Electron Source Brightness and Illumination Semi-Angle Distribution Measurement in a Transmission Electron Microscope.

Science.gov (United States)

Börrnert, Felix; Renner, Julian; Kaiser, Ute

2018-05-21

The electron source brightness is an important parameter in an electron microscope. Reliable and easy brightness measurement routes are not easily found. A determination method for the illumination semi-angle distribution in transmission electron microscopy is even less well documented. Herein, we report a simple measurement route for both entities and demonstrate it on a state-of-the-art instrument. The reduced axial brightness of the FEI X-FEG with a monochromator was determined to be larger than 108 A/(m2 sr V).

Method and apparatus for a high-resolution three dimensional confocal scanning transmission electron microscope

Science.gov (United States)

de Jonge, Niels [Oak Ridge, TN

2010-08-17

A confocal scanning transmission electron microscope which includes an electron illumination device providing an incident electron beam propagating in a direction defining a propagation axis, and a precision specimen scanning stage positioned along the propagation axis and movable in at least one direction transverse to the propagation axis. The precision specimen scanning stage is configured for positioning a specimen relative to the incident electron beam. A projector lens receives a transmitted electron beam transmitted through at least part of the specimen and focuses this transmitted beam onto an image plane, where the transmitted beam results from the specimen being illuminated by the incident electron beam. A detection system is placed approximately in the image plane.

Direct observations of the MOF (UiO-66) structure by transmission electron microscopy

KAUST Repository

Zhu, Liangkui; Zhang, Daliang; Xue, Ming; Li, Huan; Qiu, Shilun

2013-01-01

As a demonstration of ab initio structure characterizations of nano metal organic framework (MOF) crystals by high resolution transmission electron microscopy (HRTEM) and electron diffraction tomography methods, a Zr-MOF (UiO-66) structure

Transmission of electrons through Al2O3 nanocapillaries

DEFF Research Database (Denmark)

Milosavljević, A.R.; Jureta, J.J.; Víkor, Gy.

2012-01-01

We investigate transmission of low-energy electrons (250 eV) through insulating AlO nanocapillaries (270 nm diameter and 15 μm length). Kinetic energy distribution of electrons transmitted through the nanocapillaries in the straightforward direction, time dependence of the transmission rate both...

Electron beam dynamics in an ultrafast transmission electron microscope with Wehnelt electrode.

Science.gov (United States)

Bücker, K; Picher, M; Crégut, O; LaGrange, T; Reed, B W; Park, S T; Masiel, D J; Banhart, F

2016-12-01

High temporal resolution transmission electron microscopy techniques have shown significant progress in recent years. Using photoelectron pulses induced by ultrashort laser pulses on the cathode, these methods can probe ultrafast materials processes and have revealed numerous dynamic phenomena at the nanoscale. Most recently, the technique has been implemented in standard thermionic electron microscopes that provide a flexible platform for studying material's dynamics over a wide range of spatial and temporal scales. In this study, the electron pulses in such an ultrafast transmission electron microscope are characterized in detail. The microscope is based on a thermionic gun with a Wehnelt electrode and is operated in a stroboscopic photoelectron mode. It is shown that the Wehnelt bias has a decisive influence on the temporal and energy spread of the picosecond electron pulses. Depending on the shape of the cathode and the cathode-Wehnelt distance, different emission patterns with different pulse parameters are obtained. The energy spread of the pulses is determined by space charge and Boersch effects, given by the number of electrons in a pulse. However, filtering effects due to the chromatic aberrations of the Wehnelt electrode allow the extraction of pulses with narrow energy spreads. The temporal spread is governed by electron trajectories of different length and in different electrostatic potentials. High temporal resolution is obtained by excluding shank emission from the cathode and aberration-induced halos in the emission pattern. By varying the cathode-Wehnelt gap, the Wehnelt bias, and the number of photoelectrons in a pulse, tradeoffs between energy and temporal resolution as well as beam intensity can be made as needed for experiments. Based on the characterization of the electron pulses, the optimal conditions for the operation of ultrafast TEMs with thermionic gun assembly are elaborated. Copyright © 2016 Elsevier B.V. All rights reserved.

Quantitative transmission electron microscopy at atomic resolution

International Nuclear Information System (INIS)

Allen, L J; D'Alfonso, A J; Forbes, B D; Findlay, S D; LeBeau, J M; Stemmer, S

2012-01-01

In scanning transmission electron microscopy (STEM) it is possible to operate the microscope in bright-field mode under conditions which, by the quantum mechanical principle of reciprocity, are equivalent to those in conventional transmission electron microscopy (CTEM). The results of such an experiment will be presented which are in excellent quantitative agreement with theory for specimens up to 25 nm thick. This is at variance with the large contrast mismatch (typically between two and five) noted in equivalent CTEM experiments. The implications of this will be discussed.

Elemental mapping in scanning transmission electron microscopy

International Nuclear Information System (INIS)

Allen, L J; D'Alfonso, A J; Lugg, N R; Findlay, S D; LeBeau, J M; Stemmer, S

2010-01-01

We discuss atomic resolution chemical mapping in scanning transmission electron microscopy (STEM) based on core-loss electron energy loss spectroscopy (EELS) and also on energy dispersive X-ray (EDX) imaging. Chemical mapping using EELS can yield counterintuitive results which, however, can be understood using first principles calculations. Experimental chemical maps based on EDX bear out the thesis that such maps are always likely to be directly interpretable. This can be explained in terms of the local nature of the effective optical potential for ionization under those imaging conditions. This is followed by an excursion into the complementary technique of elemental mapping using energy-filtered transmission electron microscopy (EFTEM) in a conventional transmission electron microscope. We will then consider the widely used technique of Z-contrast or high-angle annular dark field (HAADF) imaging, which is based on phonon excitation, where it has recently been shown that intensity variations can be placed on an absolute scale by normalizing the measured intensities to the incident beam. Results, showing excellent agreement between theory and experiment to within a few percent, are shown for Z-contrast imaging from a sample of PbWO 4 .

Transmission Electron Microscopy of Minerals and Rocks

Science.gov (United States)

McLaren, Alex C.

1991-04-01

Of the many techniques that have been applied to the study of crystal defects, none has contributed more to our understanding of their nature and influence on the physical and chemical properties of crystalline materials than transmission electron microscopy (TEM). TEM is now used extensively by an increasing number of earth scientists for direct observation of defect microstructures in minerals and rocks. Transmission Electron Microscopy of Rocks and Minerals is an introduction to the principles of the technique and is the only book to date on the subject written specifically for geologists and mineralogists. The first part of the book deals with the essential physics of the transmission electron microscope and presents the basic theoretical background required for the interpretation of images and electron diffraction patterns. The final chapters are concerned with specific applications of TEM in mineralogy and deal with such topics as planar defects, intergrowths, radiation-induced defects, dislocations and deformation-induced microstructures. The examples cover a wide range of rock-forming minerals from crustal rocks to those in the lower mantle, and also take into account the role of defects in important mineralogical and geological processes.

Monochromated scanning transmission electron microscopy

International Nuclear Information System (INIS)

Rechberger, W.; Kothleitner, G.; Hofer, F.

2006-01-01

Full text: Electron energy-loss spectroscopy (EELS) has developed into an established technique for chemical and structural analysis of thin specimens in the (scanning) transmission electron microscope (S)TEM. The energy resolution in EELS is largely limited by the stability of the high voltage supply, by the resolution of the spectrometer and by the energy spread of the source. To overcome this limitation a Wien filter monochromator was recently introduced with commercially available STEMs, offering the advantage to better resolve EELS fine structures, which contain valuable bonding information. The method of atomic resolution Z-contrast imaging within an STEM, utilizing a high-angle annular dark-field (HAADF) detector can perfectly complement the excellent energy resolution, since EELS spectra can be collected simultaneously. In combination with a monochromator microscope not only high spatial resolution images can be recorded but also high energy resolution EELS spectra are attainable. In this work we investigated the STEM performance of a 200 kV monochromated Tecnai F20 with a high resolution Gatan Imaging Filter (HR-GIF). (author)

Transmission electron microscopy physics of image formation and microanalysis

CERN Document Server

Reimer, Ludwig

1984-01-01

The aim of this book is to outline the physics of image formation, electron­ specimen interactions and image interpretation in transmission electron mic­ roscopy. The book evolved from lectures delivered at the University of Munster and is a revised version of the first part of my earlier book Elek­ tronenmikroskopische Untersuchungs- und Priiparationsmethoden, omitting the part which describes specimen-preparation methods. In the introductory chapter, the different types of electron microscope are compared, the various electron-specimen interactions and their applications are summarized and the most important aspects of high-resolution, analytical and high-voltage electron microscopy are discussed. The optics of electron lenses is discussed in Chapter 2 in order to bring out electron-lens properties that are important for an understanding of the function of an electron microscope. In Chapter 3, the wave optics of elec­ trons and the phase shifts by electrostatic and magnetic fields are introduced; Fresne...

Transmission Electron Microscope Measures Lattice Parameters

Science.gov (United States)

Pike, William T.

1996-01-01

Convergent-beam microdiffraction (CBM) in thermionic-emission transmission electron microscope (TEM) is technique for measuring lattice parameters of nanometer-sized specimens of crystalline materials. Lattice parameters determined by use of CBM accurate to within few parts in thousand. Technique developed especially for use in quantifying lattice parameters, and thus strains, in epitaxial mismatched-crystal-lattice multilayer structures in multiple-quantum-well and other advanced semiconductor electronic devices. Ability to determine strains in indivdual layers contributes to understanding of novel electronic behaviors of devices.

Reconstruction and visualization of nanoparticle composites by transmission electron tomography

Energy Technology Data Exchange (ETDEWEB)

Wang, X.Y. [National Institute for Nanotechnology, 11421 Saskatchewan Drive, Edmonton, Canada T6H 2M9 (Canada); Department of Physics, University of Alberta, Edmonton, Canada T6G 2G7 (Canada); Lockwood, R. [National Institute for Nanotechnology, 11421 Saskatchewan Drive, Edmonton, Canada T6H 2M9 (Canada); Malac, M., E-mail: marek.malac@nrc-cnrc.gc.ca [National Institute for Nanotechnology, 11421 Saskatchewan Drive, Edmonton, Canada T6H 2M9 (Canada); Department of Physics, University of Alberta, Edmonton, Canada T6G 2G7 (Canada); Furukawa, H. [SYSTEM IN FRONTIER INC., 2-8-3, Shinsuzuharu bldg. 4F, Akebono-cho, Tachikawa-shi, Tokyo 190-0012 (Japan); Li, P.; Meldrum, A. [National Institute for Nanotechnology, 11421 Saskatchewan Drive, Edmonton, Canada T6H 2M9 (Canada)

2012-02-15

This paper examines the limits of transmission electron tomography reconstruction methods for a nanocomposite object composed of many closely packed nanoparticles. Two commonly used reconstruction methods in TEM tomography were examined and compared, and the sources of various artefacts were explored. Common visualization methods were investigated, and the resulting 'interpretation artefacts' ( i.e., deviations from 'actual' particle sizes and shapes arising from the visualization) were determined. Setting a known or estimated nanoparticle volume fraction as a criterion for thresholding does not in fact give a good visualization. Unexpected effects associated with common built-in image filtering methods were also found. Ultimately, this work set out to establish the common problems and pitfalls associated with electron beam tomographic reconstruction and visualization of samples consisting of closely spaced nanoparticles. -- Highlights: Black-Right-Pointing-Pointer Electron tomography limits were explored by both experiment and simulation. Black-Right-Pointing-Pointer Reliable quantitative volumetry using electron tomography is not presently feasible. Black-Right-Pointing-Pointer Volume rendering appears to be better choice for visualization of composite samples.

Secondary Electron Emission Materials for Transmission Dynodes in Novel Photomultipliers: A Review

Directory of Open Access Journals (Sweden)

Shu Xia Tao

2016-12-01

Full Text Available Secondary electron emission materials are reviewed with the aim of providing guidelines for the future development of novel transmission dynodes. Materials with reflection secondary electron yield higher than three and transmission secondary electron yield higher than one are tabulated for easy reference. Generations of transmission dynodes are listed in the order of the invention time with a special focus on the most recent atomic-layer-deposition synthesized transmission dynodes. Based on the knowledge gained from the survey of secondary election emission materials with high secondary electron yield, an outlook of possible improvements upon the state-of-the-art transmission dynodes is provided.

Sample Preparation and Imaging of Exosomes by Transmission Electron Microscopy.

Science.gov (United States)

Jung, Min Kyo; Mun, Ji Young

2018-01-04

Exosomes are nano-sized extracellular vesicles secreted by body fluids and are known to represent the characteristics of cells that secrete them. The contents and morphology of the secreted vesicles reflect cell behavior or physiological status, for example cell growth, migration, cleavage, and death. The exosomes' role may depend highly on size, and the size of exosomes varies from 30 to 300 nm. The most widely used method for exosome imaging is negative staining, while other results are based on Cryo-Transmission Electron Microscopy, Scanning Electron Microscopy, and Atomic Force Microscopy. The typical exosome's morphology assessed through negative staining is a cup-shape, but further details are not yet clear. An exosome well-characterized through structural study is necessary particular in medical and pharmaceutical fields. Therefore, function-dependent morphology should be verified by electron microscopy techniques such as labeling a specific protein in the detailed structure of exosome. To observe detailed structure, ultrathin sectioned images and negative stained images of exosomes were compared. In this protocol, we suggest transmission electron microscopy for the imaging of exosomes including negative staining, whole mount immuno-staining, block preparation, thin section, and immuno-gold labelling.

Electron beam dynamics in an ultrafast transmission electron microscope with Wehnelt electrode

Energy Technology Data Exchange (ETDEWEB)

Bücker, K.; Picher, M.; Crégut, O. [Institut de Physique et Chimie des Matériaux de Strasbourg, UMR 7504 CNRS, Université de Strasbourg, 23 rue du Loess, 67034 Strasbourg (France); LaGrange, T. [Interdisciplinary Centre for Electron Microscopy, École Polytechnique Fédérale de Lausanne, 1015 Lausanne (Switzerland); Reed, B.W.; Park, S.T.; Masiel, D.J. [Integrated Dynamic Electron Solutions, Inc., 5653 Stoneridge Drive 117, Pleasanton, CA 94588 (United States); Banhart, F., E-mail: florian.banhart@ipcms.unistra.fr [Institut de Physique et Chimie des Matériaux de Strasbourg, UMR 7504 CNRS, Université de Strasbourg, 23 rue du Loess, 67034 Strasbourg (France)

2016-12-15

High temporal resolution transmission electron microscopy techniques have shown significant progress in recent years. Using photoelectron pulses induced by ultrashort laser pulses on the cathode, these methods can probe ultrafast materials processes and have revealed numerous dynamic phenomena at the nanoscale. Most recently, the technique has been implemented in standard thermionic electron microscopes that provide a flexible platform for studying material's dynamics over a wide range of spatial and temporal scales. In this study, the electron pulses in such an ultrafast transmission electron microscope are characterized in detail. The microscope is based on a thermionic gun with a Wehnelt electrode and is operated in a stroboscopic photoelectron mode. It is shown that the Wehnelt bias has a decisive influence on the temporal and energy spread of the picosecond electron pulses. Depending on the shape of the cathode and the cathode-Wehnelt distance, different emission patterns with different pulse parameters are obtained. The energy spread of the pulses is determined by space charge and Boersch effects, given by the number of electrons in a pulse. However, filtering effects due to the chromatic aberrations of the Wehnelt electrode allow the extraction of pulses with narrow energy spreads. The temporal spread is governed by electron trajectories of different length and in different electrostatic potentials. High temporal resolution is obtained by excluding shank emission from the cathode and aberration-induced halos in the emission pattern. By varying the cathode-Wehnelt gap, the Wehnelt bias, and the number of photoelectrons in a pulse, tradeoffs between energy and temporal resolution as well as beam intensity can be made as needed for experiments. Based on the characterization of the electron pulses, the optimal conditions for the operation of ultrafast TEMs with thermionic gun assembly are elaborated. - Highlights: • A detailed characterization of electron

Advantages of a monochromated transmission electron microscope for solid state physics

International Nuclear Information System (INIS)

Grogger, W.; Kothleitner, G.; Hofer, F.

2006-01-01

Full text: The characterization of nanostructured devices and functional materials at a nanometer scale is paramount for the understanding of their physical and chemical properties. Transmission electron microscopy (TEM) plays a central role, especially in terms of structural and chemical analysis on a nearly atomic scale. In particular, electron energy-loss spectrometry (EELS) can obtain information not only about the chemical composition of a thin sample, but also about chemical bonding and electronic structure (ionization edge fine structures) and optical properties (through valence loss EELS). Recent instrumental advances like monochromators for the electron gun in the TEM have made it possible to reduce the energy resolution to 0.15 eV at an acceleration voltage of 200 kV. Another strong point of the method lies in the combination with a fine electron probe (0.2 nm) which allows to record EELS spectra with high energy resolution and spatial resolution in the range of 1 nm. The improved energy resolution opens new possibilities for studying detailed electronic structure and bonding effects in solids such as transmission metal oxides. The experimental results will be compared with x-ray absorption spectroscopy and band structure calculations. A better energy-resolution is particularly important for measurements in the low loss region of the EELS spectrum which provides the information about the band gap and the dielectric function. We will highlight the potential of the method for studying metallic nanoparticles and semiconducting devices. Additionally, the influence of the intrinsic effects like core-hole and excited lifetime broadening and delocalization of the inelastically scattered electrons will be discussed. (author)

Transmission environmental scanning electron microscope with scintillation gaseous detection device

International Nuclear Information System (INIS)

Danilatos, Gerasimos; Kollia, Mary; Dracopoulos, Vassileios

2015-01-01

A transmission environmental scanning electron microscope with use of a scintillation gaseous detection device has been implemented. This corresponds to a transmission scanning electron microscope but with addition of a gaseous environment acting both as environmental and detection medium. A commercial type of low vacuum machine has been employed together with appropriate modifications to the detection configuration. This involves controlled screening of various emitted signals in conjunction with a scintillation gaseous detection device already provided with the machine for regular surface imaging. Dark field and bright field imaging has been obtained along with other detection conditions. With a progressive series of modifications and tests, the theory and practice of a novel type of microscopy is briefly shown now ushering further significant improvements and developments in electron microscopy as a whole. - Highlights: • Novel scanning transmission electron microscopy (STEM) with an environmental scanning electron microscope (ESEM) called TESEM. • Use of the gaseous detection device (GDD) in scintillation mode that allows high resolution bright and dark field imaging in the TESEM. • Novel approach towards a unification of both vacuum and environmental conditions in both bulk/surface and transmission mode of electron microscopy

Nanoscale Energy-Filtered Scanning Confocal Electron Microscopy Using a Double-Aberration-Corrected Transmission Electron Microscope

International Nuclear Information System (INIS)

Wang Peng; Behan, Gavin; Kirkland, Angus I.; Nellist, Peter D.; Takeguchi, Masaki; Hashimoto, Ayako; Mitsuishi, Kazutaka; Shimojo, Masayuki

2010-01-01

We demonstrate that a transmission electron microscope fitted with two spherical-aberration correctors can be operated as an energy-filtered scanning confocal electron microscope. A method for establishing this mode is described and initial results showing 3D chemical mapping with nanoscale sensitivity to height and thickness changes in a carbon film are presented. Importantly, uncorrected chromatic aberration does not limit the depth resolution of this technique and moreover performs an energy-filtering role, which is explained in terms of a combined depth and energy-loss response function.

Accurate virus quantitation using a Scanning Transmission Electron Microscopy (STEM) detector in a scanning electron microscope.

Science.gov (United States)

Blancett, Candace D; Fetterer, David P; Koistinen, Keith A; Morazzani, Elaine M; Monninger, Mitchell K; Piper, Ashley E; Kuehl, Kathleen A; Kearney, Brian J; Norris, Sarah L; Rossi, Cynthia A; Glass, Pamela J; Sun, Mei G

2017-10-01

A method for accurate quantitation of virus particles has long been sought, but a perfect method still eludes the scientific community. Electron Microscopy (EM) quantitation is a valuable technique because it provides direct morphology information and counts of all viral particles, whether or not they are infectious. In the past, EM negative stain quantitation methods have been cited as inaccurate, non-reproducible, and with detection limits that were too high to be useful. To improve accuracy and reproducibility, we have developed a method termed Scanning Transmission Electron Microscopy - Virus Quantitation (STEM-VQ), which simplifies sample preparation and uses a high throughput STEM detector in a Scanning Electron Microscope (SEM) coupled with commercially available software. In this paper, we demonstrate STEM-VQ with an alphavirus stock preparation to present the method's accuracy and reproducibility, including a comparison of STEM-VQ to viral plaque assay and the ViroCyt Virus Counter. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

New developments in transmission electron microscopy for nanotechnology

International Nuclear Information System (INIS)

Wang, Z.L.

2003-01-01

High-resolution transmission electron microscopy (HRTEM) is one of the most powerful tools used for characterizing nanomaterials, and it is indispensable for nanotechnology. This paper reviews some of the most recent developments in electron microscopy techniques for characterizing nanomaterials. The review covers the following areas: in-situ microscopy for studying dynamic shape transformation of nanocrystals; in-situ nanoscale property measurements on the mechanical, electrical and field emission properties of nanotubes/nanowires; environmental microscopy for direct observation of surface reactions; aberration-free angstrom-resolution imaging of light elements (such as oxygen and lithium); high-angle annular-dark-field scanning transmission electron microscopy (STEM); imaging of atom clusters with atomic resolution chemical information; electron holography of magnetic materials; and high-spatial resolution electron energy-loss spectroscopy (EELS) for nanoscale electronic and chemical analysis. It is demonstrated that the picometer-scale science provided by HRTEM is the foundation of nanometer-scale technology. (Abstract Copyright [2003], Wiley Periodicals, Inc.)

On the Progress of Scanning Transmission Electron Microscopy (STEM) Imaging in a Scanning Electron Microscope.

Science.gov (United States)

Sun, Cheng; Müller, Erich; Meffert, Matthias; Gerthsen, Dagmar

2018-04-01

Transmission electron microscopy (TEM) with low-energy electrons has been recognized as an important addition to the family of electron microscopies as it may avoid knock-on damage and increase the contrast of weakly scattering objects. Scanning electron microscopes (SEMs) are well suited for low-energy electron microscopy with maximum electron energies of 30 keV, but they are mainly used for topography imaging of bulk samples. Implementation of a scanning transmission electron microscopy (STEM) detector and a charge-coupled-device camera for the acquisition of on-axis transmission electron diffraction (TED) patterns, in combination with recent resolution improvements, make SEMs highly interesting for structure analysis of some electron-transparent specimens which are traditionally investigated by TEM. A new aspect is correlative SEM, STEM, and TED imaging from the same specimen region in a SEM which leads to a wealth of information. Simultaneous image acquisition gives information on surface topography, inner structure including crystal defects and qualitative material contrast. Lattice-fringe resolution is obtained in bright-field STEM imaging. The benefits of correlative SEM/STEM/TED imaging in a SEM are exemplified by structure analyses from representative sample classes such as nanoparticulates and bulk materials.

Angularly-selective transmission imaging in a scanning electron microscope.

Science.gov (United States)

Holm, Jason; Keller, Robert R

2016-08-01

This work presents recent advances in transmission scanning electron microscopy (t-SEM) imaging control capabilities. A modular aperture system and a cantilever-style sample holder that enable comprehensive angular selectivity of forward-scattered electrons are described. When combined with a commercially available solid-state transmission detector having only basic bright-field and dark-field imaging capabilities, the advances described here enable numerous transmission imaging modes. Several examples are provided that demonstrate how contrast arising from diffraction to mass-thickness can be obtained. Unanticipated image contrast at some imaging conditions is also observed and addressed. Published by Elsevier B.V.

Preparation of ZiO2 specimens for transmission electron microscopy

International Nuclear Information System (INIS)

Bressiani, A.H.A.

1987-01-01

The determination of average grain size, of the presence of monoclinic, tetragonal and cubic phases, as well as their relative distributions are necessary for the study of several partially stabilized zirconia properties. However, the phase distributions can be changed during the preparation of specimens for transmission electron microscopy, yielding misleading results. In this work suitable preparation method is reported. (Author) [pt

Three-Dimensional scanning transmission electron microscopy of biological specimens

KAUST Repository

De Jonge, Niels

2010-01-18

A three-dimensional (3D) reconstruction of the cytoskeleton and a clathrin-coated pit in mammalian cells has been achieved from a focal-series of images recorded in an aberration-corrected scanning transmission electron microscope (STEM). The specimen was a metallic replica of the biological structure comprising Pt nanoparticles 2-3 nm in diameter, with a high stability under electron beam radiation. The 3D dataset was processed by an automated deconvolution procedure. The lateral resolution was 1.1 nm, set by pixel size. Particles differing by only 10 nm in vertical position were identified as separate objects with greater than 20% dip in contrast between them. We refer to this value as the axial resolution of the deconvolution or reconstruction, the ability to recognize two objects, which were unresolved in the original dataset. The resolution of the reconstruction is comparable to that achieved by tilt-series transmission electron microscopy. However, the focal-series method does not require mechanical tilting and is therefore much faster. 3D STEM images were also recorded of the Golgi ribbon in conventional thin sections containing 3T3 cells with a comparable axial resolution in the deconvolved dataset. © 2010 Microscopy Society of America.

Direct observations of the MOF (UiO-66) structure by transmission electron microscopy

KAUST Repository

Zhu, Liangkui

2013-01-01

As a demonstration of ab initio structure characterizations of nano metal organic framework (MOF) crystals by high resolution transmission electron microscopy (HRTEM) and electron diffraction tomography methods, a Zr-MOF (UiO-66) structure was determined and further confirmed by Rietveld refinements of powder X-ray diffraction. HRTEM gave direct imaging of the channels. © 2013 The Royal Society of Chemistry.

Magnetic imaging with a Zernike-type phase plate in a transmission electron microscope

DEFF Research Database (Denmark)

Pollard, Shawn; Malac, Marek; Beleggia, Marco

2013-01-01

We demonstrate the use of a hole-free phase plate (HFPP) for magnetic imaging in transmission electron microscopy by mapping the domain structure in PrDyFeB samples. The HFPP, a Zernike-like imaging method, allows for detecting magnetic signals in-focus to correlate the sample crystal structure...... the reference wave distortion from long-range fields affecting electron holography....

A Simple Transmission Electron Microscopy Method for Fast Thickness Characterization of Suspended Graphene and Graphite Flakes.

Science.gov (United States)

Rubino, Stefano; Akhtar, Sultan; Leifer, Klaus

2016-02-01

We present a simple, fast method for thickness characterization of suspended graphene/graphite flakes that is based on transmission electron microscopy (TEM). We derive an analytical expression for the intensity of the transmitted electron beam I 0(t), as a function of the specimen thickness t (tgraphite). We show that in thin graphite crystals the transmitted intensity is a linear function of t. Furthermore, high-resolution (HR) TEM simulations are performed to obtain λ for a 001 zone axis orientation, in a two-beam case and in a low symmetry orientation. Subsequently, HR (used to determine t) and bright-field (to measure I 0(0) and I 0(t)) images were acquired to experimentally determine λ. The experimental value measured in low symmetry orientation matches the calculated value (i.e., λ=225±9 nm). The simulations also show that the linear approximation is valid up to a sample thickness of 3-4 nm regardless of the orientation and up to several ten nanometers for a low symmetry orientation. When compared with standard techniques for thickness determination of graphene/graphite, the method we propose has the advantage of being simple and fast, requiring only the acquisition of bright-field images.

Cryo-transmission electron microscopy of Ag nanoparticles grown on an ionic liquid substrate

KAUST Repository

Anjum, Dalaver H.; Stiger, Rebecca M.; Finley, James J.; Conway, James F.

2010-01-01

We report a novel method of growing silver nanostructures by cathodic sputtering onto an ionic liquid (IL) and our visualization by transmission cryo-electron microscopy to avoid beam-induced motion of the nanoparticles. By freezing the IL

Low-energy electron transmission through high aspect ratio Al O nanocapillaries

DEFF Research Database (Denmark)

Milosavljević, A.R.; Jureta, J.; Víkor, G.

2009-01-01

Electron transmission through insulating AlO nanocapillaries of different diameters (40 and 270 nm) and 15 μm length has been investigated for low-energy electrons (2-120 V). The total intensity of transmitted current weakly depends on the incident electron energy and tilt angle defined with resp......Electron transmission through insulating AlO nanocapillaries of different diameters (40 and 270 nm) and 15 μm length has been investigated for low-energy electrons (2-120 V). The total intensity of transmitted current weakly depends on the incident electron energy and tilt angle defined...

Analysis on electronic control unit of continuously variable transmission

Science.gov (United States)

Cao, Shuanggui

Continuously variable transmission system can ensure that the engine work along the line of best fuel economy, improve fuel economy, save fuel and reduce harmful gas emissions. At the same time, continuously variable transmission allows the vehicle speed is more smooth and improves the ride comfort. Although the CVT technology has made great development, but there are many shortcomings in the CVT. The CVT system of ordinary vehicles now is still low efficiency, poor starting performance, low transmission power, and is not ideal controlling, high cost and other issues. Therefore, many scholars began to study some new type of continuously variable transmission. The transmission system with electronic systems control can achieve automatic control of power transmission, give full play to the characteristics of the engine to achieve optimal control of powertrain, so the vehicle is always traveling around the best condition. Electronic control unit is composed of the core processor, input and output circuit module and other auxiliary circuit module. Input module collects and process many signals sent by sensor and , such as throttle angle, brake signals, engine speed signal, speed signal of input and output shaft of transmission, manual shift signals, mode selection signals, gear position signal and the speed ratio signal, so as to provide its corresponding processing for the controller core.

Effects of lattice fluctuations on electronic transmission in metal/conjugated-oligomer/metal structures

International Nuclear Information System (INIS)

Yu, Z.G.; Smith, D.L.; Saxena, A.; Bishop, A.R.

1997-01-01

The electronic transmission across metal/conjugated-oligomer/metal structures in the presence of lattice fluctuations is studied for short oligomer chains. The lattice fluctuations are approximated by static white noise disorder. Resonant transmission occurs when the energy of an incoming electron coincides with a discrete electronic level of the oligomer. The corresponding transmission peak diminishes in intensity with increasing disorder strength. Because of disorder there is an enhancement of the electronic transmission for energies that lie within the electronic gap of the oligomer. If fluctuations are sufficiently strong, a transmission peak within the gap is found at the midgap energy E=0 for degenerate conjugated oligomers (e.g., trans-polyacetylene) and E≠0 for AB-type degenerate oligomers. These results can be interpreted in terms of soliton-antisoliton states created by lattice fluctuations. copyright 1997 The American Physical Society

Simulations of the electron cloud buildup and its influence on the microwave transmission measurement

Energy Technology Data Exchange (ETDEWEB)

Haas, Oliver Sebastian, E-mail: o.haas@gsi.de [GSI Helmholtzzentrum für Schwerionenforschung GmbH, Planckstraße 1, 64291 Darmstadt (Germany); Boine-Frankenheim, Oliver [GSI Helmholtzzentrum für Schwerionenforschung GmbH, Planckstraße 1, 64291 Darmstadt (Germany); Technische Universität Darmstadt, Institut für Theorie Elektromagnetischer Felder, Schlossgartenstraße 8, 64289 Darmstadt (Germany); Petrov, Fedor [Technische Universität Darmstadt, Institut für Theorie Elektromagnetischer Felder, Schlossgartenstraße 8, 64289 Darmstadt (Germany)

2013-11-21

An electron cloud density in an accelerator can be measured using the Microwave Transmission (MWT) method. The aim of our study is to evaluate the influence of a realistic, nonuniform electron cloud on the MWT. We conduct electron cloud buildup simulations for beam pipe geometries and bunch parameters resembling roughly the conditions in the CERN SPS. For different microwave waveguide modes the phase shift induced by a known electron cloud density is obtained from three different approaches: 3D Particle-In-Cell (PIC) simulation of the electron response, a 2D eigenvalue solver for waveguide modes assuming a dielectric response function for cold electrons, a perturbative method assuming a sufficiently smooth density profile. While several electron cloud parameters, such as temperature, result in minor errors in the determined density, the transversely inhomogeneous density can introduce a large error in the measured electron density. We show that the perturbative approach is sufficient to describe the phase shift under realistic electron cloud conditions. Depending on the geometry of the beam pipe, the external magnetic field configuration and the used waveguide mode, the electron cloud density can be concentrated at the beam pipe or near the beam pipe center, leading to a severe over- or underestimation of the electron density. -- Author-Highlights: •Electron cloud distributions are very inhomogeneous, especially in dipoles. •These inhomogeneities affect the microwave transmission measurement results. •Electron density might be over- or underestimated, depending on setup. •This can be quantified with several models, e.g. a perturbative approach.

Electronic Biometric Transmission Specification. Version 1.2

Science.gov (United States)

2006-11-08

Prescribed by ANSI Std Z39-18 Electronic Biometric Transmission Specification DIN: DOD_BTF_TS_EBTS_ Nov06_01.02.00 i Revision History Revision...contains: • the ORI • a Greenwich Mean (a.k.a. Zulu or UTC) date/time stamp • a code for the software used at the point of collection/transmission...long names and would generally include the tribe name. Subfield 1 Item 1 Character Type AS Characters 1 to 50 Special Characters: Any 7-bit non

Transmission electron microscopy in micro-nanoelectronics

CERN Document Server

Claverie, Alain

2013-01-01

Today, the availability of bright and highly coherent electron sources and sensitive detectors has radically changed the type and quality of the information which can be obtained by transmission electron microscopy (TEM). TEMs are now present in large numbers not only in academia, but also in industrial research centers and fabs.This book presents in a simple and practical way the new quantitative techniques based on TEM which have recently been invented or developed to address most of the main challenging issues scientists and process engineers have to face to develop or optimize sem

Nanoporous metal film: An energy-dependent transmission device for electron waves

International Nuclear Information System (INIS)

Grech, S.; Degiovanni, A.; Lapena, L.; Morin, R.

2011-01-01

We measure electron transmission through free-standing ultrathin nanoporous gold films, using the coherent electron beam emitted by sharp field emission tips in a low energy electron projection microscope setup. Transmission coefficient versus electron wavelength plots show periodic oscillations between 75 and 850 eV. These oscillations result from the energy dependence of interference between paths through the gold and paths through the nanometer-sized pores of the film. We reveal that these films constitute high transmittance quantum devices acting on electron waves through a wavelength-dependent complex transmittance defined by the porosity and the thickness of the film.

Catalysts under Controlled Atmospheres in the Transmission Electron Microscope

DEFF Research Database (Denmark)

Hansen, Thomas Willum; Wagner, Jakob Birkedal

2014-01-01

of resolution. Using suitably clean gases, modified pumping schemes, and short pathways through dense gas regions, these issues are now circumvented. Here we provide an account of best practice using environmental transmission electron microscopy on catalytic systems illustrated using select examples from......Over time, there has been an increasing interest in observing catalysts in their operating environment at high spatial resolution and ultimately to determine the structure of a catalytically active surface. One tool with the potential to do exactly this in direct space is the transmission electron...

Transmission Electron Microscopy Studies of Electron-Selective Titanium Oxide Contacts in Silicon Solar Cells

KAUST Repository

Ali, Haider; Yang, Xinbo; Weber, Klaus; Schoenfeld, Winston V.; Davis, Kristopher O.

2017-01-01

In this study, the cross-section of electron-selective titanium oxide (TiO2) contacts for n-type crystalline silicon solar cells were investigated by transmission electron microscopy. It was revealed that the excellent cell efficiency of 21

Electron microscopy methods in studies of cultural heritage sites

Science.gov (United States)

Vasiliev, A. L.; Kovalchuk, M. V.; Yatsishina, E. B.

2016-11-01

The history of the development and application of scanning electron microscopy (SEM), transmission electron microscopy (TEM), and energy-dispersive X-ray microanalysis (EDXMA) in studies of cultural heritage sites is considered. In fact, investigations based on these methods began when electron microscopes became a commercial product. Currently, these methods, being developed and improved, help solve many historical enigmas. To date, electron microscopy combined with microanalysis makes it possible to investigate any object, from parchment and wooden articles to pigments, tools, and objects of art. Studies by these methods have revealed that some articles were made by ancient masters using ancient "nanotechnologies"; hence, their comprehensive analysis calls for the latest achievements in the corresponding instrumental methods and sample preparation techniques.

Observation of superconducting fluxons by transmission electron microscopy: A Fourier space approach to calculate the electron optical phase shifts and images

International Nuclear Information System (INIS)

Beleggia, M.; Pozzi, G.

2001-01-01

An approach is presented for the calculation of the electron optical phase shift experienced by high-energy electrons in a transmission electron microscope, when they interact with the magnetic field associated with superconducting fluxons in a thin specimen tilted with respect to the beam. It is shown that by decomposing the vector potential in its Fourier components and by calculating the phase shift of each component separately, it is possible to obtain the Fourier transform of the electron optical phase shift, which can be inverted either analytically or numerically. It will be shown how this method can be used to recover the result, previously obtained by the real-space approach, relative to the case of a straight flux tube perpendicular to the specimen surfaces. Then the method is applied to the case of a London fluxon in a thin film, where the bending and the broadening of the magnetic-field lines due to the finite specimen thickness are now correctly taken into account and not treated approximately by means of a parabolic fit. Finally, it will be shown how simple models for the pancake structure of the fluxon can be analyzed within this framework and the main features of electron transmission images predicted

Iterative reconstruction of magnetic induction using Lorentz transmission electron tomography

International Nuclear Information System (INIS)

Phatak, C.; Gürsoy, D.

2015-01-01

Intense ongoing research on complex nanomagnetic structures requires a fundamental understanding of the 3D magnetization and the stray fields around the nano-objects. 3D visualization of such fields offers the best way to achieve this. Lorentz transmission electron microscopy provides a suitable combination of high resolution and ability to quantitatively visualize the magnetization vectors using phase retrieval methods. In this paper, we present a formalism to represent the magnetic phase shift of electrons as a Radon transform of the magnetic induction of the sample. Using this formalism, we then present the application of common tomographic methods particularly the iterative methods, to reconstruct the 3D components of the vector field. We present an analysis of the effect of missing wedge and the limited angular sampling as well as reconstruction of complex 3D magnetization in a nanowire using simulations. - Highlights: • We present a formalism to represent electron-optical magnetic phase shift as a Radon transform of the 3D magnetic induction of the nano-object. • We have analyzed four different tomographic reconstruction methods for vectorial data reconstruction. • Reconstruction methods were tested for varying experimental limitations such as limited tilt range and limited angular sampling. • The analysis showed that Gridrec and SIRT methods performed better with lower errors than other reconstruction methods

Development of a secondary electron energy analyzer for a transmission electron microscope.

Science.gov (United States)

Magara, Hideyuki; Tomita, Takeshi; Kondo, Yukihito; Sato, Takafumi; Akase, Zentaro; Shindo, Daisuke

2018-04-01

A secondary electron (SE) energy analyzer was developed for a transmission electron microscope. The analyzer comprises a microchannel plate (MCP) for detecting electrons, a coil for collecting SEs emitted from the specimen, a tube for reducing the number of backscattered electrons incident on the MCP, and a retarding mesh for selecting the energy of SEs incident on the MCP. The detection of the SEs associated with charging phenomena around a charged specimen was attempted by performing electron holography and SE spectroscopy using the energy analyzer. The results suggest that it is possible to obtain the energy spectra of SEs using the analyzer and the charging states of a specimen by electron holography simultaneously.

Development of the Atomic-Resolution Environmental Transmission Electron Microscope

DEFF Research Database (Denmark)

Gai, Pratibha L.; Boyes, Edward D.; Yoshida, Kenta

2016-01-01

The development of the novel atomic-resolution environmental transmission electron microscope (atomic-resolution ETEM) for directly probing dynamic gas–solid reactions in situ at the atomic level under controlled reaction conditions consisting of gas environment and elevated temperatures is descr......The development of the novel atomic-resolution environmental transmission electron microscope (atomic-resolution ETEM) for directly probing dynamic gas–solid reactions in situ at the atomic level under controlled reaction conditions consisting of gas environment and elevated temperatures...... is used to study steels, graphene, nanowires, etc. In this chapter, the experimental setup of the microscope column and its peripherals are described....

Imaging and Quantification of Extracellular Vesicles by Transmission Electron Microscopy.

Science.gov (United States)

Linares, Romain; Tan, Sisareuth; Gounou, Céline; Brisson, Alain R

2017-01-01

Extracellular vesicles (EVs) are cell-derived vesicles that are present in blood and other body fluids. EVs raise major interest for their diverse physiopathological roles and their potential biomedical applications. However, the characterization and quantification of EVs constitute major challenges, mainly due to their small size and the lack of methods adapted for their study. Electron microscopy has made significant contributions to the EV field since their initial discovery. Here, we describe the use of two transmission electron microscopy (TEM) techniques for imaging and quantifying EVs. Cryo-TEM combined with receptor-specific gold labeling is applied to reveal the morphology, size, and phenotype of EVs, while their enumeration is achieved after high-speed sedimentation on EM grids.

Oxidation mechanism of nickel particles studied in an environmental transmission electron microscope

DEFF Research Database (Denmark)

Jeangros, Q.; Hansen, Thomas Willum; Wagner, Jakob Birkedal

2014-01-01

The oxidation of nickel particles was studied in situ in an environmental transmission electron microscope in 3.2 mbar of O2 between ambient temperature and 600°C. Several different transmission electron microscopy imaging techniques, electron diffraction and electron energy-loss spectroscopy were...... diffusion of Ni2+ along NiO grain boundaries, self-diffusion of Ni2+ ions and vacancies, growth of NiO grains and nucleation of voids at Ni/NiO interfaces. We also observed the formation of transverse cracks in a growing NiO film in situ in the electron microscope....

Nanosecond time-resolved investigations using the in situ of dynamic transmission electron microscope (DTEM)

International Nuclear Information System (INIS)

LaGrange, Thomas; Campbell, Geoffrey H.; Reed, B.W.; Taheri, Mitra; Pesavento, J. Bradley; Kim, Judy S.; Browning, Nigel D.

2008-01-01

Most biological processes, chemical reactions and materials dynamics occur at rates much faster than can be captured with standard video rate acquisition methods in transmission electron microscopes (TEM). Thus, there is a need to increase the temporal resolution in order to capture and understand salient features of these rapid materials processes. This paper details the development of a high-time resolution dynamic transmission electron microscope (DTEM) that captures dynamics in materials with nanosecond time resolution. The current DTEM performance, having a spatial resolution <10 nm for single-shot imaging using 15 ns electron pulses, will be discussed in the context of experimental investigations in solid state reactions of NiAl reactive multilayer films, the study of martensitic transformations in nanocrystalline Ti and the catalytic growth of Si nanowires. In addition, this paper will address the technical issues involved with high current, electron pulse operation and the near-term improvements to the electron optics, which will greatly improve the signal and spatial resolutions, and to the laser system, which will allow tailored specimen and photocathode drive conditions

Nanosecond time-resolved investigations using the in situ of dynamic transmission electron microscope (DTEM)

Energy Technology Data Exchange (ETDEWEB)

LaGrange, Thomas [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States)], E-mail: lagrange@llnl.gov; Campbell, Geoffrey H.; Reed, B.W.; Taheri, Mitra; Pesavento, J. Bradley [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States); Kim, Judy S.; Browning, Nigel D. [Lawrence Livermore National Laboratory, 7000 East Avenue, Livermore, CA 94550 (United States); Department of Chemical Engineering and Materials Science, University of California, One Shields Avenue, Davis, CA 95616 (United States)

2008-10-15

Most biological processes, chemical reactions and materials dynamics occur at rates much faster than can be captured with standard video rate acquisition methods in transmission electron microscopes (TEM). Thus, there is a need to increase the temporal resolution in order to capture and understand salient features of these rapid materials processes. This paper details the development of a high-time resolution dynamic transmission electron microscope (DTEM) that captures dynamics in materials with nanosecond time resolution. The current DTEM performance, having a spatial resolution <10 nm for single-shot imaging using 15 ns electron pulses, will be discussed in the context of experimental investigations in solid state reactions of NiAl reactive multilayer films, the study of martensitic transformations in nanocrystalline Ti and the catalytic growth of Si nanowires. In addition, this paper will address the technical issues involved with high current, electron pulse operation and the near-term improvements to the electron optics, which will greatly improve the signal and spatial resolutions, and to the laser system, which will allow tailored specimen and photocathode drive conditions.

Electron microscopy methods in studies of cultural heritage sites

Energy Technology Data Exchange (ETDEWEB)

Vasiliev, A. L., E-mail: a.vasiliev56@gmail.com; Kovalchuk, M. V.; Yatsishina, E. B. [National Research Centre “Kurchatov Institute” (Russian Federation)

2016-11-15

The history of the development and application of scanning electron microscopy (SEM), transmission electron microscopy (TEM), and energy-dispersive X-ray microanalysis (EDXMA) in studies of cultural heritage sites is considered. In fact, investigations based on these methods began when electron microscopes became a commercial product. Currently, these methods, being developed and improved, help solve many historical enigmas. To date, electron microscopy combined with microanalysis makes it possible to investigate any object, from parchment and wooden articles to pigments, tools, and objects of art. Studies by these methods have revealed that some articles were made by ancient masters using ancient “nanotechnologies”; hence, their comprehensive analysis calls for the latest achievements in the corresponding instrumental methods and sample preparation techniques.

Electron microscopy methods in studies of cultural heritage sites

International Nuclear Information System (INIS)

Vasiliev, A. L.; Kovalchuk, M. V.; Yatsishina, E. B.

2016-01-01

The history of the development and application of scanning electron microscopy (SEM), transmission electron microscopy (TEM), and energy-dispersive X-ray microanalysis (EDXMA) in studies of cultural heritage sites is considered. In fact, investigations based on these methods began when electron microscopes became a commercial product. Currently, these methods, being developed and improved, help solve many historical enigmas. To date, electron microscopy combined with microanalysis makes it possible to investigate any object, from parchment and wooden articles to pigments, tools, and objects of art. Studies by these methods have revealed that some articles were made by ancient masters using ancient “nanotechnologies”; hence, their comprehensive analysis calls for the latest achievements in the corresponding instrumental methods and sample preparation techniques.

The Fresnel mode of Lorentz microscopy using a scanning transmission electron microscope

International Nuclear Information System (INIS)

Chapman, J.N.; Waddell, E.M.; Batson, P.E.; Ferrier, R.P.

1979-01-01

The most widely used method of investigating ferromagnetic films in the transmission electron microscope is the Fresnel or defocus mode of Lorentz microscopy. This may be implemented either in a fixed beam or a scanning instrument. Despite a rather inefficient utilization of electrons, several advantages accrue if the latter is used, and provided it is equipped with a field emission gun, low noise images may be obtained in acceptable recording times. To extract quantitative estimates of domain wall widths from such images it is necessary to measure accurately both instrumental and specimen parameters. Methods for this are discussed and an example of an analysis using a polycrystalline permalloy film is given. (Auth.)

A simple way to obtain backscattered electron images in a scanning transmission electron microscope.

Science.gov (United States)

Tsuruta, Hiroki; Tanaka, Shigeyasu; Tanji, Takayoshi; Morita, Chiaki

2014-08-01

We have fabricated a simple detector for backscattered electrons (BSEs) and incorporated the detector into a scanning transmission electron microscope (STEM) sample holder. Our detector was made from a 4-mm(2) Si chip. The fabrication procedure was easy, and similar to a standard transmission electron microscopy (TEM) sample thinning process based on ion milling. A TEM grid containing particle objects was fixed to the detector with a silver paste. Observations were carried out using samples of Au and latex particles at 75 and 200 kV. Such a detector provides an easy way to obtain BSE images in an STEM. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Characterization of Li-rich layered oxides by using transmission electron microscope

Directory of Open Access Journals (Sweden)

Hu Zhao

2017-07-01

Full Text Available Lithium-rich layered oxides (LrLOs deliver extremely high specific capacities and are considered to be promising candidates for electric vehicle and smart grid applications. However, the application of LrLOs needs further understanding of the structural complexity and dynamic evolution of monoclinic and rhombohedral phases, in order to overcome the issues including voltage decay, poor rate capability, initial irreversible capacity loss and etc. The development of aberration correction for the transmission electron microscope and concurrent progress in electron spectroscopy, have fueled rapid progress in the understanding of the mechanism of such issues. New techniques based on the transmission electron microscope are first surveyed, and the applications of these techniques for the study of the structure, migration of transition metal, and the activation of oxygen of LrLOs are then explored in detail, with a particular focus on the mechanism of voltage decay. Keywords: Lithium-ion battery, Transmission electron microscope, Lithium-rich layered oxide, Cathode material

Transmission electron microscopy of bulk specimens over 10 µm in thickness

Energy Technology Data Exchange (ETDEWEB)

Sadamatsu, Sunao, E-mail: sadamatsu@mech.kagoshima-u.ac.jp [Department of Mechanical Engineering, Kagoshima University, Korimoto, Kagoshima 890-0065 (Japan); Tanaka, Masaki; Higashida, Kenji [Department of Materials Science and Engineering, Kyushu University, Nishi-ku, Fukuoka 819-0395 (Japan); Matsumura, Syo [Department of Applied Quantum Physics and Nuclear Engineering, Kyushu University, Nishi-ku, Fukuoka 819-0395 (Japan); Ultramicroscopy Research Center, Kyushu University, Nishi-ku, Fukuoka 819-0395 (Japan)

2016-03-15

We succeeded the observation of microstructures in bulk-sized specimens of over 10 µm in thickness by employing a technique that combines transmission electron microscopy (TEM) with energy-filtered imaging based on electron energy-loss spectroscopy (EELS). This method is unique in that it incorporates the inelastically scattered electrons into the imaging process. Using this technique, bright and sharp images of dislocations in crystalline silicon specimens as thick as 10 µm were obtained. A calibration curve to determine foil thickness of such a thick specimen was also derived. This method simply extends the observable thickness range in TEM. If combined with tilt series of observation over a significant range of angle, it will disclose three dimensional nanostructures in a µm-order block of a specimen, promoting our understanding of the controlling mechanisms behind various bulky material properties. - Highlights: • We developed a method which enables thick specimens to be observed using EF-TEM. • The effects of energy filter width and position on images were determined. • We suggested a method to determine the thickness of a thick film sample. • We achieved observation of microstructures in specimens with a thickness of 10 µm.

Measurement of suprathermal electron confinement by cyclotron transmission

International Nuclear Information System (INIS)

Kirkwood, R.; Hutchinson, I.H.; Luckhardt, S.C.; Porkolab, M.; Squire, J.P.

1990-01-01

The confinement time of suprathermal electrons is determined experimentally from the distribution function determined via wave transmission measurements. Measurements of the lowest moment of the distribution perpendicular to the B field as a function of the parallel electron momentum as well as the global input power allow the suprathermal electron confinement time (τ se ) to be calculated during lower-hybrid and inductive current drive. Finite particle confinement is found to be the dominant energy loss term for the suprathermals and improves with plasma current and density

Interaction of electrons with light metal hydrides in the transmission electron microscope.

Science.gov (United States)

Wang, Yongming; Wakasugi, Takenobu; Isobe, Shigehito; Hashimoto, Naoyuki; Ohnuki, Somei

2014-12-01

Transmission electron microscope (TEM) observation of light metal hydrides is complicated by the instability of these materials under electron irradiation. In this study, the electron kinetic energy dependences of the interactions of incident electrons with lithium, sodium and magnesium hydrides, as well as the constituting element effect on the interactions, were theoretically discussed, and electron irradiation damage to these hydrides was examined using in situ TEM. The results indicate that high incident electron kinetic energy helps alleviate the irradiation damage resulting from inelastic or elastic scattering of the incident electrons in the TEM. Therefore, observations and characterizations of these materials would benefit from increased, instead decreased, TEM operating voltage. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Low-energy electron transmission and secondary-electron emission experiments on crystalline and molten long-chain alkanes

International Nuclear Information System (INIS)

Ueno, N.; Sugita, K.; Seki, K.; Inokuchi, H.

1986-01-01

This paper describes the results of low-energy electron transmission and secondary-electron emission experiments on thin films of long-chain alkanes deposited on metal substrates. The spectral changes due to crystal-melt phase transition were measured in situ in both experiments. The ground-state energy V 0 of the quasifree electron in crystalline state was determined to be 0.5 +- 0.1 eV. The value of V 0 for the molten state was found to be negative. Further, in the crystalline state evidence is found for a direct correspondence between the transmission maxima and the high value of the density of states in the conduction bands

Preparation of transmission electron microscopy cross-section specimens using focused ion beam milling

International Nuclear Information System (INIS)

Langford, R.M.; Petford-Long, A.K.

2001-01-01

The preparation of transmission electron microscopy cross-section specimens using focused ion beam milling is outlined. The 'liftout' and 'trench' techniques are both described in detail, and their relative advantages and disadvantages are discussed. Artifacts such as ion damage to the top surface and sidewalls of the cross-section specimens, and methods of reducing them, are addressed

Path-separated electron interferometry in a scanning transmission electron microscope

Science.gov (United States)

Yasin, Fehmi S.; Harvey, Tyler R.; Chess, Jordan J.; Pierce, Jordan S.; McMorran, Benjamin J.

2018-05-01

We report a path-separated electron interferometer within a scanning transmission electron microscope. In this setup, we use a nanofabricated grating as an amplitude-division beamsplitter to prepare multiple spatially separated, coherent electron probe beams. We achieve path separations of 30 nm. We pass the  +1 diffraction order probe through amorphous carbon while passing the 0th and  ‑1 orders through vacuum. The probes are then made to interfere via imaging optics, and we observe an interference pattern at the CCD detector with up to 39.7% fringe visibility. We show preliminary experimental results in which the interference pattern was recorded during a 1D scan of the diffracted probes across a test phase object. These results qualitatively agree with a modeled interference predicted by an independent measurement of the specimen thickness. This experimental design can potentially be applied to phase contrast imaging and fundamental physics experiments, such as an exploration of electron wave packet coherence length.

Structural studies of glasses by transmission electron microscopy and electron diffraction

International Nuclear Information System (INIS)

Kashchieva, E.P.

1997-01-01

The purpose of this work is to present information about the applications of transmission electron microscopy (TEM) and electron diffraction (ED) for structural investigations of glasses. TEM investigations have been carried out on some binary and on a large number of ternary borate-telluride systems where glass-forming oxides, oxides of transitional elements and modified oxides of elements from I, II and III groups in the periodic table, are used as third component. The large experimental data given by TEM method allows the fine classification of the micro-heterogeneities. A special case of micro-heterogeneous structure with technological origin occurs near the boundary between the 2 immiscible liquids obtained at macro-phase separation. TEM was also used for the direct observation of the glass structure and we have studied the nano-scale structure of borate glasses obtained at slow and fast cooling of the melts. The ED possesses advantages for analysis of amorphous thin films or micro-pastilles and it is a very useful technique for study in materials containing simultaneously light and heavy elements. A comparison between the possibilities of the 3 diffraction techniques (X-ray diffraction, neutron diffraction and ED) is presented

The Physical Characterization of Liposome Salicylic Acid Using Transmission Electron Microscope

International Nuclear Information System (INIS)

Elman Panjaitan

2008-01-01

The physical characterization of liposome, formulated from salicylic acid using thin film hydration methods with cholesterol and soybean lecithin, has been done. The formula was characterized by optical microscopes and Transmission Electron Microscope (TEM). The observation result shows that the salicylic acid can be formulated to liposomes. Soybean lecithin combined with cholesterol (600 mg : 20 mg) was the best formula and the liposome was spherical vesicle like with dimension about 70 nm unit 800 nm. (author)

Electronic control of a 4-speed automatic transmission with lock-up clutch

Energy Technology Data Exchange (ETDEWEB)

Schwab, M.

1984-01-01

The paper describes the electronic control of an automatic 4-speed transmission with lock-up clutch. As compared to purely hydraulically controlled transmissions, this control offers a clearly improved quality of shifting and the possibility of achieving improvements in fuel consumption thanks to a special economy program. The electronic control unit is a Bosch MOTRONIC which has been expanded to include the functions of transmission control. A special feature is the engine torque control which is implemented by way of retarding the ignition when shifting. This opens up an additional degree of freedom for optimizing a transmission in terms of shift comfort, life of the friction elements and the power which can be transmitted.

Correlative scanning-transmission electron microscopy reveals that a chimeric flavivirus is released as individual particles in secretory vesicles.

Directory of Open Access Journals (Sweden)

Julien Burlaud-Gaillard

Full Text Available The intracellular morphogenesis of flaviviruses has been well described, but flavivirus release from the host cell remains poorly documented. We took advantage of the optimized production of an attenuated chimeric yellow fever/dengue virus for vaccine purposes to study this phenomenon by microscopic approaches. Scanning electron microscopy (SEM showed the release of numerous viral particles at the cell surface through a short-lived process. For transmission electron microscopy (TEM studies of the intracellular ultrastructure of the small number of cells releasing viral particles at a given time, we developed a new correlative microscopy method: CSEMTEM (for correlative scanning electron microscopy - transmission electron microscopy. CSEMTEM analysis suggested that chimeric flavivirus particles were released as individual particles, in small exocytosis vesicles, via a regulated secretory pathway. Our morphological findings provide new insight into interactions between flaviviruses and cells and demonstrate that CSEMTEM is a useful new method, complementary to SEM observations of biological events by intracellular TEM investigations.

In situ Electrical measurements in Transmission Electron Microscopy

NARCIS (Netherlands)

Rudneva, M.

2013-01-01

In the present thesis the combination of real-time electricalmeasurements on nano-sampleswith simultaneous examination by transmission electron microscope (TEM) is discussed. Application of an electrical current may lead to changes in the samples thus the possibility to correlate such changes with

Pulsed Power for a Dynamic Transmission Electron Microscope

Energy Technology Data Exchange (ETDEWEB)

dehope, w j; browning, n; campbell, g; cook, e; king, w; lagrange, t; reed, b; stuart, b; Shuttlesworth, R; Pyke, B

2009-06-25

Lawrence Livermore National Laboratory (LLNL) has converted a commercial 200kV transmission electron microscope (TEM) into an ultrafast, nanoscale diagnostic tool for material science studies. The resulting Dynamic Transmission Electron Microscope (DTEM) has provided a unique tool for the study of material phase transitions, reaction front analyses, and other studies in the fields of chemistry, materials science, and biology. The TEM's thermionic electron emission source was replaced with a fast photocathode and a laser beam path was provided for ultraviolet surface illumination. The resulting photoelectron beam gives downstream images of 2 and 20 ns exposure times at 100 and 10 nm spatial resolution. A separate laser, used as a pump pulse, is used to heat, ignite, or shock samples while the photocathode electron pulses, carefully time-synchronized with the pump, function as probe in fast transient studies. The device functions in both imaging and diffraction modes. A laser upgrade is underway to make arbitrary cathode pulse trains of variable pulse width of 10-1000 ns. Along with a fast e-beam deflection scheme, a 'movie mode' capability will be added to this unique diagnostic tool. This talk will review conventional electron microscopy and its limitations, discuss the development and capabilities of DTEM, in particularly addressing the prime and pulsed power considerations in the design and fabrication of the DTEM, and conclude with the presentation of a deflector and solid-state pulser design for Movie-Mode DTEM.

Pulsed Power for a Dynamic Transmission Electron Microscope

International Nuclear Information System (INIS)

DeHope, W.J.; Browning, N.; Campbell, G.; Cook, E.; King, W.; Lagrange, T.; Reed, B.; Stuart, B.; Shuttlesworth, R.; Pyke, B.

2009-01-01

Lawrence Livermore National Laboratory (LLNL) has converted a commercial 200kV transmission electron microscope (TEM) into an ultrafast, nanoscale diagnostic tool for material science studies. The resulting Dynamic Transmission Electron Microscope (DTEM) has provided a unique tool for the study of material phase transitions, reaction front analyses, and other studies in the fields of chemistry, materials science, and biology. The TEM's thermionic electron emission source was replaced with a fast photocathode and a laser beam path was provided for ultraviolet surface illumination. The resulting photoelectron beam gives downstream images of 2 and 20 ns exposure times at 100 and 10 nm spatial resolution. A separate laser, used as a pump pulse, is used to heat, ignite, or shock samples while the photocathode electron pulses, carefully time-synchronized with the pump, function as probe in fast transient studies. The device functions in both imaging and diffraction modes. A laser upgrade is underway to make arbitrary cathode pulse trains of variable pulse width of 10-1000 ns. Along with a fast e-beam deflection scheme, a 'movie mode' capability will be added to this unique diagnostic tool. This talk will review conventional electron microscopy and its limitations, discuss the development and capabilities of DTEM, in particularly addressing the prime and pulsed power considerations in the design and fabrication of the DTEM, and conclude with the presentation of a deflector and solid-state pulser design for Movie-Mode DTEM

Structural Fingerprinting of Nanocrystals in the Transmission Electron Microscope

Science.gov (United States)

Rouvimov, Sergei; Plachinda, Pavel; Moeck, Peter

2010-03-01

Three novel strategies for the structurally identification of nanocrystals in a transmission electron microscope are presented. Either a single high-resolution transmission electron microscopy image [1] or a single precession electron diffractogram (PED) [2] may be employed. PEDs from fine-grained crystal powders may also be utilized. Automation of the former two strategies is in progress and shall lead to statistically significant results on ensembles of nanocrystals. Open-access databases such as the Crystallography Open Database which provides more than 81,500 crystal structure data sets [3] or its mainly inorganic and educational subsets [4] may be utilized. [1] http://www.scientificjournals.org/journals 2007/j/of/dissertation.htm [2] P. Moeck and S. Rouvimov, in: {Drugs and the Pharmaceutical Sciences}, Vol. 191, 2009, 270-313 [3] http://cod.ibt.lt, http://www.crystallography.net, http://cod.ensicaen.fr, http://nanocrystallography.org, http://nanocrystallography.net, http://journals.iucr.org/j/issues/2009/04/00/kk5039/kk5039.pdf [4] http://nanocrystallography.research.pdx.edu/CIF-searchable

Addressing preservation of elastic contrast in energy-filtered transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Brown, H.G.; D' Alfonso, A.J.; Forbes, B.D.; Allen, L.J., E-mail: lja@unimelb.edu.au

2016-01-15

Energy-filtered transmission electron microscopy (EFTEM) images with resolutions of the order of an Ångström can be obtained using modern microscopes corrected for chromatic aberration. However, the delocalized nature of the transition potentials for atomic ionization often confounds direct interpretation of EFTEM images, leading to what is known as “preservation of elastic contrast”. In this paper we demonstrate how more interpretable images might be obtained by scanning with a focused coherent probe and incoherently averaging the energy-filtered images over probe position. We dub this new imaging technique energy-filtered imaging scanning transmission electron microscopy (EFISTEM). We develop a theoretical framework for EFISTEM and show that it is in fact equivalent to precession EFTEM, where the plane wave illumination is precessed through a range of tilts spanning the same range of angles as the probe forming aperture in EFISTEM. It is demonstrated that EFISTEM delivers similar results to scanning transmission electron microscopy with an electron energy-loss spectrometer but has the advantage that it is immune to coherent aberrations and spatial incoherence of the probe and is also more resilient to scan distortions. - Highlights: • Interpretation of EFTEM images is complicated by preservation of elastic contrast. • More direct images obtained by scanning with a focused coherent probe and averaging. • This is equivalent to precession EFTEM through the solid angle defined by the probe. • Also yields similar results to energy-loss scanning transmission electron microscopy. • Scanning approach immune to probe aberrations and resilient to scan distortions.

Biominerals at the nanoscale: transmission electron microscopy methods for studying the special properties of biominerals

DEFF Research Database (Denmark)

Posfai, Mihaly; Kasama, Takeshi; Dunin-Borkowski, Rafal E.

2013-01-01

Biominerals have important functions in living organisms: apatite crystals are responsible for the strength of our bones and the hardness of our teeth, calcite and aragonite are used by many organisms for making shells, and magnetite and greigite help bacteria and birds to navigate in magnetic...... fields. In order to fulfill their roles in organisms, biominerals have strictly controlled physical and chemical properties. Transmission electron microscopy (TEM) is ideally suited for the study of the structures, arrangements, compositions, morphologies, crystallographic orientations, crystallographic...... minerals that form in the cells of magnetotactic bacteria....

Automated grain mapping using wide angle convergent beam electron diffraction in transmission electron microscope for nanomaterials.

Science.gov (United States)

Kumar, Vineet

2011-12-01

The grain size statistics, commonly derived from the grain map of a material sample, are important microstructure characteristics that greatly influence its properties. The grain map for nanomaterials is usually obtained manually by visual inspection of the transmission electron microscope (TEM) micrographs because automated methods do not perform satisfactorily. While the visual inspection method provides reliable results, it is a labor intensive process and is often prone to human errors. In this article, an automated grain mapping method is developed using TEM diffraction patterns. The presented method uses wide angle convergent beam diffraction in the TEM. The automated technique was applied on a platinum thin film sample to obtain the grain map and subsequently derive grain size statistics from it. The grain size statistics obtained with the automated method were found in good agreement with the visual inspection method.

Development of spin-polarized transmission electron microscope

International Nuclear Information System (INIS)

Kuwahara, M; Saitoh, K; Tanaka, N; Takeda, Y; Ujihara, T; Asano, H; Nakanishi, T

2011-01-01

In order to study spin related phenomena in nano-size materials, spin-polarized electron source (PES) has been employed for the incident beam in transmission electron microscope (TEM). The PES has been designed and constructed with optimizing for spin-polarized TEM. The illuminating system of TEM is also designed to focus the spin-polarized electron beam emitted from a semiconductor photocathode with a negative electron affinity (NEA) surface. The beam energy is set to below 40 keV which is lower energy type as a TEM, because the spin interaction with condensed matters is very small corresponding with a Coulomb interaction. The polarized electron gun has realized in an extra high vacuum (XHV) condition and high field gradient of 4 MV/m on a surface of photocathode. Furthermore, it demonstrated that 40-keV polarized electron beam was operated with a sub-milli second pulse mode by using the backside excitation type photocathode. This high performance PES will make it possible to observe dynamically a magnetic field images with high contrast and highspeed temporal imaging in TEM.

Characterization of strained semiconductor structures using transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Oezdoel, Vasfi Burak

2011-08-15

Today's state-of-the-art semiconductor electronic devices utilize the charge transport within very small volumes of the active device regions. The structural, chemical and optical material properties in these small dimensions can critically affect the performance of these devices. The present thesis is focused on the nanometer scale characterization of the strain state in semiconductor structures using transmission electron microscopy (TEM). Although high-resolution TEM has shown to provide the required accuracy at the nanometer scale, optimization of imaging conditions is necessary for accurate strain measurements. An alternative HRTEM method based on strain mapping on complex-valued exit face wave functions is developed to reduce the artifacts arising from objective lens aberrations. However, a much larger field of view is crucial for mapping strain in the active regions of complex structures like latest generation metal-oxide-semiconductor field-effect transistors (MOSFETs). To overcome this, a complementary approach based on electron holography is proposed. The technique relies on the reconstruction of the phase shifts in the diffracted electron beams from a focal series of dark-field images using recently developed exit-face wave function reconstruction algorithm. Combining high spatial resolution, better than 1 nm, with a field of view of about 1 {mu}m in each dimension, simultaneous strain measurements on the array of MOSFETs are possible. Owing to the much lower electron doses used in holography experiments when compared to conventional quantitative methods, the proposed approach allows to map compositional distribution in electron beam sensitive materials such as InGaN heterostructures without alteration of the original morphology and chemical composition. Moreover, dark-field holography experiments can be performed on thicker specimens than the ones required for high-resolution TEM, which in turn reduces the thin foil relaxation. (orig.)

Enhanced thermal stability of a polymer solar cell blend induced by electron beam irradiation in the transmission electron microscope

Energy Technology Data Exchange (ETDEWEB)

Bäcke, Olof, E-mail: obacke@chalmers.se [Department of Applied Physics, Chalmers University of Technology, 41296 Göteborg (Sweden); Lindqvist, Camilla; Diaz de Zerio Mendaza, Amaia [Department of Chemistry and Chemical Engineering, Chalmers University of Technology, 41296 Göteborg (Sweden); Gustafsson, Stefan [Department of Applied Physics, Chalmers University of Technology, 41296 Göteborg (Sweden); Wang, Ergang; Andersson, Mats R.; Müller, Christian [Department of Chemistry and Chemical Engineering, Chalmers University of Technology, 41296 Göteborg (Sweden); Kristiansen, Per Magnus [Institute of Polymer Nanotechnology (INKA), FHNW University of Applied Science and Arts Northwestern Switzerland, 5210 Windisch (Switzerland); Laboratory for Micro- and Nanotechnology, Paul Scherrer Institute, 5232 Villigen (Switzerland); Olsson, Eva, E-mail: eva.olsson@chalmers.se [Department of Applied Physics, Chalmers University of Technology, 41296 Göteborg (Sweden)

2017-05-15

We show by in situ microscopy that the effects of electron beam irradiation during transmission electron microscopy can be used to lock microstructural features and enhance the structural thermal stability of a nanostructured polymer:fullerene blend. Polymer:fullerene bulk-heterojunction thin films show great promise for use as active layers in organic solar cells but their low thermal stability is a hindrance. Lack of thermal stability complicates manufacturing and influences the lifetime of devices. To investigate how electron irradiation affects the thermal stability of polymer:fullerene films, a model bulk-heterojunction film based on a thiophene-quinoxaline copolymer and a fullerene derivative was heat-treated in-situ in a transmission electron microscope. In areas of the film that exposed to the electron beam the nanostructure of the film remained stable, while the nanostructure in areas not exposed to the electron beam underwent large phase separation and nucleation of fullerene crystals. UV–vis spectroscopy shows that the polymer:fullerene films are stable for electron doses up to 2000 kGy. - Highlights: • Thermal stability of a polymer: fullerne blend is increased using electron irradiation. • Using in-situ transmission electron microscopy the nanostructure is studied. • Electron irradiation stops phase separation between the polymer and fullerene. • Electron irradiation quenches the formation and nucleation of fullerene crystals.

Transmission Electron Microscopy and Diffractometry of Materials

CERN Document Server

Fultz, Brent

2013-01-01

This book explains concepts of transmission electron microscopy (TEM) and x-ray diffractometry (XRD) that are important for the characterization of materials. The fourth edition adds important new techniques of TEM such as electron tomography, nanobeam diffraction, and geometric phase analysis. A new chapter on neutron scattering completes the trio of x-ray, electron and neutron diffraction. All chapters were updated and revised for clarity. The book explains the fundamentals of how waves and wavefunctions interact with atoms in solids, and the similarities and differences of using x-rays, electrons, or neutrons for diffraction measurements. Diffraction effects of crystalline order, defects, and disorder in materials are explained in detail. Both practical and theoretical issues are covered. The book can be used in an introductory-level or advanced-level course, since sections are identified by difficulty. Each chapter includes a set of problems to illustrate principles, and the extensive Appendix includes la...

Processing scarce biological samples for light and transmission electron microscopy

Directory of Open Access Journals (Sweden)

P Taupin

2008-06-01

Full Text Available Light microscopy (LM and transmission electron microscopy (TEM aim at understanding the relationship structure-function. With advances in biology, isolation and purification of scarce populations of cells or subcellular structures may not lead to enough biological material, for processing for LM and TEM. A protocol for preparation of scarce biological samples is presented. It is based on pre-embedding the biological samples, suspensions or pellets, in bovine serum albumin (BSA and bis-acrylamide (BA, cross-linked and polymerized. This preparation provides a simple and reproducible technique to process biological materials, present in limited quantities that can not be amplified, for light and transmission electron microscopy.

Transmission electron microscope studies of crystalline LiNbO3

International Nuclear Information System (INIS)

Pareja, R.; Gonzalez, R.; Chen, Y.

1984-01-01

Transmission electron microscope investigations in both as-grown and hydrogen-reduced LiNbO 3 reveal that niobium oxide precipitates can be produced by in situ irradiations in the electron microscope. The precipitation process is produced by a combined effect of ionizing electrons and the thermal heating of the specimens during irradiation. It is proposed that the composition of the precipitates is primarily Nb 2 O 5

Study of electron transmission through thin metallic films by the electron moessbauer spectroscopy

International Nuclear Information System (INIS)

Babikova, Yu.F.; Vakar, O.M.; Gruzin, O.M.; Petrikin, Yu.V.

1983-01-01

Results of the experimental study of the transmission of conversion electrons through aluminium, iron, tin and gold films are presented. Absorption of resonance electrons of the Moessbauer nuclide 57 Fe, formed during target irradiation with γ-quanta of 57 Co source in chromium matrix has been studied. It is asserted that absorption of conversion electrons in films of different elements is similar; at that, like in the case of β-particles, the law of absorption of resonance electrons, emitted from the flat layer, is exponential For conversion electrons of the Moessbauer nuclide 57 Fe the absorption coefficient is (0.025+-0.002) cm 2 /μg, which in the case of iron absorbing film corresponds to (20.0+-1.0)x10 4 cm -1

Transmission environmental scanning electron microscope with scintillation gaseous detection device.

Science.gov (United States)

Danilatos, Gerasimos; Kollia, Mary; Dracopoulos, Vassileios

2015-03-01

A transmission environmental scanning electron microscope with use of a scintillation gaseous detection device has been implemented. This corresponds to a transmission scanning electron microscope but with addition of a gaseous environment acting both as environmental and detection medium. A commercial type of low vacuum machine has been employed together with appropriate modifications to the detection configuration. This involves controlled screening of various emitted signals in conjunction with a scintillation gaseous detection device already provided with the machine for regular surface imaging. Dark field and bright field imaging has been obtained along with other detection conditions. With a progressive series of modifications and tests, the theory and practice of a novel type of microscopy is briefly shown now ushering further significant improvements and developments in electron microscopy as a whole. Copyright © 2014 Elsevier B.V. All rights reserved.

Solid-state nanopores of controlled geometry fabricated in a transmission electron microscope

Science.gov (United States)

Qian, Hui; Egerton, Ray F.

2017-11-01

Energy-filtered transmission electron microscopy and electron tomography were applied to in situ studies of the formation, shape, and diameter of nanopores formed in a silicon nitride membrane in a transmission electron microscope. The nanopore geometry was observed in three dimensions by electron tomography. Drilling conditions, such as probe current, beam convergence angle, and probe position, affect the formation rate and the geometry of the pores. With a beam convergence semi-angle of α = 22 mrad, a conical shaped nanopore is formed but at α = 45 mrad, double-cone (hourglass-shaped) nanopores were produced. Nanopores with an effective diameter between 10 nm and 1.8 nm were fabricated by controlling the drilling time.

Application of Boltzmann equation to electron transmission and seconary electron emission

International Nuclear Information System (INIS)

Lanteri, H.; Bindi, R.; Rostaing, P.

1979-01-01

A method is presented for numerical treatment of integro-differential equation, based upon finite difference techniques. This method allows to formulate in a satisfactory manner the Boltzmann's equation applied to backscattering, transmission and secondary emission of metallic targets, avoiding must of the restrictive hypothesis, used until now in these models. For aluminium, the calculated energy spectra, angular distribution, transmission and backscattering coefficients, and secondary emission yield, are found to be in good agreement with experiment [fr

Three-Dimensional scanning transmission electron microscopy of biological specimens

KAUST Repository

De Jonge, Niels; Sougrat, Rachid; Northan, Brian M.; Pennycook, Stephen J.

2010-01-01

A three-dimensional (3D) reconstruction of the cytoskeleton and a clathrin-coated pit in mammalian cells has been achieved from a focal-series of images recorded in an aberration-corrected scanning transmission electron microscope (STEM

Multistage linear electron acceleration using pulsed transmission lines

International Nuclear Information System (INIS)

Miller, R.B.; Prestwich, K.R.; Poukey, J.W.; Epstein, B.G.; Freeman, J.R.; Sharpe, A.W.; Tucker, W.K.; Shope, S.L.

1981-01-01

A four-stage linear electron accelerator is described which uses pulsed radial transmission lines as the basic accelerating units. An annular electron beam produced by a foilless diode is guided through the accelerator by a strong axial magnetic field. Synchronous firing of the injector and the acccelerating modules is accomplished with self-breaking oil switches. The device has accelerated beam currents of 25 kA to kinetic energies of 9 MV, with 90% current transport efficiency. The average accelerating gradient is 3 MV/m

In situ transmission electron microscopy and scanning transmission electron microscopy studies of sintering of Ag and Pt nanoparticles

International Nuclear Information System (INIS)

Asoro, M.A.; Ferreira, P.J.; Kovar, D.

2014-01-01

Transmission electron microscopy and scanning transmission electron microscopy studies were conducted in situ on 2–5 nm Pt and 10–40 nm Ag nanoparticles to study mechanisms for sintering and to measure relevant sintering kinetics in nanoscale particles. Sintering between two separated particles was observed to initiate by either (1) diffusion of the particles on the sample support or (2) diffusion of atoms or small clusters of atoms to the neck region between the two particles. After particle contact, the rate of sintering was controlled by atomic surface diffusivity. The surface diffusivity was determined as a function of particle size and temperature from experimental measurements of the rate of neck growth of the particles. The surface diffusivities did not show a strong size effect for the range of particle sizes that were studied. The surface diffusivity for Pt nanoparticles exhibited the expected Arrhenius temperature dependence and did not appear to be sensitive to the presence of surface contaminants. In contrast, the surface diffusivity for Ag nanoparticles was affected by the presence of impurities such as carbon. The diffusivities for Ag nanoparticles were consistent with previous measurements of bulk surface diffusivities for Ag in the presence of C, but were significantly slower than those obtained from pristine Ag

In-situ straining and time-resolved electron tomography data acquisition in a transmission electron microscope.

Science.gov (United States)

Hata, S; Miyazaki, S; Gondo, T; Kawamoto, K; Horii, N; Sato, K; Furukawa, H; Kudo, H; Miyazaki, H; Murayama, M

2017-04-01

This paper reports the preliminary results of a new in-situ three-dimensional (3D) imaging system for observing plastic deformation behavior in a transmission electron microscope (TEM) as a directly relevant development of the recently reported straining-and-tomography holder [Sato K et al. (2015) Development of a novel straining holder for transmission electron microscopy compatible with single tilt-axis electron tomography. Microsc. 64: 369-375]. We designed an integrated system using the holder and newly developed straining and image-acquisition software and then developed an experimental procedure for in-situ straining and time-resolved electron tomography (ET) data acquisition. The software for image acquisition and 3D visualization was developed based on the commercially available ET software TEMographyTM. We achieved time-resolved 3D visualization of nanometer-scale plastic deformation behavior in a Pb-Sn alloy sample, thus demonstrating the capability of this system for potential applications in materials science. © The Author 2016. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Nano-structured thin films : a Lorentz transmission electron microscopy and electron holography study

NARCIS (Netherlands)

Hosson, J.Th.M. de; Raedt, H.A. De; Zhong, ZY; Saka, H; Kim, TH; Holm, EA; Han, YF; Xie, XS

2005-01-01

This paper aims at applying advanced transmission electron microscopy (TEM) to functional materials, such as ultra-soft magnetic films for high-frequency inductors, to reveal the structure-property relationship. The ultimate goal is to delineate a more quantitative way to obtain information of the

Comparing electron tomography and HRTEM slicing methods as tools to measure the thickness of nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Alloyeau, D., E-mail: alloyeau.damien@gmail.com [Laboratoire Materiaux et Phenomenes Quantiques, Universite Paris 7/CNRS, UMR 7162, 2 Place Jussieu, 75251 Paris (France); Laboratoire d' Etude des Microstructures - ONERA/CNRS, UMR 104, B.P. 72, 92322 Chatillon (France); Ricolleau, C. [Laboratoire Materiaux et Phenomenes Quantiques, Universite Paris 7/CNRS, UMR 7162, 2 Place Jussieu, 75251 Paris (France); Oikawa, T. [Laboratoire Materiaux et Phenomenes Quantiques, Universite Paris 7/CNRS, UMR 7162, 2 Place Jussieu, 75251 Paris (France); JEOL (Europe) SAS, Espace Claude Monet, 1 Allee de Giverny, 78290 Croissy-sur-Seine (France); Langlois, C. [Laboratoire Materiaux et Phenomenes Quantiques, Universite Paris 7/CNRS, UMR 7162, 2 Place Jussieu, 75251 Paris (France); Le Bouar, Y.; Loiseau, A. [Laboratoire d' Etude des Microstructures - ONERA/CNRS, UMR 104, B.P. 72, 92322 Chatillon (France)

2009-06-15

Nanoparticles' morphology is a key parameter in the understanding of their thermodynamical, optical, magnetic and catalytic properties. In general, nanoparticles, observed in transmission electron microscopy (TEM), are viewed in projection so that the determination of their thickness (along the projection direction) with respect to their projected lateral size is highly questionable. To date, the widely used methods to measure nanoparticles thickness in a transmission electron microscope are to use cross-section images or focal series in high-resolution transmission electron microscopy imaging (HRTEM 'slicing'). In this paper, we compare the focal series method with the electron tomography method to show that both techniques yield similar particle thickness in a range of size from 1 to 5 nm, but the electron tomography method provides better statistics since more particles can be analyzed at one time. For this purpose, we have compared, on the same samples, the nanoparticles thickness measurements obtained from focal series with the ones determined from cross-section profiles of tomograms (tomogram slicing) perpendicular to the plane of the substrate supporting the nanoparticles. The methodology is finally applied to the comparison of CoPt nanoparticles annealed ex situ at two different temperatures to illustrate the accuracy of the techniques in detecting small particle thickness changes.

Transmission electron-microscopic studies of structural changes in polycrystalline graphite after high temperature irradiation

International Nuclear Information System (INIS)

Platonov, P.A.; Gurovich, B.A.; Shtrombakh, Ya.I.; Karpukhin, V.I.

1985-01-01

Transmission electron-microscopic investigation of polycrystalline graphite before and after irradiation is carried out. The direct use of graphite samples after ion thinning, as an inquiry subject is the basic peculiarity of the work. Main structural components of MPG-6 graphite before and after irradiation are revealed, the structural mechanism of the reactor graphite destruction under irradiation is demonstrated. The mean values of L αm and L cm crystallite dimensions are determined. Radiation defects, occuring in some crystallites after irradiation are revealed by the dark-field electron microscopy method

Origin of spin-dependent asymmetries in electron transmission through ultrathin ferromagnetic films

International Nuclear Information System (INIS)

Gokhale, M.P.; Mills, D.L.

1991-01-01

We present theoretical calculations of exchange asymmetries in the transmission of electrons through ultrathin films of ferromagnetic Fe. The results account nicely for the magnitude of the asymmetries observed by Pappas et al. in photoemission studies of Cu covered by an ultrathin film of Fe. We argue that exchange asymmetry in the transmissivity of the Fe film, rather than the spin dependence of the electron mean free path, is responsible for the effects reported by these authors

Transmission electron microscopy of mercury metal

KAUST Repository

Anjum, Dalaver H.

2016-03-28

Summary: Transmission electron microcopy (TEM) analysis of liquid metals, especially mercury (Hg), is difficult to carry out because their specimen preparation poses a daunting task due to the unique surface properties of these metals. This paper reports a cryoTEM study on Hg using a novel specimen preparation technique. Hg metal is mixed with water using sonication and quenched in liquid ethane cryogen. This technique permits research into the morphological, phase and structural properties of Hg at nanoscale dimensions. © 2016 Royal Microscopical Society.

Single particle analysis based on Zernike phase contrast transmission electron microscopy.

Science.gov (United States)

Danev, Radostin; Nagayama, Kuniaki

2008-02-01

We present the first application of Zernike phase-contrast transmission electron microscopy to single-particle 3D reconstruction of a protein, using GroEL chaperonin as the test specimen. We evaluated the performance of the technique by comparing 3D models derived from Zernike phase contrast imaging, with models from conventional underfocus phase contrast imaging. The same resolution, about 12A, was achieved by both imaging methods. The reconstruction based on Zernike phase contrast data required about 30% fewer particles. The advantages and prospects of each technique are discussed.

Elemental distribution imaging by energy-filtering transmission electron microscopy (EFTEM) and its applications

International Nuclear Information System (INIS)

Kurata, Hiroki

1996-01-01

EFTEM is new microscopy with the object of visualizing high resolution quantitative elemental distribution. The measurement principles and the present state of EFTEM studies are explained by the examples of measurement of the elemental distributions. EFTEM is a combination of the transmission electron microscope with the electron energy loss spectroscopy (EFLS). EFTEM method sets the slit in the specific energy field and put the electron passing the slit back in the microscopic image. The qualitative elemental analysis is obtained by observing the position of the absorption end of core electronic excitation spectrum and the quantitative one by determining the core electronic excitation strength of the specific atom depend on filtering with energy selector slit. The binding state and the local structure in the neighborhood of excited atom is determined by the fine structure of absorption end. By the chemical mapping method, the distribution image of chemical binding state is visualized by the imaging chemical map obtained by filtering the specific peak strength of fine structure with the narrow energy selector slit. The fine powder of lead chromate (PbCrO 4 ) covered with silica glass was shown as a typical example of the elemental distribution image of core electronic excitation spectrum. The quantitative analysis method of elemental distribution image is explained. The possibility of single atom analysis at nanometer was shown by the example of nanotube observed by EFTEM. (S.Y.)

Thin dielectric film thickness determination by advanced transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Diebold, A.C.; Foran, B.; Kisielowski, C.; Muller, D.; Pennycook, S.; Principe, E.; Stemmer, S.

2003-09-01

High Resolution Transmission Electron Microscopy (HR-TEM) has been used as the ultimate method of thickness measurement for thin films. The appearance of phase contrast interference patterns in HR-TEM images has long been confused as the appearance of a crystal lattice by non-specialists. Relatively easy to interpret crystal lattice images are now directly observed with the introduction of annular dark field detectors for scanning TEM (STEM). With the recent development of reliable lattice image processing software that creates crystal structure images from phase contrast data, HR-TEM can also provide crystal lattice images. The resolution of both methods was steadily improved reaching now into the sub Angstrom region. Improvements in electron lens and image analysis software are increasing the spatial resolution of both methods. Optimum resolution for STEM requires that the probe beam be highly localized. In STEM, beam localization is enhanced by selection of the correct aperture. When STEM measurement is done using a highly localized probe beam, HR-TEM and STEM measurement of the thickness of silicon oxynitride films agree within experimental error. In this paper, the optimum conditions for HR-TEM and STEM measurement are discussed along with a method for repeatable film thickness determination. The impact of sample thickness is also discussed. The key result in this paper is the proposal of a reproducible method for film thickness determination.

Analysis of self-organized In(Ga)As quantum structures with the scanning transmission electron microscope

International Nuclear Information System (INIS)

Sauerwald, Andres

2008-01-01

Aim of this thesis was to apply the analytical methods of the scanning transmission electron microscopy to the study of self-organized In(Ga)As quantum structures. With the imaging methods Z contrast and bright field (position resolutions in the subnanometer range) and especially with the possibilities of the quantitative chemical EELS analysis of the scanning transmission electron microscope (STEM) fundamental questions concerning morphology and chemical properties of self-organized quantum structures should be answered. By the high position resolution of the STEM among others essentail morphological and structural parameters in the growth behaviour of ''dot in a well'' (DWell) structures and of vertically correlated quantum dots (QDs) could be analyzed. For the optimization of DWell structures samples were studied, the nominal InAs-QD growth position was directedly varied within the embedding InGaAs quantum wells. The STEM offers in connection with the EELS method a large potential for the chemical analysis of quantum structures. Studied was a sample series of self-organized InGaAs/GaAs structures on GaAs substrate, the stress of which was changed by varying the Ga content of the INGaAs material between 2.4 % and 4.3 % [de

Scanning electron microscopy and transmission electron microscopy study of hot-deformed gamma-TiAl-based alloy microstructure.

Science.gov (United States)

Chrapoński, J; Rodak, K

2006-09-01

The aim of this work was to assess the changes in the microstructure of hot-deformed specimens made of alloys containing 46-50 at.% Al, 2 at.% Cr and 2 at.% Nb (and alloying additions such as carbon and boron) with the aid of scanning electron microscopy and transmission electron microscopy techniques. After homogenization and heat treatment performed in order to make diverse lamellae thickness, the specimens were compressed at 1000 degrees C. Transmission electron microscopy examinations of specimens after the compression test revealed the presence of heavily deformed areas with a high density of dislocation. Deformation twins were also observed. Dynamically recrystallized grains were revealed. For alloys no. 2 and no. 3, the recovery and recrystallization processes were more extensive than for alloy no. 1.

Electron transmission through a periodically driven graphene magnetic barrier

Energy Technology Data Exchange (ETDEWEB)

Biswas, R., E-mail: rbiswas.pkc@gmail.com [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Maiti, S. [Ajodhya Hills G.S.A.T High School, Ajodhya, Purulia, West Bengal – 723152 (India); Mukhopadhyay, S. [Purulia Zilla School, Dulmi Nadiha, Purulia, West Bengal – 723102 (India); Sinha, C. [Department of Physics, P. K. College, Contai, Purba Medinipur, West Bengal – 721401 (India); Department of Theoretical Physics, Indian Association for the Cultivation of Science, Jadavpur – 700032 (India)

2017-05-10

Electronic transport through graphene magnetic barriers is studied theoretically in presence of an external time harmonic scalar potential in the framework of non-perturbative Landau–Floquet Formalism. The oscillating field mostly suppresses the transmission for rectangular magnetic barrier structure and exhibits the Fano resonance for multiphoton processes due to the presence of bound state inside the barrier. While, for a pair of delta function barriers of larger separation, the oscillating potential suppresses the usual Fabry–Perot oscillations in the transmission and a new type of asymmetric Fano resonance is noted for smaller separation, occurring due to extended states between the barriers. - Highlights: • Tunnelling of the Dirac Fermions through oscillating pure magnetic barriers is reported for the first time. • The high energy transmission through a graphene magnetic barrier is suppressed by the application of time periodic modulation. • Suppression of the Fabry Perot transmission is noted due to the application of an external time harmonic potential. • Two kinds of the Fano resonances are noted in transmission through a pair of modulated δ-function magnetic barriers.

Multiphoton electronic-spin generation and transmission spectroscopy in n-type GaAs

Energy Technology Data Exchange (ETDEWEB)

Idrish Miah, M., E-mail: m.miah@griffith.edu.a [Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)

2011-01-17

Multiphoton electronic-spin generation in semiconductors was investigated using differential transmission spectroscopy. The generation of the electronic spins in the semiconductor samples were achieved by multiphoton pumping with circularly polarized light beam and was probed by the spin-resolved transmission of the samples. The electronic spin-polarization of conduction band was estimated and was found to depend on the delay of the probe beam, temperature as well as on the multiphoton pumping energy. The temperature dependence showed a decrease of the spin-polarization with increasing temperature. The electronic spin-polarization was found to depolarize rapidly for multiphoton pumping energy larger than the energy gap of the split-off band to the conduction band. The results were compared with those obtained in one-photon pumping, which shows that an enhancement of the electronic spin-polarization was achieved in multiphoton pumping. The findings resulting from this investigation might have potential applications in opto-spintronics, where the generation of highly polarized electronic spins is required.

Multiphoton electronic-spin generation and transmission spectroscopy in n-type GaAs

International Nuclear Information System (INIS)

Idrish Miah, M.

2011-01-01

Multiphoton electronic-spin generation in semiconductors was investigated using differential transmission spectroscopy. The generation of the electronic spins in the semiconductor samples were achieved by multiphoton pumping with circularly polarized light beam and was probed by the spin-resolved transmission of the samples. The electronic spin-polarization of conduction band was estimated and was found to depend on the delay of the probe beam, temperature as well as on the multiphoton pumping energy. The temperature dependence showed a decrease of the spin-polarization with increasing temperature. The electronic spin-polarization was found to depolarize rapidly for multiphoton pumping energy larger than the energy gap of the split-off band to the conduction band. The results were compared with those obtained in one-photon pumping, which shows that an enhancement of the electronic spin-polarization was achieved in multiphoton pumping. The findings resulting from this investigation might have potential applications in opto-spintronics, where the generation of highly polarized electronic spins is required.

Structure Identification in High-Resolution Transmission Electron Microscopic Images

DEFF Research Database (Denmark)

Vestergaard, Jacob Schack; Kling, Jens; Dahl, Anders Bjorholm

2014-01-01

A connection between microscopic structure and macroscopic properties is expected for almost all material systems. High-resolution transmission electron microscopy is a technique offering insight into the atomic structure, but the analysis of large image series can be time consuming. The present ...

Three-Dimensional Orientation Mapping in the Transmission Electron Microscope

DEFF Research Database (Denmark)

Liu, Haihua; Schmidt, Søren; Poulsen, Henning Friis

2011-01-01

resolution of 200 nanometers (nm). We describe here a nondestructive technique that enables 3D orientation mapping in the transmission electron microscope of mono- and multiphase nanocrystalline materials with a spatial resolution reaching 1 nm. We demonstrate the technique by an experimental study...

Foucault imaging by using non-dedicated transmission electron microscope

International Nuclear Information System (INIS)

Taniguchi, Yoshifumi; Matsumoto, Hiroaki; Harada, Ken

2012-01-01

An electron optical system for observing Foucault images was constructed using a conventional transmission electron microscope without any special equipment for Lorentz microscopy. The objective lens was switched off and an electron beam was converged by a condenser optical system to the crossover on the selected area aperture plane. The selected area aperture was used as an objective aperture to select the deflected beam for Foucault mode, and the successive image-forming lenses were controlled for observation of the specimen images. The irradiation area on the specimen was controlled by selecting the appropriate diameter of the condenser aperture.

Foucault imaging by using non-dedicated transmission electron microscope

Science.gov (United States)

Taniguchi, Yoshifumi; Matsumoto, Hiroaki; Harada, Ken

2012-08-01

An electron optical system for observing Foucault images was constructed using a conventional transmission electron microscope without any special equipment for Lorentz microscopy. The objective lens was switched off and an electron beam was converged by a condenser optical system to the crossover on the selected area aperture plane. The selected area aperture was used as an objective aperture to select the deflected beam for Foucault mode, and the successive image-forming lenses were controlled for observation of the specimen images. The irradiation area on the specimen was controlled by selecting the appropriate diameter of the condenser aperture.

Foucault imaging by using non-dedicated transmission electron microscope

Energy Technology Data Exchange (ETDEWEB)

Taniguchi, Yoshifumi [Science and Medical Systems Business Group, Hitachi High-Technologies Corp., Ichige, Hitachinaka, Ibaraki 312-8504 (Japan); Matsumoto, Hiroaki [Corporate Manufacturing Strategy Group, Hitachi High-Technologies Corp., Ishikawa-cho, Hitachinaka, Ibaraki 312-1991 (Japan); Harada, Ken [Central Research Laboratory, Hitachi Ltd., Hatoyama, Saitama 350-0395 (Japan)

2012-08-27

An electron optical system for observing Foucault images was constructed using a conventional transmission electron microscope without any special equipment for Lorentz microscopy. The objective lens was switched off and an electron beam was converged by a condenser optical system to the crossover on the selected area aperture plane. The selected area aperture was used as an objective aperture to select the deflected beam for Foucault mode, and the successive image-forming lenses were controlled for observation of the specimen images. The irradiation area on the specimen was controlled by selecting the appropriate diameter of the condenser aperture.

Investigating the use of in situ liquid cell scanning transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Nguy, Amanda [Iowa State Univ., Ames, IA (United States)

2016-02-19

Engineering nanoparticles with desired shape-dependent properties is the key to many applications in nanotechnology. Although many synthetic procedures exist to produce anisotropic gold nanoparticles, the dynamics of growth are typically unknown or hypothetical. In the case of seed-mediated growth in the presence of DNA into anisotropic nanoparticles, it is not known exactly how DNA directs growth into specific morphologies. A series of preliminary experiments were carried out to contribute to the investigation of the possible mechanism of DNA-mediated growth of gold nanoprisms into gold nanostars using liquid cell scanning transmission electron microscopy (STEM). Imaging in the liquid phase was achieved through the use of a liquid cell platform and liquid cell holder that allow the sample to be contained within a “chip sandwich” between two electron transparent windows. Ex situ growth experiments were performed using Au-T30 NPrisms (30-base thymine oligonucleotide-coated gold nanoprisms) that are expected to grow into gold nanostars. Growth to form these nanostars were imaged using TEM (transmission electron microscopy) and liquid cell STEM (scanning transmission electron microscopy). An attempt to perform in situ growth experiments with the same Au-T30 nanoprisms revealed challenges in obtaining desired morphology results due to the environmental differences within the liquid cell compared to the ex situ environment. Different parameters in the experimental method were explored including fluid line set up, simultaneous and alternating reagent addition, and the effect of different liquid cell volumes to ensure adequate flow of reagents into the liquid cell. Lastly, the binding affinities were compared for T30 and A30 DNA incubated with gold nanoparticles using zeta potential measurements, absorption spectroscopy, and isothermal titration calorimetry (ITC). It was previously reported thymine bases have a lower binding affinity to gold surfaces than adenine

The effect of different electrodes on the electronic transmission of benzene junctions: Analytical approach

Energy Technology Data Exchange (ETDEWEB)

Mohebbi, Razie; Seyed-Yazdi, Jamileh, E-mail: j.seyedyazdi@vru.ac.ir

2016-06-01

In this paper we have investigated the electronic transmission of systems electrode–benzene–electrode using the Landauer approach. The effect of different electrodes made of metal (Au) and semiconductors (Si, TiO{sub 2}) is investigated. These three electrodes are compared between them and the results show that the electronic transmission of benzene junctions, when using semiconductor electrodes, is associated to a gap in transmission which is due to the electrodes band gap. As a consequence, a threshold voltage is necessary to obtain conducting channels.

Aberration-corrected scanning transmission electron microscopy of semiconductors

International Nuclear Information System (INIS)

Krivanek, O L; Dellby, N; Murfitt, M F

2011-01-01

The scanning transmission electron microscope (STEM) has been able to image individual heavy atoms in a light matrix for some time. It is now able to do much more: it can resolve individual atoms as light as boron in monolayer materials; image atomic columns as light as hydrogen, identify the chemical type of individual isolated atoms from the intensity of their annular dark field (ADF) image and by electron energy loss spectroscopy (EELS); and map elemental composition at atomic resolution by EELS and energy-dispersive X-ray spectroscopy (EDXS). It can even map electronic states, also by EELS, at atomic resolution. The instrumentation developments that have made this level of performance possible are reviewed, and examples of applications to semiconductors and oxides are shown.

Transmission Electron Microscopy of a CMSX-4 Ni-Base Superalloy Produced by Selective Electron Beam Melting

Directory of Open Access Journals (Sweden)

Alireza B. Parsa

2016-10-01

Full Text Available In this work, the microstructures of superalloy specimens produced using selective electron beam melting additive manufacturing were characterized. The materials were produced using a CMSX-4 powder. Two selective electron beam melting processing strategies, which result in higher and lower effective cooling rates, are described. Orientation imaging microscopy, scanning transmission electron microscopy and conventional high resolution transmission electron microscopy are used to investigate the microstructures. Our results suggest that selective electron beam melting processing results in near equilibrium microstructures, as far as γ′ volume fractions, the formation of small amounts of TCP phases and the partitioning behavior of the alloy elements are concerned. As expected, higher cooling rates result in smaller dendrite spacings, which are two orders of magnitude smaller than observed during conventional single crystal casting. During processing, columnar grains grow in <100> directions, which are rotated with respect to each other. There are coarse γ/γ′ microstructures in high angle boundary regions. Dislocation networks form low angle boundaries. A striking feature of the as processed selective electron beam melting specimens is their high dislocation density. From a fundamental point of view, this opens new possibilities for the investigation of elementary dislocation processes which accompany solidification.

Amyloid Structure and Assembly: Insights from Scanning Transmission Electron Microscopy

Energy Technology Data Exchange (ETDEWEB)

Goldsbury, C.; Wall, J.; Baxa, U.; Simon, M. N.; Steven, A. C.; Engel, A.; Aebi, U.; Muller, S. A.

2011-01-01

Amyloid fibrils are filamentous protein aggregates implicated in several common diseases such as Alzheimer's disease and type II diabetes. Similar structures are also the molecular principle of the infectious spongiform encephalopathies such as Creutzfeldt-Jakob disease in humans, scrapie in sheep, and of the so-called yeast prions, inherited non-chromosomal elements found in yeast and fungi. Scanning transmission electron microscopy (STEM) is often used to delineate the assembly mechanism and structural properties of amyloid aggregates. In this review we consider specifically contributions and limitations of STEM for the investigation of amyloid assembly pathways, fibril polymorphisms and structural models of amyloid fibrils. This type of microscopy provides the only method to directly measure the mass-per-length (MPL) of individual filaments. Made on both in vitro assembled and ex vivo samples, STEM mass measurements have illuminated the hierarchical relationships between amyloid fibrils and revealed that polymorphic fibrils and various globular oligomers can assemble simultaneously from a single polypeptide. The MPLs also impose strong constraints on possible packing schemes, assisting in molecular model building when combined with high-resolution methods like solid-state nuclear magnetic resonance (NMR) and electron paramagnetic resonance (EPR).

Dynamics of annular bright field imaging in scanning transmission electron microscopy

International Nuclear Information System (INIS)

Findlay, S.D.; Shibata, N.; Sawada, H.; Okunishi, E.; Kondo, Y.; Ikuhara, Y.

2010-01-01

We explore the dynamics of image formation in the so-called annular bright field mode in scanning transmission electron microscopy, whereby an annular detector is used with detector collection range lying within the cone of illumination, i.e. the bright field region. We show that this imaging mode allows us to reliably image both light and heavy columns over a range of thickness and defocus values, and we explain the contrast mechanisms involved. The role of probe and detector aperture sizes is considered, as is the sensitivity of the method to intercolumn spacing and local disorder.

Three-dimensional nanofabrication by electron-beam-induced deposition using 200-keV electrons in scanning transmission electron microscope

International Nuclear Information System (INIS)

Liu, Z.Q.; Mitsuishi, K.; Furuya, K.

2005-01-01

Attempts were made to fabricate three-dimensional nanostructures on and out of a substrate by electron-beam-induced deposition in a 200-kV scanning transmission electron microscope. Structures with parallel wires over the substrate surface were difficult to fabricate due to the direct deposition of wires on both top and bottom surfaces of the substrate. Within the penetration depth of the incident electron beam, nanotweezers were fabricated by moving the electron beam beyond different substrate layers. Combining the deposition of self-supporting wires and self-standing tips, complicated three-dimensional doll-like, flag-like, and gate-like nanostructures that extend out of the substrate were successfully fabricated with one-step or multi-step scans of the electron beam. Effects of coarsening, nucleation, and distortion during electron-beam-induced deposition are discussed. (orig.)

Design of electron wave filters in monolayer graphene by tunable transmission gap

OpenAIRE

Chen, Xi; Tao, Jia-Wei

2009-01-01

We have investigated the transmission in monolayer graphene barrier at nonzero angle of incidence. Taking the influence of parallel wave vector into account, the transmission as the function of incidence energy has a gap due to the evanescent waves in two cases of Klein tunneling and classical motion. The modulation of the transmission gap by the incidence angle, the height, and width of potential barrier may lead to potential applications in graphene-based electronic devices.

Transmission electron microscopy in molecular structural biology: A historical survey.

Science.gov (United States)

Harris, J Robin

2015-09-01

In this personal, historic account of macromolecular transmission electron microscopy (TEM), published data from the 1940s through to recent times is surveyed, within the context of the remarkable progress that has been achieved during this time period. The evolution of present day molecular structural biology is described in relation to the associated biological disciplines. The contribution of numerous electron microscope pioneers to the development of the subject is discussed. The principal techniques for TEM specimen preparation, thin sectioning, metal shadowing, negative staining and plunge-freezing (vitrification) of thin aqueous samples are described, with a selection of published images to emphasise the virtues of each method. The development of digital image analysis and 3D reconstruction is described in detail as applied to electron crystallography and reconstructions from helical structures, 2D membrane crystals as well as single particle 3D reconstruction of icosahedral viruses and macromolecules. The on-going development of new software, algorithms and approaches is highlighted before specific examples of the historical progress of the structural biology of proteins and viruses are presented. Copyright © 2014 Elsevier Inc. All rights reserved.

Tunable electronic transmission gaps in a graphene superlattice

International Nuclear Information System (INIS)

Lu Weitao; Wang Shunjin; Li Wen; Wang Yonglong; Jiang Hua

2012-01-01

The transmission in graphene superlattices with adjustable barrier height is investigated using transfer-matrix method. It is found that one could control the angular range of transmission by changing the ratio of incidence energy and barrier height. The transmission as a function of incidence energy has more than one gaps, due to the appearance of evanescent waves in different barriers. Accordingly, more than one conductivity minimums are induced. The transmission gaps could be controlled by adjusting the incidence angle, the barrier height, and the barrier number, which gives the possibility to construct an energy-dependent wavevector filter.

Practical Approaches to Mitigation of Specimen Charging in High-Resolution Transmission Electron Microscopy

Directory of Open Access Journals (Sweden)

Young-Min Kim

2010-09-01

Full Text Available Specimen charging that is associated with the electron bombardment on the sample is a practical hindrance to high-resolution transmission electron microscopy (HRTEM analysis because it causes a severe loss of resolution in either diffraction or image data. Conductive thin film deposition on an insulating specimen has been proposed as an effective approach to the mitigation of the specimen charging; however, this method is generally not useful in HRTEM imaging of materials because the deposited film induces another artifact in the HRTEM image contrast. In this study, we propose practical methods to mitigate the specimen charging that takes place during the HRTEM of materials. For bulk-type specimens prepared by either an ion-thinning or focused-ion beam (FIB process, a plasma cleaning treatment is significantly effective in eliminating the charging phenomenon. In the case of low-dimensional nanomaterials such as nanowires and nanoparticles, the plasma cleaning is not feasible; however, the charging effect can be effectively eliminated by adjusting the electron illumination condition. The proposed methods facilitate a decrease in the buildup of specimen charging, thereby enhancing the quality of high-resolution images significantly.

In situ Transmission Electron Microscopy of catalyst sintering

DEFF Research Database (Denmark)

DeLaRiva, Andrew T.; Hansen, Thomas Willum; Challa, Sivakumar R.

2013-01-01

Recent advancements in the field of electron microscopy, such as aberration correctors, have now been integrated into Environmental Transmission Electron Microscopes (TEMs), making it possible to study the behavior of supported metal catalysts under operating conditions at atomic resolution. Here......, we focus on in situ electron microscopy studies of catalysts that shed light on the mechanistic aspects of catalyst sintering. Catalyst sintering is an important mechanism for activity loss, especially for catalysts that operate at elevated temperatures. Literature from the past decade is reviewed...... along with our recent in situ TEM studies on the sintering of Ni/MgAl2O4 catalysts. These results suggest that the rapid loss of catalyst activity in the earliest stages of catalyst sintering could result from Ostwald ripening rather than through particle migration and coalescence. The smallest...

Novel low-dose imaging technique for characterizing atomic structures through scanning transmission electron microscope

Science.gov (United States)

Su, Chia-Ping; Syu, Wei-Jhe; Hsiao, Chien-Nan; Lai, Ping-Shan; Chen, Chien-Chun

2017-08-01

To investigate dislocations or heterostructures across interfaces is now of great interest to condensed matter and materials scientists. With the advances in aberration-corrected electron optics, the scanning transmission electron microscope has demonstrated its excellent capability of characterizing atomic structures within nanomaterials, and well-resolved atomic-resolution images can be obtained through long-exposure data acquisition. However, the sample drifting, carbon contamination, and radiation damage hinder further analysis, such as deriving three-dimensional (3D) structures from a series of images. In this study, a method for obtaining atomic-resolution images with significantly reduced exposure time was developed, using which an original high-resolution image with approximately one tenth the electron dose can be obtained by combining a fast-scan high-magnification image and a slow-scan low-magnification image. The feasibility of obtaining 3D atomic structures using the proposed approach was demonstrated through multislice simulation. Finally, the feasibility and accuracy of image restoration were experimentally verified. This general method cannot only apply to electron microscopy but also benefit to image radiation-sensitive materials using various light sources.

Digital acquisition and processing of electron micrographs using a scanning transmission electron microscope

International Nuclear Information System (INIS)

Engel, A.; Christen, F.; Michel, B.

1981-01-01

A digital acquisition system that collects multichannel information from a scanning transmission electron microscope (STEM) and its application are described. The hardware comprises (i) single electron counting detectors, (ii) a digital scan generator, (iii) a digital multi-channel on-line processor, (iv) an interface to a minicomputer, and (v) a display system. Experimental results characterizing these components are presented, and their performance is discussed. The software includes assembler coded programs for dynamic file maintenance and fast acquisition of image data, a display driver, and FORTRAN coded application programs. The usefulness of digitized STEM is illustrated by a variety of biological applications. (orig.)

Applications of transmission electron microscopy in the materials and mineral sciences

International Nuclear Information System (INIS)

Murr, L.E.

1975-01-01

Unique capabilities of transmission electron microscopy in characterizing the structure and properties of metals, minerals, and other crystaline materials are illustrated and compared with observations in the scanning electron and field-ion microscopes. Contrast mechanisms involving both mass-thickness and diffraction processes are illustrated, and examples presented of applications of bright and dark-field techiques. Applications of the electron microscope in the investigation of metallurgical and mineralogical problems are outlined with representative examples [pt

Enhanced thermal stability of a polymer solar cell blend induced by electron beam irradiation in the transmission electron microscope.

Science.gov (United States)

Bäcke, Olof; Lindqvist, Camilla; de Zerio Mendaza, Amaia Diaz; Gustafsson, Stefan; Wang, Ergang; Andersson, Mats R; Müller, Christian; Kristiansen, Per Magnus; Olsson, Eva

2017-05-01

We show by in situ microscopy that the effects of electron beam irradiation during transmission electron microscopy can be used to lock microstructural features and enhance the structural thermal stability of a nanostructured polymer:fullerene blend. Polymer:fullerene bulk-heterojunction thin films show great promise for use as active layers in organic solar cells but their low thermal stability is a hindrance. Lack of thermal stability complicates manufacturing and influences the lifetime of devices. To investigate how electron irradiation affects the thermal stability of polymer:fullerene films, a model bulk-heterojunction film based on a thiophene-quinoxaline copolymer and a fullerene derivative was heat-treated in-situ in a transmission electron microscope. In areas of the film that exposed to the electron beam the nanostructure of the film remained stable, while the nanostructure in areas not exposed to the electron beam underwent large phase separation and nucleation of fullerene crystals. UV-vis spectroscopy shows that the polymer:fullerene films are stable for electron doses up to 2000kGy. Copyright © 2016 Elsevier B.V. All rights reserved.

Transmission Electron Microscopy for Wood and Fiber Analysis − A Review

Directory of Open Access Journals (Sweden)

Mehedi Reza

2015-07-01

Full Text Available This review describes use of transmission electron microscopy (TEM in wood and fiber analysis. Analytical techniques and sample preparation methods are used to localize substructures of the cell wall polymers and are discussed in this review. The ultrastructural features of the wood cell walls, the structures formed by microfibrils, and the distribution of cell wall polymers, as revealed by TEM, are covered. Research investigating the distribution of lignin in tension and compression woods using TEM is reviewed. Different kinds of wood biodegrading enzymes localized using TEM are mentioned. Additional features of TEM, i.e., 3D imaging, analytical TEM, and electron diffraction are discussed. Lastly, a comparison between TEM and other imaging techniques used for wood and fiber research are made. Thus, this review provides insight into the contribution of TEM in wood research since its invention and demonstrates how to use it more effectively in the future.

Optimization of Beam Transmission of PAL-PNF Electron Linac

Energy Technology Data Exchange (ETDEWEB)

Shin, S. G.; Kim, S. K.; Kim, E. A. [Pohang University of Science and Technology, Pohang (Korea, Republic of)

2012-05-15

The PNF (Pohang Neutron Facility) electron Linac is providing converted neutrons and photons from electron beams to users for nuclear physics experiments and high energy gamma-ray exposures. This linac is capable of producing 100 MeV electron beams with a beam current of pulsed 100 mA. The pulse length is 2 {mu}s and the pulse repetition rate is typically 30 Hz. This linac consists of two SLAC-type S-band accelerating columns and the thermionic RF gun. They are powered by one klystron and the matching pulse modulator. The electron beams emitted from the RF gun are bunched as they pass through the alpha magnet and are injected into the accelerating column thereafter. In this paper, we discuss procedures and results of the beam transmission optimization with technical details of the accelerator system. We also briefly discuss the future upgrade plan to obtain short-pulse or electron beams for neutron TOF experiments by adopting a triode type thermionic DC electron gun

Electron cyclotron waves transmission: new approach for the characterization of electron distribution functions in Tokamak hot plasmas

International Nuclear Information System (INIS)

Michelot, Y.

1995-10-01

Fast electrons are one of the basic ingredients of plasma operations in many existing thermonuclear fusion research devices. However, the understanding of fast electrons dynamics during creation and sustainment of the superthermal electrons tail is far for being satisfactory. For this reason, the Electron Cyclotron Transmission (ECT) diagnostic was implemented on Tore Supra tokamak. It consists on a microwave transmission system installed on a vertical chord crossing the plasma center and working in the frequency range 77-109 GHz. Variations of the wave amplitude during the propagation across the plasma may be due to refraction and resonant absorption. For the ECT, the most common manifestation of refraction is a reduction of the received power density with respect to the signal detected in vacuum, due to the spreading and deflection of the wave beam. Wave absorption is observed in the vicinity of the electron cyclotron harmonics and may be due both to thermal plasma and to superthermal electron tails. It has a characteristic frequency dependence due to the relativistic mass variation in the wave-electron resonance condition. This thesis presents the first measurements of: the extraordinary mode optical depth at the third harmonics, the electron temperature from the width of a cyclotron absorption line and the relaxation times of the electron distribution during lower hybrid current drive from the ordinary mode spectral superthermal absorption line at the first harmonic. (J.S.). 175 refs., 110 figs., 9 tabs., 3 annexes

eV-TEM: Transmission electron microscopy in a low energy cathode lens instrument

Energy Technology Data Exchange (ETDEWEB)

Geelen, Daniël, E-mail: geelen@physics.leidenuniv.nl [Huygens-Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Leiden University, P.O. Box 9504, 2300 RA Leiden (Netherlands); Thete, Aniket [Huygens-Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Leiden University, P.O. Box 9504, 2300 RA Leiden (Netherlands); Schaff, Oliver; Kaiser, Alexander [SPECS GmbH, Voltastrasse 5, D-13355 Berlin (Germany); Molen, Sense Jan van der [Huygens-Kamerlingh Onnes Laboratory, Leiden Institute of Physics, Leiden University, P.O. Box 9504, 2300 RA Leiden (Netherlands); Tromp, Rudolf [IBM T.J. Watson Research Center, 1101 Kitchawan Road, P.O. Box 218, Yorktown Heights, NY 10598 (United States)

2015-12-15

We are developing a transmission electron microscope that operates at extremely low electron energies, 0–40 eV. We call this technique eV-TEM. Its feasibility is based on the fact that at very low electron energies the number of energy loss pathways decreases. Hence, the electron inelastic mean free path increases dramatically. eV-TEM will enable us to study elastic and inelastic interactions of electrons with thin samples. With the recent development of aberration correction in cathode lens instruments, a spatial resolution of a few nm appears within range, even for these very low electron energies. Such resolution will be highly relevant to study biological samples such as proteins and cell membranes. The low electron energies minimize adverse effects due to radiation damage. - Highlights: • We present a new way of performing low energy transmission electron microscopy in an aberration corrected LEEM/PEEM instrument. • We show a proof of principle where we measure transmitted electrons through a suspended graphene monolayer with a preliminary setup. • We present an improved setup design that provides better control of the incident electron beam.

Nanoparticle sizing: a comparative study using atomic force microscopy, transmission electron microscopy, and ferromagnetic resonance

International Nuclear Information System (INIS)

Lacava, L.M.; Lacava, B.M.; Azevedo, R.B.; Lacava, Z.G.M.; Buske, N.; Tronconi, A.L.; Morais, P.C.

2001-01-01

Atomic force microscopy (AFM), transmission electron microscopy (TEM), and ferromagnetic resonance (FMR) were used to unfold the nanoparticle size of a ferrofluid sample. Compared to TEM, the AFM method showed a nanoparticle diameter (D m ) reduction of 20% and standard deviation (σ) increase of 15%. The differences in D m and σ were associated with the AFM tip and the nanoparticle concentration on the substrate

Study of the niobium dehydrogenation process by transmission electron microscopy

International Nuclear Information System (INIS)

Bulhoes, I.A.M.; Akune, K.

1983-01-01

The evolution of the micro-structure of Nb-H, during the dehydrogenation process through thermal treatment, has been studied by Transmission Electron Microscopy. The results are used in order to interpret the variation of the line resolution of Electron Channeling Pattern (ECP) of Nb-H as a function of isochronous annealing temperature. It is concluded that the improvement of the ECP line resolution is enhanced of β hydrate in Nb. (Author) [pt

Novel lift-off technique for Transmission Electron Microscopy imaging of block copolymer films

International Nuclear Information System (INIS)

Roache, Fergus J.M.; Radjainia, Mazdak; Williams, David E.; Gerrard, Juliet A.; Travas-Sejdic, Jadranka; Malmström, Jenny

2015-01-01

We have developed a simple technique to allow for the lift-off and subsequent transfer of poly(styrene-block-ethylene glycol) films to Transmission Electron Microscopy (TEM) grids. The block copolymer is spin coated onto carbon coated mica and annealed. After the thin film is produced it can easily be floated onto water and picked up by a TEM grid. This method offers better control over film processing than dip coating the TEM grid and is also a significant improvement over methods using etchants such as hydrofluoric acid. - Highlights: • We have developed a simple method to lift block copolymer films to TEM grids. • Polymer films prepared on carbon coated mica are easily floated on water. • The new method circumvents the use of harsh chemicals

Electron holography study of magnetization behavior in the writer pole of a perpendicular magnetic recording head by a 1 MV transmission electron microscope.

Science.gov (United States)

Hirata, Kei; Ishida, Yoichi; Akashi, Tetsuya; Shindo, Daisuke; Tonomura, Akira

2012-01-01

The magnetic domain structure of the writer poles of perpendicular magnetic recording heads was studied using electron holography. Although the domain structure of a 100-nm-thick writer pole could be observed with a 300 kV transmission electron microscope, that of the 250-nm-thick writer pole could not be analyzed due to the limited transmission capability of the instrument. On the other hand, the detailed domain structure of the 250-nm-thick writer pole was successfully analyzed by a 1 MV electron microscope using its high transmission capability. The thickness and material dependency of the domain structure of a writer pole were discussed.

Spherical aberration correction in a scanning transmission electron microscope using a sculpted thin film.

Science.gov (United States)

Shiloh, Roy; Remez, Roei; Lu, Peng-Han; Jin, Lei; Lereah, Yossi; Tavabi, Amir H; Dunin-Borkowski, Rafal E; Arie, Ady

2018-06-01

Nearly eighty years ago, Scherzer showed that rotationally symmetric, charge-free, static electron lenses are limited by an unavoidable, positive spherical aberration. Following a long struggle, a major breakthrough in the spatial resolution of electron microscopes was reached two decades ago by abandoning the first of these conditions, with the successful development of multipole aberration correctors. Here, we use a refractive silicon nitride thin film to tackle the second of Scherzer's constraints and demonstrate an alternative method for correcting spherical aberration in a scanning transmission electron microscope. We reveal features in Si and Cu samples that cannot be resolved in an uncorrected microscope. Our thin film corrector can be implemented as an immediate low cost upgrade to existing electron microscopes without re-engineering of the electron column or complicated operation protocols and can be extended to the correction of additional aberrations. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Ion source for thinning of specimen in transmission electron microscopy

International Nuclear Information System (INIS)

Hammer, K.; Rothe, R.

1983-01-01

Thinning of specimen for transmission electron microscopy is carried out by means of sputtering. Construction, design, and operation parameters of an ion source are presented. Because the plasma is produced by means of hollow cathode glow discharges, no special focusing system is used

Tailoring of electron flow current in magnetically insulated transmission lines

Directory of Open Access Journals (Sweden)

J. P. Martin

2009-03-01

Full Text Available It is desirable to optimize (minimizing both the inductance and electron flow the magnetically insulated vacuum sections of low impedance pulsed-power drivers. The goal of low inductance is understandable from basic efficiency arguments. The goal of low electron flow results from two observations: (1 flowing electrons generally do not deliver energy to (or even reach most loads, and thus constitute a loss mechanism; (2 energetic electrons deposited in a small area can cause anode damage and anode plasma formation. Low inductance and low electron flow are competing goals; an optimized system requires a balance of the two. While magnetically insulated systems are generally forgiving, there are times when optimization is crucial. For example, in large pulsed-power drivers used to energize high energy density physics loads, the electron flow as a fraction of total current is small, but that flow often reaches the anode in relatively small regions. If the anode temperature becomes high enough to desorb gas, the resulting plasma initiates a gap closure process that can impact system performance. Magnetic-pressure driven (z pinches and material equation of state loads behave like a fixed inductor for much of the drive pulse. It is clear that neither fixed gap nor constant-impedance transmission lines are optimal for driving inductive loads. This work shows a technique for developing the optimal impedance profile for the magnetically insulated section of a high-current driver. Particle-in-cell calculations are used to validate the impedance profiles developed in a radial disk magnetically insulated transmission line geometry. The input parameters are the spacing and location of the minimum gap, the effective load inductance, and the desired electron flow profile. The radial electron flow profiles from these simulations are in good agreement with theoretical predictions when driven at relatively high voltage (i.e., V≥2  MV.

Transmission electron microscopy study of unhydrided,dehydrided and annealed LaNi5

NARCIS (Netherlands)

Veirman, de A.E.M.; Staals, A.A.; Notten, P.H.L.

1994-01-01

The influence of hydrogen absorption on the microstructure of LaNi5 powders has been investigated by transmission electron microscopy. At the surface of the unhydrided and dehydrided LaNi5 grains a reaction layer is observed. By means of selected area electron diffraction this layer is found to

In situ transmission electron microscopy for magnetic nanostructures

DEFF Research Database (Denmark)

Ngo, Duc-The; Kuhn, Luise Theil

2016-01-01

Nanomagnetism is a subject of great interest because of both application and fundamental aspects in which understanding of the physical and electromagnetic structure of magnetic nanostructures is essential to explore the magnetic properties. Transmission electron microscopy (TEM) is a powerful tool...... that allows understanding of both physical structure and micromagnetic structure of the thin samples at nanoscale. Among TEM techniques, in situ TEM is the state-of-the-art approach for imaging such structures in dynamic experiments, reconstructing a real-time nanoscale picture of the properties......-structure correlation. This paper aims at reviewing and discussing in situ TEM magnetic imaging studies, including Lorentz microscopy and electron holography in TEM, applied to the research of magnetic nanostructures....

Transmission electron microscope cells for use with liquid samples

Science.gov (United States)

Khalid, Waqas; Alivisatos, Paul A.; Zettl, Alexander K.

2016-08-09

This disclosure provides systems, methods, and devices related to transmission electron microscopy cells for use with liquids. In one aspect a device includes a substrate, a first graphene layer, and a second graphene layer. The substrate has a first surface and a second surface. The first surface defines a first channel, a second channel, and an outlet channel. The first channel and the second channel are joined to the outlet channel. The outlet channel defines a viewport region forming a though hole in the substrate. The first graphene layer overlays the first surface of the substrate, including an interior area of the first channel, the second channel, and the outlet channel. The second graphene layer overlays the first surface of the substrate, including open regions defined by the first channel, the second channel, and the outlet channel.

Quantitative atomic resolution mapping using high-angle annular dark field scanning transmission electron microscopy

International Nuclear Information System (INIS)

Van Aert, S.; Verbeeck, J.; Erni, R.; Bals, S.; Luysberg, M.; Dyck, D. Van; Tendeloo, G. Van

2009-01-01

A model-based method is proposed to relatively quantify the chemical composition of atomic columns using high angle annular dark field (HAADF) scanning transmission electron microscopy (STEM) images. The method is based on a quantification of the total intensity of the scattered electrons for the individual atomic columns using statistical parameter estimation theory. In order to apply this theory, a model is required describing the image contrast of the HAADF STEM images. Therefore, a simple, effective incoherent model has been assumed which takes the probe intensity profile into account. The scattered intensities can then be estimated by fitting this model to an experimental HAADF STEM image. These estimates are used as a performance measure to distinguish between different atomic column types and to identify the nature of unknown columns with good accuracy and precision using statistical hypothesis testing. The reliability of the method is supported by means of simulated HAADF STEM images as well as a combination of experimental images and electron energy-loss spectra. It is experimentally shown that statistically meaningful information on the composition of individual columns can be obtained even if the difference in averaged atomic number Z is only 3. Using this method, quantitative mapping at atomic resolution using HAADF STEM images only has become possible without the need of simultaneously recorded electron energy loss spectra.

Cryo-transmission electron tomography of native casein micelles from bovine milk

Science.gov (United States)

Trejo, R.; Dokland, T.; Jurat-Fuentes, J.; Harte, F.

2013-01-01

Caseins are the principal protein components in milk and an important ingredient in the food industry. In liquid milk, caseins are found as micelles of casein proteins and colloidal calcium nanoclusters. Casein micelles were isolated from raw skim milk by size exclusion chromatography and suspended in milk protein-free serum produced by ultrafiltration (molecular weight cut-off of 3 kDa) of raw skim milk. The micelles were imaged by cryo-electron microscopy and subjected to tomographic reconstruction methods to visualize the 3-dimensional and internal organization of native casein micelles. This provided new insights into the internal architecture of the casein micelle that had not been apparent from prior cryo-transmission electron microscopy studies. This analysis demonstrated the presence of water-filled cavities (~20 to 30 nm in diameter), channels (diameter greater than ~5 nm), and several hundred high-density nanoclusters (6 to 12 nm in diameter) within the interior of the micelles. No spherical protein submicellar structures were observed. PMID:22118067

Direct nanofabrication and transmission electron microscopy on a suite of easy-to-prepare ultrathin film substrates

International Nuclear Information System (INIS)

Allred, Daniel B.; Zin, Melvin T.; Ma, Hong; Sarikaya, Mehmet; Baneyx, Francois; Jen, Alex K.-Y.; Schwartz, Daniel T.

2007-01-01

A high-yield, easy to master method for preparing electron transparent metal, oxide, and carbon ultrathin film substrates suitable for direct nano/micro-fabrication and transmission electron microscopy (TEM) is presented. To demonstrate the versatility of these substrates for fabrication processes, we use e-beam lithography, self-assembled colloidal and protein templates, and microcontact printing to create patterned masks for subsequent electrodeposition of two dimensional and three dimensional structures. The electrodeposited structures range in scale from a few nanometers to a few micrometers in characteristic dimensions. Because fabrication occurs directly on ultrathin films, TEM analysis of the resulting materials and buried interfaces is straightforward without any destructive sample preparation. We show that all the normal TEM analytical methods (imaging, diffraction, electron and X-ray spectroscopies) are compatible with the fabricated structures and the thin film substrates. These electron transparent substrates have largely rendered the need for TEM sample preparation on fabricated structures obsolete in our lab

Reference nano-dimensional metrology by scanning transmission electron microscopy

International Nuclear Information System (INIS)

Dai, Gaoliang; Fluegge, Jens; Bosse, Harald; Heidelmann, Markus; Kübel, Christian; Prang, Robby

2013-01-01

Traceable and accurate reference dimensional metrology of nano-structures by scanning transmission electron microscopy (STEM) is introduced in the paper. Two methods, one based on the crystal lattice constant and the other based on the pitch of a feature pair, were applied to calibrate the TEM magnification. The threshold value, which was defined as the half-intensity of boundary materials, is suggested to extract the boundary position of features from the TEM image. Experimental investigations have demonstrated the high potential of the proposed methods. For instance, the standard deviation from ten repeated measurements of a line structure with a nominal 100 nm critical dimension (CD) reaches 1σ = 0.023 nm, about 0.02%. By intentionally introduced defocus and larger sample alignment errors, the investigation shows that these influences may reach 0.20 and 1.3 nm, respectively, indicating the importance of high-quality TEM measurements. Finally, a strategy for disseminating the destructive TEM results is introduced. Using this strategy, the CD of a reference material has been accurately determined. Its agreement over five independent TEM measurements is below 1.2 nm. (paper)

Current status and future directions for in situ transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Taheri, Mitra L. [Department of Materials Science and Engineering, Drexel University (United States); Stach, Eric A. [Center for Functional Nanomaterials, National Laboratory, Brookhaven (United States); Arslan, Ilke [Pacific Northwest National Laboratory, Physical and Computational Sciences Directorate, 902 Battelle Blvd, Richland, WA (United States); Crozier, P.A. [School for Engineering of Matter, Transport and Energy, Arizona State University, Tempe, AZ 85281 (United States); Kabius, Bernd C. [The Pennsylvania State University, University Park, PA 16802 (United States); LaGrange, Thomas [Lawrence Livermore National Laboratory, Physical and Life Science Directorate, Condensed Matter and Materials Division, 7000 East Avenue, P.O. 808 L-356 (United States); Minor, Andrew M. [Department of Materials Science & Engineering, University of California, Berkeley and National Center for Electron Microscopy, Molecular Foundry, Lawrence Berkeley National Laboratory, One Cyclotron Road, MS 72, Berkeley, CA (United States); Takeda, Seiji [Institute of Scientific and Industrial Research (ISIR), Osaka University, 8-1 Mihogaoka, Ibaraki, Osaka 567-0047 (Japan); Tanase, Mihaela [Center for Nanoscale Science and Technology, National Institute of Standards and Technology, Gaithersburg, MD 20899-6203 (United States); Wagner, Jakob B. [Center for Electron Nanoscopy, Technical University of Denmark, Kgs, Lyngby (Denmark); Sharma, Renu, E-mail: renu.sharma@nist.gov [Center for Nanoscale Science and Technology, National Institute of Standards and Technology, Gaithersburg, MD 20899-6203 (United States)

2016-11-15

This review article discusses the current and future possibilities for the application of in situ transmission electron microscopy to reveal synthesis pathways and functional mechanisms in complex and nanoscale materials. The findings of a group of scientists, representing academia, government labs and private sector entities (predominantly commercial vendors) during a workshop, held at the Center for Nanoscale Science and Technology- National Institute of Science and Technology (CNST-NIST), are discussed. We provide a comprehensive review of the scientific needs and future instrument and technique developments required to meet them. - Highlights: • Evaluation of currently available technology for performing in situ experiments using transmission electron microscope. • Limitations of currently available instrumentation with respect to base TEM, specialty TEM holders, and data acquisition systems. • Guidelines and wish list for the areas of future development.

Current status and future directions for in situ transmission electron microscopy

International Nuclear Information System (INIS)

Taheri, Mitra L.; Stach, Eric A.; Arslan, Ilke; Crozier, P.A.; Kabius, Bernd C.; LaGrange, Thomas; Minor, Andrew M.; Takeda, Seiji; Tanase, Mihaela; Wagner, Jakob B.; Sharma, Renu

2016-01-01

This review article discusses the current and future possibilities for the application of in situ transmission electron microscopy to reveal synthesis pathways and functional mechanisms in complex and nanoscale materials. The findings of a group of scientists, representing academia, government labs and private sector entities (predominantly commercial vendors) during a workshop, held at the Center for Nanoscale Science and Technology- National Institute of Science and Technology (CNST-NIST), are discussed. We provide a comprehensive review of the scientific needs and future instrument and technique developments required to meet them. - Highlights: • Evaluation of currently available technology for performing in situ experiments using transmission electron microscope. • Limitations of currently available instrumentation with respect to base TEM, specialty TEM holders, and data acquisition systems. • Guidelines and wish list for the areas of future development.

Investigating the mesostructure of ordered porous silica nanocomposites by transmission electron microscopy techniques

Energy Technology Data Exchange (ETDEWEB)

Bullita, S.; Casula, M. F., E-mail: casulaf@unica.it [INSTM and Department of Chemical and Geological Science, University of Cagliari, Monserrato (Canada) (Italy); Piludu, M. [Department of Biomedical Sciences, University of Cagliari, Monserrato (Canada) (Italy); Falqui, A. [INSTM and Department of Chemical and Geological Science, University of Cagliari, Monserrato (Canada) Italy and KAUST-King Abdullah University of Science and Technology, Jeddah (Saudi Arabia); Carta, D. [INSTM and Department of Chemical and Geological Science, University of Cagliari, Monserrato (Canada), Italy and Faculty of Physical Sciences and Engineering, University of Southampton, Southampton (United Kingdom); Corrias, A. [INSTM and Department of Chemical and Geological Science, University of Cagliari, Monserrato (Canada) Italy and School of Physical Sciences, Ingram Building, University of Kent, Canterbury (United Kingdom)

2014-10-21

Nanocomposites made out of FeCo alloy nanocrystals supported onto pre-formed mesoporous ordered silica which features a cubic arrangement of pores (SBA-16) were investigated. Information on the effect of the nanocrystals on the mesostructure (i.e. pore arrangement symmetry, pore size, and shape) were deduced by a multitechnique approach including N2 physisorption, low angle X-ray diffraction, and Transmission electron microscopy. It is shown that advanced transmission electron microscopy techniques are required, however, to gain direct evidence on key compositional and textural features of the nanocomposites. In particular, electron tomography and microtomy techniques make clear that the FeCo nanocrystals are located within the pores of the SBA-16 silica, and that the ordered mesostructure of the nanocomposite is retained throughout the observed specimen.

Fibonacci quasiregular graphene-based superlattices: Quasiperiodicity and its effects on the transmission, transport and electronic structure properties

Energy Technology Data Exchange (ETDEWEB)

García-Cervantes, H.; Madrigal-Melchor, J.; Martínez-Orozco, J.C.; Rodríguez-Vargas, I., E-mail: isaac@fisica.uaz.edu.mx

2015-12-01

We study the transmission, transport and electronic structure properties of aperiodic Fibonacci monolayer graphene-based structures (AFGBSs). The transfer matrix method has been implemented to obtain the transmittance, linear-regime conductance and electronic structure. In particular, we have studied two types of aperiodic graphene-based structures: (1) electrostatic AFGBSs (EAFGBSs), structures formed with electrostatic potentials, and (2) substrate AFGBSs (SAFGBSs), obtained alternating substrates that can open and non-open, such as SiC and SiO{sub 2}, an energy bandgap on graphene. We have found that the transmission properties can be modulated readily by changing the main parameters of the systems: well and barrier widths, energy and angle of incident electrons and the degree of aperiodicity. In the case of the linear-regime conductance turns out that it diminishes various orders of magnitude increasing the barrier width for SAFGBSs. On the contrary, Klein tunneling sustains the conductance in EAFGBSs. Calculating the electronic structure or miniband-structure formation and its fragmentation we establish a direct connection between the conductance peaks and the opening, closure and degeneration of energy minibands for both EAFGSLs and SAFGSLs.

Achromatic elemental mapping beyond the nanoscale in the transmission electron microscope.

Science.gov (United States)

Urban, K W; Mayer, J; Jinschek, J R; Neish, M J; Lugg, N R; Allen, L J

2013-05-03

Newly developed achromatic electron optics allows the use of wide energy windows and makes feasible energy-filtered transmission electron microscopy (EFTEM) at atomic resolution. In this Letter we present EFTEM images formed using electrons that have undergone a silicon L(2,3) core-shell energy loss, exhibiting a resolution in EFTEM of 1.35 Å. This permits elemental mapping beyond the nanoscale provided that quantum mechanical calculations from first principles are done in tandem with the experiment to understand the physical information encoded in the images.

A simple and inclusive method to determine the habit plane in transmission electron microscope based on accurate measurement of foil thickness

International Nuclear Information System (INIS)

Qiu, Dong; Zhang, Mingxing

2014-01-01

A simple and inclusive method is proposed for accurate determination of the habit plane between bicrystals in transmission electron microscope. Whilst this method can be regarded as a variant of surface trace analysis, the major innovation lies in the improved accuracy and efficiency of foil thickness measurement, which involves a simple tilt of the thin foil about a permanent tilting axis of the specimen holder, rather than cumbersome tilt about the surface trace of the habit plane. Experimental study has been done to validate this proposed method in determining the habit plane between lamellar α 2 plates and γ matrix in a Ti–Al–Nb alloy. Both high accuracy (± 1°) and high precision (± 1°) have been achieved by using the new method. The source of the experimental errors as well as the applicability of this method is discussed. Some tips to minimise the experimental errors are also suggested. - Highlights: • An improved algorithm is formulated to measure the foil thickness. • Habit plane can be determined with a single tilt holder based on the new algorithm. • Better accuracy and precision within ± 1° are achievable using the proposed method. • The data for multi-facet determination can be collected simultaneously

Transmission of high-power electron beams through small apertures

International Nuclear Information System (INIS)

Tschalär, C.; Alarcon, R.; Balascuta, S.; Benson, S.V.; Bertozzi, W.; Boyce, J.R.; Cowan, R.; Douglas, D.; Evtushenko, P.; Fisher, P.; Ihloff, E.; Kalantarians, N.; Kelleher, A.; Legg, R.; Milner, R.G.; Neil, G.R.; Ou, L.; Schmookler, B.; Tennant, C.; Williams, G.P.

2013-01-01

Tests were performed to pass a 100 MeV, 430 kWatt c.w. electron beam from the energy-recovery linac at the Jefferson Laboratory's FEL facility through a set of small apertures in a 127 mm long aluminum block. Beam transmission losses of 3 p.p.m. through a 2 mm diameter aperture were maintained during a 7 h continuous run

Charging of carbon thin films in scanning and phase-plate transmission electron microscopy

DEFF Research Database (Denmark)

Hettler, Simon; Kano, Emi; Dries, Manuel

2018-01-01

A systematic study on charging of carbon thin films under intense electron-beam irradiation was performed in a transmission electron microscope to identify the underlying physics for the functionality of hole-free phase plates. Thin amorphous carbon films fabricated by different deposition techni...

Cryo-transmission electron microscopy of Ag nanoparticles grown on an ionic liquid substrate

KAUST Repository

Anjum, Dalaver H.

2010-07-01

We report a novel method of growing silver nanostructures by cathodic sputtering onto an ionic liquid (IL) and our visualization by transmission cryo-electron microscopy to avoid beam-induced motion of the nanoparticles. By freezing the IL suspension and controlling electron dose, we can assess properties of particle size, morphology, crystallinity, and aggregation in situ and at high detail. We observed round silver nanoparticles with a well-defined diameter of 7.0 ± 1.5 nm that are faceted with crystalline cubic structures and ∼80% of the particles have multiply twinned faults. We also applied cryo-electron tomography to investigate the structure of the nanoparticles and to directly visualize the IL wetting around them. In addition to particles, we observed nanorods that appear to have assembled from individual nanoparticles. Reexamination of the samples after 4-5 days from initial preparation showed significant changes in morphology, and potential mechanisms for this are discussed. © 2010 Materials Research Society.

Magnetically insulated transmission line used for relativistic electron beam injection into SPAC-VI

International Nuclear Information System (INIS)

Tsuzuki, Tetsuya; Narihara, Kazumichi; Tomita, Yukihiro; Mohri, Akihiro.

1980-10-01

For the purpose to inject the electron beam with energy of about 1.5 MeV and current of about 100 kA into the SPAC-6 (torus device), a magnetically insulated transmission line was designed and constructed. The motion of electrons in the line was theoretically analyzed. The requirements for the design of the transmission line were as follows-: (a) condition of magnetic insulation, (b) suppression against reverse gas flow from the beam source to the torus, (c) care to minimize the influence of strong torus magnetic field, (d) reduction of inductance and (e) safety engineering measures, e.g., separation valve in the MITL between the beam source and the SPAC-6. The transmission line of 2.4 m long was designed and constructed. The wave forms of electric potential and current were measured. The transmission efficiency of current along the axis and the efficiency as a function of current at the end of the line were also measured. The reason of the loss of current is discussed. (J.P.N.)

Transmission dosimetry with a liquid-filled electronic portal imaging device

Energy Technology Data Exchange (ETDEWEB)

Boellaard, R; Van Herk, M; Mijnheer, B J [Nederlands Kanker Inst. ` Antoni van Leeuwenhoekhuis` , Amsterdam (Netherlands)

1995-12-01

The aim of transmission dosimetry is to correlate transmission dose values with patient dose values. A liquid-filled electronic portal imaging device (EPID) has been developed. After determination of the dose response relationship, i.e. the relation between pixel value and dose rate, for clinical situations it was found that the EPID is applicable for two-dimensional dosimetry with an accuracy of about 1%. The aim of this study was to investigate transmission dose distributions at different phantom-detector distances to predict exit dose distributions from transmission dose images. An extensive set of transmission dose measurements below homogeneous phantoms were performed with the EPID. The influence of several parameters such as field size, phantom thickness, phantom-detector distance and phantom-source distance on the transmission dose and its distribution were investigated. The two-dimensional transmission dose images were separated into two components: a primary dose and a scattered dose distribution. It was found that the scattered dose is maximal at a phantom thickness of about 10 cm. The scattered dose distribution below a homogeneous phantom has a Gaussian shape. The width of the Gaussian is small at small phantom-detector distances and increases for larger phantom-detector distances. The dependence of the scattered dose distribution on the field size at various phantom-detector distances has been used to estimate the dose distribution at the exit site of the phantom. More work is underway to determine the exit dose distributions for clinical situations, including the presence of inhomogeneities.

Transmission dosimetry with a liquid-filled electronic portal imaging device

International Nuclear Information System (INIS)

Boellaard, R.; Van Herk, M.; Mijnheer, B.J.

1995-01-01

The aim of transmission dosimetry is to correlate transmission dose values with patient dose values. A liquid-filled electronic portal imaging device (EPID) has been developed. After determination of the dose response relationship, i.e. the relation between pixel value and dose rate, for clinical situations it was found that the EPID is applicable for two-dimensional dosimetry with an accuracy of about 1%. The aim of this study was to investigate transmission dose distributions at different phantom-detector distances to predict exit dose distributions from transmission dose images. An extensive set of transmission dose measurements below homogeneous phantoms were performed with the EPID. The influence of several parameters such as field size, phantom thickness, phantom-detector distance and phantom-source distance on the transmission dose and its distribution were investigated. The two-dimensional transmission dose images were separated into two components: a primary dose and a scattered dose distribution. It was found that the scattered dose is maximal at a phantom thickness of about 10 cm. The scattered dose distribution below a homogeneous phantom has a Gaussian shape. The width of the Gaussian is small at small phantom-detector distances and increases for larger phantom-detector distances. The dependence of the scattered dose distribution on the field size at various phantom-detector distances has been used to estimate the dose distribution at the exit site of the phantom. More work is underway to determine the exit dose distributions for clinical situations, including the presence of inhomogeneities

Advanced scanning transmission stereo electron microscopy of structural and functional engineering materials

International Nuclear Information System (INIS)

Agudo Jácome, L.; Eggeler, G.; Dlouhý, A.

2012-01-01

Stereo transmission electron microscopy (TEM) provides a 3D impression of the microstructure in a thin TEM foil. It allows to perform depth and TEM foil thickness measurements and to decide whether a microstructural feature lies inside of a thin foil or on its surface. It allows appreciating the true three-dimensional nature of dislocation configurations. In the present study we first review some basic elements of classical stereo TEM. We then show how the method can be extended by working in the scanning transmission electron microscope (STEM) mode of a modern analytical 200 kV TEM equipped with a field emission gun (FEG TEM) and a high angle annular dark field (HAADF) detector. We combine two micrographs of a stereo pair into one anaglyph. When viewed with special colored glasses the anaglyph provides a direct and realistic 3D impression of the microstructure. Three examples are provided which demonstrate the potential of this extended stereo TEM technique: a single crystal Ni-base superalloy, a 9% Chromium tempered martensite ferritic steel and a NiTi shape memory alloy. We consider the effect of camera length, show how foil thicknesses can be measured, and discuss the depth of focus and surface effects. -- Highlights: ► The advanced STEM/HAADF diffraction contrast is extended to 3D stereo-imaging. ► The advantages of the new technique over stereo-imaging in CTEM are demonstrated. ► The new method allows foil thickness measurements in a broad range of conditions. ► We show that features associated with ion milling surface damage can be beneficial for appreciating 3D features of the microstructure.

Advanced scanning transmission stereo electron microscopy of structural and functional engineering materials

Energy Technology Data Exchange (ETDEWEB)

Agudo Jacome, L., E-mail: leonardo.agudo@bam.de [Institut fuer Werkstoffe, Ruhr-Universitaet Bochum, D-44780 Bochum (Germany); Eggeler, G., E-mail: gunther.eggeler@ruhr-uni-bochum.de [Institut fuer Werkstoffe, Ruhr-Universitaet Bochum, D-44780 Bochum (Germany); Dlouhy, A., E-mail: dlouhy@ipm.cz [Institute of Physics of Materials, Academy of Sciences of the Czech Republic, Zizkova 22, 616 62 Brno (Czech Republic)

2012-11-15

Stereo transmission electron microscopy (TEM) provides a 3D impression of the microstructure in a thin TEM foil. It allows to perform depth and TEM foil thickness measurements and to decide whether a microstructural feature lies inside of a thin foil or on its surface. It allows appreciating the true three-dimensional nature of dislocation configurations. In the present study we first review some basic elements of classical stereo TEM. We then show how the method can be extended by working in the scanning transmission electron microscope (STEM) mode of a modern analytical 200 kV TEM equipped with a field emission gun (FEG TEM) and a high angle annular dark field (HAADF) detector. We combine two micrographs of a stereo pair into one anaglyph. When viewed with special colored glasses the anaglyph provides a direct and realistic 3D impression of the microstructure. Three examples are provided which demonstrate the potential of this extended stereo TEM technique: a single crystal Ni-base superalloy, a 9% Chromium tempered martensite ferritic steel and a NiTi shape memory alloy. We consider the effect of camera length, show how foil thicknesses can be measured, and discuss the depth of focus and surface effects. -- Highlights: Black-Right-Pointing-Pointer The advanced STEM/HAADF diffraction contrast is extended to 3D stereo-imaging. Black-Right-Pointing-Pointer The advantages of the new technique over stereo-imaging in CTEM are demonstrated. Black-Right-Pointing-Pointer The new method allows foil thickness measurements in a broad range of conditions. Black-Right-Pointing-Pointer We show that features associated with ion milling surface damage can be beneficial for appreciating 3D features of the microstructure.

The Design and Construction of a Simple Transmission Electron Microscope for Educational Purposes.

Science.gov (United States)

Hearsey, Paul K.

This document presents a model for a simple transmission electron microscope for educational purposes. This microscope could demonstrate thermonic emission, particle acceleration, electron deflection, and flourescence. It is designed to be used in high school science courses, particularly physics, taking into account the size, weight, complexity…

Cathodoluminescence in the scanning transmission electron microscope

Energy Technology Data Exchange (ETDEWEB)

Kociak, M., E-mail: mathieu.kociak@u-psud.fr [Laboratoire de Physique des Solides, Université Paris-SudParis-Sud, CNRS-UMR 8502, Orsay 91405 (France); Zagonel, L.F. [“Gleb Wataghin” Institute of Physics University of Campinas - UNICAMP, 13083-859 Campinas, São Paulo (Brazil)

2017-05-15

Cathodoluminescence (CL) is a powerful tool for the investigation of optical properties of materials. In recent years, its combination with scanning transmission electron microscopy (STEM) has demonstrated great success in unveiling new physics in the field of plasmonics and quantum emitters. Most of these results were not imaginable even twenty years ago, due to conceptual and technical limitations. The purpose of this review is to present the recent advances that broke these limitations, and the new possibilities offered by the modern STEM-CL technique. We first introduce the different STEM-CL operating modes and the technical specificities in STEM-CL instrumentation. Two main classes of optical excitations, namely the coherent one (typically plasmons) and the incoherent one (typically light emission from quantum emitters) are investigated with STEM-CL. For these two main classes, we describe both the physics of light production under electron beam irradiation and the physical basis for interpreting STEM-CL experiments. We then compare STEM-CL with its better known sister techniques: scanning electron microscope CL, photoluminescence, and electron energy-loss spectroscopy. We finish by comprehensively reviewing recent STEM-CL applications. - Highlights: • Reviews the field of STEM-CL. • Introduces the technical requirements and challenges for STEM-CL. • Introduces the different types of excitations probed by STEM-CL. • Gives comprehensive overview of the last fifteenth years in the field.

Sample preparation methods for scanning electron microscopy of homogenized Al-Mg-Si billets: A comparative study

International Nuclear Information System (INIS)

Österreicher, Johannes Albert; Kumar, Manoj; Schiffl, Andreas; Schwarz, Sabine; Hillebrand, Daniel; Bourret, Gilles Remi

2016-01-01

Characterization of Mg-Si precipitates is crucial for optimizing the homogenization heat treatment of Al-Mg-Si alloys. Although sample preparation is key for high quality scanning electron microscopy imaging, most common methods lead to dealloying of Mg-Si precipitates. In this article we systematically evaluate different sample preparation methods: mechanical polishing, etching with various reagents, and electropolishing using different electrolytes. We demonstrate that the use of a nitric acid and methanol electrolyte for electropolishing a homogenized Al-Mg-Si alloy prevents the dissolution of Mg-Si precipitates, resulting in micrographs of higher quality. This preparation method is investigated in depth and the obtained scanning electron microscopy images are compared with transmission electron micrographs: the shape and size of Mg-Si precipitates appear very similar in either method. The scanning electron micrographs allow proper identification and measurement of the Mg-Si phases including needles with lengths of roughly 200 nm. These needles are β″ precipitates as confirmed by high resolution transmission electron microscopy. - Highlights: •Secondary precipitation in homogenized 6xxx Al alloys is crucial for extrudability. •Existing sample preparation methods for SEM are improvable. •Electropolishing with nitric acid/methanol yields superior quality in SEM. •The obtained micrographs are compared to TEM micrographs.

Sample preparation methods for scanning electron microscopy of homogenized Al-Mg-Si billets: A comparative study

Energy Technology Data Exchange (ETDEWEB)

Österreicher, Johannes Albert; Kumar, Manoj [LKR Light Metals Technologies Ranshofen, Austrian Institute of Technology, Postfach 26, 5282 Ranshofen (Austria); Schiffl, Andreas [Hammerer Aluminium Industries Extrusion GmbH, Lamprechtshausener Straße 69, 5282 Ranshofen (Austria); Schwarz, Sabine [University Service Centre for Transmission Electron Microscopy, Vienna University of Technology, Wiedner Hauptstr. 8-10, 1040 Wien (Austria); Hillebrand, Daniel [Hammerer Aluminium Industries Extrusion GmbH, Lamprechtshausener Straße 69, 5282 Ranshofen (Austria); Bourret, Gilles Remi, E-mail: gilles.bourret@sbg.ac.at [Department of Materials Science and Physics, University of Salzburg, Hellbrunner Straße 34, 5020 Salzburg (Austria)

2016-12-15

Characterization of Mg-Si precipitates is crucial for optimizing the homogenization heat treatment of Al-Mg-Si alloys. Although sample preparation is key for high quality scanning electron microscopy imaging, most common methods lead to dealloying of Mg-Si precipitates. In this article we systematically evaluate different sample preparation methods: mechanical polishing, etching with various reagents, and electropolishing using different electrolytes. We demonstrate that the use of a nitric acid and methanol electrolyte for electropolishing a homogenized Al-Mg-Si alloy prevents the dissolution of Mg-Si precipitates, resulting in micrographs of higher quality. This preparation method is investigated in depth and the obtained scanning electron microscopy images are compared with transmission electron micrographs: the shape and size of Mg-Si precipitates appear very similar in either method. The scanning electron micrographs allow proper identification and measurement of the Mg-Si phases including needles with lengths of roughly 200 nm. These needles are β″ precipitates as confirmed by high resolution transmission electron microscopy. - Highlights: •Secondary precipitation in homogenized 6xxx Al alloys is crucial for extrudability. •Existing sample preparation methods for SEM are improvable. •Electropolishing with nitric acid/methanol yields superior quality in SEM. •The obtained micrographs are compared to TEM micrographs.

A transaction assessment method for allocation of transmission services

Science.gov (United States)

Banunarayanan, Venkatasubramaniam

The purpose of this research is to develop transaction assessment methods for allocating transmission services that are provided by an area/utility to power transactions. Transmission services are the services needed to deliver, or provide the capacity to deliver, real and reactive power from one or more supply points to one or more delivery points. As the number of transactions increase rapidly in the emerging deregulated environment, accurate quantification of the transmission services an area/utility provides to accommodate a transaction is becoming important, because then appropriate pricing schemes can be developed to compensate for the parties that provide these services. The Allocation methods developed are based on the "Fair Resource Allocation Principle" and they determine for each transaction the following: the flowpath of the transaction (both real and reactive power components), generator reactive power support from each area/utility, real power loss support from each area/utility. Further, allocation methods for distributing the cost of relieving congestion on transmission lines caused by transactions are also developed. The main feature of the proposed methods is representation of actual usage of the transmission services by the transactions. The proposed method is tested extensively on a variety of systems. The allocation methods developed in this thesis for allocation of transmission services to transactions is not only useful in studying the impact of transactions on a transmission system in a multi-transaction case, but they are indeed necessary to meet the criteria set forth by FERC with regard to pricing based on actual usage. The "consistency" of the proposed allocation methods has also been investigated and tested.

Biological Applications and Transmission Electron Microscopy Investigations of Mesoporous Silica Nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Trewyn, Brian G. [Iowa State Univ., Ames, IA (United States)

2006-01-01

The research presented and discussed within involves the development of novel biological applications of mesoporous silica nanoparticles (MSN) and an investigation of mesoporous material by transmission electron microscopy (TEM). Mesoporous silica nanoparticles organically functionalized shown to undergo endocytosis in cancer cells and drug release from the pores was controlled intracellularly and intercellularly. Transmission electron microscopy investigations demonstrated the variety of morphologies produced in this field of mesoporous silica nanomaterial synthesis. A series of room-temperature ionic liquid (RTIL) containing mesoporous silica nanoparticle (MSN) materials with various particle morphologies, including spheres, ellipsoids, rods, and tubes, were synthesized. By changing the RTIL template, the pore morphology was tuned from the MCM-41 type of hexagonal mesopores to rotational moire type of helical channels, and to wormhole-like porous structures. These materials were used as controlled release delivery nanodevices to deliver antibacterial ionic liquids against Escherichia coli K12. The involvement of a specific organosiloxane function group, covalently attached to the exterior of fluorescein doped mesoporous silica nanoparticles (FITC-MSN), on the degree and kinetics of endocytosis in cancer and plant cells was investigated. The kinetics of endocystosis of TEG coated FITC-MSN is significantly quicker than FITC-MSN as determined by flow cytometry experiments. The fluorescence confocal microscopy investigation showed the endocytosis of TEG coated-FITC MSN triethylene glycol grafted fluorescein doped MSN (TEG coated-FITC MSN) into both KeLa cells and Tobacco root protoplasts. Once the synthesis of a controlled-release delivery system based on MCM-41-type mesoporous silica nanorods capped by disulfide bonds with superparamagnetic iron oxide nanoparticles was completed. The material was characterized by general methods and the dosage and kinetics of the

Current status and future directions for in situ transmission electron microscopy

DEFF Research Database (Denmark)

Taheri, Mitra L.; Stach, Eric A.; Arslan, Ilke

2016-01-01

This review article discusses the current and future possibilities for the application of in situ transmission electron microscopy to reveal synthesis pathways and functional mechanisms in complex and nanoscale materials. The findings of a group of scientists, representing academia, government labs...

Facilities for in situ ion beam studies in transmission electron microscopes

International Nuclear Information System (INIS)

Allen, C.W.; Ohnuki, S.; Takahashi, H.

1993-08-01

Interfacing an ion accelerator to a transmission electron microscope (TEM) allows the analytical functions of TEM imaging and electron diffraction from very small regions to be employed during ion-irradiation effects studies. At present there are ten such installations in Japan, one in France and one in the USA. General specifications of facilities which are operational in 1993 are summarized, and additional facilities which are planned or being proposed are briefly described

Improved methods for high resolution electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Taylor, J.R.

1987-04-01

Existing methods of making support films for high resolution transmission electron microscopy are investigated and novel methods are developed. Existing methods of fabricating fenestrated, metal reinforced specimen supports (microgrids) are evaluated for their potential to reduce beam induced movement of monolamellar crystals of C/sub 44/H/sub 90/ paraffin supported on thin carbon films. Improved methods of producing hydrophobic carbon films by vacuum evaporation, and improved methods of depositing well ordered monolamellar paraffin crystals on carbon films are developed. A novel technique for vacuum evaporation of metals is described which is used to reinforce microgrids. A technique is also developed to bond thin carbon films to microgrids with a polymer bonding agent. Unique biochemical methods are described to accomplish site specific covalent modification of membrane proteins. Protocols are given which covalently convert the carboxy terminus of papain cleaved bacteriorhodopsin to a free thiol. 53 refs., 19 figs., 1 tab.

Virus Particle Detection by Convolutional Neural Network in Transmission Electron Microscopy Images.

Science.gov (United States)

Ito, Eisuke; Sato, Takaaki; Sano, Daisuke; Utagawa, Etsuko; Kato, Tsuyoshi

2018-06-01

A new computational method for the detection of virus particles in transmission electron microscopy (TEM) images is presented. Our approach is to use a convolutional neural network that transforms a TEM image to a probabilistic map that indicates where virus particles exist in the image. Our proposed approach automatically and simultaneously learns both discriminative features and classifier for virus particle detection by machine learning, in contrast to existing methods that are based on handcrafted features that yield many false positives and require several postprocessing steps. The detection performance of the proposed method was assessed against a dataset of TEM images containing feline calicivirus particles and compared with several existing detection methods, and the state-of-the-art performance of the developed method for detecting virus was demonstrated. Since our method is based on supervised learning that requires both the input images and their corresponding annotations, it is basically used for detection of already-known viruses. However, the method is highly flexible, and the convolutional networks can adapt themselves to any virus particles by learning automatically from an annotated dataset.

Shielding Effectiveness Analysis and Modification of the Coupling Effect Transmission Line Method on Cavities with Multi-Sided Apertures

Directory of Open Access Journals (Sweden)

Tao Hu

2018-04-01

Full Text Available Because the traditional transmission line method treats electromagnetic waves as excitation sources and the cavity as a rectangular waveguide whose terminal is shorted, the transmission line method can only calculate shielding effectiveness in the center line of the cavity with apertures on one side. In this paper, the aperture coupling effect of different sides was analyzed based on vector analysis. According to the field intensity distribution of different transport modes in the rectangular waveguide, the calculation model of cavity shielding effectiveness in any position is proposed, which can solve the question of the calculation model of shielding effectiveness in any position in the traditional method of equivalent transmission methods. Further expansion of the equivalent transmission lines model is adopted to study the shielding effectiveness of different aperture cavities, and the coupling effect rule of the incident angle, the number of apertures, and the size of the cavity is obtained, which can provide the technical support for the design of electromagnetic shielding cavities for electronic equipment.

Statistical image reconstruction methods for simultaneous emission/transmission PET scans

International Nuclear Information System (INIS)

Erdogan, H.; Fessler, J.A.

1996-01-01

Transmission scans are necessary for estimating the attenuation correction factors (ACFs) to yield quantitatively accurate PET emission images. To reduce the total scan time, post-injection transmission scans have been proposed in which one can simultaneously acquire emission and transmission data using rod sources and sinogram windowing. However, since the post-injection transmission scans are corrupted by emission coincidences, accurate correction for attenuation becomes more challenging. Conventional methods (emission subtraction) for ACF computation from post-injection scans are suboptimal and require relatively long scan times. We introduce statistical methods based on penalized-likelihood objectives to compute ACFs and then use them to reconstruct lower noise PET emission images from simultaneous transmission/emission scans. Simulations show the efficacy of the proposed methods. These methods improve image quality and SNR of the estimates as compared to conventional methods

Dose-rate-dependent damage of cerium dioxide in the scanning transmission electron microscope.

Science.gov (United States)

Johnston-Peck, Aaron C; DuChene, Joseph S; Roberts, Alan D; Wei, Wei David; Herzing, Andrew A

2016-11-01

Beam damage caused by energetic electrons in the transmission electron microscope is a fundamental constraint limiting the collection of artifact-free information. Through understanding the influence of the electron beam, experimental routines may be adjusted to improve the data collection process. Investigations of CeO 2 indicate that there is not a critical dose required for the accumulation of electron beam damage. Instead, measurements using annular dark field scanning transmission electron microscopy and electron energy loss spectroscopy demonstrate that the onset of measurable damage occurs when a critical dose rate is exceeded. The mechanism behind this phenomenon is that oxygen vacancies created by exposure to a 300keV electron beam are actively annihilated as the sample re-oxidizes in the microscope environment. As a result, only when the rate of vacancy creation exceeds the recovery rate will beam damage begin to accumulate. This observation suggests that dose-intensive experiments can be accomplished without disrupting the native structure of the sample when executed using dose rates below the appropriate threshold. Furthermore, the presence of an encapsulating carbonaceous layer inhibits processes that cause beam damage, markedly increasing the dose rate threshold for the accumulation of damage. Published by Elsevier B.V.

Transmission electron microscopy investigation of colloids and particles from landfill leachates

Czech Academy of Sciences Publication Activity Database

Matura, M.; Ettler, V.; Klementová, Mariana

2012-01-01

Roč. 30, č. 5 (2012), s. 530-541 ISSN 0734-242X Institutional research plan: CEZ:AV0Z40320502 Keywords : colloids * landfill leachates * transmission electron microscopy * calcite * contaminant mobility Subject RIV: CA - Inorganic Chemistry Impact factor: 1.047, year: 2012

Three-dimensional optical transfer functions in the aberration-corrected scanning transmission electron microscope.

Science.gov (United States)

Jones, L; Nellist, P D

2014-05-01

In the scanning transmission electron microscope, hardware aberration correctors can now correct for the positive spherical aberration of round electron lenses. These correctors make use of nonround optics such as hexapoles or octupoles, leading to the limiting aberrations often being of a nonround type. Here we explore the effect of a number of potential limiting aberrations on the imaging performance of the scanning transmission electron microscope through their resulting optical transfer functions. In particular, the response of the optical transfer function to changes in defocus are examined, given that this is the final aberration to be tuned just before image acquisition. The resulting three-dimensional optical transfer functions also allow an assessment of the performance of a system for focal-series experiments or optical sectioning applications. © 2014 The Authors Journal of Microscopy © 2014 Royal Microscopical Society.

Post-ion beam induced degradation of copper layers in transmission electron microscopy specimens

Science.gov (United States)

Seidel, F.; Richard, O.; Bender, H.; Vandervorst, W.

2015-11-01

Copper containing transmission electron microscopy (TEM) specimens frequently show corrosion after focused ion beam (FIB) preparation. This paper reveals that the corrosion product is a Cu-S phase growing over the specimen surface. The layer is identified by energy-dispersive x-ray spectroscopy, and lattice spacing indexing of power spectra patterns. The corrosion process is further studied by TEM on cone-shaped specimens, which are intentionally stored after FIB preparation with S flakes for short time. Furthermore, a protective method against corrosion is developed by varying the time in the FIB vacuum and the duration of a subsequent plasma cleaning.

Thermal diffuse scattering in transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Forbes, B.D.; D' Alfonso, A.J. [School of Physics, University of Melbourne, Parkville, Victoria 3010 (Australia); Findlay, S.D. [School of Physics, Monash University, Victoria 3800 (Australia); Van Dyck, D. [EMAT, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp (Belgium); LeBeau, J.M. [North Carolina State University, Raleigh, NC 27695-7907 (United States); Stemmer, S. [Materials Department, University of California, Santa Barbara, CA 93106-5050 (United States); Allen, L.J., E-mail: lja@unimelb.edu.au [School of Physics, University of Melbourne, Parkville, Victoria 3010 (Australia)

2011-12-15

In conventional transmission electron microscopy, thermal scattering significantly affects the image contrast. It has been suggested that not accounting for this correctly is the main cause of the Stobbs factor, the ubiquitous, large contrast mismatch found between theory and experiment. In the case where a hard aperture is applied, we show that previous conclusions drawn from work using bright field scanning transmission electron microscopy and invoking the principle of reciprocity are reliable in the presence of thermal scattering. In the aperture-free case it has been suggested that even the most sophisticated mathematical models for thermal diffuse scattering lack in their numerical implementation, specifically that there may be issues in sampling, including that of the contrast transfer function of the objective lens. We show that these concerns can be satisfactorily overcome with modest computing resources; thermal scattering can be modelled accurately enough for the purpose of making quantitative comparison between simulation and experiment. Spatial incoherence of the source is also investigated. Neglect or inadequate handling of thermal scattering in simulation can have an appreciable effect on the predicted contrast and can be a significant contribution to the Stobbs factor problem. -- Highlights: Black-Right-Pointing-Pointer We determine the numerical requirements for accurate simulation of TDS in CTEM. Black-Right-Pointing-Pointer TDS can be simulated to high precision using the Born-Oppenheimer model. Black-Right-Pointing-Pointer Such calculations establish the contribution of TDS to the Stobbs factor problem. Black-Right-Pointing-Pointer Treating spatial incoherence using envelope functions increases image contrast. Black-Right-Pointing-Pointer Rigorous treatment of spatial incoherence significantly reduces image contrast.

The role of electron irradiation history in liquid cell transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Moser, Trevor H.; Mehta, Hardeep S.; Park, Chiwoo; Kelly, Ryan T.; Shokuhfar, Tolou; Evans, James E.

2018-04-20

In situ liquid cell transmission electron microscopy (LC-TEM) allows dynamic nanoscale characterization of systems in a hydrated state. Although powerful, this technique remains impaired by issues of repeatability that limit experimental fidelity and hinder the identification and control of some variables underlying observed dynamics. We detail new LC- TEM devices that improve experimental reproducibility by expanding available imaging area and providing a platform for investigating electron flux history on the sample. Irradiation history is an important factor influencing LC-TEM results that has, to this point, been largely qualitatively and not quantitatively described. We use these devices to highlight the role of cumulative electron flux history on samples from both nanoparticle growth and biological imaging experiments and demonstrate capture of time zero, low-dose images on beam-sensitive samples. In particular, the ability to capture pristine images of biological samples, where the acquired image is the first time that the cell experiences significant electron flux, allowed us to determine that nanoparticle movement compared to the cell membrane was a function of cell damage and therefore an artifact rather than visualizing cell dynamics in action. These results highlight just a subset of the new science that is accessible with LC-TEM through the new multiwindow devices with patterned focusing aides.

Visualizing aquatic bacteria by light and transmission electron microscopy.

Science.gov (United States)

Silva, Thiago P; Noyma, Natália P; Duque, Thabata L A; Gamalier, Juliana P; Vidal, Luciana O; Lobão, Lúcia M; Chiarini-Garcia, Hélio; Roland, Fábio; Melo, Rossana C N

2014-01-01

The understanding of the functional role of aquatic bacteria in microbial food webs is largely dependent on methods applied to the direct visualization and enumeration of these organisms. While the ultrastructure of aquatic bacteria is still poorly known, routine observation of aquatic bacteria by light microscopy requires staining with fluorochromes, followed by filtration and direct counting on filter surfaces. Here, we used a new strategy to visualize and enumerate aquatic bacteria by light microscopy. By spinning water samples from varied tropical ecosystems in a cytocentrifuge, we found that bacteria firmly adhere to regular slides, can be stained by fluorochoromes with no background formation and fast enumerated. Significant correlations were found between the cytocentrifugation and filter-based methods. Moreover, preparations through cytocentrifugation were more adequate for bacterial viability evaluation than filter-based preparations. Transmission electron microscopic analyses revealed a morphological diversity of bacteria with different internal and external structures, such as large variation in the cell envelope and capsule thickness, and presence or not of thylakoid membranes. Our results demonstrate that aquatic bacteria represent an ultrastructurally diverse population and open avenues for easy handling/quantification and better visualization of bacteria by light microscopy without the need of filter membranes.

Irradiation-related amorphization and crystallization: In situ transmission electron microscope studies

International Nuclear Information System (INIS)

Allen, C.W.

1994-01-01

Interfacing an ion accelerator to a transmission electron microscope (TEM) allows the analytical functions of TEM imaging and diffraction to be employed during ion-irradiation effects studies. At present there are twelve such installations in Japan, one in France and one in the US. This paper treats several aspects of in situ studies involving electron and ion beam induced and enhanced phase transformations and presents results of several in situ experiments to illustrate the dynamics of this approach in the materials science of irradiation effects. The paper describes the ion- and electron-induced amorphization of CuTi; the ion-irradiation-enhanced transformation of TiCr 2 ; and the ion- and electron-irradiation-enhanced crystallization of CoSi 2

Statistical Methods for Single-Particle Electron Cryomicroscopy

DEFF Research Database (Denmark)

Jensen, Katrine Hommelhoff

Electron cryomicroscopy (cryo-EM) is a form of transmission electron microscopy, aimed at reconstructing the 3D structure of a macromolecular complex from a large set of 2D projection images, as they exhibit a very low signal-to-noise ratio (SNR). In the single-particle reconstruction (SPR) probl...

Fifty years old, and still going strong: Transmission electron optical studies of materials

International Nuclear Information System (INIS)

Brown, L.M.

2008-01-01

Highlights in the history of transmission electron microscopy and scanning transmission electron microscopy include the introduction of diffraction contrast, resolution of periodic lattices by phase contrast and incoherent imaging via the high-angle annular dark-field detector. Convergent-beam electron diffraction and analytical electron microscopy, especially the application of energy-dispersive X-ray and electron energy-loss spectrometry, have provided structural and chemical information in addition to strain contrast from lattice defects. From the outset, novel specimen stages and improvements to aid the operator enhanced the electron-optical engineering provided by the instrument makers. The spatial resolution achieved was mainly determined by the way the instrument was used, and not by the basic resolution limit set by the electron optics. However, the application of computer controlled correction of spherical (and higher order) aberration has resulted in a new generation of instruments capable of sub-Angstrom point-to-point resolution. This improved performance, combined with electron energy-loss spectrometry, promises genuine three-dimensional determination of atomic and electronic structure: an indispensable weapon in the battle to fabricate and control useful nanostructures. The uncertainty principle now fundamentally restricts some of the observations one can make, but much more technical development over the next decades must occur before one can say that the techniques of electron-optical imaging of material structure have reached their fundamental limitations. One can expect remarkable progress over the next few years

Characterization of nanomaterials with transmission electron microscopy

KAUST Repository

Anjum, Dalaver H.

2016-08-01

The field of nanotechnology is about research and development on materials whose at least one dimension is in the range of 1 to 100 nanometers. In recent years, the research activity for developing nano-materials has grown exponentially owing to the fact that they offer better solutions to the challenges faced by various fields such as energy, food, and environment. In this paper, the importance of transmission electron microscopy (TEM) based techniques is demonstrated for investigating the properties of nano-materials. Specifically the nano-materials that are investigated in this report include gold nano-particles (Au-NPs), silver atom-clusters (Ag-ACs), tantalum single-atoms (Ta-SAs), carbon materials functionalized with iron cobalt (Fe-Co) NPs and titania (TiO2) NPs, and platinum loaded Ceria (Pt-CeO2) Nano composite. TEM techniques that are employed to investigate nano-materials include aberration corrected bright-field TEM (BF-TEM), high-angle dark-field scanning TEM (HAADF-STEM), electron energy-loss spectroscopy (EELS), and BF-TEM electron tomography (ET). With the help presented of results in this report, it is proved herein that as many TEM techniques as available in a given instrument are essential for a comprehensive nano-scale analysis of nanomaterials.

A numerical method to compute interior transmission eigenvalues

International Nuclear Information System (INIS)

Kleefeld, Andreas

2013-01-01

In this paper the numerical calculation of eigenvalues of the interior transmission problem arising in acoustic scattering for constant contrast in three dimensions is considered. From the computational point of view existing methods are very expensive, and are only able to show the existence of such transmission eigenvalues. Furthermore, they have trouble finding them if two or more eigenvalues are situated closely together. We present a new method based on complex-valued contour integrals and the boundary integral equation method which is able to calculate highly accurate transmission eigenvalues. So far, this is the first paper providing such accurate values for various surfaces different from a sphere in three dimensions. Additionally, the computational cost is even lower than those of existing methods. Furthermore, the algorithm is capable of finding complex-valued eigenvalues for which no numerical results have been reported yet. Until now, the proof of existence of such eigenvalues is still open. Finally, highly accurate eigenvalues of the interior Dirichlet problem are provided and might serve as test cases to check newly derived Faber–Krahn type inequalities for larger transmission eigenvalues that are not yet available. (paper)

A rapid method of reprocessing for electronic microscopy of cut histological in paraffin

International Nuclear Information System (INIS)

Hernandez Chavarri, F.; Vargas Montero, M.; Rivera, P.; Carranza, A.

2000-01-01

A simple and rapid method is described for re-processing of light microscopy paraffin sections to observe they under transmission electron microscopy (TEM) and scanning electron microscopy (SEM) The paraffin-embedded tissue is sectioned and deparaffinized in toluene; then exposed to osmium vapor under microwave irradiation using a domestic microwave oven. The tissues were embedded in epoxy resin, polymerized and ultrathin sectioned. The method requires a relatively short time (about 30 minutes for TEM and 15 for SEM), and produces a reasonable quality of the ultrastructure for diagnostic purposes. (Author) [es

Development of a testing method for asbestos fibers in treated materials of asbestos containing wastes by transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Yamamoto, Takashi, E-mail: tyama@nies.go.jp [Center for Material Cycles and Waste Management Research, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba, Ibaraki 305-8506 (Japan); Kida, Akiko [Faculty of Agriculture, Ehime University, 3-5-7 Tarumi, Matsuyama, Ehime 790-8566 (Japan); Noma, Yukio [Department of Environmental Science, Fukuoka Womens University, 1-1-1 Kasumigaoka, Higashiku, Fukuoka 813-8529 (Japan); Terazono, Atsushi [Center for Material Cycles and Waste Management Research, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba, Ibaraki 305-8506 (Japan); Sakai, Shin-ichi [Environmental Preservation Research Center, Kyoto University, Yoshidahonmachi, Sakyoku, Kyoto 606-8501 (Japan)

2014-02-15

Highlights: • A high sensitive and selective testing method for asbestos in treated materials of asbestos containing wastes was developed. • Asbestos can be determined at a limits are a few million fibers per gram and a few μg g{sup −1}. • High temperature melting treatment samples were determined by this method. Asbestos fiber concentration were below the quantitation limit in all samples, and total fiber concentrations were determined as 47–170 × 10{sup 6} g{sup −1}. - Abstract: Appropriate treatment of asbestos-containing wastes is a significant problem. In Japan, the inertization of asbestos-containing wastes based on new treatment processes approved by the Minister of the Environment is promoted. A highly sensitive method for testing asbestos fibers in inertized materials is required so that these processes can be approved. We developed a method in which fibers from milled treated materials are extracted in water by shaking, and are counted and identified by transmission electron microscopy. Evaluation of this method by using asbestos standards and simulated slag samples confirmed that the quantitation limits are a few million fibers per gram and a few μg/g in a sample of 50 mg per filter. We used this method to assay asbestos fibers in slag samples produced by high-temperature melting of asbestos-containing wastes. Fiber concentrations were below the quantitation limit in all samples, and total fiber concentrations were determined as 47–170 × 10{sup −6} f/g. Because the evaluation of treated materials by TEM is difficult owing to the limited amount of sample observable, this testing method should be used in conjunction with bulk analytical methods for sure evaluation of treated materials.

Characterization of catalysts by scanning transmission electron microscopy

International Nuclear Information System (INIS)

Targos, W.M.; Bradley, S.A.

1989-01-01

The dedicated scanning transmission electron microscope (STEM) is an integral tool for characterizing catalysts because of its unique ability to image and analyze nanosized volumes. This information is valuable in optimizing catalyst formulations and determining causes for reduced catalyst performance. For many commercial catalysts direct correlations between structural features of metal crystallites and catalytic performance are not attainable. When these instances occur, determination of elemental distribution may be the only information available. In this paper the authors discuss some of the techniques employed and limitations associated with characterizing commercial catalysts

Quasi-stationary states of an electron with linearly dependent effective mass in an open nanostructure within transmission coefficient and S-matrix methods

Science.gov (United States)

Seti, Julia; Tkach, Mykola; Voitsekhivska, Oxana

2018-03-01

The exact solutions of the Schrödinger equation for a double-barrier open semiconductor plane nanostructure are obtained by using two different approaches, within the model of the rectangular potential profile and the continuous position-dependent effective mass of the electron. The transmission coefficient and scattering matrix are calculated for the double-barrier nanostructure. The resonance energies and resonance widths of the electron quasi-stationary states are analyzed as a function of the size of the near-interface region between wells and barriers, where the effective mass linearly depends on the coordinate. It is established that, in both methods, the increasing size affects in a qualitatively similar way the spectral characteristics of the states, shifting the resonance energies into the low- or high-energy region and increasing the resonance widths. It is shown that the relative difference of resonance energies and widths of a certain state, obtained in the model of position-dependent effective mass and in the widespread abrupt model in physically correct range of near-interface sizes, does not exceed 0.5% and 5%, respectively, independently of the other geometrical characteristics of the structure.

Effects of Topography in Nano-Structured Thin Films : A Lorentz Transmission Electron Microscopy and Electron Holography Study

NARCIS (Netherlands)

Hosson, Jeff Th.M. De; Raedt, Hans A. De

2003-01-01

This paper aims at applying advanced transmission electron microscopy (TEM) to functional materials, such as ultra-soft magnetic films for high-frequency inductors, to reveal the structure-property relationship. The ultimate goal is to delineate a more quantitative way to obtain information of the

Anisotropic Shape Changes of Silica Nanoparticles Induced in Liquid with Scanning Transmission Electron Microscopy

NARCIS (Netherlands)

Zecevic, J.; Hermannsdorfer, Justus; Schuh, Tobias; de Jong, Krijn P.; de Jonge, Niels

2017-01-01

Liquid-phase transmission electron microscopy (TEM) is used for in-situ imaging of nanoscale processes taking place in liquid, such as the evolution of nanoparticles during synthesis or structural changes of nanomaterials in liquid environment. Here, it is shown that the focused electron beam of

The Development of a Hibachi Window for Electron Beam Transmission in a KrF Laser

International Nuclear Information System (INIS)

Gentile, C.A.; Parsells, R.; Butler, J.E.; Sethian, J.D.; Ciebiera, L.; Hegeler, F.; Jun, C.; Langish, S.; Myers, M.

2003-01-01

In support of Inertial Fusion Energy (IFE), a 150 (micro)m thick silicon (Si) wafer coated on one side with a 1.2 (micro)m nanocrystalline diamond foil is being fabricated as an electron beam transmission (hibachi) window for use in KrF lasers. The hibachi window separates the lasing medium from the electron beam source while allowing the electron beam to pass through. The hibachi window must be capable of withstanding the challenging environment presented in the lasing chamber, which include: fluorine gas, delta pressure >2 atm at 5 Hz, and a high heat flux due to the transmission of electrons passing through the foil. Tests at NRL/Electra and at PPPL have shown that a device employing these novel components in the stated configuration provide for a robust hibachi window with structural integrity

Dysprosium disilicide nanostructures on silicon(001) studied by scanning tunneling microscopy and transmission electron microscopy

International Nuclear Information System (INIS)

Ye Gangfeng; Nogami, Jun; Crimp, Martin A.

2006-01-01

The microstructure of self-assembled dysprosium silicide nanostructures on silicon(001) has been studied by scanning tunneling microscopy and transmission electron microscopy. The studies focused on nanostructures that involve multiple atomic layers of the silicide. Cross-sectional high resolution transmission electron microscopy images and fast Fourier transform analysis showed that both hexagonal and orthorhombic/tetragonal silicide phases were present. Both the magnitude and the anisotropy of lattice mismatch between the silicide and the substrate play roles in the morphology and epitaxial growth of the nanostructures formed

In-situ reduction of promoted cobalt oxide supported on alumina by environmental transmission electron microscopy

DEFF Research Database (Denmark)

Dehghan, Roya; Hansen, Thomas Willum; Wagner, Jakob Birkedal

2011-01-01

the reactivity of the nanoparticles and the importance of controlling the gas composition and specimen temperature during this type of experiment. Similar behaviour was observed for a non-promoted catalyst. Imaging and analysis of the promoted sample before and after reduction indicated a uniform distribution...... resolution transmission electron microscopy and scanning transmission electron microscopy imaging. The cobalt particles were mainly face centred cubic while some hexagonal close packed particles were also found. Reoxidation of the sample upon cooling to room temperature, still under flowing H2, underlines...

Transmission Electron Microscopy of the Gastrointestinal Tract of Nile Perch Lates niloticus

OpenAIRE

Namulawa, V. T; Kato, C. D; Nyatia, E; Rutaisire, J; Britz, P. J

2015-01-01

The ultrastructure of the gastrointestinal tract of Nile perch was described using Transmission Electron Microscopy standard procedures. Investigations revealed the presence of mucous cells, blood vessels and oil droplets plus several nerve cells and muscle bundles in the oral cavity. Further observations revealed columnar epithelial cells in the oesophagus, with a ragged surface, high electron dense cytoplasm, intercellular spaces, mitochondria and mucus granules. The lamina propria of the o...

Highlighting material structure with transmission electron diffraction correlation coefficient maps.

Science.gov (United States)

Kiss, Ákos K; Rauch, Edgar F; Lábár, János L

2016-04-01

Correlation coefficient maps are constructed by computing the differences between neighboring diffraction patterns collected in a transmission electron microscope in scanning mode. The maps are shown to highlight material structural features like grain boundaries, second phase particles or dislocations. The inclination of the inner crystal interfaces are directly deduced from the resulting contrast. Copyright © 2016 Elsevier B.V. All rights reserved.

INVIVO DEGRADATION OF PROCESSED DERMAL SHEEP COLLAGEN EVALUATED WITH TRANSMISSION ELECTRON-MICROSCOPY

NARCIS (Netherlands)

VANWACHEM, PB; VANLUYN, MJA; NIEUWENHUIS, P; KOERTEN, HK; DAMINK, LO; TENHOOPEN, H; FEIJEN, J

The in vivo degradation of hexamethylenediisocyanate-tanned dermal sheep collagen was studied with transmission electron microscopy. Discs of hexamethylenediisocyanate-tanned dermal sheep collagen were subcutaneously implanted in rats. Both an intra- and an extracellular route of degradation could

Characterisation of nano-structured titanium and aluminium nitride coatings by indentation, transmission electron microscopy and electron energy loss spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Girleanu, M., E-mail: maria.girleanu@uha.fr [Mecanique, Materiaux et Procedes de Fabrication, LPMT (EA CNRS 4365), Universite de Haute Alsace, 61 rue Albert Camus, F-68093 Mulhouse (France); Pac, M.-J.; Louis, P. [Mecanique, Materiaux et Procedes de Fabrication, LPMT (EA CNRS 4365), Universite de Haute Alsace, 61 rue Albert Camus, F-68093 Mulhouse (France); Ersen, O.; Werckmann, J. [Departement Structures et Interfaces, IPCMS (UMR CNRS 7504), Universite de Strasbourg, 23 rue du Loess, F-67087 Strasbourg (France); Rousselot, C. [Departement Micro Nano Sciences et Systemes, FEMTO-ST (UMR CNRS 6174), Universite de Franche-Comte, BP 71427, F-25211 Montbeliard (France); Tuilier, M.-H. [Mecanique, Materiaux et Procedes de Fabrication, LPMT (EA CNRS 4365), Universite de Haute Alsace, 61 rue Albert Camus, F-68093 Mulhouse (France)

2011-07-01

Titanium and aluminium nitride Ti{sub 1-x}Al{sub x}N films deposited by radiofrequency magnetron reactive sputtering onto steel substrate are examined by transmission electron microscopy over all the range of composition (x = 0, 0.5, 0.68, 0.86, 1). The deposition parameters are optimised in order to grow nitride films with low stress over all the composition range. Transmission electron microscopy cross-section images of Vickers indentation prints performed on that set of coatings show the evolution of their damage behaviour as increasing x Al content. Cubic Ti-rich nitrides consist of small grains clustered in rather large columns sliding along each other during indentation. Hexagonal Al-rich films grow in thinner columns which can be bent under the Vickers tip. Indentation tests carried out on TiN and AlN films are simulated using finite element modelling. Particular aspects of shear stresses and displacements in the coating/substrate are investigated. The growth mode and the nanostructure of two typical films, TiN and Ti{sub 0.14}Al{sub 0.86}N, are studied in detail by combining transmission electron microscopy cross-sections and plan views. Electron energy loss spectrum taken across Ti{sub 0.14}Al{sub 0.86}N film suggests that a part of nitrogen atoms is in cubic-like local environment though the lattice symmetry of Al-rich coatings is hexagonal. The poorly crystallised domains containing Ti and N atoms in cubic-like environment are obviously located in grain boundaries and afford protection of the coating against cracking.

Characterisation of nano-structured titanium and aluminium nitride coatings by indentation, transmission electron microscopy and electron energy loss spectroscopy

International Nuclear Information System (INIS)

Girleanu, M.; Pac, M.-J.; Louis, P.; Ersen, O.; Werckmann, J.; Rousselot, C.; Tuilier, M.-H.

2011-01-01

Titanium and aluminium nitride Ti 1-x Al x N films deposited by radiofrequency magnetron reactive sputtering onto steel substrate are examined by transmission electron microscopy over all the range of composition (x = 0, 0.5, 0.68, 0.86, 1). The deposition parameters are optimised in order to grow nitride films with low stress over all the composition range. Transmission electron microscopy cross-section images of Vickers indentation prints performed on that set of coatings show the evolution of their damage behaviour as increasing x Al content. Cubic Ti-rich nitrides consist of small grains clustered in rather large columns sliding along each other during indentation. Hexagonal Al-rich films grow in thinner columns which can be bent under the Vickers tip. Indentation tests carried out on TiN and AlN films are simulated using finite element modelling. Particular aspects of shear stresses and displacements in the coating/substrate are investigated. The growth mode and the nanostructure of two typical films, TiN and Ti 0.14 Al 0.86 N, are studied in detail by combining transmission electron microscopy cross-sections and plan views. Electron energy loss spectrum taken across Ti 0.14 Al 0.86 N film suggests that a part of nitrogen atoms is in cubic-like local environment though the lattice symmetry of Al-rich coatings is hexagonal. The poorly crystallised domains containing Ti and N atoms in cubic-like environment are obviously located in grain boundaries and afford protection of the coating against cracking.

Orientation and phase mapping in the transmission electron microscope using precession-assisted diffraction spot recognition: state-of-the-art results.

Science.gov (United States)

Viladot, D; Véron, M; Gemmi, M; Peiró, F; Portillo, J; Estradé, S; Mendoza, J; Llorca-Isern, N; Nicolopoulos, S

2013-10-01

A recently developed technique based on the transmission electron microscope, which makes use of electron beam precession together with spot diffraction pattern recognition now offers the possibility to acquire reliable orientation/phase maps with a spatial resolution down to 2 nm on a field emission gun transmission electron microscope. The technique may be described as precession-assisted crystal orientation mapping in the transmission electron microscope, precession-assisted crystal orientation mapping technique-transmission electron microscope, also known by its product name, ASTAR, and consists in scanning the precessed electron beam in nanoprobe mode over the specimen area, thus producing a collection of precession electron diffraction spot patterns, to be thereafter indexed automatically through template matching. We present a review on several application examples relative to the characterization of microstructure/microtexture of nanocrystalline metals, ceramics, nanoparticles, minerals and organics. The strengths and limitations of the technique are also discussed using several application examples. ©2013 The Authors. Journal of Microscopy published by John Wiley & Sons Ltd on behalf of Royal Microscopical Society.

Transmission electron microscopy: direct observation of crystal structure in refractory ceramics.

Science.gov (United States)

Shaw, T M; Thomas, G

1978-11-10

Using high-resolution multibeam interference techniques in the transmission electron microscope, images have been obtained that make possible a real-space structure analysis of a beryllium-silicon-nitrogen compound. The results illustrate the usefulness of lattice imaging in the analysis of local crystal structure in these technologically promising ceramic materials.

Quantitative biological measurement in Transmission Electron Tomography

International Nuclear Information System (INIS)

Mantell, Judith M; Verkade, Paul; Arkill, Kenton P

2012-01-01

It has been known for some time that biological sections shrink in the transmission electron microscope from exposure to the electron beam. This phenomenon is especially important in Electron Tomography (ET). The effect on shrinkage of parameters such as embedding medium or sample type is less well understood. In addition anisotropic area shrinkage has largely been ignored. The intention of this study is to explore the shrinkage on a number of samples ranging in thickness from 200 nm to 500 nm. A protocol was developed to determine the shrinkage in area and thickness using the gold fiducials used in electron tomography. In brief: Using low dose philosophy on the section, a focus area was used prior to a separate virgin study area for a series of known exposures on a tilted sample. The shrinkage was determined by measurements on the gold beads from both sides of the section as determined by a confirmatory tomogram. It was found that the shrinkage in area (approximately to 90-95% of the original) and the thickness (approximately 65% of the original at most) agreed with pervious authors, but that a lmost all the shrinkage was in the first minute and that although the direction of the in-plane shrinkage (in x and y) was sometimes uneven the end result was consistent. It was observed, in general, that thinner samples showed more percentage shrinkage than thicker ones. In conclusion, if direct quantitative measurements are required then the protocol described should be used for all areas studied.

Quantitative biological measurement in Transmission Electron Tomography

Science.gov (United States)

Mantell, Judith M.; Verkade, Paul; Arkill, Kenton P.

2012-07-01

It has been known for some time that biological sections shrink in the transmission electron microscope from exposure to the electron beam. This phenomenon is especially important in Electron Tomography (ET). The effect on shrinkage of parameters such as embedding medium or sample type is less well understood. In addition anisotropic area shrinkage has largely been ignored. The intention of this study is to explore the shrinkage on a number of samples ranging in thickness from 200 nm to 500 nm. A protocol was developed to determine the shrinkage in area and thickness using the gold fiducials used in electron tomography. In brief: Using low dose philosophy on the section, a focus area was used prior to a separate virgin study area for a series of known exposures on a tilted sample. The shrinkage was determined by measurements on the gold beads from both sides of the section as determined by a confirmatory tomogram. It was found that the shrinkage in area (approximately to 90-95% of the original) and the thickness (approximately 65% of the original at most) agreed with pervious authors, but that a lmost all the shrinkage was in the first minute and that although the direction of the in-plane shrinkage (in x and y) was sometimes uneven the end result was consistent. It was observed, in general, that thinner samples showed more percentage shrinkage than thicker ones. In conclusion, if direct quantitative measurements are required then the protocol described should be used for all areas studied.

Orbiting transmission source for positron tomography

International Nuclear Information System (INIS)

Huesman, R.H.; Derenzo, S.E.; Cahoon, J.L.; Geyer, A.B.; Moses, W.W.; Uber, D.C.; Vuletich, T.; Budinger, T.F.

1988-01-01

Accidental suppression and effective data rates have been measured for the orbiting transmission source as implemented in the Donner 600-Crystal Positron Tomograph. A mechanical description of the orbiting source and a description of the electronics used to discard scattered and accidental events is included. Since accidental coincidences were the rate-limiting factor in transmission data acquisition, the new method allows us to acquire sufficient transmission data in a shorter time with a more active transmission source

Nanostructured PLD-grown gadolinia doped ceria: Chemical and structural characterization by transmission electron microscopy techniques

DEFF Research Database (Denmark)

Rodrigo, Katarzyna Agnieszka; Wang, Hsiang-Jen; Heiroth, Sebastian

2011-01-01

The morphology as well as the spatially resolved elemental and chemical characterization of 10 mol% gadolinia doped ceria (CGO10) structures prepared by pulsed laser deposition (PLD) technique are investigated by scanning transmission electron microscopy accompanied with electron energy loss spec......, indicate apparent variation of the ceria valence state across and along the film. No element segregation to the grain boundaries is detected. These results are discussed in the context of solid oxide fuel cell applications.......The morphology as well as the spatially resolved elemental and chemical characterization of 10 mol% gadolinia doped ceria (CGO10) structures prepared by pulsed laser deposition (PLD) technique are investigated by scanning transmission electron microscopy accompanied with electron energy loss...... spectroscopy and energy dispersive X-ray spectroscopy. A dense, columnar and structurally inhomogeneous CGO10 film, i.e. exhibiting grain size refinement across the film thickness, is obtained in the deposition process. The cerium M4,5 edges, used to monitor the local electronic structure of the grains...

Quantitative Scanning Transmission Electron Microscopy of Electronic and Nanostructured Materials

Science.gov (United States)

Yankovich, Andrew B.

Electronic and nanostructured materials have been investigated using advanced scanning transmission electron microscopy (STEM) techniques. The first topic is the microstructure of Ga and Sb-doped ZnO. Ga-doped ZnO is a candidate transparent conducting oxide material. The microstructure of GZO thin films grown by MBE under different growth conditions and different substrates were examined using various electron microscopy (EM) techniques. The microstructure, prevalent defects, and polarity in these films strongly depend on the growth conditions and substrate. Sb-doped ZnO nanowires have been shown to be the first route to stable p-type ZnO. Using Z-contrast STEM, I have showed that an unusual microstructure of Sb-decorated head-to-head inversion domain boundaries and internal voids contain all the Sb in the nanowires and cause the p-type conduction. InGaN thin films and InGaN / GaN quantum wells (QW) for light emitting diodes are the second topic. Low-dose Z-contrast STEM, PACBED, and EDS on InGaN QW LED structures grown by MOCVD show no evidence for nanoscale composition variations, contradicting previous reports. In addition, a new extended defect in GaN and InGaN was discovered. The defect consists of a faceted pyramid-shaped void that produces a threading dislocation along the [0001] growth direction, and is likely caused by carbon contamination during growth. Non-rigid registration (NRR) and high-precision STEM of nanoparticles is the final topic. NRR is a new image processing technique that corrects distortions arising from the serial nature of STEM acquisition that previously limited the precision of locating atomic columns and counting the number of atoms in images. NRR was used to demonstrate sub-picometer precision in STEM images of single crystal Si and GaN, the best achieved in EM. NRR was used to measure the atomic surface structure of Pt nanoacatalysts and Au nanoparticles, which revealed new bond length variation phenomenon of surface atoms. In

Electronic transmission through p-n and n-p-n junctions of graphene

Energy Technology Data Exchange (ETDEWEB)

Setare, M R [Department of Science of Bijar, University of Kurdistan, Bijar (Iran, Islamic Republic of); Jahani, D, E-mail: rezakord@ipm.co, E-mail: Dariush110@gmail.co [Department of Physics, Razi University, Kermanshah (Iran, Islamic Republic of)

2010-06-23

In this paper, we first evaluate the electronic transmission of Dirac fermions into a p-n junction of gapped graphene and show that the final result depends on the sign of the refractive index, n. We also, by considering the appropriate wavefunctions in the region of the electrostatic potential, show that both transmission and the reflection probability turn out to be positive and less than unity instead of the negative transmission and higher than unity reflection coefficient commonly referred to as the Klein paradox. We then obtain the transmission probability corresponding to a special p-n junction for which there exists a region in which the low energy excitations of graphene acquire a finite mass and, interestingly, find that in this case the transmission is independent of the index of refraction, in contrast with the corresponding result for gapped graphene. We then discuss the validity of the solutions reported in some of the papers cited in this work which, considering the Buettiker formula, turn out to lead to the wrong results for conductivity.

Electron dose dependence of signal-to-noise ratio, atom contrast and resolution in transmission electron microscope images

International Nuclear Information System (INIS)

Lee, Z.; Rose, H.; Lehtinen, O.; Biskupek, J.; Kaiser, U.

2014-01-01

In order to achieve the highest resolution in aberration-corrected (AC) high-resolution transmission electron microscopy (HRTEM) images, high electron doses are required which only a few samples can withstand. In this paper we perform dose-dependent AC-HRTEM image calculations, and study the dependence of the signal-to-noise ratio, atom contrast and resolution on electron dose and sampling. We introduce dose-dependent contrast, which can be used to evaluate the visibility of objects under different dose conditions. Based on our calculations, we determine optimum samplings for high and low electron dose imaging conditions. - Highlights: • The definition of dose-dependent atom contrast is introduced. • The dependence of the signal-to-noise ratio, atom contrast and specimen resolution on electron dose and sampling is explored. • The optimum sampling can be determined according to different dose conditions

Preparation of high-quality ultrathin transmission electron microscopy specimens of a nanocrystalline metallic powder.

Science.gov (United States)

Riedl, Thomas; Gemming, Thomas; Mickel, Christine; Eymann, Konrad; Kirchner, Alexander; Kieback, Bernd

2012-06-01

This article explores the achievable transmission electron microscopy specimen thickness and quality by using three different preparation methods in the case of a high-strength nanocrystalline Cu-Nb powder alloy. Low specimen thickness is essential for spatially resolved analyses of the grains in nanocrystalline materials. We have found that single-sided as well as double-sided low-angle Ar ion milling of the Cu-Nb powders embedded into epoxy resin produced wedge-shaped particles of very low thickness (coating on the sections consisting of epoxy deployed as the embedding material and considerable nanoscale thickness variations. Copyright © 2011 Wiley Periodicals, Inc.

Atomistic observations and analyses of lattice defects in transmission electron microscopes

CERN Document Server

Abe, H

2003-01-01

The transmission electron microscope (TEM) -accelerators was developed. TEM-Accelerator made possible to observe in situ experiments of ion irradiation and implantation. The main results are the experimental proof of new lattice defects by irradiation, the formation process and synthesized conditions of carbon onion by ion implantation, the microstructure and phase transformation conditions of graphite by ion irradiated phase transformation, the irradiation damage formation process by simultaneous irradiation of electron and ion and behavior of fullerene whisker under irradiation. The microstructural evolution of defect clusters in copper irradiated with 240-keV Cu sup + ions and a high resolution electron micrograph of carbon onions synthesized by ion implantation are explained as the examples of recent researches. (S.Y.)

Methods, apparatus, and systems for monitoring transmission systems

Science.gov (United States)

Polk, Robert E [Idaho Falls, ID; Svoboda, John M [Idaho Falls, ID; West, Phillip B [Idaho Falls, ID; Heath, Gail L [Iona, ID; Scott, Clark L [Idaho Falls, ID

2010-08-31

A sensing platform for monitoring a transmission system, and method therefor, may include a sensor that senses one or more conditions relating to a condition of the transmission system and/or the condition of an environment around the transmission system. A control system operatively associated with the sensor produces output data based on an output signal produced by the sensor. A transmitter operatively associated with the control system transmits the output data from the control system.

Reciprocity relations in transmission electron microscopy: A rigorous derivation.

Science.gov (United States)

Krause, Florian F; Rosenauer, Andreas

2017-01-01

A concise derivation of the principle of reciprocity applied to realistic transmission electron microscopy setups is presented making use of the multislice formalism. The equivalence of images acquired in conventional and scanning mode is thereby rigorously shown. The conditions for the applicability of the found reciprocity relations is discussed. Furthermore the positions of apertures in relation to the corresponding lenses are considered, a subject which scarcely has been addressed in previous publications. Copyright © 2016 Elsevier Ltd. All rights reserved.

Self-consistent method for quantifying indium content from X-ray spectra of thick compound semiconductor specimens in a transmission electron microscope.

Science.gov (United States)

Walther, T; Wang, X

2016-05-01

Based on Monte Carlo simulations of X-ray generation by fast electrons we calculate curves of effective sensitivity factors for analytical transmission electron microscopy based energy-dispersive X-ray spectroscopy including absorption and fluorescence effects, as a function of Ga K/L ratio for different indium and gallium containing compound semiconductors. For the case of InGaN alloy thin films we show that experimental spectra can thus be quantified without the need to measure specimen thickness or density, yielding self-consistent values for quantification with Ga K and Ga L lines. The effect of uncertainties in the detector efficiency are also shown to be reduced. © 2015 The Authors Journal of Microscopy © 2015 Royal Microscopical Society.

Quantitative analysis of structural inhomogeneity in nanomaterials using transmission electron microscopy

Czech Academy of Sciences Publication Activity Database

Klinger, Miloslav; Polívka, Leoš; Jäger, Aleš; Tyunina, Marina

2016-01-01

Roč. 49, Jun (2016), 762-770 ISSN 1600-5767 R&D Projects: GA ČR GBP108/12/G043; GA ČR GA15-15123S Institutional support: RVO:68378271 Keywords : transmission electron microscopy * structural inhomogeneity * lattice parameters * image processing Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.495, year: 2016

A transmission electron microscopy procedure for in-situ straining of miniature

Czech Academy of Sciences Publication Activity Database

Olbricht, J.; Wagner, M. F- X.; Condó, A.; Dlouhý, Antonín; Grossman, Ch.; Kröger, A.; Somsen, Ch.; Eggeler, G.

2008-01-01

Roč. 99, č. 10 (2008), s. 1150-1156 ISSN 1862-5282 R&D Projects: GA ČR(CZ) GA106/05/0918 Institutional research plan: CEZ:AV0Z20410507 Keywords : transmission electron microscopy * in-situ straining * nano-crystalline NiTi Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.819, year: 2008

Bright-field scanning confocal electron microscopy using a double aberration-corrected transmission electron microscope

Energy Technology Data Exchange (ETDEWEB)

Wang, Peng; Behan, Gavin; Kirkland, Angus I. [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Nellist, Peter D., E-mail: peter.nellist@materials.ox.ac.uk [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Cosgriff, Eireann C.; D' Alfonso, Adrian J.; Morgan, Andrew J.; Allen, Leslie J. [School of Physics, University of Melbourne, Parkville, Victoria 3010 (Australia); Hashimoto, Ayako [Advanced Nano-characterization Center, National Institute for Materials Science (NIMS), 3-13 Sakura, Tsukuba 305-0003 (Japan); Takeguchi, Masaki [Advanced Nano-characterization Center, National Institute for Materials Science (NIMS), 3-13 Sakura, Tsukuba 305-0003 (Japan); High Voltage Electron Microscopy Station, NIMS, 3-13 Sakura, Tsukuba 305-0003 (Japan); Mitsuishi, Kazutaka [Advanced Nano-characterization Center, National Institute for Materials Science (NIMS), 3-13 Sakura, Tsukuba 305-0003 (Japan); Quantum Dot Research Center, NIMS, 3-13 Sakura, Tsukuba 305-0003 (Japan); Shimojo, Masayuki [High Voltage Electron Microscopy Station, NIMS, 3-13 Sakura, Tsukuba 305-0003 (Japan); Advanced Science Research Laboratory, Saitama Institute of Technology, 1690 Fusaiji, Fukaya 369-0293 (Japan)

2011-06-15

Scanning confocal electron microscopy (SCEM) offers a mechanism for three-dimensional imaging of materials, which makes use of the reduced depth of field in an aberration-corrected transmission electron microscope. The simplest configuration of SCEM is the bright-field mode. In this paper we present experimental data and simulations showing the form of bright-field SCEM images. We show that the depth dependence of the three-dimensional image can be explained in terms of two-dimensional images formed in the detector plane. For a crystalline sample, this so-called probe image is shown to be similar to a conventional diffraction pattern. Experimental results and simulations show how the diffracted probes in this image are elongated in thicker crystals and the use of this elongation to estimate sample thickness is explored. -- Research Highlights: {yields} The confocal probe image in a scanning confocal electron microscopy image reveals information about the thickness and height of the crystalline layer. {yields} The form of the contrast in a three-dimensional bright-field scanning confocal electron microscopy image can be explained in terms of the confocal probe image. {yields} Despite the complicated form of the contrast in bright-field scanning confocal electron microscopy, we see that depth information is transferred on a 10 nm scale.

Transmission electron microscopy a textbook for materials science

CERN Document Server

Williams, David B

1996-01-01

Electron microscopy has revolutionized our understanding the extraordinary intellectual demands required of the mi­ of materials by completing the processing-structure-prop­ croscopist in order to do the job properly: crystallography, erties links down to atomistic levels. It now is even possible diffraction, image contrast, inelastic scattering events, and to tailor the microstructure (and meso structure ) of materials spectroscopy. Remember, these used to be fields in them­ to achieve specific sets of properties; the extraordinary abili­ selves. Today, one has to understand the fundamentals ties of modem transmission electron microscopy-TEM­ of all of these areas before one can hope to tackle signifi­ instruments to provide almost all of the structural, phase, cant problems in materials science. TEM is a technique of and crystallographic data allow us to accomplish this feat. characterizing materials down to the atomic limits. It must Therefore, it is obvious that any curriculum in modem mate­ be use...

Strain fields around dislocation arrays in a Σ9 silicon bicrystal measured by scanning transmission electron microscopy

Science.gov (United States)

Couillard, Martin; Radtke, Guillaume; Botton, Gianluigi A.

2013-04-01

Strain fields around grain boundary dislocations are measured by applying geometric phase analysis on atomic resolution images obtained from multiple fast acquisitions in scanning transmission electron microscopy. Maps of lattice distortions in silicon introduced by an array of pure edge dislocations located at a Σ9(122) grain boundary are compared with the predictions from isotropic elastic theory, and the atomic structure of dislocation cores is deduced from images displaying all the atomic columns. For strain measurements, reducing the acquisition time is found to significantly decrease the effects of instabilities on the high-resolution images. Contributions from scanning artefacts are also diminished by summing multiple images following a cross-correlation alignment procedure. Combined with the sub-Ångström resolution obtained with an aberration corrector, and the stable dedicated microscope's environment, therapid acquisition method provides the measurements of atomic displacements with accuracy below 10 pm. Finally, the advantages of combining strain measurements with the collection of various analytical signals in a scanning transmission electron microscope are discussed.

3D simulation of electron and ion transmission of GEM-based detectors

Science.gov (United States)

Bhattacharya, Purba; Mohanty, Bedangadas; Mukhopadhyay, Supratik; Majumdar, Nayana; da Luz, Hugo Natal

2017-10-01

Time Projection Chamber (TPC) has been chosen as the main tracking system in several high-flux and high repetition rate experiments. These include on-going experiments such as ALICE and future experiments such as PANDA at FAIR and ILC. Different R&D activities were carried out on the adoption of Gas Electron Multiplier (GEM) as the gas amplification stage of the ALICE-TPC upgrade version. The requirement of low ion feedback has been established through these activities. Low ion feedback minimizes distortions due to space charge and maintains the necessary values of detector gain and energy resolution. In the present work, Garfield simulation framework has been used to study the related physical processes occurring within single, triple and quadruple GEM detectors. Ion backflow and electron transmission of quadruple GEMs, made up of foils with different hole pitch under different electromagnetic field configurations (the projected solutions for the ALICE TPC) have been studied. Finally a new triple GEM detector configuration with low ion backflow fraction and good electron transmission properties has been proposed as a simpler GEM-based alternative suitable for TPCs for future collider experiments.

Power electron beam front shortening in magnetically insulated transmission line with inner coaxial dielectric insert

International Nuclear Information System (INIS)

Galstjan, E.A.; Kazanskiy, L.N.

1995-01-01

By now the technology of high-power high-current relativistic electron beams with microsecond duration has been developed. The same technology is used in high-power electric pulse generation. However at present the high-power beams of subnanosecond duration are necessary for some investigations and applications. The maximum power parameter achieved by means of the usual technology is limited by a value in the range of 100-300 MW. For this reason a search for new ways to generate high-power REB (relativistic electron beam) is a topical problem. It is obvious that this problem may be reduced to the generation of pulses with a subnanosecond front duration. There are many methods to shorten a pulse duration to its front duration for instance, by using parts of short-circuited transmission lines

A graphene oxide-carbon nanotube grid for high-resolution transmission electron microscopy of nanomaterials

International Nuclear Information System (INIS)

Zhang Lina; Zhang Haoxu; Zhou Ruifeng; Chen Zhuo; Li Qunqing; Fan Shoushan; Jiang Kaili; Ge Guanglu; Liu Renxiao

2011-01-01

A novel grid for use in transmission electron microscopy is developed. The supporting film of the grid is composed of thin graphene oxide films overlying a super-aligned carbon nanotube network. The composite film combines the advantages of graphene oxide and carbon nanotube networks and has the following properties: it is ultra-thin, it has a large flat and smooth effective supporting area with a homogeneous amorphous appearance, high stability, and good conductivity. The graphene oxide-carbon nanotube grid has a distinct advantage when characterizing the fine structure of a mass of nanomaterials over conventional amorphous carbon grids. Clear high-resolution transmission electron microscopy images of various nanomaterials are obtained easily using the new grids.

Computation of nonuniform transmission lines using the FDTD method

Energy Technology Data Exchange (ETDEWEB)

Miranda, G.C.; Paulino, J.O.S. [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil). School of Engineering

1997-12-31

Calculation of lightning overvoltages on transmission lines has been described. Lightning induced overvoltages are of great significance under certain conditions because of the main characteristics of the phenomena. The lightning channel model is one of the most important parameters essential to obtaining the generated electromagnetic fields. In this study, nonuniform transmission line equations were solved using the finite difference method and the leap-frog scheme, the Finite Difference Time Domain (FDTD) method. The subroutine was interfaced with the Electromagnetic Transients Program (EMTP). Two models were used to represent the characteristic impedance of the nonuniform lines used to model the transmission line towers and the lightning main channel. The advantages of the FDTD method was the much smaller code and faster processing time. 35 refs., 5 figs.

Third generation hybrid drive. Transmission-based integration of power electronics; Dritte Generation Hybridantrieb. Getriebenahe Integration der Leistungselektronik

Energy Technology Data Exchange (ETDEWEB)

Schoen, Wolfgang [ZF Friedrichshafen AG, Friedrichshafen (DE). Hybridantriebe (F und E); Lutz, Steffen [BMW AG, Muenchen (Germany); Hensler, Alexander [Technische Univ. Chemnitz (Germany); Munding, Andreas [Liebherr Elektronik GmbH, Lindau (Germany); Thoben, Markus [Infineon Technologies AG, Warstein (Germany); Zeidler, Dietmar [Kemet Electronics GmbH, Landsberg am Lech (Germany)

2011-06-15

The power electronics components in today's hybrid vehicles are situated at different places in the vehicle - till now far away from harsh and hot surroundings. In order to develop an integrated solution near the transmission, ZF and BMW launched the research project 'Electric components for active power transmissions' (EfA). On the basis of an eight-speed full hybrid transmission and together with Infineon, Kemet, Liebherr, and the University of Technology of Chemnitz, they are developing a power electronics unit, which facilitates doubling the power density while increasing the operating temperature. The project EfA will be concluded in June 2011. (orig.)

Transmission electron microscopy of nanostructures synthesized by laser and charged particle beam interaction with materials

International Nuclear Information System (INIS)

Dey, G. K.

2011-01-01

Transmission Electron Microscopy (TEM), because of its ability to image atomic arrangements directly and its ability to give spectroscopic information at similar resolution has emerged as a very powerful tool for understanding the structure of materials at atomic level. TEM has been particularly useful in resolving the interface structures in materials. This form of microscopy is very suitable for resolving the structure and defects in ultrafine microstructures such as those of the nanocrystalline phases. After a brief description of the different characterization abilities of the aberration corrected transmission electron microscope, this presentation describes the results of TEM investigations on nanocrystalline microstructures generated by laser materials interaction and due to interaction of electrons and ions with materials. Excimer laser has become an attractive choice for new and precision application for ablation and deposition in recent times. In this work, a KrF excimer laser having 30 ns pulse width and 600 mJ energy at source has been used to deposit zirconia on Zr-base alloy in order to explore the ability of the thin oxide film to act as a diffusion barrier to hydrogen ingress into the alloy. It has been found that the variation in pressure by an order of three has resulted in maximum influence on the roughness of the laser deposited oxide film that has not been possible to achieve by other parameters within the range of the instrument. Present study has also indicated an interrelation among the roughness, adherence and the film-thickness, where the last one is indicated by the XPS study. Transmission electron microscopy was carried out to study the size, size distribution and defects in the deposited film. Nanocrystalline phases generated by interaction of electron and ion irradiation of Zr based alloys; Ni based alloys and Fe based alloys have been examined in detail by conventional and high resolution transmission electron microscopy. Results of

A method for measuring the local gas pressure within a gas-flow stage in situ in the transmission electron microscope

International Nuclear Information System (INIS)

Colby, R.; Alsem, D.H.; Liyu, A.; Kabius, B.

2015-01-01

Environmental transmission electron microscopy (TEM) has enabled in situ experiments in a gaseous environment with high resolution imaging and spectroscopy. Addressing scientific challenges in areas such as catalysis, corrosion, and geochemistry can require pressures much higher than the ∼20 mbar achievable with a differentially pumped environmental TEM. Gas flow stages, in which the environment is contained between two semi-transparent thin membrane windows, have been demonstrated at pressures of several atmospheres. However, the relationship between the pressure at the sample and the pressure drop across the system is not clear for some geometries. We demonstrate a method for measuring the gas pressure at the sample by measuring the ratio of elastic to inelastic scattering and the defocus of the pair of thin windows. This method requires two energy filtered high-resolution TEM images that can be performed during an ongoing experiment, at the region of interest. The approach is demonstrated to measure greater than atmosphere pressures of N 2 gas using a commercially available gas-flow stage. This technique provides a means to ensure reproducible sample pressures between different experiments, and even between very differently designed gas-flow stages. - Highlights: • Method developed for measuring gas pressure within a gas-flow stage in the TEM. • EFTEM and CTF-fitting used to calculate amount and volume of gas. • Requires only a pair of images without leaving region of interest. • Demonstrated for P > 1 atm with a common commercial gas-flow stage

Transmission microscopy of unmodified biological materials: comparative radiation dosages with electrons and ultrasoft X-ray photons

International Nuclear Information System (INIS)

Sayre, D.; Feder, R.; Spiller, E.; Kirz, J.; Kim, D.M.

1977-01-01

The minimum radiation dosage in a specimen consistent with transmission microscopy at resolution d and specimen thickness t is calculated for model specimens resembling biological materials in their natural state. The calculations cover 10 4 -10 7 eV electrons and 1.3-90 A photons in a number of microscopy modes. The results indicate that over a considerable part of the (t,d)-plane transmission microscopy on such specimens can be carried out at lower dosage with photons than with electrons. Estimates of the maximum resolutions obtainable with electrons and photons, consistent with structural survival of the specimen, are obtained, as are data on optimal operating conditions for microscopy with the two particles

Transmission Electron Microscopy as Key Technique for the Characterization of Telocytes.

Science.gov (United States)

Cantarero, Irene; Luesma, Maria Jose; Alvarez-Dotu, Jose Miguel; Muñoz, Eduardo; Junquera, Concepcion

2016-01-01

It was 50 years ago when the details of cellular structure were first observed with an electron microscope (EM). Today, transmission electron microscopy (TEM) still provides the highest resolution detail of cellular ultrastructure. The existence of telocytes (TCs) has been described by Hinescu and Popescu in 2005 and up to now, many studies have been done in different tissues. EM has been fundamental in identification and recognition of TC and relationship between TC and stem cells (SCs) in recent years. We present a review on the importance of TEM to provide major advances in the knowledge of the biology of these cells.

Numerical method to calculate the quantum transmission, resonance and eigenvalue energies: application to a biased multibarrier systems

Energy Technology Data Exchange (ETDEWEB)

Maiz, F., E-mail: fethimaiz@gmail.com [University of Cartage, Nabeul Engineering Preparatory Institute, Merazka, 8000 Nabeul (Tunisia); King Khalid University, Faculty of Science, Physics Department, PO Box 9004, Abha 61413 (Saudi Arabia)

2015-04-15

A novel method to calculate the quantum transmission, resonance and eigenvalue energies forming the sub-bands structure of non-symmetrical, non-periodical semiconducting heterostructure potential has been proposed in this paper. The method can be applied on a multilayer system with varying thickness of the layer and effective mass of electrons and holes. Assuming an approximated effective mass and using Bastard's boundary conditions, Schrödinger equation at each media is solved and then using a confirmed recurrence method, the transmission and reflection coefficients and the energy quantification condition are expressed. They are simple combination of coupled equations. Schrödinger's equation solutions are Airy functions or plane waves, depending on the electrical potential energy slope. To illustrate the feasibility of the proposed method, the N barriers – (N−1) wells structure for N=3, 5, 8, 9, 17 and 35 are studied. All results show very good agreements with previously published results obtained from applying different methods on similar systems.

Microstructural differences between two Zr(C,N) coatings revealed by analytical transmission electron microscopy

International Nuclear Information System (INIS)

Dörfel, Ilona; Rooch, Heidemarie; Österle, Werner

2012-01-01

The microstructures of two samples of a Zr(C,N) coating on steel, which unexpectedly differed in their tribological properties, were investigated by analytical transmission electron microscopy. The samples were produced by a cathodic arc evaporation process in two commercial coating devices under similar coating conditions with the exception of the number of Zr targets. The source of the differing tribological properties of the samples was detected by analytical transmission electron microscopy (TEM) methods energy-dispersive X-ray spectroscopy (EDX), energy filtering TEM (EFTEM), electron diffraction, high resolution electron microscopy, and high angel annular dark field. The TEM preparation and the results of the TEM investigations are shown in detail. The origin of the unexpected behavior was determined to be a nano-scale multilayer structure that existed only in the tribologically superior specimen. EDX and EFTEM investigations indicated enrichment in oxygen at the interface between coating and steel substrate in the tribologically inferior sample. Findings of the microstructural configuration were obtained by taking a closer look at the structure and comparing the results of the several analytical TEM techniques. This allows the allocation of the concentration fluctuations in N, C, and Zr to the two thickness fractions of the nano multilayers and a local correlation of the identified minority phase Zr 3 (C,N) 4 to the higher N content in the narrower type of the multilayer fraction of the sample with the excellent tribological properties. The minority phase Zr 3 (C,N) 4 is randomly distributed in the sample with the defective tribological properties. Coating conditions are not topic of this work, but after discussion of the TEM results, the fact that one of the coating devices worked with one Zr target and the other one with two, could be identified as cause for the formation of the nano multilayer structure in the sample with the superior tribological

Transmission electron microscope interfaced with ion accelerators and its application to materials science

Energy Technology Data Exchange (ETDEWEB)

Abe, Hiroaki; Naramoto, Hiroshi [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment; Hojou, Kiichi; Furuno, Shigemi; Tsukamoto, Tetsuo

1997-03-01

We have developed the transmission/analytical electron microscope interfaced with two sets of ion accelerators (TEM-Accelerators Facility) at JAERI-Takasaki. The facility is expected to provide quantitative insights into radiation effects, such as damage evolution, irradiation-induced phase transformation and their stability, through in-situ observation and analysis under ion and/or electron irradiation. The TEM-Accelerators Facility and its application to materials research are reviewed. (author)

Structural defects in multiferroic BiMnO3 studied by transmission electron microscopy and electron energy-loss spectroscopy

International Nuclear Information System (INIS)

Yang, H.; Chi, Z. H.; Yao, L. D.; Zhang, W.; Li, F. Y.; Jin, C. Q.; Yu, R. C.

2006-01-01

The multiferroic material BiMnO 3 synthesized under high pressure has been systematically studied by transmission electron microscopy and electron energy-loss spectroscopy, and some important structural defects are revealed in this multiferroic material. The frequently observed defects are characterized to be Σ3(111) twin boundaries, Ruddlesden-Popper [Acta Crystallogr. 11, 54 (1958)] antiphase boundaries, and a p p superdislocations connected with a small segment of Ruddlesden-Popper defect. These defects are present initially in the as-synthesized sample. In addition, we find that ordered voids (oxygen vacancies) are easily introduced into the multiferroic BiMnO 3 by electron-beam irradiation

Principle of energy-filtering transmission electron microscopy and its applications

International Nuclear Information System (INIS)

Kurata, Hiroki

1997-01-01

Energy-filtering transmission electron microscopy (EFTEM) is widely used to make images and diffraction patterns more quantitative by removing the inelastic background, and to perform elemental and chemical mapping at high spatial resolution. The principal factors restricting the spatial resolution in elemental maps are discussed. The relativistic effect on inelastic scattering cross-section, which becomes significant for high-voltage EFTEM analysis, is also discussed in relation to the detection efficiency of core-loss signals. (author)

In vivo degradation of processed dermal sheep collagen evaluated with transmission electron microscopy

NARCIS (Netherlands)

van Wachem, P.B.; van Luyn, M.J.A.; Nieuwenhuis, P.; Koerten, H.K.; Olde damink, L.H.H.; Olde-Damink, L.; ten Hoopen, Hermina W.M.; Feijen, Jan

1991-01-01

The in vivo degradation of hexamethylenediisocyanate-tanned dermal sheep collagen was studied with transmission electron microscopy. Discs of hexamethylenediisocyanate-tanned dermal sheep collagen were subcutaneously implanted in rats. Both an intra- and an extracellular route of degradation could

Three-dimensional visualization and characterization of polymeric self-assemblies by Transmission Electron Microtomography

NARCIS (Netherlands)

H. Jinnai (Hiroshi); T. Higuchi (Takeshi); X. Zhuge (Jason); A. Kumamoto (Akihito); K.J. Batenburg (Joost); Y. Ikuhara (Yuichi)

2017-01-01

textabstractSelf-assembling structures and their dynamical processes in polymeric systems have been investigated using three-dimensional transmission electron microscopy (3D-TEM). Block copolymers (BCPs) self-assemble into nanoscale periodic structures called microphase-separated structures, a deep

Comparison of three retail data communication and transmission methods

Directory of Open Access Journals (Sweden)

MA Yue

2016-04-01

Full Text Available With the rapid development of retail trade,the type and complexity of data keep increasing,and single data file size has a great difference between each other.How to realize an accurate,real-time and efficient data transmission based on a fixed cost is an important problem.Regarding the problem of effective transmission for business data files,this article implements analysis and comparison on 3 existing data transmission methods,considering the requirements on aspects like function in enterprise data communication system,we get a conclusion that which method can both meet the enterprise daily business development requirement better and have good extension ability.

Fine structure characterization of martensite/austenite constituent in low-carbon low-alloy steel by transmission electron forward scatter diffraction.

Science.gov (United States)

Li, C W; Han, L Z; Luo, X M; Liu, Q D; Gu, J F

2016-11-01

Transmission electron forward scatter diffraction and other characterization techniques were used to investigate the fine structure and the variant relationship of the martensite/austenite (M/A) constituent of the granular bainite in low-carbon low-alloy steel. The results demonstrated that the M/A constituents were distributed in clusters throughout the bainitic ferrite. Lath martensite was the main component of the M/A constituent, where the relationship between the martensite variants was consistent with the Nishiyama-Wassermann orientation relationship and only three variants were found in the M/A constituent, suggesting that the variants had formed in the M/A constituent according to a specific mechanism. Furthermore, the Σ3 boundaries in the M/A constituent were much longer than their counterparts in the bainitic ferrite region. The results indicate that transmission electron forward scatter diffraction is an effective method of crystallographic analysis for nanolaths in M/A constituents. © 2016 The Authors Journal of Microscopy © 2016 Royal Microscopical Society.

Bright-field scanning confocal electron microscopy using a double aberration-corrected transmission electron microscope.

Science.gov (United States)

Wang, Peng; Behan, Gavin; Kirkland, Angus I; Nellist, Peter D; Cosgriff, Eireann C; D'Alfonso, Adrian J; Morgan, Andrew J; Allen, Leslie J; Hashimoto, Ayako; Takeguchi, Masaki; Mitsuishi, Kazutaka; Shimojo, Masayuki

2011-06-01

Scanning confocal electron microscopy (SCEM) offers a mechanism for three-dimensional imaging of materials, which makes use of the reduced depth of field in an aberration-corrected transmission electron microscope. The simplest configuration of SCEM is the bright-field mode. In this paper we present experimental data and simulations showing the form of bright-field SCEM images. We show that the depth dependence of the three-dimensional image can be explained in terms of two-dimensional images formed in the detector plane. For a crystalline sample, this so-called probe image is shown to be similar to a conventional diffraction pattern. Experimental results and simulations show how the diffracted probes in this image are elongated in thicker crystals and the use of this elongation to estimate sample thickness is explored. Copyright © 2010 Elsevier B.V. All rights reserved.

Electron magnetic chiral dichroism in CrO2 thin films using monochromatic probe illumination in a transmission electron microscope

International Nuclear Information System (INIS)

Loukya, B.; Zhang, X.; Gupta, A.; Datta, R.

2012-01-01

Electron magnetic chiral dichroism (EMCD) has been studied in CrO 2 thin films (with (100) and (110) growth orientations on TiO 2 substrates) using a gun monochromator in an aberration corrected transmission electron microscope operating at 300 kV. Excellent signal-to-noise ratio is obtained at spatial resolution ∼10 nm using a monochromatic probe as compared to conventional parallel illumination, large area convergent beam electron diffraction and scanning transmission electron microscopy techniques of EMCD. Relatively rapid exposure using mono probe illumination enables collection of EMCD spectra in total of 8–9 min in energy filtered imaging mode for a given Cr L 2,3 energy scan (energy range ∼35 eV). We compared the EMCD signal obtained by extracting the Cr L 2,3 spectra under three beam diffraction geometry of two different reciprocal vectors (namely g=110 and 200) and found that the g=200 vector enables acquisition of excellent EMCD signal from relatively thicker specimen area due to the associated larger extinction distance. Orbital to spin moment ratio has been calculated using EMCD sum rules for 3d elements and dichroic spectral features associated with CrO 2 are compared and discussed with XMCD theoretical spectra. - Highlights: ► Electron magnetic circular dichroism (EMCD) of CrO 2 thin film with two different orientations. ► Improved EMCD signal with Gun monochromator illumination. ► Improved EMCD signal with higher g vector.

Burgers vector analysis of large area misfit dislocation arrays from bend contour contrast in transmission electron microscope images

CERN Document Server

Spiecker, E

2002-01-01

A transmission electron microscopy method is described which allows us to determine the Burgers vectors (BVs) of a large number of interfacial misfit dislocations (MDs) in mismatched heterostructures. The method combines large-area plan-view thinning of the sample for creating a strongly bent electron transparent foil with the analysis of the splitting and displacement of bend contours at their crossings with the MDs. The BV analysis is demonstrated for 60 deg. MDs in a low-mismatched SiGe/Si(001) heterostructure. Crossings of various bend contours with the MDs are analysed with respect to their information content for the BV analysis. In future applications the method may be used for analysing such a large number of MDs that a quantitative comparison with x-ray diffraction experiments, especially with data on diffusely scattered x-rays originating from the strain fields around the dislocations, becomes possible.

Analysis of intermetallic particles in Mg-12 wt.%Zn binyry alloy using transmission electron microscopy

Czech Academy of Sciences Publication Activity Database

Němec, Martin; Gärtnerová, Viera; Klementová, Mariana; Jäger, Aleš

2015-01-01

Roč. 106, Aug (2015), s. 428-436 ISSN 1044-5803 R&D Projects: GA ČR GBP108/12/G043 Institutional support: RVO:68378271 Keywords : biomedical alloy s * heat treatment * microstructure * transmission electron microscopy * electron diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.383, year: 2015

Calculating the albedo characteristics by the method of transmission probabilities

International Nuclear Information System (INIS)

Lukhvich, A.A.; Rakhno, I.L.; Rubin, I.E.

1983-01-01

The possibility to use the method of transmission probabilities for calculating the albedo characteristics of homogeneous and heterogeneous zones is studied. The transmission probabilities method is a numerical method for solving the transport equation in the integrated form. All calculations have been conducted as a one-group approximation for the planes and rods with different optical thicknesses and capture-to-scattering ratios. Above calculations for plane and cylindrical geometries have shown the possibility to use the numerical method of transmission probabilities for calculating the albedo characteristics of homogeneous and heterogeneous zones with high accuracy. In this case the computer time consumptions are minimum even with the cylindrical geometry, if the interpolation calculation of characteristics is used for the neutrons of the first path

Photocathode Optimization for a Dynamic Transmission Electron Microscope: Final Report

Energy Technology Data Exchange (ETDEWEB)

Ellis, P; Flom, Z; Heinselman, K; Nguyen, T; Tung, S; Haskell, R; Reed, B W; LaGrange, T

2011-08-04

The Dynamic Transmission Electron Microscope (DTEM) team at Harvey Mudd College has been sponsored by LLNL to design and build a test setup for optimizing the performance of the DTEM's electron source. Unlike a traditional TEM, the DTEM achieves much faster exposure times by using photoemission from a photocathode to produce electrons for imaging. The DTEM team's work is motivated by the need to improve the coherence and current density of the electron cloud produced by the electron gun in order to increase the image resolution and contrast achievable by DTEM. The photoemission test setup is nearly complete and the team will soon complete baseline tests of electron gun performance. The photoemission laser and high voltage power supply have been repaired; the optics path for relaying the laser to the photocathode has been finalized, assembled, and aligned; the internal setup of the vacuum chamber has been finalized and mostly implemented; and system control, synchronization, and data acquisition has been implemented in LabVIEW. Immediate future work includes determining a consistent alignment procedure to place the laser waist on the photocathode, and taking baseline performance measurements of the tantalum photocathode. Future research will examine the performance of the electron gun as a function of the photoemission laser profile, the photocathode material, and the geometry and voltages of the accelerating and focusing components in the electron gun. This report presents the team's progress and outlines the work that remains.

Transmission electron microscope sample holder with optical features

Science.gov (United States)

Milas, Mirko [Port Jefferson, NY; Zhu, Yimei [Stony Brook, NY; Rameau, Jonathan David [Coram, NY

2012-03-27

A sample holder for holding a sample to be observed for research purposes, particularly in a transmission electron microscope (TEM), generally includes an external alignment part for directing a light beam in a predetermined beam direction, a sample holder body in optical communication with the external alignment part and a sample support member disposed at a distal end of the sample holder body opposite the external alignment part for holding a sample to be analyzed. The sample holder body defines an internal conduit for the light beam and the sample support member includes a light beam positioner for directing the light beam between the sample holder body and the sample held by the sample support member.

A unified transmission loss allocation method

International Nuclear Information System (INIS)

Ding, Qifeng; Abur, Ali

2007-01-01

A new unified method which allocates transmission losses either to buses in a pool market or to individual transactions in a bilateral contract market is presented in this paper. A detailed derivation of the method is given. A bus-loss matrix and a transaction-loss matrix are developed to show the interactions between bus injections and transactions. It is further demonstrated that the ''Physical-power-flow-based'' method can be obtained as an approximation of this unified approach under certain simplifying assumptions. Test systems are used to illustrate how the proposed method behaves under different possible scenarios. (author)

Directly Observing Micelle Fusion and Growth in Solution by Liquid-Cell Transmission Electron Microscopy

Energy Technology Data Exchange (ETDEWEB)

Parent, Lucas R. [Department; amp, Biochemistry, University of California, San Diego, La Jolla, California 92093, United States; Bakalis, Evangelos [Dipartimento; Ramírez-Hernández, Abelardo [Materials; Institute; Kammeyer, Jacquelin K. [Department; amp, Biochemistry, University of California, San Diego, La Jolla, California 92093, United States; Park, Chiwoo [Department; de Pablo, Juan [Materials; Institute; Zerbetto, Francesco [Dipartimento; Patterson, Joseph P. [Department; amp, Biochemistry, University of California, San Diego, La Jolla, California 92093, United States; Laboratory; Gianneschi, Nathan C. [Department; amp, Biochemistry, University of California, San Diego, La Jolla, California 92093, United States

2017-11-16

Amphiphilic small molecules and polymers form commonplace nanoscale macromolecular compartments and bilayers, and as such are truly essential components in all cells and in many cellular processes. The nature of these architectures, including their formation, phase changes, and stimuli-response behaviors, is necessary for the most basic functions of life, and over the past half-century, these natural micellar structures have inspired a vast diversity of industrial products, from biomedicines to detergents, lubricants, and coatings. The importance of these materials and their ubiquity have made them the subject of intense investigation regarding their nanoscale dynamics with increasing interest in obtaining sufficient temporal and spatial resolution to directly observe nanoscale processes. However, the vast majority of experimental methods involve either bulk-averaging techniques including light, neutron, and X-ray scattering, or are static in nature including even the most advanced cryogenic transmission electron microscopy techniques. Here, we employ in situ liquid-cell transmission electron microscopy (LCTEM) to directly observe the evolution of individual amphiphilic block copolymer micellar nanoparticles in solution, in real time with nanometer spatial resolution. These observations, made on a proof-of-concept bioconjugate polymer amphiphile, revealed growth and evolution occurring by unimer addition processes and by particle-particle collision-and-fusion events. The experimental approach, combining direct LCTEM observation, quantitative analysis of LCTEM data, and correlated in silico simulations, provides a unique view of solvated soft matter nanoassemblies as they morph and evolve in time and space, enabling us to capture these phenomena in solution.

Determination of the cork bark porosity through the gamma ray transmission technology and electronic scanning microscopy image analysis

International Nuclear Information System (INIS)

Moraes, Antonio M.C.; Moreira, Anderson C.; Appoloni, Carlos R.

2007-01-01

This work applies the gamma transmission techniques (GTR) and imaging by scanning electron microscopy (SEM) for determination of porosity in the sparkling wine bottle corks. The gamma transmission experimental apparatus consists of a micrometric table (ZX) of sample movement automated, a Am-241 source (59,53 keV, 100 mCi), lead collimators, sample-holder, Na I(Tl) detector and appropriated electronics. For the microscopic images an FEI (Quanta 200), electronic microscope with associated electronics was used, and the image analysis was performed with IMAGO software. The average porosity for 22 samples analysed by GTR was of φ=58 +- 4.6 percent. By the imaging technique the found average porosity was φ=60.0 +- 6.2 percent. (author)

Theoretical and experimental study of image formation in scanning transmission electron microscopy

International Nuclear Information System (INIS)

Prunier epouse Mory, Claudie

1985-01-01

This thesis contains a theoretical and experimental study of image formation in a dedicated scanning transmission electron microscope (STEM). Using a detailed description of the different optical elements between the field emission source and the specimen, one calculates the shape and size of the primary probe of electrons impinging on the sample. This modelization enables to estimate the spatial resolution in the different imaging or microanalytical modes. The influence of the specimen and the role of the various detectors are taken into account to calculate the point spread function of the instrument in STEM imaging modes. An experimental study of the characteristic properties of phase contrast bright field micrographs and incoherent dark field ones is performed by comparison of digitally recorded images in similar conditions. Spatial resolution, contrast and signal/noise ratio are assessed by correlation methods, Fourier analysis and statistical considerations; one can deduce the optimum focusing conditions. Limits such as the point resolution on quasi-atomic metallic clusters are determined and an analysis of the capabilities of signal mixing concludes this work. Applications are offered in various domains such as the visualisation of small metallic particles, biomolecules and unstained biological sections. (author) [fr

A low delay transmission method of multi-channel video based on FPGA

Science.gov (United States)

Fu, Weijian; Wei, Baozhi; Li, Xiaobin; Wang, Quan; Hu, Xiaofei

2018-03-01

In order to guarantee the fluency of multi-channel video transmission in video monitoring scenarios, we designed a kind of video format conversion method based on FPGA and its DMA scheduling for video data, reduces the overall video transmission delay.In order to sace the time in the conversion process, the parallel ability of FPGA is used to video format conversion. In order to improve the direct memory access (DMA) writing transmission rate of PCIe bus, a DMA scheduling method based on asynchronous command buffer is proposed. The experimental results show that this paper designs a low delay transmission method based on FPGA, which increases the DMA writing transmission rate by 34% compared with the existing method, and then the video overall delay is reduced to 23.6ms.

Theoretical study of the transmission of low-energy (0-10 eV) electrons through thin-film organic molecular solids: benzene

International Nuclear Information System (INIS)

Goulet, T.; Jay-Gerin, J.-P.

1986-01-01

A theoretical study of the transmission of low-energy (0 to 10 eV) electrons incident from vacuum through thin-film organic molecular solids deposited on a cold metal substrate is presented and developed for the specific case of solid benzene. In essence, using a semiclassical description of electron transport in solids with an energy-independent scattering mean free path and assuming an isotropic electron scattering, the behavior of a penetrating electron in the film is simulated when a large number of scattering events are present. The good agreement between the calculated electron transmission spectra and those obtained experimentally indicates that our study provides a realistic description of the electron transport in the film, and accounts for the influence of the various electron-molecule scattering processes upon the energy dependence of the transmitted current. In particular, we show that the excitonic subionization energy losses are at the origin of the main structures of the observed electron transmission spectra. It is also shown that our study can successfully be used to estimate the probabilities of the various electron scattering processes which occur in the film, as well as the electron mean free path (l). For solid benzene, l is about 8 A in the considered electron energy range. (author)

Transmission Electron Microscopy Studies of Electron-Selective Titanium Oxide Contacts in Silicon Solar Cells

KAUST Repository

Ali, Haider

2017-08-15

In this study, the cross-section of electron-selective titanium oxide (TiO2) contacts for n-type crystalline silicon solar cells were investigated by transmission electron microscopy. It was revealed that the excellent cell efficiency of 21.6% obtained on n-type cells, featuring SiO2/TiO2/Al rear contacts and after forming gas annealing (FGA) at 350°C, is due to strong surface passivation of SiO2/TiO2 stack as well as low contact resistivity at the Si/SiO2/TiO2 heterojunction. This can be attributed to the transformation of amorphous TiO2 to a conducting TiO2-x phase. Conversely, the low efficiency (9.8%) obtained on cells featuring an a-Si:H/TiO2/Al rear contact is due to severe degradation of passivation of the a-Si:H upon FGA.

On-line transmission electron microscopic image analysis of chromatin texture for differentiation of thyroid gland tumors.

Science.gov (United States)

Kriete, A; Schäffer, R; Harms, H; Aus, H M

1987-06-01

Nuclei of the cells from the thyroid gland were analyzed in a transmission electron microscope by direct TV scanning and on-line image processing. The method uses the advantages of a visual-perception model to detect structures in noisy and low-contrast images. The features analyzed include area, a form factor and texture parameters from the second derivative stage. Three tumor-free thyroid tissues, three follicular adenomas, three follicular carcinomas and three papillary carcinomas were studied. The computer-aided cytophotometric method showed that the most significant differences were the statistics of the chromatin texture features of homogeneity and regularity. These findings document the possibility of an automated differentiation of tumors at the ultrastructural level.

Research on Quality Detection Methods for Automotive Transmission

Directory of Open Access Journals (Sweden)

Sheng FU

2014-04-01

Full Text Available Given the problems in intelligent diagnosis methods for automotive transmission, it is difficult to obtain the fault signal features and a large enough sample size to study. To solve these problems, a method integrating order tracking, cepstrum, support vector machine (SVM and extremal curve is proposed in this paper. Order tracking and cepstrum are combined for processing the non- stationary vibration signal emitted by automotive transmission. As conventional intelligent methods cannot produce true results for insufficient samples, a method that combines SVM and extremal curve is presented. Input the vector acquired from the feature signals into the SVM model for the first detection, and then do the second detection by means of extremal curve which in turn can enrich the training samples in SVM model thus making the SVM model be more perfect. Analytical description and experimental studies are presented for the methods of signal processing and quality detection. The experimental results demonstrate the effectiveness and practicability of the proposed method.

Fabrication and electric measurements of nanostructures inside transmission electron microscope.

Science.gov (United States)

Chen, Qing; Peng, Lian-Mao

2011-06-01

Using manipulation holders specially designed for transmission electron microscope (TEM), nanostructures can be characterized, measured, modified and even fabricated in-situ. In-situ TEM techniques not only enable real-time study of structure-property relationships of materials at atomic scale, but also provide the ability to control and manipulate materials and structures at nanoscale. This review highlights in-situ electric measurements and in-situ fabrication and structure modification using manipulation holder inside TEM. Copyright © 2011 Elsevier B.V. All rights reserved.

Methods for estimating disease transmission rates: Evaluating the precision of Poisson regression and two novel methods

DEFF Research Database (Denmark)

Kirkeby, Carsten Thure; Hisham Beshara Halasa, Tariq; Gussmann, Maya Katrin

2017-01-01

the transmission rate. We use data from the two simulation models and vary the sampling intervals and the size of the population sampled. We devise two new methods to determine transmission rate, and compare these to the frequently used Poisson regression method in both epidemic and endemic situations. For most...... tested scenarios these new methods perform similar or better than Poisson regression, especially in the case of long sampling intervals. We conclude that transmission rate estimates are easily biased, which is important to take into account when using these rates in simulation models....

Risk Analysis Method Based on FMEA for Transmission Line in Lightning Hazards

Directory of Open Access Journals (Sweden)

You-Yuan WANG

2014-05-01

Full Text Available Failure rate of transmission line and reliability of power system are significantly affected by Lightning meteorological factor. In view of the complexity and variability of Lightning meteorological factors, this paper presents lightning trip-out rate model of transmission line in considering distribution of ground flash density and lightning day hours. Meanwhile, presents a failure rate model of transmission line in different condition, and a risk analysis method for transmission line considering multiple risk factors based on risk quantification. This method takes Lightning meteorological factor as the main evaluation standard, and establishes risk degree evaluation system for transmission line including another five evaluation standard. Put forward the risk indicators by quantify the risk factors based on experience date of transmission line in service. Based on the risk indexes comprehensive evaluation is conducted, and the evaluation result closer to practice is achieved, providing basis for transmission line risk warning and maintenance strategy. Through the risk analysis for 220 kV transmission line in a certain power supply bureau, the effectiveness of the proposed method is validated.

Transmission electron microscopy investigation of Bi-2223/Ag tapes

DEFF Research Database (Denmark)

Andersen, L.G.; Bals, S.; Tendeloo, G. Van

2001-01-01

during the tape processing, (3) a study of the grain boundaries on an atomic scale, including intergrowth investigations. Tapes with different process parameters have been compared with respect to the microstructure. A fully processed tape has on the average 50% thicker Bi-2223 grains than a tape after......The microstructure of (Bi,Pb)(2)Sr2Ca2CuOx (Bi-2223) tapes has been investigated by means of transmission electron microscopy (TEM) and high-resolution TEM. The emphasis has been placed on: (1) an examination of the grain morphology and size, (2) grain and colony boundary angles, which are formed...

Dynamics of soft Nanomaterials captured by transmission electron microscopy in liquid water

Energy Technology Data Exchange (ETDEWEB)

Proetto, Maria T.; Rush, Anthony M.; Chien, Miao-Ping; Abellan Baeza, Patricia; Patterson, Joseph P.; Thompson, Matthew P.; Olson, Norman H.; Moore, Curtis E.; Rheingold, Arnold L.; Andolina, Christopher; Millstone, Jill; Howell, Stephen B.; Browning, Nigel D.; Evans, James E.; Gianneschi, Nathan C.

2014-01-14

In this paper we present in situ transmission electron microscopy (TEM) of soft, synthetic nanoparticles with a comparative analysis using conventional TEM methods. This comparison is made with the simple aim of describing what is an unprecedented example of in situ imaging by TEM. However, we contend the technique will quickly become essential in the characterization of analogous systems, especially where dynamics are of interest in the solvated state. In this case, particles were studied which were obtained from the direct polymerization of an oxaliplatin analog, designed for an ongoing program in novel chemotherapeutic delivery systems. The resulting nanoparticles provided sufficient contrast for facile imaging in situ, and point toward key design parameters that enable this new characterization approach for organic nanomaterials. We describe the preparation of the synthetic micellar nanoparticles to- gether with their characterization in liquid water.

METHODS OF POLYMODAL INFORMATION TRANSMISSION

Directory of Open Access Journals (Sweden)

O. O. Basov

2015-03-01

Full Text Available The research results upon the application of the existing information transmission methods in polymodal info communication systems are presented herein. The analysis of the existing commutation ways and multiplexing schemes has revealed that modern means of telecommunication are capable of providing polymodal information delivery with the required quality to the customer correspondent terminal. Under these conditions substantial capacity resource consumption in the data transmission networks with a simultaneous static time multiplexing is required, however, it is easier to achieve the modality synchronization within that kind of an infrastructure. The data networks with a static time multiplexing demand employing more sophisticated supporting algorithms of the guaranteed data blocks delivery quality. However, due to the stochastic data blocks delays modality synchronizing during the off-line processing is more difficult to provide. Nowadays there are objective preconditions for a data networking realization which is invariable to the applied transmission technology. This capability is defined by a wide (person-to-person application of the optical technologies in the transport infrastructure of the polymodal info communication systems. In case of the availability of the customer terminal and networking functioning matching mode it becomes possible to organize channels in the latter which can adaptively select the most effective networking technology according to the current volume allocation and modality types in the messages.

Transmission portal in vivo dosimetry by means of the Monte Carlo method and the mathematical programming language MATLAB

International Nuclear Information System (INIS)

BadraouiCuprova, K.

2014-01-01

Modern radiotherapy has increased demand for dose delivery verification. In this paper transmission portal dosimetry was considered. Portal detectors are a promising tool for 2D dosimetric verification and they are nowadays one of the most widely investigated topics. In this study an Electronic Portal Imaging Device (EPID) was positioned below the patient and the transmission images were captured during the irradiation. The principle of this verification consists of comparison of the acquired images with images predicted on the basis of the entrance fluence map and the tissue distribution in the patient. Such verification is not performed at any radiotherapy department in the Czech Republic. There is no system available for the prediction of transmission portal images. Even worldwide, there is still a lack of commercially available solutions. The aim of this paper is to present a new method of prediction of transmission portal images by means of the Monte Carlo (MC) method and the mathematical programming language MATLAB. The MC code EGSnrc (Electron Gamma Shower) was used. The validity of the presented method was verified by comparison of the predicted images with the acquired ones. The acquisition of EPID images was performed at the Hospital Na Bulovce. Three different validation tests were performed. In the first case, the EPID was irradiated by regular and irregular fields while there was nothing present in the beam path. In the second case, a water-equivalent phantom was added to the EPID and was irradiated by a number of irregular fields. In the third case, a real patient was present in the beam path and the EPID images were acquired during the patient's treatment. The patient was irradiated by 8 treatment fields and the portal images were acquired during 5 treatment fractions. All of the acquired images were compared with the MC predicted ones by gamma analysis with gamma criteria of 3%, 3 mm. The average gamma values were 0.31-0.4, 0.34-0.4 and 0.35-0.61 in

Study of transmission function and electronic transport in one dimensional silver nanowire: Ab-initio method using density functional theory (DFT)

Science.gov (United States)

Thakur, Anil; Kashyap, Rajinder

2018-05-01

Single nanowire electrode devices have their application in variety of fields which vary from information technology to solar energy. Silver nanowires, made in an aqueous chemical reduction process, can be reacted with gold salt to create bimetallic nanowires. Silver nanowire can be used as electrodes in batteries and have many other applications. In this paper we investigated structural and electronic transport properties of Ag nanowire using density functional theory (DFT) with SIESTA code. Electronic transport properties of Ag nanowire have been studied theoretically. First of all an optimized geometry for Ag nanowire is obtained using DFT calculations, and then the transport relations are obtained using NEGF approach. SIESTA and TranSIESTA simulation codes are used in the calculations respectively. The electrodes are chosen to be the same as the central region where transport is studied, eliminating current quantization effects due to contacts and focusing the electronic transport study to the intrinsic structure of the material. By varying chemical potential in the electrode regions, an I-V curve is traced which is in agreement with the predicted behavior. Bulk properties of Ag are in agreement with experimental values which make the study of electronic and transport properties in silver nanowires interesting because they are promising materials as bridging pieces in nanoelectronics. Transmission coefficient and V-I characteristic of Ag nano wire reveals that silver nanowire can be used as an electrode device.

Advanced scanning transmission stereo electron microscopy of structural and functional engineering materials

Czech Academy of Sciences Publication Activity Database

Agudo Jácome, L.; Eggeler, G.; Dlouhý, Antonín

2012-01-01

Roč. 122, NOV (2012), s. 48-59 ISSN 0304-3991 R&D Projects: GA ČR GA202/09/2073 Institutional research plan: CEZ:AV0Z20410507 Keywords : stereoscopy * scanning transmission electron microscopy * single crystal Ni-base superalloys * Dislocation substructures * Foil thickness measurement Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.470, year: 2012

Microstructure of NiTi orthodontic wires observations using transmission electron microscopy

OpenAIRE

Ferčec, J.; Jenko, D.; Buchmeister, B.; Rojko, F.; Budič, B.; Kosec, B.; Rudolf, R.

2014-01-01

This work presents the results of the microstructure observation of six different types of NiTi orthodontic wires by using Transmission Electron Microscopy (TEM). Within these analyses the chemical compositions of each wire were observed in different places by applying the EDS detector. Namely, the chemical composition in the orthodontic wires is very important because it shows the dependence between the phase temperatures and mechanical properties. Microstructure observations showed that ort...

Aberration corrected and monochromated environmental transmission electron microscopy: challenges and prospects for materials science

DEFF Research Database (Denmark)

Hansen, Thomas Willum; Wagner, Jakob Birkedal; Dunin-Borkowski, Rafal E.

2010-01-01

The latest generation of environmental transmission electron microscopes incorporates aberration correctors and monochromators, allowing studies of chemical reactions and growth processes with improved spatial resolution and spectral sensitivity. Here, we describe the performance of such an instr...

Subcellular localisation of radionuclides by transmission electronic microscopy in aquatic and terrestrial organisms

Energy Technology Data Exchange (ETDEWEB)

Floriani, M.; Grasset, G.; Simon, O.; Morlon, H.; Laroche, L. [CEA Cadarache (DEI/SECRE/LRE), Laboratory of Radioecology and Ecotoxicology, Institute for Radioprotection and Nuclear Safety, 13 - Saint-Paul-lez-Durance (France)

2004-07-01

The global framework of this study is to go further in the understanding of the involved mechanisms of uranium and selenium internalisation at the subcellular level and of their toxicity towards several aquatic and terrestrial organisms. In this context, the applications and performances of a Scanning Transmission Electron Microscope (TEM/STEM) equipped with CCD camera and Energy-Dispersive- X-Ray (EDAX) analysis are reported. The principal merit of this equipment is the clear expression of element distribution with nanometer resolution. The sample for TEM analysis were prepared in ultrathin sections of 70-140 nm (thickness) and those for EDAX in sections of 200-500 nm. This method offers the possibility of a direct correlation between histological image and distribution map of trace elements. For each sample, following TEM analysis, EDAX spectra or EDAX mapping were also recorded to confirm the identity of the electron dense material in the scanned sections. Demonstration of the usefulness of this method to understand the bioaccumulation mechanisms and to study the effect of the pollutant uptake at the subcellular level was performed for target organs of a metal (U) and a metalloid (Se) in various biological models: a higher rooted plant (Phaseolus vulgaris)) and a freshwater invertebrate (Orconectes Limosus) and a unicellular green alga (Chlamydomonas reinhardtii)). TEM-EDAX analysis revealed the presence of U-deposits in gills and digestive gland in crayfish, and in vacuoles or in the cytoplasm of different rooted cells bean. In the alga, the accumulation of Se was found in electron-dense granules within cytoplasm associated with ultrastructural changes and starch accumulation. (author)

Subcellular localisation of radionuclides by transmission electronic microscopy in aquatic and terrestrial organisms

International Nuclear Information System (INIS)

Floriani, M.; Grasset, G.; Simon, O.; Morlon, H.; Laroche, L.

2004-01-01

The global framework of this study is to go further in the understanding of the involved mechanisms of uranium and selenium internalisation at the subcellular level and of their toxicity towards several aquatic and terrestrial organisms. In this context, the applications and performances of a Scanning Transmission Electron Microscope (TEM/STEM) equipped with CCD camera and Energy-Dispersive- X-Ray (EDAX) analysis are reported. The principal merit of this equipment is the clear expression of element distribution with nanometer resolution. The sample for TEM analysis were prepared in ultrathin sections of 70-140 nm (thickness) and those for EDAX in sections of 200-500 nm. This method offers the possibility of a direct correlation between histological image and distribution map of trace elements. For each sample, following TEM analysis, EDAX spectra or EDAX mapping were also recorded to confirm the identity of the electron dense material in the scanned sections. Demonstration of the usefulness of this method to understand the bioaccumulation mechanisms and to study the effect of the pollutant uptake at the subcellular level was performed for target organs of a metal (U) and a metalloid (Se) in various biological models: a higher rooted plant (Phaseolus vulgaris)) and a freshwater invertebrate (Orconectes Limosus) and a unicellular green alga (Chlamydomonas reinhardtii)). TEM-EDAX analysis revealed the presence of U-deposits in gills and digestive gland in crayfish, and in vacuoles or in the cytoplasm of different rooted cells bean. In the alga, the accumulation of Se was found in electron-dense granules within cytoplasm associated with ultrastructural changes and starch accumulation. (author)

Scanning transmission electron microscopy: Albert Crewe's vision and beyond

International Nuclear Information System (INIS)

Krivanek, Ondrej L.; Chisholm, Matthew F.; Murfitt, Matthew F.; Dellby, Niklas

2012-01-01

Some four decades were needed to catch up with the vision that Albert Crewe and his group had for the scanning transmission electron microscope (STEM) in the nineteen sixties and seventies: attaining 0.5 Å resolution, and identifying single atoms spectroscopically. With these goals now attained, STEM developments are turning toward new directions, such as rapid atomic resolution imaging and exploring atomic bonding and electronic properties of samples at atomic resolution. The accomplishments and the future challenges are reviewed and illustrated with practical examples. -- Highlights: ► TV-rate STEM imaging of heavy atoms is demonstrated. ► DNA sequencing by STEM dark field imaging should be possible at a rate of 10 6 bases/s. ► Individual silicon atom impurities in graphene are imaged atom-by-atom. ► Single atoms of nitrogen and boron incorporated in graphene are imaged spectroscopically. ► Bonding of individual atoms can be probed by analyzing the fine structures of their EEL spectra.

Automated magnification calibration in transmission electron microscopy using Fourier analysis of replica images

International Nuclear Information System (INIS)

Laak, Jeroen A.W.M. van der; Dijkman, Henry B.P.M.; Pahlplatz, Martin M.M.

2006-01-01

The magnification factor in transmission electron microscopy is not very precise, hampering for instance quantitative analysis of specimens. Calibration of the magnification is usually performed interactively using replica specimens, containing line or grating patterns with known spacing. In the present study, a procedure is described for automated magnification calibration using digital images of a line replica. This procedure is based on analysis of the power spectrum of Fourier transformed replica images, and is compared to interactive measurement in the same images. Images were used with magnification ranging from 1,000x to 200,000x. The automated procedure deviated on average 0.10% from interactive measurements. Especially for catalase replicas, the coefficient of variation of automated measurement was considerably smaller (average 0.28%) compared to that of interactive measurement (average 3.5%). In conclusion, calibration of the magnification in digital images from transmission electron microscopy may be performed automatically, using the procedure presented here, with high precision and accuracy

Calculation of electron transmission through aluminium foil

International Nuclear Information System (INIS)

Abroyan, M.A.; Mel'ker, A.I.; Mikhajlin, A.I.; Sirotinkin, V.V.; Tokmakov, I.L.

1987-01-01

Calculated by Monte Carlo method energy and angular distributions of electrons transmitted through aluminium foil with 50 μm thickness are presented. 200-500 electron energy ranges and angles of electron incidence on foil from 0 to 40 deg C are considered. That allows to use results for more universal accelerator group, for example, for accelerators with scanning beam used in industry. The received values of angular and energy characteristics allow to increase essentially estimation accuracy of accelerator extraction devices and dose distribution on irradiating item

Characterization of a direct detection device imaging camera for transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Milazzo, Anna-Clare, E-mail: amilazzo@ncmir.ucsd.edu [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Moldovan, Grigore [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Lanman, Jason [Department of Molecular Biology, The Scripps Research Institute, La Jolla, CA 92037 (United States); Jin, Liang; Bouwer, James C. [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Klienfelder, Stuart [University of California at Irvine, Irvine, CA 92697 (United States); Peltier, Steven T.; Ellisman, Mark H. [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States); Kirkland, Angus I. [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Xuong, Nguyen-Huu [University of California at San Diego, 9500 Gilman Dr., La Jolla, CA 92093 (United States)

2010-06-15

The complete characterization of a novel direct detection device (DDD) camera for transmission electron microscopy is reported, for the first time at primary electron energies of 120 and 200 keV. Unlike a standard charge coupled device (CCD) camera, this device does not require a scintillator. The DDD transfers signal up to 65 lines/mm providing the basis for a high-performance platform for a new generation of wide field-of-view high-resolution cameras. An image of a thin section of virus particles is presented to illustrate the substantially improved performance of this sensor over current indirectly coupled CCD cameras.

Characterization of a direct detection device imaging camera for transmission electron microscopy

International Nuclear Information System (INIS)

Milazzo, Anna-Clare; Moldovan, Grigore; Lanman, Jason; Jin, Liang; Bouwer, James C.; Klienfelder, Stuart; Peltier, Steven T.; Ellisman, Mark H.; Kirkland, Angus I.; Xuong, Nguyen-Huu

2010-01-01

The complete characterization of a novel direct detection device (DDD) camera for transmission electron microscopy is reported, for the first time at primary electron energies of 120 and 200 keV. Unlike a standard charge coupled device (CCD) camera, this device does not require a scintillator. The DDD transfers signal up to 65 lines/mm providing the basis for a high-performance platform for a new generation of wide field-of-view high-resolution cameras. An image of a thin section of virus particles is presented to illustrate the substantially improved performance of this sensor over current indirectly coupled CCD cameras.

Numerical study of electron-leakage power loss in a tri-plate transmission line

International Nuclear Information System (INIS)

Barker, R.J.; Goldstein, S.A.

1982-01-01

Numerical simulations have been conducted using NRL's DIODE2D computer code to model the steady-state behavior of electron flow in a radial diode and in its adjacent tri-plate transmission line (TTL). Particular attention was paid to the magnitude of the electron current flowing from the cathode to the anode surface in the TTL. A quantitative value for this effective power loss is given. The electron current is restricted mainly to the transition region in the TTL into which there is seepage of the B/sub z/ that is imposed in the diode gap. This finding highlights the importance of that region to diode designers

Correction of bubble size distributions from transmission electron microscopy observations

International Nuclear Information System (INIS)

Kirkegaard, P.; Eldrup, M.; Horsewell, A.; Skov Pedersen, J.

1996-01-01

Observations by transmission electron microscopy of a high density of gas bubbles in a metal matrix yield a distorted size distribution due to bubble overlap and bubble escape from the surface. A model is described that reconstructs 3-dimensional bubble size distributions from 2-dimensional projections on taking these effects into account. Mathematically, the reconstruction is an ill-posed inverse problem, which is solved by regularization technique. Extensive Monte Carlo simulations support the validity of our model. (au) 1 tab., 32 ills., 32 refs

Gas-phase synthesis of magnesium nanoparticles : A high-resolution transmission electron microscopy study

NARCIS (Netherlands)

Kooi, B.J.; Palasantzas, G.; de Hosson, J.T.M.

2006-01-01

Magnesium nanoparticles with size above 10 nm, prepared by gas-phase syntheses, were investigated by high-resolution transmission electron microscopy. The dominant particle shape is a hexagonal prism terminated by Mg(0002) and Mg{1010} facets. Oxidation of Mg yields a MgO shell (similar to 3 nm

In-situ transmission electron microscopy growth of nanoparticles under extreme conditions

International Nuclear Information System (INIS)

Luce, F. P.; Azevedo, G. de M.; Baptista, D. L.; Zawislak, F. C.; Oliviero, E.; Fichtner, P. F. P.

2016-01-01

The formation and time resolved behavior of individual Pb nanoparticles embedded in silica have been studied by in-situ transmission electron microscopy observations at high temperatures (400–1100 °C) and under 200 keV electron irradiation. It is shown that under such extreme conditions, nanoparticles can migrate at long distances presenting a Brownian-like behavior and eventually coalesce. The particle migration phenomenon is discussed considering the influence of the thermal energy and the electron irradiation effects on the atomic diffusion process which is shown to control particle migration. These results and comparison with ex-situ experiments tackle the stability and the microstructure evolution of nanoparticles systems under extreme conditions. It elucidates on the effects of energetic particle irradiation-annealing treatments either as a tool or as a detrimental issue that could hamper their long-term applications in radiation-harsh environments such as in space or nuclear sectors

On the role of the gas environment, electron-dose-rate, and sample on the image resolution in transmission electron microscopy

DEFF Research Database (Denmark)

Ek, Martin; Jespersen, Sebastian Pirel Fredsgaard; Damsgaard, Christian Danvad

2016-01-01

on the electron-dose-rate. In this article, we demonstrate that both the total and areal electron-dose-rates work as descriptors for the dose-rate-dependent resolution and are related through the illumination area. Furthermore, the resolution degradation was observed to occur gradually over time after......The introduction of gaseous atmospheres in transmission electron microscopy offers the possibility of studying materials in situ under chemically relevant environments. The presence of a gas environment can degrade the resolution. Surprisingly, this phenomenon has been shown to depend...... initializing the illumination of the sample and gas by the electron beam. The resolution was also observed to be sensitive to the electrical conductivity of the sample. These observations can be explained by a charge buildup over the electron-illuminated sample area, caused by the beam–gas–sample interaction...

Collaborative Research and Development. Delivery Order 0006: Transmission Electron Microscope Image Modeling and Semiconductor Heterointerface Characterization

National Research Council Canada - National Science Library

Mahalingam, Krishnamurthy

2006-01-01

.... Transmission electron microscope (TEM) characterization studies were performed on a variety of novel III-V semiconductor heterostructures being developed for advanced optoelectronic device applications...

Radiating nonuniform transmission-line systems and the partial element equivalent circuit method

CERN Document Server

Nitsch, Juergen; Wollenberg, Gunter

2009-01-01

High frequencies of densely packed modern electronic equipment turn even the smallest piece of wire into a transmission line with signal retardation, dispersion, attenuation, and distortion. In electromagnetic environments with high-power microwave or ultra-wideband sources, transmission lines pick up noise currents generated by external electromagnetic fields. These are superimposed on essential signals, the lines acting not only as receiving antennas but radiating parts of the signal energy into the environment. This book is outstanding in its originality. While many textbooks rephrase

Diagnosis of Unmagnetized Plasma Electron Number Density and Electron-neutral Collision Frequency by Using Microwave

International Nuclear Information System (INIS)

Yuan Zhongcai; Shi Jiaming; Xu Bo

2005-01-01

The plasma diagnostic method using the transmission attenuation of microwaves at double frequencies (PDMUTAMDF) indicates that the frequency and the electron-neutral collision frequency of the plasma can be deduced by utilizing the transmission attenuation of microwaves at two neighboring frequencies in a non-magnetized plasma. Then the electron density can be obtained from the plasma frequency. The PDMUTAMDF is a simple method to diagnose the plasma indirectly. In this paper, the interaction of electromagnetic waves and the plasma is analyzed. Then, based on the attenuation and the phase shift of a microwave in the plasma, the principle of the PDMUTAMDF is presented. With the diagnostic method, the spatially mean electron density and electron collision frequency of the plasma can be obtained. This method is suitable for the elementary diagnosis of the atmospheric-pressure plasma

The transmission probability method in one-dimensional cylindrical geometry

International Nuclear Information System (INIS)

Rubin, I.E.

1983-01-01

The collision probability method widely used in solving the problems of neutron transpopt in a reactor cell is reliable for simple cells with small number of zones. The increase of the number of zones and also taking into account the anisotropy of scattering greatly increase the scope of calculations. In order to reduce the time of calculation the transmission probability method is suggested to be used for flux calculation in one-dimensional cylindrical geometry taking into account the scattering anisotropy. The efficiency of the suggested method is verified using the one-group calculations for cylindrical cells. The use of the transmission probability method allows to present completely angular and spatial dependences is neutrons distributions without the increase in the scope of calculations. The method is especially effective in solving the multi-group problems

Progress and applications of in situ transmission electron microscopy

International Nuclear Information System (INIS)

Wang Rongming; Liu Jialong; Song Yuanjun

2015-01-01

Recent progress in the application of in situ transmission electron microscopy (TEM) is briefly reviewed. It is emphasized that the development of advanced in situ TEM techniques makes it possible to investigate the evolution of materials under heat, strain, magnetic field, electric field or chemical reaction environments on the atomic scale. The mechanism of the microstructure evolution under various conditions and the relationship between the atomic structures and their properties can be obtained, which is beneficial for the design of new materials with tailored properties. The clarification of the structure-property relationship will help to develop new materials and solve related basic problems in the field of condensed matter physics. (authors)

A high-speed transmission method for large-scale marine seismic prospecting systems

International Nuclear Information System (INIS)

KeZhu, Song; Ping, Cao; JunFeng, Yang; FuMing, Ruan

2012-01-01

A marine seismic prospecting system is a kind of data acquisition and transmission system with large-scale coverage and synchronous multi-node acquisition. In this kind of system, data transmission is a fundamental and difficult technique. In this paper, a high-speed data-transmission method is proposed, its implications and limitations are discussed, and conclusions are drawn. The method we propose has obvious advantages over traditional techniques with respect to long-distance operation, high speed, and real-time transmission. A marine seismic system with four streamers, each 6000 m long and capable of supporting up to 1920 channels, was designed and built based on this method. The effective transmission baud rate of this system was found to reach up to 240 Mbps, while the minimum sampling interval time was as short as 0.25 ms. This system was found to achieve a good synchronization: 83 ns. Laboratory and in situ experiments showed that this marine-prospecting system could work correctly and robustly, which verifies the feasibility and validity of the method proposed in this paper. In addition to the marine seismic applications, this method can also be used in land seismic applications and certain other transmission applications such as environmental or engineering monitoring systems. (paper)

A high-speed transmission method for large-scale marine seismic prospecting systems

Science.gov (United States)

KeZhu, Song; Ping, Cao; JunFeng, Yang; FuMing, Ruan

2012-12-01

A marine seismic prospecting system is a kind of data acquisition and transmission system with large-scale coverage and synchronous multi-node acquisition. In this kind of system, data transmission is a fundamental and difficult technique. In this paper, a high-speed data-transmission method is proposed, its implications and limitations are discussed, and conclusions are drawn. The method we propose has obvious advantages over traditional techniques with respect to long-distance operation, high speed, and real-time transmission. A marine seismic system with four streamers, each 6000 m long and capable of supporting up to 1920 channels, was designed and built based on this method. The effective transmission baud rate of this system was found to reach up to 240 Mbps, while the minimum sampling interval time was as short as 0.25 ms. This system was found to achieve a good synchronization: 83 ns. Laboratory and in situ experiments showed that this marine-prospecting system could work correctly and robustly, which verifies the feasibility and validity of the method proposed in this paper. In addition to the marine seismic applications, this method can also be used in land seismic applications and certain other transmission applications such as environmental or engineering monitoring systems.

Transmission electron microscopic study of reduced Ca2UO5

International Nuclear Information System (INIS)

Krasevec, V.; Prodan, A.; Holc, J.; Kolar, D.

1983-01-01

Structural changes of Ca 2 UO 5 during reduction in hydrogen were studied by transmission electron microscopy. It was shown that monoclinic Ca 2 UO 5 changes into triclinic Ca 4 U 2 O 9 . They are related, respectively, to the fluorite and the bixbyite (C-M 2 O 3 ) structures, so that the product is a superstructure of the latter. Reduction occurs along the (100)/sub t/ planes originating from the (006)/sub m/ planes of the parent structure by diminishing the coordination number of the Ca cation from 7 to 6. 5 figures

Highlighting material structure with transmission electron diffraction correlation coefficient maps

International Nuclear Information System (INIS)

Kiss, Ákos K.; Rauch, Edgar F.; Lábár, János L.

2016-01-01

Correlation coefficient maps are constructed by computing the differences between neighboring diffraction patterns collected in a transmission electron microscope in scanning mode. The maps are shown to highlight material structural features like grain boundaries, second phase particles or dislocations. The inclination of the inner crystal interfaces are directly deduced from the resulting contrast. - Highlights: • We propose a novel technique to image the structure of polycrystalline TEM-samples. • Correlation coefficients maps highlights the evolution of the diffracting signal. • 3D views of grain boundaries are provided for nano-particles or polycrystals.

Exploring the environmental transmission electron microscope

DEFF Research Database (Denmark)

Wagner, Jakob B.; Cavalca, Filippo; Damsgaard, Christian D.

2012-01-01

of the opportunities that the environmental TEM (ETEM) offers when combined with other in situ techniques will be explored, directly in the microscope, by combining electron-based and photon-based techniques and phenomena. In addition, application of adjacent setups using sophisticated transfer methods...

METHOD FOR OBSERVATION OF DEEMBEDDED SECTIONS OF FISH GONAD BY SCANNING ELECTRON MICROSCOPY

Institute of Scientific and Technical Information of China (English)

无

2000-01-01

This article reports a method for examining the intracellular structure of fish gonads using a scanning electron microscope(SEM). The specimen preparation procedure is similar to that for transmission electron microscopy wherein samples cut into semi-thin sections are fixed and embedded in plastic. The embedment matrix was removed by solvents. Risen-free specimens could be observed by SEM. The morphology of matured sperms in the gonad was very clear, and the oocyte internal structures appeared in three-dimensional images. Spheroidal nucleoli and yolk vesicles and several bundles of filaments adhered on the nucleoli could be viewed by SEM for the first time.

Methods for measurement of electron emission yield under low energy electron-irradiation by collector method and Kelvin probe method

Energy Technology Data Exchange (ETDEWEB)

Tondu, Thomas; Belhaj, Mohamed; Inguimbert, Virginie [Onera, DESP, 2 Avenue Edouard Belin, 31400 Toulouse (France); Onera, DESP, 2 Avenue Edouard Belin, 31400 Toulouse, France and Fondation STAE, 4 allee Emile Monso, BP 84234-31432, Toulouse Cedex 4 (France); Onera, DESP, 2 Avenue Edouard Belin, 31400 Toulouse (France)

2010-09-15

Secondary electron emission yield of gold under electron impact at normal incidence below 50 eV was investigated by the classical collector method and by the Kelvin probe method. The authors show that biasing a collector to ensure secondary electron collection while keeping the target grounded can lead to primary electron beam perturbations. Thus reliable secondary electron emission yield at low primary electron energy cannot be obtained with a biased collector. The authors present two collector-free methods based on current measurement and on electron pulse surface potential buildup (Kelvin probe method). These methods are consistent, but at very low energy, measurements become sensitive to the earth magnetic field (below 10 eV). For gold, the authors can extrapolate total emission yield at 0 eV to 0.5, while a total electron emission yield of 1 is obtained at 40{+-}1 eV.

Methods for measurement of electron emission yield under low energy electron-irradiation by collector method and Kelvin probe method

International Nuclear Information System (INIS)

Tondu, Thomas; Belhaj, Mohamed; Inguimbert, Virginie

2010-01-01

Secondary electron emission yield of gold under electron impact at normal incidence below 50 eV was investigated by the classical collector method and by the Kelvin probe method. The authors show that biasing a collector to ensure secondary electron collection while keeping the target grounded can lead to primary electron beam perturbations. Thus reliable secondary electron emission yield at low primary electron energy cannot be obtained with a biased collector. The authors present two collector-free methods based on current measurement and on electron pulse surface potential buildup (Kelvin probe method). These methods are consistent, but at very low energy, measurements become sensitive to the earth magnetic field (below 10 eV). For gold, the authors can extrapolate total emission yield at 0 eV to 0.5, while a total electron emission yield of 1 is obtained at 40±1 eV.

Total electron content measurements at Gauhati using 140 MHz ATS-6 transmissions

International Nuclear Information System (INIS)

Tyagi, T.R.; Singh, L.; Minakshi Devi; Barbara, A.K.

1977-01-01

The amplitude and phase of 140 MHz transmissions from geostationary satellite ATS-6 (0 0 N, 35 0 E) have been recorded at Gauhati (26.16 0 N; 91.75 0 E) for the period Nov. 1975 to Aug. 1976. The calibration technique for geostationary satellite Faraday rotation measurements suggested by Checcacci and Giorgeo has been improved and generalized. It is then utilized to remove the n ambiguity in Faraday rotation values and also to estimate the correct value of diurnal minimum Faraday rotation angle so that the recorded Faraday rotation values can be converted into electron content values. Typical diurnal variation curves have been obtained for all the months except for equinoxes when the satellite transmission was off very often due to ecliptic conditions and hence no complete diurnal curves could be obtained for these months. It has been found that though December and January behave like typical winter months, the month of November is more like an equinoctial month. Similarly, though June and July behave like typical summer months, the month of May is more or less similar to equinoxes. The characteristic features of the diurnal and seasonal behaviour of the electron content have been discussed. (author)

In situ measurements and transmission electron microscopy of carbon nanotube field-effect transistors

International Nuclear Information System (INIS)

Kim, Taekyung; Kim, Seongwon; Olson, Eric; Zuo Jianmin

2008-01-01

We present the design and operation of a transmission electron microscopy (TEM)-compatible carbon nanotube (CNT) field-effect transistor (FET). The device is configured with microfabricated slits, which allows direct observation of CNTs in a FET using TEM and measurement of electrical transport while inside the TEM. As demonstrations of the device architecture, two examples are presented. The first example is an in situ electrical transport measurement of a bundle of carbon nanotubes. The second example is a study of electron beam radiation effect on CNT bundles using a 200 keV electron beam. In situ electrical transport measurement during the beam irradiation shows a signature of wall- or tube-breakdown. Stepwise current drops were observed when a high intensity electron beam was used to cut individual CNT bundles in a device with multiple bundles

Simulation and Analysis of Microwave Transmission through an Electron Cloud, a Comparison of Results

International Nuclear Information System (INIS)

Sonnad, Kiran; Sonnad, Kiran; Furman, Miguel; Veitzer, Seth; Stoltz, Peter; Cary, John

2007-01-01

Simulation studies for transmission of microwaves through electron clouds show good agreement with analytic results. The electron cloud produces a shift in phase of the microwave. Experimental observation of this phenomena would lead to a useful diagnostic tool for accessing the local density of electron clouds in an accelerator. These experiments are being carried out at the CERN SPS and the PEP-II LER at SLAC and is proposed to be done at the Fermilab main injector. In this study, a brief analysis of the phase shift is provided and the results are compared with that obtained from simulations

Nucleation of diamond by pure carbon ion bombardment--a transmission electron microscopy study

International Nuclear Information System (INIS)

Yao, Y.; Liao, M.Y.; Wang, Z.G.; Lifshitz, Y.; Lee, S.

2005-01-01

A cross-sectional high-resolution transmission electron microscopy (HRTEM) study of a film deposited by a 1 keV mass-selected carbon ion beam onto silicon held at 800 deg. C is presented. Initially, a graphitic film with its basal planes perpendicular to the substrate is evolving. The precipitation of nanodiamond crystallites in upper layers is confirmed by HRTEM, selected area electron diffraction, and electron energy loss spectroscopy. The nucleation of diamond on graphitic edges as predicted by Lambrecht et al. [W. R. L. Lambrecht, C. H. Lee, B. Segall, J. C. Angus, Z. Li, and M. Sunkara, Nature, 364 607 (1993)] is experimentally confirmed. The results are discussed in terms of our recent subplantation-based diamond nucleation model

Electronic excitation in transmission of relativistic H- ions through thin foils

International Nuclear Information System (INIS)

Reinhold, C.O.; Kuerpick, P.; Burgdoerfer, J.; Yoshida, S.

1998-01-01

The authors describe a theoretical model to study the transmission of relativistic H - ions through thin carbon foils. The approach is based on a Monte Carlo solution of the Langevin equation describing electronic excitations of the atoms during the transport through the foil. Calculations for the subshell populations of outgoing hydrogen atoms are found to be in good agreement with recent experimental data on an absolute scale and show that there exists a propensity for populating extreme Stark states

Ultrafast transmission electron microscopy using a laser-driven field emitter: Femtosecond resolution with a high coherence electron beam

Energy Technology Data Exchange (ETDEWEB)

Feist, Armin; Bach, Nora; Rubiano da Silva, Nara; Danz, Thomas; Möller, Marcel; Priebe, Katharina E.; Domröse, Till; Gatzmann, J. Gregor; Rost, Stefan; Schauss, Jakob; Strauch, Stefanie; Bormann, Reiner; Sivis, Murat; Schäfer, Sascha, E-mail: sascha.schaefer@phys.uni-goettingen.de; Ropers, Claus, E-mail: claus.ropers@uni-goettingen.de

2017-05-15

We present the development of the first ultrafast transmission electron microscope (UTEM) driven by localized photoemission from a field emitter cathode. We describe the implementation of the instrument, the photoemitter concept and the quantitative electron beam parameters achieved. Establishing a new source for ultrafast TEM, the Göttingen UTEM employs nano-localized linear photoemission from a Schottky emitter, which enables operation with freely tunable temporal structure, from continuous wave to femtosecond pulsed mode. Using this emission mechanism, we achieve record pulse properties in ultrafast electron microscopy of 9 Å focused beam diameter, 200 fs pulse duration and 0.6 eV energy width. We illustrate the possibility to conduct ultrafast imaging, diffraction, holography and spectroscopy with this instrument and also discuss opportunities to harness quantum coherent interactions between intense laser fields and free-electron beams. - Highlights: • First implementation of an ultrafast TEM employing a nanoscale photocathode. • Localized single photon-photoemission from nanoscopic field emitter yields low emittance ultrashort electron pulses. • Electron pulses focused down to ~9 Å, with a duration of 200 fs and an energy width of 0.6 eV are demonstrated. • Quantitative characterization of ultrafast electron gun emittance and brightness. • A range of applications of high coherence ultrashort electron pulses is shown.

Number transmission of 0.6 and 0.8MeV electrons in elemental materials

International Nuclear Information System (INIS)

Harami, Taikan; Takagaki, Torao; Matsuda, Koji; Nakai, Yohta.

1975-01-01

The number transmissions of electrons in Be, Al, Cu and Ag were obtained experimentally for well collimated electron beams of 0.6 and 0.8 MeV. Experimental results of the present work join smoothly to the previous ones of 1.0 MeV to 2.0 MeV electrons. The ratios of extrapolated range Rsub(ex) to true range R 0 give generally minimum values near 1 MeV (approximately 2mc 2 ) as well as the stopping power. An investigation was done for empirical equation of the form eta=exp(-xP/CEsup(m)), where E is the incident electron energy, x, penetration depth, and p, C and m are the parameters determined from experimental data. (author)

Validities of three multislice algorithms for quantitative low-energy transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Ming, W.Q.; Chen, J.H., E-mail: jhchen123@hnu.edu.cn

2013-11-15

Three different types of multislice algorithms, namely the conventional multislice (CMS) algorithm, the propagator-corrected multislice (PCMS) algorithm and the fully-corrected multislice (FCMS) algorithm, have been evaluated in comparison with respect to the accelerating voltages in transmission electron microscopy. Detailed numerical calculations have been performed to test their validities. The results show that the three algorithms are equivalent for accelerating voltage above 100 kV. However, below 100 kV, the CMS algorithm will introduce significant errors, not only for higher-order Laue zone (HOLZ) reflections but also for zero-order Laue zone (ZOLZ) reflections. The differences between the PCMS and FCMS algorithms are negligible and mainly appear in HOLZ reflections. Nonetheless, when the accelerating voltage is further lowered to 20 kV or below, the PCMS algorithm will also yield results deviating from the FCMS results. The present study demonstrates that the propagation of the electron wave from one slice to the next slice is actually cross-correlated with the crystal potential in a complex manner, such that when the accelerating voltage is lowered to 10 kV, the accuracy of the algorithms is dependent of the scattering power of the specimen. - Highlights: • Three multislice algorithms for low-energy transmission electron microscopy are evaluated. • The propagator-corrected algorithm is a good alternative for voltages down to 20 kV. • Below 20 kV, a fully-corrected algorithm has to be employed for quantitative simulations.

Validities of three multislice algorithms for quantitative low-energy transmission electron microscopy

International Nuclear Information System (INIS)

Ming, W.Q.; Chen, J.H.

2013-01-01

Three different types of multislice algorithms, namely the conventional multislice (CMS) algorithm, the propagator-corrected multislice (PCMS) algorithm and the fully-corrected multislice (FCMS) algorithm, have been evaluated in comparison with respect to the accelerating voltages in transmission electron microscopy. Detailed numerical calculations have been performed to test their validities. The results show that the three algorithms are equivalent for accelerating voltage above 100 kV. However, below 100 kV, the CMS algorithm will introduce significant errors, not only for higher-order Laue zone (HOLZ) reflections but also for zero-order Laue zone (ZOLZ) reflections. The differences between the PCMS and FCMS algorithms are negligible and mainly appear in HOLZ reflections. Nonetheless, when the accelerating voltage is further lowered to 20 kV or below, the PCMS algorithm will also yield results deviating from the FCMS results. The present study demonstrates that the propagation of the electron wave from one slice to the next slice is actually cross-correlated with the crystal potential in a complex manner, such that when the accelerating voltage is lowered to 10 kV, the accuracy of the algorithms is dependent of the scattering power of the specimen. - Highlights: • Three multislice algorithms for low-energy transmission electron microscopy are evaluated. • The propagator-corrected algorithm is a good alternative for voltages down to 20 kV. • Below 20 kV, a fully-corrected algorithm has to be employed for quantitative simulations

Determination of aberration center of Ronchigram for automated aberration correctors in scanning transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Sannomiya, Takumi, E-mail: sannomiya@mtl.titech.ac.jp [Tokyo Institute of Technology, Ookayama, Tokyo (Japan); Sawada, Hidetaka; Nakamichi, Tomohiro; Hosokawa, Fumio [JEOL Limited, Akishima, Tokyo (Japan); Nakamura, Yoshio; Tanishiro, Yasumasa; Takayanagi, Kunio [Tokyo Institute of Technology, Ookayama, Tokyo (Japan)

2013-12-15

A generic method to determine the aberration center is established, which can be utilized for aberration calculation and axis alignment for aberration corrected electron microscopes. In this method, decentering induced secondary aberrations from inherent primary aberrations are minimized to find the appropriate axis center. The fitness function to find the optimal decentering vector for the axis was defined as a sum of decentering induced secondary aberrations with properly distributed weight values according to the aberration order. Since the appropriate decentering vector is determined from the aberration values calculated at an arbitrary center axis, only one aberration measurement is in principle required to find the center, resulting in /very fast center search. This approach was tested for the Ronchigram based aberration calculation method for aberration corrected scanning transmission electron microscopy. Both in simulation and in experiments, the center search was confirmed to work well although the convergence to find the best axis becomes slower with larger primary aberrations. Such aberration center determination is expected to fully automatize the aberration correction procedures, which used to require pre-alignment of experienced users. This approach is also applicable to automated aperture positioning. - Highlights: • A generic method to determine the aberration center is established for (S)TEM. • Decentering induced secondary aberrations are utilized to find the center. • The method is tested on Ronchigrams both in simulation and experiment. • Proper weighting of the aberration gives a good convergence. • Larger primary aberration results in a slower convergence.

In situ transmission electron microscopy analyses of thermally annealed self catalyzed GaAs nanowires grown by molecular beam epitaxy

DEFF Research Database (Denmark)

Ambrosini, S.; Wagner, Jakob Birkedal; Booth, Tim

2011-01-01

Self catalyzed GaAs nanowires grown on Si-treated GaAs substrates were studied with a transmission electron microscope before and after annealing at 600◦C. At room temperature the nanowires have a zincblende structure and are locally characterized by a high density of rotational twins and stacking...... faults. Selected area diffraction patterns and high-resolution transmission electron microscopy images show that nanowires undergo structural modifications upon annealing, suggesting a decrease of defect density following the thermal treatment....

Transmission Electron Microscopy Study of Individual Carbon Nanotube Breakdown Caused by Joule Heating in Air

DEFF Research Database (Denmark)

Mølhave, Kristian; Gudnason, S.B.; Pedersen, Anders Tegtmeier

2006-01-01

We present repeated structural and electrical measurements on individual multiwalled carbon nanotubes, alternating between electrical measurements under ambient conditions and transmission electron microscopy (TEM). The multiwalled carbon nanotubes made by chemical vapor deposition were manipulated...

Batteryless wireless transmission system for electronic drum uses piezoelectric generator for play signal and power source

International Nuclear Information System (INIS)

Nishikawa, H; Yoshimi, A; Takemura, K; Tanaka, A; Douseki, T

2015-01-01

A batteryless self-powered wireless transmission system has been developed that sends a signal from a drum pad to a synthesizer. The power generated by a piezoelectric generator functions both as the “Play” signal for the synthesizer and as the power source for the transmitter. An FM transmitter, which theoretically operates with zero latency, and a receiver with quick-response squelch of the received signal were developed for wireless transmission with a minimum system delay. Experimental results for an electronic drum without any connecting wires fully demonstrated the feasibility of self-powered wireless transmission with a latency of 900 μs. (paper)

Atomic imaging using secondary electrons in a scanning transmission electron microscope: experimental observations and possible mechanisms.

Science.gov (United States)

Inada, H; Su, D; Egerton, R F; Konno, M; Wu, L; Ciston, J; Wall, J; Zhu, Y

2011-06-01

We report detailed investigation of high-resolution imaging using secondary electrons (SE) with a sub-nanometer probe in an aberration-corrected transmission electron microscope, Hitachi HD2700C. This instrument also allows us to acquire the corresponding annular dark-field (ADF) images both simultaneously and separately. We demonstrate that atomic SE imaging is achievable for a wide range of elements, from uranium to carbon. Using the ADF images as a reference, we studied the SE image intensity and contrast as functions of applied bias, atomic number, crystal tilt, and thickness to shed light on the origin of the unexpected ultrahigh resolution in SE imaging. We have also demonstrated that the SE signal is sensitive to the terminating species at a crystal surface. A possible mechanism for atomic-scale SE imaging is proposed. The ability to image both the surface and bulk of a sample at atomic-scale is unprecedented, and can have important applications in the field of electron microscopy and materials characterization. Copyright © 2010 Elsevier B.V. All rights reserved.

Vertical transmission of HIV from mother to child in sub-Saharan Africa: modes of transmission and methods for prevention.

Science.gov (United States)

Santmyire, B R

2001-05-01

The impact of the human immunodeficiency virus (HIV) epidemic in sub-Saharan Africa on future mortality rates of infants, children, and mothers, life expectancy, and economic growth is profound. Vertical transmission of HIV, transmission from mother to child, is a major factor in the increasing rates of HIV infection in sub-Saharan Africa. Vertical transmission of HIV occurs in utero, intrapartum during labor and delivery, and postpartum during breast-feeding. Because of the large numbers of HIV-infected mothers in developing countries, the majority trials regarding prevention of vertical transmission of HIV have been conducted in sub-Saharan Africa. Thus, sub-Saharan Africa has become a human laboratory, which demonstrates both the successes and failures of preventative methods to reduce vertical transmission of HIV. This review summarizes the body of research dedicated to understanding the pathophysiology of vertical transmission of HIV and pharmacology of inhibition of vertical transmission of HIV. While many debate the ethics of conducting trials in developing countries where effective prevention modalities have been slow to be implemented for economic, social and political reasons, studies continue and researchers continue to discover therapies and preventative methods, which may reduce the future devastation of HIV both in sub-Saharan Africa and throughout the world.

Optical and Optoelectronic Property Analysis of Nanomaterials inside Transmission Electron Microscope.

Science.gov (United States)

Fernando, Joseph F S; Zhang, Chao; Firestein, Konstantin L; Golberg, Dmitri

2017-12-01

In situ transmission electron microscopy (TEM) allows one to investigate nanostructures at high spatial resolution in response to external stimuli, such as heat, electrical current, mechanical force and light. This review exclusively focuses on the optical, optoelectronic and photocatalytic studies inside TEM. With the development of TEMs and specialized TEM holders that include in situ illumination and light collection optics, it is possible to perform optical spectroscopies and diverse optoelectronic experiments inside TEM with simultaneous high resolution imaging of nanostructures. Optical TEM holders combining the capability of a scanning tunneling microscopy probe have enabled nanomaterial bending/stretching and electrical measurements in tandem with illumination. Hence, deep insights into the optoelectronic property versus true structure and its dynamics could be established at the nanometer-range precision thus evaluating the suitability of a nanostructure for advanced light driven technologies. This report highlights systems for in situ illumination of TEM samples and recent research work based on the relevant methods, including nanomaterial cathodoluminescence, photoluminescence, photocatalysis, photodeposition, photoconductivity and piezophototronics. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Transmission electron microscope study of neutron irradiation-induced defects in silicon

International Nuclear Information System (INIS)

Oshima, Ryuichiro; Kawano, Tetsuya; Fujimoto, Ryoji

1994-01-01

Commercial Czochralski-grown silicon (Cz-Si) and float-zone silicon (Fz-Si) wafers were irradiated with fission neutrons at various fluences from 10 19 to 10 22 n/cm 2 at temperatures ranging from 473 K to 1043 K. The irradiation induced defect structures were examined by transmission electron microscopy and ultra high voltage electron microscopy, which were compared with Marlowe code computer simulation results. It was concluded that the vacancy-type damage structure formed at 473 K were initiated from collapse of vacancy-rich regions of cascades, while interstitial type defect clusters formed by irradiation above 673 K were associated with interstitial oxygen atoms and free interstitials which diffused out of the cascades. Complex defect structures were identified to consist of {113} and {111} planar faults by the parallel beam illumination diffraction analysis. (author)

Study of the nanostructure of Gum Metal using energy-filtered transmission electron microscopy

International Nuclear Information System (INIS)

Yano, T.; Murakami, Y.; Shindo, D.; Kuramoto, S.

2009-01-01

The nanostructure of Gum Metal, which has many anomalous mechanical properties, was investigated using transmission electron microscopy with energy filtering. A precise analysis of the weak diffuse electron scattering that was observed in the electron diffraction patterns of the Gum Metal specimen revealed that Gum Metal contains a substantial amount of the nanometer-sized ω phase. The morphology of the ω phase appeared to have a correlation with the faulting in the {2 1 1} planes, which are one of the characteristic lattice imperfections of the Gum Metal specimen. It is likely that the nanometer-sized ω phase may be a type of obstacle related to the restriction of the dislocation movement, which has been a significant problem in research on Gum Metal

Specific, sensitive, high-resolution detection of protein molecules in eukaryotic cells using metal-tagging transmission electron microscopy

Science.gov (United States)

Risco, Cristina; Sanmartín-Conesa, Eva; Tzeng, Wen-Pin; Frey, Teryl K.; Seybold, Volker; de Groot, Raoul J.

2012-01-01

Summary More than any other methodology, transmission electron microscopy (TEM) has contributed to our understanding of the architecture and organization of cells. With current detection limits approaching atomic resolution, it will ultimately become possible to ultrastructurally image intracellular macromolecular assemblies in situ. Presently, however, methods to unambiguously identify proteins within the crowded environment of the cell’s interior are lagging behind. We describe a novel approach, metal-tagging TEM (METTEM) that allows detection of intracellular proteins in mammalian cells with high specificity, exceptional sensitivity and at molecular scale resolution. In live cells treated with gold salts, proteins bearing a small metal-binding tag will form 1-nm gold nanoclusters, readily detectable in electron micrographs. The applicability and strength of METTEM is demonstrated by a study of Rubella virus replicase and capsid proteins, which revealed virus-induced cell structures not seen before. PMID:22579245

Electron cyclotron waves transmission: new approach for the characterization of electron distribution functions in Tokamak hot plasmas; La transmission d`ondes cyclotroniques electroniques: une approche nouvelle pour caracteriser les fonctions de distribution electronique des plasmas chauds de Tokamak

Energy Technology Data Exchange (ETDEWEB)

Michelot, Y

1995-10-01

Fast electrons are one of the basic ingredients of plasma operations in many existing thermonuclear fusion research devices. However, the understanding of fast electrons dynamics during creation and sustainment of the superthermal electrons tail is far for being satisfactory. For this reason, the Electron Cyclotron Transmission (ECT) diagnostic was implemented on Tore Supra tokamak. It consists on a microwave transmission system installed on a vertical chord crossing the plasma center and working in the frequency range 77-109 GHz. Variations of the wave amplitude during the propagation across the plasma may be due to refraction and resonant absorption. For the ECT, the most common manifestation of refraction is a reduction of the received power density with respect to the signal detected in vacuum, due to the spreading and deflection of the wave beam. Wave absorption is observed in the vicinity of the electron cyclotron harmonics and may be due both to thermal plasma and to superthermal electron tails. It has a characteristic frequency dependence due to the relativistic mass variation in the wave-electron resonance condition. This thesis presents the first measurements of: the extraordinary mode optical depth at the third harmonics, the electron temperature from the width of a cyclotron absorption line and the relaxation times of the electron distribution during lower hybrid current drive from the ordinary mode spectral superthermal absorption line at the first harmonic. (J.S.). 175 refs., 110 figs., 9 tabs., 3 annexes.

Simulation calculation for the energy deposition profile and the transmission fraction of intense pulsed electron beam at various incident angles

International Nuclear Information System (INIS)

Yang Hailiang; Qiu Aici; Zhang Jiasheng; Huang Jianjun; Sun Jianfeng

2002-01-01

The incident angles have a heavy effect on the intense pulsed electron beam energy deposition profile, energy deposition fraction and beam current transmission fraction in material. The author presents electron beam energy deposition profile and energy deposition fraction versus electron energy (0.5-2.0 MeV), at various incident angles for three aluminum targets of various thickness via theoretical calculation. The intense pulsed electron beam current transmission fractions versus electron energy (0.4-1.4 MeV) at various incident angles for three thickness of carbon targets were also theoretically calculated. The calculation results indicate that the deposition energy in unit mass of material surface layer increase with the rise of electron beam incident angle, and electron beam with low incident angle (closer to normal incident angle) penetrates deeper into the target material. The electron beams deposit more energy in unit mass of material surface layer at 60 degree-70 degree incident angle

Gas-phase synthesis of magnesium nanoparticles: A high-resolution transmission electron microscopy study

International Nuclear Information System (INIS)

Kooi, B. J.; Palasantzas, G.; De Hosson, J. Th. M.

2006-01-01

Magnesium nanoparticles with size above 10 nm, prepared by gas-phase syntheses, were investigated by high-resolution transmission electron microscopy. The dominant particle shape is a hexagonal prism terminated by Mg(0002) and Mg(1010) facets. Oxidation of Mg yields a MgO shell (∼3 nm thick), which has an orientation relation with the Mg. Inhomogeneous facet oxidation influences their growth kinetics resulting in a relatively broad size and shape distribution. Faceted voids between Mg and MgO shells indicate a fast outward diffusion of Mg and vacancy rearrangement into voids. The faceting of polar (220) planes is assisted by electron irradiation

Apparatus and methods for investigations into acoustic properties of electronic melts

International Nuclear Information System (INIS)

Glazov, V.M.; Timoshenko, V.I.; Kim, S.G.

1985-01-01

Apparatus and highly sensitive methods of systematic investigations into acoustic properties of electronic melts are described. A variant of a measuring cell to investigate agressive melts is presented. A new technique for the reception of an acoustic contact with high transmission capacity of ultrasonic wave based on utilization of clarified layers of liquid boron anhydride is described. Results of calibration tests on lead and aluminium melts point to a good agreement with literature data. High sensitivity of the above technique allows one to reveal thin structural effects in melts

Studies on the transmission and processing of pulse-shaped signals from nuclear radiation detectors using methods of systems theory

International Nuclear Information System (INIS)

Spillekothen, H.G.

2007-01-01

Using methods of the systems theory of electronic communications and theoretical electrical science, this study describes the transmission of pulse-shaped signals from nuclear radiation detectors from the detector over ''electrically long lines'' (cables) to the output of the first pulse amplifier. The example of pulses from BF 3 -proportional counters shows, using the Fourier transformation, that pulses from radiation detectors contain a frequency spectrum ranging well above 10 8 Hz. If these pulses are transmitted to the first amplifier over a line length of several meters, the laws of the theory of transmission lines must be taken into account to avoid false signals caused by reflections. In the example, line equations are applied and the influence of the line and the terminating impedance is demonstrated. The influence of the frequency response ν(ω) and the phase response δ(ω) of the amplifier is also considered in the sample calculation. The methods presented make it possible to analyze and optimize the transmission and amplification of signals from radiation detectors. Close agreement emerges between empirically observed and calculated pulse shapes. (orig.)

How to determine the morphology of plasmonic nanocrystals without transmission electron microscopy?

Energy Technology Data Exchange (ETDEWEB)

Battie, Yann, E-mail: yann.battie@univ-lorraine.fr [Université de Lorraine, LCP-A2MC, Institut Jean Barriol (France); Izquierdo-Lorenzo, Irene [Université de Technologie de Troyes, LNIO (CNRS UMR 6279) (France); Resano-Garcia, Amandine; Naciri, Aotmane En; Akil, Suzanna [Université de Lorraine, LCP-A2MC, Institut Jean Barriol (France); Adam, Pierre Michel; Jradi, Safi [Université de Technologie de Troyes, LNIO (CNRS UMR 6279) (France)

2016-08-15

This paper reports the complete ellipsometric characterization of gold nanoparticles (NPs) embedded in a photoresist films. The effective dielectric function of nanocomposite films as well as the shape distribution and the volume fraction of NPs are extracted from ellipsometric measurements by introducing an effective medium theory which takes into account the NP shape distribution and the intrinsic confinement effect. This theory remains valid as long as the nanoparticle interaction is negligible. We show that the magnitude of the confinement depends on the nanoparticle shape and the environment through chemical damping. This suggests that the NP shape distribution can be directly estimated by ellipsometry, while the determination of absolute radius distribution requires transmission electron microscopy measurements. The imaginary part of the effective dielectric function exhibits a strong asymmetric surface plasmon band, while a large variation of the real part occurs close to the resonance. The redshift and the broadening of the plasmon band as the gold volume fraction increases are correlated to the evolution of NP shape distribution. This evolution is attributed to a competition between the nucleation and the coalescence of NPs. This unambiguously demonstrates that ellipsometry combined with a shape-distributed effective medium theory is a powerful alternative tool to transmission electron microscopy for the NP shape analysis.

Transmission electron microscopy of InP-based compound semiconductor materials and devices

International Nuclear Information System (INIS)

Chu, S.N.G.

1990-01-01

InP/InGaAsP-based heteroepitaxial structures constitute the major optoelectronic devices for state-of-the-art long wavelength optical fiber communication system.s Future advanced device structures will require thin heteroepitaxial quantum wells and superlattices a few tens of angstrom or less in thickness, and lateral dimensions ranging from a few tens angstrom for quantum dots and wires to a few μm in width for buried heterostructure lasers. Due to the increasing complexity of the device structure required by band-gap engineering, the performance of these devices becomes susceptible to any lattice imperfections present in the structure. Transmission electron microscopy (TEM), therefore, becomes the most important technique in characterizing the structural integrity of these materials. Cross-section transmission electron microscopy (XTEM) not only provides the necessary geometric information on the device structure; a careful study of the materials science behind the observed lattice imperfections provides directions for optimization of both the epitaxial growth parameters and device processing conditions. Furthermore, for device reliability studies, TEM is the only technique that unambiguously identifies the cause of device degradation. In this paper, the authors discuss areas of application of various TEM techniques, describe the TEM sample preparation technique, and review case studies to demonstrate the power of the TEM technique

Millimeter wave and terahertz wave transmission characteristics in plasma

International Nuclear Information System (INIS)

Ma Ping; Qin Long; Chen Weijun; Zhao Qing; Shi Anhua; Huang Jie

2013-01-01

An experiment was conducted on the shock tube to explore the transmission characteristics of millimeter wave and terahertz wave in high density plasmas, in order to meet the communication requirement of hypersonic vehicles during blackout. The transmission attenuation curves of millimeter wave and terahertz wave in different electron density and collision frequency were obtained. The experiment was also simulated by auxiliary differential equation finite-difference time-domain (ADE-FDTD) methods. The experimental and numerical results show that the transmission attenuation of terahertz wave in the plasma is smaller than that of millimeter wave under the same conditions. The transmission attenuation of terahertz wave in the plasma is enhanced with the increase of electron density. The terahertz wave is a promising alternative to the electromagnetic wave propagation in high density plasmas. (authors)

Electron energy loss spectroscopy microanalysis and imaging in the transmission electron microscope: example of biological applications

International Nuclear Information System (INIS)

Diociaiuti, Marco

2005-01-01

This paper reports original results obtained in our laboratory over the past few years in the application of both electron energy loss spectroscopy (EELS) and electron spectroscopy imaging (ESI) to biological samples, performed in two transmission electron microscopes (TEM) equipped with high-resolution electron filters and spectrometers: a Gatan model 607 single magnetic sector double focusing EEL serial spectrometer attached to a Philips 430 TEM and a Zeiss EM902 Energy Filtering TEM. The primary interest was on the possibility offered by the combined application of these spectroscopic techniques with those offered by the TEM. In particular, the electron beam focusing available in a TEM allowed us to perform EELS and ESI on very small sample volumes, where high-resolution imaging and electron diffraction techniques can provide important structural information. I show that ESI was able to improve TEM performance, due to the reduced chromatic aberration and the possibility of avoiding the sample staining procedure. Finally, the analysis of the oscillating extended energy loss fine structure (EXELFS) beyond the ionization edges characterizing the EELS spectra allowed me, in a manner very similar to the extended X-ray absorption fine structure (EXAFS) analysis of the X-ray absorption spectra, to obtain short-range structural information for such light elements of biological interest as O or Fe. The Philips EM430 (250-300 keV) TEM was used to perform EELS microanalysis on Ca, P, O, Fe, Al and Si. The assessment of the detection limits of this method was obtained working with well-characterized samples containing Ca and P, and mimicking the actual cellular matrix. I applied EELS microanalysis to Ca detection in bone tissue during the mineralization process and to P detection in the cellular membrane of erythrocytes treated with an anti-tumoral drug, demonstrating that the cellular membrane is a drug target. I applied EELS microanalysis and selected area electron

Attainment of 40.5 pm spatial resolution using 300 kV scanning transmission electron microscope equipped with fifth-order aberration corrector.

Science.gov (United States)

Morishita, Shigeyuki; Ishikawa, Ryo; Kohno, Yuji; Sawada, Hidetaka; Shibata, Naoya; Ikuhara, Yuichi

2018-02-01

The achievement of a fine electron probe for high-resolution imaging in scanning transmission electron microscopy requires technological developments, especially in electron optics. For this purpose, we developed a microscope with a fifth-order aberration corrector that operates at 300 kV. The contrast flat region in an experimental Ronchigram, which indicates the aberration-free angle, was expanded to 70 mrad. By using a probe with convergence angle of 40 mrad in the scanning transmission electron microscope at 300 kV, we attained the spatial resolution of 40.5 pm, which is the projected interatomic distance between Ga-Ga atomic columns of GaN observed along [212] direction.

A Transmission Electron Microscope Investigation of Space Weathering Effects in Hayabusa Samples

Science.gov (United States)

Keller, Lindsay P.; Berger, Eve L.

2014-01-01

The Hayabusa mission to asteroid 25143 Itokawa successfully returned the first direct samples of the regolith from the surface of an asteroid. The Hayabusa samples thus present a special opportunity to directly investigate the evolution of asteroidal surfaces, from the development of the regolith to the study of the more complex effects of space weathering. Here we describe the mineralogy, microstructure and composition of three Hayabusa mission particles using transmission electron microscope (TEM) techniques

Quantitative annular dark field scanning transmission electron microscopy for nanoparticle atom-counting: What are the limits?

International Nuclear Information System (INIS)

De Backer, A; De Wael, A; Gonnissen, J; Martinez, G T; Béché, A; Van Aert, S; MacArthur, K E; Jones, L; Nellist, P D

2015-01-01

Quantitative atomic resolution annular dark field scanning transmission electron microscopy (ADF STEM) has become a powerful technique for nanoparticle atom-counting. However, a lot of nanoparticles provide a severe characterisation challenge because of their limited size and beam sensitivity. Therefore, quantitative ADF STEM may greatly benefit from statistical detection theory in order to optimise the instrumental microscope settings such that the incoming electron dose can be kept as low as possible whilst still retaining single-atom precision. The principles of detection theory are used to quantify the probability of error for atom-counting. This enables us to decide between different image performance measures and to optimise the experimental detector settings for atom-counting in ADF STEM in an objective manner. To demonstrate this, ADF STEM imaging of an industrial catalyst has been conducted using the near-optimal detector settings. For this experiment, we discussed the limits for atomcounting diagnosed by combining a thorough statistical method and detailed image simulations. (paper)

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Visualization of bacterial polysaccharides by scanning transmission electron microscopy.

Science.gov (United States)

Wolanski, B S; McAleer, W J; Hilleman, M R

1983-04-01

Highly purified capsular polysaccharides of Neisseria meningitidis groups A, B, and C have been visualized by high resolution Scanning Transmission Electron Microscopy (STEM). Spheroidal macromolecules approximately 200 A in diameter are characteristic of the Meningococcus A and C polysaccharides whereas filaments that are 400-600 A in length are found in Meningococcus B polysaccharide preparations. Filaments are occasionally found associated with the spheroidal Meningococcus A and C polysaccharides and it is proposed that these structures are composed of a long (1-4 microns) filament or filaments that are arranged in spheroidal molecules or micelles of high molecular weight. The Meningococcus B polysaccharide, by contrast, is a short flexuous filament or strand of relatively low molecular weight. A relationship between morphology and antigenicity is proposed.

Transmission electron microscopy of carbon-coated and iron-doped titania nanoparticles

KAUST Repository

Anjum, Dalaver H.

2016-08-02

We present a study on the properties of iron (Fe)-doped and carbon (C)-coated titania (TiO2) nanoparticles (NPs) which has been compiled by using x-ray diffraction (XRD), transmission electron microscopy (TEM), and x-ray photoelectron spectroscopy (XPS). These TiO2 NPs were prepared by using the flame synthesis method. This method allows the simultaneous C coating and Fe doping of TiO2 NPs. XRD investigations revealed that the phase of the prepared NPs was anatase TiO2. Conventional TEM analysis showed that the average size of the TiO2 NPs was about 65 nm and that the NPs were uniformly coated with the element C. Furthermore, from the x-ray energy dispersive spectrometry analysis, it was found that about 8 at.% Fe was present in the synthesized samples. High-resolution TEM (HRTEM) revealed the graphitized carbon structure of the layer surrounding the prepared TiO2 NPs. HRTEM analysis further revealed that the NPs possessed the crystalline structure of anatase titania. Energy-filtered TEM (EFTEM) analysis showed the C coating and Fe doping of the NPs. The ratio of L3 and L2 peaks for the Ti-L23 and Fe-L23 edges present in the core loss electron energy loss spectroscopy (EELS) revealed a +4 oxidation state for the Ti and a +3 oxidation state for the Fe. These EELS results were further confirmed with XPS analysis. The electronic properties of the samples were investigated by applying Kramers-Kronig analysis to the low-loss EELS spectra acquired from the prepared NPs. The presented results showed that the band gap energy of the TiO2 NPs decreased from an original value of 3.2 eV to about 2.2 eV, which is quite close to the ideal band gap energy of 1.65 eV for photocatalysis semiconductors. The observed decrease in band gap energy of the TiO2 NPs was attributed to the presence of Fe atoms at the lattice sites of the anatase TiO2 lattice. In short, C-coated and Fe-doped TiO2 NPs were synthesized with a rather cost-effective and comparatively easily scalable method. The

Ab initio transmission electron microscopy image simulations of coherent Ag-MgO interfaces

International Nuclear Information System (INIS)

Mogck, S.; Kooi, B.J.; Hosson, J.Th.M. de; Finnis, M.W.

2004-01-01

Density-functional theory calculations, within the plane-wave-ultrasoft pseudopotential framework, were performed in the projection for MgO and for the coherent (111) Ag-MgO polar interface. First-principles calculations were incorporated in high-resolution transmission electron microscopy (HRTEM) simulations by converting the charge density into electron scattering factors to examine the influence of charge transfer, charge redistribution at the interface, and ionicity on the dynamical electron scattering and on calculated HRTEM images. It is concluded that the ionicity of oxides and the charge redistribution at interfaces play a significant role in HRTEM image simulations. In particular, the calculations show that at oxygen-terminated (111) Ag-MgO interfaces the first oxygen layer at the interface is much brighter than that in calculations with neutral atoms, in agreement with experimental observations

Experimental transmission electron microscopy studies and phenomenological model of bismuth-based superconducting compounds

International Nuclear Information System (INIS)

Elboussiri, Khalid

1991-01-01

The main part of this thesis is devoted to an experimental study by transmission electron microscopy of the different phases of the superconducting bismuth cuprates Bi_2Sr_2Ca_n_-_1Cu_nO_2_n_+_4. In high resolution electron microscopy, the two types of incommensurate modulation realized in these compounds have been observed. A model of structure has been proposed from which the simulated images obtained are consistent with observations. The medium resolution images correlated with the electron diffraction data have revealed existence of a multi-soliton regime with latent lock in phases of commensurate periods between 4b and 10b. At last, a description of different phases of these compounds as a result of superstructures from a disordered perovskite type structure is proposed (author) [fr

A video-amplifier device for the transmission-type electron microscope ELMISCOP I of Siemens

International Nuclear Information System (INIS)

Groboth, G.; Hoerl, E.M.

1975-01-01

In order to get a visual image of the sample at the final screen of a transmission-type electron microscope and to keep at the same time the sample at low temperature a video-amplifier device has been developed by the authors. Details about its design and the necessary reconstruction of the electron microscope equipment are given. The beam current density at the transparent screen is reduced to 10 -12 -10 -13 A.cm -2 . Moreover the costs of this video-amplifier device are lower than those available. (CR)

Transmission positron microscopes

International Nuclear Information System (INIS)

Doyama, Masao; Kogure, Yoshiaki; Inoue, Miyoshi; Kurihara, Toshikazu; Yoshiie, Toshimasa; Oshima, Ryuichiro; Matsuya, Miyuki

2006-01-01

Immediate and near-future plans for transmission positron microscopes being built at KEK, Tsukuba, Japan, are described. The characteristic feature of this project is remolding a commercial electron microscope to a positron microscope. A point source of electrons kept at a negative high voltage is changed to a point source of positrons kept at a high positive voltage. Positional resolution of transmission microscopes should be theoretically the same as electron microscopes. Positron microscopes utilizing trapping of positrons have always positional ambiguity due to the diffusion of positrons

A Monte Carlo investigation of contaminant electrons due to a novel in vivo transmission detector

International Nuclear Information System (INIS)

Asuni, G; Jensen, J M; McCurdy, B M C

2011-01-01

A novel transmission detector (IBA Dosimetry, Germany) developed as an IMRT quality assurance tool, intended for in vivo patient dose measurements, is studied here. The goal of this investigation is to use Monte Carlo techniques to characterize treatment beam parameters in the presence of the detector and to compare to those of a plastic block tray (a frequently used clinical device). Particular attention is paid to the impact of the detector on electron contamination model parameters of two commercial dose calculation algorithms. The linac head together with the COMPASS transmission detector (TRD) was modeled using BEAMnrc code. To understand the effect of the TRD on treatment beams, the contaminant electron fluence, energy spectra, and angular distributions at different SSDs were analyzed for open and non-open (i.e. TRD and block tray) fields. Contaminant electrons in the BEAMnrc simulations were separated according to where they were created. Calculation of surface dose and the evaluation of contributions from contaminant electrons were performed using the DOSXYZnrc user code. The effect of the TRD on contaminant electrons model parameters in Eclipse AAA and Pinnacle 3 dose calculation algorithms was investigated. Comparisons of the fluence of contaminant electrons produced in the non-open fields versus open field show that electrons created in the non-open fields increase at shorter SSD, but most of the electrons at shorter SSD are of low energy with large angular spread. These electrons are out-scattered or absorbed in air and contribute less to surface dose at larger SSD. Calculated surface doses with the block tray are higher than those with the TRD. Contribution of contaminant electrons to dose in the buildup region increases with increasing field size. The additional contribution of electrons to surface dose increases with field size for TRD and block tray. The introduction of the TRD results in a 12% and 15% increase in the Gaussian widths used in the

Assessing and ameliorating the influence of the electron beam on carbon nanotube oxidation in environmental transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Koh, Ai Leen, E-mail: alkoh@stanford.edu [Stanford Nano Shared Facilities, Stanford University, Stanford, CA 94305 (United States); Sinclair, Robert [Department of Materials Science and Engineering, Stanford University, Stanford, CA 94305 (United States)

2017-05-15

In this work, we examine how the imaging electron beam can induce damage in carbon nanotubes (CNTs) at varying oxygen gas pressures and electron dose rates using environmental transmission electron microscopy (ETEM). Our studies show that there is a threshold cumulative electron dose which brings about damage in CNTs in oxygen – through removal of their graphitic walls – which is dependent on O{sub 2} pressure, with a 4–5 fold decrease in total electron dose per decade increase at a lower pressure range (10{sup −6} to 10{sup −5} mbar) and approximately 1.3 –fold decrease per decade increase at a higher pressure range (10{sup −3} to 10{sup 0} mbar). However, at a given pressure, damage in CNTs was found to occur even at the lowest dose rate utilized, suggesting the absence of a lower limit for the latter parameter. This study provides guidelines on the cumulative dose required to damage nanotubes in the 10{sup −7} mbar to 10{sup 0} mbar pressure regimes, and discusses the role of electron dose rate and total electron dose on beam-induced CNT degradation experiments. - Highlights: • The electron beam ionizes gas molecules in ETEM and affects experimental outcomes. • Beam-induced damage in CNTs occurs at varying O{sub 2} pressures and electron dose rates. • There is a threshold cumulative dose to damage CNTs which depends on O{sub 2} pressure. • At a given pressure, CNT damage occurs even at the electron dose rate utilized.

Assessing and ameliorating the influence of the electron beam on carbon nanotube oxidation in environmental transmission electron microscopy

International Nuclear Information System (INIS)

Koh, Ai Leen; Sinclair, Robert

2017-01-01

In this work, we examine how the imaging electron beam can induce damage in carbon nanotubes (CNTs) at varying oxygen gas pressures and electron dose rates using environmental transmission electron microscopy (ETEM). Our studies show that there is a threshold cumulative electron dose which brings about damage in CNTs in oxygen – through removal of their graphitic walls – which is dependent on O_2 pressure, with a 4–5 fold decrease in total electron dose per decade increase at a lower pressure range (10"−"6 to 10"−"5 mbar) and approximately 1.3 –fold decrease per decade increase at a higher pressure range (10"−"3 to 10"0 mbar). However, at a given pressure, damage in CNTs was found to occur even at the lowest dose rate utilized, suggesting the absence of a lower limit for the latter parameter. This study provides guidelines on the cumulative dose required to damage nanotubes in the 10"−"7 mbar to 10"0 mbar pressure regimes, and discusses the role of electron dose rate and total electron dose on beam-induced CNT degradation experiments. - Highlights: • The electron beam ionizes gas molecules in ETEM and affects experimental outcomes. • Beam-induced damage in CNTs occurs at varying O_2 pressures and electron dose rates. • There is a threshold cumulative dose to damage CNTs which depends on O_2 pressure. • At a given pressure, CNT damage occurs even at the electron dose rate utilized.

High-resolution imaging in the scanning transmission electron microscope

International Nuclear Information System (INIS)

Pennycook, S.J.; Jesson, D.E.

1992-03-01

The high-resolution imaging of crystalline materials in the scanning transmission electron microscopy (STEM) is reviewed with particular emphasis on the conditions under which an incoherent image can be obtained. It is shown that a high-angle annular detector can be used to break the coherence of the imaging process, in the transverse plane through the geometry of the detector, or in three dimensions if multiphonon diffuse scattering is detected. In the latter case, each atom can be treated as a highly independent source of high-angle scattering. The most effective fast electron states are therefore tightly bound s-type Bloch states. Furthermore, they add constructively for each incident angle in the coherent STEM probe, so that s states are responsible for practically the entire image contrast. Dynamical effects are largely removed, and almost perfect incoherent imaging is achieved. s states are relatively insensitive to neighboring strings, so that incoherent imaging is maintained for superlattice and interfaces, and supercell calculations are unnecessary. With an optimum probe profile, the incoherent image represents a direct image of the crystal projection, with compositional sensitivity built in through the strong dependence of the scattering cross sections on atomic number Z

Transmission electron microscopy analysis of hydroxyapatite nanocrystals from cattle bones

International Nuclear Information System (INIS)

Patel, Sangeeta; Wei, Shanghai; Han, Jie; Gao, Wei

2015-01-01

In this present study, hydroxyapatite which was obtained from cattle bones has been heat treated at temperature 400 °C and 600 °C. The microstructure after the treatment has been studied in detail using Transmission electron microscopy (TEM) and X-ray diffraction techniques. The TEM results indicate that natural bone consists of collagen and hydroxyapatite nano-crystals which are needle shaped. The heat treatment influences the crystallinity and growth of these hydroxyapatite nano-crystals known as ‘crystal maturation’ or ‘crystal ageing’. - Highlights: • Hydroxyapatite is obtained from cattle bones. • Material has been characterised using XRD and TEM. • Crystal growth and orientation has been studied in detail.

Transmission electron microscopy analysis of hydroxyapatite nanocrystals from cattle bones

Energy Technology Data Exchange (ETDEWEB)

Patel, Sangeeta, E-mail: spt658@aucklanduni.ac.nz [Department of Chemical and Materials Engineering, The University of Auckland, 20 Symonds Street, Auckland 1010 (New Zealand); Wei, Shanghai [Department of Chemical and Materials Engineering, The University of Auckland, 20 Symonds Street, Auckland 1010 (New Zealand); Han, Jie [Department of Civil and Environmental Engineering, University of Illinois at Urbana-Champaign, 205 North Mathews Avenue, Urbana, IL (United States); Gao, Wei [Department of Chemical and Materials Engineering, The University of Auckland, 20 Symonds Street, Auckland 1010 (New Zealand)

2015-11-15

In this present study, hydroxyapatite which was obtained from cattle bones has been heat treated at temperature 400 °C and 600 °C. The microstructure after the treatment has been studied in detail using Transmission electron microscopy (TEM) and X-ray diffraction techniques. The TEM results indicate that natural bone consists of collagen and hydroxyapatite nano-crystals which are needle shaped. The heat treatment influences the crystallinity and growth of these hydroxyapatite nano-crystals known as ‘crystal maturation’ or ‘crystal ageing’. - Highlights: • Hydroxyapatite is obtained from cattle bones. • Material has been characterised using XRD and TEM. • Crystal growth and orientation has been studied in detail.

Transmission electron microscopy of GaN based, doped semiconductor heterostructures

Energy Technology Data Exchange (ETDEWEB)

Pretorius, A.

2006-07-01

This thesis addresses the analysis of GaN based heterostructures with transmission electron microscopy (TEM). Basic properties of the material of interest are introduced in chapter 2. These include the structural and optical properties as well as an introduction to the growth methods used for the samples analysed in this work. In chapter 3 a brief theoretical treatment of TEM is given. As one main topic of this work is the determination of the In concentration in InGaN islands using strain state analysis, a detailed description of the method is given. Chapter 4 describes the results obtained for pyramidal defects present in metalorganic vapour phase epitaxy grown GaN:Mg with high dopant concentration. Based on the experimental results and the well established knowledge that GaN of inverted polarity is present inside the pyramidal defects, a variety of basal plane inversion domain boundary models was set up. From these models, HRTEM images were simulated using the multislice approach, followed by a quantitative comparison to experimentally obtained HRTEM images. Another focus of this work is the analysis of In{sub x}Ga{sub 1-x}N islands grown on GaN presented in chapter 5. Following a literature survey which describes different methods used to obtain In{sub x}Ga{sub 1-x}N islands, the first topic is the distinction of In{sub x}Ga{sub 1-x}N islands and metal droplets, which can form during growth. This is followed by the experimental results of molecular beam epitaxy and metalorganic vapour phase epitaxy grown In{sub x}Ga{sub 1-x}N island and quantum dot samples. (orig.)

On the optical stability of high-resolution transmission electron microscopes

International Nuclear Information System (INIS)

Barthel, J.; Thust, A.

2013-01-01

In the recent two decades the technique of high-resolution transmission electron microscopy experienced an unprecedented progress through the introduction of hardware aberration correctors and by the improvement of the achievable resolution to the sub-Ångström level. The important aspect that aberration correction at a given resolution requires also a well defined amount of optical stability has received little attention so far. Therefore we investigate the qualification of a variety of high-resolution electron microscopes to maintain an aberration corrected optical state in terms of an optical lifetime. We develop a comprehensive statistical framework for the estimation of the optical lifetime and find remarkably low values between tens of seconds and a couple of minutes. Probability curves are introduced, which inform the operator about the chance to work still in the fully aberration corrected state. - Highlights: • We investigate the temporal stability of optical aberrations in HRTEM. • We develop a statistical framework for the estimation of optical lifetimes. • We introduce plots showing the success probability for aberration-free work. • Optical lifetimes in sub-Ångström electron microscopy are surprisingly low. • The success of aberration correction depends strongly on the optical stability

An improved image alignment procedure for high-resolution transmission electron microscopy.

Science.gov (United States)

Lin, Fang; Liu, Yan; Zhong, Xiaoyan; Chen, Jianghua

2010-06-01

Image alignment is essential for image processing methods such as through-focus exit-wavefunction reconstruction and image averaging in high-resolution transmission electron microscopy. Relative image displacements exist in any experimentally recorded image series due to the specimen drifts and image shifts, hence image alignment for correcting the image displacements has to be done prior to any further image processing. The image displacement between two successive images is determined by the correlation function of the two relatively shifted images. Here it is shown that more accurate image alignment can be achieved by using an appropriate aperture to filter the high-frequency components of the images being aligned, especially for a crystalline specimen with little non-periodic information. For the image series of crystalline specimens with little amorphous, the radius of the filter aperture should be as small as possible, so long as it covers the innermost lattice reflections. Testing with an experimental through-focus series of Si[110] images, the accuracies of image alignment with different correlation functions are compared with respect to the error functions in through-focus exit-wavefunction reconstruction based on the maximum-likelihood method. Testing with image averaging over noisy experimental images from graphene and carbon-nanotube samples, clear and sharp crystal lattice fringes are recovered after applying optimal image alignment. Copyright 2010 Elsevier Ltd. All rights reserved.

Two-dimensional electron flow in pulsed power transmission lines and plasma opening switches

International Nuclear Information System (INIS)

Church, B.W.; Longcope, D.W.; Ng, C.K.; Sudan, R.N.

1991-01-01

The operation of magnetically insulated transmission lines (MITL) and the interruption of current in a plasma opening switch (POS) are determined by the physics of the electrons emitted by the cathode surface. A mathematical model describes the self-consistent two-dimensional flow of an electron fluid. A finite element code, FERUS, has been developed to solve the two equations which describe Poisson's and Ampere's law in two dimensions. The solutions from this code are obtained for parameters where the electron orbits are considerably modified by the self-magnetic field of the current. Next, the self-insulated electron flow in a MITL with a step change in cross-section is studied using a conventional two-dimensional fully electromagnetic particle-in-cell code, MASK. The equations governing two-dimensional quasi-static electron flow are solved numerically by a third technique which is suitable for predicting current interruption in a POS. The object of the study is to determine the critical load impedance, Z CL , required for current interruption for a given applied voltage, cathode voltage and plasma length. (author). 9 refs, 5 figs

Diffraction contrast as a sensitive indicator of femtosecond sub-nanoscale motion in ultrafast transmission electron microscopy

Science.gov (United States)

Cremons, Daniel R.; Schliep, Karl B.; Flannigan, David J.

2013-09-01

With ultrafast transmission electron microscopy (UTEM), access can be gained to the spatiotemporal scales required to directly visualize rapid, non-equilibrium structural dynamics of materials. This is achieved by operating a transmission electron microscope (TEM) in a stroboscopic pump-probe fashion by photoelectrically generating coherent, well-timed electron packets in the gun region of the TEM. These probe photoelectrons are accelerated down the TEM column where they travel through the specimen before reaching a standard, commercially-available CCD detector. A second laser pulse is used to excite (pump) the specimen in situ. Structural changes are visualized by varying the arrival time of the pump laser pulse relative to the probe electron packet at the specimen. Here, we discuss how ultrafast nanoscale motions of crystalline materials can be visualized and precisely quantified using diffraction contrast in UTEM. Because diffraction contrast sensitively depends upon both crystal lattice orientation as well as incoming electron wavevector, minor spatial/directional variations in either will produce dynamic and often complex patterns in real-space images. This is because sections of the crystalline material that satisfy the Laue conditions may be heterogeneously distributed such that electron scattering vectors vary over nanoscale regions. Thus, minor changes in either crystal grain orientation, as occurs during specimen tilting, warping, or anisotropic expansion, or in the electron wavevector result in dramatic changes in the observed diffraction contrast. In this way, dynamic contrast patterns observed in UTEM images can be used as sensitive indicators of ultrafast specimen motion. Further, these motions can be spatiotemporally mapped such that direction and amplitude can be determined.

Effects of Electron Flow Current Density on Flow Impedance of Magnetically Insulated Transmission Lines

International Nuclear Information System (INIS)

He Yong; Zou Wen-Kang; Song Sheng-Yi

2011-01-01

In modern pulsed power systems, magnetically insulated transmission lines (MITLs) are used to couple power between the driver and the load. The circuit parameters of MITLs are well understood by employing the concept of flow impedance derived from Maxwell's equations and pressure balance across the flow. However, the electron density in an MITL is always taken as constant in the application of flow impedance. Thus effects of electron flow current density (product of electron density and drift velocity) in an MITL are neglected. We calculate the flow impedances of an MITL and compare them under three classical MITL theories, in which the electron density profile and electron flow current density are different from each other. It is found that the assumption of constant electron density profile in the calculation of the flow impedance is not always valid. The electron density profile and the electron flow current density have significant effects on flow impedance of the MITL. The details of the electron flow current density and its effects on the operation impedance of the MITL should be addressed more explicitly by experiments and theories in the future. (nuclear physics)

System and method for compressive scanning electron microscopy

Science.gov (United States)

Reed, Bryan W

2015-01-13

A scanning transmission electron microscopy (STEM) system is disclosed. The system may make use of an electron beam scanning system configured to generate a plurality of electron beam scans over substantially an entire sample, with each scan varying in electron-illumination intensity over a course of the scan. A signal acquisition system may be used for obtaining at least one of an image, a diffraction pattern, or a spectrum from the scans, the image, diffraction pattern, or spectrum representing only information from at least one of a select subplurality or linear combination of all pixel locations comprising the image. A dataset may be produced from the information. A subsystem may be used for mathematically analyzing the dataset to predict actual information that would have been produced by each pixel location of the image.

In situ investigation of bismuth nanoparticles formation by transmission electron microscope.

Science.gov (United States)

Liu, Liming; Wang, Honghang; Yi, Zichuan; Deng, Quanrong; Lin, Zhidong; Zhang, Xiaowen

2018-02-01

Bismuth (Bi) nanoparticles are prepared by using NaBi(MoO 4 ) 2 nanosheets in the beam of electrons emitted by transmission electron microscope. The formation and growth of Bi nanoparticles are investigated in situ. The sizes of Bi nanoparticles are confined within the range of 6-10nm by controlling irradiation time. It is also observed that once the diameter of nanoparticles is larger than 10nm, the Bi particles are stable as a result of the immobility of large nanoparticles. In addition, some nanoparticles on the edges form nanorods, which are explained as the result of a coalescence process, if the irradiation period is longer than 10min. The in situ research on Bi nanoparticles facilitates in-depth investigations of the physicochemical behavior and provides more potential applications in various fields such as sensors, catalysts and optical devices. Copyright © 2017 Elsevier Ltd. All rights reserved.

Method for analysis of averages over transmission energy of resonance neutrons

International Nuclear Information System (INIS)

Komarov, A.V.; Luk'yanov, A.A.

1981-01-01

Experimental data on transmissions on iron specimens in different energy groups have been analyzed on the basis of an earlier developed theoretical model for the description of resonance neutron averages in transmission energy, as the functions of specimen thickness and mean resonance parameters. The parameter values obtained agree with the corresponding data evaluated in the theory of mean neutron cross sections. The method suggested for the transmission description permits to reproduce experimental results for any thicknesses of specimens [ru

Development of a non-destructive micro-analytical method for stable carbon isotope analysis of transmission electron microscope (TEM) samples

Energy Technology Data Exchange (ETDEWEB)

Hode, Tomas [Department of Geology, Portland State University, Portland, P.O. Box 751, OR 97201 (United States)], E-mail: hode@pdx.edu; Kristiansson, Per; Elfman, Mikael [Division of Nuclear Physics, Department of Physics, Lund Institute of Technology, Lund University, P.O. Box 118, SE-221 00 Lund (Sweden); Hugo, Richard C.; Cady, Sherry L. [Department of Geology, Portland State University, Portland, P.O. Box 751, OR 97201 (United States)

2009-10-01

The biogenicity of ancient morphological microfossil-like objects can be established by linking morphological (e.g. cell remnants and extracellular polymeric matrix) and chemical (e.g. isotopes, biomarkers and biominerals) evidence indicative of microorganisms or microbial activity. We have developed a non-destructive micro-analytical ion beam system capable of measuring with high spatial resolution the stable carbon isotope ratios of thin samples used for transmission electron microscopy. The technique is based on elastic scattering of alpha particles with an energy of 2.751 MeV. At this energy the {sup 13}C cross section is enhanced relative to the pure Rutherford cross section for {sup 13}C, whereas the {sup 12}C cross section is reduced relative to its pure Rutherford cross section. Here we report the initial results of this experimental approach used to characterize ultramicrotomed sections of sulfur-embedded graphite and microbial cells.

On the threshold conditions for electron beam damage of asbestos amosite fibers in the transmission electron microscope (TEM).

Science.gov (United States)

Martin, Joannie; Beauparlant, Martin; Sauvé, Sébastien; L'Espérance, Gilles

2016-12-01

Asbestos amosite fibers were investigated to evaluate the damage caused by a transmission electron microscope (TEM) electron beam. Since elemental x-ray intensity ratios obtained by energy dispersive x-ray spectroscopy (EDS) are commonly used for asbestos identification, the impact of beam damage on these ratios was evaluated. It was determined that the magnesium/silicon ratio best represented the damage caused to the fiber. Various tests showed that most fibers have a current density threshold above which the chemical composition of the fiber is modified. The value of this threshold current density varied depending on the fiber, regardless of fiber diameter, and in some cases could not be determined. The existence of a threshold electron dose was also demonstrated. This value was dependent on the current density used and can be increased by providing a recovery period between exposures to the electron beam. This study also established that the electron beam current is directly related to the damage rate above a current density of 165 A/cm 2 . The large number of different results obtained suggest, that in order to ensure that the amosite fibers are not damaged, analysis should be conducted below a current density of 100 A/cm 2 .

Transmission electron microscopy characterization of photocatalysts for water splitting

DEFF Research Database (Denmark)

Cavalca, Filippo; Laursen, Anders Bo; Dahl, Søren

, it is necessary to understand the fundamentals of their reaction mechanisms, chemical behavior, structure and morphology before, during and after reaction using in situ investigations. Here, we focus on the in situ characterization of photocatalysts [1] in an environmental transmission electron microscope (ETEM......) [2]. Such fundamental insight can be used for further material optimization with respect to performance and stability [3]. In this work, we combine conventional TEM analysis of photocatalysts with environmental TEM (ETEM) and photoactivation using light. A novel type of TEM specimen holder...... that enables in situ illumination is developed to study light-induced phenomena in photoactive materials at the nanoscale under working conditions. Our experiments are aimed at exposing a specimen to light and detecting resulting microstructural and chemical changes using in situ TEM techniques...

Practical considerations for high spatial and temporal resolution dynamic transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Armstrong, Michael R. [Materials Science and Technology Division, Chemistry and Materials Science Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States)], E-mail: armstrong30@llnl.gov; Boyden, Ken [Materials Science and Technology Division, Chemistry and Materials Science Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States); Browning, Nigel D. [Materials Science and Technology Division, Chemistry and Materials Science Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States); Department of Chemical Engineering and Materials Science, University of California-Davis, One Shields Avenue, Davis, CA 95616 (United States); Campbell, Geoffrey H.; Colvin, Jeffrey D.; De Hope, William J.; Frank, Alan M. [Materials Science and Technology Division, Chemistry and Materials Science Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States); Gibson, David J.; Hartemann, Fred [N Division, Physics and Advanced Technologies Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-280, Livermore, CA 94550 (United States); Kim, Judy S. [Materials Science and Technology Division, Chemistry and Materials Science Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States); Department of Chemical Engineering and Materials Science, University of California-Davis, One Shields Avenue, Davis, CA 95616 (United States); King, Wayne E.; La Grange, Thomas B.; Pyke, Ben J.; Reed, Bryan W.; Shuttlesworth, Richard M.; Stuart, Brent C.; Torralva, Ben R. [Materials Science and Technology Division, Chemistry and Materials Science Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States)

2007-04-15

Although recent years have seen significant advances in the spatial resolution possible in the transmission electron microscope (TEM), the temporal resolution of most microscopes is limited to video rate at best. This lack of temporal resolution means that our understanding of dynamic processes in materials is extremely limited. High temporal resolution in the TEM can be achieved, however, by replacing the normal thermionic or field emission source with a photoemission source. In this case the temporal resolution is limited only by the ability to create a short pulse of photoexcited electrons in the source, and this can be as short as a few femtoseconds. The operation of the photo-emission source and the control of the subsequent pulse of electrons (containing as many as 5x10{sup 7} electrons) create significant challenges for a standard microscope column that is designed to operate with a single electron in the column at any one time. In this paper, the generation and control of electron pulses in the TEM to obtain a temporal resolution <10{sup -6} s will be described and the effect of the pulse duration and current density on the spatial resolution of the instrument will be examined. The potential of these levels of temporal and spatial resolution for the study of dynamic materials processes will also be discussed.

Practical considerations for high spatial and temporal resolution dynamic transmission electron microscopy

International Nuclear Information System (INIS)

Armstrong, Michael R.; Boyden, Ken; Browning, Nigel D.; Campbell, Geoffrey H.; Colvin, Jeffrey D.; De Hope, William J.; Frank, Alan M.; Gibson, David J.; Hartemann, Fred; Kim, Judy S.; King, Wayne E.; La Grange, Thomas B.; Pyke, Ben J.; Reed, Bryan W.; Shuttlesworth, Richard M.; Stuart, Brent C.; Torralva, Ben R.

2007-01-01

Although recent years have seen significant advances in the spatial resolution possible in the transmission electron microscope (TEM), the temporal resolution of most microscopes is limited to video rate at best. This lack of temporal resolution means that our understanding of dynamic processes in materials is extremely limited. High temporal resolution in the TEM can be achieved, however, by replacing the normal thermionic or field emission source with a photoemission source. In this case the temporal resolution is limited only by the ability to create a short pulse of photoexcited electrons in the source, and this can be as short as a few femtoseconds. The operation of the photo-emission source and the control of the subsequent pulse of electrons (containing as many as 5x10 7 electrons) create significant challenges for a standard microscope column that is designed to operate with a single electron in the column at any one time. In this paper, the generation and control of electron pulses in the TEM to obtain a temporal resolution -6 s will be described and the effect of the pulse duration and current density on the spatial resolution of the instrument will be examined. The potential of these levels of temporal and spatial resolution for the study of dynamic materials processes will also be discussed

Light-Induced Reduction of Cuprous Oxide in an Environmental Transmission Electron Microscope

DEFF Research Database (Denmark)

Cavalca, Filippo Carlo; Laursen, Anders Bo; Wagner, Jakob Birkedal

2013-01-01

Photocatalysts for solar fuel production are subject to intensive investigation as they constitute one viable route for solar energy harvesting. Cuprous oxide (Cu2O) is a working photocatalyst for hydrogen evolution but it photocorrodes upon light illumination in an aqueous environment....... Environmental transmission electron microscopy (ETEM) makes it possible to obtain insight into the local structure, composition and reactivity of catalysts in their working environment, which is of fundamental interest for sustainable energy research and is essential for further material optimization. Herein...

Accelerator-based Single-shot Ultrafast Transmission Electron Microscope with Picosecond Temporal Resolution and Nanometer Spatial Resolution

OpenAIRE

Xiang, D.; Fu, F.; Zhang, J.; Huang, X.; Wang, L.; Wang, X.; Wan, W.

2014-01-01

We present feasibility study of an accelerator-based ultrafast transmission electron microscope (u-TEM) capable of producing a full field image in a single-shot with simultaneous picosecond temporal resolution and nanometer spatial resolution. We study key physics related to performance of u-TEMs, and discuss major challenges as well as possible solutions for practical realization of u-TEMs. The feasibility of u-TEMs is confirmed through simulations using realistic electron beam parameters. W...

Integrated Transmission Electron and Single-Molecule Fluorescence Microscopy Correlates Reactivity with Ultrastructure in a Single Catalyst Particle

NARCIS (Netherlands)

Hendriks, Frank C.|info:eu-repo/dai/nl/412642697; Mohammadian, Sajjad|info:eu-repo/dai/nl/374721327; Ristanovic, Zoran|info:eu-repo/dai/nl/328233005; Kalirai, Samanbir; Meirer, Florian; Vogt, Eelco T. C.|info:eu-repo/dai/nl/073717398; Bruijnincx, Pieter C. A.|info:eu-repo/dai/nl/33799529X; Gerritsen, Hans|info:eu-repo/dai/nl/071548777; Weckhuysen, Bert M.|info:eu-repo/dai/nl/285484397

2018-01-01

Establishing structure–activity relationships in complex, hierarchically structured nanomaterials, such as fluid catalytic cracking (FCC) catalysts, requires characterization with complementary, correlated analysis techniques. An integrated setup has been developed to perform transmission electron

Transmission electron and optical microscopy of the domain structure of Ni3B7O13Br ferroic boracite

International Nuclear Information System (INIS)

Castellanos-Guzman, A.G.; Trujillo-Torrez, M.; Czank, M.

2005-01-01

The study investigated the domain structure of nickel bromine boracite single crystals, by means of polarised-light in conjunction with transmission electron microscopy. Single crystals of Ni 3 B 7 O 13 Br were grown by chemical transport reactions in closed quartz ampoules, in the temperature range of 1130 K and were examined by polarising optical microscopy (PLM), and transmission electron microscopy (TEM). PLM was also used in order to study the behaviour of birefringence as a function of temperature. For TEM the single crystals were crushed and mounted on holey carbon films. Comparative electron microscope images were useful for revealing the domain structure of this fully ferroelectric/fully ferroelastic material previously observed between the crossed polars of an optical microscope. X-ray diffraction analysis of the crystal under study was performed at room temperature

Cross-section transmission electron microscopy of the ion implantation damage in annealed diamond

Energy Technology Data Exchange (ETDEWEB)

Derry, T.E. [DST/NRF Centre of Excellence in Strong Materials and School of Physics, University of the Witwatersrand, Wits 2050, Johannesburg (South Africa)], E-mail: Trevor.Derry@wits.ac.za; Nshingabigwi, E.K. [DST/NRF Centre of Excellence in Strong Materials and School of Physics, University of the Witwatersrand, Wits 2050, Johannesburg (South Africa); Department of Physics, National University of Rwanda, P.O. Box 117, Huye (Rwanda); Levitt, M. [DST/NRF Centre of Excellence in Strong Materials and School of Physics, University of the Witwatersrand, Wits 2050, Johannesburg (South Africa); Neethling, J. [DST/NRF CoE-SM and Physics Department, Nelson Mandela Metropolitan University, Port Elizabeth (South Africa); Naidoo, S.R. [DST/NRF Centre of Excellence in Strong Materials and School of Physics, University of the Witwatersrand, Wits 2050, Johannesburg (South Africa)

2009-08-15

It has formerly been shown that low-damage levels, produced during the implantation doping of diamond as a semiconductor, anneal easily while high levels 'graphitize' (above about 5.2 x 10{sup 15} ions/cm{sup 2}). The difference in the defect types and their profiles, in the two cases, has never been directly observed. We have succeeded in using cross-section transmission electron microscopy to do so. The experiments were difficult because the specimens must be polished to {approx}40 {mu}m thickness, then implanted on edge and annealed, before final ion beam thinning to electron transparency. The low-damage micrographs reveal some deeply penetrating dislocations, whose existence had been predicted in earlier work.

Cross-section transmission electron microscopy of the ion implantation damage in annealed diamond

International Nuclear Information System (INIS)

Derry, T.E.; Nshingabigwi, E.K.; Levitt, M.; Neethling, J.; Naidoo, S.R.

2009-01-01

It has formerly been shown that low-damage levels, produced during the implantation doping of diamond as a semiconductor, anneal easily while high levels 'graphitize' (above about 5.2 x 10 15 ions/cm 2 ). The difference in the defect types and their profiles, in the two cases, has never been directly observed. We have succeeded in using cross-section transmission electron microscopy to do so. The experiments were difficult because the specimens must be polished to ∼40 μm thickness, then implanted on edge and annealed, before final ion beam thinning to electron transparency. The low-damage micrographs reveal some deeply penetrating dislocations, whose existence had been predicted in earlier work.

Advances in Transmission Electron Microscopy : In Situ Straining and In Situ Compression Experiments on Metallic Glasses

NARCIS (Netherlands)

De Hosson, Jeff Th. M.

In the field of transmission electron microscopy (TEM), fundamental and practical reasons still remain that hamper a straightforward correlation between microscopic structural information and deformation mechanisms in materials. In this article, it is argued that one should focus in particular on in

Electron conductance in curved quantum structures

DEFF Research Database (Denmark)

Willatzen, Morten; Gravesen, Jens

2010-01-01

is computationally fast and provides direct (geometrical) parameter insight as regards the determination of the electron transmission coefficient. We present, as a case study, calculations of the electron conductivity of a helically shaped quantum-wire structure and discuss the influence of the quantum......A differential-geometry analysis is employed to investigate the transmission of electrons through a curved quantum-wire structure. Although the problem is a three-dimensional spatial problem, the Schrodinger equation can be separated into three general coordinates. Hence, the proposed method...

Measurement of lower-hybrid-driven current profile by Abel inversion of electron-cyclotron wave transmission spectra

International Nuclear Information System (INIS)

Fidone, I.; Giruzzi, G.; Caron, X.; Meyer, R.L.

1991-01-01

A method for measuring the radial profile of the lower-hybrid-driven current in a low-density tokamak plasma using electron-cyclotron wave attenuation is discussed. This diagnostic scheme is reminiscent of the transmission interferometry approach, commonly used in tokamaks to measure the plasma density, but now the wave amplitude instead of the phase is measured. Wave attenuation of the ordinary mode at ω p much-lt ω c along vertical chords is measured; at these frequencies, the waves are absorbed by the superthermal tail sustained by lower-hybrid waves and the local wave absorption coefficient is proportional to the noninductive current density. The radial profile of this current is obtained from Abel inversion. An application to the Tore Supra tokamak is presented

Transmission electron microscopy analysis of skin lesions from sporotrichosis epidemic in Rio de Janeiro, Brazil.

Science.gov (United States)

Ferreira, Cassio Porto; Oliveira de Almeida, Ana Cristina; Corte-Real, Suzana

2015-02-01

Transmission electron microscopy can yield useful information in a range of scientific fields; it is capable of imaging at a significantly higher resolution than light microscopes and has been a very useful tool in the identification of morphological changes of the dermis as well as assessment of changes in the extracellular matrix. Our aim is to characterize by electron microscopy the cellular profile of lesions caused by Sporothrix schenckii from the sporotrichosis epidemic in its zoonotic form that occurs in Rio de Janeiro, Brazil. © The American Society of Tropical Medicine and Hygiene.

Transmission electron microscopy and Raman characterization of copper (I) oxide microspheres composed of nanoparticles

International Nuclear Information System (INIS)

Wang Wenzhong; Tu Ya; Wang Lijuan; Liang Yujie; Shi Honglong

2013-01-01

Highlights: ► Raman spectroscopy of copper (I) oxide microspheres were investigated. ► Infrared active mode is greatly activated in Raman scattering spectrum. ► Infrared active mode shows up in Raman spectrum of copper (I) oxide microspheres. ► The defects existed in spheres could be responsible for the observed Raman property. - Abstract: The high-resolution transmission electron microscope and Raman spectroscopy were used to investigate the microstructures and Raman scattering property of copper (I) oxide microspheres composed of nanoparticles. High-resolution transmission electron microscope images indicate that the copper (I) oxide microspheres are composed of nanoparticles with random growth direction, indicating that there are many defects in microspheres. The Raman spectrum shows that infrared active mode, which must be odd parity and is Raman forbidden for bulk crystal due to its inversion symmetry, is activated and shows up in Raman scattering spectrum. On the basis of investigations of the microstructure features of copper (I) oxide microspheres, we attribute the appearance of IR active mode in Raman scattering spectrum to the breakdown of the symmetry of the lattice due to the presence of defects in the prepared copper (I) oxide microspheres as observed in HRTEM images.

A new method to detect and correct sample tilt in scanning transmission electron microscopy bright-field imaging

Energy Technology Data Exchange (ETDEWEB)

Brown, H.G. [School of Physics, University of Melbourne, Parkville, Victoria 3010 (Australia); Ishikawa, R.; Sánchez-Santolino, G. [Institute of Engineering Innovation, School of Engineering, University of Tokyo, Tokyo 113-8656 (Japan); Lugg, N.R., E-mail: shibata@sigma.t.u-tokyo.ac.jp [Institute of Engineering Innovation, School of Engineering, University of Tokyo, Tokyo 113-8656 (Japan); Ikuhara, Y. [Institute of Engineering Innovation, School of Engineering, University of Tokyo, Tokyo 113-8656 (Japan); Allen, L.J. [School of Physics, University of Melbourne, Parkville, Victoria 3010 (Australia); Shibata, N. [Institute of Engineering Innovation, School of Engineering, University of Tokyo, Tokyo 113-8656 (Japan)

2017-02-15

Important properties of functional materials, such as ferroelectric shifts and octahedral distortions, are associated with displacements of the positions of lighter atoms in the unit cell. Annular bright-field scanning transmission electron microscopy is a good experimental method for investigating such phenomena due to its ability to image light and heavy atoms simultaneously. To map atomic positions at the required accuracy precise angular alignment of the sample with the microscope optical axis is necessary, since misalignment (tilt) of the specimen contributes to errors in position measurements of lighter elements in annular bright-field imaging. In this paper it is shown that it is possible to detect tilt with the aid of images recorded using a central bright-field detector placed within the inner radius of the annular bright-field detector. For a probe focus near the middle of the specimen the central bright-field image becomes especially sensitive to tilt and we demonstrate experimentally that misalignment can be detected with a precision of less than a milliradian, as we also confirm in simulation. Coma in the probe, an aberration that can be misidentified as tilt of the specimen, is also investigated and it is shown how the effects of coma and tilt can be differentiated. The effects of tilt may be offset to a large extent by shifting the diffraction plane detector an amount equivalent to the specimen tilt and we provide an experimental proof of principle of this using a segmented detector system. - Highlights: • Octahedral distortions are associated with displacements of lighter atoms. • Annular bright-field imaging is sensitive to light and heavy atoms simultaneously. • Mistilt of the specimen leads to errors in position measurements of lighter elements. • It is possible to detect tilt using images taken by a central bright-field detector. • Tilt may be offset by shifting the diffraction plane detector by an equivalent amount.

Comparison of Transmission Line Methods for Surface Acoustic Wave Modeling

Science.gov (United States)

Wilson, William; Atkinson, Gary

2009-01-01

Surface Acoustic Wave (SAW) technology is low cost, rugged, lightweight, extremely low power and can be used to develop passive wireless sensors. For these reasons, NASA is investigating the use of SAW technology for Integrated Vehicle Health Monitoring (IVHM) of aerospace structures. To facilitate rapid prototyping of passive SAW sensors for aerospace applications, SAW models have been developed. This paper reports on the comparison of three methods of modeling SAWs. The three models are the Impulse Response Method (a first order model), and two second order matrix methods; the conventional matrix approach, and a modified matrix approach that is extended to include internal finger reflections. The second order models are based upon matrices that were originally developed for analyzing microwave circuits using transmission line theory. Results from the models are presented with measured data from devices. Keywords: Surface Acoustic Wave, SAW, transmission line models, Impulse Response Method.

High resolution Transmission Electron Microscopy characterization of a milled oxide dispersion strengthened steel powder

Energy Technology Data Exchange (ETDEWEB)

Loyer-Prost, M., E-mail: marie.loyer-prost@cea.fr [DEN-Service de Recherches de Métallurgie Physique, CEA, Université Paris-Saclay, F-91191, Gif-sur-Yvette (France); Merot, J.-S. [Laboratoire d’Etudes des Microstructures – UMR 104, CNRS/ONERA, BP72-29, Avenue de la Division Leclerc, 92 322, Châtillon (France); Ribis, J. [DEN-Service de Recherches de Métallurgie Appliquée, CEA, Université Paris-Saclay, F-91191, Gif-sur-Yvette (France); Le Bouar, Y. [Laboratoire d’Etudes des Microstructures – UMR 104, CNRS/ONERA, BP72-29, Avenue de la Division Leclerc, 92 322, Châtillon (France); Chaffron, L. [DEN-Service de Recherches de Métallurgie Appliquée, CEA, Université Paris-Saclay, F-91191, Gif-sur-Yvette (France); Legendre, F. [DEN-Service de la Corrosion et du Comportement des Matériaux dans leur Environnement, CEA, Université Paris-Saclay, F-91191, Gif-sur-Yvette (France)

2016-10-15

Oxide Dispersion Strengthened (ODS) steels are promising materials for generation IV fuel claddings as their dense nano-oxide dispersion provides good creep and irradiation resistance. Even if they have been studied for years, the formation mechanism of these nano-oxides is still unclear. Here we report for the first time a High Resolution Transmission Electron Microscopy and Energy Filtered Transmission Electron Microscopy characterization of an ODS milled powder. It provides clear evidence of the presence of small crystalline nanoclusters (NCs) enriched in titanium directly after milling. Small NCs (<5 nm) have a crystalline structure and seem partly coherent with the matrix. They have an interplanar spacing close to the (011) {sub bcc} iron structure. They coexist with larger crystalline spherical precipitates of 15–20 nm in size. Their crystalline structure may be metastable as they are not consistent with any Y-Ti-O or Ti-O structure. Such detailed observations in the as-milled grain powder confirm a mechanism of Y, Ti, O dissolution in the ferritic matrix followed by a NC precipitation during the mechanical alloying process of ODS materials. - Highlights: • We observed an ODS ball-milled powder by high resolution transmission microscopy. • The ODS ball-milled powder exhibits a lamellar microstructure. • Small crystalline nanoclusters were detected in the milled ODS powder. • The nanoclusters in the ODS milled powder are enriched in titanium. • Larger NCs of 15–20 nm in size are, at least, partly coherent with the matrix.

Research on Condition Assessment Method of Transmission Tower Under the Action of Strong Wind

Science.gov (United States)

Huang, Ren-mou; An, Li-qiang; Zhang, Rong-lun; Wu, Jiong; Liang, Ya-feng

2018-03-01

Transmission towers are often subjected to the external damage of severe weather like strong wind and so on, which may cause the collapse due to the yield and fracture of the tower material. Aiming this issue, an assessment method was proposed in this paper to assess the operation condition of transmission towers under strong wind. With a reasonable assess index system established firstly, then the internal force of the tower material was solved and its stability was determined through the mechanical analysis of the transmission tower finite element model. Meanwhile, the condition risk level of the tower was finally determined by considering the difference among the influences of other factors like corrosion and loose of members, slope on the transmission tower through the analytic hierarchy process. The assessment method was applied to assess the wind-induced collapse of towers in 110kV Bao Yi II line in Wenchang City, Hainan Province, of which the result proves the method can assess the condition of transmission tower under strong wind and of guiding significance for improving the windproof capability of transmission towers.

The use of transmission electron microscopy in the quantification of nanoparticle dose

International Nuclear Information System (INIS)

Hondow, N; Brydson, R; Brown, A

2014-01-01

There are an increasing number of potential applications for nanoparticles in clinical medicine, including targeted drug delivery and contrast agents for biomedical imaging. Current in vitro studies are concerned with the biological impact of nanoparticles, with electron microscopy commonly employed to image their intracellular location. It is critical to quantify the absolute nanoparticle dose internalized by cells in a given exposure, and to understand the factors which affect this. In this work we are aiming to develop a full quantitative description of quantum dot uptake by an in vitro cell line. Transmission electron microscopy of thin cell sections provides the location and number of cellular vesicles per 2-D cell slice plus the number of quantum dots per vesicle. These results can then be correlated to other techniques to quantify the internalized nanoparticle dose distribution for whole cells

A Practical Radiosity Method for Predicting Transmission Loss in Urban Environments

Directory of Open Access Journals (Sweden)

Liang Ming

2004-01-01

Full Text Available The ability to predict transmission loss or field strength distribution is crucial for determining coverage in planning personal communication systems. This paper presents a practical method to accurately predict entire average transmission loss distribution in complicated urban environments. The method uses a 3D propagation model based on radiosity and a simplified city information database including surfaces of roads and building groups. Narrowband validation measurements with line-of-sight (LOS and non-line-of-sight (NLOS cases at 1800 MHz give excellent agreement in urban environments.

Transmission electron microscope examination of rare-gas bubbles in metals: analysis of observed contrast effects

International Nuclear Information System (INIS)

Levy, V.

1964-01-01

Metallic samples containing rare gas bubbles have been examined by transmission electron microscopy. The different features of the contrast patterns of the bubbles have been explained by the dynamical theory of contrast, assuming that the bubble behaves as a hole in the metal. Experimental results are in good agreement with the theory. (author) [fr

Comparison of cluster-based and source-attribution methods for estimating transmission risk using large HIV sequence databases.

Science.gov (United States)

Le Vu, Stéphane; Ratmann, Oliver; Delpech, Valerie; Brown, Alison E; Gill, O Noel; Tostevin, Anna; Fraser, Christophe; Volz, Erik M

2018-06-01

Phylogenetic clustering of HIV sequences from a random sample of patients can reveal epidemiological transmission patterns, but interpretation is hampered by limited theoretical support and statistical properties of clustering analysis remain poorly understood. Alternatively, source attribution methods allow fitting of HIV transmission models and thereby quantify aspects of disease transmission. A simulation study was conducted to assess error rates of clustering methods for detecting transmission risk factors. We modeled HIV epidemics among men having sex with men and generated phylogenies comparable to those that can be obtained from HIV surveillance data in the UK. Clustering and source attribution approaches were applied to evaluate their ability to identify patient attributes as transmission risk factors. We find that commonly used methods show a misleading association between cluster size or odds of clustering and covariates that are correlated with time since infection, regardless of their influence on transmission. Clustering methods usually have higher error rates and lower sensitivity than source attribution method for identifying transmission risk factors. But neither methods provide robust estimates of transmission risk ratios. Source attribution method can alleviate drawbacks from phylogenetic clustering but formal population genetic modeling may be required to estimate quantitative transmission risk factors. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Unravelling surface and interfacial structures of a metal-organic framework by transmission electron microscopy.

Science.gov (United States)

Zhu, Yihan; Ciston, Jim; Zheng, Bin; Miao, Xiaohe; Czarnik, Cory; Pan, Yichang; Sougrat, Rachid; Lai, Zhiping; Hsiung, Chia-En; Yao, Kexin; Pinnau, Ingo; Pan, Ming; Han, Yu

2017-05-01

Metal-organic frameworks (MOFs) are crystalline porous materials with designable topology, porosity and functionality, having promising applications in gas storage and separation, ion conduction and catalysis. It is challenging to observe MOFs with transmission electron microscopy (TEM) due to the extreme instability of MOFs upon electron beam irradiation. Here, we use a direct-detection electron-counting camera to acquire TEM images of the MOF ZIF-8 with an ultralow dose of 4.1 electrons per square ångström to retain the structural integrity. The obtained image involves structural information transferred up to 2.1 Å, allowing the resolution of individual atomic columns of Zn and organic linkers in the framework. Furthermore, TEM reveals important local structural features of ZIF-8 crystals that cannot be identified by diffraction techniques, including armchair-type surface terminations and coherent interfaces between assembled crystals. These observations allow us to understand how ZIF-8 crystals self-assemble and the subsequent influence of interfacial cavities on mass transport of guest molecules.

Fabrication and electric measurements of nanostructures inside transmission electron microscope

International Nuclear Information System (INIS)

Chen, Qing; Peng, Lian-Mao

2011-01-01

Using manipulation holders specially designed for transmission electron microscope (TEM), nanostructures can be characterized, measured, modified and even fabricated in-situ. In-situ TEM techniques not only enable real-time study of structure-property relationships of materials at atomic scale, but also provide the ability to control and manipulate materials and structures at nanoscale. This review highlights in-situ electric measurements and in-situ fabrication and structure modification using manipulation holder inside TEM. -- Research highlights: → We review in-situ works using manipulation holder in TEM. → In-situ electric measurements, fabrication and structure modification are focused. → We discuss important issues that should be considered for reliable results. → In-situ TEM is becoming a very powerful tool for many research fields.

31 CFR 203.10 - Electronic payment methods.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Electronic payment methods. 203.10... TAX AND LOAN PROGRAM Electronic Federal Tax Payments § 203.10 Electronic payment methods. (a) General. Electronic payment methods for Federal tax payments available under this subpart include ACH debit entries...

Automated transmission-mode scanning electron microscopy (tSEM for large volume analysis at nanoscale resolution.

Directory of Open Access Journals (Sweden)

Masaaki Kuwajima

Full Text Available Transmission-mode scanning electron microscopy (tSEM on a field emission SEM platform was developed for efficient and cost-effective imaging of circuit-scale volumes from brain at nanoscale resolution. Image area was maximized while optimizing the resolution and dynamic range necessary for discriminating key subcellular structures, such as small axonal, dendritic and glial processes, synapses, smooth endoplasmic reticulum, vesicles, microtubules, polyribosomes, and endosomes which are critical for neuronal function. Individual image fields from the tSEM system were up to 4,295 µm(2 (65.54 µm per side at 2 nm pixel size, contrasting with image fields from a modern transmission electron microscope (TEM system, which were only 66.59 µm(2 (8.160 µm per side at the same pixel size. The tSEM produced outstanding images and had reduced distortion and drift relative to TEM. Automated stage and scan control in tSEM easily provided unattended serial section imaging and montaging. Lens and scan properties on both TEM and SEM platforms revealed no significant nonlinear distortions within a central field of ∼100 µm(2 and produced near-perfect image registration across serial sections using the computational elastic alignment tool in Fiji/TrakEM2 software, and reliable geometric measurements from RECONSTRUCT™ or Fiji/TrakEM2 software. Axial resolution limits the analysis of small structures contained within a section (∼45 nm. Since this new tSEM is non-destructive, objects within a section can be explored at finer axial resolution in TEM tomography with current methods. Future development of tSEM tomography promises thinner axial resolution producing nearly isotropic voxels and should provide within-section analyses of structures without changing platforms. Brain was the test system given our interest in synaptic connectivity and plasticity; however, the new tSEM system is readily applicable to other biological systems.

High-resolution transmission electron microscopy and energetics of flattened carbon nonoshells

International Nuclear Information System (INIS)

Bourgeois, L.N.; Bursill, L.A.

1998-01-01

When examined under a high-resolution transmission electron microscope, carbon soot produced alongside buckytubes in an arc-discharge is found to contain a small percentage of flattened carbon shells. These objects are shown to be small graphite flakes which eliminated their dangling bonds by terminating their edges with highly curved junctions. Ideal models for these structures are presented, and their energy estimated. The calculations show that the establishment of highly curved junctions is energetically favourable for a graphite flake in an inert atmosphere. Flattened shells also appear more stable than their 'inflated' counterparts (fullerene 'onions' and buckytubes) when the shell dimensions obey specific criteria.(authors)

Chemical Reactions of Molecules Promoted and Simultaneously Imaged by the Electron Beam in Transmission Electron Microscopy.

Science.gov (United States)

Skowron, Stephen T; Chamberlain, Thomas W; Biskupek, Johannes; Kaiser, Ute; Besley, Elena; Khlobystov, Andrei N

2017-08-15

The main objective of this Account is to assess the challenges of transmission electron microscopy (TEM) of molecules, based on over 15 years of our work in this field, and to outline the opportunities in studying chemical reactions under the electron beam (e-beam). During TEM imaging of an individual molecule adsorbed on an atomically thin substrate, such as graphene or a carbon nanotube, the e-beam transfers kinetic energy to atoms of the molecule, displacing them from equilibrium positions. Impact of the e-beam triggers bond dissociation and various chemical reactions which can be imaged concurrently with their activation by the e-beam and can be presented as stop-frame movies. This experimental approach, which we term ChemTEM, harnesses energy transferred from the e-beam to the molecule via direct interactions with the atomic nuclei, enabling accurate predictions of bond dissociation events and control of the type and rate of chemical reactions. Elemental composition and structure of the reactant molecules as well as the operating conditions of TEM (particularly the energy of the e-beam) determine the product formed in ChemTEM processes, while the e-beam dose rate controls the reaction rate. Because the e-beam of TEM acts simultaneously as a source of energy for the reaction and as an imaging tool monitoring the same reaction, ChemTEM reveals atomic-level chemical information, such as pathways of reactions imaged for individual molecules, step-by-step and in real time; structures of illusive reaction intermediates; and direct comparison of catalytic activity of different transition metals filmed with atomic resolution. Chemical transformations in ChemTEM often lead to previously unforeseen products, demonstrating the potential of this method to become not only an analytical tool for studying reactions, but also a powerful instrument for discovery of materials that can be synthesized on preparative scale.

Electron diffraction and high-resolution transmission electron microscopy of the high temperature crystal structures of GexSb2Te3+x (x=1,2,3) phase change material

NARCIS (Netherlands)

Kooi, B.J.; de Hosson, J.T.M.

2002-01-01

The crystal structures of GeSb2Te4, Ge2Sb2Te5, and Ge3Sb2Te6 were determined using electron diffraction and high-resolution transmission electron microscopy. The structure determined for the former two crystals deviates from the ones proposed in the literature. These crystal structures were

Compton scattering of photons from electrons in magnetically insulated transmission lines

International Nuclear Information System (INIS)

Brower, K.L.; VanDevender, J.P.

1979-01-01

Self-magnetically insulated transmission lines are used for power transport between the vacuum insulator and the diode in high current particle accelerators. Since the efficiency of the power transport depends on the details of the initial line geometry, i.e., the injector, the dependence of the electron canonical momentum distribution on the injector geometry should reveal the loss mechanism. We propose to study that dependence experimentally through a Compton scattering diagnostic. The spectrum of scattered light reveals the electron velocity distribution perpendicular to the direction of flow. The design of the diagnostic is in progress. Our preliminary analysis is based on the conservation of energy and canonical momentum for a single electron in the anti E and anti B fields determined from 2-D calculations. For the Mite accelerator with power flow along Z, the normalized canonical momentum, μ, is in the range - 0.7 < μ less than or equal to 0. For anti k/sub i/ parallel to circumflex Y, and anti k/sub s/ circumflex X, our analysis indicates that the scattered photons have 1.1 eV less than or equal to h nu/sub s/ < 5.6 eV for ruby laser scattering and can be detected with PM tubes

Transmission electron microscope CCD camera

Science.gov (United States)

Downing, Kenneth H.

1999-01-01

In order to improve the performance of a CCD camera on a high voltage electron microscope, an electron decelerator is inserted between the microscope column and the CCD. This arrangement optimizes the interaction of the electron beam with the scintillator of the CCD camera while retaining optimization of the microscope optics and of the interaction of the beam with the specimen. Changing the electron beam energy between the specimen and camera allows both to be optimized.

The method of the transfer matrix applied to the study of the electronic properties of the Kronig- Penney model with structural disorder

International Nuclear Information System (INIS)

Miranda S, Anabel; Landauro S, Carlos

2008-01-01

In the present work the transfer matrix method is employed to study the electronic properties of the Kronig-Penney model including disorder in the periodic system. The results show that although the electronic properties are very similar to the corresponding periodic case, disorder in the system produces a decrease of the transmission in the whole range of energies which indicates clearly a reduction of the electronic transport (conductivity) due to the disorder in the system. (author)

Design and implementation of a fs-resolved transmission electron microscope based on thermionic gun technology

Energy Technology Data Exchange (ETDEWEB)

Piazza, L., E-mail: luca.piazza@epfl.ch [Laboratory for Ultrafast Microscopy and Electron Scattering (LUMES), ICMP, Ecole Polytechnique Fédérale de Lausanne, CH-1015 Lausanne (Switzerland); Masiel, D.J. [Integrated Dynamic Electron Solutions, Inc., 455 Bolero Drive, Danville, CA 94526 (United States); LaGrange, T.; Reed, B.W. [Condensed Matter and Materials Division Physical and Life Sciences Directorate, Lawrence Livermore National Laboratory, P.O. Box 808, L-356, Livermore, CA 94550 (United States); Barwick, B. [Department of Physics, Trinity College, 300 Summit St., Hartford, CT 06106 (United States); Carbone, Fabrizio [Laboratory for Ultrafast Microscopy and Electron Scattering (LUMES), ICMP, Ecole Polytechnique Fédérale de Lausanne, CH-1015 Lausanne (Switzerland)

2013-09-23

Highlights: • We present the implementation of a femtosecond-resolved ultrafast TEM. • This is the first ultrafast TEM based on a thermionic gun geometry. • An additional condenser lens has been used to maximize the electron count. • We achieved a time resolution of about 300 fs and an energy resolution of 1 eV. - Abstract: In this paper, the design and implementation of a femtosecond-resolved ultrafast transmission electron microscope is presented, based on a thermionic gun geometry. Utilizing an additional magnetic lens between the electron acceleration and the nominal condenser lens system, a larger percentage of the electrons created at the cathode are delivered to the specimen without degrading temporal, spatial and energy resolution significantly, while at the same time maintaining the femtosecond temporal resolution. Using the photon-induced near field electron microscopy effect (PINEM) on silver nanowires the cross-correlation between the light and electron pulses was measured, showing the impact of the gun settings and initiating laser pulse duration on the electron bunch properties. Tuneable electron pulses between 300 fs and several ps can be obtained, and an overall energy resolution around 1 eV was achieved.

Characterization methods

Energy Technology Data Exchange (ETDEWEB)

Glass, J.T. [North Carolina State Univ., Raleigh (United States)

1993-01-01

Methods discussed in this compilation of notes and diagrams are Raman spectroscopy, scanning electron microscopy, transmission electron microscopy, and other surface analysis techniques (auger electron spectroscopy, x-ray photoelectron spectroscopy, electron energy loss spectroscopy, and scanning tunnelling microscopy). A comparative evaluation of different techniques is performed. In-vacuo and in-situ analyses are described.

Graphene as a transparent conductive support for studying biological molecules by transmission electron microscopy

International Nuclear Information System (INIS)

Nair, R. R.; Anissimova, S.; Novoselov, K. S.; Blake, P.; Blake, J. R.; Geim, A. K.; Zan, R.; Bangert, U.; Golovanov, A. P.; Morozov, S. V.; Latychevskaia, T.

2010-01-01

We demonstrate the application of graphene as a support for imaging individual biological molecules in transmission electron microscope (TEM). A simple procedure to produce free-standing graphene membranes has been designed. Such membranes are extremely robust and can support practically any submicrometer object. Tobacco mosaic virus has been deposited on graphene samples and observed in a TEM. High contrast has been achieved even though no staining has been applied.

An efficient and reproducible process for transmission electron microscopy (TEM) of rare cell populations

Science.gov (United States)

Kumar, Sachin; Ciraolo, Georgianne; Hinge, Ashwini; Filippi, Marie-Dominique

2014-01-01

Transmission electron microscopy (TEM) provides ultra-structural details of cells at the sub-organelle level. However, details of the cellular ultrastructure, and the cellular organization and content of various organelles in rare populations, particularly in the suspension, like hematopoietic stem cells (HSCs) remained elusive. This is mainly due to the requirement of millions of cells for TEM studies. Thus, there is a vital requirement of a method that will allow TEM studies with low cell numbers of such rare populations. We describe an alternative and novel approach for TEM studies for rare cell populations. Here we performed TEM study from 10,000 HSC cells with quite ease. In particular, tiny cell pellets were identified by Evans blue staining after PFA-GA fixation. The cell pellet was pre-embedded in agarose in a small microcentrifuge tube and processed for dehydration, infiltration and embedding. Semi-thin and ultra-thin sections identified clusters of numerous cells per sections with well preserved morphology and ultrastructural details of golgi complex and mitochondria. Together, this method provides an efficient, easy and reproducible process to perform qualitative and quantitative TEM analysis from limited biological samples including cells in suspension. PMID:24291346

The calibration of spectrometers for Auger electron and X-ray photoelectron spectrometers part II - the determination of the electron spectrometer transmission function and the detector sensitivity energy dependencies

International Nuclear Information System (INIS)

Smith, G.C.; Seah, M.P.

1991-01-01

For the use of published general or theoretical sensitivity factors in quantitative AES and XPS the energy dependence of both the spectrometer transmission function and the detector sensitivity must be known. Here we develop simple procedures which allow these dependencies to be determined experimentally. Detailed measurements for a modified VG Scientific ESCALAB II, the metrology spectrometer, operated in both the constant ΔE/E and constant ΔE modes, are presented and compared with theoretical estimates. It is shown that an exceptionally detailed electron-optical calculation, involving proprietary information, would be required to match the accuracy of the experimental procedures developed. Removal of the spectrometer transmission function and the detector sensitivity terms allows the measured spectrum to be converted to the true electron emission spectrum irrespective of the mode of operation. This provides the first step to the provision of reference samples to calibrate the transmission functions and detector sensitivities of all instruments so that they, in turn, may produce true electron emission spectra. This is vital if (i) all instruments are to give consistent results, (ii) theoretical terms are to be used in quantifying either AES or XPS and (iii) reference data banks are to be established for AES or XPS

Transmission Electron Microscopy of Magnetite Plaquettes in Orgueil

Science.gov (United States)

Chan, Q. H. S.; Han, J.; Zolensky, M.

2016-01-01

Magnetite sometimes takes the form of a plaquette - barrel-shaped stack of magnetite disks - in carbonaceous chondrites (CC) that show evidence of aqueous alteration. The asymmetric nature of the plaquettes caused Pizzarello and Groy to propose magnetite plaquettes as a naturally asymmetric mineral that can indroduce symmetry-breaking in organic molecules. Our previous synchrotron X-ray computed microtomography (SXRCT) and electron backscatter diffraction (EBSD) analyses of the magnetite plaquettes in fifteen CCs indicate that magnetite plaquettes are composed of nearly parallel discs, and the crystallographic orientations of the discs change around a rotational axis normal to the discs surfaces. In order to further investigate the nanostructures of magnetite plaquettes, we made two focused ion beam (FIB) sections of nine magnetite plaquettes from a thin section of CI Orgueil for transmission electron microscope (TEM) analysis. The X-ray spectrum imaging shows that the magnetite discs are purely iron oxide Fe3O4 (42.9 at% Fe and 57.1 at% O), which suggest that the plaquettes are of aqueous origin as it is difficult to form pure magnetite as a nebular condensate. The selected area electron diffraction (SAED) patterns acquired across the plaquettes show that the magnetite discs are single crystals. SEM and EBSD analyses suggest that the planar surfaces of the magnetite discs belong to the {100} planes of the cubic inverse spinel structure, which are supported by our TEM observations. Kerridge et al. suggested that the epitaxial relationship between magnetite plaquette and carbonate determines the magnetite face. However, according to our TEM observation, the association of magnetite with porous networks of phyllosilicate indicates that the epitaxial relationship with carbonate is not essential to the formation of magnetite plaquettes. It was difficult to determine the preferred rotational orientation of the plaquettes due to the symmetry of the cubic structure

Development of a transmission positron microscope

Energy Technology Data Exchange (ETDEWEB)

Matsuya, M., E-mail: matsuya@jeol.co.jp [JEOL Ltd., 1-2 Musashino, 3-Chome, Akishima, Tokyo 196-8558 (Japan); Jinno, S. [Department of Applied Chemistry, Chiba University, Yayoi, Inage, Chiba, Chiba 263-8552 (Japan); Ootsuka, T.; Inoue, M. [JEOL Ltd., 1-2 Musashino, 3-Chome, Akishima, Tokyo 196-8558 (Japan); Kurihara, T. [High Energy Accelerator Research Organization, Oho, Tsukuba, Ibaraki 305-0801 (Japan); Doyama, M.; Inoue, M. [Teikyo University of Science and Technology, Uenohara, Yamanashi 409-0913 (Japan); Fujinami, M. [Department of Applied Chemistry, Chiba University, Yayoi, Inage, Chiba, Chiba 263-8552 (Japan)

2011-07-21

A practical transmission positron microscope (TPM) JEM-1011B has been developed to survey differences in the interaction of positron and electron beams with materials, and is installed in the Slow Positron Facility of High Energy Accelerator Research Organization (KEK). The TPM can share positron and electron beams, and can also be used as a transmission electron microscope (TEM). Positron transmission images up to magnification 10,000x (resolution: 50 nm) and positron diffraction patterns up to 044 family were successfully obtained by the TPM comparing them with those of electrons. The differences in material transmittances for both beams have been measured, and can be explained by the calculated results of the Monte Carlo simulation code PENELOPE-2008.

Betweenness-Based Method to Identify Critical Transmission Sectors for Supply Chain Environmental Pressure Mitigation.

Science.gov (United States)

Liang, Sai; Qu, Shen; Xu, Ming

2016-02-02

To develop industry-specific policies for mitigating environmental pressures, previous studies primarily focus on identifying sectors that directly generate large amounts of environmental pressures (a.k.a. production-based method) or indirectly drive large amounts of environmental pressures through supply chains (e.g., consumption-based method). In addition to those sectors as important environmental pressure producers or drivers, there exist sectors that are also important to environmental pressure mitigation as transmission centers. Economy-wide environmental pressure mitigation might be achieved by improving production efficiency of these key transmission sectors, that is, using less upstream inputs to produce unitary output. We develop a betweenness-based method to measure the importance of transmission sectors, borrowing the betweenness concept from network analysis. We quantify the betweenness of sectors by examining supply chain paths extracted from structural path analysis that pass through a particular sector. We take China as an example and find that those critical transmission sectors identified by betweenness-based method are not always identifiable by existing methods. This indicates that betweenness-based method can provide additional insights that cannot be obtained with existing methods on the roles individual sectors play in generating economy-wide environmental pressures. Betweenness-based method proposed here can therefore complement existing methods for guiding sector-level environmental pressure mitigation strategies.

A multi-stage stochastic transmission expansion planning method

International Nuclear Information System (INIS)

Akbari, Tohid; Rahimikian, Ashkan; Kazemi, Ahad

2011-01-01

Highlights: → We model a multi-stage stochastic transmission expansion planning problem. → We include available transfer capability (ATC) in our model. → Involving this criterion will increase the ATC between source and sink points. → Power system reliability will be increased and more money can be saved. - Abstract: This paper presents a multi-stage stochastic model for short-term transmission expansion planning considering the available transfer capability (ATC). The ATC can have a huge impact on the power market outcomes and the power system reliability. The transmission expansion planning (TEP) studies deal with many uncertainties, such as system load uncertainties that are considered in this paper. The Monte Carlo simulation method has been applied for generating different scenarios. A scenario reduction technique is used for reducing the number of scenarios. The objective is to minimize the sum of investment costs (IC) and the expected operation costs (OC). The solution technique is based on the benders decomposition algorithm. The N-1 contingency analysis is also done for the TEP problem. The proposed model is applied to the IEEE 24 bus reliability test system and the results are efficient and promising.

Dynamical electron diffraction simulation for non-orthogonal crystal system by a revised real space method.

Science.gov (United States)

Lv, C L; Liu, Q B; Cai, C Y; Huang, J; Zhou, G W; Wang, Y G

2015-01-01

In the transmission electron microscopy, a revised real space (RRS) method has been confirmed to be a more accurate dynamical electron diffraction simulation method for low-energy electron diffraction than the conventional multislice method (CMS). However, the RRS method can be only used to calculate the dynamical electron diffraction of orthogonal crystal system. In this work, the expression of the RRS method for non-orthogonal crystal system is derived. By taking Na2 Ti3 O7 and Si as examples, the correctness of the derived RRS formula for non-orthogonal crystal system is confirmed by testing the coincidence of numerical results of both sides of Schrödinger equation; moreover, the difference between the RRS method and the CMS for non-orthogonal crystal system is compared at the accelerating voltage range from 40 to 10 kV. Our results show that the CMS method is almost the same as the RRS method for the accelerating voltage above 40 kV. However, when the accelerating voltage is further lowered to 20 kV or below, the CMS method introduces significant errors, not only for the higher-order Laue zone diffractions, but also for zero-order Laue zone. These indicate that the RRS method for non-orthogonal crystal system is necessary to be used for more accurate dynamical simulation when the accelerating voltage is low. Furthermore, the reason for the increase of differences between those diffraction patterns calculated by the RRS method and the CMS method with the decrease of the accelerating voltage is discussed. © 2015 The Authors Journal of Microscopy © 2015 Royal Microscopical Society.

Towards 3D crystal orientation reconstruction using automated crystal orientation mapping transmission electron microscopy (ACOM-TEM).

Science.gov (United States)

Kobler, Aaron; Kübel, Christian

2018-01-01

To relate the internal structure of a volume (crystallite and phase boundaries) to properties (electrical, magnetic, mechanical, thermal), a full 3D reconstruction in combination with in situ testing is desirable. In situ testing allows the crystallographic changes in a material to be followed by tracking and comparing the individual crystals and phases. Standard transmission electron microscopy (TEM) delivers a projection image through the 3D volume of an electron-transparent TEM sample lamella. Only with the help of a dedicated TEM tomography sample holder is an accurate 3D reconstruction of the TEM lamella currently possible. 2D crystal orientation mapping has become a standard method for crystal orientation and phase determination while 3D crystal orientation mapping have been reported only a few times. The combination of in situ testing with 3D crystal orientation mapping remains a challenge in terms of stability and accuracy. Here, we outline a method to 3D reconstruct the crystal orientation from a superimposed diffraction pattern of overlapping crystals without sample tilt. Avoiding the typically required tilt series for 3D reconstruction enables not only faster in situ tests but also opens the possibility for more stable and more accurate in situ mechanical testing. The approach laid out here should serve as an inspiration for further research and does not make a claim to be complete.

Interaction between single gold atom and the graphene edge: A study via aberration-corrected transmission electron microscopy

KAUST Repository

Wang, Hongtao

2012-01-01

Interaction between single noble metal atoms and graphene edges has been investigated via aberration-corrected and monochromated transmission electron microscopy. A collective motion of the Au atom and the nearby carbon atoms is observed in transition between energy-favorable configurations. Most trapping and detrapping processes are assisted by the dangling carbon atoms, which are more susceptible to knock-on displacements by electron irradiation. Thermal energy is lower than the activation barriers in transition among different energy-favorable configurations, which suggests electron-beam irradiation can be an efficient way of engineering the graphene edge with metal atoms. © 2012 The Royal Society of Chemistry.

Simplified method to solve sound transmission through structures lined with elastic porous material.

Science.gov (United States)

Lee, J H; Kim, J

2001-11-01

An approximate analysis method is developed to calculate sound transmission through structures lined with porous material. Because the porous material has both the solid phase and fluid phase, three wave components exist in the material, which makes the related analysis very complicated. The main idea in developing the approximate method is very simple: modeling the porous material using only the strongest of the three waves, which in effect idealizes the material as an equivalent fluid. The analysis procedure has to be conducted in two steps. In the first step, sound transmission through a flat double panel with a porous liner of infinite extents, which has the same cross sectional construction as the actual structure, is solved based on the full theory and the strongest wave component is identified. In the second step sound transmission through the actual structure is solved modeling the porous material as an equivalent fluid while using the actual geometry of the structure. The development and validation of the method are discussed in detail. As an application example, the transmission loss through double walled cylindrical shells with a porous core is calculated utilizing the simplified method.

Characterization of pigments applied on archaeological material from Chincha's Culture by x-rays fluorescence and transmission electronic microscopy

International Nuclear Information System (INIS)

Lopez M, Alcides; Olivera, Paula

2007-01-01

The elementary characterization of some pigments applied in the decoration of recipients used by our ancestors of the Chincha Culture by Energy dispersive X-ray fluorescence (EDXRF)method was allowed. Additionally, the morphological and crystalline characterization by Transmission Electronic Microscopy (TEM) method has been possible. The results have allowed identifying the presence of mercury sulphur (HgS) (cinnabar) in the red pigment on the 'mate'; the black and white pigments are constituted by materials of organic aspect; in the case the dark brown one they are constituted by organic matter and ferric oxide. This work also demonstrates that a portable EDXRF spectrometer is the most suitable for the study of pieces of our cultural patrimony, mainly of those that are difficult to transport from an archaeological place or museum to an analytic laboratory by reason of its dimensions and conservation conditions. (author)

Linking healthcare associated norovirus outbreaks: a molecular epidemiologic method for investigating transmission

Directory of Open Access Journals (Sweden)

Andrews Nick

2006-07-01

Full Text Available Abstract Background Noroviruses are highly infectious pathogens that cause gastroenteritis in the community and in semi-closed institutions such as hospitals. During outbreaks, multiple units within a hospital are often affected, and a major question for control programs is: are the affected units part of the same outbreak or are they unrelated transmission events? In practice, investigators often assume a transmission link based on epidemiological observations, rather than a systematic approach to tracing transmission. Here, we present a combined molecular and statistical method for assessing: 1 whether observed clusters provide evidence of local transmission and 2 the probability that anecdotally|linked outbreaks truly shared a transmission event. Methods 76 healthcare associated outbreaks were observed in an active and prospective surveillance scheme of 15 hospitals in the county of Avon, England from April 2002 to March 2003. Viral RNA from 64 out of 76 specimens from distinct outbreaks was amplified by reverse transcription-PCR and was sequenced in the polymerase (ORF 1 and capsid (ORF 2 regions. The genetic diversity, at the nucleotide level, was analysed in relation to the epidemiological patterns. Results Two out of four genetic and epidemiological clusters of outbreaks were unlikely to have occurred by chance alone, thus suggesting local transmission. There was anecdotal epidemiological evidence of a transmission link among 5 outbreaks pairs. By combining this epidemiological observation with viral sequence data, the evidence of a link remained convincing in 3 of these pairs. These results are sensitive to prior beliefs of the strength of epidemiological evidence especially when the outbreak strains are common in the background population. Conclusion The evidence suggests that transmission between hospitals units does occur. Using the proposed criteria, certain hypothesized transmission links between outbreaks were supported while

Self-assembly of silicon nanowires studied by advanced transmission electron microscopy

Directory of Open Access Journals (Sweden)

Marta Agati

2017-02-01

Full Text Available Scanning transmission electron microscopy (STEM was successfully applied to the analysis of silicon nanowires (SiNWs that were self-assembled during an inductively coupled plasma (ICP process. The ICP-synthesized SiNWs were found to present a Si–SiO2 core–shell structure and length varying from ≈100 nm to 2–3 μm. The shorter SiNWs (maximum length ≈300 nm were generally found to possess a nanoparticle at their tip. STEM energy dispersive X-ray (EDX spectroscopy combined with electron tomography performed on these nanostructures revealed that they contain iron, clearly demonstrating that the short ICP-synthesized SiNWs grew via an iron-catalyzed vapor–liquid–solid (VLS mechanism within the plasma reactor. Both the STEM tomography and STEM-EDX analysis contributed to gain further insight into the self-assembly process. In the long-term, this approach might be used to optimize the synthesis of VLS-grown SiNWs via ICP as a competitive technique to the well-established bottom-up approaches used for the production of thin SiNWs.

Mass spectrometer and method with improved ion transmission

International Nuclear Information System (INIS)

Douglas, D.J.; French, J.B.

1992-01-01

This invention relates to a mass analyzer, and to a method of operating a mass analyzer, of the kind in which ions are transmitted through a first rod set for focussing and separation from an accompanying gas, before passing through a mass filter rod set which which permits transmission only of ions of a selected mass to charge ratio. (author). 19 figs

Sample Preparation Methodologies for In Situ Liquid and Gaseous Cell Analytical Transmission Electron Microscopy of Electropolished Specimens.

Science.gov (United States)

Zhong, Xiang Li; Schilling, Sibylle; Zaluzec, Nestor J; Burke, M Grace

2016-12-01

In recent years, an increasing number of studies utilizing in situ liquid and/or gaseous cell scanning/transmission electron microscopy (S/TEM) have been reported. Because of the difficulty in the preparation of suitable specimens, these environmental S/TEM studies have been generally limited to studies of nanoscale structured materials such as nanoparticles, nanowires, or sputtered thin films. In this paper, we present two methodologies which have been developed to facilitate the preparation of electron-transparent samples from conventional bulk metals and alloys for in situ liquid/gaseous cell S/TEM experiments. These methods take advantage of combining sequential electrochemical jet polishing followed by focused ion beam extraction techniques to create large electron-transparent areas for site-specific observation. As an example, we illustrate the application of this methodology for the preparation of in situ specimens from a cold-rolled Type 304 austenitic stainless steel sample, which was subsequently examined in both 1 atm of air as well as fully immersed in a H2O environment in the S/TEM followed by hyperspectral imaging. These preparation techniques can be successfully applied as a general procedure for a wide range of metals and alloys, and are suitable for a variety of in situ analytical S/TEM studies in both aqueous and gaseous environments.

Towards the low-dose characterization of beam sensitive nanostructures via implementation of sparse image acquisition in scanning transmission electron microscopy

International Nuclear Information System (INIS)

Hwang, Sunghwan; Han, Chang Wan; Ortalan, Volkan; Venkatakrishnan, Singanallur V; Bouman, Charles A

2017-01-01

Scanning transmission electron microscopy (STEM) has been successfully utilized to investigate atomic structure and chemistry of materials with atomic resolution. However, STEM’s focused electron probe with a high current density causes the electron beam damages including radiolysis and knock-on damage when the focused probe is exposed onto the electron-beam sensitive materials. Therefore, it is highly desirable to decrease the electron dose used in STEM for the investigation of biological/organic molecules, soft materials and nanomaterials in general. With the recent emergence of novel sparse signal processing theories, such as compressive sensing and model-based iterative reconstruction, possibilities of operating STEM under a sparse acquisition scheme to reduce the electron dose have been opened up. In this paper, we report our recent approach to implement a sparse acquisition in STEM mode executed by a random sparse-scan and a signal processing algorithm called model-based iterative reconstruction (MBIR). In this method, a small portion, such as 5% of randomly chosen unit sampling areas (i.e. electron probe positions), which corresponds to pixels of a STEM image, within the region of interest (ROI) of the specimen are scanned with an electron probe to obtain a sparse image. Sparse images are then reconstructed using the MBIR inpainting algorithm to produce an image of the specimen at the original resolution that is consistent with an image obtained using conventional scanning methods. Experimental results for down to 5% sampling show consistency with the full STEM image acquired by the conventional scanning method. Although, practical limitations of the conventional STEM instruments, such as internal delays of the STEM control electronics and the continuous electron gun emission, currently hinder to achieve the full potential of the sparse acquisition STEM in realizing the low dose imaging condition required for the investigation of beam-sensitive materials

Transmission electron microscopy characterization of microstructural features in aluminum-lithium-copper alloys

Science.gov (United States)

Avalos-Borja, M.; Larson, L. A.; Pizzo, P. P.

1984-01-01

A transmission electron microscopy (TEM) examination of aluminum-lithium-copper alloys was conducted. The principal purpose is to characterize the nature, size, and distribution of stringer particles which result from the powder metallurgy (P/M) processing of these alloys. Microstructural features associated with the stringer particles are reported that help explain the stress corrosion susceptibility of the powder metallurgy-processed Al-Li-Cu alloys. In addition, matrix precipitaton events are documented for a variety of heat treatments and process variations. Hot rolling is observed to significantly alter the nature of matrix precipitation, and the observations are correlated with concomitant mechanical property variations.

Transmission electron microscopy study of dislocation motion in icosahedral Al-Pd-Mn

International Nuclear Information System (INIS)

Mompiou, F.; Caillard, D.

2005-01-01

Perfect and imperfect dislocations trailing phason faults in quasi-crystals are introduced using a simplified two-dimensional aperiodic structure. Then, on the basis of observations of deformed specimens as well as in situ experiments in a transmission electron microscope, the motion of dislocations in icosahedral Al-Pd-Mn is shown to take place exclusively by climb. Under such conditions, the very high brittleness of Al-Pd-Mn at low and medium temperatures is proposed to be a consequence of the difficulty of glide, which itself appears to be an intrinsic property of the quasi-crystalline structure

Development of a high brightness ultrafast Transmission Electron Microscope based on a laser-driven cold field emission source.

Science.gov (United States)

Houdellier, F; Caruso, G M; Weber, S; Kociak, M; Arbouet, A

2018-03-01

We report on the development of an ultrafast Transmission Electron Microscope based on a cold field emission source which can operate in either DC or ultrafast mode. Electron emission from a tungsten nanotip is triggered by femtosecond laser pulses which are tightly focused by optical components integrated inside a cold field emission source close to the cathode. The properties of the electron probe (brightness, angular current density, stability) are quantitatively determined. The measured brightness is the largest reported so far for UTEMs. Examples of imaging, diffraction and spectroscopy using ultrashort electron pulses are given. Finally, the potential of this instrument is illustrated by performing electron holography in the off-axis configuration using ultrashort electron pulses. Copyright © 2017 Elsevier B.V. All rights reserved.

Physical methods for studying minerals and solid materials: X-ray, electron and neutron diffraction; scanning and transmission electron microscopy; X-ray, electron and ion spectrometry

International Nuclear Information System (INIS)

Eberhart, J.-P.

1976-01-01

The following topics are discussed: theoretical aspects of radiation-matter interactions; production and measurement of radiations (X rays, electrons, neutrons); applications of radiation interactions to the study of crystalline materials. The following techniques are presented: X-ray and neutron diffraction, electron microscopy, electron diffraction, X-ray fluorescence analysis, electron probe microanalysis, surface analysis by electron emission spectrometry (ESCA and Auger electrons), scanning electron microscopy, secondary ion emission analysis [fr

Electron and bremsstrahlung penetration and dose calculation

Science.gov (United States)

Watts, J. W., Jr.; Burrell, M. O.

1972-01-01

Various techniques for the calculation of electron and bremsstrahlung dose deposition are described. Energy deposition, transmission, and reflection coefficients for electrons incident on plane slabs are presented, and methods for their use in electron dose calculations were developed. A method using the straight-ahead approximation was also developed, and the various methods were compared and found to be in good agreement. Both accurate and approximate methods of calculating bremsstrahlung dose were derived and compared. Approximation is found to give a good estimate of dose where the electron spectrum falls off exponentially with energy.

High-resolution visualization of Pseudomonas aeruginosa PAO1 biofilms by freeze-substitution transmission electron microscopy.

Science.gov (United States)

Hunter, Ryan C; Beveridge, Terry J

2005-11-01

High-pressure freeze-substitution and transmission electron microscopy have been used for high-resolution imaging of the natural structure of a gram-negative biofilm. Unlike more conventional embedding techniques, this method confirms many of the observations seen by confocal microscopy but with finer structural detail. It further reveals that there is a structural complexity to biofilms at both the cellular and extracellular matrix levels that has not been seen before. Different domains of healthy and lysed cells exist randomly dispersed within a single biofilm as well as different structural organizations of exopolymers. Particulate matter is suspended within this network of fibers and appears to be an integral part of the exopolymeric substance (EPS). O-side chains extending from the outer membrane are integrated into EPS polymers so as to form a continuum. Together, the results support the concept of physical microenvironments within biofilms and show a complexity that was hitherto unknown.

Transmission electron microscopy studies of C3N4H4 treated at high pressure and high temperature

International Nuclear Information System (INIS)

Yu, R C; Chen, L C; Zhu, J L; Li, F Y; Liu, Z X; Qin, Z C; Yu, T N; Jin, C Q; Duan, X F; Zhang, Z

2002-01-01

C 3 N 4 H 4 was treated at 6.0 GPa and 1500 deg C for 2.5 min. Powder x-ray measurement shows that the sample is decomposed and a hexagonal graphite phase forms. Transmission electron microscopy studies show that small amounts of diamond and amorphous carbon phase coexist with the graphite phase. Parallel electron energy-loss spectroscopy analysis was also carried out for these phases

Transmission electron microscopy studies on nanometer-sized ω phase produced in Gum Metal

International Nuclear Information System (INIS)

Yano, Takaaki; Murakami, Yasukazu; Shindo, Daisuke; Hayasaka, Yuichiro; Kuramoto, Shigeru

2010-01-01

The morphology, numerical density and average spacing of the ω phase formed in Gum Metal, a Ti-based alloy showing unique mechanical properties, were studied by transmission electron microscopy. Based on dark-field image observations and precise thickness measurements using a thin-foil specimen, the average spacing of the nanometer-sized ω phase was determined to be 6 nm. This spacing appeared to be sufficiently small for trapping dislocations. The results are discussed in conjunction with the dislocation-free deformation mechanism proposed for Gum Metal.

Transmission Electron Microscopy of Itokawa Regolith Grains

Science.gov (United States)

Keller, Lindsay P.; Berger, E. L.

2013-01-01

Introduction: In a remarkable engineering achievement, the JAXA space agency successfully recovered the Hayabusa space-craft in June 2010, following a non-optimal encounter and sur-face sampling mission to asteroid 25143 Itokawa. These are the first direct samples ever obtained and returned from the surface of an asteroid. The Hayabusa samples thus present a special op-portunity to directly investigate the evolution of asteroidal sur-faces, from the development of the regolith to the study of the effects of space weathering. Here we report on our preliminary TEM measurements on two Itokawa samples. Methods: We were allocated particles RA-QD02-0125 and RA-QD02-0211. Both particles were embedded in low viscosity epoxy and thin sections were prepared using ultramicrotomy. High resolution images and electron diffraction data were ob-tained using a JEOL 2500SE 200 kV field-emission scanning-transmission electron microscope. Quantitative maps and anal-yses were obtained using a Thermo thin-window energy-dispersive x-ray (EDX) spectrometer. Results: Both particles are olivine-rich (Fo70) with µm-sized inclusions of FeS and have microstructurally complex rims. Par-ticle RA-QD02-0125 is rounded and has numerous sub-µm grains attached to its surface including FeS, albite, olivine, and rare melt droplets. Solar flare tracks have not been observed, but the particle is surrounded by a continuous 50 nm thick, stuctur-ally disordered rim that is compositionally similar to the core of the grain. One of the surface adhering grains is pyrrhotite show-ing a S-depleted rim (8-10 nm thick) with nanophase Fe metal grains (<5 nm) decorating the outermost surface. The pyrrhotite displays a complex superstructure in its core that is absent in the S-depleted rim. Particle RA-QD02-0211 contains solar flare particle tracks (2x109 cm-2) and shows a structurally disordered rim 100 nm thick. The track density corresponds to a surface exposure of 103-104 years based on the track production rate

Transmission electron microscopy of weakly deformed alkali halide crystals

International Nuclear Information System (INIS)

Strunk, H.

1976-01-01

Transmission electron microscopy (TEM) is applied to the investigation of the dislocation arrangement of [001]-orientated alkali halide crystals (orientation four quadruple slip) deformed into stage I of the work-hardenig curve. The investigations pertain mainly to NaCl - (0.1-1) mole-% NaBr crystals, because these exhibit a relatively long stage I. The time available for observing the specimens is limited by the ionization radiation damage occuring in the microscope. An optimum reduction of the damage rate is achieved by a combination of several experimental techniques that are briefly outlined. The crystals deform essentially in single glide. According to the observations, stage I deformation of pure and weakly alloyed NaCl crystals is characterized by the glide of screw dislocations, which bow out between jogs and drag dislocation dipoles behind them. In crystals with >= 0.5 mole-% NaBr this process is not observed to occur. This is attributed to the increased importance of solid solution hardening. (orig.) [de

Unravelling surface and interfacial structures of a metal–organic framework by transmission electron microscopy

KAUST Repository

Zhu, Yihan

2017-02-21

Metal–organic frameworks (MOFs) are crystalline porous materials with designable topology, porosity and functionality, having promising applications in gas storage and separation, ion conduction and catalysis1, 2, 3. It is challenging to observe MOFs with transmission electron microscopy (TEM) due to the extreme instability of MOFs upon electron beam irradiation4, 5, 6, 7. Here, we use a direct-detection electron-counting camera to acquire TEM images of the MOF ZIF-8 with an ultralow dose of 4.1 electrons per square ångström to retain the structural integrity. The obtained image involves structural information transferred up to 2.1 Å, allowing the resolution of individual atomic columns of Zn and organic linkers in the framework. Furthermore, TEM reveals important local structural features of ZIF-8 crystals that cannot be identified by diffraction techniques, including armchair-type surface terminations and coherent interfaces between assembled crystals. These observations allow us to understand how ZIF-8 crystals self-assemble and the subsequent influence of interfacial cavities on mass transport of guest molecules.

Structural investigations on nanocrystalline Ni-W alloy films by transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Klimenkov, M. [Institut fuer Materialforschung, Forschungszentrum Karlsruhe, 76021 Karlsruhe (Germany); Haseeb, A.S.M.A. [Department of Mechanical Engineering, University of Malaya, 50603 Kuala Lumpur (Malaysia); Bade, K., E-mail: klaus.bade@imt.fzk.d [Institut fuer Mikrostrukturtechnik, Forschungszentrum Karlsruhe, 76021 Karlsruhe (Germany)

2009-10-30

Electrodeposited Ni-W alloys have been investigated in the as-deposited state by transmission electron microscopy in order to investigate the microstructural features in dependence of the tungsten content. Within the tungsten content range from 7 at.% up to 12 at.%, the microstructure is nanocrystalline characterized by a bimodal grain size distribution, consisting out of 20 to 200 nm sized grains and also larger grains with several 100 nm characteristic dimension. No clear trend in microstructure formation is visible with W content or deposition conditions in the investigated W content range. Only solid solution phase characteristics were observed. The lattice constant is 0.360 nm for 12 at.% W as derived from electron diffraction for the solid solution face centered cubic structure. Larger grains show twinning and stacking faults. Voids with diameter of a few nm were detected along with some multiple twinned particles, indicating high stress level during growth. About 2 at.% difference in the alloy composition from grain to grain was measured.

Method for local temperature measurement in a nanoreactor for in situ high-resolution electron microscopy.

Science.gov (United States)

Vendelbo, S B; Kooyman, P J; Creemer, J F; Morana, B; Mele, L; Dona, P; Nelissen, B J; Helveg, S

2013-10-01

In situ high-resolution transmission electron microscopy (TEM) of solids under reactive gas conditions can be facilitated by microelectromechanical system devices called nanoreactors. These nanoreactors are windowed cells containing nanoliter volumes of gas at ambient pressures and elevated temperatures. However, due to the high spatial confinement of the reaction environment, traditional methods for measuring process parameters, such as the local temperature, are difficult to apply. To address this issue, we devise an electron energy loss spectroscopy (EELS) method that probes the local temperature of the reaction volume under inspection by the electron beam. The local gas density, as measured using quantitative EELS, is combined with the inherent relation between gas density and temperature, as described by the ideal gas law, to obtain the local temperature. Using this method we determined the temperature gradient in a nanoreactor in situ, while the average, global temperature was monitored by a traditional measurement of the electrical resistivity of the heater. The local gas temperatures had a maximum of 56 °C deviation from the global heater values under the applied conditions. The local temperatures, obtained with the proposed method, are in good agreement with predictions from an analytical model. Copyright © 2013 Elsevier B.V. All rights reserved.

Growth Termination and Multiple Nucleation of Single-Wall Carbon Nanotubes Evidenced by in Situ Transmission Electron Microscopy

DEFF Research Database (Denmark)

Zhang, Lili; He, Maoshuai; Hansen, Thomas Willum

2017-01-01

and successive growth of additional SWCNTs on Co catalyst particles supported on MgO by means of environmental transmission electron microscopy. Such in situ observations reveal the plethora of solid carbon formations at the local scale while it is happening and thereby elucidate the multitude of configurations...

Transmission electron microscopy study of microstructural evolution in nanograined Ni-Ti microwires heat treated by electric pulse

Czech Academy of Sciences Publication Activity Database

Delville, R.; Malard, B.; Pilch, Jan; Šittner, Petr; Schryvers, D.

172-174, č. 6 (2011), s. 682-687 ISSN 1012-0394 R&D Projects: GA MŠk(CZ) LA10010 Institutional research plan: CEZ:AV0Z10100520 Keywords : transmission electron microscopy * shape memory alloy * martensitic transformation * dislocation slip * nanograins Subject RIV: BM - Solid Matter Physics ; Magnetism

Study of microstructural evolution in friction-stir welded thin-sheet Al-Cu-Li alloy using transmission-electron microscopy

International Nuclear Information System (INIS)

Shukla, A.K.; Baeslack, W.A.

2007-01-01

Microstructure evolution in friction-stir welded thin-sheet Al-Cu-Li alloy was studied using transmission-electron microscopy (TEM) and the dissolution and coarsening of T 1 and θ' precipitates were related to the microhardness profile of the weld

Acquisition parameters optimization of a transmission electron forward scatter diffraction system in a cold-field emission scanning electron microscope for nanomaterials characterization.

Science.gov (United States)

Brodusch, Nicolas; Demers, Hendrix; Trudeau, Michel; Gauvin, Raynald

2013-01-01

Transmission electron forward scatter diffraction (t-EFSD) is a new technique providing crystallographic information with high resolution on thin specimens by using a conventional electron backscatter diffraction (EBSD) system in a scanning electron microscope. In this study, the impact of tilt angle, working distance, and detector distance on the Kikuchi pattern quality were investigated in a cold-field emission scanning electron microscope (CFE-SEM). We demonstrated that t-EFSD is applicable for tilt angles ranging from -20° to -40°. Working distance (WD) should be optimized for each material by choosing the WD for which the EBSD camera screen illumination is the highest, as the number of detected electrons on the screen is directly dependent on the scattering angle. To take advantage of the best performances of the CFE-SEM, the EBSD camera should be close to the sample and oriented towards the bottom to increase forward scattered electron collection efficiency. However, specimen chamber cluttering and beam/mechanical drift are important limitations in the CFE-SEM used in this work. Finally, the importance of t-EFSD in materials science characterization was illustrated through three examples of phase identification and orientation mapping. © Wiley Periodicals, Inc.

Transmission spectra of electrons through the Thue-Morse graphene superlattice

International Nuclear Information System (INIS)

Korol', A.M.

2014-01-01

The transmission spectra of the Thue-Morse superlattice (SL) based on a monolayer gapped graphene are investigated. The SL consists of rectangular barriers located along the Ox axis. The Thue-Morse aperiodic modulation is proposed to be realized due to the difference in values of the gap width in different SL elements. It is shown that the effective splitting of the allowed bands (and thereby the arising of a series of gaps) is observed under the influence of the aperiodic factor in the case of normal incidence of the electron wave on the SL as well as in the case of oblique incidence. The spectra are periodical with potential barrier height. In some regions of the spectra, the splitting of bands is subjected to the Fibonacci inflation rule in every new Thue-Morse generation. As in the periodical graphene-based SL, in every Thue-Morse sequence a superlattice Dirac point is created. The width of the gap associated with this point depends on SL parameters substantially; at the same time the energy location of this gap depends weakly on mass term in the Hamiltonian and it does not depend on SL period. The spectra dependence on the angle of electron wave incidence is not substantial

The examination of calcium ion implanted alumina with energy filtered transmission electron microscopy

International Nuclear Information System (INIS)

Hunt, E.M.; Hampikian, J.M.

1997-01-01

Ion implantation can be used to alter in the optical response of insulators through the formation of embedded nano-sized particles. Single crystal alumina has been implanted at ambient temperature with 50 keV Ca + to a fluence of 5 x 10 16 ions/cm 2 . Ion channeling, Knoop microhardness measurements, and transmission electron microscopy (TEM) indicate that the alumina surface layer was amorphized by the implant. TEM also revealed nano-sized crystals ∼7--8 nm in diameter. These nanocrystals are randomly oriented, and exhibit a face-centered cubic structure (FCC) with a lattice parameter of 0.409 nm ± 0.002 nm. The similarity between this crystallography and that of pure aluminum suggests that they are metallic aluminum nanocrystals with a slightly dilated lattice parameter, possibly due to the incorporation of a small amount of calcium. Energy-filtered transmission electron microscopy (EFTEM) provides an avenue by which to confirm the metallic nature of the aluminum involved in the nanocrystals. EFTEM has confirmed that the aluminum present in the particles is metallic in nature, that the particles are oxygen deficient in comparison with the matrix material and that the particles are deficient in calcium, and therefore not likely to be calcia. The particles thus appear to be FCC Al (possibly alloyed with a few percent Ca) with a lattice parameter of 0.409nm. A similar result was obtained for yttrium ion implantation into alumina

Cryo-Scanning Electron Microscopy (SEM) and Scanning Transmission Electron Microscopy (STEM)-in-SEM for Bio- and Organo-Mineral Interface Characterization in the Environment.

Science.gov (United States)

Wille, Guillaume; Hellal, Jennifer; Ollivier, Patrick; Richard, Annie; Burel, Agnes; Jolly, Louis; Crampon, Marc; Michel, Caroline

2017-12-01

Understanding biofilm interactions with surrounding substratum and pollutants/particles can benefit from the application of existing microscopy tools. Using the example of biofilm interactions with zero-valent iron nanoparticles (nZVI), this study aims to apply various approaches in biofilm preparation and labeling for fluorescent or electron microscopy and energy dispersive X-ray spectrometry (EDS) microanalysis for accurate observations. According to the targeted microscopy method, biofilms were sampled as flocs or attached biofilm, submitted to labeling using 4',6-diamidino-2-phenylindol, lectins PNA and ConA coupled to fluorescent dye or gold nanoparticles, and prepared for observation (fixation, cross-section, freezing, ultramicrotomy). Fluorescent microscopy revealed that nZVI were embedded in the biofilm structure as aggregates but the resolution was insufficient to observe individual nZVI. Cryo-scanning electron microscopy (SEM) observations showed nZVI aggregates close to bacteria, but it was not possible to confirm direct interactions between nZVI and cell membranes. Scanning transmission electron microscopy in the SEM (STEM-in-SEM) showed that nZVI aggregates could enter the biofilm to a depth of 7-11 µm. Bacteria were surrounded by a ring of extracellular polymeric substances (EPS) preventing direct nZVI/membrane interactions. STEM/EDS mapping revealed a co-localization of nZVI aggregates with lectins suggesting a potential role of EPS in nZVI embedding. Thus, the combination of divergent microscopy approaches is a good approach to better understand and characterize biofilm/metal interactions.

Alignment of large image series using cubic B-splines tessellation: application to transmission electron microscopy data.

Science.gov (United States)

Dauguet, Julien; Bock, Davi; Reid, R Clay; Warfield, Simon K

2007-01-01

3D reconstruction from serial 2D microscopy images depends on non-linear alignment of serial sections. For some structures, such as the neuronal circuitry of the brain, very large images at very high resolution are necessary to permit reconstruction. These very large images prevent the direct use of classical registration methods. We propose in this work a method to deal with the non-linear alignment of arbitrarily large 2D images using the finite support properties of cubic B-splines. After initial affine alignment, each large image is split into a grid of smaller overlapping sub-images, which are individually registered using cubic B-splines transformations. Inside the overlapping regions between neighboring sub-images, the coefficients of the knots controlling the B-splines deformations are blended, to create a virtual large grid of knots for the whole image. The sub-images are resampled individually, using the new coefficients, and assembled together into a final large aligned image. We evaluated the method on a series of large transmission electron microscopy images and our results indicate significant improvements compared to both manual and affine alignment.

Studying the Kinetics of Crystalline Silicon Nanoparticle Lithiation with In Situ Transmission Electron Microscopy

KAUST Repository

McDowell, Matthew T.; Ryu, Ill; Lee, Seok Woo; Wang, Chongmin; Nix, William D.; Cui, Yi

2012-01-01

In situ transmission electron microscopy (TEM) is used to study the electrochemical lithiation of high-capacity crystalline Si nanoparticles for use in Li-ion battery anodes. The lithiation reaction slows down as it progresses into the particle interior, and analysis suggests that this behavior is due not to diffusion limitation but instead to the influence of mechanical stress on the driving force for reaction. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Studying the Kinetics of Crystalline Silicon Nanoparticle Lithiation with In Situ Transmission Electron Microscopy

KAUST Repository

McDowell, Matthew T.

2012-09-04

In situ transmission electron microscopy (TEM) is used to study the electrochemical lithiation of high-capacity crystalline Si nanoparticles for use in Li-ion battery anodes. The lithiation reaction slows down as it progresses into the particle interior, and analysis suggests that this behavior is due not to diffusion limitation but instead to the influence of mechanical stress on the driving force for reaction. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Measurement of the penetration depth and coherence length of MgB2 in all directions using transmission electron microscopy

DEFF Research Database (Denmark)

Loudon, J. C.; Yazdi, Sadegh; Kasama, Takeshi

2015-01-01

We demonstrate that images of flux vortices in a superconductor taken with a transmission electron microscope can be used to measure the penetration depth and coherence length in all directions at the same temperature and magnetic field. This is particularly useful for MgB2, where these quantities...... vary with the applied magnetic field and values are difficult to obtain at low field or in the c direction. We obtained images of flux vortices from a MgB2 single crystal cut in the ac plane by focused ion beam milling and tilted to 45 degrees. with respect to the electron beam about...... the crystallographic a axis. A new method was developed to simulate these images that accounted for vortices with a nonzero core in a thin, anisotropic superconductor and a simplex algorithm was used to make a quantitative comparison between the images and simulations to measure the penetration depths and coherence...

Understanding the structure of nanocatalysts with high resolution scanning/transmission electron microscopy

International Nuclear Information System (INIS)

Francis, L D; Rivas, J; José-Yacamán, M

2014-01-01

Nanomaterials including nanoparticles, nanowires and nanotubes play an important role in heterogeneous catalysis. Thanks to the rapid improvement of the electron microscopic techniques and with the advent of aberration corrected electron microscopy as well as theoretical methodologies, the potential effects induced by nanocatalysts are better understood than before by unravelling their atomic structure. A brief introduction to advanced electron microscopic techniques namely aberration corrected scanning transmission electron microscopy (Cs-STEM) is presented and subsequently two examples of nanocatalysts are considered in the present review. The first example will focus on the study of bimetallic/core-shell nanoalloys. In heterogeneous catalysis, catalysts containing two or more metals might show significantly different catalytic properties compared to the parent metals and thus are widely utilized in several catalytic reactions. Atom-by-atom insights of the nanoalloy based catalysts ex: Au-Pd will be described in the present review using a combination of advanced electron microscopic and spectroscopic techniques. A related example on the understanding of bimetallic clusters by HAADF-STEM will also be presented in addition to nanoparticles. In the second case understanding the structure of transition metal chalcogenide based nanocatalysts by HRTEM and aberration corrected STEM, for the case of MoS 2 will be discussed. MoS 2 -based catalysts serve as model catalysts and are employed in the hydrodesulphurisations (HDS) reactions in the removal of sulphur from gasoline and related petrochemical products. They have been studied in various forms including nanowires, nanotubes and nanoplates. Their structure, atomic insights and as a consequence elucidation of their corresponding catalytic activity are thus important

In situ Reduction and Oxidation of Nickel from Solid Oxide Fuel Cells in a Transmission Electron Microscope

DEFF Research Database (Denmark)

Faes, Antonin; Jeangros, Quentin; Wagner, Jakob Birkedal

2009-01-01

Environmental transmission electron microscopy was used to characterize in situ the reduction and oxidation of nickel from a Ni/YSZ solid oxide fuel cell anode support between 300-500{degree sign}C. The reduction is done under low hydrogen pressure. The reduction initiates at the NiO/YSZ interface...

Multiscale phase mapping of LiFePO4-based electrodes by transmission electron microscopy and electron forward scattering diffraction.

Science.gov (United States)

Robert, Donatien; Douillard, Thierry; Boulineau, Adrien; Brunetti, Guillaume; Nowakowski, Pawel; Venet, Denis; Bayle-Guillemaud, Pascale; Cayron, Cyril

2013-12-23

LiFePO4 and FePO4 phase distributions of entire cross-sectioned electrodes with various Li content are investigated from nanoscale to mesoscale, by transmission electron microscopy and by the new electron forward scattering diffraction technique. The distributions of the fully delithiated (FePO4) or lithiated particles (LiFePO4) are mapped on large fields of view (>100 × 100 μm(2)). Heterogeneities in thin and thick electrodes are highlighted at different scales. At the nanoscale, the statistical analysis of 64 000 particles unambiguously shows that the small particles delithiate first. At the mesoscale, the phase maps reveal a core-shell mechanism at the scale of the agglomerates with a preferential pathway along the electrode porosities. At larger scale, lithiation occurs in thick electrodes "stratum by stratum" from the surface in contact with electrolyte toward the current collector.

Study on the crystallization of the metal glass with the ferromagnetic resonance and transmission electron microscopy techniques

International Nuclear Information System (INIS)

Biasi, R.S. de; Rodrigues, R.W.D.; Pascual, R.; Pessoa, C.S.

1983-01-01

The crystallization of the metal glass METGLAS 2826A has been studied with the ferromagnetic resonance and electron transmission microscopy techniques. The first-derivative linewidth of the absorption curve was measured for several times of isothermal treatments at 375 0 C. After an initial decrease, attributed to stress relaxation, the linewidth increases linearly with the transformed fraction of the first crystallization phase. Comparison with the electron microscopy results shows that the ferromagnetic resonance technique is particularly useful for short and medium aging times. (Author) [pt

Probing plasmons in three dimensions by combining complementary spectroscopies in a scanning transmission electron microscope

International Nuclear Information System (INIS)

Hachtel, J A; Haglund, R F; Pantelides, S T; Marvinney, C; Mayo, D; Mouti, A; Lupini, A R; Chisholm, M F; Mu, R; Pennycook, S J

2016-01-01

The nanoscale optical response of surface plasmons in three-dimensional metallic nanostructures plays an important role in many nanotechnology applications, where precise spatial and spectral characteristics of plasmonic elements control device performance. Electron energy loss spectroscopy (EELS) and cathodoluminescence (CL) within a scanning transmission electron microscope have proven to be valuable tools for studying plasmonics at the nanoscale. Each technique has been used separately, producing three-dimensional reconstructions through tomography, often aided by simulations for complete characterization. Here we demonstrate that the complementary nature of the two techniques, namely that EELS probes beam-induced electronic excitations while CL probes radiative decay, allows us to directly obtain a spatially- and spectrally-resolved picture of the plasmonic characteristics of nanostructures in three dimensions. The approach enables nanoparticle-by-nanoparticle plasmonic analysis in three dimensions to aid in the design of diverse nanoplasmonic applications. (paper)

The method of fundamental solutions for computing acoustic interior transmission eigenvalues