model at this time. Results Employing a metabolic modeling strategy known as "flux balance analysis" coupled with experimental studies, we were able to predict how viral infection would alter bacterial metabolism. Based on our simulations, we predicted that cell growth and biosynthesis of the cell wall would be halted. Furthermore, we predicted a substantial increase in metabolic activity of the pentose phosphate pathway as a means to enhance viral biosynthesis, while a break down in the citric acid cycle was predicted. Also, no changes were predicted in the glycolytic pathway. Conclusions Through our approach, we have developed a technique of modeling virus-infected host metabolism and have investigated the metabolic effects of viral infection. These studies may provide insight into how to design better drugs. They also illustrate the potential of extending such metabolic analysis to higher order organisms, including humans.

  8. Anaplasma phagocytophilum MSP4 and HSP70 Proteins Are Involved in Interactions with Host Cells during Pathogen Infection

    Directory of Open Access Journals (Sweden)

    Marinela Contreras

    2017-07-01

    Full Text Available Anaplasma phagocytophilum transmembrane and surface proteins play a role during infection and multiplication in host neutrophils and tick vector cells. Recently, A. phagocytophilum Major surface protein 4 (MSP4 and Heat shock protein 70 (HSP70 were shown to be localized on the bacterial membrane, with a possible role during pathogen infection in ticks. In this study, we hypothesized that A. phagocytophilum MSP4 and HSP70 have similar functions in tick-pathogen and host-pathogen interactions. To address this hypothesis, herein we characterized the role of these bacterial proteins in interaction and infection of vertebrate host cells. The results showed that A. phagocytophilum MSP4 and HSP70 are involved in host-pathogen interactions, with a role for HSP70 during pathogen infection. The analysis of the potential protective capacity of MSP4 and MSP4-HSP70 antigens in immunized sheep showed that MSP4-HSP70 was only partially protective against pathogen infection. This limited protection may be associated with several factors, including the recognition of non-protective epitopes by IgG in immunized lambs. Nevertheless, these antigens may be combined with other candidate protective antigens for the development of vaccines for the control of human and animal granulocytic anaplasmosis. Focusing on the characterization of host protective immune mechanisms and protein-protein interactions at the host-pathogen interface may lead to the discovery and design of new effective protective antigens.

  9. Experimental infection of highly pathogenic avian influenza virus H5N1 in black-headed gulls (Chroicocephalus ridibundus)

    OpenAIRE

    Ramis , Antonio; van Amerongen , Geert; van de Bildt , Marco; Leijten , Loneke; Vanderstichel , Raphael; Osterhaus , Albert; Kuiken , Thijs

    2014-01-01

    Historically, highly pathogenic avian influenza viruses (HPAIV) rarely resulted in infection or clinical disease in wild birds. However, since 2002, disease and mortality from natural HPAIV H5N1 infection have been observed in wild birds including gulls. We performed an experimental HPAIV H5N1 infection of black-headed gulls (Chroicocephalus ridibundus) to determine their susceptibility to infection and disease from this virus, pattern of viral shedding, clinical signs, pathological changes a...

  10. AMPK in Pathogens.

    Science.gov (United States)

    Mesquita, Inês; Moreira, Diana; Sampaio-Marques, Belém; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo

    2016-01-01

    During host-pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recognized to play an important role in microbial growth and persistence. Extensive studies have documented the role of AMP-activated protein kinase (AMPK) signaling, a central cellular hub involved in the regulation of energy homeostasis, in host-pathogen interactions. Here, we highlight the most recent advances detailing how pathogens hijack cellular metabolism by suppressing or increasing the activity of the host energy sensor AMPK. We also address the role of lower eukaryote AMPK orthologues in the adaptive process to the host microenvironment and their contribution for pathogen survival, differentiation, and growth. Finally, we review the effects of pharmacological or genetic AMPK modulation on pathogen growth and persistence.

  11. Immunomodulatory role for membrane vesicles released by THP-1 macrophages and respiratory pathogens during macrophage infection.

    Science.gov (United States)

    Volgers, Charlotte; Benedikter, Birke J; Grauls, Gert E; Savelkoul, Paul H M; Stassen, Frank R M

    2017-11-13

    During infection, inflammation is partially driven by the release of mediators which facilitate intercellular communication. Amongst these mediators are small membrane vesicles (MVs) that can be released by both host cells and Gram-negative and -positive bacteria. Bacterial membrane vesicles are known to exert immuno-modulatory and -stimulatory actions. Moreover, it has been proposed that host cell-derived vesicles, released during infection, also have immunostimulatory properties. In this study, we assessed the release and activity of host cell-derived and bacterial MVs during the first hours following infection of THP-1 macrophages with the common respiratory pathogens non-typeable Haemophilus influenzae, Moraxella catarrhalis, Streptococcus pneumoniae, and Pseudomonas aeruginosa. Using a combination of flow cytometry, tunable resistive pulse sensing (TRPS)-based analysis and electron microscopy, we demonstrated that the release of MVs occurs by both host cells and bacteria during infection. MVs released during infection and bacterial culture were found to induce a strong pro-inflammatory response by naive THP-1 macrophages. Yet, these MVs were also found to induce tolerance of host cells to secondary immunogenic stimuli and to enhance bacterial adherence and the number of intracellular bacteria. Bacterial MVs may play a dual role during infection, as they can both trigger and dampen immune responses thereby contributing to immune defence and bacterial survival.

  12. Spleen transcriptome response to infection with avian pathogenic Escherichia coli in broiler chickens.

    Science.gov (United States)

    Sandford, Erin E; Orr, Megan; Balfanz, Emma; Bowerman, Nate; Li, Xianyao; Zhou, Huaijun; Johnson, Timothy J; Kariyawasam, Subhashinie; Liu, Peng; Nolan, Lisa K; Lamont, Susan J

    2011-09-27

    Avian pathogenic Escherichia coli (APEC) is detrimental to poultry health and its zoonotic potential is a food safety concern. Regulation of antimicrobials in food-production animals has put greater focus on enhancing host resistance to bacterial infections through genetics. To better define effective mechanism of host resistance, global gene expression in the spleen of chickens, harvested at two times post-infection (PI) with APEC, was measured using microarray technology, in a design that will enable investigation of effects of vaccination, challenge, and pathology level. There were 1,101 genes significantly differentially expressed between severely infected and non-infected groups on day 1 PI and 1,723 on day 5 PI. Very little difference was seen between mildly infected and non-infected groups on either time point. Between birds exhibiting mild and severe pathology, there were 2 significantly differentially expressed genes on day 1 PI and 799 on day 5 PI. Groups with greater pathology had more genes with increased expression than decreased expression levels. Several predominate immune pathways, Toll-like receptor, Jak-STAT, and cytokine signaling, were represented between challenged and non-challenged groups. Vaccination had, surprisingly, no detectible effect on gene expression, although it significantly protected the birds from observable gross lesions. Functional characterization of significantly expressed genes revealed unique gene ontology classifications during each time point, with many unique to a particular treatment or class contrast. More severe pathology caused by APEC infection was associated with a high level of gene expression differences and increase in gene expression levels. Many of the significantly differentially expressed genes were unique to a particular treatment, pathology level or time point. The present study not only investigates the transcriptomic regulations of APEC infection, but also the degree of pathology associated with that

  13. Spleen transcriptome response to infection with avian pathogenic Escherichia coli in broiler chickens

    Directory of Open Access Journals (Sweden)

    Kariyawasam Subhashinie

    2011-09-01

    Full Text Available Abstract Background Avian pathogenic Escherichia coli (APEC is detrimental to poultry health and its zoonotic potential is a food safety concern. Regulation of antimicrobials in food-production animals has put greater focus on enhancing host resistance to bacterial infections through genetics. To better define effective mechanism of host resistance, global gene expression in the spleen of chickens, harvested at two times post-infection (PI with APEC, was measured using microarray technology, in a design that will enable investigation of effects of vaccination, challenge, and pathology level. Results There were 1,101 genes significantly differentially expressed between severely infected and non-infected groups on day 1 PI and 1,723 on day 5 PI. Very little difference was seen between mildly infected and non-infected groups on either time point. Between birds exhibiting mild and severe pathology, there were 2 significantly differentially expressed genes on day 1 PI and 799 on day 5 PI. Groups with greater pathology had more genes with increased expression than decreased expression levels. Several predominate immune pathways, Toll-like receptor, Jak-STAT, and cytokine signaling, were represented between challenged and non-challenged groups. Vaccination had, surprisingly, no detectible effect on gene expression, although it significantly protected the birds from observable gross lesions. Functional characterization of significantly expressed genes revealed unique gene ontology classifications during each time point, with many unique to a particular treatment or class contrast. Conclusions More severe pathology caused by APEC infection was associated with a high level of gene expression differences and increase in gene expression levels. Many of the significantly differentially expressed genes were unique to a particular treatment, pathology level or time point. The present study not only investigates the transcriptomic regulations of APEC infection

  14. Experimental infection of chicken embryos with recently described Brucella microti: Pathogenicity and pathological findings.

    Science.gov (United States)

    Wareth, Gamal; Böttcher, Denny; Melzer, Falk; Shehata, Awad Ali; Roesler, Uwe; Neubauer, Heinrich; Schoon, Heinz-Adolf

    2015-08-01

    Brucellae are facultative intracellular pathogens causing disease in a wide range of domestic and wild animals as well as in humans. Brucella (B.) microti is a recently recognized species and was isolated from common voles (Microtus arvalis), red foxes and soil in Austria and the Czech Republic. Its pathogenicity for livestock and its zoonotic potential has not been confirmed yet. In the present study 25 SPF chicken embryos were inoculated at day 11 of age with 1.6×10(3) and 1.6×10(5)B. microti by yolk sac and allantoic sac routes. Re-isolation of B. microti indicated rapid multiplication of bacteria (up to 1.7×10(12)CFU). B. microti provoked marked gross lesions, i.e. hemorrhages and necroses. All inoculated embryos were dead (100% mortality) in between 2nd and 4th day post inoculation. The predominant histopathological lesion was necroses in liver, kidneys, lungs, spleen, gastrointestinal tract, spinal meninges, yolk sac and chorioallantoic membrane. Immunohistochemical examination showed the presence of Brucella antigen in nearly all of these organs, with infection being mainly restricted to non-epithelial cells or tissues. This study provides the first results on the multiplication and pathogenicity of the mouse pathogenic B. microti in chicken embryos. These data suggest that, even though chicken are not mammals, they could provide a useful tool for understanding the pathogenesis of B. microti associated disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Pathogenic Events in a Nonhuman Primate Model of Oral Poliovirus Infection Leading to Paralytic Poliomyelitis.

    Science.gov (United States)

    Shen, Ling; Chen, Crystal Y; Huang, Dan; Wang, Richard; Zhang, Meihong; Qian, Lixia; Zhu, Yanfen; Zhang, Alvin Zhuoran; Yang, Enzhuo; Qaqish, Arwa; Chumakov, Konstantin; Kouiavskaia, Diana; Vignuzzi, Marco; Nathanson, Neal; Macadam, Andrew J; Andino, Raul; Kew, Olen; Xu, Junfa; Chen, Zheng W

    2017-07-15

    Despite a great deal of prior research, the early pathogenic events in natural oral poliovirus infection remain poorly defined. To establish a model for study, we infected 39 macaques by feeding them single high doses of the virulent Mahoney strain of wild type 1 poliovirus. Doses ranging from 10 7 to 10 9 50% tissue culture infective doses (TCID 50 ) consistently infected all the animals, and many monkeys receiving 10 8 or 10 9 TCID 50 developed paralysis. There was no apparent difference in the susceptibilities of the three macaque species (rhesus, cynomolgus, and bonnet) used. Virus excretion in stool and nasopharynges was consistently observed, with occasional viremia, and virus was isolated from tonsils, gut mucosa, and draining lymph nodes. Viral replication proteins were detected in both epithelial and lymphoid cell populations expressing CD155 in the tonsil and intestine, as well as in spinal cord neurons. Necrosis was observed in these three cell types, and viral replication in the tonsil/gut was associated with histopathologic destruction and inflammation. The sustained response of neutralizing antibody correlated temporally with resolution of viremia and termination of virus shedding in oropharynges and feces. For the first time, this model demonstrates that early in the infectious process, poliovirus replication occurs in both epithelial cells (explaining virus shedding in the gastrointestinal tract) and lymphoid/monocytic cells in tonsils and Peyer's patches (explaining viremia), extending previous studies of poliovirus pathogenesis in humans. Because the model recapitulates human poliovirus infection and poliomyelitis, it can be used to study polio pathogenesis and to assess the efficacy of candidate antiviral drugs and new vaccines. IMPORTANCE Early pathogenic events of poliovirus infection remain largely undefined, and there is a lack of animal models mimicking natural oral human infection leading to paralytic poliomyelitis. All 39 macaques fed with

  16. PCR-based identification of selected pathogens associated with endodontic infections in deciduous and permanent teeth.

    Science.gov (United States)

    Cogulu, Dilsah; Uzel, Atac; Oncag, Ozant; Eronat, Cemal

    2008-09-01

    The aim of the present study was to evaluate the presence of the selected pathogens in samples from deciduous and permanent tooth root canals by using PCR method and to determine the association of these organisms with clinical symptoms. A total of 145 children, 5 to 13 years old, were involved in this study. The presence of selected pathogens (Actinomyces israelii, Candida albicans, Enterococcus faecalis, Fusobacterium nucleatum, Porphyromonas endodontalis, Porphyromonas gingivalis, Prevotella intermedia, Streptococcus intermedius, Treponema denticola, Parvimonas micra, Tannerella forsythensis, Enterococcus faecium, Prevotella melaninogenica) in infected root canals was studied using PCR. T. denticola (P = .012, .02) and E. faecalis (P = .012, .04) were highly associated with periapical radiolucency and previous pain, while P. gingivalis was associated with tenderness to percussion in both deciduous and permanent teeth (P = .01, .015). The results of the present study confirm that certain species of microorganisms are associated with clinical signs and symptoms of endodontic disease in both deciduous and permanent teeth.

  17. Diversity and relative abundance of the bacterial pathogen, Flavobacterium spp., infecting reproductive ecotypes of kokanee salmon.

    Science.gov (United States)

    Lemay, Matthew A; Russello, Michael A

    2014-11-04

    Understanding the distribution and abundance of pathogens can provide insight into the evolution and ecology of their host species. Previous research in kokanee, the freshwater form of sockeye salmon (Oncorhynchus nerka), found evidence that populations spawning in streams may experience a greater pathogen load compared with populations that spawn on beaches. In this study we tested for differences in the abundance and diversity of the gram-negative bacteria, Flavobacterium spp., infecting tissues of kokanee in both of these spawning habitats (streams and beaches). Molecular assays were carried out using primers designed to amplify a ~200 nucleotide region of the gene encoding the ATP synthase alpha subunit (AtpA) within the genus Flavobacterium. Using a combination of DNA sequencing and quantitative PCR (qPCR) we compared the diversity and relative abundance of Flavobacterium AtpA amplicons present in DNA extracted from tissue samples of kokanee collected from each spawning habitat. We identified 10 Flavobacterium AtpA haplotypes among the tissues of stream-spawning kokanee and seven haplotypes among the tissues of beach-spawning kokanee, with only two haplotypes shared between spawning habitats. Haplotypes occurring in the same clade as F. psychrophilum were the most prevalent (92% of all reads, 60% of all haplotypes), and occurred in kokanee from both spawning habitats (streams and beaches). Subsequent qPCR assays did not find any significant difference in the relative abundance of Flavobacterium AtpA amplicons between samples from the different spawning habitats. We confirmed the presence of Flavobacterium spp. in both spawning habitats and found weak evidence for increased Flavobacterium diversity in kokanee sampled from stream-spawning sites. However, the quantity of Flavobacterium DNA did not differ between spawning habitats. We recommend further study aimed at quantifying pathogen diversity and abundance in population-level samples of kokanee combined with

  18. Interchromosomal Transfer of Immune Regulation During Infection of Barley with the Powdery Mildew Pathogen

    Directory of Open Access Journals (Sweden)

    Priyanka Surana

    2017-10-01

    Full Text Available Powdery mildew pathogens colonize over 9500 plant species, causing critical yield loss. The Ascomycete fungus, Blumeria graminis f. sp. hordei (Bgh, causes powdery mildew disease in barley (Hordeum vulgare L.. Successful infection begins with penetration of host epidermal cells, culminating in haustorial feeding structures, facilitating delivery of fungal effectors to the plant and exchange of nutrients from host to pathogen. We used expression Quantitative Trait Locus (eQTL analysis to dissect the temporal control of immunity-associated gene expression in a doubled haploid barley population challenged with Bgh. Two highly significant regions possessing trans eQTL were identified near the telomeric ends of chromosomes (Chr 2HL and 1HS. Within these regions reside diverse resistance loci derived from barley landrace H. laevigatum (MlLa and H. vulgare cv. Algerian (Mla1, which associate with the altered expression of 961 and 3296 genes during fungal penetration of the host and haustorial development, respectively. Regulatory control of transcript levels for 299 of the 961 genes is reprioritized from MlLa on 2HL to Mla1 on 1HS as infection progresses, with 292 of the 299 alternating the allele responsible for higher expression, including Adaptin Protein-2 subunit μ AP2M and Vesicle Associated Membrane Protein VAMP72 subfamily members VAMP721/722. AP2M mediates effector-triggered immunity (ETI via endocytosis of plasma membrane receptor components. VAMP721/722 and SNAP33 form a Soluble N-ethylmaleimide-sensitive factor Attachment Protein REceptor (SNARE complex with SYP121 (PEN1, which is engaged in pathogen associated molecular pattern (PAMP-triggered immunity via exocytosis. We postulate that genes regulated by alternate chromosomal positions are repurposed as part of a conserved immune complex to respond to different pathogen attack scenarios.

  19. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy

    2010-06-01

    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  20. Interchromosomal Transfer of Immune Regulation During Infection of Barley with the Powdery Mildew Pathogen

    Science.gov (United States)

    Surana, Priyanka; Xu, Ruo; Fuerst, Gregory; Chapman, Antony V. E.; Nettleton, Dan; Wise, Roger P.

    2017-01-01

    Powdery mildew pathogens colonize over 9500 plant species, causing critical yield loss. The Ascomycete fungus, Blumeria graminis f. sp. hordei (Bgh), causes powdery mildew disease in barley (Hordeum vulgare L.). Successful infection begins with penetration of host epidermal cells, culminating in haustorial feeding structures, facilitating delivery of fungal effectors to the plant and exchange of nutrients from host to pathogen. We used expression Quantitative Trait Locus (eQTL) analysis to dissect the temporal control of immunity-associated gene expression in a doubled haploid barley population challenged with Bgh. Two highly significant regions possessing trans eQTL were identified near the telomeric ends of chromosomes (Chr) 2HL and 1HS. Within these regions reside diverse resistance loci derived from barley landrace H. laevigatum (MlLa) and H. vulgare cv. Algerian (Mla1), which associate with the altered expression of 961 and 3296 genes during fungal penetration of the host and haustorial development, respectively. Regulatory control of transcript levels for 299 of the 961 genes is reprioritized from MlLa on 2HL to Mla1 on 1HS as infection progresses, with 292 of the 299 alternating the allele responsible for higher expression, including Adaptin Protein-2 subunit μ AP2M and Vesicle Associated Membrane Protein VAMP72 subfamily members VAMP721/722. AP2M mediates effector-triggered immunity (ETI) via endocytosis of plasma membrane receptor components. VAMP721/722 and SNAP33 form a Soluble N-ethylmaleimide-sensitive factor Attachment Protein REceptor (SNARE) complex with SYP121 (PEN1), which is engaged in pathogen associated molecular pattern (PAMP)-triggered immunity via exocytosis. We postulate that genes regulated by alternate chromosomal positions are repurposed as part of a conserved immune complex to respond to different pathogen attack scenarios. PMID:28790145

  1. Evaluation of biocontrol agents for grapevine pruning wound protection against trunk pathogen infection.

    Directory of Open Access Journals (Sweden)

    Charl KOTZE

    2011-12-01

    Full Text Available Trunk diseases of grapevine are caused by numerous pathogens, including Eutypa lata, Phaeomoniella chlamydospora, and species of Botryosphaeriaceae (incl. Botryosphaeria and aggregate genera, Phomopsis and Phaeoacremonium. Since infections occur mainly through pruning wounds, that have been shown by previous research to stay susceptible for up to 16 weeks after pruning, long-term pruning wound protection is required for prevention of infection. This study evaluated several biocontrol agents against a range of trunk disease pathogens in dual plate laboratory trials to determine macroscopic and microscopic interactions. The biocontrol agents had a substantial effect on all the pathogens, with a wide range of macroscopic and microscopic interactions observed. The best performing biocontrol agents were tested in two field trials. Fresh pruning wounds were treated with benomyl, Trichoderma products (Biotricho®, Vinevax® and ECO 77® and isolates (USPP-T1 and -T2, identified as T. atroviride and Bacillus subtilis. Seven days after treatment the pruning wounds were inoculated by spraying with spore suspensions of Neofusicoccum australe, N. parvum, Diplodia seriata, Lasiodiplodia theobromae, Eutypa lata, Phaeomoniella chlamydospora or Phomopsis viticola. Eight months after inoculation, the treatments were evaluated by isolation onto potato dextrose agar. The efficacy of the biocontrol agents was in most cases similar or superior to that observed for benomyl. Isolate USPP-T1, in particular, was very effective, reducing incidence of Ph. viticola, E. lata, Pa. chlamydospora, N. australe, N. parvum, D. seriata and L. theobromae by 69, 76, 77, 78, 80, 85 and 92%, respectively. This is the first report of biological protection of grapevine pruning wounds against this group of grapevine trunk disease pathogens.

  2. Autoimmunity in Rheumatic Diseases Is Induced by Microbial Infections via Crossreactivity or Molecular Mimicry

    Directory of Open Access Journals (Sweden)

    Taha Rashid

    2012-01-01

    Full Text Available A general consensus supports fundamental roles for both genetic and environmental, mainly microbial, factors in the development of autoimmune diseases. One form of autoimmune rheumatic diseases is confined to a group of nonpyogenic conditions which are usually preceded by or associated with either explicit or occult infections. A previous history of clinical pharyngitis, gastroenteritis/urethritis, or tick-borne skin manifestation can be obtained from patients with rheumatic fever, reactive arthritis, or Lyme disease, respectively, whilst, other rheumatic diseases like rheumatoid arthritis (RA, ankylosing spondylitis (AS, and Crohn’s disease (CD are usually lacking such an association with a noticeable microbial infection. A great amount of data supports the notion that RA is most likely caused by Proteus asymptomatic urinary tract infections, whilst AS and CD are caused by subclinical bowel infections with Klebsiella microbes. Molecular mimicry is the main pathogenetic mechanism that can explain these forms of microbe-disease associations, where the causative microbes can initiate the disease with consequent productions of antibacterial and crossreactive autoantibodies which have a great impact in the propagation and the development of these diseases.

  3. Infectivity and pathogenicity of the oomycete Aphanomyces invadans in Atlantic menhaden Brevoortia tyrannus

    Science.gov (United States)

    Kiryu, Y.; Shields, J.D.; Vogelbein, W.K.; Kator, H.; Blazer, V.S.

    2003-01-01

    Atlantic menhaden Brevoortia tyrannus develop characteristic skin ulcers in response to infection by the oomycete Aphanomyces invadans. To investigate pathogenicity, we conducted a dose response study. Juvenile menhaden were inoculated subcutaneously with 0, 1, 5, 10, 100, and 500 secondary zoospores per fish and monitored for 37 d post-injection (p.i.). Survival rates declined with increasing zoospore dose, with significantly different survivorship curves for the different doses. Moribund and dead fish exhibited characteristic ulcerous lesions at the injection site starting at 13 d p.i. None of the sham-injected control fish (0 zoospore treatment) died. The LD50 (lethal dose killing 50% of exposed menhaden) for inoculated fish was estimated at 9.7 zoospores; however, some fish receiving an estimated single zoospore developed infections that resulted in death. Menhaden were also challenged by aqueous exposure and confirmed that A. invadans was highly pathogenic by this more environmentally realistic route. Fish that were acclimated to culture conditions for 30 d, and presumably free of skin damage, then aqueously exposed to 100 zoospores ml-1, exhibited 14% lesion prevalence with 11% mortality. Net-handled fish that were similarly infected had a significantly higher lesion prevalence (64%) and mortality (64%). Control fish developed no lesions and did not die. Scanning electron microscopy of fish skin indicated that zoospores adhered to intact epidermis, germinated and penetrated the epithelium with a germ tube. Our results indicate that A. invadans is a primary pathogen of menhaden and is able to cause disease at very low zoospore concentrations.

  4. Fighting infections due to multidrug-resistant Gram-positive pathogens.

    Science.gov (United States)

    Cornaglia, G

    2009-03-01

    Growing bacterial resistance in Gram-positive pathogens means that what were once effective and inexpensive treatments for infections caused by these bacteria are now being seriously questioned, including penicillin and macrolides for use against pneumococcal infections and-in hospitals-oxacillin for use against staphylococcal infections. As a whole, multidrug-resistant (MDR) Gram-positive pathogens are rapidly becoming an urgent and sometimes unmanageable clinical problem. Nevertheless, and despite decades of research into the effects of antibiotics, the actual risk posed to human health by antibiotic resistance has been poorly defined; the lack of reliable data concerning the outcomes resulting from antimicrobial resistance stems, in part, from problems with study designs and the methods used in resistence determination. Surprisingly little is known, too, about the actual effectiveness of the many types of intervention aimed at controlling antibiotic resistance. New antibiotics active against MDR Gram-positive pathogens have been recently introduced into clinical practice, and the antibiotic pipeline contains additional compounds at an advanced stage of development, including new glycopeptides, new anti-methicillin-resistant Staphylococcus aureus (MRSA) beta-lactams, and new diaminopyrimidines. Many novel antimicrobial agents are likely to be niche products, endowed with narrow antibacterial spectra and/or targeted at specific clinical problems. Therefore, an important educational goal will be to change the current, long-lasting attitudes of both physicians and customers towards broad-spectrum and multipurpose compounds. Scientific societies, such as the European Society of Clinical Microbiology and Infectious Diseases (ESCMID), must play a leading role in this process.

  5. Sequence of pathogenic events in cynomolgus macaques infected with aerosolized monkeypox virus.

    Science.gov (United States)

    Tree, J A; Hall, G; Pearson, G; Rayner, E; Graham, V A; Steeds, K; Bewley, K R; Hatch, G J; Dennis, M; Taylor, I; Roberts, A D; Funnell, S G P; Vipond, J

    2015-04-01

    To evaluate new vaccines when human efficacy studies are not possible, the FDA's "Animal Rule" requires well-characterized models of infection. Thus, in the present study, the early pathogenic events of monkeypox infection in nonhuman primates, a surrogate for variola virus infection, were characterized. Cynomolgus macaques were exposed to aerosolized monkeypox virus (10(5) PFU). Clinical observations, viral loads, immune responses, and pathological changes were examined on days 2, 4, 6, 8, 10, and 12 postchallenge. Viral DNA (vDNA) was detected in the lungs on day 2 postchallenge, and viral antigen was detected, by immunostaining, in the epithelium of bronchi, bronchioles, and alveolar walls. Lesions comprised rare foci of dysplastic and sloughed cells in respiratory bronchioles. By day 4, vDNA was detected in the throat, tonsil, and spleen, and monkeypox antigen was detected in the lung, hilar and submandibular lymph nodes, spleen, and colon. Lung lesions comprised focal epithelial necrosis and inflammation. Body temperature peaked on day 6, pox lesions appeared on the skin, and lesions, with positive immunostaining, were present in the lung, tonsil, spleen, lymph nodes, and colon. By day 8, vDNA was present in 9/13 tissues. Blood concentrations of interleukin 1ra (IL-1ra), IL-6, and gamma interferon (IFN-γ) increased markedly. By day 10, circulating IgG antibody concentrations increased, and on day 12, animals showed early signs of recovery. These results define early events occurring in an inhalational macaque monkeypox infection model, supporting its use as a surrogate model for human smallpox. Bioterrorism poses a major threat to public health, as the deliberate release of infectious agents, such smallpox or a related virus, monkeypox, would have catastrophic consequences. The development and testing of new medical countermeasures, e.g., vaccines, are thus priorities; however, tests for efficacy in humans cannot be performed because it would be unethical and

  6. Pathogen infection distribution and drug resistance analysis of patients with severe liver disease

    Directory of Open Access Journals (Sweden)

    Xi CHEN

    2018-04-01

    Full Text Available Objective To explore the infection distribution and drug resistance of pathogens in patients with severe liver disease, and provide reference for clinical medication. Methods Retrospective analysis of the microbiological specimens from patients with severe liver disease in Department of Infection of our hospital from August 2014 to November 2016 and the drug susceptibility testing were carried out by means of K-B disc diffusion method after bacterial culturing, and the distribution and drug resistance of pathogens were analyzed. Results Totally 17 of 73 patients with severe liver disease developed hospital infection (23.3%. 104 strains of bacteria were isolated and 78 strains out of them were multidrug-resistant bacteria (75.0%. Among them, 28(26.9% strains were gram-positive coccus, mainly consisting of Staphylococcus aureus and Staphylococcus epidermidis, and 58(55.8% were gram-negative coccus, mainly composed of Escherichia coli, Klebsiella pneumonia and Acinetobacter baumannii, and 18(17.3% strains fungi. S.aureus and enterococci were resistant to penicillin, erythromycin and levofloxacin, the resistance rates were above 80.0%, but had low resistance rates to vancomycin, teicoplanin and tigecycline. The resistance rates of E.coli and K.pneumoniae to piperacillin, cefazolin and cefuroxime sodium were above 85.0%, but they had lower resistance rates to tigecycline and amikacin. Acinetobacter baumannii was 100% resistant to piperacillin and tazobactam, ceftazidime, imipenem and amikacin, but had low resistance to tigecycline and minocycline. Conclusions Multi-drug resistant bacteria are the main bacterial pathogens in patients with severe liver disease and have a high resistance rate to commonly used antibiotics, empirical treatment in the population at high risk of multidrug-resistant bacteria infections requires the use of broad-spectrum or high-grade antibiotics (e.g. carbapenems or tigecycline and drugs against specific pathogenic

  7. Host-derived, pore-forming toxin-like protein and trefoil factor complex protects the host against microbial infection.

    Science.gov (United States)

    Xiang, Yang; Yan, Chao; Guo, Xiaolong; Zhou, Kaifeng; Li, Sheng'an; Gao, Qian; Wang, Xuan; Zhao, Feng; Liu, Jie; Lee, Wen-Hui; Zhang, Yun

    2014-05-06

    Aerolysins are virulence factors belonging to the bacterial β-pore-forming toxin superfamily. Surprisingly, numerous aerolysin-like proteins exist in vertebrates, but their biological functions are unknown. βγ-CAT, a complex of an aerolysin-like protein subunit (two βγ-crystallin domains followed by an aerolysin pore-forming domain) and two trefoil factor subunits, has been identified in frogs (Bombina maxima) skin secretions. Here, we report the rich expression of this protein, in the frog blood and immune-related tissues, and the induction of its presence in peritoneal lavage by bacterial challenge. This phenomena raises the possibility of its involvement in antimicrobial infection. When βγ-CAT was administrated in a peritoneal infection model, it greatly accelerated bacterial clearance and increased the survival rate of both frogs and mice. Meanwhile, accelerated Interleukin-1β release and enhanced local leukocyte recruitments were determined, which may partially explain the robust and effective antimicrobial responses observed. The release of interleukin-1β was potently triggered by βγ-CAT from the frog peritoneal cells and murine macrophages in vitro. βγ-CAT was rapidly endocytosed and translocated to lysosomes, where it formed high molecular mass SDS-stable oligomers (>170 kDa). Lysosomal destabilization and cathepsin B release were detected, which may explain the activation of caspase-1 inflammasome and subsequent interleukin-1β maturation and release. To our knowledge, these results provide the first functional evidence of the ability of a host-derived aerolysin-like protein to counter microbial infection by eliciting rapid and effective host innate immune responses. The findings will also largely help to elucidate the possible involvement and action mechanisms of aerolysin-like proteins and/or trefoil factors widely existing in vertebrates in the host defense against pathogens.

  8. Examining the effect of intramammary infections with minor mastitis pathogens on the acquisition of new intramammary infections with major mastitis pathogens--a systematic review and meta-analysis.

    Science.gov (United States)

    Reyher, K K; Haine, D; Dohoo, I R; Revie, C W

    2012-11-01

    Major mastitis pathogens such as Staphylococcus aureus, Streptococcus agalactiae, Streptococcus uberis, Streptococcus dysgalactiae, and the coliforms are usually considered more virulent and damaging to the udder than minor mastitis pathogens such as Corynebacterium bovis and coagulase-negative staphylococci (CNS). The current literature contains several studies detailing analyses with conflicting results as to whether intramammary infection (IMI) with the minor pathogens decreases, increases, or has no effect on the risk of a quarter acquiring a new intramammary infection (NIMI) with a major pathogen. To investigate the available scientific evidence regarding the effect of IMI with minor pathogens on the acquisition of NIMI with major pathogens, a systematic review and meta-analysis were conducted. The total extant English- and French-language literature in electronic databases was searched and all publications cited by relevant papers were investigated. Results from 68 studies were extracted from 38 relevant papers. Random-effects models were used to investigate the effects of CNS and C. bovis on acquisition of new IMI with any of the major pathogens, as well as individually for the minor pathogens and Staph. aureus. Significant heterogeneity among studies exists, some of which could be accounted for by using meta-regression. Overall, observational studies showed no effect, whereas challenge studies showed strong and significant protective effects, specifically when major pathogens were introduced into the mammary gland via methods bypassing the teat end. Underlying risk can account for several unmeasured factors, and studies with higher underlying risk found more protective effects of minor pathogens. Larger doses of challenge organisms reduced the protective effect of minor pathogens, and studies with more stringent diagnostic criteria for pathogen IMI identified less protection. Smaller studies (those utilizing fewer than 40 cows) also showed a greater

  9. The onset of virus shedding and clinical signs in chickens infected with high-pathogenicity and low-pathogenicity avian influenza viruses.

    Science.gov (United States)

    Spickler, Anna R; Trampel, Darrell W; Roth, James A

    2008-12-01

    Some avian influenza viruses may be transmissible to mammals by ingestion. Cats and dogs have been infected by H5N1 avian influenza viruses when they ate raw poultry, and two human H5N1 infections were linked to the ingestion of uncooked duck blood. The possibility of zoonotic influenza from exposure to raw poultry products raises concerns about flocks with unrecognized infections. The present review examines the onset of virus shedding and the development of clinical signs for a variety of avian influenza viruses in chickens. In experimentally infected birds, some high-pathogenicity avian influenza (HPAI) and low-pathogenicity avian influenza (LPAI) viruses can occur in faeces and respiratory secretions as early as 1 to 2 days after inoculation. Some HPAI viruses have also been found in meat 1 day after inoculation and in eggs after 3 days. There is no evidence that LPAI viruses can be found in meat, and the risk of their occurrence in eggs is poorly understood. Studies in experimentally infected birds suggest that clinical signs usually develop within a few days of virus shedding; however, some models and outbreak descriptions suggest that clinical signs may not become evident for a week or more in some H5 or H7 HPAI-infected flocks. During this time, avian influenza viruses might be found in poultry products. LPAI viruses can be shed in asymptomatically infected or minimally affected flocks, but these viruses are unlikely to cause significant human disease.

  10. Near ultraviolet radiation (280-400 nm): Direct and indirect effects on microbial pathogens

    International Nuclear Information System (INIS)

    Asthana, A.

    1993-01-01

    Responses of pigmented pathogenic fungi and E. coli strains differing in DNA repair and catalase proficiency to direct and indirect effects of ultraviolet radiation were evaluated. Pigments in the four fungal pathogens of Citrus differed in their ability to protect against direct UV and damage by UV-A -mediated phototoxins of both host and non-host origin. UV-A and UV-B did not inactivate the fungal species. Differential protection in wild type strains of the two Fusarium spp. and in the wild type strains of the two Penicilium spp. against UV-C was observed. Wild type and mutants with altered coloration in Penicilium spp. protected to varying extent against both α-T and 8-MOP in the presence of UV-A. UV-B irradiation of E. coli resulted in inactivation of strains deficient in DNA excision repair. Plasmid DNA damaged in vitro by UV-B from lamp systems as well as by sunlight, and transformed in vivo into bacterial cells lacking specific nucleases showed reduced transformation in DNA excision repair strains. UV-B enriched wavelengths isolated from a solar simulator affected plasmid DNA in a similar manner as UV-B from lamp systems. Sunlight, however affected the membrane of whole cells. Concentration of foliar furanocoumarins of Citrus jambhiri decreased with UV-B irradiation. Phototoxicity to Fusarium spp. was accounted for, in part, by furanocoumarins, psoralen and bergapten (5-MOP) and others. Pure psoralen and 5-MOP affected both Fusarium spp. similarly and carotenoids protected only partially in the wild type strains. Citrus targetted the cell membrane in Fusarium spp.l and in E. coli strains; carotenoids in both of which protected against such damage. Loss in structural integrity of plasmid DNA when treated with citral and UV-A correlated with loss in transforming activity. Biological damage to membrane and DNA was due to the production of hydrogen peroxide. Fruit-rot pathogens Penicilium spp. were not affected by either furanocoumarins or citrals

  11. Experimental infection of highly pathogenic avian influenza virus H5N1 in black-headed gulls (Chroicocephalus ridibundus)

    NARCIS (Netherlands)

    A. Ramis (Antonio); G. van Amerongen (Geert); M.W.G. van de Bildt (Marco); L.M.E. Leijten (Lonneke); R. Vanderstichel (R.); A.D.M.E. Osterhaus (Albert); T. Kuiken (Thijs)

    2014-01-01

    textabstractHistorically, highly pathogenic avian influenza viruses (HPAIV) rarely resulted in infection or clinical disease in wild birds. However, since 2002, disease and mortality from natural HPAIV H5N1 infection have been observed in wild birds including gulls. We performed an experimental

  12. A model of the transmission of micro-organisms in a public setting and its correlation to pathogen infection risks.

    Science.gov (United States)

    Gerhardts, A; Hammer, T R; Balluff, C; Mucha, H; Hoefer, D

    2012-03-01

    Gastro-intestinal infections are widespread in the community and have considerable economic consequences. In this study, we followed chains of infection from a public toilet scenario, looking at infection risks by correlating the transmission of bacteria, fungi and viruses to our current knowledge of infectious doses. Transmission of Escherichia coli, Bacillus atrophaeus spores, Candida albicans and bacteriophage MS2 from hands to surfaces was examined in a transmission model, that is toilet brush, door handle to water tap. The load of viable pathogens was significantly reduced during transfer from hands to objects. Nevertheless, it was shown that pathogens were successfully transferred to other people in contagious doses by contact with contaminated surfaces. Our results suggest that infection risks are mainly dependent on current infectious doses of pathogens. For enteritic viruses or bacteria, for example Norovirus or EHEC, only a few particles or cells are sufficient for infection in public lavatories, thus bearing a high risk of infection for other persons. However, there seems to be only a low probability of becoming infected with pathogens that have a high infectious dose whilst sharing the same bathroom. The transmission model for micro-organisms enables a risk assessment of gastro-intestinal infections on the basis of a practical approach. © 2012 The Authors. Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

  13. The risk of pathogenic intestinal parasite infections in Kisii Municipality, Kenya

    Directory of Open Access Journals (Sweden)

    Kabiru Ephantus W

    2008-07-01

    Full Text Available Abstract Background Intestinal parasitic infections are among the most common infections worldwide. Various epidemiological studies indicate that the prevalence of intestinal parasites is high especially in developing countries, although in many of these, the environmental risk factors have not been clearly elucidated. The objective of this study was to determine the risk of pathogenic intestinal parasites infections in Kisii Municipality. Methods Random sampling was used in the selection of the study samples. Stool parasitological profiles of food handlers were done by direct smear and formalin-ethyl acetate sedimentation method. Both vegetable and meat samples were examined for the presence of intestinal parasites. The storage and meat handling practices of the various butcheries were observed. Results Types of samples examined for occurrence of intestinal parasites includes, a total of 84 vegetable, 440 meat and 168 stool samples. Fifty five (65.5% vegetable, 334 (75.9% meat and 69 (41.1% of the stool samples were found positive for intestinal parasites indicating a high overall risk (66.18% for intestinal parasite infections. Of the parasites detected, the most common parasites infesting the foodstuffs and infecting the food handlers were Ascaris lumbricoides and Entamoeba histolytica. Parasites were significantly less likely to be present on meat that was refrigerated during display than meat that was displayed at ambient temperature. Conclusion There is a high risk of infection with intestinal parasites in the sampled Municipal markets. About half of the food handlers surveyed (41.1 % at the Municipal Hospital had one or more parasitic infections. Furthermore, meat (65.5% and vegetables (75.9% sold at the Municipal market were found to be contaminated with parasites hence the inhabitants requires a need for education on food safety, good distribution practices and improvement on sanitary conditions.

  14. The causes and consequences of antibiotic resistance evolution in microbial pathogens

    DEFF Research Database (Denmark)

    Jochumsen, Nicholas

    pleiotropy as they conferred a decreased growth rate in the absence of colistin and also rendered the colistin resistant strains susceptible towards all tested classes of β-lactams. The results suggest that colistin/β-lactam combination therapy could be used to reduce the risk of resistance evolution during......The evolution of antimicrobial resistance in bacterial pathogens is a growing global health problem that is gradually making the successful treatment of infectious diseases more difficult. Antimicrobial peptides have been proposed as promising candidates for future drug development as they retain...... activity against bacteria resistant to conventional antibiotics and because resistance evolution is expected to be unlikely since the peptides have complex modes of action due to their interaction with the bacterial membrane. The work presented in this thesis has involved studies to increase our...

  15. Metabolic adaptation of a human pathogen during chronic infections - a systems biology approach

    DEFF Research Database (Denmark)

    Thøgersen, Juliane Charlotte

    modeling to uncover how human pathogens adapt to the human host. Pseudomonas aeruginosa infections in cystic fibrosis patients are used as a model system for under-­‐ standing these adaptation processes. The exploratory systems biology approach facilitates identification of important phenotypes...... by classical molecular biology approaches where genes and reactions typically are investigated in a one to one relationship. This thesis is an example of how mathematical approaches and modeling can facilitate new biologi-­‐ cal understanding and provide new surprising ideas to important biological processes....... and metabolic pathways that are necessary or related to establishment of chronic infections. Archetypal analysis showed to be successful in extracting relevant phenotypes from global gene expression da-­‐ ta. Furthermore, genome-­‐scale metabolic modeling showed to be useful in connecting the genotype...

  16. CLINICAL CHARACTERISTICS AND ANTIBIOTIC RESISTANCE PATTERN OF PATHOGENS IN PEDIATRIC URINARY TRACT INFECTION.

    Science.gov (United States)

    Amornchaicharoensuk, Yupaporn

    2016-09-01

    Medical records of children less than 15-years of age admitted to hospital for urinary tract infection (UTI) from January 2010 to December 2014 were reviewed. Among 100 children (59% males and 41% females) with upper UTI, the most common pathogen (88%) was Escherichia coli, of which 69% were nonextended spectrum beta-lactamase (ESBL) and 19 % ESBL producers. Resistance to ampicillin and trimethoprim/sulfamethoxazole was 90% and 60%, respectively. All ESBL-producing E. coli were resistant to ampicillin and third generation cephalosporins (cefotaxime and ceftriaxone), while 87% and 1.5% of non ESBL-producing E. coli were resistant to ampicillin and the two third generation cephalosporins, respectively. These data highlight the high prevalence of ESBL-producing E. coli in pediatric UTI and the potential problem in treating such infections.

  17. Bioeconomic modeling of lactational antimicrobial treatment of new bovine subclinical intramammary infections caused by contagious pathogens

    DEFF Research Database (Denmark)

    Van den Borne, B. H. P.; Hisham Beshara Halasa, Tariq; Van Schaik, G.

    2010-01-01

    This study determined the direct and indirect epidemiologic and economic effects of lactational treatment of new bovine subclinical intramammary infections (IMI) caused by contagious pathogens using an existing bioeconomic model. The dynamic and stochastic model simulated the dynamics...... of uncured cows after 2 mo of infection. Model behavior was observed for variation in parameter input values. Compared with no lactational intervention, lactational intervention of new subclinical IMI resulted in fewer clinical flare ups, less transmission within the herd, and much lower combined total....... Changing the probability of cure resulted in a nonlinear change in the cumulative incidence of IMI cases and associated costs. Lactational treatment was able to prevent IMI epidemics in dairy herds at high transmission rates of Strep. uberis, Strep. dysgalactiae, and E. coli. Lactational treatment did...

  18. MICROBIAL LOAD AND MULTIPLE DRUG RESISTANCE OF PATHOGENIC BACTERIA ISOLATED FROM FEACES AND BODY SURFACES OF COCKROACHES IN AN URBAN AREA OF SOUTHWESTERN NIGERIA

    Directory of Open Access Journals (Sweden)

    Monsuru Adebayo Adeleke

    2012-06-01

    Full Text Available This study investigates the microbial load and antibiotic susceptibility pattern of pathogenic bacteria isolated from the faeces and body surfaces of cockroaches in Osogbo, Southwestern Nigeria. The cockroaches collected from residential areas and hospital vicinities were screened for microbial load and antibiotic susceptibility pattern using standard protocols. A total of twenty- three microorganisms namely Klebsiella aerogenes, Bacillius cereus, Proteus spp, Staphyloccocus aureus, S. saprophyticus, Enteroccocus faecalis, Staphylococus epididermis, E. coli, Listeria monoctogene, Proteus mirabilis, Citrobacter species, Pseudomonas aeruginosa, Psuedomonas species, Seretia mensence, Candida albicans, Candida spp., Aspergilius spp., A. flavus, A. fumigates, Mucor species and Penicilium species were isolated. The microbial load of the microorganisms was significantly higher in the isolates from hospital as compared with the residential area (p<0.05 with the exception of Canidida species, Mucor and Penicillium which had higher or equal microbial load at the residential areas. All the pathogenic bacteria isolated had multiple resistance to antibiotics most importantly, Ampicillin, Augumentin, Amoxicillin and Septrin (30μg. Efforts geared towards controlling the insects will be indispensable in curbing the wide spread of multi-drug resistant pathogens in the study area.

  19. Surface Enhanced Raman Spectroscopy for the Rapid Detection and Identification of Microbial Pathogens in Human Serum

    Science.gov (United States)

    2014-12-11

    Percival, S.L., et al., Microbiology of the skin and the role of biofilms in infection. International wound journal , 2012. 9(1): p. 14-32. 2. Geffers...several fields of study including archaeology, arts, agriculture , environmental science, geosciences, astrobiology, forensics, and material science. In...MO). UltraPure distilled water (ddH2O) was purchased from Life Technologies (Grand Island, NY), nutrient agar was purchased from BD Biosciences (San

  20. Plant Pathogenic Microbial Communication Affected by Elevated Temperature in Pectobacterium carotovorum subsp. carotovorum.

    Science.gov (United States)

    Saha, N D; Chaudhary, A; Singh, S D; Singh, D; Walia, S; Das, T K

    2015-11-01

    Gram-negative plant pathogenic bacteria regulate specific gene expression in a population density-dependent manner by sensing level of Acyl-Homoserine Lactone (HSL) molecules which they produce and liberate to the environment, called Quorum Sensing (QS). The production of virulence factors (extracellular enzyme viz. cellulase, pectinase, etc.) in Pectobacterium carotovorum subsp. carotovorum (Pcc) is under strong regulation of QS. The QS signal molecule, N-(3-oxohexanoyl)-L-Homoserine Lactone (OHHL) was found as the central regulatory system for the virulence factor production in Pcc and is also under strict regulation of external environmental temperature. Under seven different incubation temperatures (24, 26, 28, 30, 33, 35, and 37 °C) in laboratory condition, highest amount of OHHL (804 violacein unit) and highest (79 %) Disease Severity Index (DSI) were measured at 33 °C. The OHHL production kinetics showed accumulation of highest concentration of OHHL at late log phase of the growth but diminution in the concentration occurred during stationary phase onwards to death phase. At higher temperature (35 and 37 °C) exposure, OHHL was not at detectable range. The effect of temperature on virulence factor production is the concomitant effect of HSL production and degradation which justifies less disease severity index in cross-inoculated tomato fruits incubated at 35 and 37 °C. The nondetection of the OHHL in the elevated temperature may because of degradation as these signal molecules are quite sensitive and prone to get degraded under different physical factors. This result provides the rationale behind the highest disease severity up to certain elevated temperature and leaves opportunities for investigation on mutation, co-evolution of superior plant pathogen with more stable HSL signals-mediated pathogenesis under global warming context.

  1. Low pathogenicity avian influenza viruses infect chicken layers by different routes of inoculation.

    Science.gov (United States)

    Pantin-Jackwood, Mary J; Smith, Diane M; Wasilenko, Jamie L; Spackman, Erica

    2012-06-01

    In order to develop better control measures against avian influenza, it is necessary to understand how the virus transmits in poultry. In a previous study in which the infectivity and transmissibility of the pandemic H1N1 influenza virus was examined in different poultry species, we found that no or minimal infection occurred in chicken and turkeys intranasally (IN) inoculated with the virus. However, we demonstrated that the virus can infect laying turkey hens by the intracloacal (IC) and intraoviduct (IO) routes, possibly explaining the drops in egg production observed in turkey breeder farms affected by the virus. Such novel routes of exposure have not been previously examined in chickens and could also explain outbreaks of low pathogenicity avian influenza (LPAI) that cause a decrease in egg production in chicken layers and breeders. In the present study, 46-wk-old specific-pathogen-free chicken layers were infected by the IN, IC, or IO routes with one of two LPAI viruses: a poultry origin virus, A/chicken/CA/1255/02 (H6N2), and a live bird market isolate, A/chicken/NJ/12220/97 (H9N2). Only hens IN inoculated with the H6N2 virus presented mild clinical signs consisting of depression and anorexia. However, a decrease in number of eggs laid was observed in all virus-inoculated groups when compared to control hens. Evidence of infection was found in all chickens inoculated with the H6N2 virus by any of the three routes and the virus transmitted to contact hens. On the other hand, only one or two hens from each of the groups inoculated with the H9N2 virus shed detectable levels of virus, or seroconverted and did not transmit the virus to contacts, regardless of the route of inoculation. In conclusion, LPAI viruses can also infect chickens through other routes besides the IN route, which is considered the natural route of exposure. However, as seen with the H9N2 virus, the infectivity of the virus did not increase when given by these alternate routes.

  2. Development of a standardized differential-reflective bioassay for microbial pathogens

    Science.gov (United States)

    Wilhelm, Jay; Auld, J. R. X.; Smith, James E.

    2008-04-01

    This research examines standardizing a method for the rapid/semi-automated identification of microbial contaminates. It introduces a method suited to test for food/water contamination, serology, urinalysis and saliva testing for any >1 micron sized molecule that can be effectively bound to an identifying marker with exclusivity. This optical biosensor method seeks to integrate the semi-manual distribution of a collected sample onto a "transparent" substrate array of binding sites that will then be applied to a standard optical data disk and run for analysis. The detection of most microbe species is possible in this platform because the relative scale is greater than the resolution of the standard-scale digital information on a standard CD or DVD. This paper explains the critical first stage in the advance of this detection concept. This work has concentrated on developing the necessary software component needed to perform highly sensitive small-scale recognition using the standard optical disk as a detection platform. Physical testing has made significant progress in demonstrating the ability to utilize a standard optical drive for the purposes of micro-scale detection through the exploitation of CIRC error correction. Testing has also shown a definable trend in the optimum scale and geometry of micro-arrayed attachment sites for the technology's concept to reach achievement.

  3. Induction of gentisic acid 5-O-beta-D-xylopyranoside in tomato and cucumber plants infected by different pathogens.

    Science.gov (United States)

    Fayos, Joaquín; Bellés, José María; López-Gresa, M Pilar; Primo, Jaime; Conejero, Vicente

    2006-01-01

    Tomato plants infected with the citrus exocortis viroid exhibited strongly elevated levels of a compound identified as 2,5-dihydroxybenzoic acid (gentisic acid, GA) 5-O-beta-D-xylopyranoside. The compound accumulated early in leaves expressing mild symptoms from both citrus exocortis viroid-infected tomato, and prunus necrotic ringspot virus-infected cucumber plants, and progressively accumulated concomitant with symptom development. The work presented here demonstrates that GA, mainly associated with systemic infections in compatible plant-pathogen interactions [Bellés, J.M., Garro, R., Fayos, J., Navarro, P., Primo, J., Conejero, V., 1999. Gentisic acid as a pathogen-inducible signal, additional to salicylic acid for activation of plant defenses in tomato. Mol. Plant-Microbe Interact. 12, 227-235], is conjugated to xylose. Notably, this result contrasts with those previously found in other plant-pathogen interactions in which phenolics analogues of GA as benzoic or salicylic acids, are conjugated to glucose.

  4. Microbial contamination of red meat and consideration of gamma irradiation effects for increasing the shelf-life and decontamination of pathogenic microorganisms

    International Nuclear Information System (INIS)

    Motamedee Sadeh, F.; Majd, F.; Fathollahee, H.; Arbabi, K.; Mohammad Beygi Abhari, M.

    2003-01-01

    Red meat has a lot of microbial flora from different sources. Prevention of outbreak of food born diseases that are caused by pathogenic agents and prevention of microbial spoilage of meat that makes many losses to the human health and economic of society are very important. Also, different methods for decreasing the microbial flora under a standard allowance for increasing the shelf life and decontamination of microbial pathogens have been proposed. In this research, irradiation technique was used for this purposes. After drawing dose/survival curves for all kinds of meats microbial contamination, an optimum dose of 3 kGy for decreasing the contamination and specially for decontamination of salmonella was obtained. When meat is irradiated by 3 kGy gamma rays, it can be kept in a 4-7 d ig C refrigerator for 2 week without appearing any spoilage nor color changes or odor. Also, some of biochemical factors were analyzed and amounts of 16 amino acids were measured in the irradiated and controlled samples and no difference was observed between the samples

  5. Human Infection with Highly Pathogenic Avian Influenza A(H7N9) Virus, China.

    Science.gov (United States)

    Ke, Changwen; Mok, Chris Ka Pun; Zhu, Wenfei; Zhou, Haibo; He, Jianfeng; Guan, Wenda; Wu, Jie; Song, Wenjun; Wang, Dayan; Liu, Jiexiong; Lin, Qinhan; Chu, Daniel Ka Wing; Yang, Lei; Zhong, Nanshan; Yang, Zifeng; Shu, Yuelong; Peiris, Joseph Sriyal Malik

    2017-07-01

    The recent increase in zoonotic avian influenza A(H7N9) disease in China is a cause of public health concern. Most of the A(H7N9) viruses previously reported have been of low pathogenicity. We report the fatal case of a patient in China who was infected with an A(H7N9) virus having a polybasic amino acid sequence at its hemagglutinin cleavage site (PEVPKRKRTAR/GL), a sequence suggestive of high pathogenicity in birds. Its neuraminidase also had R292K, an amino acid change known to be associated with neuraminidase inhibitor resistance. Both of these molecular features might have contributed to the patient's adverse clinical outcome. The patient had a history of exposure to sick and dying poultry, and his close contacts had no evidence of A(H7N9) disease, suggesting human-to-human transmission did not occur. Enhanced surveillance is needed to determine whether this highly pathogenic avian influenza A(H7N9) virus will continue to spread.

  6. A Broad-Spectrum Infection Diagnostic that Detects Pathogen-Associated Molecular Patterns (PAMPs) in Whole Blood

    OpenAIRE

    Cartwright, Mark; Rottman, Martin; Shapiro, Nathan I.; Seiler, Benjamin; Lombardo, Patrick; Gamini, Nazita; Tomolonis, Julie; Watters, Alexander L.; Waterhouse, Anna; Leslie, Dan; Bolgen, Dana; Graveline, Amanda; Kang, Joo H.; Didar, Tohid; Dimitrakakis, Nikolaos

    2016-01-01

    Background: Blood cultures, and molecular diagnostic tests that directly detect pathogen DNA in blood, fail to detect bloodstream infections in most infected patients. Thus, there is a need for a rapid test that can diagnose the presence of infection to triage patients, guide therapy, and decrease the incidence of sepsis. Methods: An Enzyme-Linked Lectin-Sorbent Assay (ELLecSA) that uses magnetic microbeads coated with an engineered version of the human opsonin, Mannose Binding Lectin, contai...

  7. How often do they have sex? A comparative analysis of the population structure of seven eukaryotic microbial pathogens.

    Directory of Open Access Journals (Sweden)

    Nicolás Tomasini

    Full Text Available The model of predominant clonal evolution (PCE proposed for micropathogens does not state that genetic exchange is totally absent, but rather, that it is too rare to break the prevalent PCE pattern. However, the actual impact of this "residual" genetic exchange should be evaluated. Multilocus Sequence Typing (MLST is an excellent tool to explore the problem. Here, we compared online available MLST datasets for seven eukaryotic microbial pathogens: Trypanosoma cruzi, the Fusarium solani complex, Aspergillus fumigatus, Blastocystis subtype 3, the Leishmania donovani complex, Candida albicans and Candida glabrata. We first analyzed phylogenetic relationships among genotypes within each dataset. Then, we examined different measures of branch support and incongruence among loci as signs of genetic structure and levels of past recombination. The analyses allow us to identify three types of genetic structure. The first was characterized by trees with well-supported branches and low levels of incongruence suggesting well-structured populations and PCE. This was the case for the T. cruzi and F. solani datasets. The second genetic structure, represented by Blastocystis spp., A. fumigatus and the L. donovani complex datasets, showed trees with weakly-supported branches but low levels of incongruence among loci, whereby genetic structuration was not clearly defined by MLST. Finally, trees showing weakly-supported branches and high levels of incongruence among loci were observed for Candida species, suggesting that genetic exchange has a higher evolutionary impact in these mainly clonal yeast species. Furthermore, simulations showed that MLST may fail to show right clustering in population datasets even in the absence of genetic exchange. In conclusion, these results make it possible to infer variable impacts of genetic exchange in populations of predominantly clonal micro-pathogens. Moreover, our results reveal different problems of MLST to determine the

  8. Bacteriophages: the possible solution to treat infections caused by pathogenic bacteria.

    Science.gov (United States)

    El-Shibiny, Ayman; El-Sahhar, Salma

    2017-11-01

    Since their discovery in 1915, bacteriophages have been used to treat bacterial infections in animals and humans because of their unique ability to infect their specific bacterial hosts without affecting other bacterial populations. The research carried out in this field throughout the 20th century, largely in Georgia, part of USSR and Poland, led to the establishment of phage therapy protocols. However, the discovery of penicillin and sulfonamide antibiotics in the Western World during the 1930s was a setback in the advancement of phage therapy. The misuse of antibiotics has reduced their efficacy in controlling pathogens and has led to an increase in the number of antibiotic-resistant bacteria. As an alternative to antibiotics, bacteriophages have become a topic of interest with the emergence of multidrug-resistant bacteria, which are a threat to public health. Recent studies have indicated that bacteriophages can be used indirectly to detect pathogenic bacteria or directly as biocontrol agents. Moreover, they can be used to develop new molecules for clinical applications, vaccine production, drug design, and in the nanomedicine field via phage display.

  9. HIV Infection Disrupts the Sympatric Host–Pathogen Relationship in Human Tuberculosis

    Science.gov (United States)

    Fenner, Lukas; Egger, Matthias; Bodmer, Thomas; Furrer, Hansjakob; Ballif, Marie; Battegay, Manuel; Helbling, Peter; Fehr, Jan; Gsponer, Thomas; Rieder, Hans L.; Zwahlen, Marcel; Hoffmann, Matthias; Bernasconi, Enos; Cavassini, Matthias; Calmy, Alexandra; Dolina, Marisa; Frei, Reno; Janssens, Jean-Paul; Borrell, Sonia; Stucki, David; Schrenzel, Jacques; Böttger, Erik C.; Gagneux, Sebastien

    2013-01-01

    The phylogeographic population structure of Mycobacterium tuberculosis suggests local adaptation to sympatric human populations. We hypothesized that HIV infection, which induces immunodeficiency, will alter the sympatric relationship between M. tuberculosis and its human host. To test this hypothesis, we performed a nine-year nation-wide molecular-epidemiological study of HIV–infected and HIV–negative patients with tuberculosis (TB) between 2000 and 2008 in Switzerland. We analyzed 518 TB patients of whom 112 (21.6%) were HIV–infected and 233 (45.0%) were born in Europe. We found that among European-born TB patients, recent transmission was more likely to occur in sympatric compared to allopatric host–pathogen combinations (adjusted odds ratio [OR] 7.5, 95% confidence interval [95% CI] 1.21–infinity, p = 0.03). HIV infection was significantly associated with TB caused by an allopatric (as opposed to sympatric) M. tuberculosis lineage (OR 7.0, 95% CI 2.5–19.1, p<0.0001). This association remained when adjusting for frequent travelling, contact with foreigners, age, sex, and country of birth (adjusted OR 5.6, 95% CI 1.5–20.8, p = 0.01). Moreover, it became stronger with greater immunosuppression as defined by CD4 T-cell depletion and was not the result of increased social mixing in HIV–infected patients. Our observation was replicated in a second independent panel of 440 M. tuberculosis strains collected during a population-based study in the Canton of Bern between 1991 and 2011. In summary, these findings support a model for TB in which the stable relationship between the human host and its locally adapted M. tuberculosis is disrupted by HIV infection. PMID:23505379

  10. The infection biology of Sphaerulina musiva: clues to understanding a forest pathogen.

    Directory of Open Access Journals (Sweden)

    Ruqian Qin

    Full Text Available Trees in the genus Populus and their interspecific hybrids are used across North America for fiber production and as a potential source of biofuel. Plantations of these species are severely impacted by a fungal pathogen, Sphaerulina musiva, the cause of leaf spot and stem canker. An inoculation protocol that does not rely on stem wounding to achieve infection was recently developed. Using this protocol two experiments were conducted to examine infection biology and disease development in the S. musiva-Populus interaction. In the first experiment non-wounded stems of one moderately resistant clone (NM6 and one susceptible clone (NC11505 were inoculated and examined by scanning electron microscopy at six different times (6 h, 12 h, 24 h, 72 h, 1 week, and 3 weeks post-inoculation. The images indicate that the pathogen appears to enter host tissue through small openings and lenticels and that there are no significant differences in the penetration rate between the moderately resistant (NM6 and susceptible (NC11505 clones at 12 h post-inoculation. In a second experiment a histological comparison of stem cankers for resistant clone DN74 and susceptible clone NC11505 were conducted at three time points (3 weeks, 5 weeks, and 7 weeks post-inoculation. Distinct differences in disease development were apparent between the resistant and susceptible clones at each time point, with the susceptible clone exhibiting a weak and delayed defense response. These results suggest, that following penetration, the pathogen may be able to interfere with the defense response in the susceptible host.

  11. Outbreaks where food workers have been implicated in the spread of foodborne disease. Part 4. Infective doses and pathogen carriage.

    Science.gov (United States)

    Todd, Ewen C D; Greig, Judy D; Bartleson, Charles A; Michaels, Barry S

    2008-11-01

    In this article, the fourth in a series reviewing the role of food workers in foodborne outbreaks, background information on the presence of enteric pathogens in the community, the numbers of organisms required to initiate an infection, and the length of carriage are presented. Although workers have been implicated in outbreaks, they were not always aware of their infections, either because they were in the prodromic phase before symptoms began or because they were asymptomatic carriers. Pathogens of fecal, nose or throat, and skin origin are most likely to be transmitted by the hands, highlighting the need for effective hand hygiene and other barriers to pathogen contamination, such as no bare hand contact with ready-to-eat food. The pathogens most likely to be transmitted by food workers are norovirus, hepatitis A virus, Salmonella, Shigella, and Staphylococcus aureus. However, other pathogens have been implicated in worker-associated outbreaks or have the potential to be implicated. In this study, the likelihood of pathogen involvement in foodborne outbreaks where infected workers have been implicated was examined, based on infectious dose, carriage rate in the community, duration of illness, and length of pathogen excretion. Infectious dose estimates are based on volunteer studies (mostly early experiments) or data from outbreaks. Although there is considerable uncertainty associated with these data, some pathogens appear to be able to infect at doses as low as 1 to 100 units, including viruses, parasites, and some bacteria. Lengthy postsymptomatic shedding periods and excretion by asymptomatic individuals of many enteric pathogens is an important issue for the hygienic management of food workers.

  12. Intrinsic and extrinsic factors related to pathogen infection in wild small mammals in intensive milk cattle and swine production systems.

    Science.gov (United States)

    Lovera, Rosario; Fernández, María Soledad; Jacob, Jens; Lucero, Nidia; Morici, Gabriel; Brihuega, Bibiana; Farace, María Isabel; Caracostantogolo, Jorge; Cavia, Regino

    2017-06-01

    Understanding the ecological processes that are involved in the transmission of zoonotic pathogens by small mammals may aid adequate and effective management measures. Few attempts have been made to analyze the ecological aspects that influence pathogen infection in small mammals in livestock production systems. We describe the infection of small mammals with Leptospira spp., Brucella spp., Trichinella spp. and Cysticercus fasciolaris and assess the related intrinsic and extrinsic factors in livestock production systems in central Argentina at the small mammal community, population and individual levels. Ten pig farms and eight dairy farms were studied by removal trapping of small mammals from 2008 to 2011. Each farm was sampled seasonally over the course of one year with cage and Sherman live traps. The 505 small mammals captured (14,359 trap-nights) included three introduced murine rodents, four native rodents and two opossums. Leptospira spp., anti-Brucella spp. antibodies and Trichinella spp. were found in the three murine rodents and both opossums. Rattus norvegicus was also infected with C. fasciolaris; Akodon azarae and Oligoryzomys flavescens with Leptospira spp.; anti-Brucella spp. antibodies were found in A. azarae. Two or more pathogens occurred simultaneously on 89% of the farms, and each pathogen was found on at least 50% of the farms. Pathogen infections increased with host abundance. Infection by Leptospira spp. also increased with precipitation and during warm seasons. The occurrence of anti-Brucella spp. antibodies was higher on dairy farms and during the winter and summer. The host abundances limit values, from which farms are expected to be free of the studied pathogens, are reported. Murine rodents maintain pathogens within farms, whereas other native species are likely dispersing pathogens among farms. Hence, we recommend preventing and controlling murines in farm dwellings and isolating farms from their surroundings to avoid contact with other

  13. Intrinsic and extrinsic factors related to pathogen infection in wild small mammals in intensive milk cattle and swine production systems.

    Directory of Open Access Journals (Sweden)

    Rosario Lovera

    2017-06-01

    Full Text Available Understanding the ecological processes that are involved in the transmission of zoonotic pathogens by small mammals may aid adequate and effective management measures. Few attempts have been made to analyze the ecological aspects that influence pathogen infection in small mammals in livestock production systems. We describe the infection of small mammals with Leptospira spp., Brucella spp., Trichinella spp. and Cysticercus fasciolaris and assess the related intrinsic and extrinsic factors in livestock production systems in central Argentina at the small mammal community, population and individual levels.Ten pig farms and eight dairy farms were studied by removal trapping of small mammals from 2008 to 2011. Each farm was sampled seasonally over the course of one year with cage and Sherman live traps. The 505 small mammals captured (14,359 trap-nights included three introduced murine rodents, four native rodents and two opossums. Leptospira spp., anti-Brucella spp. antibodies and Trichinella spp. were found in the three murine rodents and both opossums. Rattus norvegicus was also infected with C. fasciolaris; Akodon azarae and Oligoryzomys flavescens with Leptospira spp.; anti-Brucella spp. antibodies were found in A. azarae. Two or more pathogens occurred simultaneously on 89% of the farms, and each pathogen was found on at least 50% of the farms. Pathogen infections increased with host abundance. Infection by Leptospira spp. also increased with precipitation and during warm seasons. The occurrence of anti-Brucella spp. antibodies was higher on dairy farms and during the winter and summer. The host abundances limit values, from which farms are expected to be free of the studied pathogens, are reported.Murine rodents maintain pathogens within farms, whereas other native species are likely dispersing pathogens among farms. Hence, we recommend preventing and controlling murines in farm dwellings and isolating farms from their surroundings to avoid

  14. UV-Heat Treatments for the Control of Foodborne Microbial Pathogens in Chicken Broth

    Directory of Open Access Journals (Sweden)

    M. Gouma

    2015-01-01

    Full Text Available This investigation established the process criteria for using UV-C light and mild heat (UV-H treatment to inactivate 5-Log10 cycles (performance criterion of common foodborne pathogen populations, Escherichia coli, Salmonella Typhimurium, Listeria monocytogenes, and Staphylococcus aureus, when inoculated in chicken broth. To define the target microorganism and the proper UV-H treatment conditions (including UV dose, treatment time, and temperature that would achieve the stated performance criterion, mathematical equations based on Geeraerd’s model were developed for each microorganism. For the sake of comparison, inactivation equations for heat treatments were also performed on the same chicken broth and for the same microorganisms. L. monocytogenes was the most UV-H resistant microorganism at all temperatures, requiring a UV dose between 6.10 J/mL (5.6 min and 2.26 J/mL (2.09 min to achieve 5-Log10 reductions. In comparison with UV treatments at room temperatures, the combination of UV and mild heat allowed both the UV dose and treatment time to be reduced by 30% and 63% at 55°C and 60°C, respectively. Compared to heat treatments, the UV-H process reduced the heating time for 5-Log10 reductions of all the investigated microorganisms in chicken broth from 20-fold to 2-fold when the operating temperature varied from 53 to 60°C.

  15. Conserved Patterns of Microbial Immune Escape: Pathogenic Microbes of Diverse Origin Target the Human Terminal Complement Inhibitor Vitronectin via a Single Common Motif.

    Directory of Open Access Journals (Sweden)

    Teresia Hallström

    Full Text Available Pathogenicity of many microbes relies on their capacity to resist innate immunity, and to survive and persist in an immunocompetent human host microbes have developed highly efficient and sophisticated complement evasion strategies. Here we show that different human pathogens including Gram-negative and Gram-positive bacteria, as well as the fungal pathogen Candida albicans, acquire the human terminal complement regulator vitronectin to their surface. By using truncated vitronectin fragments we found that all analyzed microbial pathogens (n = 13 bound human vitronectin via the same C-terminal heparin-binding domain (amino acids 352-374. This specific interaction leaves the terminal complement complex (TCC regulatory region of vitronectin accessible, allowing inhibition of C5b-7 membrane insertion and C9 polymerization. Vitronectin complexed with the various microbes and corresponding proteins was thus functionally active and inhibited complement-mediated C5b-9 deposition. Taken together, diverse microbial pathogens expressing different structurally unrelated vitronectin-binding molecules interact with host vitronectin via the same conserved region to allow versatile control of the host innate immune response.

  16. New Epidemiological and Clinical Signatures of 18 Pathogens from Respiratory Tract Infections Based on a 5-Year Study.

    Directory of Open Access Journals (Sweden)

    Xiaohong Liao

    Full Text Available Respiratory tract infections (RTIs are a heavy burden on society. However, due to the complex etiology of RTIs, the clinical diagnosis, treatment, and prevention of these infections remain challenging, especially in developing countries.To determine the epidemiological and clinical characteristics of 18 respiratory pathogens, we analyzed 12,502 patients with acute respiratory infections (ARIs by performing polymerase chain reaction (PCR on patient pharyngeal swabs.Samples positive for at least 1 pathogen were obtained from 48.42% of the total patients. Of these pathogen-positive patients, 17.99% were infected with more than 1 pathogen. Of the 18 pathogens analyzed, four were detected with a positive detection rate (PDR > 5%: influenza A virus (IAV > respiratory syncytial virus (RSV >Mycoplasma pneumoniae (MP > human coronavirus (HCoV. The pathogens with the 4 highest co-infection rates (CIRs were as follows: HCoV > human bocavirus (HBoV > enterovirus (EV > parainfluenza virus (PIV. The overall positive detection rate (PDR varied significantly according to patient age, the season and year of detection, and the disease subgroup, but not according to patient sex. The individual PDRs of the pathogens followed 3 types of distributions for patient sex, 4 types of distributions for patient age, 4 types of seasonal distributions, 2 types of seasonal epidemic trends, 4 types of yearly epidemic trends, and different susceptibility distributions in the disease subgroups. Additionally, the overall CIR showed significantly different distributions according to patient sex, patient age, and the disease subgroup, whereas the CIRs of individual pathogens suggested significant preference characteristics.IAV remains the most common pathogen among the pathogens analyzed. More effort should be directed toward the prevention and control of pathogens that show a trend of increasing incidence such as HCoV, human adenovirus (ADV, and RSV. Although clinically

  17. Emergence and Adaptation of a Novel Highly Pathogenic H7N9 Influenza Virus in Birds and Humans from a 2013 Human-Infecting Low-Pathogenic Ancestor.

    Science.gov (United States)

    Qi, Wenbao; Jia, Weixin; Liu, Di; Li, Jing; Bi, Yuhai; Xie, Shumin; Li, Bo; Hu, Tao; Du, Yingying; Xing, Li; Zhang, Jiahao; Zhang, Fuchun; Wei, Xiaoman; Eden, John-Sebastian; Li, Huanan; Tian, Huaiyu; Li, Wei; Su, Guanming; Lao, Guangjie; Xu, Chenggang; Xu, Bing; Liu, Wenjun; Zhang, Guihong; Ren, Tao; Holmes, Edward C; Cui, Jie; Shi, Weifeng; Gao, George F; Liao, Ming

    2018-01-15

    Since its emergence in 2013, the H7N9 low-pathogenic avian influenza virus (LPAIV) has been circulating in domestic poultry in China, causing five waves of human infections. A novel H7N9 highly pathogenic avian influenza virus (HPAIV) variant possessing multiple basic amino acids at the cleavage site of the hemagglutinin (HA) protein was first reported in two cases of human infection in January 2017. More seriously, those novel H7N9 HPAIV variants have been transmitted and caused outbreaks on poultry farms in eight provinces in China. Herein, we demonstrate the presence of three different amino acid motifs at the cleavage sites of these HPAIV variants which were isolated from chickens and humans and likely evolved from the preexisting LPAIVs. Animal experiments showed that these novel H7N9 HPAIV variants are both highly pathogenic in chickens and lethal to mice. Notably, human-origin viruses were more pathogenic in mice than avian viruses, and the mutations in the PB2 gene associated with adaptation to mammals (E627K, A588V, and D701N) were identified by next-generation sequencing (NGS) and Sanger sequencing of the isolates from infected mice. No polymorphisms in the key amino acid substitutions of PB2 and HA in isolates from infected chicken lungs were detected by NGS. In sum, these results highlight the high degree of pathogenicity and the valid transmissibility of this new H7N9 variant in chickens and the quick adaptation of this new H7N9 variant to mammals, so the risk should be evaluated and more attention should be paid to this variant. IMPORTANCE Due to the recent increased numbers of zoonotic infections in poultry and persistent human infections in China, influenza A(H7N9) virus has remained a public health threat. Most of the influenza A(H7N9) viruses reported previously have been of low pathogenicity. Now, these novel H7N9 HPAIV variants have caused human infections in three provinces and outbreaks on poultry farms in eight provinces in China. We analyzed

  18. Medical Devices; Immunology and Microbiology Devices; Classification of the Device To Detect and Identify Microbial Pathogen Nucleic Acids in Cerebrospinal Fluid. Final order.

    Science.gov (United States)

    2017-10-20

    The Food and Drug Administration (FDA or we) is classifying the device to detect and identify microbial pathogen nucleic acids in cerebrospinal fluid into class II (special controls). The special controls that will apply to the device type are identified in this order and will be part of the codified language for the device to detect and identify microbial pathogen nucleic acids in cerebrospinal fluid’s classification. We are taking this action because we have determined that classifying the device into class II (special controls) will provide a reasonable assurance of safety and effectiveness of the device. We believe this action will also enhance patients' access to beneficial innovative devices, in part by reducing regulatory burdens.

  19. Different types of stainless steel used in equipment in meat plants do not affect the initial microbial transfer, including pathogens, from pork skin.

    Science.gov (United States)

    Larivière-Gauthier, Guillaume; Quessy, Sylvain; Fournaise, Sylvain; Letellier, Ann; Fravalo, Philippe

    2015-07-01

    This study describes and measures the impact of different compositions and finishes of stainless steel used in equipment in the meat industry on the transfer of natural flora and selected pathogens from artificially contaminated pork skin. It is known that the adhesion to surfaces of Listeria monocytogenes and Salmonella, 2 pathogens frequently found in contaminated pork meat, depends on the nature and roughness of the surface. Our results show no statistically significant differences in microbial transfer regardless of the types of stainless steel considered, with the highest measured transfer difference being 0.18 log colony-forming units (CFUs)/800 cm(2). Moreover, no differences in total microbial community were observed after transfer on the 5 types of stainless steel using single-strand conformation polymorphism (SSCP). It was concluded that the different characteristics of the stainless steel tested did not affect the initial bacterial transfer in this study.

  20. ANTIMICROBIAL ACTIVITY OF ETHANOL EXTRACT OF SATUREJA HORTENSIS L. TOWARDS PATHOGENIC MICROBIAL STRAINS

    Directory of Open Access Journals (Sweden)

    Kotyuk L. A.

    2014-12-01

    Full Text Available The paper provides the information on the component composition of ethereal oil of Satureja hortensis cultivated in Zhytomyr Polissya. In the ethereal oil of summer savory, 19 components were identified: carvacrol (89,07%, γ-terpinene (3,53%, α-thujone (1,7%, camphora (1,48%, terpinen-4 ol 4 (0,91%, β-bisabolen (0,56%, β-caryophyllene (0,45%, bitsiklogermakren (0,38% para-cymene (0,34%, 1,8-cineole (0,33%, trans-sabinengidrat (0.25%, 1-octen-3-ol (0.20%, spatulenol (0,18%, β-thujone (0,14%, eugenol (0,11%, geranylacetate (0,11%, humulene (0,09%, α-terpinene (0,09%, octanol-3 (0,07%. A high carvacrol content determines antimicrobial properties of summer savory. The antimicrobial activity of S. hortensis extract was studied in accordance with the common methodology of determining the sensitivity of microorganisms to antibacterial preparations. The aboveground part of plants harvested in the last ten-day period of August, in the flowering phase, was used in the experiments. The raw material was reduced to fragments of 1-1.5mm according to the requirements of pharmacopoeia. The extract of S. hortensis was obtained by the method of maceration in 40% ethyl alcohol at a ratio of 1:5 and the concentration of 200mg/ml. The availability of antimicrobial activity of extracted substances in the structure of the substances studied was determined by the way of comparison of their minimum inhibiting concentrations (MIC and minimum bactericidal/fungicidal concentrations (MBC/MFC with those in 40% ethyl alcohol. The paper investigates the biological activity of 40 % ethanol extract of Satureja hortensis herb grown under the conditions of Ukrainian Polissya as to golden staphylococcus (Staphylococcus aureus, coliform bacillus Escherichia coli, Pseudomonas aeruginosa and Candida albicans which are pathogenic in reference to other organisms. It has been shown that S. hortensis extract was characterized by antimicrobial activity since extracted substances

  1. Preliminary Epidemiology of Human Infections with Highly Pathogenic Avian Influenza A(H7N9) Virus, China, 2017.

    Science.gov (United States)

    Zhou, Lei; Tan, Yi; Kang, Min; Liu, Fuqiang; Ren, Ruiqi; Wang, Yali; Chen, Tao; Yang, Yiping; Li, Chao; Wu, Jie; Zhang, Hengjiao; Li, Dan; Greene, Carolyn M; Zhou, Suizan; Iuliano, A Danielle; Havers, Fiona; Ni, Daxin; Wang, Dayan; Feng, Zijian; Uyeki, Timothy M; Li, Qun

    2017-08-01

    We compared the characteristics of cases of highly pathogenic avian influenza (HPAI) and low pathogenic avian influenza (LPAI) A(H7N9) virus infections in China. HPAI A(H7N9) case-patients were more likely to have had exposure to sick and dead poultry in rural areas and were hospitalized earlier than were LPAI A(H7N9) case-patients.

  2. Muscles provide protection during microbial infection by activating innate immune response pathways in Drosophila and zebrafish

    Directory of Open Access Journals (Sweden)

    Arunita Chatterjee

    2016-06-01

    Full Text Available Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual.

  3. Novel Approaches to Manipulating Bacterial Pathogen Biofilms: Whole-Systems Design Philosophy and Steering Microbial Evolution.

    Science.gov (United States)

    Penn, Alexandra S

    2016-01-01

    Understanding and manipulating bacterial biofilms is crucial in medicine, ecology and agriculture and has potential applications in bioproduction, bioremediation and bioenergy. Biofilms often resist standard therapies and the need to develop new means of intervention provides an opportunity to fundamentally rethink our strategies. Conventional approaches to working with biological systems are, for the most part, "brute force", attempting to effect control in an input and effort intensive manner and are often insufficient when dealing with the inherent non-linearity and complexity of living systems. Biological systems, by their very nature, are dynamic, adaptive and resilient and require management tools that interact with dynamic processes rather than inert artefacts. I present an overview of a novel engineering philosophy which aims to exploit rather than fight those properties, and hence provide a more efficient and robust alternative. Based on a combination of evolutionary theory and whole-systems design, its essence is what I will call systems aikido; the basic principle of aikido being to interact with the momentum of an attacker and redirect it with minimal energy expenditure, using the opponent's energy rather than one's own. In more conventional terms, this translates to a philosophy of equilibrium engineering, manipulating systems' own self-organisation and evolution so that the evolutionarily or dynamically stable state corresponds to a function which we require. I illustrate these ideas with a description of a proposed manipulation of environmental conditions to alter the stability of co-operation in the context of Pseudomonas aeruginosa biofilm infection of the cystic fibrosis lung.

  4. Microbial Shifts in the Intestinal Microbiota of Salmonella Infected Chickens in Response to Enrofloxacin.

    Science.gov (United States)

    Li, Jun; Hao, Haihong; Cheng, Guyue; Liu, Chunbei; Ahmed, Saeed; Shabbir, Muhammad A B; Hussain, Hafiz I; Dai, Menghong; Yuan, Zonghui

    2017-01-01

    Fluoroquinolones (FQs) are important antibiotics used for treatment of Salmonella infection in poultry in many countries. However, oral administration of fluoroquinolones may affect the composition and abundance of a number of bacterial taxa in the chicken intestine. Using 16S rRNA gene sequencing, the microbial shifts in the gut of Salmonella infected chickens in response to enrofloxacin treatments at different dosages (0, 0.1, 4, and 100 mg/kg b.w.) were quantitatively evaluated. The results showed that the shedding levels of Salmonella were significantly reduced in the high dosage group as demonstrated by both the culturing method and 16S rRNA sequencing method. The average values of diversity indices were higher in the control group than in the three medicated groups. Non-metric multidimensional scaling (NMDS) analysis results showed that the microbial community of high dosage group was clearly separated from the other three groups. In total, 25 genera were significantly enriched (including 6 abundant genera: Lactococcus , Bacillus , Burkholderia , Pseudomonas , Rhizobium , and Acinetobacter ) and 23 genera were significantly reduced in the medicated groups than in the control group for the treatment period, but these bacterial taxa recovered to normal levels after therapy withdrawal. Additionally, 5 genera were significantly reduced in both treatment and withdrawal periods (e.g., Blautia and Anaerotruncus ) and 23 genera (e.g., Enterobacter and Clostridium ) were significantly decreased only in the withdrawal period, indicating that these genera might be the potential targets for the fluoroquinolones antimicrobial effects. Specially, Enterococcus was significantly reduced under high dosage of enrofloxacin treatment, while significantly enriched in the withdrawal period, which was presumably due to the resistance selection. Predicted microbial functions associated with genetic information processing were significantly decreased in the high dosage group. Overall

  5. Microbial Shifts in the Intestinal Microbiota of Salmonella Infected Chickens in Response to Enrofloxacin

    Directory of Open Access Journals (Sweden)

    Jun Li

    2017-09-01

    Full Text Available Fluoroquinolones (FQs are important antibiotics used for treatment of Salmonella infection in poultry in many countries. However, oral administration of fluoroquinolones may affect the composition and abundance of a number of bacterial taxa in the chicken intestine. Using 16S rRNA gene sequencing, the microbial shifts in the gut of Salmonella infected chickens in response to enrofloxacin treatments at different dosages (0, 0.1, 4, and 100 mg/kg b.w. were quantitatively evaluated. The results showed that the shedding levels of Salmonella were significantly reduced in the high dosage group as demonstrated by both the culturing method and 16S rRNA sequencing method. The average values of diversity indices were higher in the control group than in the three medicated groups. Non-metric multidimensional scaling (NMDS analysis results showed that the microbial community of high dosage group was clearly separated from the other three groups. In total, 25 genera were significantly enriched (including 6 abundant genera: Lactococcus, Bacillus, Burkholderia, Pseudomonas, Rhizobium, and Acinetobacter and 23 genera were significantly reduced in the medicated groups than in the control group for the treatment period, but these bacterial taxa recovered to normal levels after therapy withdrawal. Additionally, 5 genera were significantly reduced in both treatment and withdrawal periods (e.g., Blautia and Anaerotruncus and 23 genera (e.g., Enterobacter and Clostridium were significantly decreased only in the withdrawal period, indicating that these genera might be the potential targets for the fluoroquinolones antimicrobial effects. Specially, Enterococcus was significantly reduced under high dosage of enrofloxacin treatment, while significantly enriched in the withdrawal period, which was presumably due to the resistance selection. Predicted microbial functions associated with genetic information processing were significantly decreased in the high dosage group

  6. The innate immunity of guinea pigs against highly pathogenic avian influenza virus infection.

    Science.gov (United States)

    Zhang, Kun; Xu, Wei Wei; Zhang, Zhaowei; Liu, Jing; Li, Jing; Sun, Lijuan; Sun, Weiyang; Jiao, Peirong; Sang, Xiaoyu; Ren, Zhiguang; Yu, Zhijun; Li, Yuanguo; Feng, Na; Wang, Tiecheng; Wang, Hualei; Yang, Songtao; Zhao, Yongkun; Zhang, Xuemei; Wilker, Peter R; Liu, WenJun; Liao, Ming; Chen, Hualan; Gao, Yuwei; Xia, Xianzhu

    2017-05-02

    H5N1 avian influenza viruses are a major pandemic concern. In contrast to the highly virulent phenotype of H5N1 in humans and many animal models, guinea pigs do not typically display signs of severe disease in response to H5N1 virus infection. Here, proteomic and transcriptional profiling were applied to identify host factors that account for the observed attenuation of A/Tiger/Harbin/01/2002 (H5N1) virulence in guinea pigs. RIG-I and numerous interferon stimulated genes were among host proteins with altered expression in guinea pig lungs during H5N1 infection. Overexpression of RIG-I or the RIG-I adaptor protein MAVS in guinea pig cell lines inhibited H5N1 replication. Endogenous GBP-1 expression was required for RIG-I mediated inhibition of viral replication upstream of the activity of MAVS. Furthermore, we show that guinea pig complement is involved in viral clearance, the regulation of inflammation, and cellular apoptosis during influenza virus infection of guinea pigs. This work uncovers features of the guinea pig innate immune response to influenza that may render guinea pigs resistant to highly pathogenic influenza viruses.

  7. The Immune Response against Acinetobacter baumannii, an Emerging Pathogen in Nosocomial Infections

    Science.gov (United States)

    García-Patiño, María Guadalupe; García-Contreras, Rodolfo; Licona-Limón, Paula

    2017-01-01

    Acinetobacter baumannii is the etiologic agent of a wide range of nosocomial infections, including pneumonia, bacteremia, and skin infections. Over the last 45 years, an alarming increase in the antibiotic resistance of this opportunistic microorganism has been reported, a situation that hinders effective treatments. In order to develop effective therapies against A. baumannii it is crucial to understand the basis of host–bacterium interactions, especially those concerning the immune response of the host. Different innate immune cells such as monocytes, macrophages, dendritic cells, and natural killer cells have been identified as important effectors in the defense against A. baumannii; among them, neutrophils represent a key immune cell indispensable for the control of the infection. Several immune strategies to combat A. baumannii have been identified such as recognition of the bacteria by immune cells through pattern recognition receptors, specifically toll-like receptors, which trigger bactericidal mechanisms including oxidative burst and cytokine and chemokine production to amplify the immune response against the pathogen. However, a complete picture of the protective immune strategies activated by this bacteria and its potential therapeutic use remains to be determined and explored. PMID:28446911

  8. Discrete time Markov chains (DTMC) susceptible infected susceptible (SIS) epidemic model with two pathogens in two patches

    Science.gov (United States)

    Lismawati, Eka; Respatiwulan; Widyaningsih, Purnami

    2017-06-01

    The SIS epidemic model describes the pattern of disease spread with characteristics that recovered individuals can be infected more than once. The number of susceptible and infected individuals every time follows the discrete time Markov process. It can be represented by the discrete time Markov chains (DTMC) SIS. The DTMC SIS epidemic model can be developed for two pathogens in two patches. The aims of this paper are to reconstruct and to apply the DTMC SIS epidemic model with two pathogens in two patches. The model was presented as transition probabilities. The application of the model obtain that the number of susceptible individuals decreases while the number of infected individuals increases for each pathogen in each patch.

  9. ANTIMICROBIAL ACTIVITY OF ETHANOL EXTRACT OF SATUREJA HORTENSIS L. TOWARDS PATHOGENIC MICROBIAL STRAINS

    Directory of Open Access Journals (Sweden)

    L. A. Kotyuk

    2014-12-01

    Full Text Available The paper provides the information on the component composition of ethereal oil of Satureja hortensis cultivated in Zhytomyr Polissya. In the ethereal oil of summer savory, 19 components were identified: carvacrol (89,07%, γ-terpinene (3,53%, α-thujone (1,7%, camphora (1,48%, terpinen-4 ol 4 (0,91%, β-bisabolen (0,56%, β-caryophyllene (0,45%, bitsiklogermakren (0,38% para-cymene (0,34%, 1,8-cineole (0,33%, trans-sabinengidrat (0.25%, 1-octen-3-ol (0.20%, spatulenol (0,18%, β-thujone (0,14%, eugenol (0,11%, geranylacetate (0,11%, humulene (0,09%, α-terpinene (0,09%, octanol-3 (0,07%. A high carvacrol content determines antimicrobial properties of summer savory. The antimicrobial activity of S. hortensis extract was studied in accordance with the common methodology of determining the sensitivity of microorganisms to antibacterial preparations. The aboveground part of plants harvested in the last ten-day period of August, in the flowering phase, was used in the experiments. The raw material was reduced to fragments of 1-1.5mm according to the requirements of pharmacopoeia. The extract of S. hortensis was obtained by the method of maceration in 40% ethyl alcohol at a ratio of 1:5 and the concentration of 200mg/ml. The availability of antimicrobial activity of extracted substances in the structure of the substances studied was determined by the way of comparison of their minimum inhibiting concentrations (MIC and minimum bactericidal/fungicidal concentrations (MBC/MFC with those in 40% ethyl alcohol. The paper investigates the biological activity of 40 % ethanol extract of Satureja hortensis herb grown under the conditions of Ukrainian Polissya as to golden staphylococcus (Staphylococcus aureus, coliform bacillus Escherichia coli, Pseudomonas aeruginosa and Candida albicans which are pathogenic in reference to other organisms. It has been shown that S. hortensis extract was characterized by antimicrobial activity since extracted substances

  10. Microbial translocation is correlated with HIV evolution in HIV-HCV co-infected patients.

    Directory of Open Access Journals (Sweden)

    Jean-Jacques Tudesq

    Full Text Available Microbial translocation (MT is characterized by bacterial products passing into the blood through the gut barrier and is a key phenomenon in the pathophysiology of Human Immunodeficiency Virus (HIV infection. MT is also associated with liver damage in Hepatitis C Virus (HCV patients. The aim of the study was to assess MT in plasma of HIV-HCV co-infected patients. 16S rDNA (16 S Ribosomal DNA subunit marker and other markers of MT such as Lipopolysaccharide (LPS-binding protein (LBP, soluble CD14 (sCD14, intestinal fatty acid binding protein (I-FABP were used. Clinical, biological and immunological characteristics of the population were studied in order to correlate them with the intensity of the MT. We demonstrate that indirect markers of MT, LBP and CD14s, and a marker of intestinal permeability (I-FABP are significantly higher in HIV-HCV co-infected patients than in healthy controls (17.0 vs 2.6 μg/mL, p < 0.001; 1901.7 vs 1255.0 ng/mL, p = 0.018; 478.3 vs 248.1 pg/mL, p < 0.001, respectively, while a direct marker of MT (16S rDNA copies is not different between these two populations. However, plasma 16S rDNA was significantly higher in co-infected patients with long-standing HIV infections (RGM = 1.47 per 10 years, CI95% = [1.04:2.06], p = 0.03. Our findings show that in HIV-HCV co-infected patients, plasma 16S rDNA levels, directly reflecting MT, seem to be linked to the duration of HIV infection, while elevated levels of LBP and sCD14 reflect only a persistence of immune activation. The levels of these markers were not correlated with HCV evolution.

  11. ANTIMICROBIAL SUSCEPTIBILITY PROFILE OF MICROBIAL PATHOGENS ISOLATED FROM CALVES WITH RESPIRATORY DISEASES

    Directory of Open Access Journals (Sweden)

    George Cosmin Nadas

    2016-11-01

    infections in calves, but the administration should always be preceded by susceptibility testing of the isolates.

  12. Infections by pathogens with different transmission modes in feral cats from urban and rural areas of Korea.

    Science.gov (United States)

    Hwang, Jusun; Gottdenker, Nicole; Oh, Dae-Hyun; Lee, Hang; Chun, Myung-Sun

    2017-12-31

    In this study, we examine prevalences of three infectious pathogens with different transmission modes ( Bartonella henselae , hemoplasma, and Toxoplasma gondii ) in feral cats from urban and rural habitats. Infection status of the three pathogens in blood samples (n = 117) was determined through molecular or serological diagnostic methods. Overall prevalence of hemoplasma, Toxoplasma gondii , and Bartonella henselae was 47.9%, 50%, and 35.7%, respectively. Comparing the two habitats, only seroprevalence of Bartonella henselae was significantly higher in urban cats. Based on the results, we discuss how pathogens with distinct transmission modes may show different prevalence between urban and rural habitat types.

  13. Removal of waterborne pathogens from liver transplant unit water taps in prevention of healthcare-associated infections: a proposal for a cost-effective, proactive infection control strategy.

    Science.gov (United States)

    Zhou, Z Y; Hu, B J; Qin, L; Lin, Y E; Watanabe, H; Zhou, Q; Gao, X D

    2014-04-01

    Hospital water supplies often contain waterborne pathogens, which can become a reservoir for healthcare-associated infections (HAIs). We surveyed the extent of waterborne pathogen contamination in the water supply of a Liver Transplant Unit. The efficacy of point-of-use (POU) water filters was evaluated by comparative analysis in routine clinical use. Our baseline environmental surveillance showed that Legionella spp. (28%, 38/136), Pseudomonas aeruginosa (8%, 11/136), Mycobacterium spp. (87%, 118/136) and filamentous fungi (50%, 68/136) were isolated from the tap water of the Liver Transplant Unit. 28.9% of Legionella spp.-positive water samples (n = 38) showed high-level Legionella contamination (≥10(3) CFU/L). After installation of the POU water filter, none of these pathogens were found in the POU filtered water samples. Furthermore, colonizations/infections with Gram-negative bacteria determined from patient specimens were reduced by 47% during this period, even if only 27% (3/11) of the distal sites were installed with POU water filters. In conclusion, the presence of waterborne pathogens was common in the water supply of our Liver Transplant Unit. POU water filters effectively eradicated these pathogens from the water supply. Concomitantly, healthcare-associated colonization/infections declined after the POU filters were installed, indicating their potential benefit in reducing waterborne HAIs. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  14. Antimicrobial potential of two traditional herbometallic drugs against certain pathogenic microbial species.

    Science.gov (United States)

    Wijenayake, A U; Abayasekara, C L; Pitawala, H M T G A; Bandara, B M R

    2016-09-15

    water soluble concentrations of the toxic elements were below the detection limits. Both drugs have significantly higher percentages of organic constituents and volatile minerals and particle sizes of drugs are in the nanometer range. AV and MR Rasashastra preparations could provide alternatives to synthetic antibiotics against human bacterial infections. Improved solubility and reduced particle sizes are influential physicochemical properties used to enhance the antimicrobial efficacy of the drugs. Therefore, traditional knowledge on the use of antimicrobial mineral sources could provide a novel path for the producing of effective antimicrobial drugs. However, further chemical and toxicological studies are urgently needed for a greater understanding of their toxicity to humans.

  15. Co-infection with arthropod-borne pathogens in domestic cats.

    Science.gov (United States)

    André, Marcos Rogério; Filgueira, Kilder Dantas; Calchi, Ana Cláudia; Sousa, Keyla Carstens Marques de; Gonçalves, Luiz Ricardo; Medeiros, Vitor Brasil; Ximenes, Poliana Araújo; Lelis, Ivana Cristina Nunes Gadelha; Meireles, Maria Vanuza Nunes de; Machado, Rosangela Zacarias

    2017-01-01

    The role of several feline vector-borne pathogens (FVBP) as a cause of disease in cats has not been clearly determined. In fact, with the exception of Bartonella spp. and hemoplasmas, FVBP in cats has not been clearly determined in Brazil yet. The present study aimed at identifying, by using molecular methods, the presence of FVBP in three cats showing non-specific clinical signs and inclusions suggestive of hemoparasites in blood smears. Cytauxzoon felis, 'Candidatus Mycoplasma haemominutum', Ehrlichia sp. closely related to Ehrlichia canis, and Anaplasma sp. closely related to Anaplasma phagocytophilum were detected in blood samples from two out of three sampled cats. Both cats positive for multiple FVBP did not show hematological and biochemical abnormalities. The present work emphasizes the need for molecular confirmation of co-infection by multiple FVBP in cats presenting non-specific clinical signs and inclusions resembling hemoparasites in blood smears.

  16. Co-infection with arthropod-borne pathogens in domestic cats

    Directory of Open Access Journals (Sweden)

    Marcos Rogério André

    2017-11-01

    Full Text Available Abstract The role of several feline vector-borne pathogens (FVBP as a cause of disease in cats has not been clearly determined. In fact, with the exception of Bartonella spp. and hemoplasmas, FVBP in cats has not been clearly determined in Brazil yet. The present study aimed at identifying, by using molecular methods, the presence of FVBP in three cats showing non-specific clinical signs and inclusions suggestive of hemoparasites in blood smears. Cytauxzoon felis, ‘Candidatus Mycoplasma haemominutum’, Ehrlichia sp. closely related to Ehrlichia canis, and Anaplasma sp. closely related to Anaplasma phagocytophilum were detected in blood samples from two out of three sampled cats. Both cats positive for multiple FVBP did not show hematological and biochemical abnormalities. The present work emphasizes the need for molecular confirmation of co-infection by multiple FVBP in cats presenting non-specific clinical signs and inclusions resembling hemoparasites in blood smears.

  17. Features of pathology in mice experimentally infected with highly pathogenic H5N1 influenza virus

    International Nuclear Information System (INIS)

    Ryabchikova, E. I.; Taranov, O. S.; Malkova, E. M.; Gritsyk, O. B.; Demina, O. K.

    2009-01-01

    Avian influenza became a new threat and has set people thinking about possibility of new influenza pandemic which may be caused by highly pathogenic H5N1 influenza virus. The virus could acquire ability of fast spreading between the humans and new pandemics could kill millions. Influenza virus H5N1 exhibited its deadly essence by taking out many millions of birds in nature and aviculture; other millions of chicks and ducks were killed to prevent spread of the epizootic. The strains isolated in Russia belong to Qinghai group of H5N1 influenza virus, and were imported to Russia by migratory birds. We examined time-course changes in mice blood and lungs after intranasal infection with strains A /Chicken/ Kurgan/ 05/2005, A/ Duck/ Kurgan/08/ 2005 and A/ Chicken/ Suzdalka/ Nov-11/2005 differing in virulence for this animal species. Development of leucopenia and severe damage of hemopoiesis were found in mice infected with all H5N1 influenza virus strains. Pathological changes in mice lungs during the infection with above mentioned strains, and strain-specific features have been examined. Main characteristics of lung pathology in all mice were focal nature of the alterations, severe damage of bronchial epithelium and pronounced alteration of lung vasculature. Strain A/Chicken/Suzdalka/Nov-11/2005 induced massive apoptosis of infected bronchial cells which may be a part of mechanism responsible for avirulent properties of this strain. The most interesting finding was absence of serious direct virus damage of the lung evidencing for principal role of the host humoral mechanisms in pathogenesis of H5N1 influenza in mice.(author)

  18. Transcriptome analysis of Pseudostellaria heterophylla in response to the infection of pathogenic Fusarium oxysporum.

    Science.gov (United States)

    Qin, Xianjin; Wu, Hongmiao; Chen, Jun; Wu, Linkun; Lin, Sheng; Khan, Muhammad Umar; Boorboori, Mohammad Reza; Lin, Wenxiong

    2017-09-18

    Pseudostellaria heterophylla (P. heterophylla), a herbaceous perennial, belongs to Caryophyllaceae family and is one of the Chinese herbal medicine with high pharmacodynamic value. It can be used to treat the spleen deficiency, anorexia, weakness after illness and spontaneous perspiration symptoms. Our previous study found that consecutive monoculture of Pseudostellaria heterophylla could lead to the deterioration of the rhizosphere microenvironment. The specialized forms of pathogenic fungus Fusarium oxysporum f.Sp. heterophylla (F. oxysporum) in rhizosphere soils of P. heterophylla plays an important role in the consecutive monoculture of P. heterophylla. In this study, F. oxysporum was used to infect the tissue culture plantlets of P. heterophylla to study the responding process at three different infection stages by using RNA-sequencing. We obtained 127,725 transcripts and 47,655 distinct unigenes by de novo assembly and obtained annotated information in details for 25,882 unigenes. The Kyoto Encyclopedia of Genes and Genomes pathway analysis and the real-time quantitative PCR results suggest that the calcium signal system and WRKY transcription factor in the plant-pathogen interaction pathway may play an important role in the response process, and all of the WRKY transcription factor genes were divided into three different types. Moreover, we also found that the stimulation of F. oxysporum may result in the accumulation of some phenolics in the plantlets and the programmed cell death of the plantlets. This study has partly revealed the possible molecular mechanism of the population explosion of F. oxysporum in rhizosphere soils and signal response process, which can be helpful in unraveling the role of F. oxysporum in consecutive monoculture problems of P. heterophylla.

  19. Neuropathogenesis of a highly pathogenic avian influenza virus (H7N1 in experimentally infected chickens

    Directory of Open Access Journals (Sweden)

    Chaves Aida J

    2011-10-01

    Full Text Available Abstract In order to understand the mechanism of neuroinvasion of a highly pathogenic avian influenza virus (HPAIV into the central nervous system (CNS of chickens, specific pathogen free chickens were inoculated with a H7N1 HPAIV. Blood, cerebrospinal fluid (CSF, nasal cavity and brain tissue samples were obtained from 1 to 4 days post-inoculation (dpi of infected and control chickens. Viral antigen topographical distribution, presence of influenza A virus receptors in the brain, as well as, the role of the olfactory route in virus CNS invasion were studied using different immunohistochemistry techniques. Besides, viral RNA load in CSF and blood was quantified by means of a quantitative real-time reverse transcription-polymerase chain reaction. Viral antigen was observed widely distributed in the CNS, showing bilateral and symmetrical distribution in the nuclei of the diencephalon, mesencephalon and rhombencephalon. Viral RNA was detected in blood and CSF at one dpi, indicating that the virus crosses the blood-CSF-barrier early during infection. This early dissemination is possibly favoured by the presence of Siaα2,3 Gal and Siaα2,6 Gal receptors in brain vascular endothelial cells, and Siaα2,3 Gal receptors in ependymal and choroid plexus cells. No viral antigen was observed in olfactory sensory neurons, while the olfactory bulb showed only weak staining, suggesting that the virus did not use this pathway to enter into the brain. The sequence of virus appearance and the topographical distribution of this H7N1 HPAIV indicate that the viral entry occurs via the haematogenous route, with early and generalized spreading through the CSF.

  20. Neuropathogenesis of a highly pathogenic avian influenza virus (H7N1) in experimentally infected chickens.

    Science.gov (United States)

    Chaves, Aida J; Busquets, Núria; Valle, Rosa; Rivas, Raquel; Vergara-Alert, Júlia; Dolz, Roser; Ramis, Antonio; Darji, Ayub; Majó, Natàlia

    2011-10-07

    In order to understand the mechanism of neuroinvasion of a highly pathogenic avian influenza virus (HPAIV) into the central nervous system (CNS) of chickens, specific pathogen free chickens were inoculated with a H7N1 HPAIV. Blood, cerebrospinal fluid (CSF), nasal cavity and brain tissue samples were obtained from 1 to 4 days post-inoculation (dpi) of infected and control chickens. Viral antigen topographical distribution, presence of influenza A virus receptors in the brain, as well as, the role of the olfactory route in virus CNS invasion were studied using different immunohistochemistry techniques. Besides, viral RNA load in CSF and blood was quantified by means of a quantitative real-time reverse transcription-polymerase chain reaction. Viral antigen was observed widely distributed in the CNS, showing bilateral and symmetrical distribution in the nuclei of the diencephalon, mesencephalon and rhombencephalon. Viral RNA was detected in blood and CSF at one dpi, indicating that the virus crosses the blood-CSF-barrier early during infection. This early dissemination is possibly favoured by the presence of Siaα2,3 Gal and Siaα2,6 Gal receptors in brain vascular endothelial cells, and Siaα2,3 Gal receptors in ependymal and choroid plexus cells. No viral antigen was observed in olfactory sensory neurons, while the olfactory bulb showed only weak staining, suggesting that the virus did not use this pathway to enter into the brain. The sequence of virus appearance and the topographical distribution of this H7N1 HPAIV indicate that the viral entry occurs via the haematogenous route, with early and generalized spreading through the CSF.

  1. Evaluating surveillance strategies for the early detection of low pathogenicity avian influenza infections.

    Science.gov (United States)

    Comin, Arianna; Stegeman, Arjan; Marangon, Stefano; Klinkenberg, Don

    2012-01-01

    In recent years, the early detection of low pathogenicity avian influenza (LPAI) viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms) was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h)). The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h) reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control). Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier), whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus introduction

  2. Evaluating surveillance strategies for the early detection of low pathogenicity avian influenza infections.

    Directory of Open Access Journals (Sweden)

    Arianna Comin

    Full Text Available In recent years, the early detection of low pathogenicity avian influenza (LPAI viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h. The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control. Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier, whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus

  3. Microbial aggregates within tissues infect a diversity of corals throughout the Indo-Pacific

    Science.gov (United States)

    Work, Thierry M.; Aeby, Greta S.

    2014-01-01

    Coral reefs are highly diverse ecosystems where symbioses play a pivotal role. Corals contain cell-associated microbial aggregates (CAMA), yet little is known about how widespread they are among coral species or the nature of the symbiotic relationship. Using histology, we found CAMA within 24 species of corals from 6 genera from Hawaii, American Samoa, Palmyra, Johnston Atoll, Guam, and Australia. Prevalence (%) of infection varied among coral genera: Acropora, Porites, and Pocillopora were commonly infected whereas Montipora were not. Acropora from the Western Pacific were significantly more likely to be infected with CAMA than those from the Central Pacific, whereas the reverse was true for Porites. Compared with apparently healthy colonies, tissues from diseased colonies were significantly more likely to have both surface and basal body walls infected. The close association of CAMA with host cells in numerous species of apparently healthy corals and lack of associated cell pathology reveals an intimate agent-host association. Furthermore, CAMA are Gram negative and in some corals may be related to chlamydia or rickettsia. We propose that CAMA in adult corals are facultative secondary symbionts that could play an important ecological role in some dominant coral genera in the Indo-Pacific. CAMA are important in the life histories of other animals, and more work is needed to understand their role in the distribution, evolution, physiology, and immunology of reef corals.

  4. Pharmacological synergism of bee venom and melittin with antibiotics and plant secondary metabolites against multi-drug resistant microbial pathogens.

    Science.gov (United States)

    Al-Ani, Issam; Zimmermann, Stefan; Reichling, Jürgen; Wink, Michael

    2015-02-15

    The goal of this study was to investigate the antimicrobial activity of bee venom and its main component, melittin, alone or in two-drug and three-drug combinations with antibiotics (vancomycin, oxacillin, and amikacin) or antimicrobial plant secondary metabolites (carvacrol, benzyl isothiocyanate, the alkaloids sanguinarine and berberine) against drug-sensitive and antibiotic-resistant microbial pathogens. The secondary metabolites were selected corresponding to the molecular targets to which they are directed, being different from those of melittin and the antibiotics. The minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC) were evaluated by the standard broth microdilution method, while synergistic or additive interactions were assessed by checkerboard dilution and time-kill curve assays. Bee venom and melittin exhibited a broad spectrum of antibacterial activity against 51 strains of both Gram-positive and Gram-negative bacteria with strong anti-MRSA and anti-VRE activity (MIC values between 6 and 800 µg/ml). Moreover, bee venom and melittin showed significant antifungal activity (MIC values between 30 and 100 µg/ml). Carvacrol displayed bactericidal activity, while BITC exhibited bacteriostatic activity against all MRSA and VRE strains tested (reference strains and clinical isolates), both compounds showed a remarkable fungicidal activity with minimum fungicidal concentration (MFC) values between 30 and 200 µg/ml. The DNA intercalating alkaloid sanguinarine showed bactericidal activity against MRSA NCTC 10442 (MBC 20 µg/ml), while berberine exhibited bacteriostatic activity against MRSA NCTC 10442 (MIC 40 µg/ml). Checkerboard dilution tests mostly revealed synergism of two-drug combinations against all the tested microorganisms with FIC indexes between 0.24 and 0.50, except for rapidly growing mycobacteria in which combinations exerted an additive effect (FICI = 0.75-1). In time-kill assays all three

  5. MICROBIAL COMMUNITY OF BLACK BAND DISEASE ON INFECTION, HEALTHY, AND DEAD PART OF SCLERACTINIAN Montipora sp. COLONY AT SERIBU ISLANDS, INDONESIA

    Directory of Open Access Journals (Sweden)

    Ofri Johan

    2014-12-01

    Full Text Available It is crucial to understand the microbial community associated with the host when attempting to discern the pathogen responsible for disease outbreaks in scleractinian corals. This study determines changes in the bacterial community associated with Montipora sp. in response to black band disease in Indonesian waters. Healthy, diseased, and dead Montipora sp. (n = 3 for each sample type per location were collected from three different locations (Pari Island, Pramuka Island, and Peteloran Island. DGGE (Denaturing Gradient Gel Electrophoresis was carried out to identify the bacterial community associated with each sample type and histological analysis was conducted to identify pathogens associated with specific tissues. Various Desulfovibrio species were found as novelty to be associated with infection samples, including Desulfovibrio desulfuricans, Desulfovibrio magneticus, and Desulfovibrio gigas, Bacillus benzoevorans, Bacillus farraginis in genus which previously associated with pathogenicity in corals. Various bacterial species associated with uninfected corals were lost in diseased and dead samples. Unlike healthy samples, coral tissues such as the epidermis, endodermis, zooxanthellae were not present on dead samples under histological observation. Liberated zooxanthellae and cyanobacteria were found in black band diseased Montipora sp. samples.

  6. Induced Release of a Plant-Defense Volatile ‘Deceptively’ Attracts Insect Vectors to Plants Infected with a Bacterial Pathogen

    Science.gov (United States)

    Mann, Rajinder S.; Ali, Jared G.; Hermann, Sara L.; Tiwari, Siddharth; Pelz-Stelinski, Kirsten S.; Alborn, Hans T.; Stelinski, Lukasz L.

    2012-01-01

    Transmission of plant pathogens by insect vectors is a complex biological process involving interactions between the plant, insect, and pathogen. Pathogen-induced plant responses can include changes in volatile and nonvolatile secondary metabolites as well as major plant nutrients. Experiments were conducted to understand how a plant pathogenic bacterium, Candidatus Liberibacter asiaticus (Las), affects host preference behavior of its psyllid (Diaphorina citri Kuwayama) vector. D. citri were attracted to volatiles from pathogen-infected plants more than to those from non-infected counterparts. Las-infected plants were more attractive to D. citri adults than non-infected plants initially; however after feeding, psyllids subsequently dispersed to non-infected rather than infected plants as their preferred settling point. Experiments with Las-infected and non-infected plants under complete darkness yielded similar results to those recorded under light. The behavior of psyllids in response to infected versus non-infected plants was not influenced by whether or not they were carriers of the pathogen. Quantification of volatile release from non-infected and infected plants supported the hypothesis that odorants mediate psyllid preference. Significantly more methyl salicylate, yet less methyl anthranilate and D-limonene, was released by infected than non-infected plants. Methyl salicylate was attractive to psyllids, while methyl anthranilate did not affect their behavior. Feeding on citrus by D. citri adults also induced release of methyl salicylate, suggesting that it may be a cue revealing location of conspecifics on host plants. Infected plants were characterized by lower levels of nitrogen, phosphorus, sulfur, zinc, and iron, as well as, higher levels of potassium and boron than non-infected plants. Collectively, our results suggest that host selection behavior of D. citri may be modified by bacterial infection of plants, which alters release of specific headspace

  7. Gastrointestinal and urinary tract pathogenic infections among HIV seropositive patients at the Komfo Anokye Teaching Hospital in Ghana.

    Science.gov (United States)

    Boaitey, Yaw Agyekum; Nkrumah, Bernard; Idriss, Ali; Tay, Samuel Crowther Kofi

    2012-08-21

    Gastrointestinal and urinary tract pathogenic infections are aggravating the incidence and progression of the Human Immunodeficiency Virus (HIV) infection into Acquired Immune Deficiency Syndrome (AIDS) more especially in the developing countries. This study was conducted to assess the common gastrointestinal and urinary infections among HIV/AIDS patients at the Komfo Anokye Teaching Hospital (KATH) in Ghana between April and December 2008. This work reports on gastrointestinal and urinary tract pathogenic infections among 500 HIV seropositive and 300 HIV seronegative patients. There was a 35% (175/500) prevalence of intestinal parasites among HIV seropositive patients compared to 4.3% (13/300) in HIV seronegative patients. Giardia lamblia and Cryptosporidium accounted for 19% (95/500) and 14% (70/500) respectively, while Schistosoma mansoni, Strongyloides stercoralis and hookworm together accounted for 2% (10/500) of intestinal parasitic infections among the HIV seropositive patients. There was no significant difference (p > 0.05) in urinary parasitic infection between HIV seropositive 1% (2/500) and seronegative patients 0.7% (2/300). Most, 60 (86%) out of 70, of the urinary tract infection among the HIV seropositive patients was due to bacteria with E. coli being the most predominant isolate, 28 (47%) out of 60. There was no significant difference in infections based on age and gender. G. lamblia and Cryptosporidium were the most common gastrointestinal parasites detected while bacteria accounted for majority of the urinary tract infections among the HIV seropositive patients at the hospital.

  8. Use of amplicon sequencing to improve sensitivity in PCR-based detection of microbial pathogen in environmental samples.

    Science.gov (United States)

    Saingam, Prakit; Li, Bo; Yan, Tao

    2018-06-01

    DNA-based molecular detection of microbial pathogens in complex environments is still plagued by sensitivity, specificity and robustness issues. We propose to address these issues by viewing them as inadvertent consequences of requiring specific and adequate amplification (SAA) of target DNA molecules by current PCR methods. Using the invA gene of Salmonella as the model system, we investigated if next generation sequencing (NGS) can be used to directly detect target sequences in false-negative PCR reaction (PCR-NGS) in order to remove the SAA requirement from PCR. False-negative PCR and qPCR reactions were first created using serial dilutions of laboratory-prepared Salmonella genomic DNA and then analyzed directly by NGS. Target invA sequences were detected in all false-negative PCR and qPCR reactions, which lowered the method detection limits near the theoretical minimum of single gene copy detection. The capability of the PCR-NGS approach in correcting false negativity was further tested and confirmed under more environmentally relevant conditions using Salmonella-spiked stream water and sediment samples. Finally, the PCR-NGS approach was applied to ten urban stream water samples and detected invA sequences in eight samples that would be otherwise deemed Salmonella negative. Analysis of the non-target sequences in the false-negative reactions helped to identify primer dime-like short sequences as the main cause of the false negativity. Together, the results demonstrated that the PCR-NGS approach can significantly improve method sensitivity, correct false-negative detections, and enable sequence-based analysis for failure diagnostics in complex environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Viral Small-RNA Analysis of Bombyx mori Larval Midgut during Persistent and Pathogenic Cytoplasmic Polyhedrosis Virus Infection

    OpenAIRE

    Zografidis, Aris; Van Nieuwerburgh, Filip; Kolliopoulou, Anna; Apostolou-Karampelis, Konstantinos; Head, Steven R.; Deforce, Dieter; Smagghe, Guy; Swevers, Luc

    2015-01-01

    The lepidopteran innate immune response against RNA viruses remains poorly understood, while in other insects several studies have highlighted an essential role for the exo-RNAi pathway in combating viral infection. Here, by using deep-sequencing technology for viral small-RNA (vsRNA) assessment, we provide evidence that exo-RNAi is operative in the silkworm Bombyx mori against both persistent and pathogenic infection of B. mori cytoplasmic polyhedrosis virus (BmCPV) which is characterized by...

  10. THE “CHALLENGING” MULTIDRUG-RESISTANT PATHOGENS OF NOSOCOMIAL INFECTIONS IN CRITICALLY ILL PATIENTS (A LITERATURE REVIEW

    Directory of Open Access Journals (Sweden)

    T. V. Chernenkaya

    2015-01-01

    Full Text Available ABSTRACT. Changes in the structure of the main causative agents of nosocomial infections and significant spread of multidrug­resistant strains of bacteria are a natural biological response for antibiotics that selectively inhibit pathogens and contribute to selection, survival and growth of drug resistant strains of bacteria. In this literature review we present the change of structure of the major causative microorganisms of nosocomial septic infections and theirs resistance to antibiotics for the last 70 years. 

  11. Viral pathogen discovery

    Science.gov (United States)

    Chiu, Charles Y

    2015-01-01

    Viral pathogen discovery is of critical importance to clinical microbiology, infectious diseases, and public health. Genomic approaches for pathogen discovery, including consensus polymerase chain reaction (PCR), microarrays, and unbiased next-generation sequencing (NGS), have the capacity to comprehensively identify novel microbes present in clinical samples. Although numerous challenges remain to be addressed, including the bioinformatics analysis and interpretation of large datasets, these technologies have been successful in rapidly identifying emerging outbreak threats, screening vaccines and other biological products for microbial contamination, and discovering novel viruses associated with both acute and chronic illnesses. Downstream studies such as genome assembly, epidemiologic screening, and a culture system or animal model of infection are necessary to establish an association of a candidate pathogen with disease. PMID:23725672

  12. Priming by Rhizobacterium Protects Tomato Plants from Biotrophic and Necrotrophic Pathogen Infections through Multiple Defense Mechanisms

    Science.gov (United States)

    Ahn, Il-Pyung; Lee, Sang-Woo; Kim, Min Gab; Park, Sang-Ryeol; Hwang, Duk-Ju; Bae, Shin-Chul

    2011-01-01

    A selected strain of rhizobacterium, Pseudomonas putida strain LSW17S (LSW17S), protects tomato plants (Lycopersicon esculentum L. cv. Seokwang) from bacterial speck by biotrophic Pseudomonas syringae pv. tomato strain DC3000 (DC3000) and bacterial wilt by necrotrophic Ralstonia solanacearum KACC 10703 (Rs10703). To investigate defense mechanisms induced by LSW17S in tomato plants, transcription patterns of pathogenesis-related (PR) genes and H2O2 production were analyzed in plants treated with LSW17S and subsequent pathogen inoculation. LSW17S alone did not induce transcriptions of employed PR genes in leaves and roots. DC3000 challenge following LSW17S triggered rapid transcriptions of PR genes and H2O2 production in leaves and roots. Catalase infiltration with DC3000 attenuated defense-related responses and resistance against DC3000 infection. Despite depriving H2O2 production and PR1b transcription by the same treatment, resistance against Rs10703 infection was not deterred significantly. H2O2 is indispensable for defense signaling and/or mechanisms primed by LSW17S and inhibition of bacterial speck, however, it is not involved in resistance against bacterial wilt. PMID:21710203

  13. Immunological Control of Viral Infections in Bats and the Emergence of Viruses Highly Pathogenic to Humans

    Directory of Open Access Journals (Sweden)

    Tony Schountz

    2017-09-01

    Full Text Available Bats are reservoir hosts of many important viruses that cause substantial disease in humans, including coronaviruses, filoviruses, lyssaviruses, and henipaviruses. Other than the lyssaviruses, they do not appear to cause disease in the reservoir bats, thus an explanation for the dichotomous outcomes of infections of humans and bat reservoirs remains to be determined. Bats appear to have a few unusual features that may account for these differences, including evidence of constitutive interferon (IFN activation and greater combinatorial diversity in immunoglobulin genes that do not undergo substantial affinity maturation. We propose these features may, in part, account for why bats can host these viruses without disease and how they may contribute to the highly pathogenic nature of bat-borne viruses after spillover into humans. Because of the constitutive IFN activity, bat-borne viruses may be shed at low levels from bat cells. With large naive antibody repertoires, bats may control the limited virus replication without the need for rapid affinity maturation, and this may explain why bats typically have low antibody titers to viruses. However, because bat viruses have evolved in high IFN environments, they have enhanced countermeasures against the IFN response. Thus, upon infection of human cells, where the IFN response is not constitutive, the viruses overwhelm the IFN response, leading to abundant virus replication and pathology.

  14. Microfluidic system for the identification of bacterial pathogens causing urinary tract infections

    Science.gov (United States)

    Becker, Holger; Hlawatsch, Nadine; Haraldsson, Tommy; van der Wijngaart, Wouter; Lind, Anders; Malhotra-Kumar, Surbi; Turlej-Rogacka, Agata; Goossens, Herman

    2015-03-01

    Urinary tract infections (UTIs) are among the most common bacterial infections and pose a significant healthcare burden. The growing trend in antibiotic resistance makes it mandatory to develop diagnostic kits which allow not only the determination of a pathogen but also the antibiotic resistances. We have developed a microfluidic cartridge which takes a direct urine sample, extracts the DNA, performs an amplification using batch-PCR and flows the sample over a microarray which is printed into a microchannel for fluorescence detection. The cartridge is injection-molded out of COP and contains a set of two-component injection-molded rotary valves to switch between input and to isolate the PCR chamber during thermocycling. The hybridization probes were spotted directly onto a functionalized section of the outlet microchannel. We have been able to successfully perform PCR of E.coli in urine in this chip and perform a fluorescence detection of PCR products. An upgraded design of the cartridge contains the buffers and reagents in blisters stored on the chip.

  15. Hyperglycemia Impairs Neutrophil-Mediated Bacterial Clearance in Mice Infected with the Lyme Disease Pathogen.

    Directory of Open Access Journals (Sweden)

    Ashkan Javid

    Full Text Available Insulin-insufficient type 1 diabetes is associated with attenuated bactericidal function of neutrophils, which are key mediators of innate immune responses to microbes as well as pathological inflammatory processes. Neutrophils are central to immune responses to the Lyme pathogen Borrelia burgdorferi. The effect of hyperglycemia on host susceptibility to and outcomes of B. burgdorferi infection has not been examined. The present study investigated the impact of sustained obesity-independent hyperglycemia in mice on bacterial clearance, inflammatory pathology and neutrophil responses to B. burgdorferi. Hyperglycemia was associated with reduced arthritis incidence but more widespread tissue colonization and reduced clearance of bacterial DNA in multiple tissues including brain, heart, liver, lung and knee joint. B. burgdorferi uptake and killing were impaired in neutrophils isolated from hyperglycemic mice. Thus, attenuated neutrophil function in insulin-insufficient hyperglycemia was associated with reduced B. burgdorferi clearance in target organs. These data suggest that investigating the effects of comorbid conditions such as diabetes on outcomes of B. burgdorferi infections in humans may be warranted.

  16. Sugarcane Elongin C is involved in infection by sugarcane mosaic disease pathogens.

    Science.gov (United States)

    Zhai, Yushan; Deng, Yuqing; Cheng, Guangyuan; Peng, Lei; Zheng, Yanru; Yang, Yongqing; Xu, Jingsheng

    2015-10-23

    Sugarcane (Saccharum sp. hybrid) provides the main source of sugar for humans. Sugarcane mosaic disease (SMD) is a major threat to sugarcane production. Currently, control of SMD is mainly dependent on breeding resistant cultivars through hybridization, which is time-consuming. Understanding the mechanism of viral infection may facilitate novel strategies to breed cultivars resistant to SMD and to control the disease. In this study, a wide interaction was detected between the viral VPg protein and host proteins. Several genes were screened from sugarcane cDNA library that could interact with Sugarcane streak mosaic virus VPg, including SceIF4E1 and ScELC. ScELC was predicted to be a cytoplasmic protein, but subcellular localization analysis showed it was distributed both in cytoplasmic and nuclear, and interactions were also detected between ScELC and VPg of SCMV or SrMV that reveal ScELC was widely used in the SMD pathogen infection process. ScELC and VPgs interacted in the nucleus, and may function to enhance the viral transcription rate. ScELC also interacted with SceIF4E2 both in the cytoplasm and nucleus, but not with SceIF4E1 and SceIF4E3. These results suggest that ScELC may be essential for the function of SceIF4E2, an isomer of eIF4E. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Plant-pathogen interactions: leaf physiology alterations in poplars infected with rust (Melampsora medusae).

    Science.gov (United States)

    Gortari, Fermín; Guiamet, Juan José; Graciano, Corina

    2018-01-23

    Rust produced by Melampsora sp. is considered one of the most relevant diseases in poplar plantations. Growth reduction in poplar plantations takes place because rust, like other pathogens, alters leaf physiology. There is not a complete evaluation of several of the physiological traits that can be affected by rust at leaf level. Therefore, the aim of this work was to evaluate, in an integrative way and in the same pathosystem, which physiological processes are affected when Populus deltoides Bartr. ex Marsh. leaves are infected by rust (Melampsora medusae Thümen). Leaves of two clones with different susceptibility to rust were analyzed. Field and pot experiments were performed, and several physiological traits were measured in healthy and infected leaves. We conclude that rust affects leaf mesophyll integrity, and so water movement in the leaf in liquid phase is affected. As a consequence, gas exchange is reduced, affecting both carbon fixation and transpiration. However, there is an increase in respiration rate, probably due to plant and fungal respiration. The increase in respiration rate is important in the reduction of net photosynthetic rate, but also some damage in the photosynthetic apparatus limits leaf capacity to fix carbon. The decrease in chlorophyll content would start later and seems not to explain the reduction in net photosynthetic rate. Both clones, although they have different susceptibility to rust, are affected in the same physiological mechanisms. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Unlikely remedy: fungicide clears infection from pathogenic fungus in larval southern leopard frogs (Lithobates sphenocephalus.

    Directory of Open Access Journals (Sweden)

    Shane M Hanlon

    Full Text Available Amphibians are often exposed to a wide variety of perturbations. Two of these, pesticides and pathogens, are linked to declines in both amphibian health and population viability. Many studies have examined the separate effects of such perturbations; however, few have examined the effects of simultaneous exposure of both to amphibians. In this study, we exposed larval southern leopard frog tadpoles (Lithobates sphenocephalus to the chytrid fungus Batrachochytrium dendrobatidis and the fungicide thiophanate-methyl (TM at 0.6 mg/L under laboratory conditions. The experiment was continued until all larvae completed metamorphosis or died. Overall, TM facilitated increases in tadpole mass and length. Additionally, individuals exposed to both TM and Bd were heavier and larger, compared to all other treatments. TM also cleared Bd in infected larvae. We conclude that TM affects larval anurans to facilitate growth and development while clearing Bd infection. Our findings highlight the need for more research into multiple perturbations, specifically pesticides and disease, to further promote amphibian heath.

  19. Unexpected infection outcomes of China-origin H7N9 low pathogenicity avian influenza virus in turkeys.

    Science.gov (United States)

    Slomka, Marek J; Seekings, Amanda H; Mahmood, Sahar; Thomas, Saumya; Puranik, Anita; Watson, Samantha; Byrne, Alexander M P; Hicks, Daniel; Nunez, Alejandro; Brown, Ian H; Brookes, Sharon M

    2018-05-09

    The China-origin H7N9 low pathogenicity avian influenza virus (LPAIV) emerged as a zoonotic threat in 2013 where it continues to circulate in live poultry markets. Absence of overt clinical signs in poultry is a typical LPAIV infection outcome, and has contributed to its insidious maintenance in China. This study is the first description of H7N9 LPAIV (A/Anhui/1/13) infection in turkeys, with efficient transmission to two additional rounds of introduced contact turkeys which all became infected during cohousing. Surprisingly, mortality was observed in six of eight (75%) second-round contact turkeys which is unusual for LPAIV infection, with unexpected systemic dissemination to many organs beyond the respiratory and enteric tracts, but interestingly no accompanying mutation to highly pathogenic AIV. The intravenous pathogenicity index score for a turkey-derived isolate (0.39) affirmed the LPAIV phenotype. However, the amino acid change L235Q in the haemagglutinin gene occurred in directly-infected turkeys and transmitted to the contacts, including those that died and the two which resolved infection to survive to the end of the study. This polymorphism was indicative of a reversion from mammalian to avian adaptation for the H7N9 virus. This study underlined a new risk to poultry in the event of H7N9 spread beyond China.

  20. No evidence of enemy release in pathogen and microbial communities of common wasps (Vespula vulgaris in their native and introduced range.

    Directory of Open Access Journals (Sweden)

    Philip J Lester

    Full Text Available When invasive species move to new environments they typically experience population bottlenecks that limit the probability that pathogens and parasites are also moved. The invasive species may thus be released from biotic interactions that can be a major source of density-dependent mortality, referred to as enemy release. We examined for evidence of enemy release in populations of the common wasp (Vespula vulgaris, which attains high densities and represents a major threat to biodiversity in its invaded range. Mass spectrometry proteomic methods were used to compare the microbial communities in wasp populations in the native (Belgium and England and invaded range (Argentina and New Zealand. We found no evidence of enemy release, as the number of microbial taxa was similar in both the introduced and native range. However, some evidence of distinctiveness in the microbial communities was observed between countries. The pathogens observed were similar to a variety of taxa observed in honey bees. These taxa included Nosema, Paenibacillus, and Yersina spp. Genomic methods confirmed a diversity of Nosema spp., Actinobacteria, and the Deformed wing and Kashmir bee viruses. We also analysed published records of bacteria, viruses, nematodes and fungi from both V. vulgaris and the related invader V. germanica. Thirty-three different microorganism taxa have been associated with wasps including Kashmir bee virus and entomophagous fungi such as Aspergillus flavus. There was no evidence that the presence or absence of these microorganisms was dependent on region of wasp samples (i.e. their native or invaded range. Given the similarity of the wasp pathogen fauna to that from honey bees, the lack of enemy release in wasp populations is probably related to spill-over or spill-back from bees and other social insects. Social insects appear to form a reservoir of generalist parasites and pathogens, which makes the management of wasp and bee disease difficult.

  1. No evidence of enemy release in pathogen and microbial communities of common wasps (Vespula vulgaris) in their native and introduced range.

    Science.gov (United States)

    Lester, Philip J; Bosch, Peter J; Gruber, Monica A M; Kapp, Eugene A; Peng, Lifeng; Brenton-Rule, Evan C; Buchanan, Joe; Stanislawek, Wlodek L; Archer, Michael; Corley, Juan C; Masciocchi, Maitè; Van Oystaeyen, Annette; Wenseleers, Tom

    2015-01-01

    When invasive species move to new environments they typically experience population bottlenecks that limit the probability that pathogens and parasites are also moved. The invasive species may thus be released from biotic interactions that can be a major source of density-dependent mortality, referred to as enemy release. We examined for evidence of enemy release in populations of the common wasp (Vespula vulgaris), which attains high densities and represents a major threat to biodiversity in its invaded range. Mass spectrometry proteomic methods were used to compare the microbial communities in wasp populations in the native (Belgium and England) and invaded range (Argentina and New Zealand). We found no evidence of enemy release, as the number of microbial taxa was similar in both the introduced and native range. However, some evidence of distinctiveness in the microbial communities was observed between countries. The pathogens observed were similar to a variety of taxa observed in honey bees. These taxa included Nosema, Paenibacillus, and Yersina spp. Genomic methods confirmed a diversity of Nosema spp., Actinobacteria, and the Deformed wing and Kashmir bee viruses. We also analysed published records of bacteria, viruses, nematodes and fungi from both V. vulgaris and the related invader V. germanica. Thirty-three different microorganism taxa have been associated with wasps including Kashmir bee virus and entomophagous fungi such as Aspergillus flavus. There was no evidence that the presence or absence of these microorganisms was dependent on region of wasp samples (i.e. their native or invaded range). Given the similarity of the wasp pathogen fauna to that from honey bees, the lack of enemy release in wasp populations is probably related to spill-over or spill-back from bees and other social insects. Social insects appear to form a reservoir of generalist parasites and pathogens, which makes the management of wasp and bee disease difficult.

  2. Host and Pathogen Copper-Transporting P-Type ATPases Function Antagonistically during Salmonella Infection.

    Science.gov (United States)

    Ladomersky, Erik; Khan, Aslam; Shanbhag, Vinit; Cavet, Jennifer S; Chan, Jefferson; Weisman, Gary A; Petris, Michael J

    2017-09-01

    Copper is an essential yet potentially toxic trace element that is required by all aerobic organisms. A key regulator of copper homeostasis in mammalian cells is the copper-transporting P-type ATPase ATP7A, which mediates copper transport from the cytoplasm into the secretory pathway, as well as copper export across the plasma membrane. Previous studies have shown that ATP7A-dependent copper transport is required for killing phagocytosed Escherichia coli in a cultured macrophage cell line. In this investigation, we expanded on these studies by generating Atp7a LysMcre mice, in which the Atp7a gene was specifically deleted in cells of the myeloid lineage, including macrophages. Primary macrophages isolated from Atp7a LysMcre mice exhibit decreased copper transport into phagosomal compartments and a reduced ability to kill Salmonella enterica serovar Typhimurium compared to that of macrophages isolated from wild-type mice. The Atp7a LysMcre mice were also more susceptible to systemic infection by S Typhimurium than wild-type mice. Deletion of the S Typhimurium copper exporters, CopA and GolT, was found to decrease infection in wild-type mice but not in the Atp7a LysMcre mice. These studies suggest that ATP7A-dependent copper transport into the phagosome mediates host defense against S Typhimurium, which is counteracted by copper export from the bacteria via CopA and GolT. These findings reveal unique and opposing functions for copper transporters of the host and pathogen during infection. Copyright © 2017 American Society for Microbiology.

  3. Immunomodulation of Host Chitinase 3-Like 1 During a Mammary Pathogenic Escherichia coli Infection

    Directory of Open Access Journals (Sweden)

    Koen Breyne

    2018-05-01

    Full Text Available Chitin is a N-acetyl-d-glucosamine biopolymer that can be recognized by chitin-binding proteins. Although mammals lack chitin synthase, they induce proteins responsible for detecting chitin in response to bacterial infections. Our aim was to investigate whether chitinase 3-like 1 (CHI3L1 has a potential role in the innate immunity of the Escherichia coli (E. coli infected mammary gland. CHI3L1 protein was found to be secreted in whey of naturally coliform-affected quarters compared to whey samples isolated from healthy udders. In addition, gene expression of CHI3L1 was confirmed in udder tissue of cows experimentally infected with a mammary pathogenic E. coli (MPEC strain. Despite the known anatomical differences, the bovine udders’ innate immune response was mimicked by applying an experimental mouse model using MPEC or non-MPEC isolates. The effect of CHI3L1 expression in the murine mammary gland in response to coliform bacteria was investigated through the use of CHI3L1−/− mice as well as through treatment with either a pan-caspase inhibitor or chitin particles in wild-type mice. The local induction of CHI3L1 postinfection with different E. coli strains was demonstrated to be independent of both bacterial growth and mammary interleukin (IL-8 levels. Indeed, CHI3L1 emerged as a regulator impacting on the transcytosis of Ly6G-positive cells from the interstitial space into the alveolar lumen of the mammary tissue. Furthermore, CHI3L1 was found to be upstream regulated by caspase activity and had a major downstream effect on the local pro-inflammatory cytokine profile, including IL-1beta, IL-6, and RANTES/CCL5. In conclusion, CHI3L1 was demonstrated to play a key role in the cytokine and caspase signaling during E. coli triggered inflammation of the mammary gland.

  4. Modulation of Quorum Sensing in a Gram Positive Pathogen by Linear Imprinted Copolymers with anti-Infective Properties

    NARCIS (Netherlands)

    Motib, Anfal; Guerreiro, Antonio; Al-Bayati, Firas; Piletska, Elena; Manzoor, Irfan; Shafeeq, Sulman; Kadam, Anagha; Kuipers, Oscar; Hiller, Luisa; Cowen, Todd; Piletsky, Sergey; Andrew, Peter; Yesilkaya, Hasan

    2017-01-01

    Here we describe the development, characterization and biological testing of a new type of linear molecularly imprinted polymer (LMIP) designed to act as anti-infective by blocking the quorum sensing (QS) mechanism and so preventing virulence of the pathogen Streptococcus pneumoniae. The LMIP is

  5. [Microbial etiology and susceptibility of community urinary tract infections during pregnancy in the south of Brazil].

    Science.gov (United States)

    Schenkel, Daniela Fraguas; Dallé, Jessica; Antonello, Vicente Sperb

    2014-03-01

    Urinary tract infection (UTI) is one of the most common conditions during pregnancy. The aim of this study was to assess the prevalence of germs and the antimicrobial susceptibility profile in urine culture isolates from pregnant patients treated at a tertiary maternity hospital in Porto Alegre, Brazil. A cross-sectional, retrospective and descriptive study was carried out at Hospital Fêmina, a leading institution in prenatal, birth and postnatal healthcare in the city of Porto Alegre, Brazil. A total of 482 microbial community results were analyzed out of 1,558 positive urine cultures of pregnant women in all gestational ages treated at Fêmina Hospital between January 2007 and July 2013. The susceptibility pattern presented in this research shows that the choice for UTI treatment during pregnancy should be nitrofurantoin (for uncomplicated infections) or second-generation cephalosporins such as cefuroxime (for uncomplicated and complicated infections), over ampicillin, first-generation cephalosporins and sulfamethoxazole/trimethoprim. Empirical treatment for UTI in pregnancy should be started according to the susceptibility patterns described in the literature and re-analyzed after the results of the urine culture.

  6. Urethritis/cervicitis pathogen prevalence and associated risk factors among asymptomatic HIV-infected patients in South Africa.

    Science.gov (United States)

    Lewis, David A; Chirwa, Tobias F; Msimang, Veerle M Y; Radebe, Frans M; Kamb, Mary L; Firnhaber, Cynthia S

    2012-07-01

    To determine sexually transmitted infection (STI) prevalence, and patient characteristics associated with detection of urethritis/cervicitis pathogens, among HIV-infected individuals offered voluntary STI screening at a South African HIV treatment center. Individuals, asymptomatic for genital discharge, were screened for Neisseria gonorrhoeae (NG), Chlamydia trachomatis, Trichomonas vaginalis (TV), Mycoplasma genitalium (MG) infections (real-time polymerase chain reaction assay), for syphilis and herpes simplex type 2 (serologically), and for bacterial vaginosis and Candida (microscopy, women only). Patients' most recent CD4 and viral load results were recorded. Demographic, clinical, and behavioral data were collected by nurse-administered questionnaire. Compared with men (n = 551), women (n = 558) were younger (mean age, 35.0 vs. 37.9 years; P urethritis/cervicitis pathogens detected (21.3% vs.16.4%, P = 0.035), and were less aware of their partner's HIV status (53.1% vs. 62.3%; P = 0.007). The overall prevalence of individual urethritis/cervicitis pathogens was TV (7.6%), MG (6.1%), NG (5.4%), and C. trachomatis (2.1%). Multivariate analysis highlighted 4 significant factors associated with the detection of specific urethritis/cervicitis pathogens, namely female gender (TV, adjusted odds ratio [aOR] 2.53, 95% confidence interval [CI]: 1.47-4.37), having a regular sexual partner in the past 3 months (NG, aOR 2.26, 95% CI: 1.01-5.08), suboptimal condom use with regular partners (TV, aOR 2.07, 95% CI: 1.25-3.42), and a history of genital warts in the past year (NG, 2.25, 95% CI: 1.26-4.03). Asymptomatic urethritis/cervicitis pathogens were highly prevalent in this population. Few urethritis/cervicitis pathogen-associated patient characteristics were identified, emphasizing the need for affordable STI diagnostics to screen HIV-infected patients.

  7. Incidence of Cercopithifilaria bainae in dogs and probability of co-infection with other tick-borne pathogens.

    Directory of Open Access Journals (Sweden)

    Rafael Antonio Nascimento Ramos

    Full Text Available BACKGROUND: Cercopithifilaria bainae is a filarioid parasite that infects dogs, being transmitted by Rhipicephalus sanguineus group ticks in many countries of the Mediterranean basin. This study assessed the incidence density rate (IDR of infection by C. bainae in dogs and the probability of co-infection with other tick-borne pathogens (i.e., Anaplasma platys, Babesia vogeli and Hepatozoon canis, in an area of high endemicity in southern Italy. METHODOLOGY/PRINCIPAL FINDINGS: From March 2011 to October 2012, a field study involving 58 young dogs naturally exposed to tick infestation was conducted. Skin and blood samples obtained from each dog six times during an 18-month period were tested for C. bainae by parasite detection within skin snip sediments, with subsequent confirmation through PCR and DNA sequencing. Dogs examined monthly for ticks and A. platys, B. vogeli and H. canis were microscopically and/or molecularly diagnosed and after the first and the second summer seasons, the IDR for positive animal-month at risk was 3.8% and 1.7% in November 2011 and October 2012, respectively. All 58 C. bainae-infected dogs were simultaneously infected with at least one other tick-borne pathogen. After the first summer season (assessment in November 2011, a C. bainae-infected dog had a 33% probability of being infected with H. canis or A. platys, whereas after the second tick season (assessment in October 2012 the probability of co-infection was 78%, 22% and 11% for H. canis, A. platys and B. vogeli, respectively. CONCLUSIONS: Our data indicate that tick-infested dogs are at risk of acquiring infection by C. bainae. In addition, the detection of C. bainae microfilariae indicates a prior tick exposure and, should stimulate testing for other tick-borne disease causing pathogens.

  8. A Broad-Spectrum Infection Diagnostic that Detects Pathogen-Associated Molecular Patterns (PAMPs) in Whole Blood.

    Science.gov (United States)

    Cartwright, Mark; Rottman, Martin; Shapiro, Nathan I; Seiler, Benjamin; Lombardo, Patrick; Gamini, Nazita; Tomolonis, Julie; Watters, Alexander L; Waterhouse, Anna; Leslie, Dan; Bolgen, Dana; Graveline, Amanda; Kang, Joo H; Didar, Tohid; Dimitrakakis, Nikolaos; Cartwright, David; Super, Michael; Ingber, Donald E

    2016-07-01

    Blood cultures, and molecular diagnostic tests that directly detect pathogen DNA in blood, fail to detect bloodstream infections in most infected patients. Thus, there is a need for a rapid test that can diagnose the presence of infection to triage patients, guide therapy, and decrease the incidence of sepsis. An Enzyme-Linked Lectin-Sorbent Assay (ELLecSA) that uses magnetic microbeads coated with an engineered version of the human opsonin, Mannose Binding Lectin, containing the Fc immunoglobulin domain linked to its carbohydrate recognition domain (FcMBL) was developed to quantify pathogen-associated molecular patterns (PAMPs) in whole blood. This assay was tested in rats and pigs to explore whether it can detect infections and monitor disease progression, and in prospectively enrolled, emergency room patients with suspected sepsis. These results were also compared with data obtained from non-infected patients with or without traumatic injuries. The FcMBL ELLecSA was able to detect PAMPS present on, or released by, 85% of clinical isolates representing 47 of 55 different pathogen species, including the most common causes of sepsis. The PAMP assay rapidly (animals, even when blood cultures were negative and bacteriocidal antibiotics were administered. In patients with suspected sepsis, the FcMBL ELLecSA detected infection in 55 of 67 patients with high sensitivity (>81%), specificity (>89%), and diagnostic accuracy of 0·87. It also distinguished infection from trauma-related inflammation in the same patient cohorts with a higher specificity than the clinical sepsis biomarker, C-reactive Protein. The FcMBL ELLecSA-based PAMP assay offers a rapid, simple, sensitive and specific method for diagnosing infections, even when blood cultures are negative and antibiotic therapy has been initiated. It may help to triage patients with suspected systemic infections, and serve as a companion diagnostic to guide administration of emerging dialysis-like sepsis therapies

  9. Evaluation of an ultraviolet room disinfection protocol to decrease nursing home microbial burden, infection and hospitalization rates

    OpenAIRE

    Kovach, Christine R.; Taneli, Yavuz; Neiman, Tammy; Dyer, Elaine M.; Arzaga, Alvin Jason A.; Kelber, Sheryl T

    2017-01-01

    Background The focus of nursing home infection control procedures has been on decreasing transmission between healthcare workers and residents. Less evidence is available regarding whether decontamination of high-touch environmental surfaces impacts infection rates or resident outcomes. The purpose of this study was to examine if ultraviolet disinfection is associated with changes in: 1) microbial counts and adenosine triphosphate counts on high-touch surfaces; and 2) facility wide nursing ho...

  10. Bi-layered nanocomposite bandages for controlling microbial infections and overproduction of matrix metalloproteinase activity.

    Science.gov (United States)

    Anjana, J; Mohandas, Annapoorna; Seethalakshmy, S; Suresh, Maneesha K; Menon, Riju; Biswas, Raja; Jayakumar, R

    2018-04-15

    Chronic diabetic wounds is characterised by increased microbial contamination and overproduction of matrix metalloproteases that would degrade the extracellular matrix. A bi-layer bandage was developed, that promotes the inhibition of microbial infections and matrix metalloprotease (MMPs) activity. Bi-layer bandage containing benzalkonium chloride loaded gelatin nanoparticles (BZK GNPs) in chitosan-Hyaluronic acid (HA) as a bottom layer and sodium alendronate containing chitosan as top layer was developed. We hypothesized that the chitosan-gelatin top layer with sodium alendronate could inhibit the MMPs activity, whereas the chitosan-HA bottom layer with BZK GNPs (240±66nm) would enable the elimination of microbes. The porosity, swelling and degradation nature of the prepared Bi-layered bandage was studied. The bottom layer could degrade within 4days whereas the top layer remained upto 7days. The antimicrobial activity of the BZK NPs loaded bandage was determined using normal and clinical strains. Gelatin zymography shows that the proteolytic activity of MMP was inhibited by the bandage. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Quantitative Microbial Risk Assessment in Occupational Settings Applied to the Airborne Human Adenovirus Infection

    Directory of Open Access Journals (Sweden)

    Annalaura Carducci

    2016-07-01

    Full Text Available Quantitative Microbial Risk Assessment (QMRA methodology, which has already been applied to drinking water and food safety, may also be applied to risk assessment and management at the workplace. The present study developed a preliminary QMRA model to assess microbial risk that is associated with inhaling bioaerosols that are contaminated with human adenovirus (HAdV. This model has been applied to air contamination data from different occupational settings, including wastewater systems, solid waste landfills, and toilets in healthcare settings and offices, with different exposure times. Virological monitoring showed the presence of HAdVs in all the evaluated settings, thus confirming that HAdV is widespread, but with different average concentrations of the virus. The QMRA results, based on these concentrations, showed that toilets had the highest probability of viral infection, followed by wastewater treatment plants and municipal solid waste landfills. Our QMRA approach in occupational settings is novel, and certain caveats should be considered. Nonetheless, we believe it is worthy of further discussions and investigations.

  12. Processes for managing pathogens.

    Science.gov (United States)

    Godfree, Alan; Farrell, Joseph

    2005-01-01

    Wastewater contains human, animal, and plant pathogens capable of causing viral, bacterial, or parasitic infections. There are several routes whereby sewage pathogens may affect human health, including direct contact, contamination of food crops, zoonoses, and vectors. The range and numbers of pathogens in municipal wastewater vary with the level of endemic disease in the community, discharges from commercial activities, and seasonal factors. Regulations to control pathogen risk in the United States and Europe arising from land application of biosolids are based on the concept of multiple barriers to the prevention of transmission. The barriers are (i) treatment to reduce pathogen content and vector attraction, (ii) restrictions on crops grown on land to which biosolids have been applied, and (iii) minimum intervals following application and grazing or harvesting. Wastewater treatment reduces number of pathogens in the wastewater by concentrating them with the solids in the sludge. Although some treatment processes are designed specifically to inactivate pathogens, many are not, and the actual mechanisms of microbial inactivation are not fully understood for all processes. Vector attraction is reduced by stabilization (reduction of readily biodegradable material) and/or incorporation immediately following application. Concerns about health risks have renewed interest in the effects of treatment (on pathogens) and advanced treatment methods, and work performed in the United States suggests that Class A pathogen reduction can be achieved less expensively than previously thought. Effective pathogen risk management requires control to the complete chain of sludge treatment, biosolids handling and application, and post-application activities. This may be achieved by adherence to quality management systems based on hazard analysis critical control point (HACCP) principles.

  13. Use of static Quantitative Microbial Risk Assessment to determine pathogen risks in an unconfined carbonate aquifer used for Managed Aquifer Recharge.

    Science.gov (United States)

    Toze, Simon; Bekele, Elise; Page, Declan; Sidhu, Jatinder; Shackleton, Mark

    2010-02-01

    Managed Aquifer Recharge (MAR) is becoming a mechanism used for recycling treated wastewater and captured urban stormwater and is being used as a treatment barrier to remove contaminants such as pathogens from the recharged water. There is still a need, however, to demonstrate the effectiveness of MAR to reduce any residual risk of pathogens in the recovered water. A MAR research site recharging secondary treated wastewater in an unconfined carbonate aquifer was used in conjunction with a static Quantitative Microbial Risk Assessment (QMRA) to assess the microbial pathogen risk in the recovered water following infiltration and aquifer passage. The research involved undertaking a detailed hydrogeological assessment of the aquifer at the MAR site and determining the decay rates of reference pathogens from an in-situ decay study. These variables along with literature data were then used in the static QMRA which demonstrated that the recovered water at this site did not meet the Australian Guidelines for recycled water when used for differing private green space irrigation scenarios. The results also confirmed the importance of obtaining local hydrogeological data as local heterogeneity can influence of residence time in the aquifer which, in turn, influences the outcomes. The research demonstrated that a static QMRA can be used to determine the residual risk from pathogens in recovered water and showed that it can be a valuable tool in the preliminary design and operation of MAR systems and the incorporation of complementary engineered treatment processes to ensure that there is acceptable health risk from the recovered water. Crown Copyright 2009. Published by Elsevier Ltd. All rights reserved.

  14. Genome-Wide Host-Pathogen Interaction Unveiled by Transcriptomic Response of Diamondback Moth to Fungal Infection.

    Directory of Open Access Journals (Sweden)

    Zhen-Jian Chu

    Full Text Available Genome-wide insight into insect pest response to the infection of Beauveria bassiana (fungal insect pathogen is critical for genetic improvement of fungal insecticides but has been poorly explored. We constructed three pairs of transcriptomes of Plutella xylostella larvae at 24, 36 and 48 hours post treatment of infection (hptI and of control (hptC for insight into the host-pathogen interaction at genomic level. There were 2143, 3200 and 2967 host genes differentially expressed at 24, 36 and 48 hptI/hptC respectively. These infection-responsive genes (~15% of the host genome were enriched in various immune processes, such as complement and coagulation cascades, protein digestion and absorption, and drug metabolism-cytochrome P450. Fungal penetration into cuticle and host defense reaction began at 24 hptI, followed by most intensive host immune response at 36 hptI and attenuated immunity at 48 hptI. Contrastingly, 44% of fungal genes were differentially expressed in the infection course and enriched in several biological processes, such as antioxidant activity, peroxidase activity and proteolysis. There were 1636 fungal genes co-expressed during 24-48 hptI, including 116 encoding putative secretion proteins. Our results provide novel insights into the insect-pathogen interaction and help to probe molecular mechanisms involved in the fungal infection to the global pest.

  15. Evaluation of the significance of cell wall polymers in flax infected with a pathogenic strain of Fusarium oxysporum.

    Science.gov (United States)

    Wojtasik, Wioleta; Kulma, Anna; Dymińska, Lucyna; Hanuza, Jerzy; Czemplik, Magdalena; Szopa, Jan

    2016-03-22

    Fusarium oxysporum infection leads to Fusarium-derived wilt, which is responsible for the greatest losses in flax (Linum usitatissimum) crop yield. Plants infected by Fusarium oxysporum show severe symptoms of dehydration due to the growth of the fungus in vascular tissues. As the disease develops, vascular browning and leaf yellowing can be observed. In the case of more virulent strains, plants die. The pathogen's attack starts with secretion of enzymes degrading the host cell wall. The main aim of the study was to evaluate the role of the cell wall polymers in the flax plant response to the infection in order to better understand the process of resistance and develop new ways to protect plants against infection. For this purpose, the expression of genes involved in cell wall polymer metabolism and corresponding polymer levels were investigated in flax seedlings after incubation with Fusarium oxysporum. This analysis was facilitated by selecting two groups of genes responding differently to the infection. The first group comprised genes strongly affected by the infection and activated later (phenylalanine ammonia lyase and glucosyltransferase). The second group comprised genes which are slightly affected (up to five times) and their expression vary as the infection progresses. Fusarium oxysporum infection did not affect the contents of cell wall polymers, but changed their structure. The results suggest that the role of the cell wall polymers in the plant response to Fusarium oxysporum infection is manifested through changes in expression of their genes and rearrangement of the cell wall polymers. Our studies provided new information about the role of cellulose and hemicelluloses in the infection process, the change of their structure and the expression of genes participating in their metabolism during the pathogen infection. We also confirmed the role of pectin and lignin in this process, indicating the major changes at the mRNA level of lignin metabolism genes

  16. Variations of immune parameters in the lined seahorse Hippocampus erectus after infection with enteritis pathogen of Vibrio parahaemolyticus.

    Science.gov (United States)

    Lin, Tingting; Zhang, Dong; Liu, Xin; Xiao, Dongxue

    2016-03-01

    Enteritis has been increasingly recognized as one of the major obstacles for the lined seahorse Hippocampus erectus mass culture success. In the present study, the intestinal bacteria strains of the lined seahorses H. erectus suffered from enteritis were isolated, then their pathogenicities were confirmed by artificial infection, and one pathogenic bacteria strain named DS3 was obtained. The median lethal dose (LD50) of strain DS3 for 10 days was determined. The seahorses with different infection levels of uninfected (control), early stage of infection (ESI) and late stage of infection (LSI) were respectively sampled at 0, 3, 6 and 9 days post infection, and 12 immune parameters in the plasma were analyzed. The strain DS3 identified with a biochemical test combined with a molecular method was Vibrio parahaemolyticus, and its LD50 for 10 days was 1.3 × 10(3) cfu/fish. Six parameters including monocytes/leucocytes, leucocytes phagocytic rate, interleukin-2, interferon-α, lysozyme and immunoglobulin M exhibited a generally similar variation trend: highest in the control, second in the ESI and lowest in the LSI throughout the entire experiment. In view of the infection level of V. parahaemolyticus to H. erectus is largely decided by the seahorse's own immune capacity, therefore, these immune parameters were high in the non- or slightly infected seahorses, and low in the severely infected individuals may be an indicator for immune level. These immune parameters may be reliable indicators for the juvenile and broodstock quality assessment. Moreover, clarification of the enteritis pathogen also provides guidances for targeted medicine choice for the lined seahorse. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. An Alteration of Lymphocytes Subpopulations and Immunoglobulins Levels in Patients with Diabetic Foot Ulcers Infected Particularly by Resistant Pathogens

    Directory of Open Access Journals (Sweden)

    Vladimíra Fejfarová

    2016-01-01

    Full Text Available The aim of our study was to analyse immune abnormalities in patients with chronic infected diabetic foot ulcers (DFUs especially those infected by resistant microorganisms. Methods. 68 patients treated in our foot clinic for infected chronic DFUs with 34 matched diabetic controls were studied. Patients with infected DFUs were subdivided into two subgroups according to the antibiotic sensitivity of causal pathogen: subgroup S infected by sensitive (n=50 and subgroup R by resistant pathogens (n=18. Selected immunological markers were compared between the study groups and subgroups. Results. Patients with infected chronic DFUs had, in comparison with diabetic controls, significantly reduced percentages (p<0.01 and total numbers of lymphocytes (p<0.001 involving B lymphocytes (p<0.01, CD4+ (p<0.01, and CD8+ T cells (p<0.01 and their naive and memory effector cells. Higher levels of IgG (p<0.05 including IgG1 (p<0.001 and IgG3 (p<0.05 were found in patients with DFUs compared to diabetic controls. Serum levels of immunoglobulin subclasses IgG2 and IgG3 correlated negatively with metabolic control (p<0.05. A trend towards an increased frequency of IgG2 deficiency was found in patients with DFUs compared to diabetic controls (22% versus 15%; NS. Subgroup R revealed lower levels of immunoglobulins, especially of IgG4 (p<0.01 in contrast to patients infected by sensitive bacteria. The innate immunity did not differ significantly between the study groups. Conclusion. Our study showed changes mainly in the adaptive immune system represented by low levels of lymphocyte subpopulations and their memory effector cells, and also changes in humoral immunity in patients with DFUs, even those infected by resistant pathogens, in comparison with diabetic controls.

  18. In vitro studies on medicinal plants used against bacterial diabetic foot ulcer (BDFU) and urinary tract infected (UTI) causing pathogens.

    Science.gov (United States)

    Subbu Lakshmi, S; Chelladurai, G; Suresh, B

    2016-09-01

    The pus samples from diabetic foot ulcer patients and urine samples from urinary tract infected patients were collected and inoculated in nutrient agar plates. The colonies showing different morphologies were streaked on selective agar plates. The antibacterial assay of selected commercial antibiotics was tested against the foot ulcer and urinary tract isolates. The result revealed that most of the organisms were found to be resistant against the antibiotics. Screening of antibacterial activity of selected plants, methanol extracts of plants were prepared and tested against foot ulcer pathogens. Among the plants used, the methanolic extract Tragia involucrata was very effective against the foot ulcer pathogens and to separate the compounds present in the methanolic extract of T. involucrata, when it was subjected to column chromatography. The fractions obtained were further checked for their antibacterial property and fraction 1 which inhibited the pathogens, were subjected to thin layer chromatography and the structure of the particular phytochemical compound was elucidated by NMR study. The spices were tested for their antibacterial property against the urinary tract pathogens. Among the spices tested; Allium sativum inhibited the growth of the pathogens isolated from urinary tract infection. It can be concluded that the plants extract can be used to discover natural products that may serve as lead for the development of new pharmaceuticals addressing the major therapeutic needs.

  19. Pathogens Causing Blood Stream Infections and their Drug Susceptibility Profile in Immunocompromised Patients

    International Nuclear Information System (INIS)

    Fayyaz, M.; Mirza, I.A.; Ikram, A.; Hussain, A.; Ghafoor, T.; Shujat, U.

    2013-01-01

    Objective: To determine the types of pathogens causing blood stream infections and their drug susceptibility profile in immunocompromised patients. Study Design: Cross-sectional, observational study. Place and Duration of Study: Department of Microbiology, Armed Forces Institute of Pathology, Rawalpindi, from January to September 2012. Methodology: Blood culture bottles received from immunocompromised patients were dealt by two methods, brain heart infusion (BHI) broth based manual method and automated BACTEC system. The samples yielding positive growth from either of two methods were further analyzed. The identification of isolates was done with the help of biochemical reactions and rapid tests. Antimicrobial susceptibility of the isolates was carried out as per recommendations of Clinical and Laboratory Standards Institute (CLSI). Results: Out of the 938 blood culture specimens received from immunocompromised patients, 188 (20%) yielded positive growth. Out of these, 89 (47.3%) isolates were Gram positive and Gram negative each, while 10 (5.3%) isolates were fungi (Candida spp.). In case of Gram positive isolates, 75 (84.3%) were Staphylococcus spp. and 51 (67%) were Methicillin resistant. Amongst Gram negative group 49 (55.1%) isolates were of enterobacteriaceae family, while 40 (44.9%) were non-lactose fermenters (NLF). In vitro antimicrobial susceptibility of Staphylococci revealed 100% susceptibility to vancomycin and linezolid. The enterobacteriaceae isolates had better susceptibility against amikacin 85.7% compared to tigecycline 61.2% and imipenem 59.2%. For NLF, the in vitro efficacy of aminoglycosides was 72.5%. Conclusion: The frequency of Gram positive and Gram negative organisms causing blood stream infections in immunocompromised patients was equal. Vancomycin in case of Gram positive and amikacin for Gram negative organisms revealed better in vitro efficacy as compared to other antibiotics. (author)

  20. Invasive Fungal Infections in Patients with Hematological Malignancies: Emergence of Resistant Pathogens and New Antifungal Therapies

    Directory of Open Access Journals (Sweden)

    Maria N. Gamaletsou

    2018-02-01

    Full Text Available Invasive fungal infections caused by drug-resistant organisms are an emerging threat to heavily immunosuppressed patients with hematological malignancies. Modern early antifungal treatment strategies, such as prophylaxis and empirical and preemptive therapy, result in long-term exposure to antifungal agents, which is a major driving force for the development of resistance. The extended use of central venous catheters, the nonlinear pharmacokinetics of certain antifungal agents, neutropenia, other forms of intense immunosuppression, and drug toxicities are other contributing factors. The widespread use of agricultural and industrial fungicides with similar chemical structures and mechanisms of action has resulted in the development of environmental reservoirs for some drug-resistant fungi, especially azole-resistant Aspergillus species, which have been reported from four continents. The majority of resistant strains have the mutation TR34/L98H, a finding suggesting that the source of resistance is the environment. The global emergence of new fungal pathogens with inherent resistance, such as Candida auris, is a new public health threat. The most common mechanism of antifungal drug resistance is the induction of efflux pumps, which decrease intracellular drug concentrations. Overexpression, depletion, and alteration of the drug target are other mechanisms of resistance. Mutations in the ERG11 gene alter the protein structure of C-demethylase, reducing the efficacy of antifungal triazoles. Candida species become echinocandin-resistant by mutations in FKS genes. A shift in the epidemiology of Candida towards resistant non-albicans Candida spp. has emerged among patients with hematological malignancies. There is no definite association between antifungal resistance, as defined by elevated minimum inhibitory concentrations, and clinical outcomes in this population. Detection of genes or mutations conferring resistance with the use of molecular methods

  1. Pathogens causing blood stream infections and their drug susceptibility profile in immunocompromised patients.

    Science.gov (United States)

    Fayyaz, Muhammad; Mirza, Irfan Ali; Ikram, Aamer; Hussain, Aamir; Ghafoor, Tahir; Shujat, Umer

    2013-12-01

    To determine the types of pathogens causing blood stream infections and their drug susceptibility profile in immunocompromised patients. Cross-sectional, observational study. Department of Microbiology, Armed Forces Institute of Pathology, Rawalpindi, from January to September 2012. Blood culture bottles received from immunocompromised patients were dealt by two methods, brain heart infusion (BHI) broth based manual method and automated BACTEC system. The samples yielding positive growth from either of two methods were further analyzed. The identification of isolates was done with the help of biochemical reactions and rapid tests. Antimicrobial susceptibility of the isolates was carried out as per recommendations of Clinical and Laboratory Standards Institute (CLSI). Out of the 938 blood culture specimens received from immunocompromised patients, 188 (20%) yielded positive growth. Out of these, 89 (47.3%) isolates were Gram positive and Gram negative each, while 10 (5.3%) isolates were fungi (Candida spp.). In case of Gram positive isolates, 75 (84.3%) were Staphylococcus spp. and 51 (67%) were Methicillin resistant. Amongst Gram negative group 49 (55.1%) isolates were of enterobacteriaceae family, while 40 (44.9%) were non-lactose fermenters (NLF). In vitro antimicrobial susceptibility of Staphylococci revealed 100% susceptibility to vancomycin and linezolid. The enterobacteriaceae isolates had better susceptibility against amikacin 85.7% compared to tigecycline 61.2% and imipenem 59.2%. For NLF, the in vitro efficacy of aminoglycosides was 72.5%. The frequency of Gram positive and Gram negative organisms causing blood stream infections in immunocompromised patients was equal. Vancomycin in case of Gram positive and amikacin for Gram negative organisms revealed better in vitro efficacy as compared to other antibiotics.

  2. Modelling fungal sink competitiveness with grains for assimilates in wheat infected by a biotrophic pathogen

    Science.gov (United States)

    Bancal, Marie-Odile; Hansart, Amandine; Sache, Ivan; Bancal, Pierre

    2012-01-01

    Background and Aims Experiments have shown that biotrophic fungi divert assimilates for their growth. However, no attempt has been made either to account for this additional sink or to predict to what extent it competes with both grain filling and plant reserve metabolism for carbon. Fungal sink competitiveness with grains was quantified by a mixed experimental–modelling approach based on winter wheat infected by Puccinia triticina. Methods One week after anthesis, plants grown under controlled conditions were inoculated with varying loads. Sporulation was recorded while plants underwent varying degrees of shading, ensuring a range of both fungal sink and host source levels. Inoculation load significantly increased both sporulating area and rate. Shading significantly affected net assimilation, reserve mobilization and sporulating area, but not grain filling or sporulation rates. An existing carbon partitioning (source–sink) model for wheat during the grain filling period was then enhanced, in which two parameters characterize every sink: carriage capacity and substrate affinity. Fungal sink competitiveness with host sources and sinks was modelled by representing spore production as another sink in diseased wheat during grain filling. Key Results Data from the experiment were fitted to the model to provide the fungal sink parameters. Fungal carriage capacity was 0·56 ± 0·01 µg dry matter °Cd−1 per lesion, much less than grain filling capacity, even in highly infected plants; however, fungal sporulation had a competitive priority for assimilates over grain filling. Simulation with virtual crops accounted for the importance of the relative contribution of photosynthesis loss, anticipated reserve depletion and spore production when light level and disease severity vary. The grain filling rate was less reduced than photosynthesis; however, over the long term, yield loss could double because the earlier reserve depletion observed here would shorten the

  3. [Uncommon non-fermenting Gram-negative rods as pathogens of lower respiratory tract infection].

    Science.gov (United States)

    Juhász, Emese; Iván, Miklós; Pongrácz, Júlia; Kristóf, Katalin

    2018-01-01

    Glucose non-fermenting Gram-negative bacteria are ubiquitous environmental organisms. Most of them are identified as opportunistic, nosocomial pathogens in patients. Uncommon species are identified accurately, mainly due to the introduction of matrix-assisted laser desorption-ionization time of flight mass spectrometry (MALDI-TOF MS) in clinical microbiology practice. Most of these uncommon non-fermenting rods are isolated from lower respiratory tract samples. Their significance in lower respiratory tract infections, such as rules of their testing are not clarified yet. The aim of this study was to review the clinical microbiological features of these bacteria, especially their roles in lower respiratory tract infections and antibiotic treatment options. Lower respiratory tract samples of 3589 patients collected in a four-year period (2013-2016) were analyzed retrospectively at Semmelweis University (Budapest, Hungary). Identification of bacteria was performed by MALDI-TOF MS, the antibiotic susceptibility was tested by disk diffusion method. Stenotrophomonas maltophilia was revealed to be the second, whereas Acinetobacter baumannii the third most common non-fermenting rod in lower respiratory tract samples, behind the most common Pseudomonas aeruginosa. The total number of uncommon non-fermenting Gram-negative isolates was 742. Twenty-three percent of isolates were Achromobacter xylosoxidans. Beside Chryseobacterium, Rhizobium, Delftia, Elizabethkingia, Ralstonia and Ochrobactrum species, and few other uncommon species were identified among our isolates. The accurate identification of this species is obligatory, while most of them show intrinsic resistance to aminoglycosides. Resistance to ceftazidime, cefepime, piperacillin-tazobactam and carbapenems was frequently observed also. Ciprofloxacin, levofloxacin and trimethoprim-sulfamethoxazole were found to be the most effective antibiotic agents. Orv Hetil. 2018; 159(1): 23-30.

  4. The Pathogenic Potential of Proteus mirabilis Is Enhanced by Other Uropathogens during Polymicrobial Urinary Tract Infection.

    Science.gov (United States)

    Armbruster, Chelsie E; Smith, Sara N; Johnson, Alexandra O; DeOrnellas, Valerie; Eaton, Kathryn A; Yep, Alejandra; Mody, Lona; Wu, Weisheng; Mobley, Harry L T

    2017-02-01

    Urinary catheter use is prevalent in health care settings, and polymicrobial colonization by urease-positive organisms, such as Proteus mirabilis and Providencia stuartii, commonly occurs with long-term catheterization. We previously demonstrated that coinfection with P. mirabilis and P. stuartii increased overall urease activity in vitro and disease severity in a model of urinary tract infection (UTI). In this study, we expanded these findings to a murine model of catheter-associated UTI (CAUTI), delineated the contribution of enhanced urease activity to coinfection pathogenesis, and screened for enhanced urease activity with other common CAUTI pathogens. In the UTI model, mice coinfected with the two species exhibited higher urine pH values, urolithiasis, bacteremia, and more pronounced tissue damage and inflammation compared to the findings for mice infected with a single species, despite having a similar bacterial burden within the urinary tract. The presence of P. stuartii, regardless of urease production by this organism, was sufficient to enhance P. mirabilis urease activity and increase disease severity, and enhanced urease activity was the predominant factor driving tissue damage and the dissemination of both organisms to the bloodstream during coinfection. These findings were largely recapitulated in the CAUTI model. Other uropathogens also enhanced P. mirabilis urease activity in vitro, including recent clinical isolates of Escherichia coli, Enterococcus faecalis, Klebsiella pneumoniae, and Pseudomonas aeruginosa We therefore conclude that the underlying mechanism of enhanced urease activity may represent a widespread target for limiting the detrimental consequences of polymicrobial catheter colonization, particularly by P. mirabilis and other urease-positive bacteria. Copyright © 2017 American Society for Microbiology.

  5. Disclosing respiratory co-infections: a broad-range panel assay for avian respiratory pathogens on a nanofluidic PCR platform.

    Science.gov (United States)

    Croville, Guillaume; Foret, Charlotte; Heuillard, Pauline; Senet, Alexis; Delpont, Mattias; Mouahid, Mohammed; Ducatez, Mariette F; Kichou, Faouzi; Guerin, Jean-Luc

    2018-06-01

    Respiratory syndromes (RS) are among the most significant pathological conditions in edible birds and are caused by complex coactions of pathogens and environmental factors. In poultry, low pathogenic avian influenza A viruses, metapneumoviruses, infectious bronchitis virus, infectious laryngotracheitis virus, Mycoplasma spp. Escherichia coli and/or Ornithobacterium rhinotracheale in turkeys are considered as key co-infectious agents of RS. Aspergillus sp., Pasteurella multocida, Avibacterium paragallinarum or Chlamydia psittaci may also be involved in respiratory outbreaks. An innovative quantitative PCR method, based on a nanofluidic technology, has the ability to screen up to 96 samples with 96 pathogen-specific PCR primers, at the same time, in one run of real-time quantitative PCR. This platform was used for the screening of avian respiratory pathogens: 15 respiratory agents, including viruses, bacteria and fungi potentially associated with respiratory infections of poultry, were targeted. Primers were designed and validated for SYBR green real-time quantitative PCR and subsequently validated on the Biomark high throughput PCR nanofluidic platform (Fluidigm©, San Francisco, CA, USA). As a clinical assessment, tracheal swabs were sampled from turkeys showing RS and submitted to this panel assay. Beside systematic detection of E. coli, avian metapneumovirus, Mycoplasma gallisepticum and Mycoplasma synoviae were frequently detected, with distinctive co-infection patterns between French and Moroccan flocks. This proof-of-concept study illustrates the potential of such panel assays for unveiling respiratory co-infection profiles in poultry.

  6. Pathobiology of highly pathogenic avian influenza virus (H5N1) infection in mute swans (Cygnus olor).

    Science.gov (United States)

    Pálmai, Nimród; Erdélyi, Károly; Bálint, Adám; Márton, Lázár; Dán, Adám; Deim, Zoltán; Ursu, Krisztina; Löndt, Brandon Z; Brown, Ian H; Glávits, Róbert

    2007-06-01

    The results of pathological, virological and polymerase chain reaction examinations carried out on 35 mute swans (Cygnus olor) that succumbed to a highly pathogenic avian influenza virus (H5N1) infection during an outbreak in Southern Hungary are reported. The most frequently observed macroscopic lesions included: haemorrhages under the epicardium, in the proventricular and duodenal mucosa and pancreas; focal necrosis in the pancreas; myocardial degeneration; acute mucous enteritis; congestion of the spleen and lung, and the accumulation of sero-mucinous exudate in the body cavity. Histopathological lesions comprised: lymphocytic meningo-encephalomyelitis accompanied by gliosis and occasional perivascular haemorrhages; multi-focal myocardial necrosis with lympho-histiocytic infiltration; pancreatitis with focal necrosis; acute desquamative mucous enteritis; lung congestion and oedema; oedema of the tracheal mucosa and, in young birds, the atrophy of the bursa of Fabricius as a result of lymphocyte depletion and apoptosis. The observed lesions and the moderate to good body conditions were compatible with findings in acute highly pathogenic avian influenza infections of other bird species reported in the literature. Skin lesions and lesions typical for infections caused by strains of lower pathogenicity (low pathogenic avian influenza virus) such as emaciation or fibrinous changes in the reproductive and respiratory organs, sinuses and airsacs were not observed. The H5N1 subtype avian influenza virus was isolated in embryonated fowl eggs from all cases and it was identified by classical and molecular virological methods.

  7. Cytokine expression in three chicken host systems infected with H9N2 influenza viruses with different pathogenicities.

    Science.gov (United States)

    Wang, Jianlin; Cao, Zhiwei; Guo, Xuejin; Zhang, Yi; Wang, Dongdong; Xu, Shouzheng; Yin, Yanbo

    2016-12-01

    SD/818 and SD/196 are H9N2 influenza virus strains isolated from chickens from the same farm at different times that exhibited similar genetic evolution. However, strain SD/818 exhibited higher pathogenicity in chickens than strain SD/196 and other H9N2 influenza virus epidemic strains from China. The expression of cytokines is an important host defence mechanism following viral infection and their intensity is a major determinant of viral pathogenicity. To elucidate the mechanism underlying the increased pathogenicity of strain SD/818 from the host's perspective, viral replication and cytokine expression were dynamically studied using real-time quantitative reverse transcription PCR in chickens infected with strain SD/818 compared with chickens infected with strain SD/196 in this study. The results showed that the replication of strain SD/818 and the expressions of IL-1β, IL-6, TNF-α, IFN-α and IFN-β induced by strain SD/818 were higher than those induced by strain SD/196 in the chicken host system. Expression of these cytokines in chickens coincided with or followed virus replication. These results suggested that high-level viral replication and pro-inflammatory cytokine expression (but not decreased type I IFN expression) were associated with the higher pathogenicity of strain SD/818 in chickens.

  8. Infection capacity of the pathogens Penicillium italicum and P. Expansum in orange during storage

    Directory of Open Access Journals (Sweden)

    Veljović Sonja P.

    2017-01-01

    Full Text Available Penicillium italicum and P. expansum are important pathogens causing decay in most fruits and vegetables. In this study, orange fruits were inoculated with these two species of fungus and stored 14 days with or without bagging, in a cold room for 11 days and 3 days at room temperature to determine the effect of bagging and infection capacities of both molds on oranges during storage. The results indicated that P. expansum can grow on orange peel with smaller colony diameter than P. italicum in bagged and unbagged fruits. Total soluble solids (TSS and firmness were not affected by bag. Gas composition of the bags showed low oxygen and high carbon dioxide concentration after fourteen days of storage. Bagged fruits decreased decay caused by P. italicum and weight loss, and delayed changes in firmness, TSS and acidity compared with control fruits. The study suggests that bagging may be a promising option for controlling decay, maintaining fruit quality and extending shelf-life of oranges.

  9. Effect of a lytic bacteriophage on rabbits experimentally infected with pathogenic Escherichia coli

    Directory of Open Access Journals (Sweden)

    J. Zhao

    2017-09-01

    Full Text Available Pathogenic Escherichia coli (E. coli is severely threatening the rabbit industry in China, and the concern over antibiotic-resistant bacteria has given rise to an urgent need for antibiotic alternatives. In this study, a member (ZRP1 of the Myoviridae family was isolated from rabbit faeces using a strain of rabbit atypical enteropathogenic E. coli (ZR1 as host. The one-step growth curve indicated that the latent period was around 25 to 30 min and the burst size was 144±31 plaque-forming unit/cell. The rate of phage-resistant mutation was 7×10–5±4×10–5. When the bacteriophage input at the multiplicity of infection (MOI was 0.1, 1 or 10, the growth of host E. coli in broth was inhibited for 5 h. A single intravenous injection of ZRP1 at MOI 0.1, 1 or 10 significantly prolonged the survival time of rabbits which simultaneously received a lethal dose of ZR1.

  10. Increasing resistance to quinolones: A four-year prospective study of urinary tract infection pathogens

    Directory of Open Access Journals (Sweden)

    Orhiosefe Omigie

    2009-08-01

    Full Text Available Orhiosefe Omigie, Lawrence Okoror, Patience Umolu, Gladys IkuuhDepartment of Microbiology, Ambrose Alli University, Ekpoma, NigeriaAbstract: A four-year prospective study was carried out to determine the incidence and rate of development of resistance by common urinary tract infection (UTI pathogens to quinolone antimicrobial agents. Results show that there is high intrinsic resistance to the quinolones among strains of Pseudomonas aeruginosa (43.4%, Escherichia coli (26.3%, and Proteus spp. (17.1%. Over four years, rising rates of resistance were observed in P. aeruginosa (14.6% increase, Staphylococcus aureus (9.8%, and E. coli (9.7%. The highest potency was exhibited by ciprofloxacin (91.2%, levofloxacin (89.2%, and moxifloxacin (85.1%, while there were high rates of resistance to nalidixic acid (51.7% and pefloxacin (29.0%. Coliforms, particularly E. coli (>45%, remain the most prevalent causative agents of UTI while females within the age range of 20–50 years were most vulnerable to UTI.Keywords: UTI, microorganisms, antibiotics, resistance

  11. Cellulose gum and copper nanoparticles based hydrogel as antimicrobial agents against urinary tract infection (UTI) pathogens.

    Science.gov (United States)

    Al-Enizi, Abdullah M; Ahamad, Tansir; Al-Hajji, Abdullah Baker; Ahmed, Jahangeer; Chaudhary, Anis Ahmad; Alshehri, Saad M

    2018-04-01

    In the present study, stable copper nanoparticles (CuNPs) were successfully prepared in the hydrogel matrix. The prepared nanocomposite (HCuNPs) was characterized via x-ray diffraction (XRD), electron microscopy (TEM), and energy-dispersive (EDX) and x-ray photoelectron spectroscopic (XPS) studies. The wide scan XPS spectra support the presence of C, N and O in neat hydrogel; while, the XPS spectra of HCuNPs demonstrate the presence of Cu along with C, N, and O elements. TEM studies show the formation of spherical shaped CuNPs in the size range from 7 to 12nm. The rheology results reveal that the storage modulus (G') of the HCuNPs was found to be higher than the loss modulus (G"). Additionally, the antibacterial activities and cytotoxic were carried out against urinary tract infection (UTI) microbes and HeLa (cervical) cells respectively. The antibacterial results reveal that HCuNPs composites show higher zone of inhibition against these pathogens then that of corresponding hydrogel matrix. The cytotoxic effects suggest that the prepared nanocomposite could be used as promising candidates for biomedical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Are antimicrobial defences in bird eggs related to climatic conditions associated with risk of trans-shell microbial infection?

    Science.gov (United States)

    Horrocks, Nicholas Pc; Hine, Kathryn; Hegemann, Arne; Ndithia, Henry K; Shobrak, Mohammed; Ostrowski, Stéphane; Williams, Joseph B; Matson, Kevin D; Tieleman, B Irene

    2014-01-01

    All bird eggs are exposed to microbes in the environment, which if transmitted to the developing embryo, could cause hatching failure. However, the risk of trans-shell infection varies with environmental conditions and is higher for eggs laid in wetter environments. This might relate to generally higher microbial abundances and diversity in more humid environments, including on the surface of eggshells, as well as the need for moisture to facilitate microbial penetration of the eggshell. To protect against microbial infection, the albumen of avian eggs contains antimicrobial proteins, including lysozyme and ovotransferrin. We tested whether lysozyme and ovotransferrin activities varied in eggs of larks (Alaudidae) living along an arid-mesic gradient of environmental aridity, which we used as a proxy for risk of trans-shell infection. Contrary to expectations, lysozyme activity was highest in eggs from hotter, more arid locations, where we predicted the risk of trans-shell infection would be lower. Ovotransferrin concentrations did not vary with climatic factors. Temperature was a much better predictor of antimicrobial protein activity than precipitation, a result inconsistent with studies stressing the importance of moisture for trans-shell infection. Our study raises interesting questions about the links between temperature and lysozyme activity in eggs, but we find no support for the hypothesis that antimicrobial protein deposition is higher in eggs laid in wetter environments.

  13. Biomarkers of inflammation, coagulation and microbial translocation in HIV/HCV co-infected patients in the SMART study

    DEFF Research Database (Denmark)

    Peters, Lars; Neuhaus, Jacqueline; Duprez, Daniel

    2014-01-01

    BACKGROUND: Previous results from the SMART study showed that HIV/viral hepatitis co-infected persons with impaired liver function are at increased risk of death following interruption of antiretroviral therapy (ART). OBJECTIVES: To investigate the influence of fibrosis and ART interruption...... on levels of biomarkers of inflammation, coagulation and microbial translocation in HIV/HCV co-infected persons in the SMART study. STUDY DESIGN: All HIV/HCV co-infected persons with stored plasma at study entry and at six months of follow-up were included (N=362). D-dimer, IL-6, sCD14 and hepatic...

  14. The Secretion of IL-22 from Mucosal NKp44+ NK Cells Is Associated with Microbial Translocation and Virus Infection in SIV/SHIV-Infected Chinese Macaques

    Directory of Open Access Journals (Sweden)

    Wei Wang

    2014-01-01

    Full Text Available Microbial translocation (MT causes systemic immune activation in chronic human immunodeficiency virus (HIV infection. The role of a novel subtype of innate lymphoid cells, the NKp44+ NK cells, in HIV/simian immunodeficiency virus- (SIV- induced MT remains unknown. In this study, 12 simian-human immunodeficiency virus- (SHIV- infected macaques were chosen and split into two groups based on the MT level. Blood and Peripheral lymphoid tissue were sampled for flow cytometric analysis, viral load detection, and interleukin testing. Then, six naive Chinese macaques were used to determine the dynamics of cytokine secretion from mucosal NKp44+ NK cells in different phases of SIV infection. As a result, the degranulation capacity and IL-22 production of mucosal NKp44+ NK cells were associated with the MT level in the SHIV-infected macaques. And the number of mucosal NKp44+ NK cells and IL-22 secretion by these cells were lower in the chronic phase than in the early acute phase of SIV infection. The number of mucosal NKp44+ NK cells and interleukin-22 (IL-22 secretion by these cells increased before MT occurred. Therefore, we conclude that a decline in IL-22 production from mucosal NKp44+ NK cells induced by virus infection may be one of the causes of microbial translocation in HIV/SIV infection.

  15. Clinical predictors of the leading pathogens in human immunodeficiency virus-infected adults with community-onset bacteremia in the emergency department: The importance of transmission routes

    Directory of Open Access Journals (Sweden)

    Ching-Chi Lee

    2018-06-01

    Conclusion: Focusing on the two key pathogens in HIV-infected adults with community-onset bacteremia, IDU was one of independent predictors associated with S. aureus infection, whereas MSM was the leading risk factor of S. enterica infection. Although the proposed predictive model of these pathogens has been not established, a scoring system involving the transmission risk of HIV may be of use for the early identification of these patients for clinicians.

  16. Contribution of intestinal barrier damage, microbial translocation and HIV-1 infection status to an inflammaging signature.

    Directory of Open Access Journals (Sweden)

    Amanda K Steele

    Full Text Available Systemic inflammation is a characteristic of both HIV-1 infection and aging ("inflammaging". Intestinal epithelial barrier damage (IEBD and microbial translocation (MT contribute to HIV-associated inflammation, but their impact on inflammaging remains unclear.Plasma biomarkers for IEBD (iFABP, MT (LPS, sCD14, T-cell activation (sCD27, and inflammation (hsCRP, IL-6 were measured in 88 HIV-1 uninfected (HIV(neg and 83 treated, HIV-1-infected (HIV(pos adults from 20-100 years old.Age positively correlated with iFABP (r = 0.284, p = 0.008, sCD14 (r = 0.646, p = <0.0001 and LPS (r = 0.421, p = 0.0002 levels in HIV(neg but not HIV(pos subjects. Age also correlated with sCD27, hsCRP, and IL-6 levels regardless of HIV status. Middle-aged HIV(pos subjects had elevated plasma biomarker levels similar to or greater than those of elderly HIV(neg subjects with the exception of sCD14. Clustering analysis described an inflammaging phenotype (IP based on iFABP, sCD14, sCD27, and hsCRP levels in HIV(neg subjects over 60 years of age. The IP in HIV(neg subjects was used to develop a classification model that was applied to HIV(pos subjects to determine whether HIV(pos subjects under 60 years of age were IP+. HIV(pos IP+ subjects were similar in age to IP- subjects but had a greater risk of cardiovascular disease (CVD based on Framingham risk score (p =  0.01.We describe a novel IP that incorporates biomarkers of IEBD, MT, immune activation as well as inflammation. Application of this novel IP in HIV-infected subjects identified a group at higher risk of CVD.

  17. Global Microbial Identifier

    DEFF Research Database (Denmark)

    Wielinga, Peter; Hendriksen, Rene S.; Aarestrup, Frank Møller

    2017-01-01

    ) will likely also enable a much better understanding of the pathogenesis of the infection and the molecular basis of the host response to infection. But the full potential of these advances will only transpire if the data in this area become transferable and thereby comparable, preferably in open-source...... of microorganisms, for the identification of relevant genes and for the comparison of genomes to detect outbreaks and emerging pathogens. To harness the full potential of WGS, a shared global database of genomes linked to relevant metadata and the necessary software tools needs to be generated, hence the global...... microbial identifier (GMI) initiative. This tool will ideally be used in amongst others in the diagnosis of infectious diseases in humans and animals, in the identification of microorganisms in food and environment, and to track and trace microbial agents in all arenas globally. This will require...

  18. Highly (H5N1 and low (H7N2 pathogenic avian influenza virus infection in falcons via nasochoanal route and ingestion of experimentally infected prey.

    Directory of Open Access Journals (Sweden)

    Kateri Bertran

    Full Text Available An experimental infection with highly pathogenic avian influenza (HPAI and low pathogenic avian influenza (LPAI viruses was carried out on falcons in order to examine the effects of these viruses in terms of pathogenesis, viral distribution in tissues and viral shedding. The distribution pattern of influenza virus receptors was also assessed. Captive-reared gyr-saker (Falco rusticolus x Falco cherrug hybrid falcons were challenged with a HPAI H5N1 virus (A/Great crested grebe/Basque Country/06.03249/2006 or a LPAI H7N2 virus (A/Anas plathyrhynchos/Spain/1877/2009, both via the nasochoanal route and by ingestion of previously infected specific pathogen free chicks. Infected falcons exhibited similar infection dynamics despite the different routes of exposure, demonstrating the effectiveness of in vivo feeding route. H5N1 infected falcons died, or were euthanized, between 5-7 days post-infection (dpi after showing acute severe neurological signs. Presence of viral antigen in several tissues was confirmed by immunohistochemistry and real time RT-PCR (RRT-PCR, which were generally associated with significant microscopical lesions, mostly in the brain. Neither clinical signs, nor histopathological findings were observed in any of the H7N2 LPAI infected falcons, although all of them had seroconverted by 11 dpi. Avian receptors were strongly present in the upper respiratory tract of the falcons, in accordance with the consistent oral viral shedding detected by RRT-PCR in both H5N1 HPAI and H7N2 LPAI infected falcons. The present study demonstrates that gyr-saker hybrid falcons are highly susceptible to H5N1 HPAI virus infection, as previously observed, and that they may play a major role in the spreading of both HPAI and LPAI viruses. For the first time in raptors, natural infection by feeding on infected prey was successfully reproduced. The use of avian prey species in falconry husbandry and wildlife rehabilitation facilities could put valuable birds

  19. Highly (H5N1) and low (H7N2) pathogenic avian influenza virus infection in falcons via nasochoanal route and ingestion of experimentally infected prey.

    Science.gov (United States)

    Bertran, Kateri; Busquets, Núria; Abad, Francesc Xavier; García de la Fuente, Jorge; Solanes, David; Cordón, Iván; Costa, Taiana; Dolz, Roser; Majó, Natàlia

    2012-01-01

    An experimental infection with highly pathogenic avian influenza (HPAI) and low pathogenic avian influenza (LPAI) viruses was carried out on falcons in order to examine the effects of these viruses in terms of pathogenesis, viral distribution in tissues and viral shedding. The distribution pattern of influenza virus receptors was also assessed. Captive-reared gyr-saker (Falco rusticolus x Falco cherrug) hybrid falcons were challenged with a HPAI H5N1 virus (A/Great crested grebe/Basque Country/06.03249/2006) or a LPAI H7N2 virus (A/Anas plathyrhynchos/Spain/1877/2009), both via the nasochoanal route and by ingestion of previously infected specific pathogen free chicks. Infected falcons exhibited similar infection dynamics despite the different routes of exposure, demonstrating the effectiveness of in vivo feeding route. H5N1 infected falcons died, or were euthanized, between 5-7 days post-infection (dpi) after showing acute severe neurological signs. Presence of viral antigen in several tissues was confirmed by immunohistochemistry and real time RT-PCR (RRT-PCR), which were generally associated with significant microscopical lesions, mostly in the brain. Neither clinical signs, nor histopathological findings were observed in any of the H7N2 LPAI infected falcons, although all of them had seroconverted by 11 dpi. Avian receptors were strongly present in the upper respiratory tract of the falcons, in accordance with the consistent oral viral shedding detected by RRT-PCR in both H5N1 HPAI and H7N2 LPAI infected falcons. The present study demonstrates that gyr-saker hybrid falcons are highly susceptible to H5N1 HPAI virus infection, as previously observed, and that they may play a major role in the spreading of both HPAI and LPAI viruses. For the first time in raptors, natural infection by feeding on infected prey was successfully reproduced. The use of avian prey species in falconry husbandry and wildlife rehabilitation facilities could put valuable birds of prey and

  20. Transmission dynamics of Bacillus thuringiensis infecting Plodia interpunctella: a test of the mass action assumption with an insect pathogen.

    Science.gov (United States)

    Knell, R J; Begon, M; Thompson, D J

    1996-01-22

    Central to theoretical studies of host-pathogen population dynamics is a term describing transmission of the pathogen. This usually assumes that transmission is proportional to the density of infectious hosts or particles and of susceptible individuals. We tested this assumption with the bacterial pathogen Bacillus thuringiensis infecting larvae of Plodia interpunctella, the Indian meal moth. Transmission was found to increase in a more than linear way with host density in fourth and fifth instar P. interpunctella, and to decrease with the density of infectious cadavers in the case of fifth instar larvae. Food availability was shown to play an important part in this process. Therefore, on a number of counts, the usual assumption was found not to apply in our experimental system.

  1. Evidence for the importance of hydrogen peroxide in wheat infected by the hemibiotrophic pathogen Septoria triciti

    DEFF Research Database (Denmark)

    Shetty, Nandini Prasad; Jensen, Jens Due; Mehrabi, Rahim

    infection is the oxidative burst, which leads to the production of reactive oxygen species (ROS). ROS have been found to inhibit biotrophic pathogens whereas necrotrophic pathogens are generally believed to benefit or even stimulate ROS production. We studied the role of hydrogen peroxide (H2O2) in defence...... in the susceptible cv. Sevin. In Sevin, very little H2O2 accumulated, except during sporulation, where tissue degradation occurred. This accumulation probably represents a stress response coinciding with tissue collapse. This pattern of H2O2 accumulation supports the dogma that pathogens with a necrotrophic phase...... plant material infiltrated with catalase or H2O2 and by the use of catalase knock-out mutants of S. tritici. Likewise, we are studying the sources and regulation of both the early and the late . Likewise, we are studying the sources and regulation of both the early and the late accumulation of H2O2...

  2. A genome-wide survey for host response of silkworm, Bombyx mori during pathogen Bacillus bombyseptieus infection.

    Directory of Open Access Journals (Sweden)

    Lulin Huang

    Full Text Available Host-pathogen interactions are complex relationships, and a central challenge is to reveal the interactions between pathogens and their hosts. Bacillus bombysepticus (Bb which can produces spores and parasporal crystals was firstly separated from the corpses of the infected silkworms (Bombyx mori. Bb naturally infects the silkworm can cause an acute fuliginosa septicaemia and kill the silkworm larvae generally within one day in the hot and humid season. Bb pathogen of the silkworm can be used for investigating the host responses after the infection. Gene expression profiling during four time-points of silkworm whole larvae after Bb infection was performed to gain insight into the mechanism of Bb-associated host whole body effect. Genome-wide survey of the host genes demonstrated many genes and pathways modulated after the infection. GO analysis of the induced genes indicated that their functions could be divided into 14 categories. KEGG pathway analysis identified that six types of basal metabolic pathway were regulated, including genetic information processing and transcription, carbohydrate metabolism, amino acid and nitrogen metabolism, nucleotide metabolism, metabolism of cofactors and vitamins, and xenobiotic biodegradation and metabolism. Similar to Bacillus thuringiensis (Bt, Bb can also induce a silkworm poisoning-related response. In this process, genes encoding midgut peritrophic membrane proteins, aminopeptidase N receptors and sodium/calcium exchange protein showed modulation. For the first time, we found that Bb induced a lot of genes involved in juvenile hormone synthesis and metabolism pathway upregulated. Bb also triggered the host immune responses, including cellular immune response and serine protease cascade melanization response. Real time PCR analysis showed that Bb can induce the silkworm systemic immune response, mainly by the Toll pathway. Anti-microorganism peptides (AMPs, including of Attacin, Lebocin, Enbocin, Gloverin

  3. Accumulation of gentisic acid as associated with systemic infections but not with the hypersensitive response in plant-pathogen interactions.

    Science.gov (United States)

    Bellés, José M; Garro, Rafael; Pallás, Vicente; Fayos, Joaquín; Rodrigo, Ismael; Conejero, Vicente

    2006-02-01

    In the present work we have studied the accumulation of gentisic acid (2,5-dihydroxybenzoic acid, a metabolic derivative of salicylic acid, SA) in the plant-pathogen systems, Cucumis sativus and Gynura aurantiaca, infected with either prunus necrotic ringspot virus (PNRSV) or the exocortis viroid (CEVd), respectively. Both pathogens produced systemic infections and accumulated large amounts of the intermediary signal molecule gentisic acid as ascertained by electrospray ionization mass spectrometry (ESI-MS) coupled on line with high performance liquid chromatography (HPLC). The compound was found mostly in a conjugated (beta-glucoside) form. Gentisic acid has also been found to accumulate (although at lower levels) in cucumber inoculated with low doses of Pseudomonas syringae pv. tomato, producing a nonnecrotic reaction. In contrast, when cucumber was inoculated with high doses of this pathogen, a hypersensitive reaction occurred, but no gentisic-acid signal was induced. This is consistent with our results supporting the idea that gentisic-acid signaling may be restricted to nonnecrotizing reactions of the host plant (Bellés et al. in Mol Plant-Microbe Interact 12:227-235, 1999). In cucumber and Gynura plants, the activity of gentisic acid as inducing signal was different to that of SA, thus confirming the data found for tomato. Exogenously supplied gentisic acid was able to induce peroxidase activity in both Gynura and cucumber plants in a similar way as SA or pathogens. However, gentisic-acid treatments strongly induced polyphenol oxidase activity in cucumber, whereas pathogen infection or SA treatment resulted in a lower induction of this enzyme. Nevertheless, gentisic acid did not induce other defensive proteins which are induced by SA in these plants. This indicates that gentisic acid could act as an additional signal to SA for the activation of plant defenses in cucumber and Gynura plants.

  4. Novel experimental Pseudomonas aeruginosa lung infection model mimicking long-term host-pathogen interactions in cystic fibrosis

    DEFF Research Database (Denmark)

    Moser, Claus; van Gennip, Maria; Bjarnsholt, Thomas

    2009-01-01

    Moser C, van Gennip M, Bjarnsholt T, Jensen PO, Lee B, Hougen HP, Calum H, Ciofu O, Givskov M, Molin S, Hoiby N. Novel experimental Pseudomonas aeruginosa lung infection model mimicking long-term host-pathogen interactions in cystic fibrosis. APMIS 2009; 117: 95-107. The dominant cause of premature...... death in patients suffering from cystic fibrosis (CF) is chronic lung infection with Pseudomonas aeruginosa. The chronic lung infection often lasts for decades with just one clone. However, as a result of inflammation, antibiotic treatment and different niches in the lungs, the clone undergoes...... and 2003) of the chronic lung infection of one CF patient using the seaweed alginate embedment model. The results showed that the non-mucoid clones reduced their virulence over time, resulting in faster clearing of the bacteria from the lungs, improved pathology and reduced pulmonary production...

  5. Idiopathic urethritis in young men in the United States: prevalence and comparison to infections with known sexually transmitted pathogens.

    Science.gov (United States)

    Wetmore, Catherine M; Manhart, Lisa E; Golden, Matthew R

    2009-11-01

    Urethritis is the most common male reproductive tract disease syndrome; yet 20-50% of diagnosed cases have no defined etiology, and few population-level data exist on the prevalence or etiology of the syndrome. We estimated the prevalence of urethritis among young men in the United States and compared correlates of idiopathic cases to correlates of detected infections with sexually transmitted pathogens. Questionnaire data and urine specimens from 5,447 men aged 18-27 years participating in Wave III of the National Longitudinal Study of Adolescent Health were analyzed. Symptomatic urethritis was defined as self-reported dysuria or urethral discharge in the past 24hours. Neisseria gonorrhoeae, Chlamydia trachomatis, Trichomonas vaginalis, and Mycoplasma genitalium were identified using nucleic acid amplification tests. Idiopathic urethritis (IU) was defined as urethral symptoms in the absence of these four pathogens. Stratified weighted analyses generated population-based estimates. Urethritis was reported by 1.2% (95% CI=.8-1.6%) of men, of whom 82.4% (61.1-93.3%) had IU. Men with previous STD diagnoses (aOR=9.3 [95% CI=3.0-28.7]), or fewer (1-4) or no lifetime vaginal sex partners (aOR=7.5 [2.9-19.3] and aOR=7.2 [1.9-27.4]), were more likely to have IU compared with men without urethral symptoms or identified pathogens, whereas men of Native American or Asian/Pacific Islander descent (aOR=.04 [.01-.2]) and heavy drinkers (aOR=.08 [.03-.2]) were less likely to have IU. Unlike infection with known pathogens, IU was not associated with black race, Hispanic ethnicity, or age at sexual debut. Urethral symptoms were rarely associated with known pathogens. IU and known pathogens were associated with distinct characteristics.

  6. InvA protein is a Nudix hydrolase required for infection by pathogenic Leptospira in cell lines and animals.

    Science.gov (United States)

    Luo, Yihui; Liu, Yan; Sun, Dexter; Ojcius, David M; Zhao, Jinfang; Lin, Xuai; Wu, Dong; Zhang, Rongguang; Chen, Ming; Li, Lanjuan; Yan, Jie

    2011-10-21

    Leptospirosis caused by pathogenic species of the genus Leptospira is a re-emerging zoonotic disease, which affects a wide variety of host species and is transmitted by contaminated water. The genomes of several pathogenic Leptospira species contain a gene named invA, which contains a Nudix domain. However, the function of this gene has never been characterized. Here, we demonstrated that the invA gene was highly conserved in protein sequence and present in all tested pathogenic Leptospira species. The recombinant InvA protein of pathogenic L. interrogans strain Lai hydrolyzed several specific dinucleoside oligophosphate substrates, reflecting the enzymatic activity of Nudix in Leptospira species. Pathogenic leptospires did not express this protein in media but temporarily expressed it at early stages (within 60 min) of infection of macrophages and nephric epithelial cells. Comparing with the wild type, the invA-deficient mutant displayed much lower infectivity and a significantly reduced survival rate in macrophages and nephric epithelial cells. Moreover, the invA-deficient leptospires presented an attenuated virulence in hamsters, caused mild histopathological damage, and were transmitted in lower numbers in the urine, compared with the wild-type strain. The invA revertant, made by complementing the invA-deficient mutant with the invA gene, reacquired virulence similar to the wild type in vitro and in vivo. The LD(50) in hamsters was 1000-fold higher for the invA-deficient mutant than for the invA revertant and wild type. These results demonstrate that the InvA protein is a Nudix hydrolase, and the invA gene is essential for virulence in pathogenic Leptospira species.

  7. Utilization and control of ecological interactions in polymicrobial infections and community-based microbial cell factories

    DEFF Research Database (Denmark)

    Wigneswaran, Vinoth; Amador Hierro, Cristina Isabel; Jelsbak, Lotte

    2016-01-01

    Microbial activities are most often shaped by interactions between co-existing microbes within mixed-species communities. Dissection of the molecular mechanisms of species interactions within communities is a central issue in microbial ecology, and our ability to engineer and control microbial co...

  8. Blood stream infection by an emerging pathogen Oligella ureolytica in a cancer patient: Case report and review of literature

    Directory of Open Access Journals (Sweden)

    Frincy K Baruah

    2014-01-01

    Full Text Available Oligella ureolytica is an emerging bacteria rarely implicated as a human pathogen. It is infrequently recovered from clinical specimens probably because of inadequate processing of non-fermenting oxidase positive Gram negative bacilli. We present here a case of a 30 year old male suffering from right lung adenocarcinoma (moderately differentiated with multiple abdominal lymph node metastasis with Syringohydromyelia whose blood culture yielded Oligella ureolytica in pure culture. Oligella ureolytica isolation in pure culture and the patient′s response to targeted treatment supported that Oligella ureolytica was the true causative agent of the blood stream infection. Early suspicion, diagnosis and treatment with potent antibiotics are needed to prevent further complications resulting from infection with this emerging pathogen.

  9. Resting spore formation of aphid-pathogenic fungus Pandora nouryi depends on the concentration of infective inoculum.

    Science.gov (United States)

    Huang, Zhi-Hong; Feng, Ming-Guang

    2008-07-01

    Resting spore formation of some aphid-pathogenic Entomophthorales is important for the seasonal pattern of their prevalence and survival but this process is poorly understood. To explore the possible mechanism involved in the process, Pandora nouryi (obligate aphid pathogen) interacted with green peach aphid Myzus persicae on cabbage leaves under favourable conditions. Host nymphs showered with primary conidia of an isolate (LC(50): 0.9-6.7 conidia mm(-2) 4-7 days post shower) from air captures in the low-latitude plateau of China produced resting spores (azygospores), primary conidia or both spore types. Surprisingly, the proportion of mycosed cadavers forming resting spores (P(CFRS)) increased sharply within the concentrations (C) of 28-240 conidia mm(-2), retained high levels at 240-1760, but was zero or extremely low at 0.3-16. The P(CFRS)-C relationship fit well the logistic equation P(CFRS) = 0.6774/[1 + exp(3.1229-0.0270C)] (r(2) = 0.975). This clarified for the first time the dependence of in vivo resting spore formation of P. nouryi upon the concentration of infective inoculum. A hypothesis is thus proposed that some sort of biochemical signals may exist in the host-pathogen interaction so that the fungal pathogen perceives the signals for prompt response to forthcoming host-density changes by either producing conidia for infecting available hosts or forming resting spores for surviving host absence in situ.

  10. Analysis of pathogenic factors of Proteus mirabilis isolated from urinary tract infection

    OpenAIRE

    室谷,勝久

    1991-01-01

    Proteus mirabilis has several pathogenic factors such as adherent ability to urinary tract epitherial cells, urease, motility and resistance to urine. The pathogenic activities of clinically isolated P. mirabilis were analyzed. Higher pathogenic strains (No. 25 and No. 30) which had morphologically different pili but had a higher density of pili showed strong adherent activity to bladder epithelial cells of mouse and rat. These strains also showed a clear chemotaxis to urinary tract tissue ex...

  11. [Experimental study of the effects of impulse-electric discharge on chemotaxis and cytoadhesion of urinary infection pathogens].

    Science.gov (United States)

    Kuderinov, S K; Azizov, I S; Turgunov, E M; Shambilova, N A

    2006-01-01

    The aim of the experimental study was to evaluate effects of impulse-electric discharge in liquid on chemotaxis and cytoadhesion of urinary infection pathogens. Chemotaxis was determined in respect to the lung, liver, spleen, kidney, ureter, urinary bladder, urethra of white mice by S. Likholetov's modified method. Cytoadhesion was assessed by V. Brilis. The experiments show that the impulse-electric discharge holds promise for urological practice.

  12. High-throughput sequencing reveals microbial communities in drinking water treatment sludge from six geographically distributed plants, including potentially toxic cyanobacteria and pathogens.

    Science.gov (United States)

    Xu, Hangzhou; Pei, Haiyan; Jin, Yan; Ma, Chunxia; Wang, Yuting; Sun, Jiongming; Li, Hongmin

    2018-04-10

    The microbial community structures of drinking water treatment sludge (DWTS) generated for raw water (RW) from different locations and with different source types - including river water, lake water and reservoir water -were investigated using high-throughput sequencing. Because the unit operations in the six DWTPs were similar, community composition in fresh sludge may be determined by microbial community in the corresponding RW. Although Proteobacteria, Cyanobacteria, Bacteroidetes, Firmicutes, Verrucomicrobia, and Planctomycetes were the dominant phyla among the six DWTS samples, no single phylum exhibited similar abundance across all the samples, owing to differences in total phosphorus, chemical oxygen demand, Al, Fe, and chloride in RW. Three genera of potentially toxic cyanobacteria (Planktothrix, Microcystis and Cylindrospermopsis), and four potential pathogens (Escherichia coli, Bacteroides ovatus, Prevotella copri and Rickettsia) were found in sludge samples. Because proliferation of potentially toxic cyanobacteria and Rickettsia in RW was mainly affected by nutrients, while growth of Escherichia coli, Bacteroides ovatus and Prevotella copri in RW may be influenced by Fe, control of nutrients and Fe in RW is essential to decrease toxic cyanobacteria and pathogens in DWTS. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Sugarcane Elongin C is involved in infection by sugarcane mosaic disease pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Zhai, Yushan; Deng, Yuqing; Cheng, Guangyuan; Peng, Lei; Zheng, Yanru; Yang, Yongqing, E-mail: yyq287346@163.com; Xu, Jingsheng, E-mail: xujingsheng@126.com

    2015-10-23

    Sugarcane (Saccharum sp. hybrid) provides the main source of sugar for humans. Sugarcane mosaic disease (SMD) is a major threat to sugarcane production. Currently, control of SMD is mainly dependent on breeding resistant cultivars through hybridization, which is time-consuming. Understanding the mechanism of viral infection may facilitate novel strategies to breed cultivars resistant to SMD and to control the disease. In this study, a wide interaction was detected between the viral VPg protein and host proteins. Several genes were screened from sugarcane cDNA library that could interact with Sugarcane streak mosaic virus VPg, including SceIF4E1 and ScELC. ScELC was predicted to be a cytoplasmic protein, but subcellular localization analysis showed it was distributed both in cytoplasmic and nuclear, and interactions were also detected between ScELC and VPg of SCMV or SrMV that reveal ScELC was widely used in the SMD pathogen infection process. ScELC and VPgs interacted in the nucleus, and may function to enhance the viral transcription rate. ScELC also interacted with SceIF4E2 both in the cytoplasm and nucleus, but not with SceIF4E1 and SceIF4E3. These results suggest that ScELC may be essential for the function of SceIF4E2, an isomer of eIF4E. - Highlights: • We cloned ScELC, SceIF4E1, SceIF4E2 and SceIF4E3 from sugarcane accession Badila. • We examined interactions among VPg, ScELC, SceIF4E1, SceIF4E2 and SceIF4E3. • We proofed that ScELC interacted with VPgs of SCMV, SrMV and SCSMV. • We proofed that ScELC interacted with SceIF4E2 but not SceIF4E1 or SceIF4E3.

  14. Sugarcane Elongin C is involved in infection by sugarcane mosaic disease pathogens

    International Nuclear Information System (INIS)

    Zhai, Yushan; Deng, Yuqing; Cheng, Guangyuan; Peng, Lei; Zheng, Yanru; Yang, Yongqing; Xu, Jingsheng

    2015-01-01

    Sugarcane (Saccharum sp. hybrid) provides the main source of sugar for humans. Sugarcane mosaic disease (SMD) is a major threat to sugarcane production. Currently, control of SMD is mainly dependent on breeding resistant cultivars through hybridization, which is time-consuming. Understanding the mechanism of viral infection may facilitate novel strategies to breed cultivars resistant to SMD and to control the disease. In this study, a wide interaction was detected between the viral VPg protein and host proteins. Several genes were screened from sugarcane cDNA library that could interact with Sugarcane streak mosaic virus VPg, including SceIF4E1 and ScELC. ScELC was predicted to be a cytoplasmic protein, but subcellular localization analysis showed it was distributed both in cytoplasmic and nuclear, and interactions were also detected between ScELC and VPg of SCMV or SrMV that reveal ScELC was widely used in the SMD pathogen infection process. ScELC and VPgs interacted in the nucleus, and may function to enhance the viral transcription rate. ScELC also interacted with SceIF4E2 both in the cytoplasm and nucleus, but not with SceIF4E1 and SceIF4E3. These results suggest that ScELC may be essential for the function of SceIF4E2, an isomer of eIF4E. - Highlights: • We cloned ScELC, SceIF4E1, SceIF4E2 and SceIF4E3 from sugarcane accession Badila. • We examined interactions among VPg, ScELC, SceIF4E1, SceIF4E2 and SceIF4E3. • We proofed that ScELC interacted with VPgs of SCMV, SrMV and SCSMV. • We proofed that ScELC interacted with SceIF4E2 but not SceIF4E1 or SceIF4E3.

  15. Proline utilization system is required for infection by the pathogenic α-proteobacterium Brucella abortus.

    Science.gov (United States)

    Caudill, Mitchell T; Budnick, James A; Sheehan, Lauren M; Lehman, Christian R; Purwantini, Endang; Mukhopadhyay, Biswarup; Caswell, Clayton C

    2017-07-01

    Proline utilization (Put) systems have been described in a number of bacteria; however, the importance and functionality of the Put system in the intracellular pathogen Brucellaabortus has not been explored. Generally, bacterial Put systems are composed of the bifunctional enzyme proline dehydrogenase PutA and its transcriptional activator PutR. Here, we demonstrate that the genes putA (bab2_0518) and putR (bab2_0517) are critical for the chronic infection of mice by B. abortus, but putA and putR are not required for the survival and replication of the bacteria in naive macrophages. Additionally, in vitro experiments revealed that putR is necessary for the ability of the bacteria to withstand oxidative stress, as a ΔputR deletion strain is hypersensitive to hydrogen peroxide exposure. Quantitative reverse transcription-PCR and putA-lacZ transcriptional reporter studies revealed that PutR acts as a transcriptional activator of putA in Brucella, and electrophoretic mobility shift assays confirmed that PutR binds directly to the putA promoter region. Biochemical analyses demonstrated that a purified recombinant B. abortus PutA protein possesses quintessential proline dehydrogenase activity, as PutA is capable of catalysing the conversion of proline to glutamate. Altogether, these data are the first to reveal that the Put system plays a significant role in the ability of B. abortus to replicate and survive within its host, as well as to describe the genetic regulation and biochemical activity of the Put system in Brucella.

  16. Third wave of African swine fever infection in Armenia: Virus demonstrates the reduction of pathogenicity

    Science.gov (United States)

    Sargsyan, M. A.; Voskanyan, H. E.; Karalova, E. M.; Hakobyan, L. H.; Karalyan, Z. A.

    2018-01-01

    Aim: First cases of clinically uncommon African swine fever (ASF), caused by virus genotype II are described in this article. These cases occurred in Armenia, Tavush region, Dilijan municipality in 2011. The aim of this study was to identify and describe the new pathogenic forms of ASF in Armenia. Materials and Methods: The isolation and identification of ASF virus (ASFV) were carried out using conventional techniques. Clinical signs of infection were recorded daily. Gross anatomical pathology characteristics were observed during routine postmortem examinations. Blood and serum were obtained by puncture of the jugular vein using a vacutainer system. Results: The presence of ASFV DNA in the spleens was confirmed by polymerase chain reaction. Sequenced sections of p72 showed phylogenetic identity to genotype 2. The pathology exhibits unusual manifestations of the main disease. The unusual form of ASF demonstrates characteristics of a subacute form of the disease, with the possibility of conversion to a chronic form. Decreased lethality, low level of hemorrhages, and absence of severe pancytopenia in smears from spleen, lymph nodes, and blood are common features of the new form of ASF. Unlike severe thrombocytopenia in the typical ASF, the unusual form exhibited moderate or minor decrease of this feature. Despite a moderate decrease in hemadsorption titers, the unusual pattern of the disease was characterized by viremia and the presence of the virus in the visceral organs, including the brain. Conclusion: Our data allow assuming that new nosological form of ASF (genotype II) may present as a transitional form of the disease with the possibility of chronization. PMID:29479149

  17. Third wave of African swine fever infection in Armenia: Virus demonstrates the reduction of pathogenicity

    Directory of Open Access Journals (Sweden)

    M. A. Sargsyan

    2018-01-01

    Full Text Available Aim: First cases of clinically uncommon African swine fever (ASF, caused by virus genotype II are described in this article. These cases occurred in Armenia, Tavush region, Dilijan municipality in 2011. The aim of this study was to identify and describe the new pathogenic forms of ASF in Armenia. Materials and Methods: The isolation and identification of ASF virus (ASFV were carried out using conventional techniques. Clinical signs of infection were recorded daily. Gross anatomical pathology characteristics were observed during routine postmortem examinations. Blood and serum were obtained by puncture of the jugular vein using a vacutainer system. Results: The presence of ASFV DNA in the spleens was confirmed by polymerase chain reaction. Sequenced sections of p72 showed phylogenetic identity to genotype 2. The pathology exhibits unusual manifestations of the main disease. The unusual form of ASF demonstrates characteristics of a subacute form of the disease, with the possibility of conversion to a chronic form. Decreased lethality, low level of hemorrhages, and absence of severe pancytopenia in smears from spleen, lymph nodes, and blood are common features of the new form of ASF. Unlike severe thrombocytopenia in the typical ASF, the unusual form exhibited moderate or minor decrease of this feature. Despite a moderate decrease in hemadsorption titers, the unusual pattern of the disease was characterized by viremia and the presence of the virus in the visceral organs, including the brain. Conclusion: Our data allow assuming that new nosological form of ASF (genotype II may present as a transitional form of the disease with the possibility of chronization.

  18. Lipoteichoic Acid (LTA) and Lipopolysaccharides (LPS) from Periodontal Pathogenic Bacteria Facilitate Oncogenic Herpesvirus Infection within Primary Oral Cells

    Science.gov (United States)

    Dai, Lu; DeFee, Michael R.; Cao, Yueyu; Wen, Jiling; Wen, Xiaofei; Noverr, Mairi C.; Qin, Zhiqiang

    2014-01-01

    Kaposi’s sarcoma (KS) remains the most common tumor arising in patients with HIV/AIDS, and involvement of the oral cavity represents one of the most common clinical manifestations of this tumor. HIV infection incurs an increased risk for periodontal diseases and oral carriage of a variety of bacteria. Whether interactions involving pathogenic bacteria and oncogenic viruses in the local environment facilitate replication or maintenance of these viruses in the oral cavity remains unknown. In the current study, our data indicate that pretreatment of primary human oral fibroblasts with two prototypical pathogen-associated molecular patterns (PAMPs) produced by oral pathogenic bacteria–lipoteichoic acid (LTA) and lipopolysaccharide (LPS), increase KSHV entry and subsequent viral latent gene expression during de novo infection. Further experiments demonstrate that the underlying mechanisms induced by LTA and/or LPS include upregulation of cellular receptor, increasing production of reactive oxygen species (ROS), and activating intracellular signaling pathways such as MAPK and NF-κB, and all of which are closely associated with KSHV entry or gene expression within oral cells. Based on these findings, we hope to provide the framework of developing novel targeted approaches for treatment and prevention of oral KSHV infection and KS development in high-risk HIV-positive patients. PMID:24971655

  19. A Multi-Omic View of Host-Pathogen-Commensal Interplay in Salmonella-Mediated Intestinal Infection

    Energy Technology Data Exchange (ETDEWEB)

    Kaiser, Brooke LD; Li, Jie; Sanford, James A.; Kim, Young-Mo; Kronewitter, Scott R.; Jones, Marcus B.; Peterson, Christine; Peterson, Scott N.; Frank, Bryan C.; Purvine, Samuel O.; Brown, Joseph N.; Metz, Thomas O.; Smith, Richard D.; Heffron, Fred; Adkins, Joshua N.

    2013-06-26

    The potential for commensal microorganisms indigenous to a host (the ‘microbiome’ or ‘microbiota’) to alter infection outcome by influencing host-pathogen interplay is largely unknown. We used a multi-omics “systems” approach, incorporating proteomics, metabolomics, glycomics, and metagenomics, to explore the molecular interplay between the murine host, the pathogen Salmonella enterica serovar Typhimurium (S. Typhimurium), and commensal gut microorganisms during intestinal infection with S. Typhimurium. We find proteomic evidence that S. Typhimurium thrives within the infected 129/SvJ mouse gut without antibiotic pre-treatment, inducing inflammation and disrupting the intestinal microbiome (e.g., suppressing Bacteroidetes and Firmicutes while promoting growth of Salmonella and Enterococcus). Alteration of the host microbiome population structure was highly correlated with gut environmental changes, including the accumulation of metabolites normally consumed by commensal microbiota. Finally, the less characterized phase of S. Typhimurium’s lifecycle was investigated, and both proteomic and glycomic evidence suggests S. Typhimurium may take advantage of increased fucose moieties to metabolize fucose while growing in the gut. The application of multiple omics measurements to Salmonella-induced intestinal inflammation provides insights into complex molecular strategies employed during pathogenesis between host, pathogen, and the microbiome.

  20. All Yersinia enterocolitica are pathogenic: virulence of phylogroup 1 Y. enterocolitica in a Galleria mellonella infection model.

    Science.gov (United States)

    Alenizi, Dhahi; Ringwood, Tamara; Redhwan, Alya; Bouraha, Bouchra; Wren, Brendan W; Prentice, Michael; McNally, Alan

    2016-08-01

    Yersinia enterocolitica is a zoonotic pathogen and a common cause of gastroenteritis in humans. The species is composed of six diverse phylogroups, of which strains of phylogroup 1 are considered non-pathogenic to mammals due to the lack of the major virulence plasmid pYV, and their lack of virulence in a mouse infection model. In the present report we present data examining the pathogenicity of strains of Y. enterocolitica across all six phylogroups in a Galleria mellonellla model. We have demonstrated that in this model strains of phylogroup 1 exhibit severe pathogenesis with a lethal dose of as low as 10 c.f.u., that this virulence is an active process and that flagella play a major role in the virulence phenotype. We have also demonstrated that the complete lack of virulence in Galleria of the mammalian pathogenic phylogroups is not due to carriage of the pYV virulence plasmid. Our data suggest that all Y. enterocolitica can be pathogenic, which may be a reflection of the true natural habitat of the species, and that we may need to reconsider the eco-evo perspective of this important bacterial species.

  1. The PDB database is a rich source of alpha-helical anti-microbial peptides to combat disease causing pathogens [version 2; referees: 2 approved, 1 approved with reservations

    Directory of Open Access Journals (Sweden)

    Sandeep Chakraborty

    2015-06-01

    Full Text Available The therapeutic potential of α-helical anti-microbial peptides (AH-AMP to combat pathogens is fast gaining prominence. Based on recently published open access software for characterizing α-helical peptides (PAGAL, we elucidate a search methodology (SCALPEL that leverages the massive structural data pre-existing in the PDB database to obtain AH-AMPs belonging to the host proteome. We provide in vitro validation of SCALPEL on plant pathogens (Xylella fastidiosa, Xanthomonas arboricola and Liberibacter crescens by identifying AH-AMPs that mirror the function and properties of cecropin B, a well-studied AH-AMP. The identified peptides include a linear AH-AMP present within the existing structure of phosphoenolpyruvate carboxylase (PPC20, and an AH-AMP mimicing the properties of the two α-helices of cecropin B from chitinase (CHITI25. The minimum inhibitory concentration of these peptides are comparable to that of cecropin B, while anionic peptides used as control failed to show any inhibitory effect on these pathogens. Substitute therapies in place of conventional chemotherapies using membrane permeabilizing peptides like these might also prove effective to target cancer cells. The use of native structures from the same organism could possibly ensure that administration of such peptides will be better tolerated and not elicit an adverse immune response. We suggest a similar approach to target Ebola epitopes, enumerated using PAGAL recently, by selecting suitable peptides from the human proteome, especially in wake of recent reports of cationic amphiphiles inhibiting virus entry and infection.

  2. Microbial Profile of Soil-Free versus In-Soil Grown Lettuce and Intervention Methodologies to Combat Pathogen Surrogates and Spoilage Microorganisms on Lettuce

    Directory of Open Access Journals (Sweden)

    Sujata A. Sirsat

    2013-11-01

    Full Text Available Aquaponics is an effective method to practice sustainable agriculture and is gaining popularity in the US; however, the microbial safety of aquaponically grown produce needs to be ascertained. Aquaponics is a unique marriage of fish production and soil-free produce (e.g., leafy greens production. Fish are raised in fresh water tanks that are connected to water filled beds where fruits and vegetables are grown. The fish bi-products create nutrient-rich water that provides the key elements for the growth of plants and vegetables. The objective of this study was to perform a comparative analysis of the microbial safety and quality of aquaponic lettuce and soil grown lettuce (conventional, bagged, certified organic, and field lettuce. Following this, an intervention study was performed to combat foodborne pathogen surrogates (Salmonella and E. coli, spoilage, and fecal microorganisms using 2.5% acetic acid. The results of the comparative analysis study showed that aquaponically grown lettuce had significantly lower concentration of spoilage and fecal microorganisms compared to in-soil grown lettuce. The intervention study showed that diluted vinegar (2.5% acetic acid significantly reduced Salmonella, E. coli, coliforms, and spoilage microorganisms on fresh lettuce by 2 to 3 log CFU/g. Irrespective of growing methods (in-soil or soilless, it is crucial to incorporate good agricultural practices to reduce microbial contamination on fresh produce. The intervention employed in this study can be proposed to small farmers and consumers to improve quality and safety of leafy greens.

  3. Microbial Profile of Soil-Free versus In-Soil Grown Lettuce and Intervention Methodologies to Combat Pathogen Surrogates and Spoilage Microorganisms on Lettuce.

    Science.gov (United States)

    Sirsat, Sujata A; Neal, Jack A

    2013-11-11

    Aquaponics is an effective method to practice sustainable agriculture and is gaining popularity in the US; however, the microbial safety of aquaponically grown produce needs to be ascertained. Aquaponics is a unique marriage of fish production and soil-free produce (e.g., leafy greens) production. Fish are raised in fresh water tanks that are connected to water filled beds where fruits and vegetables are grown. The fish bi-products create nutrient-rich water that provides the key elements for the growth of plants and vegetables. The objective of this study was to perform a comparative analysis of the microbial safety and quality of aquaponic lettuce and soil grown lettuce (conventional, bagged, certified organic, and field lettuce). Following this, an intervention study was performed to combat foodborne pathogen surrogates ( Salmonella and E. coli ), spoilage, and fecal microorganisms using 2.5% acetic acid. The results of the comparative analysis study showed that aquaponically grown lettuce had significantly lower concentration of spoilage and fecal microorganisms compared to in-soil grown lettuce. The intervention study showed that diluted vinegar (2.5% acetic acid) significantly reduced Salmonella , E. coli , coliforms, and spoilage microorganisms on fresh lettuce by 2 to 3 log CFU/g. Irrespective of growing methods (in-soil or soilless), it is crucial to incorporate good agricultural practices to reduce microbial contamination on fresh produce. The intervention employed in this study can be proposed to small farmers and consumers to improve quality and safety of leafy greens.

  4. Microbial community profiling of fresh basil and pitfalls in taxonomic assignment of enterobacterial pathogenic species based upon 16S rRNA amplicon sequencing.

    Science.gov (United States)

    Ceuppens, Siele; De Coninck, Dieter; Bottledoorn, Nadine; Van Nieuwerburgh, Filip; Uyttendaele, Mieke

    2017-09-18

    Application of 16S rRNA (gene) amplicon sequencing on food samples is increasingly applied for assessing microbial diversity but may as unintended advantage also enable simultaneous detection of any human pathogens without a priori definition. In the present study high-throughput next-generation sequencing (NGS) of the V1-V2-V3 regions of the 16S rRNA gene was applied to identify the bacteria present on fresh basil leaves. However, results were strongly impacted by variations in the bioinformatics analysis pipelines (MEGAN, SILVAngs, QIIME and MG-RAST), including the database choice (Greengenes, RDP and M5RNA) and the annotation algorithm (best hit, representative hit and lowest common ancestor). The use of pipelines with default parameters will lead to discrepancies. The estimate of microbial diversity of fresh basil using 16S rRNA (gene) amplicon sequencing is thus indicative but subject to biases. Salmonella enterica was detected at low frequencies, between 0.1% and 0.4% of bacterial sequences, corresponding with 37 to 166 reads. However, this result was dependent upon the pipeline used: Salmonella was detected by MEGAN, SILVAngs and MG-RAST, but not by QIIME. Confirmation of Salmonella sequences by real-time PCR was unsuccessful. It was shown that taxonomic resolution obtained from the short (500bp) sequence reads of the 16S rRNA gene containing the hypervariable regions V1-V3 cannot allow distinction of Salmonella with closely related enterobacterial species. In conclusion 16S amplicon sequencing, getting the status of standard method in microbial ecology studies of foods, needs expertise on both bioinformatics and microbiology for analysis of results. It is a powerful tool to estimate bacterial diversity but amenable to biases. Limitations concerning taxonomic resolution for some bacterial species or its inability to detect sub-dominant (pathogenic) species should be acknowledged in order to avoid overinterpretation of results. Copyright © 2017 Elsevier B

  5. Can Phlorotannins Purified Extracts Constitute a Novel Pharmacological Alternative for Microbial Infections with Associated Inflammatory Conditions?

    Science.gov (United States)

    Lopes, Graciliana; Sousa, Carla; Silva, Luís R.; Pinto, Eugénia; Andrade, Paula B.; Bernardo, João; Mouga, Teresa; Valentão, Patrícia

    2012-01-01

    Bacterial and fungal infections and the emerging multidrug resistance are driving interest in fighting these microorganisms with natural products, which have generally been considered complementary to pharmacological therapies. Phlorotannins are polyphenols restricted to brown seaweeds, recognized for their biological capacity. This study represents the first research on the antibacterial, antifungal, anti-inflammatory and antioxidant activity of phlorotannins purified extracts, which were obtained from ten dominant brown seaweeds of the occidental Portuguese coast. Phlorotannins content was determined by the specific dimethoxybenzaldehyde (DMBA) method and a yield between 75 and 969 mg/Kg phloroglucinol units (dry matter) was obtained. Fucus spiralis ranked first, followed by three Cystoseira species. The anti-inflammatory potential of the purified extracts was assessed via inhibitory effect on nitric oxide (NO) production by lipopolysaccharide-stimulated RAW 264.7 macrophage cells, Cystoseira tamariscifolia being the one showing promising activity for the treatment of inflammation. NO scavenging ability was also addressed in cell free systems, F. spiralis being the species with highest capacity. The antimicrobial potential of the extracts was checked against five Gram-positive and four Gram-negative bacteria and three fungi strains, that commonly colonize skin and mucosa and are responsible for food contamination. The different extracts were more effective against Gram-positive bacteria, Staphylococcus epidermidis being the most susceptible species. Concerning antifungal activity, Trichophyton rubrum was the most sensitive species. Although the molecular mechanisms underlying these properties remain poorly understood, the results obtained turn phlorotannins purified extracts a novel and potent pharmacological alternative for the treatment of a wide range of microbial infections, which usually also present an inflammatory component. In addition to the biological

  6. Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.

    Science.gov (United States)

    Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco

    2016-01-01

    Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis.

  7. The opportunistic pathogen Pseudomonas aeruginosa activates the DNA double-strand break signaling and repair pathway in infected cells

    International Nuclear Information System (INIS)

    Elsen, S.; Collin-Faure, V.; Gidrol, X.; Lemercier, C.

    2013-01-01

    Highly hazardous DNA double-strand breaks can be induced in eukaryotic cells by a number of agents including pathogenic bacterial strains. We have investigated the genotoxic potential of Pseudomonas aeruginosa, an opportunistic pathogen causing devastating nosocomial infections in cystic fibrosis or immunocompromised patients. Our data revealed that infection of immune or epithelial cells by P. aeruginosa triggered DNA strand breaks and phosphorylation of histone H2AX (γH2AX), a marker of DNA double-strand breaks. Moreover, it induced formation of discrete nuclear repair foci similar to gamma-irradiation-induced foci, and containing γH2AX and 53BP1, an adaptor protein mediating the DNA-damage response pathway. Gene deletion, mutagenesis, and complementation in P. aeruginosa identified ExoS bacterial toxin as the major factor involved in γH2AX induction. Chemical inhibition of several kinases known to phosphorylate H2AX demonstrated that Ataxia Telangiectasia Mutated (ATM) was the principal kinase in P. aeruginosa-induced H2AX phosphorylation. Finally, infection led to ATM kinase activation by an auto-phosphorylation mechanism. Together, these data show for the first time that infection by P. aeruginosa activates the DNA double-strand break repair machinery of the host cells. This novel information sheds new light on the consequences of P. aeruginosa infection in mammalian cells. As pathogenic Escherichia coli or carcinogenic Helicobacter pylori can alter genome integrity through DNA double-strand breaks, leading to chromosomal instability and eventually cancer, our findings highlight possible new routes for further investigations of P. aeruginosa in cancer biology and they identify ATM as a potential target molecule for drug design. (authors)

  8. Secretome of fungus-infected aphids documents high pathogen activity and weak host response

    DEFF Research Database (Denmark)

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Olsen, Peter B.

    2011-01-01

    Discovery of novel secretome proteins contributes to the understanding of host-pathogen interactions. Here we report a rich diversity of secreted proteins from the interaction between grain aphids (host, insect order Hemiptera) and fungi of the order Entomophthorales (insect pathogens), made...

  9. Fruit-Enhanced Resistance to Microbial Infection Induced by Selective Laser Excitation

    Directory of Open Access Journals (Sweden)

    Alicia G. Gonzálvez

    2013-01-01

    Full Text Available Table grapes were irradiated with laser pulses at two different wavelengths: one selected at 302.1 nm, that is, resonant with the transresveratrol biphoton absorption band, and another selected at 300 nm, that is a nonresonant wavelength where trans-resveratrol two-photon absorption is negligible. Attenuated total reflectance Fourier transformed infrared spectroscopic analyses of the irradiated grapes' skin showed an enhancement of polyphenols' content when the resonant wavelength was employed. Furthermore, microbiological analysis performed with nontreated (control, nonresonant, and resonantly irradiated grapes demonstrated how the last samples developed a significantly lower number of colony forming units. Since the only difference between the two (resonant and nonresonant irradiation conditions was just a couple of nanometres in the employed UV-B laser wavelengths, the germicidal effect should be considered very similar. As a result, the observed difference in the table grape resistance to microbial infection was attributed to a wavelength-dependent-induced photochemistry. Finally, the potentiality of this method to enhance the postharvest health status of table grapes is remarked.

  10. Long-term monitoring of waterborne pathogens and microbial source tracking markers in paired agricultural watersheds under controlled and conventional tile drainage management.

    Science.gov (United States)

    Wilkes, Graham; Brassard, Julie; Edge, Thomas A; Gannon, Victor; Gottschall, Natalie; Jokinen, Cassandra C; Jones, Tineke H; Khan, Izhar U H; Marti, Romain; Sunohara, Mark D; Topp, Edward; Lapen, David R

    2014-06-01

    Surface waters from paired agricultural watersheds under controlled tile drainage (CTD) and uncontrolled tile drainage (UCTD) were monitored over 7 years in order to determine if there was an effect of CTD (imposed during the growing season) on occurrences and loadings of bacterial and viral pathogens, coliphages, and microbial source tracking markers. There were significantly lower occurrences of human, ruminant, and livestock (ruminant plus pig) Bacteroidales markers in the CTD watershed in relation to the UCTD watershed. As for pathogens, there were significantly lower occurrences of Salmonella spp. and Arcobacter spp. in the CTD watershed. There were no instances where there were significantly higher quantitative loadings of any microbial target in the CTD watershed, except for F-specific DNA (F-DNA) and F-RNA coliphages, perhaps as a result of fecal inputs from a hobby farm independent of the drainage practice treatments. There was lower loading of the ruminant marker in the CTD watershed in relation to the UCTD system, and results were significant at the level P = 0.06. The odds of Salmonella spp. occurring increased when a ruminant marker was present relative to when the ruminant marker was absent, yet for Arcobacter spp., the odds of this pathogen occurring significantly decreased when a ruminant marker was present relative to when the ruminant marker was absent (but increased when a wildlife marker was present relative to when the wildlife marker was absent). Interestingly, the odds of norovirus GII (associated with human and swine) occurring in water increased significantly when a ruminant marker was present relative to when a ruminant marker was absent. Overall, this study suggests that fecal pollution from tile-drained fields to stream could be reduced by CTD utilization. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  11. Long-Term Monitoring of Waterborne Pathogens and Microbial Source Tracking Markers in Paired Agricultural Watersheds under Controlled and Conventional Tile Drainage Management

    Science.gov (United States)

    Wilkes, Graham; Brassard, Julie; Edge, Thomas A.; Gannon, Victor; Gottschall, Natalie; Jokinen, Cassandra C.; Jones, Tineke H.; Khan, Izhar U. H.; Marti, Romain; Sunohara, Mark D.; Topp, Edward

    2014-01-01

    Surface waters from paired agricultural watersheds under controlled tile drainage (CTD) and uncontrolled tile drainage (UCTD) were monitored over 7 years in order to determine if there was an effect of CTD (imposed during the growing season) on occurrences and loadings of bacterial and viral pathogens, coliphages, and microbial source tracking markers. There were significantly lower occurrences of human, ruminant, and livestock (ruminant plus pig) Bacteroidales markers in the CTD watershed in relation to the UCTD watershed. As for pathogens, there were significantly lower occurrences of Salmonella spp. and Arcobacter spp. in the CTD watershed. There were no instances where there were significantly higher quantitative loadings of any microbial target in the CTD watershed, except for F-specific DNA (F-DNA) and F-RNA coliphages, perhaps as a result of fecal inputs from a hobby farm independent of the drainage practice treatments. There was lower loading of the ruminant marker in the CTD watershed in relation to the UCTD system, and results were significant at the level P = 0.06. The odds of Salmonella spp. occurring increased when a ruminant marker was present relative to when the ruminant marker was absent, yet for Arcobacter spp., the odds of this pathogen occurring significantly decreased when a ruminant marker was present relative to when the ruminant marker was absent (but increased when a wildlife marker was present relative to when the wildlife marker was absent). Interestingly, the odds of norovirus GII (associated with human and swine) occurring in water increased significantly when a ruminant marker was present relative to when a ruminant marker was absent. Overall, this study suggests that fecal pollution from tile-drained fields to stream could be reduced by CTD utilization. PMID:24727274

  12. In vitro and in vivo infectivity and pathogenicity of the lymphoid cell-derived woodchuck hepatitis virus.

    Science.gov (United States)

    Lew, Y Y; Michalak, T I

    2001-02-01

    Woodchuck hepatitis virus (WHV) and human hepatitis B virus are closely related, highly hepatotropic mammalian DNA viruses that also replicate in the lymphatic system. The infectivity and pathogenicity of hepadnaviruses propagating in lymphoid cells are under debate. In this study, hepato- and lymphotropism of WHV produced by naturally infected lymphoid cells was examined in specifically established woodchuck hepatocyte and lymphoid cell cultures and coculture systems, and virus pathogenicity was tested in susceptible animals. Applying PCR-based assays discriminating between the total pool of WHV genomes and covalently closed circular DNA (cccDNA), combined with enzymatic elimination of extracellular viral sequences potentially associated with the cell surface, our study documents that virus replicating in woodchuck lymphoid cells is infectious to homologous hepatocytes and lymphoid cells in vitro. The productive replication of WHV from lymphoid cells in cultured hepatocytes was evidenced by the appearance of virus-specific DNA, cccDNA, and antigens, transmissibility of the virus through multiple passages in hepatocyte cultures, and the ability of the passaged virus to infect virus-naive animals. The data also revealed that WHV from lymphoid cells can initiate classical acute viral hepatitis in susceptible animals, albeit small quantities (approximately 10(3) virions) caused immunovirologically undetectable (occult) WHV infection that engaged the lymphatic system but not the liver. Our results provide direct in vitro and in vivo evidence that lymphoid cells in the infected host support propagation of infectious hepadnavirus that has the potential to induce hepatitis. They also emphasize a principal role of the lymphatic system in the maintenance and dissemination of hepadnavirus infection, particularly when infection is induced by low virus doses.

  13. Cross-species infection of specific-pathogen-free pigs by a genotype 4 strain of human hepatitis E virus

    Science.gov (United States)

    Feagins, A. R.; Opriessnig, T.; Huang, Y. W.; Halbur, P. G.; Meng, X. J.

    2010-01-01

    SUMMARY Hepatitis E virus (HEV) is an important pathogen. The animal strain of HEV, swine HEV, is related to human HEV. The genotype 3 swine HEV infected humans and genotype 3 human HEV infected pigs. The genotype 4 swine and human HEV strains are genetically related, but it is unknown whether genotype 4 human HEV can infect pigs. A swine bioassay was utilized in this study to determine whether genotype 4 human HEV can infect pigs. Fifteen, 4-week-old, specific-pathogen-free pigs were divided into 3 groups of 5 each. Group 1 pigs were each inoculated intravenously with PBS buffer as negative controls, group 2 pigs similarly with genotype 3 human HEV (strain US-2), and group 3 pigs similarly with genotype 4 human HEV (strain TW6196E). Serum and fecal samples were collected at 0, 7, 14, 21, 28, 35, 42, 49, and 56 days postinoculation (dpi) and tested for evidence of HEV infection. All pigs were necropsied at 56 dpi. As expected, the negative control pigs remained negative. The positive control pigs inoculated with genotype 3 human HEV all became infected as evidenced by detection of HEV antibodies, viremia and fecal virus shedding. All five pigs in group 3 inoculated with genotype 4 human HEV also became infected: fecal virus shedding and viremia were detected variably from 7 to 56 dpi, and seroconversion occurred by 28 dpi. The data indicated that genotype 4 human HEV has an expanded host range, and the results have important implications for understanding the natural history and zoonosis of HEV. PMID:18551597

  14. In vivo fluorescence imaging of bacteriogenic cyanide in the lungs of live mice infected with cystic fibrosis pathogens.

    Directory of Open Access Journals (Sweden)

    Seong-Won Nam

    Full Text Available BACKGROUND: Pseudomonas aeruginosa (PA and Burkholderia cepacia complex (Bcc, commonly found in the lungs of cystic fibrosis (CF patients, often produce cyanide (CN, which inhibits cellular respiration. CN in sputa is a potential biomarker for lung infection by CF pathogens. However, its actual concentration in the infected lungs is unknown. METHODS AND FINDINGS: This work reports observation of CN in the lungs of mice infected with cyanogenic PA or Bcc strains using a CN fluorescent chemosensor (4',5'-fluorescein dicarboxaldehyde with a whole animal imaging system. When the CN chemosensor was injected into the lungs of mice intratracheally infected with either PA or B. cepacia strains embedded in agar beads, CN was detected in the millimolar range (1.8 to 4 mM in the infected lungs. CN concentration in PA-infected lungs rapidly increased within 24 hours but gradually decreased over the following days, while CN concentration in B. cepacia-infected lungs slowly increased, reaching a maximum at 5 days. CN concentrations correlated with the bacterial loads in the lungs. In vivo efficacy of antimicrobial treatments was tested in live mice by monitoring bacteriogenic CN in the lungs. CONCLUSIONS: The in vivo imaging method was also found suitable for minimally invasive testing the efficacy of antibiotic compounds as well as for aiding the understanding of bacterial cyanogenesis in CF lungs.

  15. Risk of Human Infections With Highly Pathogenic H5N2 and Low Pathogenic H7N1 Avian Influenza Strains During Outbreaks in Ostriches in South Africa.

    Science.gov (United States)

    Venter, Marietjie; Treurnicht, Florette K; Buys, Amelia; Tempia, Stefano; Samudzi, Rudo; McAnerney, Johanna; Jacobs, Charlene A; Thomas, Juno; Blumberg, Lucille

    2017-09-15

    Risk factors for human infection with highly pathogenic (HP) and low-pathogenic (LP) avian influenza (AI) H5N2 and H7N1 were investigated during outbreaks in ostriches in the Western Cape province, South Africa. Serum surveys were conducted for veterinarians, farmworkers, and laboratory and abattoir workers involved in 2 AI outbreaks in the Western Cape province: (1) controlling and culling of 42000 ostriches during (HPAI)H5N2 outbreaks in ostriches (2011) (n = 207); (2) movement control during (LPAI)H7N1 outbreaks in 2012 (n = 66). A third serosurvey was conducted on state veterinarians from across the country in 2012 tasked with disease control in general (n = 37). Antibodies to H5 and H7 were measured by means of hemagglutination inhibition and microneutralization assays, with microneutralization assay titers >40 considered positive. Two of 207 (1%) participants were seropositive for H5 and 4 of 207 (2%) for H7 in 2011, compared with 1 of 66 (1.5%) and 8 of 66 (13%) in 2012. Although individuals in all professions tested seropositive, abattoir workers (10 of 97; 10.3%) were significantly more at risk of influenza A(H7N1) infection (P = .001) than those in other professions (2 of 171;1.2%). Among state veterinarians, 4 of 37(11%) were seropositive for H7 and 1 of 37 (2.7%) for H5. Investigations of (LP)H7N1-associated fatalities in wild birds and quarantined exotic birds in Gauteng, AI outbreaks in poultry in KwaZulu-Natal, and ostriches in Western Cape province provide possible exposure events. (LPAI)H7N1 strains pose a greater infection-risk than (HPAI)H5N2 strains to persons involved in control of outbreaks in infected birds, with ostrich abattoir workers at highest risk. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  16. Characterization of the microbial community in a lotic environment to assess the effect of pollution on nitrifying and potentially pathogenic bacteria.

    Science.gov (United States)

    Medeiros, J D; Araújo, L X; da Silva, V L; Diniz, C G; Cesar, D E; Del'Duca, A; Coelho, C M

    2014-08-01

    This study aimed to investigate microbes involved in the nitrogen cycle and potentially pathogenic bacteria from urban and rural sites of the São Pedro stream. Water samples were collected from two sites. A seasonal survey of bacterial abundance was conducted. The dissolved nutrient content was analysed. PCR and FISH analysis were performed to identify and quantify microbes involved in the nitrogen cycle and potentially pathogenic bacteria. The seasonal survey revealed that the bacterial abundance was similar along the year on the rural area but varied on the urban site. Higher concentration of dissolved nutrients in the urban area indicated a eutrophic system. Considering the nitrifying microbes, the genus Nitrobacter was found, especially in the urban area, and may act as the principal bacteria in converting nitrite into nitrate at this site. The molecular markers napA, amoA, and nfrA were more accumulated at the urban site, justifying the higher content of nutrients metabolised by these enzymes. Finally, high intensity of amplicons from Enterococcus, Streptococcus, Bacteroides/Prevotella/Porphyromonas, Salmonella, S. aureus, P. aeruginosa and the diarrheagenic lineages of E. coli were observed at the urban site. These results indicate a change in the structure of the microbial community imposed by anthrophic actions. The incidence of pathogenic bacteria in aquatic environments is of particular importance to public health, emphasising the need for sewage treatment to minimise the environmental impacts associated with urbanisation.

  17. Genomic Microbial Epidemiology Is Needed to Comprehend the Global Problem of Antibiotic Resistance and to Improve Pathogen Diagnosis

    OpenAIRE

    Wyrsch, Ethan R.; Roy Chowdhury, Piklu; Chapman, Toni A.; Charles, Ian G.; Hammond, Jeffrey M.; Djordjevic, Steven P.

    2016-01-01

    Contamination of waste effluent from hospitals and intensive food animal production with antimicrobial residues is an immense global problem. Antimicrobial residues exert selection pressures that influence the acquisition of antimicrobial resistance and virulence genes in diverse microbial populations. Despite these concerns there is only a limited understanding of how antimicrobial residues contribute to the global problem of antimicrobial resistance. Furthermore, rapid detection of emerging...

  18. Microbial ecology, bacterial pathogens, and antibiotic resistant genes in swine manure as influenced by three swine management systems

    Science.gov (United States)

    The environmental influence of farm management in concentrated animal feeding operations (CAFO) can yield vastly different microbial constituents in both the pig and the manure lagoons used to treat the fecal waste of the operation. While some of these changes may not be negative, it is possible th...

  19. Experimental infection of swans and geese with highly pathogenic avian influenza virus (H5N1) of Asian lineage.

    Science.gov (United States)

    Brown, Justin D; Stallknecht, David E; Swayne, David E

    2008-01-01

    The role of wild birds in the epidemiology of the Asian lineage highly pathogenic avian influenza (HPAI) virus subtype H5N1 epizootic and their contribution to the spread of the responsible viruses in Eurasia and Africa are unclear. To better understand the potential role of swans and geese in the epidemiology of this virus, we infected 4 species of swans and 2 species of geese with an HPAI virus of Asian lineage recovered from a whooper swan in Mongolia in 2005, A/whooper swan/Mongolia/244/2005 (H5N1). The highest mortality rates were observed in swans, and species-related differences in clinical illness and viral shedding were evident. These results suggest that the potential for HPAI (H5N1) viral shedding and the movement of infected birds may be species-dependent and can help explain observed deaths associated with HPAI (H5N1) infection in anseriforms in Eurasia.

  20. Microbial population analysis of the salivary glands of ticks; a possible strategy for the surveillance of bacterial pathogens.

    Directory of Open Access Journals (Sweden)

    Yongjin Qiu

    Full Text Available Ticks are one of the most important blood-sucking vectors for infectious microorganisms in humans and animals. When feeding they inject saliva, containing microbes, into the host to facilitate the uptake of blood. An understanding of the microbial populations within their salivary glands would provide a valuable insight when evaluating the vectorial capacity of ticks. Three tick species (Ixodes ovatus, I. persulcatus and Haemaphysalis flava were collected in Shizuoka Prefecture of Japan between 2008 and 2011. Each tick was dissected and the salivary glands removed. Bacterial communities in each salivary gland were characterized by 16S amplicon pyrosequencing using a 454 GS-Junior Next Generation Sequencer. The Ribosomal Database Project (RDP Classifier was used to classify sequence reads at the genus level. The composition of the microbial populations of each tick species were assessed by principal component analysis (PCA using the Metagenomics RAST (MG-RAST metagenomic analysis tool. Rickettsia-specific PCR was used for the characterization of rickettsial species. Almost full length of 16S rDNA was amplified in order to characterize unclassified bacterial sequences obtained in I. persulcatus female samples. The numbers of bacterial genera identified for the tick species were 71 (I. ovatus, 127 (I. persulcatus and 59 (H. flava. Eighteen bacterial genera were commonly detected in all tick species. The predominant bacterial genus observed in all tick species was Coxiella. Spiroplasma was detected in Ixodes, and not in H. flava. PCA revealed that microbial populations in tick salivary glands were different between tick species, indicating that host specificities may play an important role in determining the microbial complement. Four female I. persulcatus samples contained a high abundance of several sequences belonging to Alphaproteobacteria symbionts. This study revealed the microbial populations within the salivary glands of three species of

  1. Microbial infections are associated with embryo mortality in Arctic-nesting geese.

    Science.gov (United States)

    Hansen, Cristina M.; Meixell, Brandt W.; Van Hemert, Caroline R.; Hare, Rebekah F.; Hueffer, Karsten

    2015-01-01

    To address the role of bacterial infection in hatching failure of wild geese, we monitored embryo development in a breeding population of Greater white-fronted geese (Anser albifrons) on the Arctic Coastal Plain of Alaska. During 2013, we observed mortality of normally developing embryos and collected 36 addled eggs for analysis. We also collected 17 infertile eggs for comparison. Using standard culture methods and gene sequencing to identify bacteria within collected eggs, we identified a potentially novel species of Neisseria in 33 eggs, Macrococcus caseolyticus in 6 eggs, and Streptococcus uberis and Rothia nasimurium in 4 eggs each. We detected seven other bacterial species at lower frequencies. Sequences of the 16S rRNA genes from the Neisseria isolates most closely matched sequences from N. animaloris and N. canis (96 to 97% identity), but phylogenetic analysis suggested substantial genetic differentiation between egg isolates and known Neisseria species. Although definitive sources of the bacteria remain unknown, we detected Neisseria DNA from swabs of eggshells, nest contents, and cloacae of nesting females. To assess the pathogenicity of bacteria identified in contents of addled eggs, we inoculated isolates of Neisseria, Macrococcus, Streptococcus, and Rothia at various concentrations into developing chicken eggs. Seven-day mortality rates varied from 70 to 100%, depending on the bacterial species and inoculation dose. Our results suggest that bacterial infections are a source of embryo mortality in wild geese in the Arctic.    

  2. A cross-sectional serological survey of the Dutch commercial poultry population for the presence of Low Pathogenic Avian Influenza virus infection

    NARCIS (Netherlands)

    Wit, de J.J.; Koch, G.; Fabri, T.H.F.; Elbers, A.R.W.

    2004-01-01

    After the discovery of poultry infected with highly pathogenic avian influenza (HPAI) virus of subtype H7N7 in the central area of the Netherlands on 28 February 2003, the hypothesis was put forward that an outbreak of the low pathogenic (LP) variant of H7N7 had preceded, unnoticed, the occurrence

  3. Infection of Drosophila suzukii with the obligate insect-pathogenic fungus Entomophthora muscae

    DEFF Research Database (Denmark)

    Becher, Paul G.; Jensen, Rasmus E.; Natsopoulou, Myrsini E.

    2018-01-01

    Physiological constraints restrict specialist pathogens from infecting new hosts. From an applied perspective, a narrow host range makes specialist pathogens interesting for targeting specific pest insects since they have minimal direct effects on non-target species. Entomopathogenic fungi of the...

  4. CT-Guided Biopsy in Suspected Spondylodiscitis--The Association of Paravertebral Inflammation with Microbial Pathogen Detection.

    Directory of Open Access Journals (Sweden)

    Daniel Spira

    Full Text Available To search for imaging characteristics distinguishing patients with successful from those with futile microbiological pathogen detection by CT-guided biopsy in suspected spondylodiscitis.34 consecutive patients with suspected spondylodiscitis underwent CT-guided biopsy for pathogen detection. MR-images were assessed for inflammatory infiltration of disks, adjacent vertebrae, epidural and paravertebral space. CT-images were reviewed for arrosion of adjacent end plates and reduced disk height. Biopsy samples were sent for microbiological examination in 34/34 patients, and for additional histological analysis in 28/34 patients.Paravertebral infiltration was present in all 10/10 patients with positive microbiology and occurred in only 12/24 patients with negative microbiology, resulting in a sensitivity of 100% and a specificity of 50% for pathogen detection. Despite its limited sensitivities, epidural infiltration and paravertebral abscesses showed considerably higher specificities of 83.3% and 90.9%, respectively. Paravertebral infiltration was more extensive in patients with positive as compared to negative microbiology (p = 0.002. Even though sensitivities for pathogen detection were also high in case of vertebral and disk infiltration, or end plate arrosion, specificities remained below 10%.Inflammatory infiltration of the paravertebral space indicated successful pathogen detection by CT-guided biopsy. Specificity was increased by the additional occurrence of epidural infiltration or paravertebral abscesses.

  5. Microbial Quality, Safety, and Pathogen Detection by Using Quantitative PCR of Raw Salad Vegetables Sold in Dhanbad City, India.

    Science.gov (United States)

    Mritunjay, Sujeet K; Kumar, Vipin

    2017-01-01

    Consumption of ready-to-eat fresh vegetables has increased worldwide, with a consequent increase in outbreaks caused by foodborne pathogens. In the Indian subcontinent, raw fresh vegetables are usually consumed without washing or other decontamination procedures, thereby leading to new food safety threats. In this study, the microbiological quality and pathogenic profile of raw salad vegetables was evaluated through standard protocols. In total, 480 samples (60 each of eight different salad vegetables) of cucumber, tomato, carrot, coriander, cabbage, beetroot, radish, and spinach were collected from different locations in Dhanbad, a city famous for its coal fields and often called the "Coal Capital of India." The samples were analyzed for total plate count, total coliforms, Escherichia coli , E. coli O157:H7, Listeria monocytogenes , and Salmonella spp. Incidences of pathogens were detected through quantitative PCR subsequent to isolation. Results showed that 46.7% (for total plate counts) and 30% (for total coliforms) of samples were unacceptable for consumption per the Food Safety and Standards Authority of India. Pathogenic microorganisms were detected in 3.7% of total samples. E. coli O157:H7 was detected in three samples of spinach (2) and beetroot ( 1 ); L. monocytogenes was detected in 14 samples of spinach ( 8 ), tomato ( 3 ), cucumber ( 2 ), and radish ( 1 ); and Salmonella spp. were detected in 16 samples of spinach ( 7 ), tomato ( 3 ), beetroot ( 2 ), cucumber ( 2 ), carrot ( 1 ), and radish ( 1 ). Pathogens were not detected in any of the cabbage and coriander samples.

  6. Utilization and control of ecological interactions in polymicrobial infections and community-based microbial cell factories.

    Science.gov (United States)

    Wigneswaran, Vinoth; Amador, Cristina Isabel; Jelsbak, Lotte; Sternberg, Claus; Jelsbak, Lars

    2016-01-01

    Microbial activities are most often shaped by interactions between co-existing microbes within mixed-species communities. Dissection of the molecular mechanisms of species interactions within communities is a central issue in microbial ecology, and our ability to engineer and control microbial communities depends, to a large extent, on our knowledge of these interactions. This review highlights the recent advances regarding molecular characterization of microbe-microbe interactions that modulate community structure, activity, and stability, and aims to illustrate how these findings have helped us reach an engineering-level understanding of microbial communities in relation to both human health and industrial biotechnology.

  7. Meta-analysis of the Effects of Insect Vector Saliva on Host Immune Responses and Infection of Vector-Transmitted Pathogens: A Focus on Leishmaniasis

    OpenAIRE

    Ockenfels, Brittany; Michael, Edwin; McDowell, Mary Ann

    2014-01-01

    A meta-analysis of the effects of vector saliva on the immune response and progression of vector-transmitted disease, specifically with regard to pathology, infection level, and host cytokine levels was conducted. Infection in the absence or presence of saliva in naïve mice was compared. In addition, infection in mice pre-exposed to uninfected vector saliva was compared to infection in unexposed mice. To control for differences in vector and pathogen species, mouse strain, and experimental de...

  8. Elimination of root-infecting pathogens in recirculation water from closed cultivation systems by ultra-violet radiation

    International Nuclear Information System (INIS)

    Runia, W.T.

    1994-01-01

    The development from growing in border soil to soilless cultures has not resulted in the disappearance of soil-borne diseases. Most root-infecting pathogens also occur in these new cultivation systems. Some pathogens such as Pythium, Phytophthora, cucumber green mottle mosaic virus and tomato mosaic virus are easily transmitted in recirculation water as is Olpidium, the vector of several viruses. To exclude any risk of dispersal of plant pathogens the water has to be sterilised before re-use. Rainwater collected from the glasshouse roof can also be contaminated with pathogens. When this rainwater is used for irrigation water it should be disinfected first. Currently water disinfection by heating or ozonisation is applied on some 450 nurseries. Initially ultra-violet(UV) radiation was not effective against plant pathogens. Only at a low capacity of 18 l h -1 and a high UV-dose of 430 mJ cm -2 could fungal spores be eliminated in nutrient solution. A low capacity however implies a poor turbulence in the water, resulting in varying UV-doses in the different water layers. Two new UV-installations with high capacities were tested for their efficacy against fungal and viral plant pathogens. One installation was equipped with a high-pressure and the other with a low-pressure mercury vapour lamp. In both installations a sandfilter first removed organic particles from the water. A UV-dose from the high-pressure lamp of 28 mJ cm -2 reduced the infectivity of conidia of Fusarium oxysporum f.sp lycopersici by 90 % resulting in a 99.9 % reduction at 84 mJ cm -2 . The low-pressure lamp completely eliminated conidia of Fusarium at a UV-dose of 70 mJ cm -2 . Tomato mosaic virus was reduced by 99 % using a UV-dose of 100 mJ cm -2 in both installations. Ultra-violet radiation can be effective against plant pathogens providing the dose under controlled conditions is sufficient. Numerous growers use UV-radiation for the disinfection of water in closed cultivation systems. (author)

  9. Antibacterial and antioxidant activities of Musa sp. leaf extracts against multidrug resistant clinical pathogens causing nosocomial infection.

    Science.gov (United States)

    Karuppiah, Ponmurugan; Mustaffa, Muhammed

    2013-09-01

    To investigate different Musa sp. leave extracts of hexane, ethyl acetate and methanol were evaluated for antibacterial activity against multi-drug resistant pathogens causing nosocomial infection by agar well diffusion method and also antioxidant activities. The four different Musa species leaves were extracted with hexane, ethyl acetate and methanol. Antibacterial susceptibility test, minimum inhibitory concentration and minimum inhibitory bacterial concentration were determined by agar well diffusion method. Total phenolic content and in vitro antioxidant activity was determined. All the Musa sp. extracts showed moderate antibacterial activities expect Musa paradisiaca with the inhibition zone ranging from 8.0 to 18.6 mm. Among four species ethyl acetate extracts of Musa paradisiaca showed highest activity against tested pathogens particularly E. coli, P. aeruginosa and Citrobacter sp. The minimum inhibitory concentrations were within the value of 15.63- 250 µg/mL and minimum bactericidal concentrations were ranging from 31.25- 250 µg/mL. Antioxidant activity of Musa acuminate exhibited maximum activity among other three Musa species. The present study concluded that among the different Musa species, Musa paradisiaca displayed efficient antibacterial activity followed by Musa acuminata against multi-drug resistant nosocomial infection causing pathogens. Further, an extensive study is needed to identify the bioactive compounds, mode of action and toxic effect in vivo of Musa sp.

  10. The defense-responsive genes showing enhanced and repressed expression after pathogen infection in rice (Oryza sativa L.)

    Institute of Scientific and Technical Information of China (English)

    ZHOU; Bin(周斌); PENG; Kaiman(彭开蔓); CHU; Zhaohui(储昭晖); WANG; Shiping(王石平); ZHANG; Qifa(张启发)

    2002-01-01

    Despite large numbers of studies about defense response, processes involved in the resistance of plants to incompatible pathogens are still largely uncharacterized. The objective of this study was to identify genes involved in defense response by cDNA array analysis and to gain knowledge about the functions of the genes involved in defense response. Approximately 20000 rice cDNA clones were arrayed on nylon filters. RNA samples isolated from different rice lines after infection with incompatible strains or isolates of Xanthomonas oryzae pv. oryzae or Pyricularia grisea, respectively, were used to synthesize cDNA as probes for screening the cDNA arrays. A total of 100 differentially expressed unique sequences were identified from 5 pathogen-host combinations. Fifty-three sequences were detected as showing enhanced expression and 47 sequences were detected as showing repressed expression after pathogen infection. Sequence analysis revealed that most of the 100 sequences had various degrees of homology with genes in databases which encode or putatively encode transcription regulating proteins, translation regulating proteins, transport proteins, kinases, metabolic enzymes, and proteins involved in other functions. Most of the genes have not been previously reported as being involved in the disease resistance response in rice. The results from cDNA arrays, reverse transcription-polymerase chain reaction, and RNA gel blot analysis suggest that activation or repression of most of these genes might occur commonly in the defense response.

  11. Discoloration and tyrosinase activity in Agaricus bisporus fruit bodies infected with various pathogens

    NARCIS (Netherlands)

    Soler-Rivas, C.; Arpin, N.; Olivier, J.M.; Wichers, H.J.

    2000-01-01

    The discoloration of A. bisporus after infection by Pseudomonas tolaasii, P. gingeri, P. agarici, P. reactans, Verticillium fungicola and Trichoderma harzianum can be distinguished by chromametric measurements. Infection with P. tolaasii caused a specific colour change, independent of the bacterial

  12. Method of inhibiting plant virus pathogen infections by crispr/cas9-mediated interference

    KAUST Repository

    Mahfouz, Magdy Mahmoud

    2016-11-24

    A genetically modified tobacco plant or tomato plant resistant to at least one pathogenic geminiviridae virus species is provided. The plant comprises a heterologous CRISPR/Cas9 system and at least one heterologous nucleotide sequence that is capable of hybridizing to a nucleotide sequence of the pathogenic virus and that directs inactivation of the pathogenic virus species or plurality of viral species by the CRISPR/Cas9 system. The heterologous nucleotide sequence can be complementary to, but not limited to an Intergenic Region (IR) of the Tomato Yellow Leaf Curl Virus (TYLCV), Further provided are methods of generating a genetically modified plant that is resistant to a virus pathogen by a heterologous CRISPR/Cas9 system and expression of a gRNA specifically targeting the virus.

  13. Method of inhibiting plant virus pathogen infections by crispr/cas9-mediated interference

    KAUST Repository

    Mahfouz, Magdy M.; Ali, Zahir

    2016-01-01

    A genetically modified tobacco plant or tomato plant resistant to at least one pathogenic geminiviridae virus species is provided. The plant comprises a heterologous CRISPR/Cas9 system and at least one heterologous nucleotide sequence

  14. Direct and indirect effects of climate change on the risk of infection by water-transmitted pathogens.

    Science.gov (United States)

    Sterk, Ankie; Schijven, Jack; de Nijs, Ton; de Roda Husman, Ana Maria

    2013-11-19

    Climate change is likely to affect the infectious disease burden from exposure to pathogens in water used for drinking and recreation. Effective intervention measures require quantification of impacts of climate change on the distribution of pathogens in the environment and their potential effects on human health. Objectives of this systematic review were to summarize current knowledge available to estimate how climate change may directly and indirectly affect infection risks due to Campylobacter, Cryptosporidium, norovirus, and Vibrio. Secondary objectives were to prioritize natural processes and interactions that are susceptible to climate change and to identify knowledge gaps. Search strategies were determined based on a conceptual model and scenarios with the main emphasis on The Netherlands. The literature search resulted in a large quantity of publications on climate variables affecting pathogen input and behavior in aquatic environments. However, not all processes and pathogens are evenly covered by the literature, and in many cases, the direction of change is still unclear. To make useful predictions of climate change, it is necessary to combine both negative and positive effects. This review provides an overview of the most important effects of climate change on human health and shows the importance of QMRA to quantify the net effects.

  15. Vector-borne pathogens in dogs from Costa Rica: first molecular description of Babesia vogeli and Hepatozoon canis infections with a high prevalence of monocytic ehrlichiosis and the manifestations of co-infection.

    Science.gov (United States)

    Rojas, Alicia; Rojas, Diana; Montenegro, Víctor; Gutiérrez, Ricardo; Yasur-Landau, Daniel; Baneth, Gad

    2014-01-31

    Infection with canine vector-borne pathogens was evaluated in dogs from four different regions of Costa Rica by PCR. Demographic data, clinical signs, packed cell volume values, and the presence of tick infestation were recorded for each dog. Forty seven percent (69/146) of the dogs were infected with at least one pathogen and 12% were co-infected with two pathogens. Ehrlichia canis was detected in 34%, Anaplasma platys in 10%, Babesia vogeli in 8%, and Hepatozoon canis in 7.5% of the blood samples. No infection was detected with Leishmania spp. in blood, skin scrapings or conjunctival swabs. Thirty percent of the dogs presented at least one clinical sign compatible with vector-borne disease, and of those, 66% were infected with a pathogen. Subclinical infections were determined in 58% of the infected dogs including 82% (9/11), 58% (29/50), 42% (5/12) and 36% (5/14) of the dogs with H. canis, E. canis, B. vogeli and A. platys infections, respectively. A distinct relationship was found between infection and anemia. The mean PCV values were 34.4% in dogs with no infection, 31.5% in those who had a single infection and 23% in those with co-infection. Co-infected dogs had significantly lower PCV values compared to non-infected and single-infected dogs (pcanis were significantly associated with R. sanguineus s.l. infestation (pcanis in Costa Rica as well as in Central America. The results of this study indicate that multiple vector-borne pathogens responsible for severe diseases infect dogs in Costa Rica and therefore, increased owner and veterinarian awareness are needed. Moreover, prevention of tick infestation is recommended to decrease the threat of these diseases to the canine population. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Nosocomial infections after aneurysmal subarachnoid hemorrhage : time course and causative pathogens

    NARCIS (Netherlands)

    Laban, Kamil G.; Rinkel, Gabriel J. E.; Vergouwen, Mervyn D. I.

    BackgroundNosocomial infections after aneurysmal subarachnoid hemorrhage (aSAH) are associated with prolonged length of stay and poor functional outcome. It remains unclear if infections result in prolonged length of stay or, vice versa, if prolonged length of stay results in more infections. Before

  17. Bacterial diversity analysis of Huanglongbing pathogen-infected citrus, using PhyloChip and 16S rRNA gene clone library sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Shankar Sagaram, U.; DeAngelis, K.M.; Trivedi, P.; Andersen, G.L.; Lu, S.-E.; Wang, N.

    2009-03-01

    The bacterial diversity associated with citrus leaf midribs was characterized 1 from citrus groves that contained the Huanglongbing (HLB) pathogen, which has yet to be cultivated in vitro. We employed a combination of high-density phylogenetic 16S rDNA microarray and 16S rDNA clone library sequencing to determine the microbial community composition of symptomatic and asymptomatic citrus midribs. Our results revealed that citrus leaf midribs can support a diversity of microbes. PhyloChip analysis indicated that 47 orders of bacteria from 15 phyla were present in the citrus leaf midribs while 20 orders from phyla were observed with the cloning and sequencing method. PhyloChip arrays indicated that nine taxa were significantly more abundant in symptomatic midribs compared to asymptomatic midribs. Candidatus Liberibacter asiaticus (Las) was detected at a very low level in asymptomatic plants, but was over 200 times more abundant in symptomatic plants. The PhyloChip analysis was further verified by sequencing 16S rDNA clone libraries, which indicated the dominance of Las in symptomatic leaves. These data implicate Las as the pathogen responsible for HLB disease. Citrus is the most important commercial fruit crop in Florida. In recent years, citrus Huanglongbing (HLB), also called citrus greening, has severely affected Florida's citrus production and hence has drawn an enormous amount of attention. HLB is one of the most devastating diseases of citrus (6,13), characterized by blotchy mottling with green islands on leaves, as well as stunting, fruit decline, and small, lopsided fruits with poor coloration. The disease tends to be associated with a phloem-limited fastidious {alpha}-proteobacterium given a provisional Candidatus status (Candidatus Liberobacter spp. later changed to Candidatus Liberibacter spp.) in nomenclature (18,25,34). Previous studies indicate that HLB infection causes disorder in the phloem and severely impairs the translocation of assimilates in

  18. Airborne Transmission of Highly Pathogenic Influenza Virus during Processing of Infected Poultry.

    Science.gov (United States)

    Bertran, Kateri; Balzli, Charles; Kwon, Yong-Kuk; Tumpey, Terrence M; Clark, Andrew; Swayne, David E

    2017-11-01

    Exposure to infected poultry is a suspected cause of avian influenza (H5N1) virus infections in humans. We detected infectious droplets and aerosols during laboratory-simulated processing of asymptomatic chickens infected with human- (clades 1 and 2.2.1) and avian- (clades 1.1, 2.2, and 2.1) origin H5N1 viruses. We detected fewer airborne infectious particles in simulated processing of infected ducks. Influenza virus-naive chickens and ferrets exposed to the air space in which virus-infected chickens were processed became infected and died, suggesting that the slaughter of infected chickens is an efficient source of airborne virus that can infect birds and mammals. We did not detect consistent infections in ducks and ferrets exposed to the air space in which virus-infected ducks were processed. Our results support the hypothesis that airborne transmission of HPAI viruses can occur among poultry and from poultry to humans during home or live-poultry market slaughter of infected poultry.

  19. Quantification of disease progression of several microbial pathogens on Arabidopsis thaliana using real-time fluorescence PCR

    NARCIS (Netherlands)

    Brouwer, M.; Lievens, B.; Hemelrijck, van W.; Ackerveken, van den G.; Cammue, B.P.A.; Thomma, B.P.H.J.

    2003-01-01

    An accurate monitoring of disease progression is important to evaluate disease susceptibility phenotypes. Over the years, Arabidopsis thaliana has become the model species to serve as a host in plant-pathogen interactions. Despite the efforts to study genetic mechanisms of host defense, little

  20. Implementing hospital-based surveillance for severe acute respiratory infections caused by influenza and other respiratory pathogens in New Zealand

    Directory of Open Access Journals (Sweden)

    Q Sue Huang

    2014-05-01

    Full Text Available Background: Recent experience with pandemic influenza A(H1N1pdm09 highlighted the importance of global surveillance for severe respiratory disease to support pandemic preparedness and seasonal influenza control. Improved surveillance in the southern hemisphere is needed to provide critical data on influenza epidemiology, disease burden, circulating strains and effectiveness of influenza prevention and control measures. Hospital-based surveillance for severe acute respiratory infection (SARI cases was established in New Zealand on 30 April 2012. The aims were to measure incidence, prevalence, risk factors, clinical spectrum and outcomes for SARI and associated influenza and other respiratory pathogen cases as well as to understand influenza contribution to patients not meeting SARI case definition. Methods/Design: All inpatients with suspected respiratory infections who were admitted overnight to the study hospitals were screened daily. If a patient met the World Health Organization’s SARI case definition, a respiratory specimen was tested for influenza and other respiratory pathogens. A case report form captured demographics, history of presenting illness, co-morbidities, disease course and outcome and risk factors. These data were supplemented from electronic clinical records and other linked data sources. Discussion: Hospital-based SARI surveillance has been implemented and is fully functioning in New Zealand. Active, prospective, continuous, hospital-based SARI surveillance is useful in supporting pandemic preparedness for emerging influenza A(H7N9 virus infections and seasonal influenza prevention and control.

  1. Pattern of Bacterial Pathogens and Their Susceptibility Isolated from Surgical Site Infections at Selected Referral Hospitals, Addis Ababa, Ethiopia

    Directory of Open Access Journals (Sweden)

    Walelign Dessie

    2016-01-01

    Full Text Available Background. The emergence of multidrug resistant bacterial pathogens in hospitals is becoming a challenge for surgeons to treat hospital acquired infections. Objective. To determine bacterial pathogens and drug susceptibility isolated from surgical site infections at St. Paul Specialized Hospital Millennium Medical College and Yekatit 12 Referral Hospital Medical College, Addis Ababa, Ethiopia. Methods. A cross-sectional study was conducted between October 2013 and March 2014 on 107 surgical site infected patients. Wound specimens were collected using sterile cotton swab and processed as per standard operative procedures in appropriate culture media; and susceptibility testing was done using Kirby-Bauer disc diffusion technique. The data were analyzed by using SPSS version 20. Result. From a total of 107 swabs collected, 90 (84.1% were culture positive and 104 organisms were isolated. E. coli (24 (23.1% was the most common organism isolated followed by multidrug resistant Acinetobacter species (23 (22.1%. More than 58 (75% of the Gram negative isolates showed multiple antibiotic resistance (resistance ≥ 5 drugs. Pan-antibiotic resistance was noted among 8 (34.8% Acinetobacter species and 3 (12.5% E. coli. This calls for abstinence from antibiotic abuse. Conclusion. Gram negative bacteria were the most important isolates accounting for 76 (73.1%. Ampicillin, amoxicillin, penicillin, cephazoline, and tetracycline showed resistance while gentamicin and ciprofloxacin were relatively effective antimicrobials.

  2. Approaches for Reverse Line Blot-Based Detection of Microbial Pathogens in Ixodes ricinus Ticks Collected in Austria and Impact of the Chosen Method.

    Science.gov (United States)

    Schötta, Anna-Margarita; Wijnveld, Michiel; Stockinger, Hannes; Stanek, Gerold

    2017-07-01

    Ticks transmit a large number of pathogens capable of causing human disease. In this study, the PCR-reverse line blot (RLB) method was used to screen for pathogens in a total of 554 Ixodes ricinus ticks collected from all provinces of Austria. These pathogens belong to the genera Borrelia , Rickettsiae , Anaplasma / Ehrlichia (including " Candidatus Neoehrlichia"), Babesia , and Coxiella The pathogens with the highest detected prevalence were spirochetes of the Borrelia burgdorferi sensu lato complex, in 142 ticks (25.6%). Borrelia afzelii (80/142) was the most frequently detected species, followed by Borrelia burgdorferi sensu stricto (38/142) and Borrelia valaisiana (36/142). Borrelia garinii/Borrelia bavariensis , Borrelia lusitaniae , and Borrelia spielmanii were found in 28 ticks, 5 ticks, and 1 tick, respectively. Rickettsia spp. were detected in 93 ticks (16.8%): R. helvetica (39/93), R. raoultii (38/93), R. monacensis (2/93), and R. slovaca (1/93). Thirteen Rickettsia samples remain uncharacterized. " Candidatus Neoehrlichia mikurensis," Babesia spp. ( B. venatorum , B. divergens , B. microti ), and Anaplasma phagocytophilum were found in 4.5%, 2.7%, and 0.7%, respectively. Coxiella burnetii was not detected. Multiple microorganisms were detected in 40 ticks (7.2%), and the cooccurrence of Babesia spp. and " Candidatus Neoehrlichia mikurensis" showed a significant positive correlation. We also compared different PCR-RLBs for detection of Borrelia burgdorferi sensu lato and Rickettsia spp. and showed that different detection approaches provide highly diverse results, indicating that analysis of environmental samples remains challenging. IMPORTANCE This study determined the wide spectrum of tick-borne bacterial and protozoal pathogens that can be encountered in Austria. Surveillance of (putative) pathogenic microorganisms occurring in the environment is of medical importance, especially when those agents can be transmitted by ticks and cause disease. The

  3. Proteomics and its applications to aquaculture in China: infection, immunity, and interaction of aquaculture hosts with pathogens.

    Science.gov (United States)

    Peng, Xuan-Xian

    2013-01-01

    China is the largest fishery producer worldwide in term of its aquaculture output, and plays leading and decisive roles in international aquaculture development. To improve aquaculture output further and promote aquaculture business development, infectious diseases and immunity of fishes and other aquaculture species must be studied. In this regard, aquaculture proteomics has been widely carried out in China to get a better understanding of aquaculture host immunity and microbial pathogenesis as well as host-pathogen interactions, and to identify novel disease targets and vaccine candidates for therapeutic interventions. These proteomics studies include development of novel methods, assays, and advanced concepts in order to characterize proteomics mechanisms of host innate immune defense and microbial pathogenesis. This review article summarizes some recently published technical approaches and their applications to aquaculture proteomics with an emphasis on the responses of aquaculture animals to bacteria, viruses, and other aqua-environmental stresses, and development of broadly cross-protective vaccine candidates. The reviewed articles are those that have been published in international peer reviewed journals. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Penicillium expansum (compatible) and Penicillium digitatum (non-host) pathogen infection differentially alter ethylene biosynthesis in apple fruit.

    Science.gov (United States)

    Vilanova, Laura; Vall-Llaura, Núria; Torres, Rosario; Usall, Josep; Teixidó, Neus; Larrigaudière, Christian; Giné-Bordonaba, Jordi

    2017-11-01

    The role of ethylene on inducing plant resistance or susceptibility to certain fungal pathogens clearly depends on the plant pathogen interaction with little or no-information available focused on the apple-Penicillium interaction. Taken advantage that Penicillium expansum is the compatible pathogen and P. digitatum is the non-host of apples, the present study aimed at deciphering how each Penicillium spp. could interfere in the fruit ethylene biosynthesis at the biochemical and molecular level. The infection capacity and different aspects related to the ethylene biosynthesis were conducted at different times post-inoculation. The results show that the fruit ethylene biosynthesis was differently altered during the P. expansum infection than in response to other biotic (non-host pathogen P. digitatum) or abiotic stresses (wounding). The first symptoms of the disease due to P. expansum were visible before the initiation of the fruit ethylene climacteric burst. Indeed, the ethylene climacteric burst was reduced in response to P. expansum concomitant to an important induction of MdACO3 gene expression and an inhibition (ca. 3-fold) and overexpression (ca. 2-fold) of ACO (1-Aminocyclopropane-1-carboxylic acid oxidase) and ACS (1-Aminocyclopropane-1-carboxylic acid synthase) enzyme activities, indicating a putative role of MdACO3 in the P. expansum-apple interaction which may, in turn, be related to System-1 ethylene biosynthesis. System-1 is auto-inhibited by ethylene and is characteristic of non-climateric or pre-climacteric fruit. Accordingly, we hypothesise that P. expansum may 'manipulate' the endogenous ethylene biosynthesis in apples, leading to the circumvention or suppression of effective defences hence facilitating its colonization. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  5. Insertion of an esterase gene into a specific locust pathogen (Metarhizium acridum enables it to infect caterpillars.

    Directory of Open Access Journals (Sweden)

    Sibao Wang

    2011-06-01

    Full Text Available An enduring theme in pathogenic microbiology is poor understanding of the mechanisms of host specificity. Metarhizium is a cosmopolitan genus of invertebrate pathogens that contains generalist species with broad host ranges such as M. robertsii (formerly known as M. anisopliae var. anisopliae as well as specialists such as the acridid-specific grasshopper pathogen M. acridum. During growth on caterpillar (Manduca sexta cuticle, M. robertsii up-regulates a gene (Mest1 that is absent in M. acridum and most other fungi. Disrupting M. robertsii Mest1 reduced virulence and overexpression increased virulence to caterpillars (Galleria mellonella and M. sexta, while virulence to grasshoppers (Melanoplus femurrubrum was unaffected. When Mest1 was transferred to M. acridum under control of its native M. robertsii promoter, the transformants killed and colonized caterpillars in a similar fashion to M. robertsii. MEST1 localized exclusively to lipid droplets in M. robertsii conidia and infection structures was up-regulated during nutrient deprivation and had esterase activity against lipids with short chain fatty acids. The mobilization of stored lipids was delayed in the Mest1 disruptant mutant. Overall, our results suggest that expression of Mest1 allows rapid hydrolysis of stored lipids, and promotes germination and infection structure formation by M. robertsii during nutrient deprivation and invasion, while Mest1 expression in M. acridum broadens its host range by bypassing the regulatory signals found on natural hosts that trigger the mobilization of endogenous nutrient reserves. This study suggests that speciation in an insect pathogen could potentially be driven by host shifts resulting from changes in a single gene.

  6. Pattern of pathogens and their sensitivity isolated from superficial surgical site infections in a tertiary care hospital

    International Nuclear Information System (INIS)

    Ali, S.A.; Tahir, S.M.; Shaikh, N.A.

    2009-01-01

    Infection is an important cause of morbidity and mortality in surgical patients. Rapidly emerging nosocomial pathogens and the problem of multi-drug resistance necessitates periodic review of isolation patterns and sensitivity in surgical practice. Surgical site infections (SSI) are defined as an infections that occurs at the incision site within thirty days after surgery. Objectives of the study were to determine the pattern of pathogens involved and their antibiotic sensitivity isolated from superficial surgical site infections in a teaching hospital. This observational study was conducted for 1 year from January 2008 to December 2008 in all 4 surgical units of Liaquat University Hospital Hyderabad which caters to patients from low socioeconomic status. Pus culture and sensitivity reports were collected prospectively from hospitalised patients who developed postoperative wound infection. The patients who developed fecal/biliary/urinary fistula or operated for malignancies, and with negative cultures were excluded from the study. Analysis was carried out using SPSS 10. During the study period 112 pus culture and sensitivity reports were analyzed. E. coli 68 (60.7%) was the most common organism isolated followed by Klebsiella 23 (20.5%). The least frequent organism was staph. Epidermidis 1 (0.9%). All isolates were sensitive to penicillin derivatives and carbapenem. Quinolones, Aminoglycosides and Monobactum were also showing some promise in our study. However, Cephalosporins were ineffective against most of the important isolates in our study. E. coli and klebsiella were the most important isolates form SSI in our study, and penicillin derivatives and carbapenem were showing 100% antibiotic sensitivity to all of the isolates. (author)

  7. Characterization and genome analysis of novel bacteriophages infecting the opportunistic human pathogens Klebsiella oxytoca and K. pneumoniae.

    Science.gov (United States)

    Park, Eun-Ah; Kim, You-Tae; Cho, Jae-Hyun; Ryu, Sangryeol; Lee, Ju-Hoon

    2017-04-01

    Klebsiella is a genus of well-known opportunistic human pathogens that are associated with diabetes mellitus and chronic pulmonary obstruction; however, this pathogen is often resistant to multiple drugs. To control this pathogen, two Klebsiella-infecting phages, K. oxytoca phage PKO111 and K. pneumoniae phage PKP126, were isolated from a sewage sample. Analysis of their host range revealed that they infect K. pneumoniae and K. oxytoca, suggesting host specificity for members of the genus Klebsiella. Stability tests confirmed that the phages are stable under various temperature (4 to 60 °C) and pH (3 to 11) conditions. A challenge assay showed that PKO111 and PKP126 inhibit growth of their host strains by 2 log and 4 log, respectively. Complete genome sequencing of the phages revealed that their genome sizes are quite different (168,758 bp for PKO111 and 50,934 bp for PKP126). Their genome annotation results showed that they have no human virulence-related genes, an important safety consideration. In addition, no lysogen-formation gene cluster was detected in either phage genome, suggesting that they are both virulent phages in their bacterial hosts. Based on these results, PKO111 and PKP126 may be good candidates for development of biocontrol agents against members of the genus Klebsiella for therapeutic purposes. A comparative analysis of tail-associated gene clusters of PKO111 and PKP126 revealed relatively low homology, suggesting that they might differ in the way they recognize and infect their specific hosts.

  8. Evaluation of an ultraviolet room disinfection protocol to decrease nursing home microbial burden, infection and hospitalization rates.

    Science.gov (United States)

    Kovach, Christine R; Taneli, Yavuz; Neiman, Tammy; Dyer, Elaine M; Arzaga, Alvin Jason A; Kelber, Sheryl T

    2017-03-03

    The focus of nursing home infection control procedures has been on decreasing transmission between healthcare workers and residents. Less evidence is available regarding whether decontamination of high-touch environmental surfaces impacts infection rates or resident outcomes. The purpose of this study was to examine if ultraviolet disinfection is associated with changes in: 1) microbial counts and adenosine triphosphate counts on high-touch surfaces; and 2) facility wide nursing home acquired infection rates, and infection-related hospitalization. The study was conducted in one 160-bed long-term care facility. Following discharge of each resident, their room was cleaned and then disinfected using a newly acquired ultraviolet light disinfection device. Shared living spaces received weekly ultraviolet light disinfection. Thirty-six months of pretest infection and hospitalization data were compared with 12 months of posttest data. Pre and posttest cultures were taken from high-touch surfaces, and luminometer readings of adenosine triphosphate were done. Nursing home acquired infection rates were analyzed relative to hospital acquired infection rates using analysis of variance procedures. Wilcoxon signed rank tests, The Cochran's Q, and Chi Square were also used. There were statistically significant decreases in adenosine triphosphate readings on all high-touch surfaces after cleaning and disinfection. Culture results were positive for gram-positive cocci or rods on 33% (n = 30) of the 90 surfaces swabbed at baseline. After disinfectant cleaning, 6 of 90 samples (7.1%) tested positive for a gram-positive bacilli, and after ultraviolet disinfection 4 of the 90 samples (4.4%) were positive. There were significant decreases in nursing home acquired relative to hospital-acquired infection rates for the total infections (p = .004), urinary tract infection rates (p = .014), respiratory system infection rates (p = .017) and for rates of infection of the skin

  9. [The role of natural environment in spreading of hantavirus--model of the correlation between host, pathogen and human infections].

    Science.gov (United States)

    Baumann, Anna; Dudek, Dorota; Sadkowska-Todys, Małgorzata

    2007-01-01

    The environmental changes caused by humans influence ecosystem and thus have significant impact on occurrence of emerging and re-emerging diseases. The hantavirus infection belong to the one of them. The aim of this paper was to present current knowledge about relationship between hantavirus, their natural host and the spread of the infection to people. Rodents constitute both the natural host of the hantaviruses and the reservoir of hantavirus for environment. Circulation of the virus in the rodent population is crucial to maintain the virus in the environment. The individual characteristics of rodents influence on risk of infection with hantavirus. However, this relationship is still unexplained. Risk of pathogen exposure often increases with age and behavioral differences associated with the sex of the susceptible individual. Mating behaviors seem to play an important role in the spread of the virus among rodents. Human incidence of hantavirus infection has in general been found to correlate to the population size of rodent host especially in the model of nephropathia epidemica (NE; a mild form of HFRS), Puumala virus (PUU) and bank voles. The occurrence of hantavirus infections in humans is assumed to rise as a secondary effect from altered population sizes of rodents in a changing environment due to e.g. mast years, forest fragmentation, global warming.

  10. Infection processes of xylem-colonizing pathogenic bacteria: possible explanations for the scarcity of qualitative disease resistance genes against them in crops.

    Science.gov (United States)

    Bae, Chungyun; Han, Sang Wook; Song, Yu-Rim; Kim, Bo-Young; Lee, Hyung-Jin; Lee, Je-Min; Yeam, Inhwa; Heu, Sunggi; Oh, Chang-Sik

    2015-07-01

    Disease resistance against xylem-colonizing pathogenic bacteria in crops. Plant pathogenic bacteria cause destructive diseases in many commercially important crops. Among these bacteria, eight pathogens, Ralstonia solanacearum, Xanthomonas oryzae pv. oryzae, X. campestris pv. campestris, Erwinia amylovora, Pantoea stewartii subsp. stewartii, Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. actinidiae, and Xylella fastidiosa, infect their host plants through different infection sites and paths and eventually colonize the xylem tissues of their host plants, resulting in wilting symptoms by blocking water flow or necrosis of xylem tissues. Noticeably, only a relatively small number of resistant cultivars in major crops against these vascular bacterial pathogens except X. oryzae pv. oryzae have been found or generated so far, although these pathogens threaten productivity of major crops. In this review, we summarize the lifestyles of major xylem-colonizing bacterial pathogens and then discuss the progress of current research on disease resistance controlled by qualitative disease resistance genes or quantitative trait loci against them. Finally, we propose infection processes of xylem-colonizing bacterial pathogens as one of possible reasons for why so few qualitative disease resistance genes against these pathogens have been developed or identified so far in crops.

  11. The ability to cause infection in a pathogenic fungus uncovers a new biological feature of honey bee viruses.

    Science.gov (United States)

    Li, Zhiguo; Su, Songkun; Hamilton, Michele; Yan, Limin; Chen, Yanping

    2014-07-01

    We demonstrated that honey bee viruses including Deformed wing virus (DWV), Black queen cell virus (BQCV) and Israeli acute paralysis virus (IAPV) could infect and replicate in the fungal pathogen Ascosphaera apis that causes honey bee chalkbrood disease, revealing a novel biological feature of honey bee viruses. The phylogenetic analysis show that viruses of fungal and honey bee origins form two clusters in the phylogenetic trees distinctly and that host range of honey bee viruses is dynamic. Further studies are warranted to investigate the impact of the viruses on the fitness of their fungal host and phenotypic effects the virus-fungus combination has on honey bee hosts. Published by Elsevier Inc.

  12. The cereal pathogen Fusarium pseudograminearum produces a new class of active cytokinins during infection

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Benfield, Aurelie H.; Wollenberg, Rasmus Dam

    2018-01-01

    -senescence activities and the production of a cytokinin mimic by what was once considered a necrotrophic pathogen that promotes cell death and senescence challenges the simple view that this pathogen invades its hosts by employing a barrage of lytic enzymes and toxins. Through genome mining, a gene cluster in the F....... pseudograminearum genome for the production of Fusarium cytokinins was identified and the biosynthetic pathway established using gene knockouts. The Fusarium cytokinins could activate plant cytokinin signalling, demonstrating their genuine hormone mimicry. In planta analysis of the transcriptional response to one...

  13. A novel photo-biological engineering method for Salvia miltiorrhiza-mediated fabrication of silver nanoparticles using LED lights sources and its effectiveness against Aedes aegypti mosquito larvae and microbial pathogens

    Science.gov (United States)

    In this study, Salvia miltiorrhiza-synthesized Ag nanoparticles (AgNPs) fabricated using sunlight or various LED lights were studied for their biophysical features and evaluated as larvicides against Aedes aegypti mosquitoes and growth inhibitors on different species of microbial pathogens. AgNPs pr...

  14. Transcription factor regulation and cytokine expression following in vitro infection of primary chicken cell culture with low pathogenic avian influenza virus

    Science.gov (United States)

    Avian influenza virus (AIV) induced proinflammatory cytokine expression is believed to contribute to the disease pathogenesis following infection. However, there is limited information on the avian immune response to infection with low pathogenic avian influenza virus (LPAIV). To gain a better under...

  15. Immune responses of mature chicken bone-marrow-derived dendritic cells infected with Newcastle disease virus strains with differing pathogenicity.

    Science.gov (United States)

    Xiang, Bin; Zhu, Wenxian; Li, Yaling; Gao, Pei; Liang, Jianpeng; Liu, Di; Ding, Chan; Liao, Ming; Kang, Yinfeng; Ren, Tao

    2018-06-01

    Infection of chickens with virulent Newcastle disease virus (NDV) is associated with severe pathology and increased morbidity and mortality. The innate immune response contributes to the pathogenicity of NDV. As professional antigen-presenting cells, dendritic cells (DCs) play a unique role in innate immunity. However, the contribution of DCs to NDV infection has not been investigated in chickens. In this study, we selected two representative NDV strains, i.e., the velogenic NDV strain Chicken/Guangdong/GM/2014 (GM) and the lentogenic NDV strain La Sota, to investigate whether NDVs could infect LPS-activated chicken bone-derived marrow DCs (mature chicken BM-DCs). We compared the viral titres and innate immune responses in mature chicken BM-DCs following infection with those strains. Both NDV strains could infect mature chicken BM-DC, but the GM strain showed stronger replication capacity than the La Sota strain in mature chicken BM-DCs. Gene expression profiling showed that MDA5, LGP2, TLR3, TLR7, IFN-α, IFN-β, IFN-γ, IL-1β, IL-6, IL-18, IL-8, CCL5, IL-10, IL-12, MHC-I, and MHC-II levels were altered in mature DCs after infection with NDVs at all evaluated times postinfection. Notably, the GM strain triggered stronger innate immune responses than the La Sota strain in chicken BM-DCs. However, both strains were able to suppress the expression of some cytokines, such as IL-6 and IFN-α, in mature chicken DCs at 24 hpi. These data provide a foundation for further investigation of the role of chicken DCs in NDV infection.

  16. Population Abundance of Potentially Pathogenic Organisms in Intestinal Microbiome of Jungle Crow (Corvus macrorhynchos Shown with 16S rRNA Gene-Based Microbial Community Analysis

    Directory of Open Access Journals (Sweden)

    Isamu Maeda

    2013-01-01

    Full Text Available Jungle Crows (Corvus macrorhynchos prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms.

  17. Assessment of microbial infection risks posed by ingestion of water during domestic water use and full-contact recreation in a mid-southern African region

    CSIR Research Space (South Africa)

    Steyn, M

    2004-01-01

    Full Text Available -adverse-effect-level approach (OAELA) and a quantitative microbial risk assessment (QMRA). The OAELA was based on the occurrence of E coli in the study waters to determine the possible risk of infection and the QMRA probable risk of infection by salmonellae. The WRQMRA...

  18. Pharmacodynamics of nitrofurantoin at different pH levels against pathogens involved in urinary tract infections

    NARCIS (Netherlands)

    Fransen, F.; Melchers, M.J.B.; Lagarde, C.M.C.; Meletiadis, J.; Mouton, J.W.

    2017-01-01

    Background: Urinary tract infections are among the most common human infections. Due to the progressive increase in ESBL-producing bacteria and the unavailability of new antibiotics, re-evaluation of 'old' antibiotics is needed. However, the pharmacodynamics of nitrofurantoin under variable pH

  19. Inter-chromosomal transfer of immune regulation during infection of barley with the powdery mildew pathogen

    Science.gov (United States)

    Powdery mildews infect over 9,500 plant species, causing critical yield loss. Powdery mildew disease of barley is caused by the Ascomycete fungus, Blumeria graminis f. sp. hordei (Bgh) and has become a model for the interactions among obligate biotrophs and their cereal hosts. Successful infection r...

  20. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  1. Pathogen burden, co-infection and major histocompatibility complex variability in the European badger (Meles meles)

    NARCIS (Netherlands)

    Sin, Yung Wa; Annavi, Geetha; Dugdale, Hannah L.; Newman, Chris; Burke, Terry; MacDonald, David W.

    2014-01-01

    Pathogen-mediated selection is thought to maintain the extreme diversity in the major histocompatibility complex (MHC) genes, operating through the heterozygote advantage, rare-allele advantage and fluctuating selection mechanisms. Heterozygote advantage (i.e. recognizing and binding a wider range

  2. A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus.

    Science.gov (United States)

    Coleman, Stewart; Choi, K Yeon; Root, Matthew; McGregor, Alistair

    2016-07-01

    In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107-179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model.

  3. Pathogenesis of highly pathogenic avian influenza A virus (H7N1) infection in chickens inoculated with three different doses.

    Science.gov (United States)

    Chaves, Aida J; Busquets, Nuria; Campos, Naiana; Ramis, Antonio; Dolz, Roser; Rivas, Raquel; Valle, Rosa; Abad, F Xavier; Darji, Ayub; Majo, Natalia

    2011-04-01

    To study the pathogenesis of a H7N1 highly pathogenic avian influenza virus strain, specific pathogen free chickens were inoculated with decreasing concentrations of virus: 10(5.5) median embryo lethal dose (ELD(50)) (G1), 10(3.5) ELD(50) (G2) and 10(1.5) ELD(50) (G3). Disease progression was monitored over a period of 16 days and sequential necropsies and tissue samples were collected for histological and immunohistochemical examination. Viral RNA loads were also quantified in different tissues, blood, oropharyngeal swabs, and cloacal swabs using quantitative real-time reverse transcriptase-polymerase chain reaction (RT-qPCR). Clinical signs of depression, apathy, listlessness, huddling and ruffled feathers were recorded in G1 and a few G2 birds, whilst neurological signs were only observed in chickens inoculated with the highest dose. Gross lesions of haemorrhages were observed in the unfeathered skin of the comb and legs, and skeletal muscle, lung, pancreas and kidneys of birds inoculated with 10(5.5) ELD(50) and 10(3.5) ELD(50) doses. Microscopic lesions and viral antigen were demonstrated in cells of the nasal cavity, lung, heart, skeletal muscle, brain, spinal cord, gastrointestinal tract, pancreas, liver, bone marrow, thymus, bursa of Fabricius, spleen, kidney, adrenal gland and skin. Viral RNA was detected by RT-qPCR in kidney, lung, intestine, and brain samples of G1 and G2 birds. However, in birds infected with the lowest dose, viral RNA was detected only in brain and lung samples in low amounts at 5 and 7 days post infection. Interestingly, viral shedding was observed in oropharyngeal and cloacal swabs with proportionate decrease with the inoculation dose. We conclude that although an adequate infectious dose is critical in reproducing the clinical infection, chickens exposed to lower doses can be infected and shed virus representing a risk for the dissemination of the viral agent.

  4. Immunity to plant pathogens and iron homeostasis.

    Science.gov (United States)

    Aznar, Aude; Chen, Nicolas W G; Thomine, Sebastien; Dellagi, Alia

    2015-11-01

    Iron is essential for metabolic processes in most living organisms. Pathogens and their hosts often compete for the acquisition of this nutrient. However, iron can catalyze the formation of deleterious reactive oxygen species. Hosts may use iron to increase local oxidative stress in defense responses against pathogens. Due to this duality, iron plays a complex role in plant-pathogen interactions. Plant defenses against pathogens and plant response to iron deficiency share several features, such as secretion of phenolic compounds, and use common hormone signaling pathways. Moreover, fine tuning of iron localization during infection involves genes coding iron transport and iron storage proteins, which have been shown to contribute to immunity. The influence of the plant iron status on the outcome of a given pathogen attack is strongly dependent on the nature of the pathogen infection strategy and on the host species. Microbial siderophores emerged as important factors as they have the ability to trigger plant defense responses. Depending on the plant species, siderophore perception can be mediated by their strong iron scavenging capacity or possibly via specific recognition as pathogen associated molecular patterns. This review highlights that iron has a key role in several plant-pathogen interactions by modulating immunity. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Synovial fluid multiplex PCR is superior to culture for detection of low-virulent pathogens causing periprosthetic joint infection.

    Science.gov (United States)

    Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora

    2018-02-01

    Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. No Observed Effect of Landscape Fragmentation on Pathogen Infection Prevalence in Blacklegged Ticks (Ixodes scapularis in the Northeastern United States.

    Directory of Open Access Journals (Sweden)

    Christine P Zolnik

    Full Text Available Pathogen prevalence within blacklegged ticks (Ixodes scapularis Say, 1821 tends to vary across sites and geographic regions, but the underlying causes of this variation are not well understood. Efforts to understand the ecology of Lyme disease have led to the proposition that sites with higher host diversity will result in lower disease risk due to an increase in the abundance of inefficient reservoir species relative to the abundance of species that are highly competent reservoirs. Although the Lyme disease transmission cycle is often cited as a model for this "dilution effect hypothesis", little empirical evidence exists to support that claim. Here we tested the dilution effect hypothesis for two pathogens transmitted by the blacklegged tick along an urban-to-rural gradient in the northeastern United States using landscape fragmentation as a proxy for host biodiversity. Percent impervious surface and habitat fragment size around each site were determined to assess the effect of landscape fragmentation on nymphal blacklegged tick infection with Borrelia burgdorferi and Anaplasma phagocytophilum. Our results do not support the dilution effect hypothesis for either pathogen and are in agreement with the few studies to date that have tested this idea using either a landscape proxy or direct measures of host biodiversity.

  7. Comparative study of CXC chemokines modulation in brown trout (Salmo trutta) following infection with a bacterial or viral pathogen.

    Science.gov (United States)

    Gorgoglione, Bartolomeo; Zahran, Eman; Taylor, Nick G H; Feist, Stephen W; Zou, Jun; Secombes, Christopher J

    2016-03-01

    Chemokine modulation in response to pathogens still needs to be fully characterised in fish, in view of the recently described novel chemokines present. This paper reports the first comparative study of CXC chemokine genes transcription in salmonids (brown trout), with a particular focus on the fish specific CXC chemokines (CXCL_F). Adopting new primer sets, optimised to specifically target mRNA, a RT-qPCR gene screening was carried out. Constitutive gene expression was assessed first in six tissues from SPF brown trout. Transcription modulation was next investigated in kidney and spleen during septicaemic infection induced by a RNA virus (Viral Haemorrhagic Septicaemia virus, genotype Ia) or by a Gram negative bacterium (Yersinia ruckeri, ser. O1/biot. 2). From each target organ specific pathogen burden, measured detecting VHSV-glycoprotein or Y. ruckeri 16S rRNA, and IFN-γ gene expression were analysed for their correlation to chemokine transcription. Both pathogens modulated CXC chemokine gene transcript levels, with marked up-regulation seen in some cases, and with both temporal and tissue specific effects apparent. For example, Y. ruckeri strongly induced chemokine transcription in spleen within 24h, whilst VHS generally induced the largest increases at 3d.p.i. in both tissues. This study gives clues to the role of the novel CXC chemokines, in comparison to the other known CXC chemokines in salmonids. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Corneal Opacity in Domestic Ducks Experimentally Infected With H5N1 Highly Pathogenic Avian Influenza Virus.

    Science.gov (United States)

    Yamamoto, Y; Nakamura, K; Yamada, M; Mase, M

    2016-01-01

    Domestic ducks can be a key factor in the regional spread of H5N1 highly pathogenic avian influenza (HPAI) virus in Asia. The authors performed experimental infections to examine the relationship between corneal opacity and H5N1 HPAI virus infection in domestic ducks (Anas platyrhyncha var domestica). A total of 99 domestic ducks, including 3 control birds, were used in the study. In experiment 1, when domestic ducks were inoculated intranasally with 2 H5N1 HPAI viruses, corneal opacity appeared more frequently than neurologic signs and mortality. Corneal ulceration and exophthalmos were rare findings. Histopathologic examinations of the eyes of domestic ducks in experiment 2 revealed that corneal opacity was due to the loss of corneal endothelial cells and subsequent keratitis with edema. Influenza viral antigen was detected in corneal endothelial cells and some other ocular cells by immunohistochemistry. Results suggest that corneal opacity is a characteristic and frequent finding in domestic ducks infected with the H5N1 HPAI virus. Confirming this ocular change may improve the detection rate of infected domestic ducks in the field. © The Author(s) 2015.

  9. The co-transcriptome of uropathogenic Escherichia coli-infected mouse macrophages reveals new insights into host-pathogen interactions

    KAUST Repository

    Mavromatis, Charalampos Harris; Bokil, Nilesh J.; Totsika, Makrina; Kakkanat, Asha; Schaale, Kolja; Cannistraci, Carlo V.; Ryu, Tae Woo; Beatson, Scott A.; Ulett, Glen C.; Schembri, Mark A.; Sweet, Matthew J.; Ravasi, Timothy

    2015-01-01

    Urinary tract infections (UTI) are among the most common infections in humans. Uropathogenic Escherichia coli (UPEC) can invade and replicate within bladder epithelial cells, and some UPEC strains can also survive within macrophages. To understand the UPEC transcriptional programme associated with intramacrophage survival, we performed host–pathogen co-transcriptome analyses using RNA sequencing. Mouse bone marrow-derived macrophages (BMMs) were challenged over a 24 h time course with two UPEC reference strains that possess contrasting intramacrophage phenotypes: UTI89, which survives in BMMs, and 83972, which is killed by BMMs. Neither of these strains caused significant BMM cell death at the low multiplicity of infection that was used in this study. We developed an effective computational framework that simultaneously separated, annotated and quantified the mammalian and bacterial transcriptomes. Bone marrow-derived macrophages responded to the two UPEC strains with a broadly similar gene expression programme. In contrast, the transcriptional responses of the UPEC strains diverged markedly from each other. We identified UTI89 genes up-regulated at 24 h post-infection, and hypothesized that some may contribute to intramacrophage survival. Indeed, we showed that deletion of one such gene (pspA) significantly reduced UTI89 survival within BMMs. Our study provides a technological framework for simultaneously capturing global changes at the transcriptional level in co-cultures, and has generated new insights into the mechanisms that UPEC use to persist within the intramacrophage environment.

  10. The co-transcriptome of uropathogenic Escherichia coli-infected mouse macrophages reveals new insights into host-pathogen interactions

    KAUST Repository

    Mavromatis, Charalampos Harris

    2015-01-24

    Urinary tract infections (UTI) are among the most common infections in humans. Uropathogenic Escherichia coli (UPEC) can invade and replicate within bladder epithelial cells, and some UPEC strains can also survive within macrophages. To understand the UPEC transcriptional programme associated with intramacrophage survival, we performed host–pathogen co-transcriptome analyses using RNA sequencing. Mouse bone marrow-derived macrophages (BMMs) were challenged over a 24 h time course with two UPEC reference strains that possess contrasting intramacrophage phenotypes: UTI89, which survives in BMMs, and 83972, which is killed by BMMs. Neither of these strains caused significant BMM cell death at the low multiplicity of infection that was used in this study. We developed an effective computational framework that simultaneously separated, annotated and quantified the mammalian and bacterial transcriptomes. Bone marrow-derived macrophages responded to the two UPEC strains with a broadly similar gene expression programme. In contrast, the transcriptional responses of the UPEC strains diverged markedly from each other. We identified UTI89 genes up-regulated at 24 h post-infection, and hypothesized that some may contribute to intramacrophage survival. Indeed, we showed that deletion of one such gene (pspA) significantly reduced UTI89 survival within BMMs. Our study provides a technological framework for simultaneously capturing global changes at the transcriptional level in co-cultures, and has generated new insights into the mechanisms that UPEC use to persist within the intramacrophage environment.

  11. Genome-wide analysis of gene expression and protein secretion of Babesia canis during virulent infection identifies potential pathogenicity factors.

    Science.gov (United States)

    Eichenberger, Ramon M; Ramakrishnan, Chandra; Russo, Giancarlo; Deplazes, Peter; Hehl, Adrian B

    2017-06-13

    Infections of dogs with virulent strains of Babesia canis are characterized by rapid onset and high mortality, comparable to complicated human malaria. As in other apicomplexan parasites, most Babesia virulence factors responsible for survival and pathogenicity are secreted to the host cell surface and beyond where they remodel and biochemically modify the infected cell interacting with host proteins in a very specific manner. Here, we investigated factors secreted by B. canis during acute infections in dogs and report on in silico predictions and experimental analysis of the parasite's exportome. As a backdrop, we generated a fully annotated B. canis genome sequence of a virulent Hungarian field isolate (strain BcH-CHIPZ) underpinned by extensive genome-wide RNA-seq analysis. We find evidence for conserved factors in apicomplexan hemoparasites involved in immune-evasion (e.g. VESA-protein family), proteins secreted across the iRBC membrane into the host bloodstream (e.g. SA- and Bc28 protein families), potential moonlighting proteins (e.g. profilin and histones), and uncharacterized antigens present during acute crisis in dogs. The combined data provides a first predicted and partially validated set of potential virulence factors exported during fatal infections, which can be exploited for urgently needed innovative intervention strategies aimed at facilitating diagnosis and management of canine babesiosis.

  12. Alendronate augments interleukin-1β release from macrophages infected with periodontal pathogenic bacteria through activation of caspase-1

    International Nuclear Information System (INIS)

    Deng Xue; Tamai, Riyoko; Endo, Yasuo; Kiyoura, Yusuke

    2009-01-01

    Nitrogen-containing bisphosphonates (NBPs) are anti-bone-resorptive drugs with inflammatory side effects that include osteomyelitis and osteonecrosis of the jaw. Oral bacteria have been considered to be a trigger for these NBP-associated jaw bone diseases. The present study examined the effects of alendronate (a typical NBP) and clodronate (a non-NBP) on the production of proinflammatory cytokines by macrophages infected with Porphyromonas gingivalis and Tannerella forsythia, which are important pathogens of periodontal diseases. Pretreatment with alendronate augmented IL-1β, but not TNFα, production by macrophages infected with P. gingivalis or T. forsythia. This augmentation of IL-1β production was inhibited by clodronate. Furthermore, caspase-1, a promoter of IL-1β production, was activated by treatment with alendronate, and caspase-1 inhibitor reduced the production of IL-1β induced by alendronate and P. gingivalis. These results suggest that NBPs augment periodontal pathogenic bacteria-induced IL-1β release via caspase-1 activation, and this phenomenon may contribute to the development of NBP-associated inflammatory side effects including jaw osteomyelitis. Co-treatment with clodronate may prevent and/or reduce these inflammatory effects induced by NBPs

  13. Alendronate augments interleukin-1{beta} release from macrophages infected with periodontal pathogenic bacteria through activation of caspase-1

    Energy Technology Data Exchange (ETDEWEB)

    Xue, Deng; Tamai, Riyoko [Division of Oral Bacteriology, Department of Oral Medical Science, Ohu University School of Dentistry, 31-1 Misumido, Tomitamachi, Koriyama, Fukushima 963-8611 (Japan); Endo, Yasuo [Department of Molecular Regulation, Graduate School of Dentistry, Tohoku University, 4-1 Seiryo-machi, Aoba-ku, Sendai 980-8575 (Japan); Kiyoura, Yusuke [Division of Oral Bacteriology, Department of Oral Medical Science, Ohu University School of Dentistry, 31-1 Misumido, Tomitamachi, Koriyama, Fukushima 963-8611 (Japan)

    2009-02-15

    Nitrogen-containing bisphosphonates (NBPs) are anti-bone-resorptive drugs with inflammatory side effects that include osteomyelitis and osteonecrosis of the jaw. Oral bacteria have been considered to be a trigger for these NBP-associated jaw bone diseases. The present study examined the effects of alendronate (a typical NBP) and clodronate (a non-NBP) on the production of proinflammatory cytokines by macrophages infected with Porphyromonas gingivalis and Tannerella forsythia, which are important pathogens of periodontal diseases. Pretreatment with alendronate augmented IL-1{bet