WorldWideScience

Sample records for methods provide similar

  1. A Similarity-Ranking Method on Semantic Computing for Providing Information-Services in Station-Concierge System

    Directory of Open Access Journals (Sweden)

    Motoki Yokoyama

    2017-07-01

    Full Text Available The prevalence of smartphones and wireless broadband networks have been progressing as a new Railway infomration environment. According to the spread of such devices and information technology, various types of information can be obtained from databases connected to the Internet. One scenario of obtaining such a wide variety of information resources is in the phase of user’s transportation. This paper proposes an information provision system, named the Station Concierge System that matches the situation and intention of passengers. The purpose of this system is to estimate the needs of passengers like station staff or hotel concierge and to provide information resources that satisfy user’s expectations dynamically. The most important module of the system is constructed based on a new information ranking method for passenger intention prediction and service recommendation. This method has three main features, which are (1 projecting a user to semantic vector space by using her current context, (2 predicting the intention of a user based on selecting a semantic vector subspace, and (3 ranking the services by a descending order of relevant scores to the user’ intention. By comparing the predicted results of our method with those of two straightforward computation methods, the experimental studies show the effectiveness and efficiency of the proposed method. Using this system, users can obtain transit information and service map that dynamically matches their context.

  2. A method for analyzing the business case for provider participation in the National Cancer Institute's Community Clinical Oncology Program and similar federally funded, provider-based research networks.

    Science.gov (United States)

    Reiter, Kristin L; Song, Paula H; Minasian, Lori; Good, Marjorie; Weiner, Bryan J; McAlearney, Ann Scheck

    2012-09-01

    The Community Clinical Oncology Program (CCOP) plays an essential role in the efforts of the National Cancer Institute (NCI) to increase enrollment in clinical trials. Currently, there is little practical guidance in the literature to assist provider organizations in analyzing the return on investment (ROI), or business case, for establishing and operating a provider-based research network (PBRN) such as the CCOP. In this article, the authors present a conceptual model of the business case for PBRN participation, a spreadsheet-based tool and advice for evaluating the business case for provider participation in a CCOP organization. A comparative, case-study approach was used to identify key components of the business case for hospitals attempting to support a CCOP research infrastructure. Semistructured interviews were conducted with providers and administrators. Key themes were identified and used to develop the financial analysis tool. Key components of the business case included CCOP start-up costs, direct revenue from the NCI CCOP grant, direct expenses required to maintain the CCOP research infrastructure, and incidental benefits, most notably downstream revenues from CCOP patients. The authors recognized the value of incidental benefits as an important contributor to the business case for CCOP participation; however, currently, this component is not calculated. The current results indicated that providing a method for documenting the business case for CCOP or other PBRN involvement will contribute to the long-term sustainability and expansion of these programs by improving providers' understanding of the financial implications of participation. Copyright © 2011 American Cancer Society.

  3. Statistical modelling and RCS detrending methods provide similar estimates of long-term trend in radial growth of common beech in north-eastern France

    OpenAIRE

    Bontemps , Jean-Daniel; Esper , Jan

    2011-01-01

    International audience; Dendrochronological methods have greatly contributed to the documentation of past long-term trends in forest growth. These methods primarily focus on the high-frequency signals of tree ring chronologies. They require the removal of the ageing trend in tree growth, known as 'standardisation' or 'detrending', as a prerequisite to the estimation of such trends. Because the approach is sequential, it may however absorb part of the low-frequency historical signal. In this s...

  4. Facilitating Navigation in Quality Manuals by Providing Bookmarks or Similar

    International Nuclear Information System (INIS)

    Shaharum bin Ramli

    2012-01-01

    Nuclear Malaysia level quality manuals need to be shared with all divisions. A manual is usually distributed in the form of an electronic document that contains all procedures. Navigation from one heading or procedure to another should be facilitated by providing bookmarks or similar. This paper shows how to do it for Microsoft Word and PDF documents. (author)

  5. Scalar Similarity for Relaxed Eddy Accumulation Methods

    Science.gov (United States)

    Ruppert, Johannes; Thomas, Christoph; Foken, Thomas

    2006-07-01

    The relaxed eddy accumulation (REA) method allows the measurement of trace gas fluxes when no fast sensors are available for eddy covariance measurements. The flux parameterisation used in REA is based on the assumption of scalar similarity, i.e., similarity of the turbulent exchange of two scalar quantities. In this study changes in scalar similarity between carbon dioxide, sonic temperature and water vapour were assessed using scalar correlation coefficients and spectral analysis. The influence on REA measurements was assessed by simulation. The evaluation is based on observations over grassland, irrigated cotton plantation and spruce forest. Scalar similarity between carbon dioxide, sonic temperature and water vapour showed a distinct diurnal pattern and change within the day. Poor scalar similarity was found to be linked to dissimilarities in the energy contained in the low frequency part of the turbulent spectra ( definition.

  6. Incentives and provider payment methods.

    Science.gov (United States)

    Barnum, H; Kutzin, J; Saxenian, H

    1995-01-01

    The mode of payment creates powerful incentives affecting provider behavior and the efficiency, equity and quality outcomes of health finance reforms. This article examines provider incentives as well as administrative costs, and institutional conditions for successful implementation associated with provider payment alternatives. The alternatives considered are budget reforms, capitation, fee-for-service, and case-based reimbursement. We conclude that competition, whether through a regulated private sector or within a public system, has the potential to improve the performance of any payment method. All methods generate both adverse and beneficial incentives. Systems with mixed forms of provider payment can provide tradeoffs to offset the disadvantages of individual modes. Low-income countries should avoid complex payment systems requiring higher levels of institutional development.

  7. A Signal Processing Method to Explore Similarity in Protein Flexibility

    Directory of Open Access Journals (Sweden)

    Simina Vasilache

    2010-01-01

    Full Text Available Understanding mechanisms of protein flexibility is of great importance to structural biology. The ability to detect similarities between proteins and their patterns is vital in discovering new information about unknown protein functions. A Distance Constraint Model (DCM provides a means to generate a variety of flexibility measures based on a given protein structure. Although information about mechanical properties of flexibility is critical for understanding protein function for a given protein, the question of whether certain characteristics are shared across homologous proteins is difficult to assess. For a proper assessment, a quantified measure of similarity is necessary. This paper begins to explore image processing techniques to quantify similarities in signals and images that characterize protein flexibility. The dataset considered here consists of three different families of proteins, with three proteins in each family. The similarities and differences found within flexibility measures across homologous proteins do not align with sequence-based evolutionary methods.

  8. Assessing semantic similarity of texts - Methods and algorithms

    Science.gov (United States)

    Rozeva, Anna; Zerkova, Silvia

    2017-12-01

    Assessing the semantic similarity of texts is an important part of different text-related applications like educational systems, information retrieval, text summarization, etc. This task is performed by sophisticated analysis, which implements text-mining techniques. Text mining involves several pre-processing steps, which provide for obtaining structured representative model of the documents in a corpus by means of extracting and selecting the features, characterizing their content. Generally the model is vector-based and enables further analysis with knowledge discovery approaches. Algorithms and measures are used for assessing texts at syntactical and semantic level. An important text-mining method and similarity measure is latent semantic analysis (LSA). It provides for reducing the dimensionality of the document vector space and better capturing the text semantics. The mathematical background of LSA for deriving the meaning of the words in a given text by exploring their co-occurrence is examined. The algorithm for obtaining the vector representation of words and their corresponding latent concepts in a reduced multidimensional space as well as similarity calculation are presented.

  9. Efficient data retrieval method for similar plasma waveforms in EAST

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ying, E-mail: liuying-ipp@szu.edu.cn [SZU-CASIPP Joint Laboratory for Applied Plasma, Shenzhen University, Shenzhen 518060 (China); Huang, Jianjun; Zhou, Huasheng; Wang, Fan [SZU-CASIPP Joint Laboratory for Applied Plasma, Shenzhen University, Shenzhen 518060 (China); Wang, Feng [Institute of Plasma Physics Chinese Academy of Sciences, Hefei 230031 (China)

    2016-11-15

    Highlights: • The proposed method is carried out by means of bounding envelope and angle distance. • It allows retrieving for whole similar waveforms of any time length. • In addition, the proposed method is also possible to retrieve subsequences. - Abstract: Fusion research relies highly on data analysis due to its massive-sized database. In the present work, we propose an efficient method for searching and retrieving similar plasma waveforms in Experimental Advanced Superconducting Tokamak (EAST). Based on Piecewise Linear Aggregate Approximation (PLAA) for extracting feature values, the searching process is accomplished in two steps. The first one is coarse searching to narrow down the search space, which is carried out by means of bounding envelope. The second step is fine searching to retrieval similar waveforms, which is implemented by the angle distance. The proposed method is tested in EAST databases and turns out to have good performance in retrieving similar waveforms.

  10. AREAL FEATURE MATCHING BASED ON SIMILARITY USING CRITIC METHOD

    Directory of Open Access Journals (Sweden)

    J. Kim

    2015-10-01

    Full Text Available In this paper, we propose an areal feature matching method that can be applied for many-to-many matching, which involves matching a simple entity with an aggregate of several polygons or two aggregates of several polygons with fewer user intervention. To this end, an affine transformation is applied to two datasets by using polygon pairs for which the building name is the same. Then, two datasets are overlaid with intersected polygon pairs that are selected as candidate matching pairs. If many polygons intersect at this time, we calculate the inclusion function between such polygons. When the value is more than 0.4, many of the polygons are aggregated as single polygons by using a convex hull. Finally, the shape similarity is calculated between the candidate pairs according to the linear sum of the weights computed in CRITIC method and the position similarity, shape ratio similarity, and overlap similarity. The candidate pairs for which the value of the shape similarity is more than 0.7 are determined as matching pairs. We applied the method to two geospatial datasets: the digital topographic map and the KAIS map in South Korea. As a result, the visual evaluation showed two polygons that had been well detected by using the proposed method. The statistical evaluation indicates that the proposed method is accurate when using our test dataset with a high F-measure of 0.91.

  11. Areal Feature Matching Based on Similarity Using Critic Method

    Science.gov (United States)

    Kim, J.; Yu, K.

    2015-10-01

    In this paper, we propose an areal feature matching method that can be applied for many-to-many matching, which involves matching a simple entity with an aggregate of several polygons or two aggregates of several polygons with fewer user intervention. To this end, an affine transformation is applied to two datasets by using polygon pairs for which the building name is the same. Then, two datasets are overlaid with intersected polygon pairs that are selected as candidate matching pairs. If many polygons intersect at this time, we calculate the inclusion function between such polygons. When the value is more than 0.4, many of the polygons are aggregated as single polygons by using a convex hull. Finally, the shape similarity is calculated between the candidate pairs according to the linear sum of the weights computed in CRITIC method and the position similarity, shape ratio similarity, and overlap similarity. The candidate pairs for which the value of the shape similarity is more than 0.7 are determined as matching pairs. We applied the method to two geospatial datasets: the digital topographic map and the KAIS map in South Korea. As a result, the visual evaluation showed two polygons that had been well detected by using the proposed method. The statistical evaluation indicates that the proposed method is accurate when using our test dataset with a high F-measure of 0.91.

  12. Information loss method to measure node similarity in networks

    Science.gov (United States)

    Li, Yongli; Luo, Peng; Wu, Chong

    2014-09-01

    Similarity measurement for the network node has been paid increasing attention in the field of statistical physics. In this paper, we propose an entropy-based information loss method to measure the node similarity. The whole model is established based on this idea that less information loss is caused by seeing two more similar nodes as the same. The proposed new method has relatively low algorithm complexity, making it less time-consuming and more efficient to deal with the large scale real-world network. In order to clarify its availability and accuracy, this new approach was compared with some other selected approaches on two artificial examples and synthetic networks. Furthermore, the proposed method is also successfully applied to predict the network evolution and predict the unknown nodes' attributions in the two application examples.

  13. A similarity measure method combining location feature for mammogram retrieval.

    Science.gov (United States)

    Wang, Zhiqiong; Xin, Junchang; Huang, Yukun; Li, Chen; Xu, Ling; Li, Yang; Zhang, Hao; Gu, Huizi; Qian, Wei

    2018-05-28

    Breast cancer, the most common malignancy among women, has a high mortality rate in clinical practice. Early detection, diagnosis and treatment can reduce the mortalities of breast cancer greatly. The method of mammogram retrieval can help doctors to find the early breast lesions effectively and determine a reasonable feature set for image similarity measure. This will improve the accuracy effectively for mammogram retrieval. This paper proposes a similarity measure method combining location feature for mammogram retrieval. Firstly, the images are pre-processed, the regions of interest are detected and the lesions are segmented in order to get the center point and radius of the lesions. Then, the method, namely Coherent Point Drift, is used for image registration with the pre-defined standard image. The center point and radius of the lesions after registration are obtained and the standard location feature of the image is constructed. This standard location feature can help figure out the location similarity between the image pair from the query image to each dataset image in the database. Next, the content feature of the image is extracted, including the Histogram of Oriented Gradients, the Edge Direction Histogram, the Local Binary Pattern and the Gray Level Histogram, and the image pair content similarity can be calculated using the Earth Mover's Distance. Finally, the location similarity and content similarity are fused to form the image fusion similarity, and the specified number of the most similar images can be returned according to it. In the experiment, 440 mammograms, which are from Chinese women in Northeast China, are used as the database. When fusing 40% lesion location feature similarity and 60% content feature similarity, the results have obvious advantages. At this time, precision is 0.83, recall is 0.76, comprehensive indicator is 0.79, satisfaction is 96.0%, mean is 4.2 and variance is 17.7. The results show that the precision and recall of this

  14. Structural similarities between brain and linguistic data provide evidence of semantic relations in the brain.

    Directory of Open Access Journals (Sweden)

    Colleen E Crangle

    Full Text Available This paper presents a new method of analysis by which structural similarities between brain data and linguistic data can be assessed at the semantic level. It shows how to measure the strength of these structural similarities and so determine the relatively better fit of the brain data with one semantic model over another. The first model is derived from WordNet, a lexical database of English compiled by language experts. The second is given by the corpus-based statistical technique of latent semantic analysis (LSA, which detects relations between words that are latent or hidden in text. The brain data are drawn from experiments in which statements about the geography of Europe were presented auditorily to participants who were asked to determine their truth or falsity while electroencephalographic (EEG recordings were made. The theoretical framework for the analysis of the brain and semantic data derives from axiomatizations of theories such as the theory of differences in utility preference. Using brain-data samples from individual trials time-locked to the presentation of each word, ordinal relations of similarity differences are computed for the brain data and for the linguistic data. In each case those relations that are invariant with respect to the brain and linguistic data, and are correlated with sufficient statistical strength, amount to structural similarities between the brain and linguistic data. Results show that many more statistically significant structural similarities can be found between the brain data and the WordNet-derived data than the LSA-derived data. The work reported here is placed within the context of other recent studies of semantics and the brain. The main contribution of this paper is the new method it presents for the study of semantics and the brain and the focus it permits on networks of relations detected in brain data and represented by a semantic model.

  15. A method for rapid similarity analysis of RNA secondary structures

    Directory of Open Access Journals (Sweden)

    Liu Na

    2006-11-01

    Full Text Available Abstract Background Owing to the rapid expansion of RNA structure databases in recent years, efficient methods for structure comparison are in demand for function prediction and evolutionary analysis. Usually, the similarity of RNA secondary structures is evaluated based on tree models and dynamic programming algorithms. We present here a new method for the similarity analysis of RNA secondary structures. Results Three sets of real data have been used as input for the example applications. Set I includes the structures from 5S rRNAs. Set II includes the secondary structures from RNase P and RNase MRP. Set III includes the structures from 16S rRNAs. Reasonable phylogenetic trees are derived for these three sets of data by using our method. Moreover, our program runs faster as compared to some existing ones. Conclusion The famous Lempel-Ziv algorithm can efficiently extract the information on repeated patterns encoded in RNA secondary structures and makes our method an alternative to analyze the similarity of RNA secondary structures. This method will also be useful to researchers who are interested in evolutionary analysis.

  16. Finding Similarities in Ancient Ceramics by EDXRF and Multivariate Methods

    International Nuclear Information System (INIS)

    Civici, N.; Stamati, F.

    1999-01-01

    We have studied 39 samples of fragments from ceramic roof tiles with different stamps(Diamalas and Heraion), dated between 330 to 170 BC and found at the archaeological site of Dimales, some 30 km from the Adriatic coast. The data from these samples were compared with those obtained from 7 samples of similar objects and period with the stamp H eraion , found at the archaeological site of APOLLONIA. The samples were analyzed by energy-dispersive X -ray fluorescence(EDXRF), using of the x-ray lines of the elements to the intensity of the Compton peak. The results have been treated with diverse multivariate methods. The application of hierarchical cluster analysis and factor analysis permitted the identification of two main clusters. The first cluster is composed from the ''Heraion'' samples discovered in Apollonia, while the second comprises all the samples discovered in Dimale independent of their stamp. (authors)

  17. Multicriteria decision-making method based on a cosine similarity ...

    African Journals Online (AJOL)

    the cosine similarity measure is often used in information retrieval, citation analysis, and automatic classification. However, it scarcely deals with trapezoidal fuzzy information and multicriteria decision-making problems. For this purpose, a cosine similarity measure between trapezoidal fuzzy numbers is proposed based on ...

  18. Genomic similarity and kernel methods I: advancements by building on mathematical and statistical foundations.

    Science.gov (United States)

    Schaid, Daniel J

    2010-01-01

    Measures of genomic similarity are the basis of many statistical analytic methods. We review the mathematical and statistical basis of similarity methods, particularly based on kernel methods. A kernel function converts information for a pair of subjects to a quantitative value representing either similarity (larger values meaning more similar) or distance (smaller values meaning more similar), with the requirement that it must create a positive semidefinite matrix when applied to all pairs of subjects. This review emphasizes the wide range of statistical methods and software that can be used when similarity is based on kernel methods, such as nonparametric regression, linear mixed models and generalized linear mixed models, hierarchical models, score statistics, and support vector machines. The mathematical rigor for these methods is summarized, as is the mathematical framework for making kernels. This review provides a framework to move from intuitive and heuristic approaches to define genomic similarities to more rigorous methods that can take advantage of powerful statistical modeling and existing software. A companion paper reviews novel approaches to creating kernels that might be useful for genomic analyses, providing insights with examples [1]. Copyright © 2010 S. Karger AG, Basel.

  19. Neutrosophic Cubic MCGDM Method Based on Similarity Measure

    Directory of Open Access Journals (Sweden)

    Surapati Pramanik

    2017-06-01

    Full Text Available The notion of neutrosophic cubic set is originated from the hybridization of the concept of neutrosophic set and interval valued neutrosophic set. We define similarity measure for neutrosophic cubic sets and prove some of its basic properties.

  20. Mixed Methods and Action Research: similar or different?

    OpenAIRE

    Wiśniewska, Danuta

    2011-01-01

    This article attempts to analyse and compare ELT studies grounded solely in mixed methods and ELT action research studies based on a mixed methods approach in order to identify to what degree action research studies combining different methods in a single study comply with the principles of rigorous mixed methods study.

  1. Low molecular weight dextran provides similar optical coherence tomography coronary imaging compared to radiographic contrast media.

    Science.gov (United States)

    Frick, Kyle; Michael, Tesfaldet T; Alomar, Mohammed; Mohammed, Atif; Rangan, Bavana V; Abdullah, Shuaib; Grodin, Jerrold; Hastings, Jeffrey L; Banerjee, Subhash; Brilakis, Emmanouil S

    2014-11-01

    Optical coherence tomography (OCT) coronary imaging requires displacement of red blood cells from the vessel lumen. This is usually accomplished using radiographic contrast. Low molecular weight dextran has low cost and is safe in low volumes. In the present study, we compared dextran with contrast for coronary OCT imaging. Fifty-one vessels in 26 patients were sequentially imaged using manual injection of radiographic contrast (iodixanol) and dextran. OCT images were analyzed at 1 mm intervals to determine the image clarity (defined as a visible lumen border > 270°) and to measure the lumen area and lumen diameter. To correct for the refractive index of dextran, the dextran area measurements were multiplied by 1.117 and the dextran length measurements were multiplied by 1.057. A total of 3,418 cross-sections (1,709 with contrast and 1,709 with dextran) were analyzed. There were no complications related to OCT imaging or to contrast or dextran administration. Clear image segments were observed in 97.0% vs. 96.7% of the cross-sections obtained with contrast and dextran, respectively (P = 0.45). The mean lumen areas were also similar: 6.69 ± 1.95 mm(2) with iodixanol vs. 7.06 ± 2.06 mm(2) with dextran (correlation coefficient 0.984). The image quality and measurements during OCT image acquisition are similar for dextran and contrast. Dextran could be used instead of contrast for OCT imaging, especially in patients in whom contrast load minimization is desired. © 2013 Wiley Periodicals, Inc.

  2. Different and Similar at the Same Time. Cultural Competence through the Leans of Healthcare Providers.

    Science.gov (United States)

    Dell'Aversana, Giuseppina; Bruno, Andreina

    2017-01-01

    Cultural competence (CC) for professionals and organizations has been recognized as a key strategy to reduce health care inequalities for migrants and to promote responsiveness to diversity. For decades its main aim has been matching health services to the cultural needs of migrant users. Otherwise literature highlighted the need to find a pragmatic middle way between the 'static' and the 'dynamic' views of culture that are recognizable in CC approaches. A pragmatic middle way to CC will be proposed as the way to respect diversity, even responding to cultural issues, without stereotyping or discriminating. To understand conditions that favor this pragmatic middle way this study aims to explore: (1) perceptions of healthcare providers in managing diversity; (2) strategies used to meet health needs at a professional and organizational level. A qualitative case study was conducted in a healthcare service renowned for its engagement in migrant sensitive care. Four different professional figures involved in CC strategies at different levels, both managerial and non-managerial, were interviewed. Data were analyzed using thematic analysis. Findings indicated that dealing with diversity poses challenges for healthcare providers, by confronting them with multilevel barriers to quality of care. A pragmatic middle way to CC seems to rely on complex understanding of the interaction between patients social conditions and the capacity of the institutional system to promote equity. Professional and organizational strategies, such as inter-professional and intersectional collaboration, cultural food adaptation and professional training can enhance quality of care, patient compliance responding to social and cultural needs.

  3. Computer Facilitated Mathematical Methods in Chemical Engineering--Similarity Solution

    Science.gov (United States)

    Subramanian, Venkat R.

    2006-01-01

    High-performance computers coupled with highly efficient numerical schemes and user-friendly software packages have helped instructors to teach numerical solutions and analysis of various nonlinear models more efficiently in the classroom. One of the main objectives of a model is to provide insight about the system of interest. Analytical…

  4. An inter-comparison of similarity-based methods for organisation and classification of groundwater hydrographs

    Science.gov (United States)

    Haaf, Ezra; Barthel, Roland

    2018-04-01

    Classification and similarity based methods, which have recently received major attention in the field of surface water hydrology, namely through the PUB (prediction in ungauged basins) initiative, have not yet been applied to groundwater systems. However, it can be hypothesised, that the principle of "similar systems responding similarly to similar forcing" applies in subsurface hydrology as well. One fundamental prerequisite to test this hypothesis and eventually to apply the principle to make "predictions for ungauged groundwater systems" is efficient methods to quantify the similarity of groundwater system responses, i.e. groundwater hydrographs. In this study, a large, spatially extensive, as well as geologically and geomorphologically diverse dataset from Southern Germany and Western Austria was used, to test and compare a set of 32 grouping methods, which have previously only been used individually in local-scale studies. The resulting groupings are compared to a heuristic visual classification, which serves as a baseline. A performance ranking of these classification methods is carried out and differences in homogeneity of grouping results were shown, whereby selected groups were related to hydrogeological indices and geological descriptors. This exploratory empirical study shows that the choice of grouping method has a large impact on the object distribution within groups, as well as on the homogeneity of patterns captured in groups. The study provides a comprehensive overview of a large number of grouping methods, which can guide researchers when attempting similarity-based groundwater hydrograph classification.

  5. [Baking method of Platycladi Cacumen Carbonisatum based on similarity of UPLC fingerprints].

    Science.gov (United States)

    Shan, Mingqiu; Chen, Chao; Yao, Xiaodong; Ding, Anwei

    2010-09-01

    To establish a baking method of Platycladi Cacumen Carbonisatum for providing a new idea to Carbonic Herbs' research. Samples were prepared in an oven for different time at different temperatures separately. Then the fingerprints of the samples were determined by UPLC. According to the standard fingerprint, the similarities of the samples' fingerprints were compared. The similarities of 3 samples, which were baked at 230 degrees C for 20 min, 30 min and at 240 degrees C for 20 min, were above 0.96. According to the similarities of the fingerprints and in view of the appearances, Platycladi Cacumen Carbonizing should be baked at 230 degrees C for 20 min.

  6. 29 CFR 778.214 - Benefit plans; including profit-sharing plans or trusts providing similar benefits.

    Science.gov (United States)

    2010-07-01

    ... fide plan for providing old age, retirement, life, accident, or health insurance or similar benefits... employee on account of severance of employment (or for any other reason) would not result in any increase... mechanics performing contract work subject to the Davis-Bacon Act and related statutes, the provisions of...

  7. A Two-Stage Composition Method for Danger-Aware Services Based on Context Similarity

    Science.gov (United States)

    Wang, Junbo; Cheng, Zixue; Jing, Lei; Ota, Kaoru; Kansen, Mizuo

    Context-aware systems detect user's physical and social contexts based on sensor networks, and provide services that adapt to the user accordingly. Representing, detecting, and managing the contexts are important issues in context-aware systems. Composition of contexts is a useful method for these works, since it can detect a context by automatically composing small pieces of information to discover service. Danger-aware services are a kind of context-aware services which need description of relations between a user and his/her surrounding objects and between users. However when applying the existing composition methods to danger-aware services, they show the following shortcomings that (1) they have not provided an explicit method for representing composition of multi-user' contexts, (2) there is no flexible reasoning mechanism based on similarity of contexts, so that they can just provide services exactly following the predefined context reasoning rules. Therefore, in this paper, we propose a two-stage composition method based on context similarity to solve the above problems. The first stage is composition of the useful information to represent the context for a single user. The second stage is composition of multi-users' contexts to provide services by considering the relation of users. Finally the danger degree of the detected context is computed by using context similarity between the detected context and the predefined context. Context is dynamically represented based on two-stage composition rules and a Situation theory based Ontology, which combines the advantages of Ontology and Situation theory. We implement the system in an indoor ubiquitous environment, and evaluate the system through two experiments with the support of subjects. The experiment results show the method is effective, and the accuracy of danger detection is acceptable to a danger-aware system.

  8. Budesonide/formoterol and formoterol provide similar rapid relief in patients with acute asthma showing refractoriness to salbutamol

    Directory of Open Access Journals (Sweden)

    Lombardi DM

    2006-01-01

    Full Text Available Abstract Background To compare the efficacy and safety of budesonide/formoterol (Symbicort® with formoterol (Oxis® in the treatment of patients with acute asthma who showed evidence of refractoriness to short-acting β2-agonist therapy. Methods In a 3 hour, randomized, double-blind study, a total of 115 patients with acute asthma (mean FEV1 40% of predicted normal and a refractory response to salbutamol (mean reversibility 2% of predicted normal after inhalation of 400 μg, were randomized to receive either budesonide/formoterol (320/9 μg, 2 inhalations at t = -5 minutes and 2 inhalations at 0 minutes [total dose 1280/36 μg] or formoterol (9 μg, 2 inhalations at t = -5 minutes and 2 inhalations at 0 minutes [total dose 36 μg]. The primary efficacy variable was the average FEV1 from the first intake of study medication to the measurement at 90 minutes. Secondary endpoints included changes in FEV1 at other timepoints and change in respiratory rate at 180 minutes. Treatment success, treatment failure and patient assessment of the effectiveness of the study medication were also measured. Results FEV1 increased after administration of the study medication in both treatment groups. No statistically significant difference between the treatment groups was apparent for the primary outcome variable, or for any of the other efficacy endpoints. There were no statistically significant between-group differences for treatment success, treatment failure or patient assessment of medication effectiveness. Both treatments were well tolerated. Conclusion Budesonide/formoterol and formoterol provided similarly rapid relief of acute bronchoconstriction in patients with asthma who showed evidence of refractoriness to a short-acting β2-agonist.

  9. Logarithmic Similarity Measure between Interval-Valued Fuzzy Sets and Its Fault Diagnosis Method

    Directory of Open Access Journals (Sweden)

    Zhikang Lu

    2018-02-01

    Full Text Available Fault diagnosis is an important task for the normal operation and maintenance of equipment. In many real situations, the diagnosis data cannot provide deterministic values and are usually imprecise or uncertain. Thus, interval-valued fuzzy sets (IVFSs are very suitable for expressing imprecise or uncertain fault information in real problems. However, existing literature scarcely deals with fault diagnosis problems, such as gasoline engines and steam turbines with IVFSs. However, the similarity measure is one of the important tools in fault diagnoses. Therefore, this paper proposes a new similarity measure of IVFSs based on logarithmic function and its fault diagnosis method for the first time. By the logarithmic similarity measure between the fault knowledge and some diagnosis-testing samples with interval-valued fuzzy information and its relation indices, we can determine the fault type and ranking order of faults corresponding to the relation indices. Then, the misfire fault diagnosis of the gasoline engine and the vibrational fault diagnosis of a turbine are presented to demonstrate the simplicity and effectiveness of the proposed diagnosis method. The fault diagnosis results of gasoline engine and steam turbine show that the proposed diagnosis method not only gives the main fault types of the gasoline engine and steam turbine but also provides useful information for multi-fault analyses and predicting future fault trends. Hence, the logarithmic similarity measure and its fault diagnosis method are main contributions in this study and they provide a useful new way for the fault diagnosis with interval-valued fuzzy information.

  10. Dimensional analysis and self-similarity methods for engineers and scientists

    CERN Document Server

    Zohuri, Bahman

    2015-01-01

    This ground-breaking reference provides an overview of key concepts in dimensional analysis, and then pushes well beyond traditional applications in fluid mechanics to demonstrate how powerful this tool can be in solving complex problems across many diverse fields. Of particular interest is the book's coverage of  dimensional analysis and self-similarity methods in nuclear and energy engineering. Numerous practical examples of dimensional problems are presented throughout, allowing readers to link the book's theoretical explanations and step-by-step mathematical solutions to practical impleme

  11. Estimation of Cross-Lingual News Similarities Using Text-Mining Methods

    Directory of Open Access Journals (Sweden)

    Zhouhao Wang

    2018-01-01

    Full Text Available In this research, two estimation algorithms for extracting cross-lingual news pairs based on machine learning from financial news articles have been proposed. Every second, innumerable text data, including all kinds news, reports, messages, reviews, comments, and tweets are generated on the Internet, and these are written not only in English but also in other languages such as Chinese, Japanese, French, etc. By taking advantage of multi-lingual text resources provided by Thomson Reuters News, we developed two estimation algorithms for extracting cross-lingual news pairs from multilingual text resources. In our first method, we propose a novel structure that uses the word information and the machine learning method effectively in this task. Simultaneously, we developed a bidirectional Long Short-Term Memory (LSTM based method to calculate cross-lingual semantic text similarity for long text and short text, respectively. Thus, when an important news article is published, users can read similar news articles that are written in their native language using our method.

  12. Similarity and symmetry methods applications in elasticity and mechanics of materials

    CERN Document Server

    Mladenov, Ivaïlo

    2014-01-01

    The principle aim of the book is to present a self-contained, modern account of similarity and symmetry methods, which are important mathematical tools for both physicists, engineers and applied mathematicians. The idea is to provide a balanced presentation of the mathematical techniques and applications of symmetry methods in mathematics, physics and engineering. That is why it includes recent developments and many examples in finding systematically conservation laws, local and nonlocal symmetries for ordinary and partial differential equations. The role of continuous symmetries in classical and quantum field theories is exposed at a technical level accessible even for non specialists. The importance of symmetries in continuum mechanics and mechanics of materials is highlighted through recent developments, such as the construction of constitutive models for various materials combining Lie symmetries with experimental data. As a whole this book is a unique collection of contributions from experts in the field...

  13. Random walk-based similarity measure method for patterns in complex object

    Directory of Open Access Journals (Sweden)

    Liu Shihu

    2017-04-01

    Full Text Available This paper discusses the similarity of the patterns in complex objects. The complex object is composed both of the attribute information of patterns and the relational information between patterns. Bearing in mind the specificity of complex object, a random walk-based similarity measurement method for patterns is constructed. In this method, the reachability of any two patterns with respect to the relational information is fully studied, and in the case of similarity of patterns with respect to the relational information can be calculated. On this bases, an integrated similarity measurement method is proposed, and algorithms 1 and 2 show the performed calculation procedure. One can find that this method makes full use of the attribute information and relational information. Finally, a synthetic example shows that our proposed similarity measurement method is validated.

  14. Does a Nintendo Wii exercise program provide similar exercise demands as a traditional pulmonary rehabilitation program in adults with COPD?

    Science.gov (United States)

    LeGear, Tyler; LeGear, Mark; Preradovic, Dejan; Wilson, Geoffrey; Kirkham, Ashley; Camp, Pat G

    2016-05-01

    The chronic obstructive pulmonary disease (COPD) population can experience lower activity and fitness levels than the non-COPD population. The Nintendo Wii may be an appropriate at-home training device for the COPD population, which could be used as a supplement for a pulmonary rehabilitation program. This study was a randomized, within-subject, cross-over study involving 10 adults with COPD previously enrolled in St Paul's Hospital's pulmonary rehabilitation program. This study attempted to determine if specific Wii activities resulted in similar energy expenditures to that of a more traditional pulmonary rehabilitation activity. Participants completed two 15-min exercise interventions in a single session, with a washout period of 30 min in-between. The interventions were an experimental Wii intervention and a traditional treadmill intervention. There was no significant difference in total energy expenditure between the two 15-min exercise interventions [mean difference 36.3 joules; 95% confidence interval (CI): 31.4, 104]. There was no significant difference in heart rate (mean difference -0.167 beats per minute; 95% CI: -4.83, 4.50), rating of perceived exertion (mean difference 0.100; 95% CI: -0.416, 0.616) and Borg dyspnea scale (mean difference 0.267; 95% CI: -0.004, 0.537) between the two 15-min exercise interventions. There was a significant difference in SpO2 between the two 15-min exercise interventions (Wii intervention mean difference 2.33% > treadmill intervention; 95% CI: 1.52, 3.15). Gaming technology can provide an exercise program that has similar cardiovascular demands to traditional pulmonary rehabilitation programs for patients with COPD. Further research is necessary to address feasibility and long-term adherence. © 2014 John Wiley & Sons Ltd.

  15. Methods for providing intermediates in the synthesis of atorvastatin.

    NARCIS (Netherlands)

    Dömling, Alexander Stephan Siegfried

    2016-01-01

    The invention relates to the field of medicinal chemistry, In particular, it relates to methods for providing intermediates in the synthesis of Atorvastatin, a competitive inhibitor of HMG-Co A reductase. Provided is a process for providing a compound having a Formula (I) or a pharmaceutically

  16. A Novel Drug-Mouse Phenotypic Similarity Method Detects Molecular Determinants of Drug Effects.

    Directory of Open Access Journals (Sweden)

    Jeanette Prinz

    2016-09-01

    Full Text Available The molecular mechanisms that translate drug treatment into beneficial and unwanted effects are largely unknown. We present here a novel approach to detect gene-drug and gene-side effect associations based on the phenotypic similarity of drugs and single gene perturbations in mice that account for the polypharmacological property of drugs. We scored the phenotypic similarity of human side effect profiles of 1,667 small molecules and biologicals to profiles of phenotypic traits of 5,384 mouse genes. The benchmarking with known relationships revealed a strong enrichment of physical and indirect drug-target connections, causative drug target-side effect links as well as gene-drug links involved in pharmacogenetic associations among phenotypically similar gene-drug pairs. The validation by in vitro assays and the experimental verification of an unknown connection between oxandrolone and prokineticin receptor 2 reinforces the ability of this method to provide new molecular insights underlying drug treatment. Thus, this approach may aid in the proposal of novel and personalized treatments.

  17. Olympic weightlifting and plyometric training with children provides similar or greater performance improvements than traditional resistance training.

    Science.gov (United States)

    Chaouachi, Anis; Hammami, Raouf; Kaabi, Sofiene; Chamari, Karim; Drinkwater, Eric J; Behm, David G

    2014-06-01

    A number of organizations recommend that advanced resistance training (RT) techniques can be implemented with children. The objective of this study was to evaluate the effectiveness of Olympic-style weightlifting (OWL), plyometrics, and traditional RT programs with children. Sixty-three children (10-12 years) were randomly allocated to a 12-week control OWL, plyometric, or traditional RT program. Pre- and post-training tests included body mass index (BMI), sum of skinfolds, countermovement jump (CMJ), horizontal jump, balance, 5- and 20-m sprint times, isokinetic force and power at 60 and 300° · s(-1). Magnitude-based inferences were used to analyze the likelihood of an effect having a standardized (Cohen's) effect size exceeding 0.20. All interventions were generally superior to the control group. Olympic weightlifting was >80% likely to provide substantially better improvements than plyometric training for CMJ, horizontal jump, and 5- and 20-m sprint times, whereas >75% likely to substantially exceed traditional RT for balance and isokinetic power at 300° · s(-1). Plyometric training was >78% likely to elicit substantially better training adaptations than traditional RT for balance, isokinetic force at 60 and 300° · s(-1), isokinetic power at 300° · s(-1), and 5- and 20-m sprints. Traditional RT only exceeded plyometric training for BMI and isokinetic power at 60° · s(-1). Hence, OWL and plyometrics can provide similar or greater performance adaptations for children. It is recommended that any of the 3 training modalities can be implemented under professional supervision with proper training progressions to enhance training adaptations in children.

  18. Fludarabine Melphalan reduced-intensity conditioning allotransplanation provides similar disease control in lymphoid and myeloid malignancies: analysis of 344 patients.

    Science.gov (United States)

    Bryant, A; Nivison-Smith, I; Pillai, E S; Kennedy, G; Kalff, A; Ritchie, D; George, B; Hertzberg, M; Patil, S; Spencer, A; Fay, K; Cannell, P; Berkahn, L; Doocey, R; Spearing, R; Moore, J

    2014-01-01

    This was an Australasian Bone Marrow Transplant Recipient Registry (ABMTRR)-based retrospective study assessing the outcome of Fludarabine Melphalan (FluMel) reduced-intensity conditioning between 1998 and 2008. Median follow-up was 3.4 years. There were 344 patients with a median age of 54 years (18-68). In all, 234 patients had myeloid malignancies, with AML (n=166) being the commonest indication. There were 110 lymphoid patients with non-hodgkins lymphoma (NHL) (n=64) the main indication. TRM at day 100 was 14% with no significant difference between the groups. OS and disease-free survival (DFS) were similar between myeloid and lymphoid patients (57 and 50% at 3 years, respectively). There was no difference in cumulative incidence of relapse or GVHD between groups. Multivariate analysis revealed four significant adverse risk factors for DFS: donor other than HLA-identical sibling donor, not in remission at transplant, previous autologous transplant and recipient CMV positive. Chronic GVHD was associated with improved DFS in multivariate analysis predominantly due to a marked reduction in relapse (HR:0.44, P=0.003). This study confirms that FluMel provides durable and equivalent remissions in both myeloid and lymphoid malignancies. Disease stage and chronic GVHD remain important determinants of outcome for FluMel allografting.

  19. Method of synthesis of abstract images with high self-similarity

    Science.gov (United States)

    Matveev, Nikolay V.; Shcheglov, Sergey A.; Romanova, Galina E.; Koneva, Ð.¢atiana A.

    2017-06-01

    Abstract images with high self-similarity could be used for drug-free stress therapy. This based on the fact that a complex visual environment has a high affective appraisal. To create such an image we can use the setup based on the three laser sources of small power and different colors (Red, Green, Blue), the image is the pattern resulting from the reflecting and refracting by the complicated form object placed into the laser ray paths. The images were obtained experimentally which showed the good therapy effect. However, to find and to choose the object which gives needed image structure is very difficult and requires many trials. The goal of the work is to develop a method and a procedure of finding the object form which if placed into the ray paths can provide the necessary structure of the image In fact the task means obtaining the necessary irradiance distribution on the given surface. Traditionally such problems are solved using the non-imaging optics methods. In the given case this task is very complicated because of the complicated structure of the illuminance distribution and its high non-linearity. Alternative way is to use the projected image of a mask with a given structure. We consider both ways and discuss how they can help to speed up the synthesis procedure for the given abstract image of the high self-similarity for the setups of drug-free therapy.

  20. Similarity measurement method of high-dimensional data based on normalized net lattice subspace

    Institute of Scientific and Technical Information of China (English)

    Li Wenfa; Wang Gongming; Li Ke; Huang Su

    2017-01-01

    The performance of conventional similarity measurement methods is affected seriously by the curse of dimensionality of high-dimensional data.The reason is that data difference between sparse and noisy dimensionalities occupies a large proportion of the similarity, leading to the dissimilarities between any results.A similarity measurement method of high-dimensional data based on normalized net lattice subspace is proposed.The data range of each dimension is divided into several intervals, and the components in different dimensions are mapped onto the corresponding interval.Only the component in the same or adjacent interval is used to calculate the similarity.To validate this meth-od, three data types are used, and seven common similarity measurement methods are compared. The experimental result indicates that the relative difference of the method is increasing with the di-mensionality and is approximately two or three orders of magnitude higher than the conventional method.In addition, the similarity range of this method in different dimensions is [0, 1], which is fit for similarity analysis after dimensionality reduction.

  1. A FAST METHOD FOR MEASURING THE SIMILARITY BETWEEN 3D MODEL AND 3D POINT CLOUD

    Directory of Open Access Journals (Sweden)

    Z. Zhang

    2016-06-01

    Full Text Available This paper proposes a fast method for measuring the partial Similarity between 3D Model and 3D point Cloud (SimMC. It is crucial to measure SimMC for many point cloud-related applications such as 3D object retrieval and inverse procedural modelling. In our proposed method, the surface area of model and the Distance from Model to point Cloud (DistMC are exploited as measurements to calculate SimMC. Here, DistMC is defined as the weighted distance of the distances between points sampled from model and point cloud. Similarly, Distance from point Cloud to Model (DistCM is defined as the average distance of the distances between points in point cloud and model. In order to reduce huge computational burdens brought by calculation of DistCM in some traditional methods, we define SimMC as the ratio of weighted surface area of model to DistMC. Compared to those traditional SimMC measuring methods that are only able to measure global similarity, our method is capable of measuring partial similarity by employing distance-weighted strategy. Moreover, our method is able to be faster than other partial similarity assessment methods. We demonstrate the superiority of our method both on synthetic data and laser scanning data.

  2. Dynamic Time Warping Distance Method for Similarity Test of Multipoint Ground Motion Field

    Directory of Open Access Journals (Sweden)

    Yingmin Li

    2010-01-01

    Full Text Available The reasonability of artificial multi-point ground motions and the identification of abnormal records in seismic array observations, are two important issues in application and analysis of multi-point ground motion fields. Based on the dynamic time warping (DTW distance method, this paper discusses the application of similarity measurement in the similarity analysis of simulated multi-point ground motions and the actual seismic array records. Analysis results show that the DTW distance method not only can quantitatively reflect the similarity of simulated ground motion field, but also offers advantages in clustering analysis and singularity recognition of actual multi-point ground motion field.

  3. Flat and complex temperate reefs provide similar support for fish: Evidence for a unimodal species-habitat relationship.

    Directory of Open Access Journals (Sweden)

    Avery B Paxton

    Full Text Available Structural complexity, a form of habitat heterogeneity, influences the structure and function of ecological communities, generally supporting increased species density, richness, and diversity. Recent research, however, suggests the most complex habitats may not harbor the highest density of individuals and number of species, especially in areas with elevated human influence. Understanding nuances in relationships between habitat heterogeneity and ecological communities is warranted to guide habitat-focused conservation and management efforts. We conducted fish and structural habitat surveys of thirty warm-temperate reefs on the southeastern US continental shelf to quantify how structural complexity influences fish communities. We found that intermediate complexity maximizes fish abundance on natural and artificial reefs, as well as species richness on natural reefs, challenging the current paradigm that abundance and other fish community metrics increase with increasing complexity. Naturally occurring rocky reefs of flat and complex morphologies supported equivalent abundance, biomass, species richness, and community composition of fishes. For flat and complex morphologies of rocky reefs to receive equal consideration as essential fish habitat (EFH, special attention should be given to detecting pavement type rocky reefs because their ephemeral nature makes them difficult to detect with typical seafloor mapping methods. Artificial reefs of intermediate complexity also maximized fish abundance, but human-made structures composed of low-lying concrete and metal ships differed in community types, with less complex, concrete structures supporting lower numbers of fishes classified largely as demersal species and metal ships protruding into the water column harboring higher numbers of fishes, including more pelagic species. Results of this study are essential to the process of evaluating habitat function provided by different types and shapes of

  4. EVALUATION OF SEMANTIC SIMILARITY FOR SENTENCES IN NATURAL LANGUAGE BY MATHEMATICAL STATISTICS METHODS

    Directory of Open Access Journals (Sweden)

    A. E. Pismak

    2016-03-01

    Full Text Available Subject of Research. The paper is focused on Wiktionary articles structural organization in the aspect of its usage as the base for semantic network. Wiktionary community references, article templates and articles markup features are analyzed. The problem of numerical estimation for semantic similarity of structural elements in Wiktionary articles is considered. Analysis of existing software for semantic similarity estimation of such elements is carried out; algorithms of their functioning are studied; their advantages and disadvantages are shown. Methods. Mathematical statistics methods were used to analyze Wiktionary articles markup features. The method of semantic similarity computing based on statistics data for compared structural elements was proposed.Main Results. We have concluded that there is no possibility for direct use of Wiktionary articles as the source for semantic network. We have proposed to find hidden similarity between article elements, and for that purpose we have developed the algorithm for calculation of confidence coefficients proving that each pair of sentences is semantically near. The research of quantitative and qualitative characteristics for the developed algorithm has shown its major performance advantage over the other existing solutions in the presence of insignificantly higher error rate. Practical Relevance. The resulting algorithm may be useful in developing tools for automatic Wiktionary articles parsing. The developed method could be used in computing of semantic similarity for short text fragments in natural language in case of algorithm performance requirements are higher than its accuracy specifications.

  5. Comparative analysis of chemical similarity methods for modular natural products with a hypothetical structure enumeration algorithm.

    Science.gov (United States)

    Skinnider, Michael A; Dejong, Chris A; Franczak, Brian C; McNicholas, Paul D; Magarvey, Nathan A

    2017-08-16

    Natural products represent a prominent source of pharmaceutically and industrially important agents. Calculating the chemical similarity of two molecules is a central task in cheminformatics, with applications at multiple stages of the drug discovery pipeline. Quantifying the similarity of natural products is a particularly important problem, as the biological activities of these molecules have been extensively optimized by natural selection. The large and structurally complex scaffolds of natural products distinguish their physical and chemical properties from those of synthetic compounds. However, no analysis of the performance of existing methods for molecular similarity calculation specific to natural products has been reported to date. Here, we present LEMONS, an algorithm for the enumeration of hypothetical modular natural product structures. We leverage this algorithm to conduct a comparative analysis of molecular similarity methods within the unique chemical space occupied by modular natural products using controlled synthetic data, and comprehensively investigate the impact of diverse biosynthetic parameters on similarity search. We additionally investigate a recently described algorithm for natural product retrobiosynthesis and alignment, and find that when rule-based retrobiosynthesis can be applied, this approach outperforms conventional two-dimensional fingerprints, suggesting it may represent a valuable approach for the targeted exploration of natural product chemical space and microbial genome mining. Our open-source algorithm is an extensible method of enumerating hypothetical natural product structures with diverse potential applications in bioinformatics.

  6. Method for providing uranium with a protective copper coating

    Science.gov (United States)

    Waldrop, Forrest B.; Jones, Edward

    1981-01-01

    The present invention is directed to a method for providing uranium metal with a protective coating of copper. Uranium metal is subjected to a conventional cleaning operation wherein oxides and other surface contaminants are removed, followed by etching and pickling operations. The copper coating is provided by first electrodepositing a thin and relatively porous flash layer of copper on the uranium in a copper cyanide bath. The resulting copper-layered article is then heated in an air or inert atmosphere to volatilize and drive off the volatile material underlying the copper flash layer. After the heating step an adherent and essentially non-porous layer of copper is electro-deposited on the flash layer of copper to provide an adherent, multi-layer copper coating which is essentially impervious to corrosion by most gases.

  7. System and Method for Providing a Climate Data Persistence Service

    Science.gov (United States)

    Schnase, John L. (Inventor); Ripley, III, William David (Inventor); Duffy, Daniel Q. (Inventor); Thompson, John H. (Inventor); Strong, Savannah L. (Inventor); McInerney, Mark (Inventor); Sinno, Scott (Inventor); Tamkin, Glenn S. (Inventor); Nadeau, Denis (Inventor)

    2018-01-01

    A system, method and computer-readable storage devices for providing a climate data persistence service. A system configured to provide the service can include a climate data server that performs data and metadata storage and management functions for climate data objects, a compute-storage platform that provides the resources needed to support a climate data server, provisioning software that allows climate data server instances to be deployed as virtual climate data servers in a cloud computing environment, and a service interface, wherein persistence service capabilities are invoked by software applications running on a client device. The climate data objects can be in various formats, such as International Organization for Standards (ISO) Open Archival Information System (OAIS) Reference Model Submission Information Packages, Archive Information Packages, and Dissemination Information Packages. The climate data server can enable scalable, federated storage, management, discovery, and access, and can be tailored for particular use cases.

  8. A small world of weak ties provides optimal global integration of self-similar modules in functional brain networks.

    Science.gov (United States)

    Gallos, Lazaros K; Makse, Hernán A; Sigman, Mariano

    2012-02-21

    The human brain is organized in functional modules. Such an organization presents a basic conundrum: Modules ought to be sufficiently independent to guarantee functional specialization and sufficiently connected to bind multiple processors for efficient information transfer. It is commonly accepted that small-world architecture of short paths and large local clustering may solve this problem. However, there is intrinsic tension between shortcuts generating small worlds and the persistence of modularity, a global property unrelated to local clustering. Here, we present a possible solution to this puzzle. We first show that a modified percolation theory can define a set of hierarchically organized modules made of strong links in functional brain networks. These modules are "large-world" self-similar structures and, therefore, are far from being small-world. However, incorporating weaker ties to the network converts it into a small world preserving an underlying backbone of well-defined modules. Remarkably, weak ties are precisely organized as predicted by theory maximizing information transfer with minimal wiring cost. This trade-off architecture is reminiscent of the "strength of weak ties" crucial concept of social networks. Such a design suggests a natural solution to the paradox of efficient information flow in the highly modular structure of the brain.

  9. Depth compensating calculation method of computer-generated holograms using symmetry and similarity of zone plates

    Science.gov (United States)

    Wei, Hui; Gong, Guanghong; Li, Ni

    2017-10-01

    Computer-generated hologram (CGH) is a promising 3D display technology while it is challenged by heavy computation load and vast memory requirement. To solve these problems, a depth compensating CGH calculation method based on symmetry and similarity of zone plates is proposed and implemented on graphics processing unit (GPU). An improved LUT method is put forward to compute the distances between object points and hologram pixels in the XY direction. The concept of depth compensating factor is defined and used for calculating the holograms of points with different depth positions instead of layer-based methods. The proposed method is suitable for arbitrary sampling objects with lower memory usage and higher computational efficiency compared to other CGH methods. The effectiveness of the proposed method is validated by numerical and optical experiments.

  10. A Method for Generating Approximate Similarity Solutions of Nonlinear Partial Differential Equations

    Directory of Open Access Journals (Sweden)

    Mazhar Iqbal

    2014-01-01

    Full Text Available Standard application of similarity method to find solutions of PDEs mostly results in reduction to ODEs which are not easily integrable in terms of elementary or tabulated functions. Such situations usually demand solving reduced ODEs numerically. However, there are no systematic procedures available to utilize these numerical solutions of reduced ODE to obtain the solution of original PDE. A practical and tractable approach is proposed to deal with such situations and is applied to obtain approximate similarity solutions to different cases of an initial-boundary value problem of unsteady gas flow through a semi-infinite porous medium.

  11. Rational Selection, Criticality Assessment, and Tiering of Quality Attributes and Test Methods for Analytical Similarity Evaluation of Biosimilars.

    Science.gov (United States)

    Vandekerckhove, Kristof; Seidl, Andreas; Gutka, Hiten; Kumar, Manish; Gratzl, Gyöngyi; Keire, David; Coffey, Todd; Kuehne, Henriette

    2018-05-10

    Leading regulatory agencies recommend biosimilar assessment to proceed in a stepwise fashion, starting with a detailed analytical comparison of the structural and functional properties of the proposed biosimilar and reference product. The degree of analytical similarity determines the degree of residual uncertainty that must be addressed through downstream in vivo studies. Substantive evidence of similarity from comprehensive analytical testing may justify a targeted clinical development plan, and thus enable a shorter path to licensing. The importance of a careful design of the analytical similarity study program therefore should not be underestimated. Designing a state-of-the-art analytical similarity study meeting current regulatory requirements in regions such as the USA and EU requires a methodical approach, consisting of specific steps that far precede the work on the actual analytical study protocol. This white paper discusses scientific and methodological considerations on the process of attribute and test method selection, criticality assessment, and subsequent assignment of analytical measures to US FDA's three tiers of analytical similarity assessment. Case examples of selection of critical quality attributes and analytical methods for similarity exercises are provided to illustrate the practical implementation of the principles discussed.

  12. Method for Providing Semiconductors Having Self-Aligned Ion Implant

    Science.gov (United States)

    Neudeck, Philip G. (Inventor)

    2014-01-01

    A method is disclosed that provides a self-aligned nitrogen-implant particularly suited for a Junction Field Effect Transistor (JFET) semiconductor device preferably comprised of a silicon carbide (SiC). This self-aligned nitrogen-implant allows for the realization of durable and stable electrical functionality of high temperature transistors such as JFETs. The method implements the self-aligned nitrogen-implant having predetermined dimensions, at a particular step in the fabrication process, so that the SiC junction field effect transistors are capable of being electrically operating continuously at 500.degree. C. for over 10,000 hours in an air ambient with less than a 10% change in operational transistor parameters.

  13. Method for providing a low density high strength polyurethane foam

    Science.gov (United States)

    Whinnery, Jr., Leroy L.; Goods, Steven H.; Skala, Dawn M.; Henderson, Craig C.; Keifer, Patrick N.

    2013-06-18

    Disclosed is a method for making a polyurethane closed-cell foam material exhibiting a bulk density below 4 lbs/ft.sup.3 and high strength. The present embodiment uses the reaction product of a modified MDI and a sucrose/glycerine based polyether polyol resin wherein a small measured quantity of the polyol resin is "pre-reacted" with a larger quantity of the isocyanate in a defined ratio such that when the necessary remaining quantity of the polyol resin is added to the "pre-reacted" resin together with a tertiary amine catalyst and water as a blowing agent, the polymerization proceeds slowly enough to provide a stable foam body.

  14. Local non-similarity method through the Crocco's transformation in boundary layer problem

    International Nuclear Information System (INIS)

    Jardim, R.G.M.

    1981-04-01

    The coordinate transformation developed by L. Crocco to obtain the solution of the compressible fluid flows over isotermal flat plates is originally employed in the present work, with the purpose of adding its inherent advantage to the Non-Similarity Method idealized by E.M. Sparrow, in the solution of the incompressible non-similar boundary layers. The Crocco's transformation is applied to the conservation equation for forced convection, laminar, constant properties and two-dimensional flows over solids. Two non-similar problems arisen from freestream velocity distribution, the cylinder in crossflow and the Howarth's retarded flow, are solved with a view to illustrating the new procedure. In those solutions the effect of frictional heat is also considered. The results of hydrodynamic and thermal problems are compared with available published information and good agreement was observed. (Author) [pt

  15. Enzyme sequence similarity improves the reaction alignment method for cross-species pathway comparison

    Energy Technology Data Exchange (ETDEWEB)

    Ovacik, Meric A. [Chemical and Biochemical Engineering Department, Rutgers University, Piscataway, NJ 08854 (United States); Androulakis, Ioannis P., E-mail: yannis@rci.rutgers.edu [Chemical and Biochemical Engineering Department, Rutgers University, Piscataway, NJ 08854 (United States); Biomedical Engineering Department, Rutgers University, Piscataway, NJ 08854 (United States)

    2013-09-15

    Pathway-based information has become an important source of information for both establishing evolutionary relationships and understanding the mode of action of a chemical or pharmaceutical among species. Cross-species comparison of pathways can address two broad questions: comparison in order to inform evolutionary relationships and to extrapolate species differences used in a number of different applications including drug and toxicity testing. Cross-species comparison of metabolic pathways is complex as there are multiple features of a pathway that can be modeled and compared. Among the various methods that have been proposed, reaction alignment has emerged as the most successful at predicting phylogenetic relationships based on NCBI taxonomy. We propose an improvement of the reaction alignment method by accounting for sequence similarity in addition to reaction alignment method. Using nine species, including human and some model organisms and test species, we evaluate the standard and improved comparison methods by analyzing glycolysis and citrate cycle pathways conservation. In addition, we demonstrate how organism comparison can be conducted by accounting for the cumulative information retrieved from nine pathways in central metabolism as well as a more complete study involving 36 pathways common in all nine species. Our results indicate that reaction alignment with enzyme sequence similarity results in a more accurate representation of pathway specific cross-species similarities and differences based on NCBI taxonomy.

  16. Enzyme sequence similarity improves the reaction alignment method for cross-species pathway comparison

    International Nuclear Information System (INIS)

    Ovacik, Meric A.; Androulakis, Ioannis P.

    2013-01-01

    Pathway-based information has become an important source of information for both establishing evolutionary relationships and understanding the mode of action of a chemical or pharmaceutical among species. Cross-species comparison of pathways can address two broad questions: comparison in order to inform evolutionary relationships and to extrapolate species differences used in a number of different applications including drug and toxicity testing. Cross-species comparison of metabolic pathways is complex as there are multiple features of a pathway that can be modeled and compared. Among the various methods that have been proposed, reaction alignment has emerged as the most successful at predicting phylogenetic relationships based on NCBI taxonomy. We propose an improvement of the reaction alignment method by accounting for sequence similarity in addition to reaction alignment method. Using nine species, including human and some model organisms and test species, we evaluate the standard and improved comparison methods by analyzing glycolysis and citrate cycle pathways conservation. In addition, we demonstrate how organism comparison can be conducted by accounting for the cumulative information retrieved from nine pathways in central metabolism as well as a more complete study involving 36 pathways common in all nine species. Our results indicate that reaction alignment with enzyme sequence similarity results in a more accurate representation of pathway specific cross-species similarities and differences based on NCBI taxonomy

  17. Improvement of training set structure in fusion data cleaning using Time-Domain Global Similarity method

    International Nuclear Information System (INIS)

    Liu, J.; Lan, T.; Qin, H.

    2017-01-01

    Traditional data cleaning identifies dirty data by classifying original data sequences, which is a class-imbalanced problem since the proportion of incorrect data is much less than the proportion of correct ones for most diagnostic systems in Magnetic Confinement Fusion (MCF) devices. When using machine learning algorithms to classify diagnostic data based on class-imbalanced training set, most classifiers are biased towards the major class and show very poor classification rates on the minor class. By transforming the direct classification problem about original data sequences into a classification problem about the physical similarity between data sequences, the class-balanced effect of Time-Domain Global Similarity (TDGS) method on training set structure is investigated in this paper. Meanwhile, the impact of improved training set structure on data cleaning performance of TDGS method is demonstrated with an application example in EAST POlarimetry-INTerferometry (POINT) system.

  18. Similar estimates of temperature impacts on global wheat yield by three independent methods

    DEFF Research Database (Denmark)

    Liu, Bing; Asseng, Senthold; Müller, Christoph

    2016-01-01

    The potential impact of global temperature change on global crop yield has recently been assessed with different methods. Here we show that grid-based and point-based simulations and statistical regressions (from historic records), without deliberate adaptation or CO2 fertilization effects, produ......-method ensemble, it was possible to quantify ‘method uncertainty’ in addition to model uncertainty. This significantly improves confidence in estimates of climate impacts on global food security.......The potential impact of global temperature change on global crop yield has recently been assessed with different methods. Here we show that grid-based and point-based simulations and statistical regressions (from historic records), without deliberate adaptation or CO2 fertilization effects, produce...... similar estimates of temperature impact on wheat yields at global and national scales. With a 1 °C global temperature increase, global wheat yield is projected to decline between 4.1% and 6.4%. Projected relative temperature impacts from different methods were similar for major wheat-producing countries...

  19. Traditional and robust vector selection methods for use with similarity based models

    International Nuclear Information System (INIS)

    Hines, J. W.; Garvey, D. R.

    2006-01-01

    Vector selection, or instance selection as it is often called in the data mining literature, performs a critical task in the development of nonparametric, similarity based models. Nonparametric, similarity based modeling (SBM) is a form of 'lazy learning' which constructs a local model 'on the fly' by comparing a query vector to historical, training vectors. For large training sets the creation of local models may become cumbersome, since each training vector must be compared to the query vector. To alleviate this computational burden, varying forms of training vector sampling may be employed with the goal of selecting a subset of the training data such that the samples are representative of the underlying process. This paper describes one such SBM, namely auto-associative kernel regression (AAKR), and presents five traditional vector selection methods and one robust vector selection method that may be used to select prototype vectors from a larger data set in model training. The five traditional vector selection methods considered are min-max, vector ordering, combination min-max and vector ordering, fuzzy c-means clustering, and Adeli-Hung clustering. Each method is described in detail and compared using artificially generated data and data collected from the steam system of an operating nuclear power plant. (authors)

  20. Similar Estimates of Temperature Impacts on Global Wheat Yield by Three Independent Methods

    Science.gov (United States)

    Liu, Bing; Asseng, Senthold; Muller, Christoph; Ewart, Frank; Elliott, Joshua; Lobell, David B.; Martre, Pierre; Ruane, Alex C.; Wallach, Daniel; Jones, James W.; hide

    2016-01-01

    The potential impact of global temperature change on global crop yield has recently been assessed with different methods. Here we show that grid-based and point-based simulations and statistical regressions (from historic records), without deliberate adaptation or CO2 fertilization effects, produce similar estimates of temperature impact on wheat yields at global and national scales. With a 1 C global temperature increase, global wheat yield is projected to decline between 4.1% and 6.4%. Projected relative temperature impacts from different methods were similar for major wheat-producing countries China, India, USA and France, but less so for Russia. Point-based and grid-based simulations, and to some extent the statistical regressions, were consistent in projecting that warmer regions are likely to suffer more yield loss with increasing temperature than cooler regions. By forming a multi-method ensemble, it was possible to quantify 'method uncertainty' in addition to model uncertainty. This significantly improves confidence in estimates of climate impacts on global food security.

  1. Similar estimates of temperature impacts on global wheat yield by three independent methods

    Science.gov (United States)

    Liu, Bing; Asseng, Senthold; Müller, Christoph; Ewert, Frank; Elliott, Joshua; Lobell, David B.; Martre, Pierre; Ruane, Alex C.; Wallach, Daniel; Jones, James W.; Rosenzweig, Cynthia; Aggarwal, Pramod K.; Alderman, Phillip D.; Anothai, Jakarat; Basso, Bruno; Biernath, Christian; Cammarano, Davide; Challinor, Andy; Deryng, Delphine; Sanctis, Giacomo De; Doltra, Jordi; Fereres, Elias; Folberth, Christian; Garcia-Vila, Margarita; Gayler, Sebastian; Hoogenboom, Gerrit; Hunt, Leslie A.; Izaurralde, Roberto C.; Jabloun, Mohamed; Jones, Curtis D.; Kersebaum, Kurt C.; Kimball, Bruce A.; Koehler, Ann-Kristin; Kumar, Soora Naresh; Nendel, Claas; O'Leary, Garry J.; Olesen, Jørgen E.; Ottman, Michael J.; Palosuo, Taru; Prasad, P. V. Vara; Priesack, Eckart; Pugh, Thomas A. M.; Reynolds, Matthew; Rezaei, Ehsan E.; Rötter, Reimund P.; Schmid, Erwin; Semenov, Mikhail A.; Shcherbak, Iurii; Stehfest, Elke; Stöckle, Claudio O.; Stratonovitch, Pierre; Streck, Thilo; Supit, Iwan; Tao, Fulu; Thorburn, Peter; Waha, Katharina; Wall, Gerard W.; Wang, Enli; White, Jeffrey W.; Wolf, Joost; Zhao, Zhigan; Zhu, Yan

    2016-12-01

    The potential impact of global temperature change on global crop yield has recently been assessed with different methods. Here we show that grid-based and point-based simulations and statistical regressions (from historic records), without deliberate adaptation or CO2 fertilization effects, produce similar estimates of temperature impact on wheat yields at global and national scales. With a 1 °C global temperature increase, global wheat yield is projected to decline between 4.1% and 6.4%. Projected relative temperature impacts from different methods were similar for major wheat-producing countries China, India, USA and France, but less so for Russia. Point-based and grid-based simulations, and to some extent the statistical regressions, were consistent in projecting that warmer regions are likely to suffer more yield loss with increasing temperature than cooler regions. By forming a multi-method ensemble, it was possible to quantify `method uncertainty’ in addition to model uncertainty. This significantly improves confidence in estimates of climate impacts on global food security.

  2. Pulse shape analysis based on similarity and neural network with digital-analog fusion method

    International Nuclear Information System (INIS)

    Mardiyanto, M.P.; Uritani, A.; Sakai, H.; Kawarabayashi, J.; Iguchi, T.

    2000-01-01

    Through the measurement of 22 Na γ-rays, it has been demonstrated that the correction process was well done by fusing the similarity values with the pulse heights measured by the analog system, where at least four improvements in the energy spectrum characteristics were recognized, i.e., the increase of the peak-to-valley ratio, the photopeak area, the photopeak sharpness without discarding any events, and the 1,275 keV γ-ray photopeak was seen. The use of a slow digitizer was the main problem for this method. However, it can be solved easily using a faster digitizer. The fusion method was also applied for the beta-gamma mixed spectra separation. Mixed spectra of beta-gamma of the 137 Cs- 90 Sr mixed source could be separated well. We made a comparison between the energy spectrum of 137 Cs as a result of independent measurement with the result of the separation. After being compared, both FWHM agreed quite well. However, there was a slight difference between the two spectra on the peak-to-valley ratio. This separation method is simple and useful so that it can be applied for many other similar applications. (S.Y.)

  3. Do Tillage Methods Affect Germination and Species Similarity of Soil Weed Seeds Bank?

    Directory of Open Access Journals (Sweden)

    Shahgholi Hassan

    2015-12-01

    Full Text Available Cultural practices such as tillage used for crop production influence the composition of the weed seed bank in the soil. In order to investigate the effects of different tillage methods on seed bank properties, species diversity and similarity, two laboratory and greenhouse experiments were carried out as randomized complete block design with four replications in 2011. Treatments included: once tillage per year (T1, twice tillage per year (T2, more than twice tillage (T3 and no tillage (T4. Laboratory results showed that the T3 and T4 treatments had the highest and the lowest observed seeds numbers, respectively. Between the laboratory observed weed seeds, the maximum weed seed numbers were Echinochloa crus-galli and Amaranthus retroflexus in the T3 treatment, while Chenopodium album, Polygonum aviculare and Cuscuta campestris had the highest seed numbers in the T2 treatment. At the greenhouse study, Chenopodium album, Amaranthus retroflexus and Hordeum morinum in the T2 treatment were dominant species. The highest diversity was observed in the T2 treatment, and Chenopodium album and Echinochloa crus-galli were dominant species in the T2 and T3 treatments. Maximum species similarity index was achieved from the T1 and T3 treatments. Thereby this study concluded that increasing of tillage number could affect the similarity index of weed seeds and subsequently alters the weed community composition.

  4. GEPSI: A Gene Expression Profile Similarity-Based Identification Method of Bioactive Components in Traditional Chinese Medicine Formula.

    Science.gov (United States)

    Zhang, Baixia; He, Shuaibing; Lv, Chenyang; Zhang, Yanling; Wang, Yun

    2018-01-01

    The identification of bioactive components in traditional Chinese medicine (TCM) is an important part of the TCM material foundation research. Recently, molecular docking technology has been extensively used for the identification of TCM bioactive components. However, target proteins that are used in molecular docking may not be the actual TCM target. For this reason, the bioactive components would likely be omitted or incorrect. To address this problem, this study proposed the GEPSI method that identified the target proteins of TCM based on the similarity of gene expression profiles. The similarity of the gene expression profiles affected by TCM and small molecular drugs was calculated. The pharmacological action of TCM may be similar to that of small molecule drugs that have a high similarity score. Indeed, the target proteins of the small molecule drugs could be considered TCM targets. Thus, we identified the bioactive components of a TCM by molecular docking and verified the reliability of this method by a literature investigation. Using the target proteins that TCM actually affected as targets, the identification of the bioactive components was more accurate. This study provides a fast and effective method for the identification of TCM bioactive components.

  5. Load reduction test method of similarity theory and BP neural networks of large cranes

    Science.gov (United States)

    Yang, Ruigang; Duan, Zhibin; Lu, Yi; Wang, Lei; Xu, Gening

    2016-01-01

    Static load tests are an important means of supervising and detecting a crane's lift capacity. Due to space restrictions, however, there are difficulties and potential danger when testing large bridge cranes. To solve the loading problems of large-tonnage cranes during testing, an equivalency test is proposed based on the similarity theory and BP neural networks. The maximum stress and displacement of a large bridge crane is tested in small loads, combined with the training neural network of a similar structure crane through stress and displacement data which is collected by a physics simulation progressively loaded to a static load test load within the material scope of work. The maximum stress and displacement of a crane under a static load test load can be predicted through the relationship of stress, displacement, and load. By measuring the stress and displacement of small tonnage weights, the stress and displacement of large loads can be predicted, such as the maximum load capacity, which is 1.25 times the rated capacity. Experimental study shows that the load reduction test method can reflect the lift capacity of large bridge cranes. The load shedding predictive analysis for Sanxia 1200 t bridge crane test data indicates that when the load is 1.25 times the rated lifting capacity, the predicted displacement and actual displacement error is zero. The method solves the problem that lifting capacities are difficult to obtain and testing accidents are easily possible when 1.25 times related weight loads are tested for large tonnage cranes.

  6. Similar judgment method of brain neural pathway using DT-MRI

    International Nuclear Information System (INIS)

    Watashiba, Yasuhiro; Sakamoto, Naohisa; Sakai, Koji; Koyamada, Koji; Kanazawa, Masanori; Doi, Akio

    2008-01-01

    Nowadays, the visualization of brain neural pathway extracted by the tractography technology is thought as a useful effective tool for the detection of involved area and the analysis of sick cause by comparison of difference of normal and patient's nerve fiber configurations and for the support of the surgery planning and the forecast of progress after an operation. So far, for the observation of the brain neural pathway, the method of the user's subjectively judging the 3D shape of them displayed in the image has been used. However, in this kind of subjective observation, verification of the propriety for the diagnostic result is difficult, in addition it cannot obtain sufficient reliability. Therefore, we think that the system to compare the shape based on a quantitative evaluation is necessary. To resolve this problem, we propose the system that enables the shape of the brain neural pathway extracted by the tractography technology to be compared quantitatively. The proposed system realized to calculate similarity between two neural pathways, and to display the difference area according to the similarity. (author)

  7. K-Line Patterns’ Predictive Power Analysis Using the Methods of Similarity Match and Clustering

    Directory of Open Access Journals (Sweden)

    Lv Tao

    2017-01-01

    Full Text Available Stock price prediction based on K-line patterns is the essence of candlestick technical analysis. However, there are some disputes on whether the K-line patterns have predictive power in academia. To help resolve the debate, this paper uses the data mining methods of pattern recognition, pattern clustering, and pattern knowledge mining to research the predictive power of K-line patterns. The similarity match model and nearest neighbor-clustering algorithm are proposed for solving the problem of similarity match and clustering of K-line series, respectively. The experiment includes testing the predictive power of the Three Inside Up pattern and Three Inside Down pattern with the testing dataset of the K-line series data of Shanghai 180 index component stocks over the latest 10 years. Experimental results show that (1 the predictive power of a pattern varies a great deal for different shapes and (2 each of the existing K-line patterns requires further classification based on the shape feature for improving the prediction performance.

  8. A novel method for unsteady flow field segmentation based on stochastic similarity of direction

    Science.gov (United States)

    Omata, Noriyasu; Shirayama, Susumu

    2018-04-01

    Recent developments in fluid dynamics research have opened up the possibility for the detailed quantitative understanding of unsteady flow fields. However, the visualization techniques currently in use generally provide only qualitative insights. A method for dividing the flow field into physically relevant regions of interest can help researchers quantify unsteady fluid behaviors. Most methods at present compare the trajectories of virtual Lagrangian particles. The time-invariant features of an unsteady flow are also frequently of interest, but the Lagrangian specification only reveals time-variant features. To address these challenges, we propose a novel method for the time-invariant spatial segmentation of an unsteady flow field. This segmentation method does not require Lagrangian particle tracking but instead quantitatively compares the stochastic models of the direction of the flow at each observed point. The proposed method is validated with several clustering tests for 3D flows past a sphere. Results show that the proposed method reveals the time-invariant, physically relevant structures of an unsteady flow.

  9. Reliability Study Regarding the Use of Histogram Similarity Methods for Damage Detection

    Directory of Open Access Journals (Sweden)

    Nicoleta Gillich

    2013-01-01

    Full Text Available The paper analyses the reliability of three dissimilarity estimators to compare histograms, as support for a frequency-based damage detection method, able to identify structural changes in beam-like structures. First a brief presentation of the own developed damage detection method is made, with focus on damage localization. It consists actually in comparing a histogram derived from measurement results, with a large series of histograms, namely the damage location indexes for all locations along the beam, obtained by calculus. We tested some dissimilarity estimators like the Minkowski-form Distances, the Kullback-Leibler Divergence and the Histogram Intersection and found the Minkowski Distance as the method providing best results. It was tested for numerous locations, using real measurement results and with results artificially debased by noise, proving its reliability.

  10. The In-Medium Similarity Renormalization Group: A novel ab initio method for nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Hergert, H., E-mail: hergert@nscl.msu.edu [National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI 48824 (United States); Department of Physics and Astronomy, Michigan State University, East Lansing, MI 48824 (United States); Department of Physics, The Ohio State University, Columbus, OH 43210 (United States); Bogner, S.K., E-mail: bogner@nscl.msu.edu [National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI 48824 (United States); Department of Physics and Astronomy, Michigan State University, East Lansing, MI 48824 (United States); Morris, T.D., E-mail: morrist@nscl.msu.edu [Department of Physics and Astronomy, Michigan State University, East Lansing, MI 48824 (United States); National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI 48824 (United States); Schwenk, A., E-mail: schwenk@physik.tu-darmstadt.de [Institut für Kernphysik, Technische Universität Darmstadt, 64289 Darmstadt (Germany); ExtreMe Matter Institute EMMI, GSI Helmholtzzentrum für Schwerionenforschung GmbH, 64291 Darmstadt (Germany); Tsukiyama, K., E-mail: tsuki.kr@gmail.com [Center for Nuclear Study, Graduate School of Science, University of Tokyo, Hongo, Tokyo, 113-0033 (Japan)

    2016-03-21

    We present a comprehensive review of the In-Medium Similarity Renormalization Group (IM-SRG), a novel ab initio method for nuclei. The IM-SRG employs a continuous unitary transformation of the many-body Hamiltonian to decouple the ground state from all excitations, thereby solving the many-body problem. Starting from a pedagogical introduction of the underlying concepts, the IM-SRG flow equations are developed for systems with and without explicit spherical symmetry. We study different IM-SRG generators that achieve the desired decoupling, and how they affect the details of the IM-SRG flow. Based on calculations of closed-shell nuclei, we assess possible truncations for closing the system of flow equations in practical applications, as well as choices of the reference state. We discuss the issue of center-of-mass factorization and demonstrate that the IM-SRG ground-state wave function exhibits an approximate decoupling of intrinsic and center-of-mass degrees of freedom, similar to Coupled Cluster (CC) wave functions. To put the IM-SRG in context with other many-body methods, in particular many-body perturbation theory and non-perturbative approaches like CC, a detailed perturbative analysis of the IM-SRG flow equations is carried out. We conclude with a discussion of ongoing developments, including IM-SRG calculations with three-nucleon forces, the multi-reference IM-SRG for open-shell nuclei, first non-perturbative derivations of shell-model interactions, and the consistent evolution of operators in the IM-SRG. We dedicate this review to the memory of Gerry Brown, one of the pioneers of many-body calculations of nuclei.

  11. The In-Medium Similarity Renormalization Group: A novel ab initio method for nuclei

    International Nuclear Information System (INIS)

    Hergert, H.; Bogner, S.K.; Morris, T.D.; Schwenk, A.; Tsukiyama, K.

    2016-01-01

    We present a comprehensive review of the In-Medium Similarity Renormalization Group (IM-SRG), a novel ab initio method for nuclei. The IM-SRG employs a continuous unitary transformation of the many-body Hamiltonian to decouple the ground state from all excitations, thereby solving the many-body problem. Starting from a pedagogical introduction of the underlying concepts, the IM-SRG flow equations are developed for systems with and without explicit spherical symmetry. We study different IM-SRG generators that achieve the desired decoupling, and how they affect the details of the IM-SRG flow. Based on calculations of closed-shell nuclei, we assess possible truncations for closing the system of flow equations in practical applications, as well as choices of the reference state. We discuss the issue of center-of-mass factorization and demonstrate that the IM-SRG ground-state wave function exhibits an approximate decoupling of intrinsic and center-of-mass degrees of freedom, similar to Coupled Cluster (CC) wave functions. To put the IM-SRG in context with other many-body methods, in particular many-body perturbation theory and non-perturbative approaches like CC, a detailed perturbative analysis of the IM-SRG flow equations is carried out. We conclude with a discussion of ongoing developments, including IM-SRG calculations with three-nucleon forces, the multi-reference IM-SRG for open-shell nuclei, first non-perturbative derivations of shell-model interactions, and the consistent evolution of operators in the IM-SRG. We dedicate this review to the memory of Gerry Brown, one of the pioneers of many-body calculations of nuclei.

  12. 32 CFR 199.14 - Provider reimbursement methods.

    Science.gov (United States)

    2010-07-01

    ... physicians. (6) All services provided by nurse anesthetists. (7) All services related to discharges involving... more accurate data became available. (v) No update for inflation. The children's hospital differential... considered lower volume hospitals. (B) Hospitals that subsequently become higher volume hospitals. In any...

  13. Methodical Approaches to Communicative Providing of Retailer Branding

    Directory of Open Access Journals (Sweden)

    Andrey Kataev

    2017-07-01

    Full Text Available The thesis is devoted to the rationalization of methodical approaches for provision of branding of retail trade enterprises. The article considers the features of brand perception by retail consumers and clarifies the specifics of customer reviews of stores for the procedures accompanying brand management. It is proved that besides traditional communication mix, the most important tool of communicative influence on buyers is the store itself as a place for comfortable shopping. The shop should have a stimulating effect on all five human senses, including sight, smell, hearing, touch, and taste, which shall help maximize consumer integration into the buying process.

  14. New Similarity Functions

    DEFF Research Database (Denmark)

    Yazdani, Hossein; Ortiz-Arroyo, Daniel; Kwasnicka, Halina

    2016-01-01

    spaces, in addition to their similarity in the vector space. Prioritized Weighted Feature Distance (PWFD) works similarly as WFD, but provides the ability to give priorities to desirable features. The accuracy of the proposed functions are compared with other similarity functions on several data sets....... Our results show that the proposed functions work better than other methods proposed in the literature....

  15. Testing statistical significance scores of sequence comparison methods with structure similarity

    Directory of Open Access Journals (Sweden)

    Leunissen Jack AM

    2006-10-01

    Full Text Available Abstract Background In the past years the Smith-Waterman sequence comparison algorithm has gained popularity due to improved implementations and rapidly increasing computing power. However, the quality and sensitivity of a database search is not only determined by the algorithm but also by the statistical significance testing for an alignment. The e-value is the most commonly used statistical validation method for sequence database searching. The CluSTr database and the Protein World database have been created using an alternative statistical significance test: a Z-score based on Monte-Carlo statistics. Several papers have described the superiority of the Z-score as compared to the e-value, using simulated data. We were interested if this could be validated when applied to existing, evolutionary related protein sequences. Results All experiments are performed on the ASTRAL SCOP database. The Smith-Waterman sequence comparison algorithm with both e-value and Z-score statistics is evaluated, using ROC, CVE and AP measures. The BLAST and FASTA algorithms are used as reference. We find that two out of three Smith-Waterman implementations with e-value are better at predicting structural similarities between proteins than the Smith-Waterman implementation with Z-score. SSEARCH especially has very high scores. Conclusion The compute intensive Z-score does not have a clear advantage over the e-value. The Smith-Waterman implementations give generally better results than their heuristic counterparts. We recommend using the SSEARCH algorithm combined with e-values for pairwise sequence comparisons.

  16. Short-arm human centrifugation with 0.4g at eye and 0.75g at heart level provides similar cerebrovascular and cardiovascular responses to standing.

    Science.gov (United States)

    Goswami, Nandu; Bruner, Michelle; Xu, Da; Bareille, Marie-Pierre; Beck, Arnaud; Hinghofer-Szalkay, Helmut; Blaber, Andrew P

    2015-07-01

    Orthostatic intolerance continues to be a problem with astronauts upon return to Earth as a result of cerebral and cardiovascular adaptations to weightlessness. We tested the hypothesis that artificial gravity from a short-arm human centrifuge (SAHC) could provide cerebral and cardiovascular stimuli similar to upright posture and thereby serve as a suitable countermeasure. We compared cardiovascular and cerebrovascular responses before, during, and after exposure to hyper-G with that of standing in healthy young participants. The head was positioned such that the middle cerebral artery (MCA) was 0.46 m from the center of rotation. Two levels of hyper-G that provided 1g and 2g at foot level were investigated. Continuous blood pressure, heart rate, calf blood volume, MCA mean blood flow velocity (MFV) and end-tidal CO2 were measured. Blood pressure at the level of the MCA (BP-MCA) and MFV was reduced during stand and at 2g. The relationship between MFV and BP-MCA at 2g was different from supine and similar to standing, while 1g centrifugation was not different from supine. The cardiovascular system was also not different from supine at 1g but was similarly challenged in 2g compared to stand. Our data suggest that short-arm centrifugation 2g at the feet, with the head offset 0.5 m from the center, provides similar cardiovascular and cerebral responses to standing. This supports the hypothesis that passive 2g SAHC exposure at the feet could be used as a countermeasure for in-flight cardiovascular and cerebrovascular deconditioning.

  17. Composites Similarity Analysis Method Based on Knowledge Set in Composites Quality Control

    OpenAIRE

    Li Haifeng

    2016-01-01

    Composites similarity analysis is an important link of composites review, it can not only to declare composites review rechecking, still help composites applicants promptly have the research content relevant progress and avoid duplication. This paper mainly studies the composites similarity model in composites review. With the actual experience of composites management, based on the author’s knowledge set theory, paper analyzes deeply knowledge set representation of composites knowledge, impr...

  18. Comparison between statistical and optimization methods in accessing unmixing of spectrally similar materials

    CSIR Research Space (South Africa)

    Debba, Pravesh

    2010-11-01

    Full Text Available This paper reports on the results from ordinary least squares and ridge regression as statistical methods, and is compared to numerical optimization methods such as the stochastic method for global optimization, simulated annealing, particle swarm...

  19. Position detectors, methods of detecting position, and methods of providing positional detectors

    Science.gov (United States)

    Weinberg, David M.; Harding, L. Dean; Larsen, Eric D.

    2002-01-01

    Position detectors, welding system position detectors, methods of detecting various positions, and methods of providing position detectors are described. In one embodiment, a welding system positional detector includes a base that is configured to engage and be moved along a curved surface of a welding work piece. At least one position detection apparatus is provided and is connected with the base and configured to measure angular position of the detector relative to a reference vector. In another embodiment, a welding system positional detector includes a weld head and at least one inclinometer mounted on the weld head. The one inclinometer is configured to develop positional data relative to a reference vector and the position of the weld head on a non-planar weldable work piece.

  20. THIRD PARTY LOGISTIC SERVICE PROVIDER SELECTION USING FUZZY AHP AND TOPSIS METHOD

    Directory of Open Access Journals (Sweden)

    Golam Kabir

    2012-03-01

    Full Text Available The use of third party logistic(3PL services providers is increasing globally to accomplish the strategic objectives. In the increasingly competitive environment, logistics strategic management requires systematic and structured approach to have cutting edge over the rival. Logistics service provider selection is a complex multi-criteria decision making process; in which, decision makers have to deals with the optimization of conflicting objectives such as quality, cost, and delivery time. In this paper, fuzzy analytic hierarchy process (FAHP approach based on technique for order preference by similarity to ideal solution (TOPSIS method has been proposed for evaluating and selecting an appropriate logistics service provider, where the ratings of each alternative and importance weight of each criterion are expressed in triangular fuzzy numbers.

  1. Thickness measuring apparatus and method for tire ply and similar materials

    International Nuclear Information System (INIS)

    Cho, B.Y.; Utt, O.L.

    1978-01-01

    The invention relates to method and apparatus for measuring the amount of material on opposite sides of the reinforcing cord of a tire ply, and more particularly relates to a backscatter X-ray radiation gauging apparatus and method for obtaining the aforesaid measurements. (author)

  2. One-stage exchange with antibacterial hydrogel coated implants provides similar results to two-stage revision, without the coating, for the treatment of peri-prosthetic infection.

    Science.gov (United States)

    Capuano, Nicola; Logoluso, Nicola; Gallazzi, Enrico; Drago, Lorenzo; Romanò, Carlo Luca

    2018-03-16

    Aim of this study was to verify the hypothesis that a one-stage exchange procedure, performed with an antibiotic-loaded, fast-resorbable hydrogel coating, provides similar infection recurrence rate than a two-stage procedure without the coating, in patients affected by peri-prosthetic joint infection (PJI). In this two-center case-control, study, 22 patients, treated with a one-stage procedure, using implants coated with an antibiotic-loaded hydrogel [defensive antibacterial coating (DAC)], were compared with 22 retrospective matched controls, treated with a two-stage revision procedure, without the coating. At a mean follow-up of 29.3 ± 5.0 months, two patients (9.1%) in the DAC group showed an infection recurrence, compared to three patients (13.6%) in the two-stage group. Clinical scores were similar between groups, while average hospital stay and antibiotic treatment duration were significantly reduced after one-stage, compared to two-stage (18.9 ± 2.9 versus 35.8 ± 3.4 and 23.5 ± 3.3 versus 53.7 ± 5.6 days, respectively). Although in a relatively limited series of patients, our data shows similar infection recurrence rate after one-stage exchange with DAC-coated implants, compared to two-stage revision without coating, with reduced overall hospitalization time and antibiotic treatment duration. These findings warrant further studies in the possible applications of antibacterial coating technologies to treat implant-related infections. III.

  3. Single shot “3-in-1” femoral nerve blockade with 0.25% or 0.375% levobupivacaine provides similar postoperative analgesia for total knee replacement

    OpenAIRE

    APAN, Alpaslan; SARI, Filiz; EKMEKÇİ, Alp Burak

    2010-01-01

    To compare postoperative analgesia provided by single shot "3-in-1" femoral nerve blockade using 0.25% or 0.375% levobupivacaine in preceding with spinal anesthesia for unilateral total knee replacement surgery. Materials and methods: Forty consenting patients undergoing unilateral total knee arthroplasty were included in this prospective randomized study. Spinal anesthesia was achieved with 15 mg plain bupivacaine at the L3-4 or L4-5 interspace. After resolution of the sp...

  4. Intelligent method of plant dynamics behavior estimation by effectively applying similar cases

    International Nuclear Information System (INIS)

    Gofuku, Akio; Numoto, Atsushi; Yoshikawa, Hidekazu

    1994-01-01

    In order to accomplish efficient execution of a dynamic simulation of engineering systems, it is important to construct suitable mathematical models for the simulation. In the construction of the mathematical models, it is necessary to estimate the system's behavior to suppose the phenomena which are needed to be modeled. The case-based reasoning is considered to be a powerful tool to estimate the outline of system's behavior because we often estimate it from the similar cases which are stored as our experience or in literature. In this study, the technique based on similar cases is investigated to estimate the outline of time-responses of several important variables of pressurized water reactor (PWR) plants at a small break loss of coolant accident (SBLOCA). The registered cases in case base are gathered from various reports and the authors' numerical simulations related with SBLOCA of PWR plants. The functions to use in the case retrieval are formed from the characteristic features of SBLOCA of PWR plants. On the other hand, the rules to use in the case refinement are obtained from the qualitative and quantitative consideration of plants' behaviors of the cases in the case base. The applicability of the technique is discussed by two simple estimation trials of plant behavior. (author)

  5. Measuring age differences among globular clusters having similar metallicities - A new method and first results

    International Nuclear Information System (INIS)

    Vandenberg, D.A.; Bolte, M.; Stetson, P.B.

    1990-01-01

    A color-difference technique for estimating the relative ages of globular clusters with similar chemical compositions on the basis of their CM diagrams is described and demonstrated. The theoretical basis and implementation of the procedure are explained, and results for groups of globular clusters with m/H = about -2, -1.6, and -1.3, and for two special cases (Palomar 12 and NGC 5139) are presented in extensive tables and graphs and discussed in detail. It is found that the more metal-deficient globular clusters are nearly coeval (differences less than 0.5 Gyr), whereas the most metal-rich globular clusters exhibit significant age differences (about 2 Gyr). This result is shown to contradict Galactic evolution models postulating halo collapse in less than a few times 100 Myr. 77 refs

  6. Application of clustering methods: Regularized Markov clustering (R-MCL) for analyzing dengue virus similarity

    Science.gov (United States)

    Lestari, D.; Raharjo, D.; Bustamam, A.; Abdillah, B.; Widhianto, W.

    2017-07-01

    Dengue virus consists of 10 different constituent proteins and are classified into 4 major serotypes (DEN 1 - DEN 4). This study was designed to perform clustering against 30 protein sequences of dengue virus taken from Virus Pathogen Database and Analysis Resource (VIPR) using Regularized Markov Clustering (R-MCL) algorithm and then we analyze the result. By using Python program 3.4, R-MCL algorithm produces 8 clusters with more than one centroid in several clusters. The number of centroid shows the density level of interaction. Protein interactions that are connected in a tissue, form a complex protein that serves as a specific biological process unit. The analysis of result shows the R-MCL clustering produces clusters of dengue virus family based on the similarity role of their constituent protein, regardless of serotypes.

  7. Lyme Disease Diagnosed by Alternative Methods: A Phenotype Similar to That of Chronic Fatigue Syndrome.

    Science.gov (United States)

    Patrick, David M; Miller, Ruth R; Gardy, Jennifer L; Parker, Shoshana M; Morshed, Muhammad G; Steiner, Theodore S; Singer, Joel; Shojania, Kam; Tang, Patrick

    2015-10-01

    A subset of patients reporting a diagnosis of Lyme disease can be described as having alternatively diagnosed chronic Lyme syndrome (ADCLS), in which diagnosis is based on laboratory results from a nonreference Lyme specialty laboratory using in-house criteria. Patients with ADCLS report symptoms similar to those reported by patients with chronic fatigue syndrome (CFS). We performed a case-control study comparing patients with ADCLS and CFS to each other and to both healthy controls and controls with systemic lupus erythematosus (SLE). Subjects completed a history, physical exam, screening laboratory tests, 7 functional scales, reference serology for Lyme disease using Centers for Disease Control and Prevention criteria, reference serology for other tick-associated pathogens, and cytokine expression studies. The study enrolled 13 patients with ADCLS (12 of whom were diagnosed by 1 alternative US laboratory), 25 patients with CFS, 25 matched healthy controls, and 11 SLE controls. Baseline clinical data and functional scales indicate significant disability among ADCLS and CFS patients and many important differences between these groups and controls, but no significant differences between each other. No ADCLS patient was confirmed as having positive Lyme serology by reference laboratory testing, and there was no difference in distribution of positive serology for other tick-transmitted pathogens or cytokine expression across the groups. In British Columbia, a setting with low Lyme disease incidence, ADCLS patients have a similar phenotype to that of CFS patients. Disagreement between alternative and reference laboratory Lyme testing results in this setting is most likely explained by false-positive results from the alternative laboratory. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. IntNetLncSim: an integrative network analysis method to infer human lncRNA functional similarity.

    Science.gov (United States)

    Cheng, Liang; Shi, Hongbo; Wang, Zhenzhen; Hu, Yang; Yang, Haixiu; Zhou, Chen; Sun, Jie; Zhou, Meng

    2016-07-26

    Increasing evidence indicated that long non-coding RNAs (lncRNAs) were involved in various biological processes and complex diseases by communicating with mRNAs/miRNAs each other. Exploiting interactions between lncRNAs and mRNA/miRNAs to lncRNA functional similarity (LFS) is an effective method to explore function of lncRNAs and predict novel lncRNA-disease associations. In this article, we proposed an integrative framework, IntNetLncSim, to infer LFS by modeling the information flow in an integrated network that comprises both lncRNA-related transcriptional and post-transcriptional information. The performance of IntNetLncSim was evaluated by investigating the relationship of LFS with the similarity of lncRNA-related mRNA sets (LmRSets) and miRNA sets (LmiRSets). As a result, LFS by IntNetLncSim was significant positively correlated with the LmRSet (Pearson correlation γ2=0.8424) and LmiRSet (Pearson correlation γ2=0.2601). Particularly, the performance of IntNetLncSim is superior to several previous methods. In the case of applying the LFS to identify novel lncRNA-disease relationships, we achieved an area under the ROC curve (0.7300) in experimentally verified lncRNA-disease associations based on leave-one-out cross-validation. Furthermore, highly-ranked lncRNA-disease associations confirmed by literature mining demonstrated the excellent performance of IntNetLncSim. Finally, a web-accessible system was provided for querying LFS and potential lncRNA-disease relationships: http://www.bio-bigdata.com/IntNetLncSim.

  9. Similar estimates of temperature impacts on global wheat yield by three independent methods

    NARCIS (Netherlands)

    Liu, Bing; Asseng, Senthold; Müller, Christoph; Ewert, Frank; Elliott, Joshua; Lobell, David B.; Martre, Pierre; Ruane, Alex C.; Wallach, Daniel; Jones, James W.; Supit, Iwan; Wolf, Joost

    2016-01-01

    The potential impact of global temperature change on global crop yield has recently been assessed with different methods. Here we show that grid-based and point-based simulations and statistical regressions (from historic records), without deliberate adaptation or CO 2 fertilization effects,

  10. SemFunSim: a new method for measuring disease similarity by integrating semantic and gene functional association.

    Directory of Open Access Journals (Sweden)

    Liang Cheng

    Full Text Available Measuring similarity between diseases plays an important role in disease-related molecular function research. Functional associations between disease-related genes and semantic associations between diseases are often used to identify pairs of similar diseases from different perspectives. Currently, it is still a challenge to exploit both of them to calculate disease similarity. Therefore, a new method (SemFunSim that integrates semantic and functional association is proposed to address the issue.SemFunSim is designed as follows. First of all, FunSim (Functional similarity is proposed to calculate disease similarity using disease-related gene sets in a weighted network of human gene function. Next, SemSim (Semantic Similarity is devised to calculate disease similarity using the relationship between two diseases from Disease Ontology. Finally, FunSim and SemSim are integrated to measure disease similarity.The high average AUC (area under the receiver operating characteristic curve (96.37% shows that SemFunSim achieves a high true positive rate and a low false positive rate. 79 of the top 100 pairs of similar diseases identified by SemFunSim are annotated in the Comparative Toxicogenomics Database (CTD as being targeted by the same therapeutic compounds, while other methods we compared could identify 35 or less such pairs among the top 100. Moreover, when using our method on diseases without annotated compounds in CTD, we could confirm many of our predicted candidate compounds from literature. This indicates that SemFunSim is an effective method for drug repositioning.

  11. Detecting and classifying method based on similarity matching of Android malware behavior with profile.

    Science.gov (United States)

    Jang, Jae-Wook; Yun, Jaesung; Mohaisen, Aziz; Woo, Jiyoung; Kim, Huy Kang

    2016-01-01

    Mass-market mobile security threats have increased recently due to the growth of mobile technologies and the popularity of mobile devices. Accordingly, techniques have been introduced for identifying, classifying, and defending against mobile threats utilizing static, dynamic, on-device, and off-device techniques. Static techniques are easy to evade, while dynamic techniques are expensive. On-device techniques are evasion, while off-device techniques need being always online. To address some of those shortcomings, we introduce Andro-profiler, a hybrid behavior based analysis and classification system for mobile malware. Andro-profiler main goals are efficiency, scalability, and accuracy. For that, Andro-profiler classifies malware by exploiting the behavior profiling extracted from the integrated system logs including system calls. Andro-profiler executes a malicious application on an emulator in order to generate the integrated system logs, and creates human-readable behavior profiles by analyzing the integrated system logs. By comparing the behavior profile of malicious application with representative behavior profile for each malware family using a weighted similarity matching technique, Andro-profiler detects and classifies it into malware families. The experiment results demonstrate that Andro-profiler is scalable, performs well in detecting and classifying malware with accuracy greater than 98 %, outperforms the existing state-of-the-art work, and is capable of identifying 0-day mobile malware samples.

  12. Similar predictions of etravirine sensitivity regardless of genotypic testing method used: comparison of available scoring systems.

    Science.gov (United States)

    Vingerhoets, Johan; Nijs, Steven; Tambuyzer, Lotke; Hoogstoel, Annemie; Anderson, David; Picchio, Gaston

    2012-01-01

    The aims of this study were to compare various genotypic scoring systems commonly used to predict virological outcome to etravirine, and examine their concordance with etravirine phenotypic susceptibility. Six etravirine genotypic scoring systems were assessed: Tibotec 2010 (based on 20 mutations; TBT 20), Monogram, Stanford HIVdb, ANRS, Rega (based on 37, 30, 27 and 49 mutations, respectively) and virco(®)TYPE HIV-1 (predicted fold change based on genotype). Samples from treatment-experienced patients who participated in the DUET trials and with both genotypic and phenotypic data (n=403) were assessed using each scoring system. Results were retrospectively correlated with virological response in DUET. κ coefficients were calculated to estimate the degree of correlation between the different scoring systems. Correlation between the five scoring systems and the TBT 20 system was approximately 90%. Virological response by etravirine susceptibility was comparable regardless of which scoring system was utilized, with 70-74% of DUET patients determined as susceptible to etravirine by the different scoring systems achieving plasma viral load <50 HIV-1 RNA copies/ml. In samples classed as phenotypically susceptible to etravirine (fold change in 50% effective concentration ≤3), correlations with genotypic score were consistently high across scoring systems (≥70%). In general, the etravirine genotypic scoring systems produced similar results, and genotype-phenotype concordance was high. As such, phenotypic interpretations, and in their absence all genotypic scoring systems investigated, may be used to reliably predict the activity of etravirine.

  13. Different methods to define utility functions yield similar results but engage different neural processes

    Directory of Open Access Journals (Sweden)

    Marcus Heldmann

    2009-10-01

    Full Text Available Although the concept of utility is fundamental to many economic theories, up to now a generally accepted method determining a subject’s utility function is not available. We investigated two methods that are used in economic sciences for describing utility functions by using response-locked event-related potentials in order to assess their neural underpinnings. For defining the certainty equivalent (CE, we used a lottery game with probabilities to win p=0.5, for identifying the subjects’ utility functions directly a standard bisection task was applied. Although the lottery tasks’ payoffs were only hypothetical, a pronounced negativity was observed resembling the error related negativity (ERN previously described in action monitoring research, but this occurred only for choices far away from the indifference point between money and lottery. By contrast, the bisection task failed to evoke an ERN irrespective of the responses’ correctness. Based on these findings we are reasoning that only decisions made in the lottery task achieved a level of subjective relevance that activates cognitive-emotional monitoring. In terms of economic sciences, our findings support the view that the bisection method is unaffected by any kind of probability valuation or other parameters related to risk and in combination with the lottery task can, therefore, be used to differentiate between payoff and probability valuation.

  14. Determining when a fracture occurred: Does the method matter? Analysis of the similarity of three different methods for estimating time since fracture of juvenile long bones.

    Science.gov (United States)

    Drury, Anne; Cunningham, Craig

    2018-01-01

    Radiographic fracture date estimation is a critical component of skeletal trauma analysis in the living. Several timetables have been proposed for how the appearance of radiographic features can be interpreted to provide a likely time frame for fracture occurrence. This study compares three such timetables for pediatric fractures, by Islam et al. (2000), Malone et al. (2011), and Prosser et al. (2012), in order to determine whether the fracture date ranges produced by using these methods are in agreement with one another. Fracture date ranges were estimated for 112 long bone fractures in 96 children aged 1-17 years, using the three different timetables. The extent of similarity of the intervals was tested by statistically comparing the overlap between the ranges. Results showed that none of the methods were in perfect agreement with one another. Differences seen included the size of the estimated date range for when a fracture occurred, and the specific dates given for both the upper and lower ends of the fracture date range. There was greater similarity between the ranges produced by Malone et al. (2011) and both the other two studies than there was between Islam et al. (2000) and Prosser et al. (2012). The greatest similarity existed between Malone et al. (2011) and Islam et al. (2000). The extent of differences between methods can vary widely, depending on the fracture analysed. Using one timetable gives an average earliest possible fracture date of less than 2 days before another, but the range was extreme, with one method estimating minimum time since fracture as 25 days before another method for a given fracture. In most cases, one method gave maximum time since fracture as a week less than the other two methods, but range was extreme and some estimates were nearly two months different. The variability in fracture date estimates given by these timetables indicates that caution should be exercised when estimating the timing of a juvenile fracture if relying

  15. Generalized method for sorting Shack-Hartmann spot patterns using local similarity

    International Nuclear Information System (INIS)

    Smith, Daniel G.; Greivenkamp, John E.

    2008-01-01

    The sensitivity and dynamic range of a Shack-Hartmann wavefront sensor is enhanced when the spots produced by the lenslet array are allowed to shift more than one lenslet radius from their on-axis positions. However, this presents the problem of accurately and robustly associating the spots with their respective subapertures. This paper describes a method for sorting spots that takes advantage of the local spot position distortions to unwrap the spot pattern. The described algorithm is both simple and robust and also applicable to any lenslet array geometry that can be described as a two-dimensional lattice, including hexagonal arrays, which are shown here to be more efficient than square arrays

  16. On the similarities between micro/nano lithography and topology optimization projection methods

    DEFF Research Database (Denmark)

    Jansen, Miche; Lazarov, Boyan Stefanov; Schevenels, Mattias

    2013-01-01

    The aim of this paper is to incorporate a model for micro/nano lithography production processes in topology optimization. The production process turns out to provide a physical analogy for projection filters in topology optimization. Blueprints supplied by the designers cannot be directly used...... as inputs to lithographic processes due to the proximity effect which causes rounding of sharp corners and geometric interaction of closely spaced design elements. Therefore, topology optimization is applied as a tool for proximity effect correction. Furthermore, it is demonstrated that the robust...... projection filter can be used to account for uncertainties due to lithographic production processes which results in manufacturable blueprint designs and eliminates the need for subsequent corrections....

  17. An adaptive image sparse reconstruction method combined with nonlocal similarity and cosparsity for mixed Gaussian-Poisson noise removal

    Science.gov (United States)

    Chen, Yong-fei; Gao, Hong-xia; Wu, Zi-ling; Kang, Hui

    2018-01-01

    Compressed sensing (CS) has achieved great success in single noise removal. However, it cannot restore the images contaminated with mixed noise efficiently. This paper introduces nonlocal similarity and cosparsity inspired by compressed sensing to overcome the difficulties in mixed noise removal, in which nonlocal similarity explores the signal sparsity from similar patches, and cosparsity assumes that the signal is sparse after a possibly redundant transform. Meanwhile, an adaptive scheme is designed to keep the balance between mixed noise removal and detail preservation based on local variance. Finally, IRLSM and RACoSaMP are adopted to solve the objective function. Experimental results demonstrate that the proposed method is superior to conventional CS methods, like K-SVD and state-of-art method nonlocally centralized sparse representation (NCSR), in terms of both visual results and quantitative measures.

  18. Study for the design method of multi-agent diagnostic system to improve diagnostic performance for similar abnormality

    International Nuclear Information System (INIS)

    Minowa, Hirotsugu; Gofuku, Akio

    2014-01-01

    Accidents on industrial plants cause large loss on human, economic, social credibility. In recent, studies of diagnostic methods using techniques of machine learning such as support vector machine is expected to detect the occurrence of abnormality in a plant early and correctly. There were reported that these diagnostic machines has high accuracy to diagnose the operating state of industrial plant under mono abnormality occurrence. But the each diagnostic machine on the multi-agent diagnostic system may misdiagnose similar abnormalities as a same abnormality if abnormalities to diagnose increases. That causes that a single diagnostic machine may show higher diagnostic performance than one of multi-agent diagnostic system because decision-making considering with misdiagnosis is difficult. Therefore, we study the design method for multi-agent diagnostic system to diagnose similar abnormality correctly. This method aimed to realize automatic generation of diagnostic system where the generation process and location of diagnostic machines are optimized to diagnose correctly the similar abnormalities which are evaluated from the similarity of process signals by statistical method. This paper explains our design method and reports the result evaluated our method applied to the process data of the fast-breeder reactor Monju

  19. Neutron-Gamma Pulse Shape Discrimination With Ne-213 Liquid Scintillator By Using Digital Signal Processing Combined With Similarity Method

    International Nuclear Information System (INIS)

    Mardiyanto

    2008-01-01

    Neutron-Gamma Pulse Shape Discrimination with a NE-213 Liquid Scintillator by Using Digital Signal Processing Combined with Similarity Method. Measurement of mixed neutron-gamma radiation is difficult because a nuclear detector is usually sensitive to both radiations. A new attempt of neutron-gamma pulse shape discrimination for a NE-213 liquid scintillator is presented by using digital signal processing combined with an off-line similarity method. The output pulse shapes are digitized with a high speed digital oscilloscope. The n-γ discrimination is done by calculating the index of each pulse shape, which is determined by the similarity method, and then fusing it with its corresponding pulse height. Preliminary results demonstrate good separation of neutron and gamma-ray signals from a NE-213 scintillator with a simple digital system. The results were better than those with a conventional rise time method. Figure of Merit is used to determine the quality of discrimination. The figure of merit of the discrimination using digital signal processing combined with off-line similarity method are 1.9; 1.7; 1.1; 1.1; and 0.8; on the other hand by using conventional method the rise time are 0.9; 0.9; 0.9; 0.7; and 0.4 for the equivalent electron energy of 800; 278; 139; 69; and 30 keV. (author)

  20. Distinguishing the Chinese materia medica Tiepishihu from similar Dendrobium species of the same genus using histological and microscopic method.

    Science.gov (United States)

    Yu, Kun-Zi; Yan, Hua; Tai, Hai-Chuan; Zhang, Nan-Ping; Cheng, Xian-Long; Guo, Zeng-Xi; Ma, Shuang-Cheng; Wei, Feng

    2017-07-01

    The Chinese Materia Medica, Tiepishihu, used as a tonic for over one thousand years, is a well-known precious medicine in China. According to the Chinese Pharmacopoeia, its source is the species Dendrobium officinale Kimura et Migo, which is distinguished from other species in Dendrobium genus. However, these species from the same genus are similar with Tiepishihu and caused confusion in the market. To find a quick and simple method to distinguish Tiepishihu from other similar species, histologic and microscopic methods were combined together to investigate the transverse section of stem of Tiepishihu and other similar species. Phloroglucinol test solution with hydrochloric acid was used to reveal the lignified tissue by staining the transverse section of Tiepishihu and similar species. Results revealed the unique identification characteristics to distinguish Tiepishihu from similar species, which were difficult to distinguish by other methods. The identification characteristics of Tiepishihu include the cells of vascular bundle sheath were stained red, parenchyma cells were not stained red. What's more, other species can be distinguished from each other with microscopic and histological characteristics. These characteristics proved stable and can be easily observed by normal light microscopic examination. This method is rapid, accurate, stable, and inexpensive. © 2017 Wiley Periodicals, Inc.

  1. Usefulness of computerized method for lung nodule detection on digital chest radiographs using similar subtraction images from different patients

    International Nuclear Information System (INIS)

    Aoki, Takatoshi; Oda, Nobuhiro; Yamashita, Yoshiko; Yamamoto, Keiji; Korogi, Yukunori

    2012-01-01

    Purpose: The purpose of this study is to evaluate the usefulness of a novel computerized method to select automatically the similar chest radiograph for image subtraction in the patients who have no previous chest radiographs and to assist the radiologists’ interpretation by presenting the “similar subtraction image” from different patients. Materials and methods: Institutional review board approval was obtained, and the requirement for informed patient consent was waived. A large database of approximately 15,000 normal chest radiographs was used for searching similar images of different patients. One hundred images of candidates were selected according to two clinical parameters and similarity of the lung field in the target image. We used the correlation value of chest region in the 100 images for searching the most similar image. The similar subtraction images were obtained by subtracting the similar image selected from the target image. Thirty cases with lung nodules and 30 cases without lung nodules were used for an observer performance test. Four attending radiologists and four radiology residents participated in this observer performance test. Results: The AUC for all radiologists increased significantly from 0.925 to 0.974 with the CAD (P = .004). When the computer output images were available, the average AUC for the residents was more improved (0.960 vs. 0.890) than for the attending radiologists (0.987 vs. 0.960). Conclusion: The novel computerized method for lung nodule detection using similar subtraction images from different patients would be useful to detect lung nodules on digital chest radiographs, especially for less experienced readers.

  2. Similarities and differences between Turkic languages and comparative methods in teaching them

    Directory of Open Access Journals (Sweden)

    Gyulzura Zhumakunova

    2018-03-01

    Full Text Available Turkic languages are cognate language which stem back to the single ancestor – Proto-Turkic language. In the course of long and convoluted history of Turkic-speaking peoples, all of their languages suffered various degrees of change on every level of its structure – in phonemes, morphemes, vocabulary and syntax. At the same time, all of these languages have preserved some of their common features which link them to their ancestor tongue. In this article, the author, from her long experience of teaching Kyrgyz at Ankara University, explains her vision of teaching Turkic languages in general and describes the methods and approaches which she deems helpful in successful teaching on university level. In teaching a Turkic language, the main objective is not to focus on language study as such, but take a breathtaking journey along the hidden paths of one’s mother tongue and get to understand it in a more profound way, in its historical retrospective. Turkic languages have always attracted linguists and were in the focus of their studies. Getting acquainted with various linguistic theories and the works of prominent Turkologists, as seen from teaching practice, is also very helpful to shape an enduring interest in learning both the target language and first language more profoundly. We also have to take into account such extralinguistic factors as the objective of language study, friendliness of the environment and the demand for language in a given environment. The article examines these issues through the alphabets and their various uses among Turkic peoples. When setting up a language study program, it is also important to take into account how familiar students are with the target language. Overall, this new type of work required a fundamental study of methodological foundations of language teaching. New types of academic and learners’ dictionaries have to be prepared, as well as new textbooks to help students of a specific Turkic language.

  3. 3D–2D image registration for target localization in spine surgery: investigation of similarity metrics providing robustness to content mismatch

    International Nuclear Information System (INIS)

    De Silva, T; Ketcha, M D; Siewerdsen, J H; Uneri, A; Reaungamornrat, S; Kleinszig, G; Vogt, S; Aygun, N; Lo, S-F; Wolinsky, J-P

    2016-01-01

    In image-guided spine surgery, robust three-dimensional to two-dimensional (3D–2D) registration of preoperative computed tomography (CT) and intraoperative radiographs can be challenged by the image content mismatch associated with the presence of surgical instrumentation and implants as well as soft-tissue resection or deformation. This work investigates image similarity metrics in 3D–2D registration offering improved robustness against mismatch, thereby improving performance and reducing or eliminating the need for manual masking. The performance of four gradient-based image similarity metrics (gradient information (GI), gradient correlation (GC), gradient information with linear scaling (GS), and gradient orientation (GO)) with a multi-start optimization strategy was evaluated in an institutional review board-approved retrospective clinical study using 51 preoperative CT images and 115 intraoperative mobile radiographs. Registrations were tested with and without polygonal masks as a function of the number of multistarts employed during optimization. Registration accuracy was evaluated in terms of the projection distance error (PDE) and assessment of failure modes (PDE  >  30 mm) that could impede reliable vertebral level localization. With manual polygonal masking and 200 multistarts, the GC and GO metrics exhibited robust performance with 0% gross failures and median PDE  <  6.4 mm (±4.4 mm interquartile range (IQR)) and a median runtime of 84 s (plus upwards of 1–2 min for manual masking). Excluding manual polygonal masks and decreasing the number of multistarts to 50 caused the GC-based registration to fail at a rate of  >14%; however, GO maintained robustness with a 0% gross failure rate. Overall, the GI, GC, and GS metrics were susceptible to registration errors associated with content mismatch, but GO provided robust registration (median PDE  =  5.5 mm, 2.6 mm IQR) without manual masking and with an improved

  4. 3D-2D image registration for target localization in spine surgery: investigation of similarity metrics providing robustness to content mismatch

    Science.gov (United States)

    De Silva, T.; Uneri, A.; Ketcha, M. D.; Reaungamornrat, S.; Kleinszig, G.; Vogt, S.; Aygun, N.; Lo, S.-F.; Wolinsky, J.-P.; Siewerdsen, J. H.

    2016-04-01

    In image-guided spine surgery, robust three-dimensional to two-dimensional (3D-2D) registration of preoperative computed tomography (CT) and intraoperative radiographs can be challenged by the image content mismatch associated with the presence of surgical instrumentation and implants as well as soft-tissue resection or deformation. This work investigates image similarity metrics in 3D-2D registration offering improved robustness against mismatch, thereby improving performance and reducing or eliminating the need for manual masking. The performance of four gradient-based image similarity metrics (gradient information (GI), gradient correlation (GC), gradient information with linear scaling (GS), and gradient orientation (GO)) with a multi-start optimization strategy was evaluated in an institutional review board-approved retrospective clinical study using 51 preoperative CT images and 115 intraoperative mobile radiographs. Registrations were tested with and without polygonal masks as a function of the number of multistarts employed during optimization. Registration accuracy was evaluated in terms of the projection distance error (PDE) and assessment of failure modes (PDE  >  30 mm) that could impede reliable vertebral level localization. With manual polygonal masking and 200 multistarts, the GC and GO metrics exhibited robust performance with 0% gross failures and median PDE  interquartile range (IQR)) and a median runtime of 84 s (plus upwards of 1-2 min for manual masking). Excluding manual polygonal masks and decreasing the number of multistarts to 50 caused the GC-based registration to fail at a rate of  >14% however, GO maintained robustness with a 0% gross failure rate. Overall, the GI, GC, and GS metrics were susceptible to registration errors associated with content mismatch, but GO provided robust registration (median PDE  =  5.5 mm, 2.6 mm IQR) without manual masking and with an improved runtime (29.3 s). The GO metric

  5. A comparative analysis of Painleve, Lax pair, and similarity transformation methods in obtaining the integrability conditions of nonlinear Schroedinger equations

    International Nuclear Information System (INIS)

    Al Khawaja, U.

    2010-01-01

    We derive the integrability conditions of nonautonomous nonlinear Schroedinger equations using the Lax pair and similarity transformation methods. We present a comparative analysis of these integrability conditions with those of the Painleve method. We show that while the Painleve integrability conditions restrict the dispersion, nonlinearity, and dissipation/gain coefficients to be space independent and the external potential to be only a quadratic function of position, the Lax Pair and the similarity transformation methods allow for space-dependent coefficients and an external potential that is not restricted to the quadratic form. The integrability conditions of the Painleve method are retrieved as a special case of our general integrability conditions. We also derive the integrability conditions of nonautonomous nonlinear Schroedinger equations for two- and three-spacial dimensions.

  6. Ultrasound-guided transversus abdominis plane block in patients undergoing open inguinal hernia repair: 0.125% bupivacaine provides similar analgesic effect compared to 0.25% bupivacaine.

    Science.gov (United States)

    Erdoğan Arı, Dilek; Yıldırım Ar, Arzu; Karadoğan, Firdevs; Özcabı, Yetkin; Koçoğlu, Ayşegül; Kılıç, Fatih; Akgün, Fatma Nur

    2016-02-01

    To evaluate the effectiveness of 0.125% bupivacaine compared to 0.25% bupivacaine for ultrasound-guided transversus abdominis plane (TAP) block in patients undergoing open inguinal hernia repair. Randomized, double-blind study. Educational and research hospital. Forty adult patients of American Society of Anesthesiologists physical status I-III undergoing elective primary unilateral open inguinal hernia repair under spinal anesthesia. Patients in group I received 20 mL of 0.25% bupivacaine, whereas patients in group II received 20 mL of 0.125% bupivacaine for TAP block at the end of the surgery. Pain intensity was assessed at rest and during coughing using 10-cm visual analog scale score at 5, 15, 30, and 45 minutes and 1, 2, 4, 6, 12, and 24 hours after TAP block. Morphine consumption and time to first morphine requirement were recorded. Visual analog scale scores at rest and during coughing were not significantly different between groups at all time points measured. Twenty-four hours of morphine consumption (7.72±7.33 mg in group I and 6.06±5.20 mg in group II; P=.437) and time to first morphine requirement (182.35±125.16 minutes in group I and 143.21±87.28 minutes in group II; P=.332) were not different between groups. 0.125% Bupivacaine provides similar analgesic effect compared to 0.25% bupivacaine for ultrasound-guided TAP block in patients undergoing open inguinal hernia repair. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Nalbuphine as an adjuvant to 0.25% levobupivacaine in ultrasound-guided supraclavicular block provided prolonged sensory block and similar motor block durations (RCT).

    Science.gov (United States)

    Abdelhamid, Bassant Mohamed; Omar, Heba

    2018-05-28

    Prolonged postoperative analgesia with early motor recovery for early rehabilitation is a challenge in regional block. The purpose of this study is to evaluate the effect of adding 20 mg nalbuphine to 25 ml of 0.25% levobupivacaine in supraclavicular brachial plexus block. One hundred thirty-five (135) patients scheduled for hand and forearm surgeries with supraclavicular block were randomly allocated into three equal groups. Group L received 25 ml of 0.5% levobupivacaine + 1 ml normal saline; group H received 25 ml of 0.25% levobupivacaine + 1 ml normal saline; and group N received 25 ml of 0.25% levobupivacaine + 1 ml (20 mg) nalbuphine. Onset time and duration of sensory and motor block, and time to first analgesic dose were recorded. Sensory block onset was comparable between the three groups. Motor block onset in group L and group N was comparable (13.16 ± 3.07 and 13.84 ± 3.05 min, respectively) and was shorter than that in group H (15.71 ± 2 0.91 min). Sensory block duration in group L and group N was comparable (522.22 ± 69.57 and 533.78 ± 66.03 min, respectively) and was longer than that in group H (342.67 ± 92.80 min). Motor block duration in group N and group H was comparable (272.00 ± 59.45 and 249.78 ± 66.01 min, respectively) and was shorter than that in group L (334.67 ± 57.90 min). Time to first analgesic dose was significantly longer in group N (649.78 ± 114.76 min) than that of group L and group H (575.56 ± 96.85 and 375.56 ± 84.49 min, respectively) and longer in group L when compared to group H. Adding 20 mg nalbuphine to 25 ml of 0.25% levobupivacaine in supraclavicular block provided prolonged duration of sensory block with similar duration of motor block.

  8. A novel method of providing a library of n-mers or biopolymers

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to a method of providing a library of n-mer sequences, wherein the library is composed of an n-mer sequence. Also the invention concerns a method of providing a library of biopolymer sequences having one or more n-mers in common. Further provided are specific primers...

  9. A new method for brain tumor detection using the Bhattacharyya similarity coefficient, color conversions and neural network

    Directory of Open Access Journals (Sweden)

    Bahman Mansori

    2015-10-01

    Full Text Available Background: Magnetic resonance imaging (MRI is widely applied for examination and diagnosis of brain tumors based on its advantages of high resolution in detecting the soft tissues and especially of its harmless radiation damages to human bodies. The goal of the processing of images is automatic segmentation of brain edema and tumors, in different dimensions of the magnetic resonance images. Methods: The proposed method is based on the unsupervised method which discovers the tumor region, if there is any, by analyzing the similarities between two hemispheres and computes the image size of the goal function based on Bhattacharyya coefficient which is used in the next stage to detect the tumor region or some part of it. In this stage, for reducing the color variation, the gray brain image is segmented, then it is turned to gray again. The self-organizing map (SOM neural network is used the segmented brain image is colored and finally the tumor is detected by matching the detected region and the colored image. This method is proposed to analyze MRI images for discovering brain tumors, and done in Bu Ali Sina University, Hamedan, Iran, in 2014. Results: The results for 30 randomly selected images from data bank of MRI center in Hamedan was compared with manually segmentation of experts. The results showed that, our proposed method had the accuracy of more than 94% at Jaccard similarity index (JSI, 97% at Dice similarity score (DSS, and 98% and 99% at two measures of specificity and sensitivity. Conclusion: The experimental results showed that it was satisfactory and can be used in automatic separation of tumor from normal brain tissues and therefore it can be used in practical applications. The results showed that the use of SOM neural network to classify useful magnetic resonance imaging of the brain and demonstrated a good performance.

  10. A novel method to remove GPR background noise based on the similarity of non-neighboring regions

    Science.gov (United States)

    Montiel-Zafra, V.; Canadas-Quesada, F. J.; Vera-Candeas, P.; Ruiz-Reyes, N.; Rey, J.; Martinez, J.

    2017-09-01

    Ground penetrating radar (GPR) is a non-destructive technique that has been widely used in many areas of research, such as landmine detection or subsurface anomalies, where it is required to locate targets embedded within a background medium. One of the major challenges in the research of GPR data remains the improvement of the image quality of stone materials by means of detection of true anisotropies since most of the errors are caused by an incorrect interpretation by the users. However, it is complicated due to the interference of the horizontal background noise, e.g., the air-ground interface, that reduces the high-resolution quality of radargrams. Thus, weak or deep anisotropies are often masked by this type of noise. In order to remove the background noise obtained by GPR, this work proposes a novel background removal method assuming that the horizontal noise shows repetitive two-dimensional regions along the movement of the GPR antenna. Specifically, the proposed method, based on the non-local similarity of regions over the distance, computes similarities between different regions of the same depth in order to identify most repetitive regions using a criterion to avoid closer regions. Evaluations are performed using a set of synthetic and real GPR data. Experimental results show that the proposed method obtains promising results compared to the classic background removal techniques and the most recently published background removal methods.

  11. [Confidence interval or p-value--similarities and differences between two important methods of statistical inference of quantitative studies].

    Science.gov (United States)

    Harari, Gil

    2014-01-01

    Statistic significance, also known as p-value, and CI (Confidence Interval) are common statistics measures and are essential for the statistical analysis of studies in medicine and life sciences. These measures provide complementary information about the statistical probability and conclusions regarding the clinical significance of study findings. This article is intended to describe the methodologies, compare between the methods, assert their suitability for the different needs of study results analysis and to explain situations in which each method should be used.

  12. Development of guidance and methodical documents for providing the decommissioning of radiation-hazardous objects

    International Nuclear Information System (INIS)

    Ermakov, A.

    2015-01-01

    Federal Center for Nuclear and Radiation Safety (JSC FCNRS) developed and approbated guidance and methodical documents for providing the facility to radiologically safe status in the course of Building B decommissioning activity at JSC VNIINM (A.A. Bochvar High-Technology Scientific Research Institute for Inorganic Materials). The scope of application of the documents developed is as follows: - preliminary segregation of radwaste into streams during its collection and preparation for removal from facilities/sites under decommissioning; - express assessment of specific activity (activity) of radwaste generated in the course of dismantling and decontamination activities; - radiological survey of premises and building structures following completion of dismantling and decontamination activities; - SRW processing (compaction, reduction in size), packaging, characterisation and containerisation in order to reduce risks of spread of radioactive contamination. Documents that have been developed can be used both at nuclear facilities/ sites similar to the JSC VNIINM Building B in terms of work stages and types of waste to be generated, and other facilities/ sites taking into consideration their peculiarities. (author)

  13. A touch-probe path generation method through similarity analysis between the feature vectors in new and old models

    Energy Technology Data Exchange (ETDEWEB)

    Jeon, Hye Sung; Lee, Jin Won; Yang, Jeong Sam [Dept. of Industrial Engineering, Ajou University, Suwon (Korea, Republic of)

    2016-10-15

    The On-machine measurement (OMM), which measures a work piece during or after the machining process in the machining center, has the advantage of measuring the work piece directly within the work space without moving it. However, the path generation procedure used to determine the measuring sequence and variables for the complex features of a target work piece has the limitation of requiring time-consuming tasks to generate the measuring points and mostly relies on the proficiency of the on-site engineer. In this study, we propose a touch-probe path generation method using similarity analysis between the feature vectors of three-dimensional (3-D) shapes for the OMM. For the similarity analysis between a new 3-D model and existing 3-D models, we extracted the feature vectors from models that can describe the characteristics of a geometric shape model; then, we applied those feature vectors to a geometric histogram that displays a probability distribution obtained by the similarity analysis algorithm. In addition, we developed a computer-aided inspection planning system that corrects non-applied measuring points that are caused by minute geometry differences between the two models and generates the final touch-probe path.

  14. Pilates and Proprioceptive Neuromuscular Facilitation Methods Induce Similar Strength Gains but Different Neuromuscular Adaptations in Elderly Women.

    Science.gov (United States)

    Teixeira de Carvalho, Fabiana; de Andrade Mesquita, Laiana Sepúlveda; Pereira, Rafael; Neto, Osmar Pinto; Amaro Zangaro, Renato

    2017-01-01

    Background/Study Context: The aging process is associated with a decline in muscle mass, strength, and conditioning. Two training methods that may be useful to improve muscle function are Pilates and proprioceptive neuromuscular facilitation (PNF). Thus, the present study aimed to compare the influence of training programs using Pilates and PNF methods with elderly women. Sixty healthy elderly women were randomly divided into three groups: Pilates group, PNF group, and control group. Pilates and PNF groups underwent 1-month training programs with Pilates and PNF methods, respectively. The control group received no intervention during the 1 month. The maximal isometric force levels from knee extension and flexion, as well as the electromyography (EMG) signals from quadriceps and biceps femoris, were recorded before and after the 1-month intervention period. A two-way analysis of variance revealed that the Pilates and PNF methods induced similar strength gains from knee flexors and extensors, but Pilates exhibited greater low-gamma drive (i.e., oscillations in 30-60 Hz) in the EMG power spectrum after the training period. These results support use of both Pilates and PNF methods to enhance lower limb muscle strength in older groups, which is very important for gait, postural stability, and performance of daily life activities.

  15. SVMTriP: a method to predict antigenic epitopes using support vector machine to integrate tri-peptide similarity and propensity.

    Directory of Open Access Journals (Sweden)

    Bo Yao

    Full Text Available Identifying protein surface regions preferentially recognizable by antibodies (antigenic epitopes is at the heart of new immuno-diagnostic reagent discovery and vaccine design, and computational methods for antigenic epitope prediction provide crucial means to serve this purpose. Many linear B-cell epitope prediction methods were developed, such as BepiPred, ABCPred, AAP, BCPred, BayesB, BEOracle/BROracle, and BEST, towards this goal. However, effective immunological research demands more robust performance of the prediction method than what the current algorithms could provide. In this work, a new method to predict linear antigenic epitopes is developed; Support Vector Machine has been utilized by combining the Tri-peptide similarity and Propensity scores (SVMTriP. Applied to non-redundant B-cell linear epitopes extracted from IEDB, SVMTriP achieves a sensitivity of 80.1% and a precision of 55.2% with a five-fold cross-validation. The AUC value is 0.702. The combination of similarity and propensity of tri-peptide subsequences can improve the prediction performance for linear B-cell epitopes. Moreover, SVMTriP is capable of recognizing viral peptides from a human protein sequence background. A web server based on our method is constructed for public use. The server and all datasets used in the current study are available at http://sysbio.unl.edu/SVMTriP.

  16. IONS: Identification of Orthologs by Neighborhood and Similarity-an Automated Method to Identify Orthologs in Chromosomal Regions of Common Evolutionary Ancestry and its Application to Hemiascomycetous Yeasts.

    Science.gov (United States)

    Seret, Marie-Line; Baret, Philippe V

    2011-01-01

    Comparative sequence analysis is widely used to infer gene function and study genome evolution and requires proper ortholog identification across different genomes. We have developed a program for the Identification of Orthologs in one-to-one relationship by Neighborhood and Similarity (IONS) between closely related species. The algorithm combines two levels of evidence to determine co-ancestrality at the genome scale: sequence similarity and shared neighborhood. The method was initially designed to provide anchor points for syntenic blocks within the Génolevures project concerning nine hemiascomycetous yeasts (about 50,000 genes) and is applicable to different input databases. Comparison based on use of a Rand index shows that the results are highly consistent with the pillars of the Yeast Gene Order Browser, a manually curated database. Compared with SYNERGY, another algorithm reporting homology relationships, our method's main advantages are its automation and the absence of dataset-dependent parameters, facilitating consistent integration of newly released genomes.

  17. Mesh fixation in laparoscopic incisional hernia repair: glue fixation provides attachment strength similar to absorbable tacks but differs substantially in different meshes.

    Science.gov (United States)

    Rieder, Erwin; Stoiber, Martin; Scheikl, Verena; Poglitsch, Marcus; Dal Borgo, Andrea; Prager, Gerhard; Schima, Heinrich

    2011-01-01

    Laparoscopic ventral hernia repair has gained popularity among minimally invasive surgeons. However, mesh fixation remains a matter of discussion. This study was designed to compare noninvasive fibrin-glue attachment with tack fixation of meshes developed primarily for intra-abdominal use. It was hypothesized that particular mesh structures would substantially influence detachment force. For initial evaluation, specimens of laminated polypropylene/polydioxanone meshes were anchored to porcine abdominal walls by either helical titanium tacks or absorbable tacks in vitro. A universal tensile-testing machine was used to measure tangential detachment forces (TF). For subsequent experiments of glue fixation, polypropylene/polydioxanone mesh and 4 additional meshes with diverse particular mesh structure, ie, polyvinylidene fluoride/polypropylene mesh, a titanium-coated polypropylene mesh, a polyester mesh bonded with a resorbable collagen, and a macroporous condensed PTFE mesh were evaluated. TF tests revealed that fibrin-glue attachment was not substantially different from that achieved with absorbable tacks (median TF 7.8 Newton [N], range 1.3 to 15.8 N), but only when certain open porous meshes (polyvinylidene fluoride/polypropylene mesh: median 6.2 N, range 3.4 to 10.3 N; titanium-coated polypropylene mesh: median 5.2 N, range 2.1 to 11.7 N) were used. Meshes coated by an anti-adhesive barrier (polypropylene/polydioxanone mesh: median 3.1 N, range 1.7 to 5.8 N; polyester mesh bonded with a resorbable collagen: median 1.3 N, range 0.5 to 1.9 N), or the condensed PTFE mesh (median 3.1 N, range 2.1 to 7.0 N) provided a significantly lower TF (p < 0.01). Fibrin glue appears to be an appealing noninvasive option for mesh fixation in laparoscopic ventral hernia repair, but only if appropriate meshes are used. Glue can also serve as an adjunct to mechanical fixation to reduce the number of invasive tacks. Copyright © 2010 American College of Surgeons. Published by Elsevier

  18. System and Method for Providing Vertical Profile Measurements of Atmospheric Gases

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A system and method for using an air collection device to collect a continuous air sample as the device descends through the atmosphere are provided. The air...

  19. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    DEFF Research Database (Denmark)

    Sabourin, David; Snakenborg, Detlef; Dufva, Hans Martin

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observ...

  20. Systems and methods for providing power to a load based upon a control strategy

    Science.gov (United States)

    Perisic, Milun; Kajouke, Lateef A; Ransom, Ray M

    2013-12-24

    Systems and methods are provided for an electrical system. The electrical system includes a load, an interface configured to receive a voltage from a voltage source, and a controller configured to receive the voltage from the voltage source through the interface and to provide a voltage and current to the load. Wherein, when the controller is in a constant voltage mode, the controller provides a constant voltage to the load, when the controller is in a constant current mode, the controller provides a constant current to the load, and when the controller is in a constant power mode, the controller provides a constant power to the load.

  1. Method and Apparatus Providing Deception and/or Altered Operation in an Information System Operating System

    Science.gov (United States)

    Cohen, Fred; Rogers, Deanna T.; Neagoe, Vicentiu

    2008-10-14

    A method and/or system and/or apparatus providing deception and/or execution alteration in an information system. In specific embodiments, deceptions and/or protections are provided by intercepting and/or modifying operation of one or more system calls of an operating system.

  2. Provider Payment Trends and Methods in the Massachusetts Health Care System

    OpenAIRE

    Allison Barrett; Timothy Lake

    2010-01-01

    This report investigates provider payment methods in Massachusetts. Payments include fee-for-service, the predominant model; global payments, which pay providers a single fee for all or most required services during a contract period; and pay-for-performance models, which layer quality incentives onto payments.

  3. 47 CFR 51.329 - Notice of network changes: Methods for providing notice.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Notice of network changes: Methods for providing notice. 51.329 Section 51.329 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED...) Filing a public notice with the Commission; or (2) Providing public notice through industry fora...

  4. Meta-Analysis of Quantification Methods Shows that Archaea and Bacteria Have Similar Abundances in the Subseafloor

    Science.gov (United States)

    May, Megan K.; Kevorkian, Richard T.; Steen, Andrew D.

    2013-01-01

    There is no universally accepted method to quantify bacteria and archaea in seawater and marine sediments, and different methods have produced conflicting results with the same samples. To identify best practices, we compiled data from 65 studies, plus our own measurements, in which bacteria and archaea were quantified with fluorescent in situ hybridization (FISH), catalyzed reporter deposition FISH (CARD-FISH), polyribonucleotide FISH, or quantitative PCR (qPCR). To estimate efficiency, we defined “yield” to be the sum of bacteria and archaea counted by these techniques divided by the total number of cells. In seawater, the yield was high (median, 71%) and was similar for FISH, CARD-FISH, and polyribonucleotide FISH. In sediments, only measurements by CARD-FISH in which archaeal cells were permeabilized with proteinase K showed high yields (median, 84%). Therefore, the majority of cells in both environments appear to be alive, since they contain intact ribosomes. In sediments, the sum of bacterial and archaeal 16S rRNA gene qPCR counts was not closely related to cell counts, even after accounting for variations in copy numbers per genome. However, qPCR measurements were precise relative to other qPCR measurements made on the same samples. qPCR is therefore a reliable relative quantification method. Inconsistent results for the relative abundance of bacteria versus archaea in deep subsurface sediments were resolved by the removal of CARD-FISH measurements in which lysozyme was used to permeabilize archaeal cells and qPCR measurements which used ARCH516 as an archaeal primer or TaqMan probe. Data from best-practice methods showed that archaea and bacteria decreased as the depth in seawater and marine sediments increased, although archaea decreased more slowly. PMID:24096423

  5. Direct Patlak Reconstruction From Dynamic PET Data Using the Kernel Method With MRI Information Based on Structural Similarity.

    Science.gov (United States)

    Gong, Kuang; Cheng-Liao, Jinxiu; Wang, Guobao; Chen, Kevin T; Catana, Ciprian; Qi, Jinyi

    2018-04-01

    Positron emission tomography (PET) is a functional imaging modality widely used in oncology, cardiology, and neuroscience. It is highly sensitive, but suffers from relatively poor spatial resolution, as compared with anatomical imaging modalities, such as magnetic resonance imaging (MRI). With the recent development of combined PET/MR systems, we can improve the PET image quality by incorporating MR information into image reconstruction. Previously, kernel learning has been successfully embedded into static and dynamic PET image reconstruction using either PET temporal or MRI information. Here, we combine both PET temporal and MRI information adaptively to improve the quality of direct Patlak reconstruction. We examined different approaches to combine the PET and MRI information in kernel learning to address the issue of potential mismatches between MRI and PET signals. Computer simulations and hybrid real-patient data acquired on a simultaneous PET/MR scanner were used to evaluate the proposed methods. Results show that the method that combines PET temporal information and MRI spatial information adaptively based on the structure similarity index has the best performance in terms of noise reduction and resolution improvement.

  6. System and Method for Providing a Climate Data Analytic Services Application Programming Interface Distribution Package

    Science.gov (United States)

    Schnase, John L. (Inventor); Duffy, Daniel Q. (Inventor); Tamkin, Glenn S. (Inventor)

    2016-01-01

    A system, method and computer-readable storage devices for providing a climate data analytic services application programming interface distribution package. The example system can provide various components. The system provides a climate data analytic services application programming interface library that enables software applications running on a client device to invoke the capabilities of a climate data analytic service. The system provides a command-line interface that provides a means of interacting with a climate data analytic service by issuing commands directly to the system's server interface. The system provides sample programs that call on the capabilities of the application programming interface library and can be used as templates for the construction of new client applications. The system can also provide test utilities, build utilities, service integration utilities, and documentation.

  7. Similarity measure and topology evolution of foreign exchange markets using dynamic time warping method: Evidence from minimal spanning tree

    Science.gov (United States)

    Wang, Gang-Jin; Xie, Chi; Han, Feng; Sun, Bo

    2012-08-01

    In this study, we employ a dynamic time warping method to study the topology of similarity networks among 35 major currencies in international foreign exchange (FX) markets, measured by the minimal spanning tree (MST) approach, which is expected to overcome the synchronous restriction of the Pearson correlation coefficient. In the empirical process, firstly, we subdivide the analysis period from June 2005 to May 2011 into three sub-periods: before, during, and after the US sub-prime crisis. Secondly, we choose NZD (New Zealand dollar) as the numeraire and then, analyze the topology evolution of FX markets in terms of the structure changes of MSTs during the above periods. We also present the hierarchical tree associated with the MST to study the currency clusters in each sub-period. Our results confirm that USD and EUR are the predominant world currencies. But USD gradually loses the most central position while EUR acts as a stable center in the MST passing through the crisis. Furthermore, an interesting finding is that, after the crisis, SGD (Singapore dollar) becomes a new center currency for the network.

  8. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    International Nuclear Information System (INIS)

    Sabourin, D; Snakenborg, D; Dufva, M

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observation. The interconnection block method is scalable, flexible and supports high interconnection density. The average pressure limit of the interconnection block was near 5.5 bar and all individual results were well above the 2 bar threshold considered applicable to most microfluidic applications

  9. Configurable memory system and method for providing atomic counting operations in a memory device

    Science.gov (United States)

    Bellofatto, Ralph E.; Gara, Alan G.; Giampapa, Mark E.; Ohmacht, Martin

    2010-09-14

    A memory system and method for providing atomic memory-based counter operations to operating systems and applications that make most efficient use of counter-backing memory and virtual and physical address space, while simplifying operating system memory management, and enabling the counter-backing memory to be used for purposes other than counter-backing storage when desired. The encoding and address decoding enabled by the invention provides all this functionality through a combination of software and hardware.

  10. Method of immobilizing weapons plutonium to provide a durable, disposable waste product

    Science.gov (United States)

    Ewing, Rodney C.; Lutze, Werner; Weber, William J.

    1996-01-01

    A method of atomic scale fixation and immobilization of plutonium to provide a durable waste product. Plutonium is provided in the form of either PuO.sub.2 or Pu(NO.sub.3).sub.4 and is mixed with and SiO.sub.2. The resulting mixture is cold pressed and then heated under pressure to form (Zr,Pu)SiO.sub.4 as the waste product.

  11. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 1

    Science.gov (United States)

    2013-11-01

    of Standards and Technology (NIST) Special Publication 800-145 (NIST SP 800-145) defines three types of cloud services : Software as a Service ( SaaS ...among these three models. NIST SP 800-145 describes the three service models as follows: SaaS —The capability provided to the consumer is to use the...Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase I Greg Porter November 2013 TECHNICAL NOTE CMU/SEI-2013-TN-020

  12. Box-counting dimension revisited: presenting an efficient method of minimising quantisation error and an assessment of the self-similarity of structural root systems

    Directory of Open Access Journals (Sweden)

    Martin eBouda

    2016-02-01

    Full Text Available Fractal dimension (FD, estimated by box-counting, is a metric used to characterise plant anatomical complexity or space-filling characteristic for a variety of purposes. The vast majority of published studies fail to evaluate the assumption of statistical self-similarity, which underpins the validity of the procedure. The box-counting procedure is also subject to error arising from arbitrary grid placement, known as quantisation error (QE, which is strictly positive and varies as a function of scale, making it problematic for the procedure's slope estimation step. Previous studies either ignore QE or employ inefficient brute-force grid translations to reduce it. The goals of this study were to characterise the effect of QE due to translation and rotation on FD estimates, to provide an efficient method of reducing QE, and to evaluate the assumption of statistical self-similarity of coarse root datasets typical of those used in recent trait studies. Coarse root systems of 36 shrubs were digitised in 3D and subjected to box-counts. A pattern search algorithm was used to minimise QE by optimising grid placement and its efficiency was compared to the brute force method. The degree of statistical self-similarity was evaluated using linear regression residuals and local slope estimates.QE due to both grid position and orientation was a significant source of error in FD estimates, but pattern search provided an efficient means of minimising it. Pattern search had higher initial computational cost but converged on lower error values more efficiently than the commonly employed brute force method. Our representations of coarse root system digitisations did not exhibit details over a sufficient range of scales to be considered statistically self-similar and informatively approximated as fractals, suggesting a lack of sufficient ramification of the coarse root systems for reiteration to be thought of as a dominant force in their development. FD estimates did

  13. A method of providing a barrier in a fracture-containing system

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking into an el......The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking...... into an elastomer, and c) at least one crosslinking agent; ii) Placing the treatment fluid in a fracture-containing system; iii) Allowing the elastomeric material to crosslink with itself to form a barrier in said fracture-containing system; wherein the elastomeric material and/or the crosslinking agent...... are of neutral buoyancy with regard to the base fluid. The invention is contemplated to having utility not only in the oil-drilling industry but also in the plugging of fractures in sewer drains, pipelines etc....

  14. Development of a systematic method to assess similarity between nanomaterials for human hazard evaluation purposes - lessons learnt.

    NARCIS (Netherlands)

    Vdz Park, Margriet; Catalán, Julia; Ferraz, Natalia; Cabellos, Joan; Vanhauten, Ralph; Vázquez-Campos, Socorro; Janer, Gemma

    2018-01-01

    Within the EU FP-7 GUIDEnano project, a methodology was developed to systematically quantify the similarity between a nanomaterial (NM) that has been tested in toxicity studies and the NM for which risk needs to be evaluated, for the purpose of extrapolating toxicity data between the two materials.

  15. ELV Recycling Service Provider Selection Using the Hybrid MCDM Method: A Case Application in China

    Directory of Open Access Journals (Sweden)

    Fuli Zhou

    2016-05-01

    Full Text Available With the rapid depletion of natural resources and undesired environmental changes globally, more interest has been shown in the research of green supply chain practices, including end-of-life vehicle (ELV recycling. The ELV recycling is mandatory for auto-manufacturers by legislation for the purpose of minimizing potential environmental damages. The purpose of the present research is to determine the best choice of ELV recycling service provider by employing an integrating hybrid multi-criteria decision making (MCDM method. In this research, economic, environmental and social factors are taken into consideration. The linguistic variables and trapezoidal fuzzy numbers (TFNs are applied into this evaluation to deal with the vague and qualitative information. With the combined weight calculation of criteria based on fuzzy aggregation and Shannon Entropy techniques, the normative multi-criteria optimization technique (FVIKOR method is applied to explore the best solution. An application was performed based on the proposed hybrid MCDM method, and sensitivity analysis was conducted on different decision making scenarios. The present study provides a decision-making approach on ELV recycling business selection under sustainability and green philosophy with high robustness and easy implementation.

  16. Mathematical evaluation of similarity factor using various weighing approaches on aceclofenac marketed formulations by model-independent method.

    Science.gov (United States)

    Soni, T G; Desai, J U; Nagda, C D; Gandhi, T R; Chotai, N P

    2008-01-01

    The US Food and Drug Administration's (FDA's) guidance for industry on dissolution testing of immediate-release solid oral dosage forms describes that drug dissolution may be the rate limiting step for drug absorption in the case of low solubility/high permeability drugs (BCS class II drugs). US FDA Guidance describes the model-independent mathematical approach proposed by Moore and Flanner for calculating a similarity factor (f2) of dissolution across a suitable time interval. In the present study, the similarity factor was calculated on dissolution data of two marketed aceclofenac tablets (a BCS class II drug) using various weighing approaches proposed by Gohel et al. The proposed approaches were compared with a conventional approach (W = 1). On the basis of consideration of variability, preference is given in the order of approach 3 > approach 2 > approach 1 as approach 3 considers batch-to-batch as well as within-samples variability and shows best similarity profile. Approach 2 considers batch-to batch variability with higher specificity than approach 1.

  17. System and method of providing quick thermal comfort with reduced energy by using directed spot conditioning

    Science.gov (United States)

    Wang, Mingyu; Kadle, Prasad S.; Ghosh, Debashis; Zima, Mark J.; Wolfe, IV, Edward; Craig, Timothy D

    2016-10-04

    A heating, ventilation, and air conditioning (HVAC) system and a method of controlling a HVAC system that is configured to provide a perceived comfortable ambient environment to an occupant seated in a vehicle cabin. The system includes a nozzle configured to direct an air stream from the HVAC system to the location of a thermally sensitive portion of the body of the occupant. The system also includes a controller configured to determine an air stream temperature and an air stream flow rate necessary to establish the desired heat supply rate for the sensitive portion and provide a comfortable thermal environment by thermally isolating the occupant from the ambient vehicle cabin temperature. The system may include a sensor to determine the location of the sensitive portion. The nozzle may include a thermoelectric device to heat or cool the air stream.

  18. Method of App Selection for Healthcare Providers Based on Consumer Needs.

    Science.gov (United States)

    Lee, Jisan; Kim, Jeongeun

    2018-01-01

    Mobile device applications can be used to manage health. However, healthcare providers hesitate to use them because selection methods that consider the needs of health consumers and identify the most appropriate application are rare. This study aimed to create an effective method of identifying applications that address user needs. Women experiencing dysmenorrhea and premenstrual syndrome were the targeted users. First, we searched for related applications from two major sources of mobile applications. Brainstorming, mind mapping, and persona and scenario techniques were used to create a checklist of relevant criteria, which was used to rate the applications. Of the 2784 applications found, 369 were analyzed quantitatively. Of those, five of the top candidates were evaluated by three groups: application experts, clinical experts, and potential users. All three groups ranked one application the highest; however, the remaining rankings differed. The results of this study suggest that the method created is useful because it considers not only the needs of various users but also the knowledge of application and clinical experts. This study proposes a method for finding and using the best among existing applications and highlights the need for nurses who can understand and combine opinions of users and application and clinical experts.

  19. Discussion of a method for providing general risk information by linking with the nuclear information

    International Nuclear Information System (INIS)

    Shobu, Nobuhiro; Yokomizo, Shirou; Umezawa, Sayaka

    2004-06-01

    'Risk information navigator (http://www.ricotti.jp/risknavi/)', an internet tool for arousing public interest and fostering people's risk literacy, has been developed as the contents for the official website of Techno Community Square 'RICOTTI' (http://www.ricotti.jp) at TOKAI village. In this report we classified the risk information into the fields, Health/Daily Life', 'Society/Crime/Disaster' and Technology/Environment/Energy', for the internet tool contents. According to these categories we discussed a method for providing various risk information on general fields by linking with the information on nuclear field. The web contents are attached to this report with the CD-R media. (author)

  20. A method to provide rapid in situ determination of tip radius in dynamic atomic force microscopy

    International Nuclear Information System (INIS)

    Santos, Sergio; Guang Li; Souier, Tewfik; Gadelrab, Karim; Chiesa, Matteo; Thomson, Neil H.

    2012-01-01

    We provide a method to characterize the tip radius of an atomic force microscopy in situ by monitoring the dynamics of the cantilever in ambient conditions. The key concept is that the value of free amplitude for which transitions from the attractive to repulsive force regimes are observed, strongly depends on the curvature of the tip. In practice, the smaller the value of free amplitude required to observe a transition, the sharper the tip. This general behavior is remarkably independent of the properties of the sample and cantilever characteristics and shows the strong dependence of the transitions on the tip radius. The main advantage of this method is rapid in situ characterization. Rapid in situ characterization enables one to continuously monitor the tip size during experiments. Further, we show how to reproducibly shape the tip from a given initial size to any chosen larger size. This approach combined with the in situ tip size monitoring enables quantitative comparison of materials measurements between samples. These methods are set to allow quantitative data acquisition and make direct data comparison readily available in the community.

  1. Method for providing slip energy control in permanent magnet electrical machines

    Science.gov (United States)

    Hsu, John S.

    2006-11-14

    An electric machine (40) has a stator (43), a permanent magnet rotor (38) with permanent magnets (39) and a magnetic coupling uncluttered rotor (46) for inducing a slip energy current in secondary coils (47). A dc flux can be produced in the uncluttered rotor when the secondary coils are fed with dc currents. The magnetic coupling uncluttered rotor (46) has magnetic brushes (A, B, C, D) which couple flux in through the rotor (46) to the secondary coils (47c, 47d) without inducing a current in the rotor (46) and without coupling a stator rotational energy component to the secondary coils (47c, 47d). The machine can be operated as a motor or a generator in multi-phase or single-phase embodiments and is applicable to the hybrid electric vehicle. A method of providing a slip energy controller is also disclosed.

  2. Providing the physical basis of SCS curve number method and its proportionality relationship from Richards' equation

    Science.gov (United States)

    Hooshyar, M.; Wang, D.

    2016-12-01

    The empirical proportionality relationship, which indicates that the ratio of cumulative surface runoff and infiltration to their corresponding potentials are equal, is the basis of the extensively used Soil Conservation Service Curve Number (SCS-CN) method. The objective of this paper is to provide the physical basis of the SCS-CN method and its proportionality hypothesis from the infiltration excess runoff generation perspective. To achieve this purpose, an analytical solution of Richards' equation is derived for ponded infiltration in shallow water table environment under the following boundary conditions: 1) the soil is saturated at the land surface; and 2) there is a no-flux boundary which moves downward. The solution is established based on the assumptions of negligible gravitational effect, constant soil water diffusivity, and hydrostatic soil moisture profile between the no-flux boundary and water table. Based on the derived analytical solution, the proportionality hypothesis is a reasonable approximation for rainfall partitioning at the early stage of ponded infiltration in areas with a shallow water table for coarse textured soils.

  3. Content and Methods used to Train Tobacco Cessation Treatment Providers: An International Survey.

    Science.gov (United States)

    Kruse, Gina R; Rigotti, Nancy A; Raw, Martin; McNeill, Ann; Murray, Rachael; Piné-Abata, Hembadoon; Bitton, Asaf; McEwen, Andy

    2017-12-01

    There are limited existing data describing the training methods used to educate tobacco cessation treatment providers around the world. To measure the prevalence of tobacco cessation treatment content, skills training and teaching methods reported by tobacco treatment training programs across the world. Web-based survey in May-September 2013 among tobacco cessation training experts across six geographic regions and four World Bank income levels. Response rate was 73% (84 of 115 countries contacted). Of 104 individual programs from 84 countries, most reported teaching brief advice (78%) and one-to-one counseling (74%); telephone counseling was uncommon (33%). Overall, teaching of knowledge topics was more commonly reported than skills training. Programs in lower income countries less often reported teaching about medications, behavioral treatments and biomarkers and less often reported skills-based training about interviewing clients, medication management, biomarker measurement, assessing client outcomes, and assisting clients with co-morbidities. Programs reported a median 15 hours of training. Face-to-face training was common (85%); online programs were rare (19%). Almost half (47%) included no learner assessment. Only 35% offered continuing education. Nearly all programs reported teaching evidence-based treatment modalities in a face-to-face format. Few programs delivered training online or offered continuing education. Skills-based training was less common among low- and middle-income countries (LMICs). There is a large unmet need for tobacco treatment training protocols which emphasize practical skills, and which are more rapidly scalable than face-to-face training in LMICs.

  4. Transcoding method from H.264/AVC to high efficiency video coding based on similarity of intraprediction, interprediction, and motion vector

    Science.gov (United States)

    Liu, Mei-Feng; Zhong, Guo-Yun; He, Xiao-Hai; Qing, Lin-Bo

    2016-09-01

    Currently, most video resources on line are encoded in the H.264/AVC format. More fluent video transmission can be obtained if these resources are encoded in the newest international video coding standard: high efficiency video coding (HEVC). In order to improve the video transmission and storage on line, a transcoding method from H.264/AVC to HEVC is proposed. In this transcoding algorithm, the coding information of intraprediction, interprediction, and motion vector (MV) in H.264/AVC video stream are used to accelerate the coding in HEVC. It is found through experiments that the region of interprediction in HEVC overlaps that in H.264/AVC. Therefore, the intraprediction for the region in HEVC, which is interpredicted in H.264/AVC, can be skipped to reduce coding complexity. Several macroblocks in H.264/AVC are combined into one PU in HEVC when the MV difference between two of the macroblocks in H.264/AVC is lower than a threshold. This method selects only one coding unit depth and one prediction unit (PU) mode to reduce the coding complexity. An MV interpolation method of combined PU in HEVC is proposed according to the areas and distances between the center of one macroblock in H.264/AVC and that of the PU in HEVC. The predicted MV accelerates the motion estimation for HEVC coding. The simulation results show that our proposed algorithm achieves significant coding time reduction with a little loss in bitrates distortion rate, compared to the existing transcoding algorithms and normal HEVC coding.

  5. Similarity analysis applied to the design of scaled tests of hydraulic mitigation methods for Tank 241-SY-101

    International Nuclear Information System (INIS)

    Liljegren, L.M.

    1993-02-01

    The episodic gas releases from Tank 241-SY-101 (SY-101) pose a potential safety hazard. It is thought that gas releases occur because gases are generated and trapped in layers of settled solids located at the bottom of the tank. This document focuses on issues associated with testing of hydraulic mitigation technologies proposed for SY-101. The basic assumption underlying the concept of hydraulic mitigation is that mobilization or maintained suspension of the solids settled in the bottom of the tank wig prevent gas accumulation. Engineering of hydraulic technologies will require testing to determine the operating parameters required to mobilize the solids and to maintain these solids in suspension. Because full scale testing is extremely expensive (even when possible), scaled tests are needed to assess the merit of the proposed technologies and to provide data for numerical or analytical modeling. This research is conducted to support testing and evaluation of proposed hydraulic mitigation concepts only. The work here is oriented towards determining the jet velocities, nozzle sizes, and other operating parameters required to mobilize the settled solids in SY- 101 and maintain them in suspension

  6. The Effect of Health Information Technology on Health Care Provider Communication: A Mixed-Method Protocol.

    Science.gov (United States)

    Manojlovich, Milisa; Adler-Milstein, Julia; Harrod, Molly; Sales, Anne; Hofer, Timothy P; Saint, Sanjay; Krein, Sarah L

    2015-06-11

    Communication failures between physicians and nurses are one of the most common causes of adverse events for hospitalized patients, as well as a major root cause of all sentinel events. Communication technology (ie, the electronic medical record, computerized provider order entry, email, and pagers), which is a component of health information technology (HIT), may help reduce some communication failures but increase others because of an inadequate understanding of how communication technology is used. Increasing use of health information and communication technologies is likely to affect communication between nurses and physicians. The purpose of this study is to describe, in detail, how health information and communication technologies facilitate or hinder communication between nurses and physicians with the ultimate goal of identifying how we can optimize the use of these technologies to support effective communication. Effective communication is the process of developing shared understanding between communicators by establishing, testing, and maintaining relationships. Our theoretical model, based in communication and sociology theories, describes how health information and communication technologies affect communication through communication practices (ie, use of rich media; the location and availability of computers) and work relationships (ie, hierarchies and team stability). Therefore we seek to (1) identify the range of health information and communication technologies used in a national sample of medical-surgical acute care units, (2) describe communication practices and work relationships that may be influenced by health information and communication technologies in these same settings, and (3) explore how differences in health information and communication technologies, communication practices, and work relationships between physicians and nurses influence communication. This 4-year study uses a sequential mixed-methods design, beginning with a

  7. A mixed methods study of patient-provider communication about opioid analgesics.

    Science.gov (United States)

    Hughes, Helen Kinsman; Korthuis, Philip Todd; Saha, Somnath; Eggly, Susan; Sharp, Victoria; Cohn, Jonathan; Moore, Richard; Beach, Mary Catherine

    2015-04-01

    To describe patient-provider communication about opioid pain medicine and explore how these discussions affect provider attitudes toward patients. We audio-recorded 45 HIV providers and 423 patients in routine outpatient encounters at four sites across the country. Providers completed post-visit questionnaires assessing their attitudes toward patients. We identified discussions about opioid pain management and analyzed them qualitatively. We used logistic regression to assess the association between opioid discussion and providers' attitudes toward patients. 48 encounters (11% of the total sample) contained substantive discussion of opioid-related pain management. Most conversations were initiated by patients (n=28, 58%) and ended by the providers (n=36, 75%). Twelve encounters (25%) contained dialog suggesting a difference of opinion or conflict. Providers more often agreed than disagreed to give the prescription (50% vs. 23%), sometimes reluctantly; in 27% (n=13) of encounters, no decision was made. Fewer than half of providers (n=20, 42%) acknowledged the patient's experience of pain. Providers had a lower odds of positive regard for the patient (adjusted OR=0.51, 95% CI: 0.27-0.95) when opioids were discussed. Pain management discussions are common in routine outpatient HIV encounters and providers may regard patients less favorably if opioids are discussed during visits. The sometimes-adversarial nature of these discussions may negatively affect provider attitudes toward patients. Empathy and pain acknowledgment are tools that clinicians can use to facilitate productive discussions of pain management. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Devices and methods of operation thereof for providing stable flow for centrifugal compressors

    Science.gov (United States)

    Skoch, Gary J. (Inventor); Stevens, Mark A. (Inventor); Jett, Thomas A. (Inventor)

    2008-01-01

    Centrifugal compressor flow stabilizing devices and methods of operation thereof are disclosed that act upon the flow field discharging from the impeller of a centrifugal compressor and modify the flow field ahead of the diffuser vanes such that flow conditions contributing to rotating stall and surge are reduced or even eliminated. In some embodiments, shaped rods and methods of operation thereof are disclosed, whereas in other embodiments reverse-tangent air injection devices and methods are disclosed.

  9. Judgments of brand similarity

    NARCIS (Netherlands)

    Bijmolt, THA; Wedel, M; Pieters, RGM; DeSarbo, WS

    This paper provides empirical insight into the way consumers make pairwise similarity judgments between brands, and how familiarity with the brands, serial position of the pair in a sequence, and the presentation format affect these judgments. Within the similarity judgment process both the

  10. Genome-wide comparative analysis reveals similar types of NBS genes in hybrid Citrus sinensis genome and original Citrus clementine genome and provides new insights into non-TIR NBS genes.

    Directory of Open Access Journals (Sweden)

    Yunsheng Wang

    Full Text Available In this study, we identified and compared nucleotide-binding site (NBS domain-containing genes from three Citrus genomes (C. clementina, C. sinensis from USA and C. sinensis from China. Phylogenetic analysis of all Citrus NBS genes across these three genomes revealed that there are three approximately evenly numbered groups: one group contains the Toll-Interleukin receptor (TIR domain and two different Non-TIR groups in which most of proteins contain the Coiled Coil (CC domain. Motif analysis confirmed that the two groups of CC-containing NBS genes are from different evolutionary origins. We partitioned NBS genes into clades using NBS domain sequence distances and found most clades include NBS genes from all three Citrus genomes. This suggests that three Citrus genomes have similar numbers and types of NBS genes. We also mapped the re-sequenced reads of three pomelo and three mandarin genomes onto the C. sinensis genome. We found that most NBS genes of the hybrid C. sinensis genome have corresponding homologous genes in both pomelo and mandarin genomes. The homologous NBS genes in pomelo and mandarin suggest that the parental species of C. sinensis may contain similar types of NBS genes. This explains why the hybrid C. sinensis and original C. clementina have similar types of NBS genes in this study. Furthermore, we found that sequence variation amongst Citrus NBS genes were shaped by multiple independent and shared accelerated mutation accumulation events among different groups of NBS genes and in different Citrus genomes. Our comparative analyses yield valuable insight into the structure, organization and evolution of NBS genes in Citrus genomes. Furthermore, our comprehensive analysis showed that the non-TIR NBS genes can be divided into two groups that come from different evolutionary origins. This provides new insights into non-TIR genes, which have not received much attention.

  11. Unsafe abortion in urban and rural Tanzania: method, provider and consequences

    DEFF Research Database (Denmark)

    Rasch, Vibeke; Kipingili, Rose

    2009-01-01

    OBJECTIVE: To describe unsafe abortion methods and associated health consequences in Tanzania, where induced abortion is restricted by law but common and known to account for a disproportionate share of hospital admissions. METHOD: Cross-sectional study of women admitted with alleged miscarriage...

  12. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert; De Zelicourt, Axel; Saad, Maged

    2017-01-01

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under

  13. UNITE: a database providing web-based methods for the molecular identification of ectomycorrhizal fungi

    DEFF Research Database (Denmark)

    Köljalg, U.; Larsson, K.H.; Abarenkov, K.

    2005-01-01

    Identification of ectomycorrhizal (ECM) fungi is often achieved through comparisons of ribosomal DNA internal transcribed spacer (ITS) sequences with accessioned sequences deposited in public databases. A major problem encountered is that annotation of the sequences in these databases is not always....... At present UNITE contains 758 ITS sequences from 455 species and 67 genera of ECM fungi. •  UNITE can be searched by taxon name, via sequence similarity using blastn, and via phylogenetic sequence identification using galaxie. Following implementation, galaxie performs a phylogenetic analysis of the query...... sequence after alignment either to pre-existing generic alignments, or to matches retrieved from a blast search on the UNITE data. It should be noted that the current version of UNITE is dedicated to the reliable identification of ECM fungi. •  The UNITE database is accessible through the URL http://unite.zbi.ee...

  14. A fully automatic end-to-end method for content-based image retrieval of CT scans with similar liver lesion annotations.

    Science.gov (United States)

    Spanier, A B; Caplan, N; Sosna, J; Acar, B; Joskowicz, L

    2018-01-01

    The goal of medical content-based image retrieval (M-CBIR) is to assist radiologists in the decision-making process by retrieving medical cases similar to a given image. One of the key interests of radiologists is lesions and their annotations, since the patient treatment depends on the lesion diagnosis. Therefore, a key feature of M-CBIR systems is the retrieval of scans with the most similar lesion annotations. To be of value, M-CBIR systems should be fully automatic to handle large case databases. We present a fully automatic end-to-end method for the retrieval of CT scans with similar liver lesion annotations. The input is a database of abdominal CT scans labeled with liver lesions, a query CT scan, and optionally one radiologist-specified lesion annotation of interest. The output is an ordered list of the database CT scans with the most similar liver lesion annotations. The method starts by automatically segmenting the liver in the scan. It then extracts a histogram-based features vector from the segmented region, learns the features' relative importance, and ranks the database scans according to the relative importance measure. The main advantages of our method are that it fully automates the end-to-end querying process, that it uses simple and efficient techniques that are scalable to large datasets, and that it produces quality retrieval results using an unannotated CT scan. Our experimental results on 9 CT queries on a dataset of 41 volumetric CT scans from the 2014 Image CLEF Liver Annotation Task yield an average retrieval accuracy (Normalized Discounted Cumulative Gain index) of 0.77 and 0.84 without/with annotation, respectively. Fully automatic end-to-end retrieval of similar cases based on image information alone, rather that on disease diagnosis, may help radiologists to better diagnose liver lesions.

  15. Towards Personalized Medicine: Leveraging Patient Similarity and Drug Similarity Analytics

    Science.gov (United States)

    Zhang, Ping; Wang, Fei; Hu, Jianying; Sorrentino, Robert

    2014-01-01

    The rapid adoption of electronic health records (EHR) provides a comprehensive source for exploratory and predictive analytic to support clinical decision-making. In this paper, we investigate how to utilize EHR to tailor treatments to individual patients based on their likelihood to respond to a therapy. We construct a heterogeneous graph which includes two domains (patients and drugs) and encodes three relationships (patient similarity, drug similarity, and patient-drug prior associations). We describe a novel approach for performing a label propagation procedure to spread the label information representing the effectiveness of different drugs for different patients over this heterogeneous graph. The proposed method has been applied on a real-world EHR dataset to help identify personalized treatments for hypercholesterolemia. The experimental results demonstrate the effectiveness of the approach and suggest that the combination of appropriate patient similarity and drug similarity analytics could lead to actionable insights for personalized medicine. Particularly, by leveraging drug similarity in combination with patient similarity, our method could perform well even on new or rarely used drugs for which there are few records of known past performance. PMID:25717413

  16. NMR system and method having a permanent magnet providing a rotating magnetic field

    Science.gov (United States)

    Schlueter, Ross D [Berkeley, CA; Budinger, Thomas F [Berkeley, CA

    2009-05-19

    Disclosed herein are systems and methods for generating a rotating magnetic field. The rotating magnetic field can be used to obtain rotating-field NMR spectra, such as magic angle spinning spectra, without having to physically rotate the sample. This result allows magic angle spinning NMR to be conducted on biological samples such as live animals, including humans.

  17. The duty to provide information in the case of neuroradiological examination methods

    International Nuclear Information System (INIS)

    Deutsch, E.

    1987-01-01

    The author gives a survey on the judicial decisions concerning the obligation to give information in the case of neuroradiological examination methods. The scope and content of the medical explanation depends inter alia on the urgency and the necessity of the medical diagnosis and on the understanding of the patient. (WG) [de

  18. Vehicle Tracking System, Vehicle Infrastructure Provided with Vehicle Tracking System and Method for Tracking

    NARCIS (Netherlands)

    Papp, Z.; Doodeman, G.J.N.; Nelisse, M.W.; Sijs, J.; Theeuwes, J.A.C.; Driessen, B.J.F.

    2010-01-01

    A vehicle tracking system is described comprising - a plurality of sensor nodes (10) that each provide a message (D) indicative for an occupancy status of a detection area of an vehicle infrastructure monitored by said sensor node, said sensor nodes (10) being arranged in the vehicle infrastructure

  19. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert

    2017-07-27

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under environmental stress conditions.

  20. A Novel Resource Management Method of Providing Operating System as a Service for Mobile Transparent Computing

    Directory of Open Access Journals (Sweden)

    Yonghua Xiong

    2014-01-01

    Full Text Available This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU virtualization and mobile agent for mobile transparent computing (MTC to devise a method of managing shared resources and services management (SRSM. It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user’s requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  1. A novel resource management method of providing operating system as a service for mobile transparent computing.

    Science.gov (United States)

    Xiong, Yonghua; Huang, Suzhen; Wu, Min; Zhang, Yaoxue; She, Jinhua

    2014-01-01

    This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU) virtualization and mobile agent for mobile transparent computing (MTC) to devise a method of managing shared resources and services management (SRSM). It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user's requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  2. UNITE: a database providing web-based methods for the molecular identification of ectomycorrhizal fungi.

    Science.gov (United States)

    Kõljalg, Urmas; Larsson, Karl-Henrik; Abarenkov, Kessy; Nilsson, R Henrik; Alexander, Ian J; Eberhardt, Ursula; Erland, Susanne; Høiland, Klaus; Kjøller, Rasmus; Larsson, Ellen; Pennanen, Taina; Sen, Robin; Taylor, Andy F S; Tedersoo, Leho; Vrålstad, Trude; Ursing, Björn M

    2005-06-01

    Identification of ectomycorrhizal (ECM) fungi is often achieved through comparisons of ribosomal DNA internal transcribed spacer (ITS) sequences with accessioned sequences deposited in public databases. A major problem encountered is that annotation of the sequences in these databases is not always complete or trustworthy. In order to overcome this deficiency, we report on UNITE, an open-access database. UNITE comprises well annotated fungal ITS sequences from well defined herbarium specimens that include full herbarium reference identification data, collector/source and ecological data. At present UNITE contains 758 ITS sequences from 455 species and 67 genera of ECM fungi. UNITE can be searched by taxon name, via sequence similarity using blastn, and via phylogenetic sequence identification using galaxie. Following implementation, galaxie performs a phylogenetic analysis of the query sequence after alignment either to pre-existing generic alignments, or to matches retrieved from a blast search on the UNITE data. It should be noted that the current version of UNITE is dedicated to the reliable identification of ECM fungi. The UNITE database is accessible through the URL http://unite.zbi.ee

  3. METHODS OF PROVIDING NOISE IMMUNITY IN AUTOMOBILE ANTI-THEFT SYSTEM CONTROL

    Directory of Open Access Journals (Sweden)

    Frolov, V.

    2013-06-01

    Full Text Available In modern ani-theft systems they use frequency and phase modulation. Since the width of the signal is limited, it is possible to intercept the signal and then switch off the alarm at the right time.To ensure the noise immunity and secrecy manufacturers use more sophisticated codes using the methods of cryptography. Significant increase in noise immunity in modern ani-theft systems is possible using broadband signals.

  4. System and Method for Providing Web-Based Remote Application Service

    OpenAIRE

    Shuen-Tai Wang; Yu-Ching Lin; Hsi-Ya Chang

    2017-01-01

    With the development of virtualization technologies, a new type of service named cloud computing service is produced. Cloud users usually encounter the problem of how to use the virtualized platform easily over the web without requiring the plug-in or installation of special software. The object of this paper is to develop a system and a method enabling process interfacing within an automation scenario for accessing remote application by using the web browser. To meet this challenge, we have ...

  5. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 2, Expanded Analysis and Recommendations

    Science.gov (United States)

    2014-01-01

    and software as a service ( SaaS )) for staff’s abnormal behavior that may indicate an insider incident. As mentioned above, combining SIEM data...Mellon Software Engineering Institute, contacted commercial and government cloud service providers (CSPs) to better understand the administrative and...availability services . We have observed a number of scenarios in which a customer leaves a CSP’s IaaS, PaaS, or SaaS , but its data remains online for some

  6. Molecular similarity measures.

    Science.gov (United States)

    Maggiora, Gerald M; Shanmugasundaram, Veerabahu

    2011-01-01

    Molecular similarity is a pervasive concept in chemistry. It is essential to many aspects of chemical reasoning and analysis and is perhaps the fundamental assumption underlying medicinal chemistry. Dissimilarity, the complement of similarity, also plays a major role in a growing number of applications of molecular diversity in combinatorial chemistry, high-throughput screening, and related fields. How molecular information is represented, called the representation problem, is important to the type of molecular similarity analysis (MSA) that can be carried out in any given situation. In this work, four types of mathematical structure are used to represent molecular information: sets, graphs, vectors, and functions. Molecular similarity is a pairwise relationship that induces structure into sets of molecules, giving rise to the concept of chemical space. Although all three concepts - molecular similarity, molecular representation, and chemical space - are treated in this chapter, the emphasis is on molecular similarity measures. Similarity measures, also called similarity coefficients or indices, are functions that map pairs of compatible molecular representations that are of the same mathematical form into real numbers usually, but not always, lying on the unit interval. This chapter presents a somewhat pedagogical discussion of many types of molecular similarity measures, their strengths and limitations, and their relationship to one another. An expanded account of the material on chemical spaces presented in the first edition of this book is also provided. It includes a discussion of the topography of activity landscapes and the role that activity cliffs in these landscapes play in structure-activity studies.

  7. Evaluation of Two Statistical Methods Provides Insights into the Complex Patterns of Alternative Polyadenylation Site Switching

    Science.gov (United States)

    Li, Jie; Li, Rui; You, Leiming; Xu, Anlong; Fu, Yonggui; Huang, Shengfeng

    2015-01-01

    Switching between different alternative polyadenylation (APA) sites plays an important role in the fine tuning of gene expression. New technologies for the execution of 3’-end enriched RNA-seq allow genome-wide detection of the genes that exhibit significant APA site switching between different samples. Here, we show that the independence test gives better results than the linear trend test in detecting APA site-switching events. Further examination suggests that the discrepancy between these two statistical methods arises from complex APA site-switching events that cannot be represented by a simple change of average 3’-UTR length. In theory, the linear trend test is only effective in detecting these simple changes. We classify the switching events into four switching patterns: two simple patterns (3’-UTR shortening and lengthening) and two complex patterns. By comparing the results of the two statistical methods, we show that complex patterns account for 1/4 of all observed switching events that happen between normal and cancerous human breast cell lines. Because simple and complex switching patterns may convey different biological meanings, they merit separate study. We therefore propose to combine both the independence test and the linear trend test in practice. First, the independence test should be used to detect APA site switching; second, the linear trend test should be invoked to identify simple switching events; and third, those complex switching events that pass independence testing but fail linear trend testing can be identified. PMID:25875641

  8. Physicians' opinions about partner notification methods: case reporting, patient referral, and provider referral.

    Science.gov (United States)

    Hogben, M; St Lawrence, J S; Montaño, D E; Kasprzyk, D; Leichliter, J S; Phillips, W R

    2004-02-01

    The United States has relied upon partner notification strategies to help break the chain of infection and re-infection for sexually transmitted diseases (STD). Physicians are a vital link in the system of STD control, but little is known of physician opinions about partner notification strategies. We collected opinions about partner notification from a national probability sample of physicians in specialties diagnosing STDs. Physicians responded to 17 questions about three relevant forms of STD partner notification: patient based referral, provider based referral, and case reporting. Exploratory factor analyses showed that responses for each form of partner notification could be grouped into four categories: perceived practice norms, infection control, patient relationships, and time/money. Multivariate analyses of the factors showed that physicians endorsed patient based referral most favourably and provider based referral least favourably. Physicians' opinions about partner notification strategies appear to reflect objective reality in some areas, but not in others. Strategies that improve the fit between physicians' opinions and effective notification are needed: some are discussed here.

  9. Similarity solution and Runge Kutta method to a thermal boundary layer model at the entrance region of a circular tube: The Lévêque Approximation

    Directory of Open Access Journals (Sweden)

    Ali Belhocine

    2018-01-01

    Full Text Available In the thermal entrance region, a thermal boundary layer develops and also reaches the circular tube center. The fully developed region is the zone in which the flow is both hydrodynamically and thermally developed. The heat flux will be higher near the inlet because the heat transfer coefficient is highest at the tube inlet where the thickness of the thermal boundary layer is zero and decreases gradually to the fully developed value. In this paper, the assumptions implicit in Leveque's approximation are re-examined, and the analytical solution of the problem with additional boundary conditions, for the temperature field and the boundary layer thickness through the long tube is presented. By defining a similarity variable, the governing equations are reduced to a dimensionless equation with an analytic solution in the entrance region. This report gives justification for the similarity variable via scaling analysis, details the process of converting to a similarity form, and presents a similarity solution. The analytical solutions are then checked against numerical solution programming by Fortran code obtained via using Runge-Kutta fourth order (RK4 method. Finally, others important thermal results obtained from this analysis, such as; approximate Nusselt number in the thermal entrance region was discussed in detail.

  10. Neural interface methods and apparatus to provide artificial sensory capabilities to a subject

    Energy Technology Data Exchange (ETDEWEB)

    Buerger, Stephen P.; Olsson, III, Roy H.; Wojciechowski, Kenneth E.; Novick, David K.; Kholwadwala, Deepesh K.

    2017-01-24

    Embodiments of neural interfaces according to the present invention comprise sensor modules for sensing environmental attributes beyond the natural sensory capability of a subject, and communicating the attributes wirelessly to an external (ex-vivo) portable module attached to the subject. The ex-vivo module encodes and communicates the attributes via a transcutaneous inductively coupled link to an internal (in-vivo) module implanted within the subject. The in-vivo module converts the attribute information into electrical neural stimuli that are delivered to a peripheral nerve bundle within the subject, via an implanted electrode. Methods and apparatus according to the invention incorporate implantable batteries to power the in-vivo module allowing for transcutaneous bidirectional communication of low voltage (e.g. on the order of 5 volts) encoded signals as stimuli commands and neural responses, in a robust, low-error rate, communication channel with minimal effects to the subjects' skin.

  11. Method for providing uranium articles with a corrosion resistant anodized coating

    International Nuclear Information System (INIS)

    Waldrop, F.B.; Washington, C.A.

    1982-01-01

    Uranium articles are provided with anodized oxide coatings in an aqueous solution of an electrolyte selected from the group consisting of potassium phosphate, potassium hydroxide, ammonium hydroxide, and a mixture of potassium tetraborate and boric acid. The uranium articles are anodized at a temperature greater than about 75 degrees C. With a current flow of less than about 0.036 A/cm2 of surface area while the Ph of the solution is maintained in a range of about 2 to 11.5. The Ph values of the aqueous solution and the low current density utilized during the electrolysis prevent excessive dissolution of the uranium and porosity in the film or watering. The relatively high temperature of the electrolyte bath inhibits hydration and the attendant deleterious pitting so as to enhance corrosion resistance of the anodized coating

  12. A Statistical Method for Aggregated Wind Power Plants to Provide Secondary Frequency Control

    DEFF Research Database (Denmark)

    Hu, Junjie; Ziras, Charalampos; Bindner, Henrik W.

    2017-01-01

    curtailment for aggregated wind power plants providing secondary frequency control (SFC) to the power system. By using historical SFC signals and wind speed data, we calculate metrics for the reserve provision error as a function of the scheduled wind power. We show that wind curtailment can be significantly......The increasing penetration of wind power brings significant challenges to power system operators due to the wind’s inherent uncertainty and variability. Traditionally, power plants and more recently demand response have been used to balance the power system. However, the use of wind power...... as a balancing-power source has also been investigated, especially for wind power dominated power systems such as Denmark. The main drawback is that wind power must be curtailed by setting a lower operating point, in order to offer upward regulation. We propose a statistical approach to reduce wind power...

  13. Pediatric primary care providers' perspectives regarding hospital discharge communication: a mixed methods analysis.

    Science.gov (United States)

    Leyenaar, JoAnna K; Bergert, Lora; Mallory, Leah A; Engel, Richard; Rassbach, Caroline; Shen, Mark; Woehrlen, Tess; Cooperberg, David; Coghlin, Daniel

    2015-01-01

    Effective communication between inpatient and outpatient providers may mitigate risks of adverse events associated with hospital discharge. However, there is an absence of pediatric literature defining effective discharge communication strategies at both freestanding children's hospitals and general hospitals. The objectives of this study were to assess associations between pediatric primary care providers' (PCPs) reported receipt of discharge communication and referral hospital type, and to describe PCPs' perspectives regarding effective discharge communication and areas for improvement. We administered a questionnaire to PCPs referring to 16 pediatric hospital medicine programs nationally. Multivariable models were developed to assess associations between referral hospital type and receipt and completeness of discharge communication. Open-ended questions asked respondents to describe effective strategies and areas requiring improvement regarding discharge communication. Conventional qualitative content analysis was performed to identify emergent themes. Responses were received from 201 PCPs, for a response rate of 63%. Although there were no differences between referral hospital type and PCP-reported receipt of discharge communication (relative risk 1.61, 95% confidence interval 0.97-2.67), PCPs referring to general hospitals more frequently reported completeness of discharge communication relative to those referring to freestanding children's hospitals (relative risk 1.78, 95% confidence interval 1.26-2.51). Analysis of free text responses yielded 4 major themes: 1) structured discharge communication, 2) direct personal communication, 3) reliability and timeliness of communication, and 4) communication for effective postdischarge care. This study highlights potential differences in the experiences of PCPs referring to general hospitals and freestanding children's hospitals, and presents valuable contextual data for future quality improvement initiatives

  14. The semantic similarity ensemble

    Directory of Open Access Journals (Sweden)

    Andrea Ballatore

    2013-12-01

    Full Text Available Computational measures of semantic similarity between geographic terms provide valuable support across geographic information retrieval, data mining, and information integration. To date, a wide variety of approaches to geo-semantic similarity have been devised. A judgment of similarity is not intrinsically right or wrong, but obtains a certain degree of cognitive plausibility, depending on how closely it mimics human behavior. Thus selecting the most appropriate measure for a specific task is a significant challenge. To address this issue, we make an analogy between computational similarity measures and soliciting domain expert opinions, which incorporate a subjective set of beliefs, perceptions, hypotheses, and epistemic biases. Following this analogy, we define the semantic similarity ensemble (SSE as a composition of different similarity measures, acting as a panel of experts having to reach a decision on the semantic similarity of a set of geographic terms. The approach is evaluated in comparison to human judgments, and results indicate that an SSE performs better than the average of its parts. Although the best member tends to outperform the ensemble, all ensembles outperform the average performance of each ensemble's member. Hence, in contexts where the best measure is unknown, the ensemble provides a more cognitively plausible approach.

  15. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  16. Analysis of methods of providing anonymity in facial photographs; a randomised controlled study.

    LENUS (Irish Health Repository)

    Clover, A J P

    2010-09-01

    Clinical images are invaluable in medical teaching and research publications. In the past efforts to conceal patient identity, if any, were limited to a black bar concealing the eyes. However, there is no consensus on this among major journals and publishing houses. This research analyses the effectiveness of blacking out the eyes in facial photographs and evaluates alternative techniques. 126 questionnaires were completed. The average numbers of correct responses out of 30 was 24.64 (82.13%) in the control group, 20.59 (68.63%) in the eyes, 20.42 (68.07%) in the eyes and nose group, and 17.53 (58.43%) in the T-shaped group (eyes, nose and mouth). The traditional method of covering the eyes does significantly decrease recognition, however it is only as effective as covering the nose and mouth. The more of the face that is covered the less likely it is that the person is recognised. However, there are people who remain identifiable no matter how much of the face is covered. This work highlights the importance of obtaining consent prior to publication as well as attempting to hide identity.

  17. Similarity Measure of Graphs

    Directory of Open Access Journals (Sweden)

    Amine Labriji

    2017-07-01

    Full Text Available The topic of identifying the similarity of graphs was considered as highly recommended research field in the Web semantic, artificial intelligence, the shape recognition and information research. One of the fundamental problems of graph databases is finding similar graphs to a graph query. Existing approaches dealing with this problem are usually based on the nodes and arcs of the two graphs, regardless of parental semantic links. For instance, a common connection is not identified as being part of the similarity of two graphs in cases like two graphs without common concepts, the measure of similarity based on the union of two graphs, or the one based on the notion of maximum common sub-graph (SCM, or the distance of edition of graphs. This leads to an inadequate situation in the context of information research. To overcome this problem, we suggest a new measure of similarity between graphs, based on the similarity measure of Wu and Palmer. We have shown that this new measure satisfies the properties of a measure of similarities and we applied this new measure on examples. The results show that our measure provides a run time with a gain of time compared to existing approaches. In addition, we compared the relevance of the similarity values obtained, it appears that this new graphs measure is advantageous and  offers a contribution to solving the problem mentioned above.

  18. Gamma Knife radiosurgery of olfactory groove meningiomas provides a method to preserve subjective olfactory function.

    Science.gov (United States)

    Gande, Abhiram; Kano, Hideyuki; Bowden, Gregory; Mousavi, Seyed H; Niranjan, Ajay; Flickinger, John C; Lunsford, L Dade

    2014-02-01

    Anosmia is a common outcome after resection of olfactory groove meningioma(s) (OGM) and for some patients represents a significant disability. To evaluate long term tumor control rates and preservation of subjective olfaction after Gamma Knife (GK) stereotactic radiosurgery (SRS) of OGM. We performed a retrospective chart review and telephone assessments of 41 patients who underwent GK SRS between 1987 and 2008. Clinical outcomes were stratified by full, partial or no subjective olfaction, whereas tumor control was assessed by changes in volume greater or lesser than 25%. The median clinical and imaging follow-up were 76 and 65 months, respectively. Prior to SRS, 19 (46%) patients had surgical resections and two (5%) had received fractionated radiation therapy. Twenty four patients (59%) reported a normal sense of smell, 12 (29%) reported a reduced sense of smell and five (12%) had complete anosmia. The median tumor volume was 8.5 cm(3) (range 0.6-56.1), the mean radiation dose at the tumor margin was 13 Gy (range 10-20) and the median estimated dose to the olfactory nerve was 5.1 Gy (range 1.1-18.1). At follow-up, 27 patients (66%) reported intact olfaction (three (7%) described return to a normal sense of smell), nine (22%) described partial anosmia, and five (12%) had complete anosmia. No patient reported deterioration in olfaction after SRS. Thirteen patients (32%) showed significant tumor regression, 26 (63%) had no further growth and two (5%) had progressed. The progression free tumor control rates were 97% at 1 year and 95% at 2, 10 and 20 years. Symptomatic adverse radiation effects occurred in three (7%) patients. Stereotactic radiosurgery provided both long term tumor control and preservation of olfaction.

  19. Development of a NIR-based blend uniformity method for a drug product containing multiple structurally similar actives by using the quality by design principles.

    Science.gov (United States)

    Lin, Yiqing; Li, Weiyong; Xu, Jin; Boulas, Pierre

    2015-07-05

    The aim of this study is to develop an at-line near infrared (NIR) method for the rapid and simultaneous determination of four structurally similar active pharmaceutical ingredients (APIs) in powder blends intended for the manufacturing of tablets. Two of the four APIs in the formula are present in relatively small amounts, one at 0.95% and the other at 0.57%. Such small amounts in addition to the similarity in structures add significant complexity to the blend uniformity analysis. The NIR method is developed using spectra from six laboratory-created calibration samples augmented by a small set of spectra from a large-scale blending sample. Applying the quality by design (QbD) principles, the calibration design included concentration variations of the four APIs and a main excipient, microcrystalline cellulose. A bench-top FT-NIR instrument was used to acquire the spectra. The obtained NIR spectra were analyzed by applying principal component analysis (PCA) before calibration model development. Score patterns from the PCA were analyzed to reveal relationship between latent variables and concentration variations of the APIs. In calibration model development, both PLS-1 and PLS-2 models were created and evaluated for their effectiveness in predicting API concentrations in the blending samples. The final NIR method shows satisfactory specificity and accuracy. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. An alignment-free method to find similarity among protein sequences via the general form of Chou's pseudo amino acid composition.

    Science.gov (United States)

    Gupta, M K; Niyogi, R; Misra, M

    2013-01-01

    In this paper, we propose a method to create the 60-dimensional feature vector for protein sequences via the general form of pseudo amino acid composition. The construction of the feature vector is based on the contents of amino acids, total distance of each amino acid from the first amino acid in the protein sequence and the distribution of 20 amino acids. The obtained cosine distance metric (also called the similarity matrix) is used to construct the phylogenetic tree by the neighbour joining method. In order to show the applicability of our approach, we tested it on three proteins: 1) ND5 protein sequences from nine species, 2) ND6 protein sequences from eight species, and 3) 50 coronavirus spike proteins. The results are in agreement with known history and the output from the multiple sequence alignment program ClustalW, which is widely used. We have also compared our phylogenetic results with six other recently proposed alignment-free methods. These comparisons show that our proposed method gives a more consistent biological relationship than the others. In addition, the time complexity is linear and space required is less as compared with other alignment-free methods that use graphical representation. It should be noted that the multiple sequence alignment method has exponential time complexity.

  1. Private providers' knowledge, attitudes and misconceptions related to long-acting and permanent contraceptive methods: a case study in Bangladesh.

    Science.gov (United States)

    Ugaz, Jorge; Banke, Kathryn; Rahaim, Stephen; Chowdhury, Wahiduzzaman; Williams, Julie

    2016-11-01

    In Bangladesh, use of long-acting and permanent methods of contraception (LAPMs) remains stagnant. Providers' limited knowledge and biases may be a factor. We assessed private providers' knowledge, misconceptions and general attitudes towards LAPM in two urban areas. The ultimate goal is to shape programs and interventions to overcome these obstacles and improve full method choice in Bangladesh. Trained data collectors interviewed a convenience sample of 235 female doctors (obstetricians-gynecologists and general practitioners) and 150 female nurses from 194 commercial (for-profit) health care facilities in Chittagong City Corporation and Dhaka district. Data were collected on the nature of the practice, training received, knowledge about modern contraceptives and attitudes towards LAPM [including intrauterine device (IUDs), implants, female and male sterilization]. All providers, and especially doctors, lacked adequate knowledge regarding side effects for all LAPMs, particularly female and male sterilization. Providers had misconceptions about the effectiveness and convenience of LAPMs compared to short-acting contraceptive methods. Implants and IUDs were generally perceived more negatively than other methods. The majority of providers believed that husbands favor short-acting methods rather than LAPMs and that women should not use a method that their husbands do not approve of. Our findings document knowledge and attitudinal barriers among private for-profit providers in urban areas affecting their provision of accurate information about LAPM choices. Practitioners should be offered the necessary tools to provide women full access to all modern methods, especially LAPMs, in order to contribute to decreasing unmet need and improving full method choice in Bangladesh. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Gender similarities and differences.

    Science.gov (United States)

    Hyde, Janet Shibley

    2014-01-01

    Whether men and women are fundamentally different or similar has been debated for more than a century. This review summarizes major theories designed to explain gender differences: evolutionary theories, cognitive social learning theory, sociocultural theory, and expectancy-value theory. The gender similarities hypothesis raises the possibility of theorizing gender similarities. Statistical methods for the analysis of gender differences and similarities are reviewed, including effect sizes, meta-analysis, taxometric analysis, and equivalence testing. Then, relying mainly on evidence from meta-analyses, gender differences are reviewed in cognitive performance (e.g., math performance), personality and social behaviors (e.g., temperament, emotions, aggression, and leadership), and psychological well-being. The evidence on gender differences in variance is summarized. The final sections explore applications of intersectionality and directions for future research.

  3. On different forms of self similarity

    International Nuclear Information System (INIS)

    Aswathy, R.K.; Mathew, Sunil

    2016-01-01

    Fractal geometry is mainly based on the idea of self-similar forms. To be self-similar, a shape must able to be divided into parts that are smaller copies, which are more or less similar to the whole. There are different forms of self similarity in nature and mathematics. In this paper, some of the topological properties of super self similar sets are discussed. It is proved that in a complete metric space with two or more elements, the set of all non super self similar sets are dense in the set of all non-empty compact sub sets. It is also proved that the product of self similar sets are super self similar in product metric spaces and that the super self similarity is preserved under isometry. A characterization of super self similar sets using contracting sub self similarity is also presented. Some relevant counterexamples are provided. The concepts of exact super and sub self similarity are introduced and a necessary and sufficient condition for a set to be exact super self similar in terms of condensation iterated function systems (Condensation IFS’s) is obtained. A method to generate exact sub self similar sets using condensation IFS’s and the denseness of exact super self similar sets are also discussed.

  4. Analysis of the similarity factors of the villages in the areas of the nuclear power plants from the premature death-rate performed by fuzzy logic method

    International Nuclear Information System (INIS)

    Letkovicova, M.; Rehak, R.; Korec, J.; Mihaly, B.; Prikazsky, V.

    1998-01-01

    Our paper examines the surrounding areas of NPP from the proportion of premature death-rate which is one of the complex indicators of the health situation of the population. Specially, attention is focused on NPP in Bohunice (SE-EBO) which has been in operation for the last 30 years and NPP Mochovce (SE-EMO) which was still under construction when data was collected. WHO considers every death of the individual before 65 years of age a premature death case, except death cases of children younger that 1 year. Because of the diversity of the population, this factor is a standard for the population of Slovak Republic (SR) as well as for the european population. The objective of the work is to prove, that even a long term production of energy in NPP does not evoke health problems for the population living in the surrounding areas, which could be recorded through analysis of premature death cases. Using the fuzzy logic method when searching for similar objects and evaluating the influence of the NPP on its surrounding area seems more natural than classical accumulation method, which separates objects into groups. When using the classical accumulation method, the objects in particular accumulation group are more similar than 2 objects in different accumulation groups. When using the fuzzy logic method the similarity is defined more naturally. Within the observed regions of the NPP, the percentage of directly standardized premature death cases is almost identical with the average for the SR. The most closely observed region of SE-EMO up to 5 kilometers zone even shows the lowest percentage. Also we did not record any areas that would have unfavourable values from the wind streams perspective neither than from the local water streams recipients of SE-EBO Manivier and Dudvah. The region of SE-EMO is also within the SR average, unfavourable coherent areas of premature death case are non existent. Galanta city region comes out of the comparison with the relatively worse

  5. Modeling the kinetics of hydrates formation using phase field method under similar conditions of petroleum pipelines; Modelagem da cinetica de formacao de hidratos utilizando o Modelo do Campo de Fase em condicoes similares a dutos de petroleo

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, Mabelle Biancardi; Castro, Jose Adilson de; Silva, Alexandre Jose da [Universidade Federal Fluminense (UFF), Volta Redonda, RJ (Brazil). Programa de Pos-Graduacao em Engenharia Metalurgica], e-mails: mabelle@metal.eeimvr.uff.br; adilson@metal.eeimvr.uff.br; ajs@metal.eeimvr.uff.br

    2008-10-15

    Natural hydrates are crystalline compounds that are ice-like formed under oil extraction transportation and processing. This paper deals with the kinetics of hydrate formation by using the phase field approach coupled with the transport equation of energy. The kinetic parameters of the hydrate formation were obtained by adjusting the proposed model to experimental results in similar conditions of oil extraction. The effect of thermal and nucleation conditions were investigated while the rate of formation and morphology were obtained by numerical computation. Model results of kinetics growth and morphology presented good agreement with the experimental ones. Simulation results indicated that super-cooling and pressure were decisive parameters for hydrates growth, morphology and interface thickness. (author)

  6. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    Directory of Open Access Journals (Sweden)

    B. V. Savchinskiy

    2010-03-01

    Full Text Available On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  7. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    OpenAIRE

    B. V. Savchinskiy

    2010-01-01

    On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  8. A Mixed-Methods Investigation of Early Childhood Professional Development for Providers and Recipients in the United States

    Science.gov (United States)

    Linder, Sandra M.; Rembert, Kellye; Simpson, Amber; Ramey, M. Deanna

    2016-01-01

    This multi-phase mixed-methods study explores provider and recipient perceptions of the current state of early childhood professional development in a southeastern area of the United States. Professional development for the early childhood workforce has been shown to positively influence the quality of early childhood classrooms. This study…

  9. Perceptions of vaginal microbicides as an HIV prevention method among health care providers in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Mantell Joanne E

    2007-03-01

    Full Text Available Abstract Background The promise of microbicides as an HIV prevention method will not be realized if not supported by health care providers. They are the primary source of sexual health information for potential users, in both the public and private health sectors. Therefore, the aim of this study was to determine perceptions of vaginal microbicides as a potential HIV prevention method among health care providers in Durban and Hlabisa, South Africa, using a combination of quantitative and qualitative methods. Results During 2004, semi structured interviews with 149 health care providers were conducted. Fifty seven percent of hospital managers, 40% of pharmacists and 35% of nurses possessed some basic knowledge of microbicides, such as the product being used intra-vaginally before sex to prevent HIV infection. The majority of them were positive about microbicides and were willing to counsel users regarding potential use. Providers from both public and private sectors felt that an effective microbicide should be available to all people, regardless of HIV status. Providers felt that the product should be accessed over-the-counter in pharmacies and in retail stores. They also felt a need for potential microbicides to be available free of charge, and packaged with clear instructions. The media was seen by health care providers as being an effective strategy for promoting microbicides. Conclusion Overall, health care providers were very positive about the possible introduction of an effective microbicide for HIV prevention. The findings generated by this study illustrated the need for training health care providers prior to making the product accessible, as well as the importance of addressing the potential barriers to use of the product by women. These are important concerns in the health care community, and this study also served to educate them for the day when research becomes reality.

  10. Calculation of the energy provided by a PV generator. Comparative study: Conventional methods vs. artificial neural networks

    International Nuclear Information System (INIS)

    Almonacid, F.; Rus, C.; Perez-Higueras, P.; Hontoria, L.

    2011-01-01

    The use of photovoltaics for electricity generation purposes has recorded one of the largest increases in the field of renewable energies. The energy production of a grid-connected PV system depends on various factors. In a wide sense, it is considered that the annual energy provided by a generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. However, a range of factors is influencing the expected outcome by reducing the generation of energy. The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network developed by the R and D Group for Solar and Automatic Energy at the University of Jaen. The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study, mainly due to the fact that this method takes also into account some second order effects, such as low irradiance, angular and spectral effects. -- Research highlights: → It is considered that the annual energy provided by a PV generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. → A range of factors are influencing the expected outcome by reducing the generation of energy (mismatch losses, dirt and dust, Ohmic losses,.). → The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network. → The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study. While classical methods have only taken into account temperature losses, the method based in

  11. A combined usage of stochastic and quantitative risk assessment methods in the worksites: Application on an electric power provider

    International Nuclear Information System (INIS)

    Marhavilas, P.K.; Koulouriotis, D.E.

    2012-01-01

    An individual method cannot build either a realistic forecasting model or a risk assessment process in the worksites, and future perspectives should focus on the combined forecasting/estimation approach. The main purpose of this paper is to gain insight into a risk prediction and estimation methodological framework, using the combination of three different methods, including the proportional quantitative-risk-assessment technique (PRAT), the time-series stochastic process (TSP), and the method of estimating the societal-risk (SRE) by F–N curves. In order to prove the usefulness of the combined usage of stochastic and quantitative risk assessment methods, an application on an electric power provider industry is presented to, using empirical data.

  12. Evaluation of protection factors provided by full-face masks using man-test method at workplace

    International Nuclear Information System (INIS)

    Izumi, Yukio; Kinouchi, Nobuyuki; Ikezawa, Yoshio.

    1994-01-01

    From a practical angle of view to estimate the protection factors (PFs) provided by full-face masks, a number of protection factors were measured with a man-test apparatus just before the wearers started to do radiation work in radiation controlled area. PFs of the total number of 2,279 cases were measured under five simulated working conditions. The measured PFs were widely distributed from 2.3 to 6,700. About 95% of workers obtained PFs more than 50, and about 64% showed much higher PFs more than 1,000 due to good fitting. In the case of some persons, the measured PFs irregularly varied and changed to a large degree. This method is a reliable technique that has been confirmed to protect unexpected internal exposure. From the results obtained, the method should be necessary to provide a better mask and higher PF for each worker. (author)

  13. A METHOD AND AN APPARATUS FOR PROVIDING TIMING SIGNALS TO A NUMBER OF CIRCUITS, AN INTEGRATED CIRCUIT AND A NODE

    DEFF Research Database (Denmark)

    2006-01-01

    A method of providing or transporting a timing signal between a number of circuits, electrical or optical, where each circuit is fed by a node. The nodes forward timing signals between each other, and at least one node is adapted to not transmit a timing signal before having received a timing...... signal from at least two nodes. In this manner, the direction of the timing skew between nodes and circuits is known and data transport between the circuits made easier....

  14. Evaluation of Effective Factors on e-Loyalty in Organizations Providing Electronic Services using Fuzzy AHP Method

    Directory of Open Access Journals (Sweden)

    fatemeh mohammadi

    2012-12-01

    Full Text Available In today's business world, proper identification of customer’s requirements and a quick response to these requirements is a key to commercial success. Increasing customer loyalty affects the profitability and organizations can ensure their long-term interests by means of planning. In today's competitive world, the services provided by the competing company have to be more similar to each other and can be hard to surprise customers within completely new service in the long term, because the newest services are quickly imitated by competitors and marketed. Hence investment in customer loyalty is an effective and profitable investment for companies. One criticism that has entered into the e-service is customer loyalty. In order to study the causes of e-loyalty for organization providing e-services, this research identified the factors affecting customer loyalty in e-services and with questionnaire prepared and by using fuzzy hierarchical decision-making process acquires the weight of each factor and ultimately rank them. The results show that the quality of service provided to e-services customers is the most important factor in creating e-loyalty.

  15. A method for identifying hierarchical sub-networks / modules and weighting network links based on their similarity in sub-network / module affiliation

    Directory of Open Access Journals (Sweden)

    WenJun Zhang

    2016-06-01

    Full Text Available Some networks, including biological networks, consist of hierarchical sub-networks / modules. Based on my previous study, in present study a method for both identifying hierarchical sub-networks / modules and weighting network links is proposed. It is based on the cluster analysis in which between-node similarity in sets of adjacency nodes is used. Two matrices, linkWeightMat and linkClusterIDs, are achieved by using the algorithm. Two links with both the same weight in linkWeightMat and the same cluster ID in linkClusterIDs belong to the same sub-network / module. Two links with the same weight in linkWeightMat but different cluster IDs in linkClusterIDs belong to two sub-networks / modules at the same hirarchical level. However, a link with an unique cluster ID in linkClusterIDs does not belong to any sub-networks / modules. A sub-network / module of the greater weight is the more connected sub-network / modules. Matlab codes of the algorithm are presented.

  16. Identification of strains with phenotypes similar to those of Staphylococcus aureus isolated from table chicken eggs using MALDI-TOF MS and genotyping methods

    Directory of Open Access Journals (Sweden)

    Marek Agnieszka

    2015-06-01

    Full Text Available The aim of the study was to identify the affinity of 10 Staphylococcus strains isolated from table chicken eggs to specific species. Preliminary analysis performed by API ID32 Staph test identified these strains as S. aureus, but they exhibited a negative reaction in the tube coagulase test. Thus, the analysed strains were initially characterised as Staphylococcus aureus-like (SAL. Further characterisation was performed by genotypic methods, using restriction fragment length polymorphism (RFLP of the coagulase gene (coa and sequencing of the gene rpoB. An attempt was also made to identify the isolated Staphylococcus strains by MALDI-TOF mass spectrometry. The results indicated that none of the strains tested belonged to the species S. aureus. The rpoB sequences of five isolates showed the highest sequence similarity to S. haemolyticus, three isolates to S. chromogenes, and one isolate to S. epidermidis. One strain (SAL4 remained unidentified in this analysis. The results obtained using mass spectrometry were comparable to those based on gene sequence analysis. Strain SAL4, which could not be identified by sequencing, was identified by MALDI-TOF as Staphylococcus chromogenes.

  17. Behavioural responses to hypoxia provide a non-invasive method for distinguishing between stress coping styles in fish

    DEFF Research Database (Denmark)

    Laursen, Danielle Caroline; Olsén, Hanna L.; Ruiz-Gomez, Maria de Lourdes

    2011-01-01

    . These individual differences may result in suboptimal production and compromised welfare in aquaculture. An approach to overcome these problems could be to sort fish and optimise rearing conditions according to coping style. It has been previously demonstrated that the proactive and reactive coping styles in fish......, these fish provided an opportunity for verifying a method for sorting fish with respect to coping style by exposure to hypoxia. Groups consisting of 24 individually tagged fish, 12 HR and 12 LR were exposed to hypoxia in a two choice system. The system consisted of a “home” tank provided with cover connected...... to a second brightly “illuminated” tank via a closable doorway. During the experiment, the doorway between the two tanks was opened and hypoxic conditions were gradually induced in the “home” tank by bubbling with nitrogen. The latency time to move away from hypoxic conditions to normoxic conditions...

  18. The paradox of compassionate work: a mixed-methods study of satisfying and fatiguing experiences of animal health care providers.

    Science.gov (United States)

    Polachek, Alicia J; Wallace, Jean E

    2018-03-01

    Compassionate work appears paradoxical as it may provide great rewards, but may also come at great costs to care providers. This paper explores the paradox of compassionate work by examining what interactions contribute to compassion satisfaction and what interactions contribute to compassion fatigue. This mixed-methods, cross-sectional study uses qualitative interview data from animal health care providers (N = 20) to identify work interactions that they find satisfying or stressful. Quantitative survey data (N = 572) are used to test hypotheses generated from the interviews regarding predictors of compassion satisfaction and compassion fatigue. Interview transcripts were analyzed using a directed content analysis approach. Survey data were analyzed using ordinary least squares regression. The results highlight the complex nature of compassionate work. As hypothesized, making a difference to animals and building relationships with animal patients and human clients relate to greater compassion satisfaction. Human client barriers to animal care and witnessing client grief relate to greater compassion fatigue, as predicted. None of the predictors relate to less compassion fatigue, but forming relationships with animal patients relates to both greater compassion satisfaction and compassion fatigue. This paper enhances our understanding of provider-client-patient interactions and highlights the paradox of compassionate work.

  19. runjags: An R Package Providing Interface Utilities, Model Templates, Parallel Computing Methods and Additional Distributions for MCMC Models in JAGS

    Directory of Open Access Journals (Sweden)

    Matthew J. Denwood

    2016-07-01

    Full Text Available The runjags package provides a set of interface functions to facilitate running Markov chain Monte Carlo models in JAGS from within R. Automated calculation of appropriate convergence and sample length diagnostics, user-friendly access to commonly used graphical outputs and summary statistics, and parallelized methods of running JAGS are provided. Template model specifications can be generated using a standard lme4-style formula interface to assist users less familiar with the BUGS syntax. Automated simulation study functions are implemented to facilitate model performance assessment, as well as drop-k type cross-validation studies, using high performance computing clusters such as those provided by parallel. A module extension for JAGS is also included within runjags, providing the Pareto family of distributions and a series of minimally-informative priors including the DuMouchel and half-Cauchy priors. This paper outlines the primary functions of this package, and gives an illustration of a simulation study to assess the sensitivity of two equivalent model formulations to different prior distributions.

  20. DETECTION OF REPORTS FALSIFICATION PROVIDED TO A BANK BY A BORROWER USING THE METHOD OF DYNAMIC PARAMETERS ANALYSIS

    Directory of Open Access Journals (Sweden)

    M. S. Lyuft

    2015-01-01

    Full Text Available Summary. The main stop-factors in a landing were formed in the article according to the procedure of the European Bank for Reconstruction and Development by the means of questioning the leading Russian banks that finance small-scale business. It is given the description of this method, also it is identified the main weaknesses of the EBRD methodology. There is a description of the main methods of the borrowing company’s analytical balance and thereupon it is made the conclusion about the necessity of the analysis of the balance’s principal factors across time. The analysis of indicators and factors in the dynamics enables us to see trends in the development of the company, and to identify deviations in the coefficients. Either materiality or difference from normal values of these coefficients may indicate the factors of the borrowers’ misconduct, and in particular it gives evidence concerning falsification of reports provided to a bank. There are stages of information processing for falsification’s detection, excluding the interest from decision-makers about the possibility of lending in the results of a transaction. The formula that determinates the value of net profit falsification has been made on basis of dynamic parameters of the analytical balance and the connection with the administrative profit-and-loss report. Further, the article provides the second method of a determination of the net profit falsification already based on data of the parameters in dynamics namely business profitability rate. The process of calculation Payment To Income - payment to income - an indicator, in order to obtain good data on who falsify net income. Are key strengths of this method of identifying and conclusions paragraph article.

  1. Two Project Methods: Preliminary Observations on the Similarities and Differences between William Heard Kilpatrick's Project Method and John Dewey's Problem-Solving Method

    Science.gov (United States)

    Sutinen, Ari

    2013-01-01

    The project method became a famous teaching method when William Heard Kilpatrick published his article "Project Method" in 1918. The key idea in Kilpatrick's project method is to try to explain how pupils learn things when they work in projects toward different common objects. The same idea of pupils learning by work or action in an…

  2. Digital photography provides a fast, reliable, and noninvasive method to estimate anthocyanin pigment concentration in reproductive and vegetative plant tissues.

    Science.gov (United States)

    Del Valle, José C; Gallardo-López, Antonio; Buide, Mª Luisa; Whittall, Justen B; Narbona, Eduardo

    2018-03-01

    Anthocyanin pigments have become a model trait for evolutionary ecology as they often provide adaptive benefits for plants. Anthocyanins have been traditionally quantified biochemically or more recently using spectral reflectance. However, both methods require destructive sampling and can be labor intensive and challenging with small samples. Recent advances in digital photography and image processing make it the method of choice for measuring color in the wild. Here, we use digital images as a quick, noninvasive method to estimate relative anthocyanin concentrations in species exhibiting color variation. Using a consumer-level digital camera and a free image processing toolbox, we extracted RGB values from digital images to generate color indices. We tested petals, stems, pedicels, and calyces of six species, which contain different types of anthocyanin pigments and exhibit different pigmentation patterns. Color indices were assessed by their correlation to biochemically determined anthocyanin concentrations. For comparison, we also calculated color indices from spectral reflectance and tested the correlation with anthocyanin concentration. Indices perform differently depending on the nature of the color variation. For both digital images and spectral reflectance, the most accurate estimates of anthocyanin concentration emerge from anthocyanin content-chroma ratio, anthocyanin content-chroma basic, and strength of green indices. Color indices derived from both digital images and spectral reflectance strongly correlate with biochemically determined anthocyanin concentration; however, the estimates from digital images performed better than spectral reflectance in terms of r 2 and normalized root-mean-square error. This was particularly noticeable in a species with striped petals, but in the case of striped calyces, both methods showed a comparable relationship with anthocyanin concentration. Using digital images brings new opportunities to accurately quantify the

  3. Development of quality indicators for low-risk labor care provided by midwives using a RAND-modified Delphi method.

    Science.gov (United States)

    Ueda, Kayo; Ohtera, Shosuke; Kaso, Misato; Nakayama, Takeo

    2017-09-22

    In childbirth, most deliveries are low-risk, defined as spontaneous labor at full term without special high-risk facts or complications, especially in high-resource countries where maternal and perinatal mortality rates are very low. Indeed, the majority of mothers and infants have no serious conditions during labor. However, the quality of care provided is not assured, and performance may vary by birthing facility and provider. The overuse of technology in childbirth in some parts of the world is almost certainly based on assumptions like, "something can go wrong at any minute." There is a need to assess the quality of care provided for mothers and infants in low-risk labor. We aimed to develop specific quality indicators for low-risk labor care provided primarily by midwives in Japan. We used a RAND-modified Delphi method, which integrates evidence review with expert consensus development. The procedure comprises five steps: (1) literature review, including clinical practice guidelines, to extract and develop quality indicator candidates; (2) formation of a multidisciplinary panel; (3) independent panel ratings (Round 1); (4) panel meeting and independent panel ratings (Round 2); and (5) independent panel ratings (Round 3). The three independent panel ratings (Rounds 1-3) were held between July and December 2012. The assembled multidisciplinary panel comprised eight clinicians (two pediatricians, three obstetricians, and three midwives) and three mothers who were nonclinicians. Evidentiary review extracted 166 key recommendations from 32 clinical practice guidelines, and 31 existing quality indicators were added. After excluding duplicate recommendations and quality indicators, the panel discussed 25 candidate indicators. Of these, 18 were adopted, one was modified, six were not adopted, and four were added during the meeting, respectively. We established 23 quality indicators for low-risk labor care provided by midwives in labor units in Japan.

  4. A mixed-methods examination of communication between oncologists and primary care providers among primary care physicians in underserved communities.

    Science.gov (United States)

    Shen, Megan Johnson; Binz-Scharf, Maria; D'Agostino, Tom; Blakeney, Natasha; Weiss, Elisa; Michaels, Margo; Patel, Shilpa; McKee, M Diane; Bylund, Carma L

    2015-03-15

    Research has demonstrated that communication and care coordination improve cancer patient outcomes. To improve communication and care coordination, it is important to understand primary care providers' (PCPs') perceptions of communication with oncologists as well as PCPs' communication needs. A mixed-methods approach was used in the present study. In the qualitative phase of the study, 18 PCPs practicing in underserved, minority communities were interviewed about their experiences communicating with oncologists. In the quantitative phase of the study, 128 PCPs completed an online survey about their preferences, experiences, and satisfaction with communication with oncologists. Results indicated a PCP-oncologist gap in communication occurred between diagnosis and treatment. PCPs wanted more communication with oncologists, updates on their patients' prognosis throughout treatment, and to be contacted via telephone or email and saw their role as crucial in providing supportive care for their patients. Although PCPs recognize that they play a critical, proactive role in supporting patients throughout the continuum of their cancer care experience, existing norms regarding postreferral engagement and oncologist-PCP communication often hinder activation of this role among PCPs. Expected standards regarding the method, frequency, and quality of postreferral communication should be jointly articulated and made accountable between PCPs and oncologists to help improve cancer patients' quality of care, particularly in minority communities. © 2014 American Cancer Society.

  5. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group.

    Directory of Open Access Journals (Sweden)

    Tiago R Simões

    Full Text Available Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes that radiated during the Late Cretaceous (95-66 million years ago. They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus.

  6. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group

    Science.gov (United States)

    Vernygora, Oksana; Paparella, Ilaria; Jimenez-Huidobro, Paulina; Caldwell, Michael W.

    2017-01-01

    Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes) that radiated during the Late Cretaceous (95–66 million years ago). They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted) maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus. PMID:28467456

  7. Family building using embryo adoption: relationships and contact arrangements between provider and recipient families-a mixed-methods study.

    Science.gov (United States)

    Frith, Lucy; Blyth, Eric; Lui, Steve

    2017-05-01

    What contact arrangements are established between providers and recipients of embryos using Snowflakes® Embryo Adoption Program? Contact arrangements varied considerably and were generally positively described, although some challenges were acknowledged. Reproductive technologies create new and diverse family forms, and the ways in which families created by embryo adoption are negotiated in practice have not been extensively investigated. This exploratory, mixed-methods study had two phases: (i) an online survey (open May-September 2013) and (ii) qualitative semi-structured interviews by email (conducted between 2014 and 2015), exploring participants' experiences of contact with their embryo provider or recipient. Phase I included 17 providers (14 women and 3 men) and 28 recipients (27 women and 1 man). Phase II included 8 providers (5 women and 3 men) and 12 recipients (10 women and 2 men). All participants, except one, were located in the US. This study illustrates how embryo adoption in the US, as a form of conditional donation, can operate and how the participants define and negotiate these emerging relationships. All families were open with their children about how they were conceived and early contact between recipients and providers (frequently before birth) was valued. On the whole, participants were happy with the amount and type of contact they had, and where the current contact did not involve the children, it was seen as a way of keeping the channels open for future contact when the children were older. Participants often portrayed the opportunities for contact as being in the best interests of the child. The study participants are a particular group who had chosen to either receive or give their embryos via a conditional embryo adoption agency in the US and had established contact. Therefore, this is not a representative sample of those who provide or receive embryos for family building. This embryo adoption model clearly fulfils a need; some people

  8. Measuring transferring similarity via local information

    Science.gov (United States)

    Yin, Likang; Deng, Yong

    2018-05-01

    Recommender systems have developed along with the web science, and how to measure the similarity between users is crucial for processing collaborative filtering recommendation. Many efficient models have been proposed (i.g., the Pearson coefficient) to measure the direct correlation. However, the direct correlation measures are greatly affected by the sparsity of dataset. In other words, the direct correlation measures would present an inauthentic similarity if two users have a very few commonly selected objects. Transferring similarity overcomes this drawback by considering their common neighbors (i.e., the intermediates). Yet, the transferring similarity also has its drawback since it can only provide the interval of similarity. To break the limitations, we propose the Belief Transferring Similarity (BTS) model. The contributions of BTS model are: (1) BTS model addresses the issue of the sparsity of dataset by considering the high-order similarity. (2) BTS model transforms uncertain interval to a certain state based on fuzzy systems theory. (3) BTS model is able to combine the transferring similarity of different intermediates using information fusion method. Finally, we compare BTS models with nine different link prediction methods in nine different networks, and we also illustrate the convergence property and efficiency of the BTS model.

  9. On the use of the fictitious wave steepness and related surf-similarity parameters in methods that describe the hydraulic and structural response to waves

    NARCIS (Netherlands)

    Heineke, D.; Verhagen, H.J.

    2007-01-01

    To assess the hydraulic performance of coastal structures - viz. wave run-up, overtopping and reflection - and to evaluate the stability of the armour layers, use is made of the dimensionless surf similarity parameter, as introduced by Battjes (1974). The front side slope of the structure and the

  10. An analytical solution of Richards' equation providing the physical basis of SCS curve number method and its proportionality relationship

    Science.gov (United States)

    Hooshyar, Milad; Wang, Dingbao

    2016-08-01

    The empirical proportionality relationship, which indicates that the ratio of cumulative surface runoff and infiltration to their corresponding potentials are equal, is the basis of the extensively used Soil Conservation Service Curve Number (SCS-CN) method. The objective of this paper is to provide the physical basis of the SCS-CN method and its proportionality hypothesis from the infiltration excess runoff generation perspective. To achieve this purpose, an analytical solution of Richards' equation is derived for ponded infiltration in shallow water table environment under the following boundary conditions: (1) the soil is saturated at the land surface; and (2) there is a no-flux boundary which moves downward. The solution is established based on the assumptions of negligible gravitational effect, constant soil water diffusivity, and hydrostatic soil moisture profile between the no-flux boundary and water table. Based on the derived analytical solution, the proportionality hypothesis is a reasonable approximation for rainfall partitioning at the early stage of ponded infiltration in areas with a shallow water table for coarse textured soils.

  11. Evaluating the impact of healthcare provider training to improve tuberculosis management: a systematic review of methods and outcome indicators used.

    Science.gov (United States)

    Wu, Shishi; Roychowdhury, Imara; Khan, Mishal

    2017-03-01

    Developing human resources capacity is vital for tuberculosis (TB) control in low- and middle-income countries. Although investments in TB healthcare provider (HCP) training programmes have increased, it is unclear whether these are robustly evaluated. The objective of this systematic review was to synthesize the methods and outcome indicators used to assess TB HCP training programmes. A systematic scoping review of publications reporting on evaluations of training programmes for TB HCPs - including doctors, nurses, paramedics, and lay health workers - was conducted through a search in three electronic databases, Google Scholar, and five websites of non-profit organizations. Data on the study location, population trained, outcomes assessed, and evaluation approach were extracted. After screening 499 unique publications, 21 were eligible for inclusion in the analysis. The majority of evaluations were conducted in Africa. The most common evaluation methods were a review of patient records (n=8, 38%) and post-training interview with trainees (n=7, 33%). In terms of outcomes, more than half of the studies (n=12, 57%) evaluated knowledge acquisition of trainees, with only six (29%) assessing on-the-job behaviour change. Even though more funds have been invested in TB HCP training, publications from robust evaluations assessing the impact on quality of care and behaviour change are limited. Copyright © 2016. Published by Elsevier Ltd.

  12. Team dynamics, clinical work satisfaction, and patient care coordination between primary care providers: A mixed methods study.

    Science.gov (United States)

    Song, Hummy; Ryan, Molly; Tendulkar, Shalini; Fisher, Josephine; Martin, Julia; Peters, Antoinette S; Frolkis, Joseph P; Rosenthal, Meredith B; Chien, Alyna T; Singer, Sara J

    Team-based care is essential for delivering high-quality, comprehensive, and coordinated care. Despite considerable research about the effects of team-based care on patient outcomes, few studies have examined how team dynamics relate to provider outcomes. The aim of this study was to examine relationships among team dynamics, primary care provider (PCP) clinical work satisfaction, and patient care coordination between PCPs in 18 Harvard-affiliated primary care practices participating in Harvard's Academic Innovations Collaborative. First, we administered a cross-sectional survey to all 548 PCPs (267 attending clinicians, 281 resident physicians) working at participating practices; 65% responded. We assessed the relationship of team dynamics with PCPs' clinical work satisfaction and perception of patient care coordination between PCPs, respectively, and the potential mediating effect of patient care coordination on the relationship between team dynamics and work satisfaction. In addition, we embedded a qualitative evaluation within the quantitative evaluation to achieve a convergent mixed methods design to help us better understand our findings and illuminate relationships among key variables. Better team dynamics were positively associated with clinical work satisfaction and quality of patient care coordination between PCPs. Coordination partially mediated the relationship between team dynamics and satisfaction for attending clinicians, suggesting that higher satisfaction depends, in part, on better teamwork, yielding more coordinated patient care. We found no mediating effects for resident physicians. Qualitative results suggest that sources of satisfaction from positive team dynamics for PCPs may be most relevant to attending clinicians. Improving primary care team dynamics could improve clinical work satisfaction among PCPs and patient care coordination between PCPs. In addition to improving outcomes that directly concern health care providers, efforts to

  13. Renewing the Respect for Similarity

    Directory of Open Access Journals (Sweden)

    Shimon eEdelman

    2012-07-01

    Full Text Available In psychology, the concept of similarity has traditionally evoked a mixture of respect, stemmingfrom its ubiquity and intuitive appeal, and concern, due to its dependence on the framing of the problemat hand and on its context. We argue for a renewed focus on similarity as an explanatory concept, bysurveying established results and new developments in the theory and methods of similarity-preservingassociative lookup and dimensionality reduction — critical components of many cognitive functions, aswell as of intelligent data management in computer vision. We focus in particular on the growing familyof algorithms that support associative memory by performing hashing that respects local similarity, andon the uses of similarity in representing structured objects and scenes. Insofar as these similarity-basedideas and methods are useful in cognitive modeling and in AI applications, they should be included inthe core conceptual toolkit of computational neuroscience.

  14. Protein structural similarity search by Ramachandran codes

    Directory of Open Access Journals (Sweden)

    Chang Chih-Hung

    2007-08-01

    Full Text Available Abstract Background Protein structural data has increased exponentially, such that fast and accurate tools are necessary to access structure similarity search. To improve the search speed, several methods have been designed to reduce three-dimensional protein structures to one-dimensional text strings that are then analyzed by traditional sequence alignment methods; however, the accuracy is usually sacrificed and the speed is still unable to match sequence similarity search tools. Here, we aimed to improve the linear encoding methodology and develop efficient search tools that can rapidly retrieve structural homologs from large protein databases. Results We propose a new linear encoding method, SARST (Structural similarity search Aided by Ramachandran Sequential Transformation. SARST transforms protein structures into text strings through a Ramachandran map organized by nearest-neighbor clustering and uses a regenerative approach to produce substitution matrices. Then, classical sequence similarity search methods can be applied to the structural similarity search. Its accuracy is similar to Combinatorial Extension (CE and works over 243,000 times faster, searching 34,000 proteins in 0.34 sec with a 3.2-GHz CPU. SARST provides statistically meaningful expectation values to assess the retrieved information. It has been implemented into a web service and a stand-alone Java program that is able to run on many different platforms. Conclusion As a database search method, SARST can rapidly distinguish high from low similarities and efficiently retrieve homologous structures. It demonstrates that the easily accessible linear encoding methodology has the potential to serve as a foundation for efficient protein structural similarity search tools. These search tools are supposed applicable to automated and high-throughput functional annotations or predictions for the ever increasing number of published protein structures in this post-genomic era.

  15. Phoneme Similarity and Confusability

    Science.gov (United States)

    Bailey, T.M.; Hahn, U.

    2005-01-01

    Similarity between component speech sounds influences language processing in numerous ways. Explanation and detailed prediction of linguistic performance consequently requires an understanding of these basic similarities. The research reported in this paper contrasts two broad classes of approach to the issue of phoneme similarity-theoretically…

  16. Evidence-based practice beliefs and behaviors of nurses providing cancer pain management: a mixed-methods approach.

    Science.gov (United States)

    Eaton, Linda H; Meins, Alexa R; Mitchell, Pamela H; Voss, Joachim; Doorenbos, Ardith Z

    2015-03-01

    To describe evidence-based practice (EBP) beliefs and behaviors of nurses who provide cancer pain management. Descriptive, cross-sectional with a mixed-methods approach. Two inpatient oncology units in the Pacific Northwest. 40 RNs.
 Data collected by interviews and web-based surveys. EBP beliefs, EBP implementation, evidence-based pain management. Nurses agreed with the positive aspects of EBP and their implementation ability, although implementation level was low. They were satisfied with their pain management practices. Oncology nursing certification was associated with innovativeness, and innovativeness was associated with EBP beliefs. Themes identified were (a) limited definition of EBP, (b) varied evidence-based pain management decision making, (c) limited identification of evidence-based pain management practices, and (d) integration of nonpharmacologic interventions into patient care. Nurses' low level of EBP implementation in the context of pain management was explained by their trust that standards of care and medical orders were evidence-based. Nurses' EBP beliefs and behaviors should be considered when developing strategies for sustaining evidence-based pain management practices. Implementation of the EBP process by nurses may not be realistic in the inpatient setting; therefore, hospital pain management policies need to be evidence-based and reinforced with nurses.

  17. Similar or different?

    DEFF Research Database (Denmark)

    Cornér, Solveig; Pyhältö, Kirsi; Peltonen, Jouni

    2018-01-01

    Previous research has identified researcher community and supervisory support as key determinants of the doctoral journey contributing to students’ persistence and robustness. However, we still know little about cross-cultural variation in the researcher community and supervisory support experien...... counter partners, whereas the Finnish students perceived lower levels of instrumental support than the Danish students. The findings imply that seemingly similar contexts hold valid differences in experienced social support and educational strategies at the PhD level....... experienced by PhD students within the same discipline. This study explores the support experiences of 381 PhD students within the humanities and social sciences from three research-intensive universities in Denmark (n=145) and Finland (n=236). The mixed methods design was utilized. The data were collected...... counter partners. The results also indicated that the only form of support in which the students expressed more matched support than mismatched support was informational support. Further investigation showed that the Danish students reported a high level of mismatch in emotional support than their Finnish...

  18. Using data mining techniques to explore physicians' therapeutic decisions when clinical guidelines do not provide recommendations: methods and example for type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Toussi Massoud

    2009-06-01

    Full Text Available Abstract Background Clinical guidelines carry medical evidence to the point of practice. As evidence is not always available, many guidelines do not provide recommendations for all clinical situations encountered in practice. We propose an approach for identifying knowledge gaps in guidelines and for exploring physicians' therapeutic decisions with data mining techniques to fill these knowledge gaps. We demonstrate our method by an example in the domain of type 2 diabetes. Methods We analyzed the French national guidelines for the management of type 2 diabetes to identify clinical conditions that are not covered or those for which the guidelines do not provide recommendations. We extracted patient records corresponding to each clinical condition from a database of type 2 diabetic patients treated at Avicenne University Hospital of Bobigny, France. We explored physicians' prescriptions for each of these profiles using C5.0 decision-tree learning algorithm. We developed decision-trees for different levels of detail of the therapeutic decision, namely the type of treatment, the pharmaco-therapeutic class, the international non proprietary name, and the dose of each medication. We compared the rules generated with those added to the guidelines in a newer version, to examine their similarity. Results We extracted 27 rules from the analysis of a database of 463 patient records. Eleven rules were about the choice of the type of treatment and thirteen rules about the choice of the pharmaco-therapeutic class of each drug. For the choice of the international non proprietary name and the dose, we could extract only a few rules because the number of patient records was too low for these factors. The extracted rules showed similarities with those added to the newer version of the guidelines. Conclusion Our method showed its usefulness for completing guidelines recommendations with rules learnt automatically from physicians' prescriptions. It could be used

  19. Discovering Music Structure via Similarity Fusion

    DEFF Research Database (Denmark)

    for representing music structure is studied in a simplified scenario consisting of 4412 songs and two similarity measures among them. The results suggest that the PLSA model is a useful framework to combine different sources of information, and provides a reasonable space for song representation.......Automatic methods for music navigation and music recommendation exploit the structure in the music to carry out a meaningful exploration of the “song space”. To get a satisfactory performance from such systems, one should incorporate as much information about songs similarity as possible; however...... semantics”, in such a way that all observed similarities can be satisfactorily explained using the latent semantics. Therefore, one can think of these semantics as the real structure in music, in the sense that they can explain the observed similarities among songs. The suitability of the PLSA model...

  20. Discovering Music Structure via Similarity Fusion

    DEFF Research Database (Denmark)

    Arenas-García, Jerónimo; Parrado-Hernandez, Emilio; Meng, Anders

    Automatic methods for music navigation and music recommendation exploit the structure in the music to carry out a meaningful exploration of the “song space”. To get a satisfactory performance from such systems, one should incorporate as much information about songs similarity as possible; however...... semantics”, in such a way that all observed similarities can be satisfactorily explained using the latent semantics. Therefore, one can think of these semantics as the real structure in music, in the sense that they can explain the observed similarities among songs. The suitability of the PLSA model...... for representing music structure is studied in a simplified scenario consisting of 4412 songs and two similarity measures among them. The results suggest that the PLSA model is a useful framework to combine different sources of information, and provides a reasonable space for song representation....

  1. A recursive method for calculating the total number of spanning trees and its applications in self-similar small-world scale-free network models

    Science.gov (United States)

    Ma, Fei; Su, Jing; Yao, Bing

    2018-05-01

    The problem of determining and calculating the number of spanning trees of any finite graph (model) is a great challenge, and has been studied in various fields, such as discrete applied mathematics, theoretical computer science, physics, chemistry and the like. In this paper, firstly, thank to lots of real-life systems and artificial networks built by all kinds of functions and combinations among some simpler and smaller elements (components), we discuss some helpful network-operation, including link-operation and merge-operation, to design more realistic and complicated network models. Secondly, we present a method for computing the total number of spanning trees. As an accessible example, we apply this method to space of trees and cycles respectively, and our results suggest that it is indeed a better one for such models. In order to reflect more widely practical applications and potentially theoretical significance, we study the enumerating method in some existing scale-free network models. On the other hand, we set up a class of new models displaying scale-free feature, that is to say, following P(k) k-γ, where γ is the degree exponent. Based on detailed calculation, the degree exponent γ of our deterministic scale-free models satisfies γ > 3. In the rest of our discussions, we not only calculate analytically the solutions of average path length, which indicates our models have small-world property being prevailing in amounts of complex systems, but also derive the number of spanning trees by means of the recursive method described in this paper, which clarifies our method is convenient to research these models.

  2. Examining Similarity Structure: Multidimensional Scaling and Related Approaches in Neuroimaging

    Directory of Open Access Journals (Sweden)

    Svetlana V. Shinkareva

    2013-01-01

    Full Text Available This paper covers similarity analyses, a subset of multivariate pattern analysis techniques that are based on similarity spaces defined by multivariate patterns. These techniques offer several advantages and complement other methods for brain data analyses, as they allow for comparison of representational structure across individuals, brain regions, and data acquisition methods. Particular attention is paid to multidimensional scaling and related approaches that yield spatial representations or provide methods for characterizing individual differences. We highlight unique contributions of these methods by reviewing recent applications to functional magnetic resonance imaging data and emphasize areas of caution in applying and interpreting similarity analysis methods.

  3. Self-similar factor approximants

    International Nuclear Information System (INIS)

    Gluzman, S.; Yukalov, V.I.; Sornette, D.

    2003-01-01

    The problem of reconstructing functions from their asymptotic expansions in powers of a small variable is addressed by deriving an improved type of approximants. The derivation is based on the self-similar approximation theory, which presents the passage from one approximant to another as the motion realized by a dynamical system with the property of group self-similarity. The derived approximants, because of their form, are called self-similar factor approximants. These complement the obtained earlier self-similar exponential approximants and self-similar root approximants. The specific feature of self-similar factor approximants is that their control functions, providing convergence of the computational algorithm, are completely defined from the accuracy-through-order conditions. These approximants contain the Pade approximants as a particular case, and in some limit they can be reduced to the self-similar exponential approximants previously introduced by two of us. It is proved that the self-similar factor approximants are able to reproduce exactly a wide class of functions, which include a variety of nonalgebraic functions. For other functions, not pertaining to this exactly reproducible class, the factor approximants provide very accurate approximations, whose accuracy surpasses significantly that of the most accurate Pade approximants. This is illustrated by a number of examples showing the generality and accuracy of the factor approximants even when conventional techniques meet serious difficulties

  4. An Analysis of Looking Back Method in Problem-Based Learning: Case Study on Congruence and Similarity in Junior High School

    Science.gov (United States)

    Kosasih, U.; Wahyudin, W.; Prabawanto, S.

    2017-09-01

    This study aims to understand how learners do look back their idea of problem solving. This research is based on qualitative approach with case study design. Participants in this study were xx students of Junior High School, who were studying the material of congruence and similarity. The supporting instruments in this research are test and interview sheet. The data obtained were analyzed by coding and constant-comparison. The analysis find that there are three ways in which the students review the idea of problem solving, which is 1) carried out by comparing answers to the completion measures exemplified by learning resources; 2) carried out by examining the logical relationship between the solution and the problem; and 3) carried out by means of confirmation to the prior knowledge they have. This happens because most students learn in a mechanistic way. This study concludes that students validate the idea of problem solving obtained, influenced by teacher explanations, learning resources, and prior knowledge. Therefore, teacher explanations and learning resources contribute to the success or failure of students in solving problems.

  5. Concurrent validity and clinical utility of the HCR-20V3 compared with the HCR-20 in forensic mental health nursing: similar tools but improved method.

    Science.gov (United States)

    Bjørkly, Stål; Eidhammer, Gunnar; Selmer, Lars Erik

    2014-01-01

    The main scope of this small-scale investigation was to compare clinical application of the HCR-20V3 with its predecessor, the HCR-20. To explore concurrent validity, two experienced nurses assessed 20 forensic mental health service patients with the tools. Estimates of internal consistency for the HCR-20 and the HCR-20V3 were calculated by Cronbach's alpha for two levels of measurement: the H-, C-, and R-scales and the total sum scores. We found moderate (C-scale) to good (H- and R- scales and aggregate scores) estimates of internal consistency and significant differences for the two versions of the HCR. This finding indicates that the two versions reflect common underlying dimensions and that there still appears to be differences between V2 and V3 ratings for the same patients. A case from forensic mental health was used to illustrate similarities and differences in assessment results between the two HCR-20 versions. The case illustration depicts clinical use of the HCR-20V3 and application of two structured nursing interventions pertaining to the risk management part of the tool. According to our experience, Version 3 is superior to Version 2 concerning: (a) item clarity; (b) the distinction between presence and relevance of risk factors; (c) the integration of risk formulation and risk scenario; and (d) the explicit demand to construct a risk management plan as part of the standard assessment procedure.

  6. Method of data mining including determining multidimensional coordinates of each item using a predetermined scalar similarity value for each item pair

    Science.gov (United States)

    Meyers, Charles E.; Davidson, George S.; Johnson, David K.; Hendrickson, Bruce A.; Wylie, Brian N.

    1999-01-01

    A method of data mining represents related items in a multidimensional space. Distance between items in the multidimensional space corresponds to the extent of relationship between the items. The user can select portions of the space to perceive. The user also can interact with and control the communication of the space, focusing attention on aspects of the space of most interest. The multidimensional spatial representation allows more ready comprehension of the structure of the relationships among the items.

  7. Processes of Similarity Judgment

    Science.gov (United States)

    Larkey, Levi B.; Markman, Arthur B.

    2005-01-01

    Similarity underlies fundamental cognitive capabilities such as memory, categorization, decision making, problem solving, and reasoning. Although recent approaches to similarity appreciate the structure of mental representations, they differ in the processes posited to operate over these representations. We present an experiment that…

  8. Using data mining techniques to explore physicians' therapeutic decisions when clinical guidelines do not provide recommendations: methods and example for type 2 diabetes.

    Science.gov (United States)

    Toussi, Massoud; Lamy, Jean-Baptiste; Le Toumelin, Philippe; Venot, Alain

    2009-06-10

    Clinical guidelines carry medical evidence to the point of practice. As evidence is not always available, many guidelines do not provide recommendations for all clinical situations encountered in practice. We propose an approach for identifying knowledge gaps in guidelines and for exploring physicians' therapeutic decisions with data mining techniques to fill these knowledge gaps. We demonstrate our method by an example in the domain of type 2 diabetes. We analyzed the French national guidelines for the management of type 2 diabetes to identify clinical conditions that are not covered or those for which the guidelines do not provide recommendations. We extracted patient records corresponding to each clinical condition from a database of type 2 diabetic patients treated at Avicenne University Hospital of Bobigny, France. We explored physicians' prescriptions for each of these profiles using C5.0 decision-tree learning algorithm. We developed decision-trees for different levels of detail of the therapeutic decision, namely the type of treatment, the pharmaco-therapeutic class, the international non proprietary name, and the dose of each medication. We compared the rules generated with those added to the guidelines in a newer version, to examine their similarity. We extracted 27 rules from the analysis of a database of 463 patient records. Eleven rules were about the choice of the type of treatment and thirteen rules about the choice of the pharmaco-therapeutic class of each drug. For the choice of the international non proprietary name and the dose, we could extract only a few rules because the number of patient records was too low for these factors. The extracted rules showed similarities with those added to the newer version of the guidelines. Our method showed its usefulness for completing guidelines recommendations with rules learnt automatically from physicians' prescriptions. It could be used during the development of guidelines as a complementary source from

  9. Personalized recommendation with corrected similarity

    International Nuclear Information System (INIS)

    Zhu, Xuzhen; Tian, Hui; Cai, Shimin

    2014-01-01

    Personalized recommendation has attracted a surge of interdisciplinary research. Especially, similarity-based methods in applications of real recommendation systems have achieved great success. However, the computations of similarities are overestimated or underestimated, in particular because of the defective strategy of unidirectional similarity estimation. In this paper, we solve this drawback by leveraging mutual correction of forward and backward similarity estimations, and propose a new personalized recommendation index, i.e., corrected similarity based inference (CSI). Through extensive experiments on four benchmark datasets, the results show a greater improvement of CSI in comparison with these mainstream baselines. And a detailed analysis is presented to unveil and understand the origin of such difference between CSI and mainstream indices. (paper)

  10. EVALUATION OF ASSEMBLY LINE BALANCING METHODS USING AN ANALYTICAL HIERARCHY PROCESS (AHP AND TECHNIQUE FOR ORDER PREFERENCES BY SIMILARITY TO IDEAL SOLUTION (TOPSIS BASED APPROACH

    Directory of Open Access Journals (Sweden)

    Pallavi Sharma

    2013-12-01

    Full Text Available Assembly lines are special flow-line production systems which are of great importance in the industrial production of high quantity standardized commodities. In this article, assembly line balancing problem is formulated as a multi objective (criteria problem where four easily quantifiable objectives (criteria's are defined. Objectives (criteria's included are line efficiency, balance delay, smoothness index, and line time. And the value of these objectives is calculated by five different heuristics. In this paper, focus is made on the prioritization of assembly line balancing (ALB solution methods (heuristics and to select the best of them. For this purpose, a bench mark assembly line balancing problem is solved by five different heuristics and the value of objectives criteria's (performance measures of the line is determined. Finally the prioritization of heuristics is carried out through the use of AHP-TOPSIS based approach by solving an example.

  11. Size-specific dose estimate (SSDE) provides a simple method to calculate organ dose for pediatric CT examinations

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Bria M.; Brady, Samuel L., E-mail: samuel.brady@stjude.org; Kaufman, Robert A. [Department of Radiological Sciences, St Jude Children' s Research Hospital, Memphis, Tennessee 38105 (United States); Mirro, Amy E. [Department of Biomedical Engineering, Washington University, St Louis, Missouri 63130 (United States)

    2014-07-15

    Purpose: To investigate the correlation of size-specific dose estimate (SSDE) with absorbed organ dose, and to develop a simple methodology for estimating patient organ dose in a pediatric population (5–55 kg). Methods: Four physical anthropomorphic phantoms representing a range of pediatric body habitus were scanned with metal oxide semiconductor field effect transistor (MOSFET) dosimeters placed at 23 organ locations to determine absolute organ dose. Phantom absolute organ dose was divided by phantom SSDE to determine correlation between organ dose and SSDE. Organ dose correlation factors (CF{sub SSDE}{sup organ}) were then multiplied by patient-specific SSDE to estimate patient organ dose. The CF{sub SSDE}{sup organ} were used to retrospectively estimate individual organ doses from 352 chest and 241 abdominopelvic pediatric CT examinations, where mean patient weight was 22 kg ± 15 (range 5–55 kg), and mean patient age was 6 yrs ± 5 (range 4 months to 23 yrs). Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm; thus, showing appropriate scalability of the phantoms across the entire pediatric population in this study. IndividualCF{sub SSDE}{sup organ} were determined for a total of 23 organs in the chest and abdominopelvic region across nine weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7–1.4) and abdominopelvic region (average 0.9; range 0.7–1.3) was near unity. For organ/tissue that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1–0.4) for both the chest and abdominopelvic regions, respectively. A means to estimate patient organ dose was demonstrated. Calculated patient organ dose, using patient SSDE and CF{sub SSDE}{sup organ}, was compared to

  12. Similarity measures for face recognition

    CERN Document Server

    Vezzetti, Enrico

    2015-01-01

    Face recognition has several applications, including security, such as (authentication and identification of device users and criminal suspects), and in medicine (corrective surgery and diagnosis). Facial recognition programs rely on algorithms that can compare and compute the similarity between two sets of images. This eBook explains some of the similarity measures used in facial recognition systems in a single volume. Readers will learn about various measures including Minkowski distances, Mahalanobis distances, Hansdorff distances, cosine-based distances, among other methods. The book also summarizes errors that may occur in face recognition methods. Computer scientists "facing face" and looking to select and test different methods of computing similarities will benefit from this book. The book is also useful tool for students undertaking computer vision courses.

  13. The Patient-Provider Relationship Is Associated with Hepatitis C Treatment Eligibility: A Prospective Mixed-Methods Cohort Study.

    Directory of Open Access Journals (Sweden)

    Shari S Rogal

    Full Text Available Hepatitis C virus (HCV treatment has the potential to cure the leading cause of cirrhosis and hepatocellular carcinoma. However, only those deemed eligible for treatment have the possibility of this cure. Therefore, understanding the determinants of HCV treatment eligibility is critical. Given that effective communication with and trust in healthcare providers significantly influences treatment eligibility decisions in other diseases, we aimed to understand patient-provider interactions in the HCV treatment eligibility process. This prospective cohort study was conducted in the VA Pittsburgh Healthcare System. Patients were recruited after referral for gastroenterology consultation for HCV treatment with interferon and ribavirin. Consented patients completed semi-structured interviews and validated measures of depression, substance and alcohol use, and HCV knowledge. Two coders analyzed the semi-structured interviews. Factors associated with patient eligibility for interferon-based therapy were assessed using multivariate logistic regression. Of 339 subjects included in this analysis, only 56 (16.5% were deemed eligible for HCV therapy by gastroenterology (GI providers. In the multivariate logistic regression, patients who were older (OR = 0.96, 95%CI = 0.92-0.99, p = .049, reported concerns about the GI provider (OR = 0.40, 95%CI = 0.10-0.87, p = 0.02 and had depression symptoms (OR = 0.32, 95%CI = 0.17-0.63, p = 0.001 were less likely to be eligible. Patients described barriers that included feeling stigmatized and poor provider interpersonal or communication skills. In conclusion, we found that patients' perceptions of the relationship with their GI providers were associated with treatment eligibility. Establishing trust and effective communication channels between patients and providers may lower barriers to potential HCV cure.

  14. A Post-Final Assignment for the Methods Course: Providing an Incentive to Professional Growth for Future Teachers.

    Science.gov (United States)

    Bentley, Michael L.

    This paper describes J. Rosengren's post-final assignment and M. Harmin's truth signs activity that were incorporated into a secondary science methods course for preservice teachers. The strength of the post-final assignment is that it is a strategy for extending student learning past the end of a course and even beyond the initial teaching…

  15. New Technologies Provide Quantum Changes in the Scale, Speed, and Success of SELEX Methods and Aptamer Characterization

    Directory of Open Access Journals (Sweden)

    Abdullah Ozer

    2014-01-01

    Full Text Available Single-stranded oligonucleotide aptamers have attracted great attention in the past decade because of their diagnostic and therapeutic potential. These versatile, high affinity and specificity reagents are selected by an iterative in vitro process called SELEX, Systematic Evolution of Ligands by Exponential Enrichment. Numerous SELEX methods have been developed for aptamer selections; some that are simple and straightforward, and some that are specialized and complicated. The method of SELEX is crucial for selection of an aptamer with desired properties; however, success also depends on the starting aptamer library, the target molecule, aptamer enrichment monitoring assays, and finally, the analysis and characterization of selected aptamers. Here, we summarize key recent developments in aptamer selection methods, as well as other aspects of aptamer selection that have significant impact on the outcome. We discuss potential pitfalls and limitations in the selection process with an eye to aid researchers in the choice of a proper SELEX strategy, and we highlight areas where further developments and improvements are desired. We believe carefully designed multiplexed selection methods, when complemented with high-throughput downstream analysis and characterization assays, will yield numerous high-affinity aptamers to protein and small molecule targets, and thereby generate a vast array of reagents for probing basic biological mechanisms and implementing new diagnostic and therapeutic applications in the near future.

  16. 47 CFR 52.31 - Deployment of long-term database methods for number portability by CMRS providers.

    Science.gov (United States)

    2010-10-01

    ... require software but not hardware changes to provide portability (“Hardware Capable Switches”), within 60... queries, so that they can deliver calls from their networks to any party that has retained its number after switching from one telecommunications carrier to another. (c) [Reserved] (d) In the event a...

  17. An optical device capable of providing a structural color, and a corresponding method of manufacturing such a device

    DEFF Research Database (Denmark)

    2014-01-01

    ) with respect to the average surface positions. The position, size, and randomness of the protrusions are arranged so as to provide, at least up to a maximum angle of incidence (A_in) with respect to a normal to the surface, an angle-independent substantially homogeneous structural color perception for a normal...

  18. Efficient estimation for high similarities using odd sketches

    DEFF Research Database (Denmark)

    Mitzenmacher, Michael; Pagh, Rasmus; Pham, Ninh Dang

    2014-01-01

    . This means that Odd Sketches provide a highly space-efficient estimator for sets of high similarity, which is relevant in applications such as web duplicate detection, collaborative filtering, and association rule learning. The method extends to weighted Jaccard similarity, relevant e.g. for TF-IDF vector...... and web duplicate detection tasks....

  19. Similarity or difference?

    DEFF Research Database (Denmark)

    Villadsen, Anders Ryom

    2013-01-01

    While the organizational structures and strategies of public organizations have attracted substantial research attention among public management scholars, little research has explored how these organizational core dimensions are interconnected and influenced by pressures for similarity....... In this paper I address this topic by exploring the relation between expenditure strategy isomorphism and structure isomorphism in Danish municipalities. Different literatures suggest that organizations exist in concurrent pressures for being similar to and different from other organizations in their field......-shaped relation exists between expenditure strategy isomorphism and structure isomorphism in a longitudinal quantitative study of Danish municipalities....

  20. An overview of filtration methods that can provide protection from the macrofouling zebra mussel at hydroelectric facilities

    Energy Technology Data Exchange (ETDEWEB)

    Smythe, A.G.; Short, T.M. [Acres International Corp., Amherst, NY (United States)

    1995-12-31

    The non-indigenous freshwater zebra and quagga mussels (Dreissena, spp.) threaten to foul freshwater conduits throughout much of the United States and southern Canada. Initially, many electric facilities within the lower Great Lakes drainage were fouled. More recently, other systems both in and out of the Great Lakes, have been exposed to infested water facilitated by canals and boat traffic and impacted by the mussels. Mussels have clogged conduits and fouled equipment and monitoring sensors in relatively distant regions including the Hudson River, the Mississippi River south to New Orleans, and the Arkansas River into Oklahoma. Chemicals can effectively control the mussels, however, filtration methods promise to be a relatively cost effective, environmentally safe alternative control approach. Information on traditional filtration methods will be presented in this paper along with recent research results for in-line filters.

  1. Comparing Harmonic Similarity Measures

    NARCIS (Netherlands)

    de Haas, W.B.; Robine, M.; Hanna, P.; Veltkamp, R.C.; Wiering, F.

    2010-01-01

    We present an overview of the most recent developments in polyphonic music retrieval and an experiment in which we compare two harmonic similarity measures. In contrast to earlier work, in this paper we specifically focus on the symbolic chord description as the primary musical representation and

  2. Development of similarity theory for control systems

    Science.gov (United States)

    Myshlyaev, L. P.; Evtushenko, V. F.; Ivushkin, K. A.; Makarov, G. V.

    2018-05-01

    The area of effective application of the traditional similarity theory and the need necessity of its development for systems are discussed. The main statements underlying the similarity theory of control systems are given. The conditions for the similarity of control systems and the need for similarity control control are formulated. Methods and algorithms for estimating and similarity control of control systems and the results of research of control systems based on their similarity are presented. The similarity control of systems includes the current evaluation of the degree of similarity of control systems and the development of actions controlling similarity, and the corresponding targeted change in the state of any element of control systems.

  3. Mixed Methods Survey of Zoonotic Disease Awareness and Practice among Animal and Human Healthcare Providers in Moshi, Tanzania.

    Directory of Open Access Journals (Sweden)

    Helen L Zhang

    2016-03-01

    Full Text Available Zoonoses are common causes of human and livestock illness in Tanzania. Previous studies have shown that brucellosis, leptospirosis, and Q fever account for a large proportion of human febrile illness in northern Tanzania, yet they are infrequently diagnosed. We conducted this study to assess awareness and knowledge regarding selected zoonoses among healthcare providers in Moshi, Tanzania; to determine what diagnostic and treatment protocols are utilized; and obtain insights into contextual factors contributing to the apparent under-diagnosis of zoonoses.We conducted a questionnaire about zoonoses knowledge, case reporting, and testing with 52 human health practitioners and 10 livestock health providers. Immediately following questionnaire administration, we conducted semi-structured interviews with 60 of these respondents, using the findings of a previous fever etiology study to prompt conversation. Sixty respondents (97% had heard of brucellosis, 26 (42% leptospirosis, and 20 (32% Q fever. Animal sector respondents reported seeing cases of animal brucellosis (4, rabies (4, and anthrax (3 in the previous 12 months. Human sector respondents reported cases of human brucellosis (15, 29%, rabies (9, 18% and anthrax (6, 12%. None reported leptospirosis or Q fever cases. Nineteen respondents were aware of a local diagnostic test for human brucellosis. Reports of tests for human leptospirosis or Q fever, or for any of the study pathogens in animals, were rare. Many respondents expressed awareness of malaria over-diagnosis and zoonoses under-diagnosis, and many identified low knowledge and testing capacity as reasons for zoonoses under-diagnosis.This study revealed differences in knowledge of different zoonoses and low case report frequencies of brucellosis, leptospirosis, and Q fever. There was a lack of known diagnostic services for leptospirosis and Q fever. These findings emphasize a need for improved diagnostic capacity alongside healthcare

  4. Image magnification based on similarity analogy

    International Nuclear Information System (INIS)

    Chen Zuoping; Ye Zhenglin; Wang Shuxun; Peng Guohua

    2009-01-01

    Aiming at the high time complexity of the decoding phase in the traditional image enlargement methods based on fractal coding, a novel image magnification algorithm is proposed in this paper, which has the advantage of iteration-free decoding, by using the similarity analogy between an image and its zoom-out and zoom-in. A new pixel selection technique is also presented to further improve the performance of the proposed method. Furthermore, by combining some existing fractal zooming techniques, an efficient image magnification algorithm is obtained, which can provides the image quality as good as the state of the art while greatly decrease the time complexity of the decoding phase.

  5. Glove boxes and similar containments

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    According to the present invention a glove box or similar containment is provided with an exhaust system including a vortex amplifier venting into the system, the vortex amplifier also having its main inlet in fluid flow connection with the containment and a control inlet in fluid flow connection with the atmosphere outside the containment. (U.S.)

  6. ANALYSIS OF METHODS PROVIDING ACCURACY FOR TOOLS AND TECHNIQUES VIBRATION MEASUREMENT IN THE PROCESS OF MAINTAINING AIRWORTHINESS OF AIRCRAFT

    Directory of Open Access Journals (Sweden)

    Anatoliy Alexandrovich Bogoyavlenskiy

    2017-01-01

    Full Text Available On the basis of system approach the structure of the aviation activity areas on air transport related to monitoring and measurements of vibration parameters is presented.The technology analysis of laboratory tests of the onboard equipment control of vibration parameters is carried out. The issues related to ensuring the unity of measurements of vibration parameters are researched and summarized.While dealing with the works on metrological certification described in the article, the risks arising from aviation activity on air transport are taken into account. The certification methods of measuring channels of vibration parametersused on stands for testing GTE at the repairing of aircraft engines are developed. The methods are implemented when con- ducting initial and periodic certifications of test benches for twelve types of aircraft GTE in repair organizations. The reliability of the results of the conducted research due to the fact that they were carried out with the use of certified measure- ment equipment, included in the State register of measuring instruments. The research is conducted for a sufficiently high statistical confidence level with the boundaries 0.95. The studies have shown that running on air transport measurements of vibration parameters are metrologically se- cured, the unity of measurements and their traceability from the national primary reference to special measuring instru- ments, test equipment, and onboard controls of the aircraft is maintained.

  7. Large margin classification with indefinite similarities

    KAUST Repository

    Alabdulmohsin, Ibrahim

    2016-01-07

    Classification with indefinite similarities has attracted attention in the machine learning community. This is partly due to the fact that many similarity functions that arise in practice are not symmetric positive semidefinite, i.e. the Mercer condition is not satisfied, or the Mercer condition is difficult to verify. Examples of such indefinite similarities in machine learning applications are ample including, for instance, the BLAST similarity score between protein sequences, human-judged similarities between concepts and words, and the tangent distance or the shape matching distance in computer vision. Nevertheless, previous works on classification with indefinite similarities are not fully satisfactory. They have either introduced sources of inconsistency in handling past and future examples using kernel approximation, settled for local-minimum solutions using non-convex optimization, or produced non-sparse solutions by learning in Krein spaces. Despite the large volume of research devoted to this subject lately, we demonstrate in this paper how an old idea, namely the 1-norm support vector machine (SVM) proposed more than 15 years ago, has several advantages over more recent work. In particular, the 1-norm SVM method is conceptually simpler, which makes it easier to implement and maintain. It is competitive, if not superior to, all other methods in terms of predictive accuracy. Moreover, it produces solutions that are often sparser than more recent methods by several orders of magnitude. In addition, we provide various theoretical justifications by relating 1-norm SVM to well-established learning algorithms such as neural networks, SVM, and nearest neighbor classifiers. Finally, we conduct a thorough experimental evaluation, which reveals that the evidence in favor of 1-norm SVM is statistically significant.

  8. Leveraging long read sequencing from a single individual to provide a comprehensive resource for benchmarking variant calling methods.

    Science.gov (United States)

    Mu, John C; Tootoonchi Afshar, Pegah; Mohiyuddin, Marghoob; Chen, Xi; Li, Jian; Bani Asadi, Narges; Gerstein, Mark B; Wong, Wing H; Lam, Hugo Y K

    2015-09-28

    A high-confidence, comprehensive human variant set is critical in assessing accuracy of sequencing algorithms, which are crucial in precision medicine based on high-throughput sequencing. Although recent works have attempted to provide such a resource, they still do not encompass all major types of variants including structural variants (SVs). Thus, we leveraged the massive high-quality Sanger sequences from the HuRef genome to construct by far the most comprehensive gold set of a single individual, which was cross validated with deep Illumina sequencing, population datasets, and well-established algorithms. It was a necessary effort to completely reanalyze the HuRef genome as its previously published variants were mostly reported five years ago, suffering from compatibility, organization, and accuracy issues that prevent their direct use in benchmarking. Our extensive analysis and validation resulted in a gold set with high specificity and sensitivity. In contrast to the current gold sets of the NA12878 or HS1011 genomes, our gold set is the first that includes small variants, deletion SVs and insertion SVs up to a hundred thousand base-pairs. We demonstrate the utility of our HuRef gold set to benchmark several published SV detection tools.

  9. 24 CFR 1000.54 - What procedures apply to complaints arising out of any of the methods of providing for Indian...

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false What procedures apply to complaints arising out of any of the methods of providing for Indian preference? 1000.54 Section 1000.54 Housing and... ACTIVITIES General § 1000.54 What procedures apply to complaints arising out of any of the methods of...

  10. Determination of subjective similarity for pairs of masses and pairs of clustered microcalcifications on mammograms: Comparison of similarity ranking scores and absolute similarity ratings

    International Nuclear Information System (INIS)

    Muramatsu, Chisako; Li Qiang; Schmidt, Robert A.; Shiraishi, Junji; Suzuki, Kenji; Newstead, Gillian M.; Doi, Kunio

    2007-01-01

    The presentation of images that are similar to that of an unknown lesion seen on a mammogram may be helpful for radiologists to correctly diagnose that lesion. For similar images to be useful, they must be quite similar from the radiologists' point of view. We have been trying to quantify the radiologists' impression of similarity for pairs of lesions and to establish a ''gold standard'' for development and evaluation of a computerized scheme for selecting such similar images. However, it is considered difficult to reliably and accurately determine similarity ratings, because they are subjective. In this study, we compared the subjective similarities obtained by two different methods, an absolute rating method and a 2-alternative forced-choice (2AFC) method, to demonstrate that reliable similarity ratings can be determined by the responses of a group of radiologists. The absolute similarity ratings were previously obtained for pairs of masses and pairs of microcalcifications from five and nine radiologists, respectively. In this study, similarity ranking scores for eight pairs of masses and eight pairs of microcalcifications were determined by use of the 2AFC method. In the first session, the eight pairs of masses and eight pairs of microcalcifications were grouped and compared separately for determining the similarity ranking scores. In the second session, another similarity ranking score was determined by use of mixed pairs, i.e., by comparison of the similarity of a mass pair with that of a calcification pair. Four pairs of masses and four pairs of microcalcifications were grouped together to create two sets of eight pairs. The average absolute similarity ratings and the average similarity ranking scores showed very good correlations in the first study (Pearson's correlation coefficients: 0.94 and 0.98 for masses and microcalcifications, respectively). Moreover, in the second study, the correlations between the absolute ratings and the ranking scores were also

  11. Medicare Provider Data - Hospice Providers

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Hospice Utilization and Payment Public Use File provides information on services provided to Medicare beneficiaries by hospice providers. The Hospice PUF...

  12. Perceptions of methicillin-resistant Staphylococcus aureus and hand hygiene provider training and patient education: results of a mixed method study of health care providers in Department of Veterans Affairs spinal cord injury and disorder units.

    Science.gov (United States)

    Hill, Jennifer N; Hogan, Timothy P; Cameron, Kenzie A; Guihan, Marylou; Goldstein, Barry; Evans, Martin E; Evans, Charlesnika T

    2014-08-01

    The goal of this study was to assess current practices for training of spinal cord injury and disorder (SCI/D) health care workers and education of veterans with SCI/D in Department of Veterans Affairs (VA) spinal cord injury (SCI) centers on methicillin-resistant Staphylococcus aureus (MRSA) prevention. Mixed methods. A Web-based survey was distributed to 673 VA SCI/D providers across 24 SCI centers; 21 acute care and 1 long-term care facility participated. There were 295 that responded, 228 had complete data and were included in this analysis. Semistructured interviews were conducted with 30 SCI/D providers across 9 SCI centers. Nurses, physicians, and therapists represent most respondents (92.1%, n = 210); over half (56.6%, n = 129) were nurses. Of providers, 75.9% (n = 173) reported receiving excellent or good training on how to educate patients about MRSA. However, nurses were more likely to report having excellent or good training for how to educate patients about MRSA (P = .005). Despite this, only 63.6% (n = 82) of nurses perceived the education they provide patients on how MRSA is transmitted as excellent or good. Despite health care workers reporting receiving excellent or good training on MRSA-related topics, this did not translate to excellent or good education for patients, suggesting that health care workers need additional training for educating patients. Population-specific MRSA prevention educational materials may also assist providers in educating patients about MRSA prevention for individuals with SCI/D. Published by Mosby, Inc.

  13. Mixed Methods for Implementation Research: Application to Evidence-Based Practice Implementation and Staff Turnover in Community Based Organizations Providing Child Welfare Services

    Science.gov (United States)

    Aarons, Gregory A.; Fettes, Danielle L.; Sommerfeld, David H.; Palinkas, Lawrence

    2013-01-01

    Many public sector services systems and provider organizations are in some phase of learning about or implementing evidence-based interventions. Child welfare service systems represent a context where implementation spans system, management, and organizational concerns. Research utilizing mixed methods that combine qualitative and quantitative design, data collection, and analytic approaches are particularly well-suited to understanding both the process and outcomes of dissemination and implementation efforts in child welfare systems. This paper describes the process of using mixed methods in implementation research and provides an applied example of an examination of factors impacting staff retention during an evidence-based intervention implementation in a statewide child welfare system. We integrate qualitative data with previously published quantitative analyses of job autonomy and staff turnover during this statewide implementation project in order to illustrate the utility of mixed method approaches in providing a more comprehensive understanding of opportunities and challenges in implementation research. PMID:22146861

  14. Mixed methods for implementation research: application to evidence-based practice implementation and staff turnover in community-based organizations providing child welfare services.

    Science.gov (United States)

    Aarons, Gregory A; Fettes, Danielle L; Sommerfeld, David H; Palinkas, Lawrence A

    2012-02-01

    Many public sector service systems and provider organizations are in some phase of learning about or implementing evidence-based interventions. Child welfare service systems represent a context where implementation spans system, management, and organizational concerns. Research utilizing mixed methods that combine qualitative and quantitative design, data collection, and analytic approaches are particularly well suited to understanding both the process and outcomes of dissemination and implementation efforts in child welfare systems. This article describes the process of using mixed methods in implementation research and provides an applied example of an examination of factors impacting staff retention during an evidence-based intervention implementation in a statewide child welfare system. The authors integrate qualitative data with previously published quantitative analyses of job autonomy and staff turnover during this statewide implementation project in order to illustrate the utility of mixed method approaches in providing a more comprehensive understanding of opportunities and challenges in implementation research.

  15. Similarity and Modeling in Science and Engineering

    CERN Document Server

    Kuneš, Josef

    2012-01-01

    The present text sets itself in relief to other titles on the subject in that it addresses the means and methodologies versus a narrow specific-task oriented approach. Concepts and their developments which evolved to meet the changing needs of applications are addressed. This approach provides the reader with a general tool-box to apply to their specific needs. Two important tools are presented: dimensional analysis and the similarity analysis methods. The fundamental point of view, enabling one to sort all models, is that of information flux between a model and an original expressed by the similarity and abstraction. Each chapter includes original examples and ap-plications. In this respect, the models can be divided into several groups. The following models are dealt with separately by chapter; mathematical and physical models, physical analogues, deterministic, stochastic, and cybernetic computer models. The mathematical models are divided into asymptotic and phenomenological models. The phenomenological m...

  16. Accuracy of the visual estimation method as a predictor of food intake in Alzheimer's patients provided with different types of food.

    Science.gov (United States)

    Amano, Nobuko; Nakamura, Tomiyo

    2018-02-01

    The visual estimation method is commonly used in hospitals and other care facilities to evaluate food intake through estimation of plate waste. In Japan, no previous studies have investigated the validity and reliability of this method under the routine conditions of a hospital setting. The present study aimed to evaluate the validity and reliability of the visual estimation method, in long-term inpatients with different levels of eating disability caused by Alzheimer's disease. The patients were provided different therapeutic diets presented in various food types. This study was performed between February and April 2013, and 82 patients with Alzheimer's disease were included. Plate waste was evaluated for the 3 main daily meals, for a total of 21 days, 7 consecutive days during each of the 3 months, originating a total of 4851 meals, from which 3984 were included. Plate waste was measured by the nurses through the visual estimation method, and by the hospital's registered dietitians through the actual measurement method. The actual measurement method was first validated to serve as a reference, and the level of agreement between both methods was then determined. The month, time of day, type of food provided, and patients' physical characteristics were considered for analysis. For the 3984 meals included in the analysis, the level of agreement between the measurement methods was 78.4%. Disagreement of measurements consisted of 3.8% of underestimation and 17.8% of overestimation. Cronbach's α (0.60, P visual estimation method was within the acceptable range. The visual estimation method was found to be a valid and reliable method for estimating food intake in patients with different levels of eating impairment. The successful implementation and use of the method depends upon adequate training and motivation of the nurses and care staff involved. Copyright © 2017 European Society for Clinical Nutrition and Metabolism. Published by Elsevier Ltd. All rights reserved.

  17. Modeling of similar economies

    Directory of Open Access Journals (Sweden)

    Sergey B. Kuznetsov

    2017-06-01

    Full Text Available Objective to obtain dimensionless criteria ndash economic indices characterizing the national economy and not depending on its size. Methods mathematical modeling theory of dimensions processing statistical data. Results basing on differential equations describing the national economy with the account of economical environment resistance two dimensionless criteria are obtained which allow to compare economies regardless of their sizes. With the theory of dimensions we show that the obtained indices are not accidental. We demonstrate the implementation of the obtained dimensionless criteria for the analysis of behavior of certain countriesrsquo economies. Scientific novelty the dimensionless criteria are obtained ndash economic indices which allow to compare economies regardless of their sizes and to analyze the dynamic changes in the economies with time. nbsp Practical significance the obtained results can be used for dynamic and comparative analysis of different countriesrsquo economies regardless of their sizes.

  18. Similar speaker recognition using nonlinear analysis

    International Nuclear Information System (INIS)

    Seo, J.P.; Kim, M.S.; Baek, I.C.; Kwon, Y.H.; Lee, K.S.; Chang, S.W.; Yang, S.I.

    2004-01-01

    Speech features of the conventional speaker identification system, are usually obtained by linear methods in spectral space. However, these methods have the drawback that speakers with similar voices cannot be distinguished, because the characteristics of their voices are also similar in spectral space. To overcome the difficulty in linear methods, we propose to use the correlation exponent in the nonlinear space as a new feature vector for speaker identification among persons with similar voices. We show that our proposed method surprisingly reduces the error rate of speaker identification system to speakers with similar voices

  19. Impact of an online medical internet site on knowledge and practice of health care providers: a mixed methods study of the Spinal Cord Injury Rehabilitation Evidence project.

    Science.gov (United States)

    Eng, Janice J; Noonan, Vanessa K; Townson, Andrea F; Higgins, Caroline E; Rogers, Jess; Wolfe, Dalton L

    2014-12-23

    It is not known whether ongoing access to a broad-based Internet knowledge resource can influence the practice of health care providers. We undertook a study to evaluate the impact of a Web-based knowledge resource on increasing access to evidence and facilitating best practice of health care providers. The objective of this study was to evaluate (1) the impact of the Spinal Cord Injury Rehabilitation Evidence (SCIRE) project on access to information for health care providers and researchers and (2) how SCIRE influenced health care providers' management of clients. A 4-part mixed methods evaluation was undertaken: (1) monitoring website traffic and utilization using Google Analytics, (2) online survey of users who accessed the SCIRE website, (3) online survey of targeted end-users, that is, rehabilitation health care providers known to work with spinal cord injury (SCI) clients, as well as researchers, and (4) focus groups with health care providers who had previously accessed SCIRE. The online format allowed the content for a relatively specialized field to have far reach (eg, 26 countries and over 6500 users per month). The website survey and targeted end-user survey confirmed that health care providers, as well as researchers perceived that the website increased their access to SCI evidence. Access to SCIRE not only improved knowledge of SCI evidence but helped inform changes to the health providers' clinical practice and improved their confidence in treating SCI clients. The SCIRE information directly influenced the health providers' clinical decision making, in terms of choice of intervention, equipment needs, or assessment tool. A Web-based knowledge resource may be a relatively inexpensive method to increase access to evidence-based information, increase knowledge of the evidence, inform changes to the health providers' practice, and influence their clinical decision making.

  20. Similarity flows in relativistic hydrodynamics

    International Nuclear Information System (INIS)

    Blaizot, J.P.; Ollitrault, J.Y.

    1986-01-01

    In ultra-relativistic heavy ion collisions, one expects in particular to observe a deconfinement transition leading to a formation of quark gluon plasma. In the framework of the hydrodynamic model, experimental signatures of such a plasma may be looked for as observable consequences of a first order transition on the evolution of the system. In most of the possible scenario, the phase transition is accompanied with discontinuities in the hydrodynamic flow, such as shock waves. The method presented in this paper has been developed to treat without too much numerical effort such discontinuous flow. It relies heavily on the use of similarity solutions of the hydrodynamic equations

  1. Similarity analysis between quantum images

    Science.gov (United States)

    Zhou, Ri-Gui; Liu, XingAo; Zhu, Changming; Wei, Lai; Zhang, Xiafen; Ian, Hou

    2018-06-01

    Similarity analyses between quantum images are so essential in quantum image processing that it provides fundamental research for the other fields, such as quantum image matching, quantum pattern recognition. In this paper, a quantum scheme based on a novel quantum image representation and quantum amplitude amplification algorithm is proposed. At the end of the paper, three examples and simulation experiments show that the measurement result must be 0 when two images are same, and the measurement result has high probability of being 1 when two images are different.

  2. Organizational and provider level factors in implementation of trauma-informed care after a city-wide training: an explanatory mixed methods assessment.

    Science.gov (United States)

    Damian, April Joy; Gallo, Joseph; Leaf, Philip; Mendelson, Tamar

    2017-11-21

    While there is increasing support for training youth-serving providers in trauma-informed care (TIC) as a means of addressing high prevalence of U.S. childhood trauma, we know little about the effects of TIC training on organizational culture and providers' professional quality of life. This mixed-methods study evaluated changes in organizational- and provider-level factors following participation in a citywide TIC training. Government workers and nonprofit professionals (N = 90) who participated in a nine-month citywide TIC training completed a survey before and after the training to assess organizational culture and professional quality of life. Survey data were analyzed using multiple regression analyses. A subset of participants (n = 16) was interviewed using a semi-structured format, and themes related to organizational and provider factors were identified using qualitative methods. Analysis of survey data indicated significant improvements in participants' organizational culture and professional satisfaction at training completion. Participants' perceptions of their own burnout and secondary traumatic stress also increased. Four themes emerged from analysis of the interview data, including "Implementation of more flexible, less-punitive policies towards clients," "Adoption of trauma-informed workplace design," "Heightened awareness of own traumatic stress and need for self-care," and "Greater sense of camaraderie and empathy for colleagues." Use of a mixed-methods approach provided a nuanced understanding of the impact of TIC training and suggested potential benefits of the training on organizational and provider-level factors associated with implementation of trauma-informed policies and practices. Future trainings should explicitly address organizational factors such as safety climate and morale, managerial support, teamwork climate and collaboration, and individual factors including providers' compassion satisfaction, burnout, and secondary

  3. Validation of a new method for testing provider clinical quality in rural settings in low- and middle-income countries: the observed simulated patient.

    Directory of Open Access Journals (Sweden)

    Tin Aung

    Full Text Available BACKGROUND: Assessing the quality of care provided by individual health practitioners is critical to identifying possible risks to the health of the public. However, existing assessment methods can be inaccurate, expensive, or infeasible in many developing country settings, particularly in rural areas and especially for children. Following an assessment of the strengths and weaknesses of the existing methods for provider assessment, we developed a synthesis method combining components of direct observation, clinical vignettes, and medical mannequins which we have termed "Observed Simulated Patient" or OSP. An OSP assessment involves a trained actor playing the role of a 'mother', a life-size doll representing a 5-year old boy, and a trained observer. The provider being assessed was informed in advance of the role-playing, and told to conduct the diagnosis and treatment as he normally would while verbally describing the examinations. METHODOLOGY/PRINCIPAL FINDINGS: We tested the validity of OSP by conducting parallel scoring of medical providers in Myanmar, assessing the quality of their diagnosis and treatment of pediatric malaria, first by direct observation of true patients and second by OSP. Data were collected from 20 private independent medical practitioners in Mon and Kayin States, Myanmar between December 26, 2010 and January 12, 2011. All areas of assessment showed agreement between OSP and direct observation above 90% except for history taking related to past experience with malaria medicines. In this area, providers did not ask questions of the OSP to the same degree that they questioned real patients (agreement 82.8%. CONCLUSIONS/SIGNIFICANCE: The OSP methodology may provide a valuable option for quality assessment of providers in places, or for health conditions, where other assessment tools are unworkable.

  4. Abundance estimation of spectrally similar minerals

    CSIR Research Space (South Africa)

    Debba, Pravesh

    2009-07-01

    Full Text Available This paper evaluates a spectral unmixing method for estimating the partial abundance of spectrally similar minerals in complex mixtures. The method requires formulation of a linear function of individual spectra of individual minerals. The first...

  5. Patient-provider communication styles in HIV treatment programs in Bamako, Mali: A mixed-methods study to define dimensions and measure patient preferences

    Directory of Open Access Journals (Sweden)

    Emily A. Hurley

    2017-12-01

    Full Text Available Effective patient-provider communication (PPC promotes patient adherence and retention in long-term care. Sub-Saharan Africa faces unprecedented demand for chronic care for HIV patients on antiretroviral therapy (ART, yet adherence and retention remain challenging. In high-income countries, research describing patient preferences for different PPC styles has guided interventions to improve PPC and patient outcomes. However, research on PPC preferences in sub-Saharan Africa is limited. We sought to define PPC dimensions relevant to ART programs in Bamako, Mali through recordings of clinical interactions, in-depth interviews and focus-group discussions with 69 patients and 17 providers. To assess preferences toward contrasting PPC styles within dimensions, we conducted a vignette-based survey with 141 patients across five ART facilities. Qualitative analysis revealed two PPC dimensions similar to those described in the literature on patient-centered communication (level of psychosocial regard, balance of power, and one unique dimension that emerged from the data (guiding patient behavior: easy/tough/sharp. Significantly more survey participants chose the vignette demonstrating high psychosocial regard (52.2% compared to a biomedical style (22.5% (p<0.001. Within balance of power, a statistically similar proportion of participants chose the vignette demonstrating shared power (40.2% compared to a provider-dominated style (35.8%. In guiding patient behavior, a similar proportion of participants preferred the vignette depicting the “easy” (38.4% and/or “tough” style (40.6%, but significantly fewer preferred the “sharp” style (14.5% (p<0.001. Highly educated participants chose biomedical and shared power styles more frequently, while less educated participants more frequently indicated “no preference”. Working to understand, develop, and tailor PPC styles to patients in chronic care may help support patient retention and ultimately

  6. The copper intrauterine device for emergency contraception: an opportunity to provide the optimal emergency contraception method and transition to highly effective contraception.

    Science.gov (United States)

    Dermish, Amna I; Turok, David K

    2013-07-01

    Worldwide, 40% of all pregnancies are unintended. Widespread, over-the-counter availability of oral emergency contraception (EC) has not reduced unintended pregnancy rates. The EC visit presents an opportunity to initiate a highly effective method of contraception in a population at high risk of unintended pregnancy who are actively seeking to avoid pregnancy. The copper intrauterine device (IUD), the most effective method of EC, continues to provide contraception as effective as sterilization for up to 12 years, and it should be offered as the first-line method of EC wherever possible. Increased demand for and supply of the copper IUD for EC may have an important role in reducing rates of unintended pregnancy. The EC visit should include access to the copper IUD as optimal care but should ideally include access to all highly effective methods of contraception.

  7. Organizational and provider level factors in implementation of trauma-informed care after a city-wide training: an explanatory mixed methods assessment

    Directory of Open Access Journals (Sweden)

    April Joy Damian

    2017-11-01

    Full Text Available Abstract Background While there is increasing support for training youth-serving providers in trauma-informed care (TIC as a means of addressing high prevalence of U.S. childhood trauma, we know little about the effects of TIC training on organizational culture and providers’ professional quality of life. This mixed-methods study evaluated changes in organizational- and provider-level factors following participation in a citywide TIC training. Methods Government workers and nonprofit professionals (N = 90 who participated in a nine-month citywide TIC training completed a survey before and after the training to assess organizational culture and professional quality of life. Survey data were analyzed using multiple regression analyses. A subset of participants (n = 16 was interviewed using a semi-structured format, and themes related to organizational and provider factors were identified using qualitative methods. Results Analysis of survey data indicated significant improvements in participants’ organizational culture and professional satisfaction at training completion. Participants’ perceptions of their own burnout and secondary traumatic stress also increased. Four themes emerged from analysis of the interview data, including “Implementation of more flexible, less-punitive policies towards clients,” “Adoption of trauma-informed workplace design,” “Heightened awareness of own traumatic stress and need for self-care,” and “Greater sense of camaraderie and empathy for colleagues.” Conclusion Use of a mixed-methods approach provided a nuanced understanding of the impact of TIC training and suggested potential benefits of the training on organizational and provider-level factors associated with implementation of trauma-informed policies and practices. Future trainings should explicitly address organizational factors such as safety climate and morale, managerial support, teamwork climate and collaboration, and

  8. Semantic similarity measure in biomedical domain leverage web search engine.

    Science.gov (United States)

    Chen, Chi-Huang; Hsieh, Sheau-Ling; Weng, Yung-Ching; Chang, Wen-Yung; Lai, Feipei

    2010-01-01

    Semantic similarity measure plays an essential role in Information Retrieval and Natural Language Processing. In this paper we propose a page-count-based semantic similarity measure and apply it in biomedical domains. Previous researches in semantic web related applications have deployed various semantic similarity measures. Despite the usefulness of the measurements in those applications, measuring semantic similarity between two terms remains a challenge task. The proposed method exploits page counts returned by the Web Search Engine. We define various similarity scores for two given terms P and Q, using the page counts for querying P, Q and P AND Q. Moreover, we propose a novel approach to compute semantic similarity using lexico-syntactic patterns with page counts. These different similarity scores are integrated adapting support vector machines, to leverage the robustness of semantic similarity measures. Experimental results on two datasets achieve correlation coefficients of 0.798 on the dataset provided by A. Hliaoutakis, 0.705 on the dataset provide by T. Pedersen with physician scores and 0.496 on the dataset provided by T. Pedersen et al. with expert scores.

  9. Acceptability of multipurpose human papillomavirus vaccines among providers and mothers of adolescent girls: A mixed-methods study in five countries

    Directory of Open Access Journals (Sweden)

    Nadja A. Vielot

    2017-06-01

    Full Text Available Introduction: Multipurpose vaccines (MPVs could be formulated to prevent multiple sexually transmitted infections simultaneously. Little is known about acceptability of MPVs among vaccine health care providers (HCPs or mothers of adolescent girls. Methods: 151 adolescent vaccine providers and 118 mothers of adolescent girls aged 9–14 were recruited from five geographically-diverse countries: Argentina, Malaysia, South Africa, South Korea, and Spain. We assessed providers’ preferences for single-purpose human papillomavirus (HPV vaccine versus MPVs (including HPV+herpes simplex virus (HSV−2, HPV+HIV, or HPV+HSV-2+HIV via quantitative surveys. Maternal MPV attitudes were assessed in four focus group discussions (FGDs in each country. Results: Most providers preferred MPVs over single-purpose HPV vaccination, with preference ranging from 61% in Malaysia to 96% in South Africa. HPV+HSV-2+HIV was the most preferred MPV formulation (56–82%. Overall, 53% of the mothers preferred MPVs over single-purpose HPV vaccines, with strongest support in South Africa (90% and lowest support in South Korea (29%. Convenience and trust in the health care system were commonly-cited reasons for MPV acceptability. Safety and efficacy concerns were common barriers to accepting MPVs, though specific concerns differed by country. Across FGDs, additional safety and efficacy information on MPVs were requested, particularly from trusted sources like HCPs. Conclusions: Though maternal acceptability of MPVs varied by country, MPV acceptability would be enhanced by having HCPs provide parents with additional MPV vaccine safety and efficacy information. While most providers preferred MPVs, future health behavior research should identify acceptability barriers, and targeted provider interventions should equip providers to improve vaccination discussions with parents. Keywords: Vaccines, Acceptability, Multipurpose, Human papillomavirus, Sexually transmitted

  10. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, December 2015

    International Nuclear Information System (INIS)

    Cabellos, Oscar; De Saint Jean, Cyrille; Hursin, Mathieu; Pelloni, Sandro; Ivanov, Evgeny; Kodeli, Ivan; Leconte, Pierre; Palmiotti, Giuseppe; Salvatores, Massimo; Sobes, Vladimir; Yokoyama, Kenji

    2015-12-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the fifth formal Subgroup 39 meeting held at the Institute Curie, Paris, France, on 4 December 2015. It comprises a Summary Record of the meeting, and all the available presentations (slides) given by the participants: A - Sensitivity methods: - 1: Short update on deliverables (K. Yokoyama); - 2: Does one shot Bayesian is equivalent to successive update? Bayesian inference: some matrix linear algebra (C. De Saint Jean); - 3: Progress in Methodology (G. Palmiotti); - SG39-3: Use of PIA approach. Possible application to neutron propagation experiments (S. Pelloni); - 4: Update on sensitivity coefficient methods (E. Ivanov); - 5: Stress test for U-235 fission (H. Wu); - 6: Methods and approaches development at ORNL for providing feedback from integral benchmark experiments for improvement of nuclear data files (V. Sobes); B - Integral experiments: - 7a: Update on SEG analysis (G. Palmiotti); - 7b:Status of MANTRA (G. Palmiotti); - 7c: Possible new experiments at NRAD (G. Palmiotti); - 8: B-eff experiments (I. Kodeli); - 9: On going CEA activities related to dedicated integral experiments for nuclear date validation in the Fast energy range (P. Leconte); - 10: PROTEUS Experiments: an update (M. Hursin); - 11: Short updates on neutron propagation experiments, STEK, CIELO status (O. Cabellos)

  11. Presentations provided

    Energy Technology Data Exchange (ETDEWEB)

    Hashemian, H; Beverly, D [Analysis and Measurement Services Corp., Knoxville, TN (United States)

    1999-12-31

    The following topics covered in detail at the workshop included: temperature instrumentation; pressure instrumentation; in-situ calibration and response time testing of RTDs and pressure transmitters; on-line performance monitoring and preventive maintenance of critical equipment; automated measurement of critical parameters; nuclear power plant infrastructure, management and Quality Assurance issues and recent developments for WWER and RBMK reactors. Conclusions drawn were: aging can adversely affect the performance of nuclear plant pressure transmitters; current testing interval of once in every fuel cycle is adequate for aging management; in-situ response time measurements and on-line calibration testing methods have been developed and validated for nuclear plant pressure transmitters; NUREG/CR-5851 should be taken into account for details of aging research on pressure transmitters

  12. Presentations provided

    International Nuclear Information System (INIS)

    Hashemian, H.; Beverly, D.

    1998-01-01

    The following topics covered in detail at the workshop included: temperature instrumentation; pressure instrumentation; in-situ calibration and response time testing of RTDs and pressure transmitters; on-line performance monitoring and preventive maintenance of critical equipment; automated measurement of critical parameters; nuclear power plant infrastructure, management and Quality Assurance issues and recent developments for WWER and RBMK reactors. Conclusions drawn were: aging can adversely affect the performance of nuclear plant pressure transmitters; current testing interval of once in every fuel cycle is adequate for aging management; in-situ response time measurements and on-line calibration testing methods have been developed and validated for nuclear plant pressure transmitters; NUREG/CR-5851 should be taken into account for details of aging research on pressure transmitters

  13. Self-similar gravitational clustering

    International Nuclear Information System (INIS)

    Efstathiou, G.; Fall, S.M.; Hogan, C.

    1979-01-01

    The evolution of gravitational clustering is considered and several new scaling relations are derived for the multiplicity function. These include generalizations of the Press-Schechter theory to different densities and cosmological parameters. The theory is then tested against multiplicity function and correlation function estimates for a series of 1000-body experiments. The results are consistent with the theory and show some dependence on initial conditions and cosmological density parameter. The statistical significance of the results, however, is fairly low because of several small number effects in the experiments. There is no evidence for a non-linear bootstrap effect or a dependence of the multiplicity function on the internal dynamics of condensed groups. Empirical estimates of the multiplicity function by Gott and Turner have a feature near the characteristic luminosity predicted by the theory. The scaling relations allow the inference from estimates of the galaxy luminosity function that galaxies must have suffered considerable dissipation if they originally formed from a self-similar hierarchy. A method is also developed for relating the multiplicity function to similar measures of clustering, such as those of Bhavsar, for the distribution of galaxies on the sky. These are shown to depend on the luminosity function in a complicated way. (author)

  14. Seniority bosons from similarity transformations

    International Nuclear Information System (INIS)

    Geyer, H.B.

    1986-01-01

    The requirement of associating in the boson space seniority with twice the number of non-s bosons defines a similarity transformation which re-expresses the Dyson pair boson images in terms of seniority bosons. In particular the fermion S-pair creation operator is mapped onto an operator which, unlike the pair boson image, does not change the number of non-s bosons. The original results of Otsuka, Arima and Iachello are recovered by this procedure while at the same time they are generalized to include g-bosons or even bosons with J>4 as well as any higher order boson terms. Furthermore the seniority boson images are valid for an arbitrary number of d- or g-bosons - a result which is not readily obtainable within the framework of the usual Marumori- or OAI-method

  15. Similarity queries for temporal toxicogenomic expression profiles.

    Directory of Open Access Journals (Sweden)

    Adam A Smith

    2008-07-01

    Full Text Available We present an approach for answering similarity queries about gene expression time series that is motivated by the task of characterizing the potential toxicity of various chemicals. Our approach involves two key aspects. First, our method employs a novel alignment algorithm based on time warping. Our time warping algorithm has several advantages over previous approaches. It allows the user to impose fairly strong biases on the form that the alignments can take, and it permits a type of local alignment in which the entirety of only one series has to be aligned. Second, our method employs a relaxed spline interpolation to predict expression responses for unmeasured time points, such that the spline does not necessarily exactly fit every observed point. We evaluate our approach using expression time series from the Edge toxicology database. Our experiments show the value of using spline representations for sparse time series. More significantly, they show that our time warping method provides more accurate alignments and classifications than previous standard alignment methods for time series.

  16. Quantitative fluorescence kinetic analysis of NADH and FAD in human plasma using three- and four-way calibration methods capable of providing the second-order advantage

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Chao [School of Chemistry and Chemical Engineering, Guizhou University, Guiyang 550025 (China); Wu, Hai-Long, E-mail: hlwu@hnu.edu.cn [State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082 (China); Zhou, Chang; Xiang, Shou-Xia; Zhang, Xiao-Hua; Yu, Yong-Jie; Yu, Ru-Qin [State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082 (China)

    2016-03-03

    The metabolic coenzymes reduced nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FAD) are the primary electron donor and acceptor respectively, participate in almost all biological metabolic pathways. This study develops a novel method for the quantitative kinetic analysis of the degradation reaction of NADH and the formation reaction of FAD in human plasma containing an uncalibrated interferent, by using three-way calibration based on multi-way fluorescence technique. In the three-way analysis, by using the calibration set in a static manner, we directly predicted the concentrations of both analytes in the mixture at any time after the start of their reactions, even in the presence of an uncalibrated spectral interferent and a varying background interferent. The satisfactory quantitative results indicate that the proposed method allows one to directly monitor the concentration of each analyte in the mixture as the function of time in real-time and nondestructively, instead of determining the concentration after the analytical separation. Thereafter, we fitted the first-order rate law to their concentration data throughout their reactions. Additionally, a four-way calibration procedure is developed as an alternative for highly collinear systems. The results of the four-way analysis confirmed the results of the three-way analysis and revealed that both the degradation reaction of NADH and the formation reaction of FAD in human plasma fit the first-order rate law. The proposed methods could be expected to provide promising tools for simultaneous kinetic analysis of multiple reactions in complex systems in real-time and nondestructively. - Highlights: • A novel three-way calibration method for the quantitative kinetic analysis of NADH and FAD in human plasma is proposed. • The method can directly monitor the concentration of each analyte in the reaction in real-time and nondestructively. • The method has the second-order advantage. • A

  17. Quantitative fluorescence kinetic analysis of NADH and FAD in human plasma using three- and four-way calibration methods capable of providing the second-order advantage

    International Nuclear Information System (INIS)

    Kang, Chao; Wu, Hai-Long; Zhou, Chang; Xiang, Shou-Xia; Zhang, Xiao-Hua; Yu, Yong-Jie; Yu, Ru-Qin

    2016-01-01

    The metabolic coenzymes reduced nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FAD) are the primary electron donor and acceptor respectively, participate in almost all biological metabolic pathways. This study develops a novel method for the quantitative kinetic analysis of the degradation reaction of NADH and the formation reaction of FAD in human plasma containing an uncalibrated interferent, by using three-way calibration based on multi-way fluorescence technique. In the three-way analysis, by using the calibration set in a static manner, we directly predicted the concentrations of both analytes in the mixture at any time after the start of their reactions, even in the presence of an uncalibrated spectral interferent and a varying background interferent. The satisfactory quantitative results indicate that the proposed method allows one to directly monitor the concentration of each analyte in the mixture as the function of time in real-time and nondestructively, instead of determining the concentration after the analytical separation. Thereafter, we fitted the first-order rate law to their concentration data throughout their reactions. Additionally, a four-way calibration procedure is developed as an alternative for highly collinear systems. The results of the four-way analysis confirmed the results of the three-way analysis and revealed that both the degradation reaction of NADH and the formation reaction of FAD in human plasma fit the first-order rate law. The proposed methods could be expected to provide promising tools for simultaneous kinetic analysis of multiple reactions in complex systems in real-time and nondestructively. - Highlights: • A novel three-way calibration method for the quantitative kinetic analysis of NADH and FAD in human plasma is proposed. • The method can directly monitor the concentration of each analyte in the reaction in real-time and nondestructively. • The method has the second-order advantage. • A

  18. Wiring assembly and method of forming a channel in a wiring assembly for receiving conductor and providing separate regions of conductor contact with the channel

    Energy Technology Data Exchange (ETDEWEB)

    Stelzer, Gerald; Meinke, Rainer; Senti, Mark

    2018-03-06

    A conductor assembly and method for constructing an assembly of the type which, when conducting current, generates a magnetic field or which, in the presence of a changing magnetic field, induces a voltage. In one embodiment the method provides a first insulative layer tubular in shape and including a surface along which a conductor segment may be positioned. A channel formed in the surface of the insulative layer defines a first conductor path and includes a surface of first contour in cross section along a first plane transverse to the conductor path. A segment of conductor having a surface of second contour in cross section is positioned at least partly in the channel and extends along the conductor path. Along the first plane, contact between the conductor surface of second contour and the channel surface of first contour includes at least two separate regions of contact.

  19. Human rights versus societal norms: a mixed methods study among healthcare providers on social stigma related to adolescent abortion and contraceptive use in Kisumu, Kenya.

    Science.gov (United States)

    Håkansson, Miranda; Oguttu, Monica; Gemzell-Danielsson, Kristina; Makenzius, Marlene

    2018-01-01

    Adolescent pregnancy represents a serious public health issue in sub-Saharan Africa, and stigmatising attitudes are contributing factors. This study investigates stigmatising attitudes related to adolescent pregnancy, abortion and contraceptive use among healthcare providers working with postabortion care (PAC) in a low-resource setting in Kenya. A mixed methods approach in a convergent design was utilised to capture attitudes related to abortion and contraceptive use among 86 (f=62; m=19) PAC providers in Kisumu, Kenya. Two Likert-scale questionnaires were used: the 18-item Stigmatising Attitudes, Beliefs and Actions Scale (SABAS) and the 7-item Contraceptive Use Stigma Scale (CUSS). 74 PAC providers responded to the SABAS, 44 to the CUSS and 12 participated in two focus group discussions. Descriptive statistics, psychometric tests of instruments and qualitative content analysis were conducted and reported in accordance with Consolidated Criteria for Reporting Qualitative Research. Cronbach's α coefficients for the total instrument was 0.88 (SABAS) and 0.84 (CUSS). The majority, 92% (68/74) agreed that a woman who has had an abortion should be treated equally to everyone else, 27% (20/74) considered abortion a sin and 30% (22/74) believed she will make abortion a habit. Contraceptive use among adolescent women was associated with promiscuity (39%; 17/44), hence contraceptives should only be available to married women (36%; 16/44), and 20% (9/44) believed that contraceptive use causes infertility. The providers encouraged women's autonomy and their rights to sexual and reproductive health; however, unclear regulations reinforce religious and cultural beliefs, which hampers implementation of evidence-based contraceptive counselling. Stigmatising attitudes towards young women in need of abortion and contraception is common among PAC providers. Their work is characterised by a conflict between human rights and societal norms, thus highlighting the need for

  20. Development of a reject classification method, applied to the diagnotic of a nuclear reactor core: processing of thermal signals providing from out-of-reactor simulation

    International Nuclear Information System (INIS)

    Smolarz, A.

    1982-07-01

    Development of an evolution detection algorithm which aim is to extend the application field of the form recognition analysis to the diagnosis and follow-up of a complex system: study of the data from the out-of-reactor test loop with forced convection in sodium, study and description of a reject classification algorithm developed in the general point of view of evolution detection. This method is tested with theoretical data and with experimental data provided by the second test loop ISIS [fr

  1. Self-similar continued root approximants

    International Nuclear Information System (INIS)

    Gluzman, S.; Yukalov, V.I.

    2012-01-01

    A novel method of summing asymptotic series is advanced. Such series repeatedly arise when employing perturbation theory in powers of a small parameter for complicated problems of condensed matter physics, statistical physics, and various applied problems. The method is based on the self-similar approximation theory involving self-similar root approximants. The constructed self-similar continued roots extrapolate asymptotic series to finite values of the expansion parameter. The self-similar continued roots contain, as a particular case, continued fractions and Padé approximants. A theorem on the convergence of the self-similar continued roots is proved. The method is illustrated by several examples from condensed-matter physics.

  2. Mining Diagnostic Assessment Data for Concept Similarity

    Science.gov (United States)

    Madhyastha, Tara; Hunt, Earl

    2009-01-01

    This paper introduces a method for mining multiple-choice assessment data for similarity of the concepts represented by the multiple choice responses. The resulting similarity matrix can be used to visualize the distance between concepts in a lower-dimensional space. This gives an instructor a visualization of the relative difficulty of concepts…

  3. Similarity Structure of Wave-Collapse

    DEFF Research Database (Denmark)

    Rypdal, Kristoffer; Juul Rasmussen, Jens; Thomsen, Kenneth

    1985-01-01

    Similarity transformations of the cubic Schrödinger equation (CSE) are investigated. The transformations are used to remove the explicit time variation in the CSE and reduce it to differential equations in the spatial variables only. Two different methods for similarity reduction are employed and...

  4. Applications versus properties of Mg–Al layered double hydroxides provided by their syntheses methods: Alkoxide and alkoxide-free sol–gel syntheses and hydrothermal precipitation

    KAUST Repository

    Chubar, Natalia

    2013-12-01

    A tremendous number of studies have examined layered double hydroxides (LDH) for their technological applications in the ion exchange removal of toxic ions, recovery of valuable substances, catalysis, CO2 capture, as a layered host for storage/delivery of biologically active molecules, additives to plastics and building materials, and other functions. Numerous publications always conclude that the materials (prepared, as a rule, using the oldest synthesis method) are very promising for each investigated application; however, the main chemical industries producing these materials advertise them mainly (or only) as plastic additives. The authors performed extensive research using many of the appropriate methods to compare the structure, surface and adsorptive properties of three Mg-Al LHDs produced by advanced synthesis methods. One industrial sample (by Sasol, Germany) prepared by the alkoxide sol-gel method and two novel Mg-Al LDHs synthesised in-house by alkoxide-free sol-gel and hydrothermal precipitation approaches were investigated. Reasons for the very different adsorptive selectivity of the three LDHs towards arsenate, selenate, phosphate, arsenite and selenite have been provided, highlighting the role of speciation of the interlayer carbonate, aluminium, magnesium, interlayer hydration and moisture content in the adsorptive selectivity towards each toxic anion. This work is the first report presenting the regularities of the LDHs structure, surface and anion exchange properties as a function of their syntheses method. It establishes the links to potential technological applications of each investigated LDH and explains the necessary properties required to make the technological application cost-effective and efficient. The paper might accelerate industrial applications of these advanced materials. © 2013 Elsevier B.V.

  5. HYPOTHESIS TESTING WITH THE SIMILARITY INDEX

    Science.gov (United States)

    Mulltilocus DNA fingerprinting methods have been used extensively to address genetic issues in wildlife populations. Hypotheses concerning population subdivision and differing levels of diversity can be addressed through the use of the similarity index (S), a band-sharing coeffic...

  6. Outsourced similarity search on metric data assets

    KAUST Repository

    Yiu, Man Lung

    2012-02-01

    This paper considers a cloud computing setting in which similarity querying of metric data is outsourced to a service provider. The data is to be revealed only to trusted users, not to the service provider or anyone else. Users query the server for the most similar data objects to a query example. Outsourcing offers the data owner scalability and a low-initial investment. The need for privacy may be due to the data being sensitive (e.g., in medicine), valuable (e.g., in astronomy), or otherwise confidential. Given this setting, the paper presents techniques that transform the data prior to supplying it to the service provider for similarity queries on the transformed data. Our techniques provide interesting trade-offs between query cost and accuracy. They are then further extended to offer an intuitive privacy guarantee. Empirical studies with real data demonstrate that the techniques are capable of offering privacy while enabling efficient and accurate processing of similarity queries.

  7. Examining inequalities in uptake of maternal health care and choice of provider in underserved urban areas of Mumbai, India: a mixed methods study.

    Science.gov (United States)

    Alcock, Glyn; Das, Sushmita; Shah More, Neena; Hate, Ketaki; More, Sharda; Pantvaidya, Shanti; Osrin, David; Houweling, Tanja A J

    2015-09-28

    Discussions of maternity care in developing countries tend to emphasise service uptake and overlook choice of provider. Understanding how families choose among health providers is essential to addressing inequitable access to care. Our objectives were to quantify the determinants and choice of maternity care provider in Mumbai's informal urban settlements, and to explore the reasons underlying their choices. The study was conducted in informal urban communities in eastern Mumbai. We developed regression models using data from a census of married women aged 15-49 to test for associations between maternal characteristics and uptake of care and choice of provider. We then conducted seven focus group discussions and 16 in-depth interviews with purposively selected participants, and used grounded theory methods to examine the reasons for their choices. Three thousand eight hundred forty-eight women who had given birth in the preceding 2 years were interviewed in the census. The odds of institutional prenatal and delivery care increased with education, economic status, and duration of residence in Mumbai, and decreased with parity. Tertiary public hospitals were the commonest site of care, but there was a preference for private hospitals with increasing socio-economic status. Women were more likely to use tertiary public hospitals for delivery if they had fewer children and were Hindu. The odds of delivery in the private sector increased with maternal education, wealth, age, recent arrival in Mumbai, and Muslim faith. Four processes were identified in choosing a health care provider: exploring the options, defining a sphere of access, negotiating autonomy, and protective reasoning. Women seeking a positive health experience and outcome adopted strategies to select the best or most suitable, accessible provider. In Mumbai's informal settlements, institutional maternity care is the norm, except among recent migrants. Poor perceptions of primary public health facilities

  8. District health manager and mid-level provider perceptions of practice environments in acute obstetric settings in Tanzania: a mixed-method study.

    Science.gov (United States)

    Ng'ang'a, Njoki; Byrne, Mary Woods; Kruk, Margaret E; Shemdoe, Aloisia; de Pinho, Helen

    2016-08-08

    In sub-Saharan Africa, the capacity of human resources for health (HRH) managers to create positive practice environments that enable motivated, productive, and high-performing HRH is weak. We implemented a unique approach to examining HRH management practices by comparing perspectives offered by mid-level providers (MLPs) of emergency obstetric care (EmOC) in Tanzania to those presented by local health authorities, known as council health management teams (CHMTs). This study was guided by the basic strategic human resources management (SHRM) component model. A convergent mixed-method design was utilized to assess qualitative and quantitative data from the Health Systems Strengthening for Equity: The Power and Potential of Mid-Level Providers project. Survey data was obtained from 837 mid-level providers, 83 of whom participated in a critical incident interview whose aim was to elicit negative events in the practice environment that induced intention to leave their job. HRH management practices were assessed quantitatively in 48 districts with 37 members of CHMTs participating in semi-structured interviews. The eight human resources management practices enumerated in the basic SHRM component model were implemented unevenly. On the one hand, members of CHMTs and mid-level providers agreed that there were severe shortages of health workers, deficient salaries, and an overwhelming workload. On the other hand, members of CHMTs and mid-level providers differed in their perspectives on rewards and allocation of opportunities for in-service training. Although written standards of performance and supervision requirements were available in most districts, they did not reflect actual duties. Members of CHMTs reported high levels of autonomy in key HRH management practices, but mid-level providers disputed the degree to which the real situation on the ground was factored into job-related decision-making by CHMTs. The incongruence in perspectives offered by members of CHMTs

  9. Health care providers' perceived barriers to and need for the implementation of a national integrated health care standard on childhood obesity in the Netherlands - a mixed methods approach.

    Science.gov (United States)

    Schalkwijk, Annemarie A H; Nijpels, Giel; Bot, Sandra D M; Elders, Petra J M

    2016-03-08

    In 2010, a national integrated health care standard for (childhood) obesity was published and disseminated in the Netherlands. The aim of this study is to gain insight into the needs of health care providers and the barriers they face in terms of implementing this integrated health care standard. A mixed-methods approach was applied using focus groups, semi-structured, face-to-face interviews and an e-mail-based internet survey. The study's participants included: general practitioners (GPs) (focus groups); health care providers in different professions (face-to-face interviews) and health care providers, including GPs; youth health care workers; pediatricians; dieticians; psychologists and physiotherapists (survey). First, the transcripts from the focus groups were analyzed thematically. The themes identified in this process were then used to analyze the interviews. The results of the analysis of the qualitative data were used to construct the statements used in the e-mail-based internet survey. Responses to items were measured on a 5-point Likert scale and were categorized into three outcomes: 'agree' or 'important' (response categories 1 and 2), 'disagree' or 'not important'. Twenty-seven of the GPs that were invited (51 %) participated in four focus groups. Seven of the nine health care professionals that were invited (78 %) participated in the interviews and 222 questionnaires (17 %) were returned and included in the analysis. The following key barriers were identified with regard to the implementation of the integrated health care standard: reluctance to raise the subject; perceived lack of motivation and knowledge on the part of the parents; previous negative experiences with lifestyle programs; financial constraints and the lack of a structured multidisciplinary approach. The main needs identified were: increased knowledge and awareness on the part of both health care providers and parents/children; a social map of effective intervention; structural

  10. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, December 2016

    International Nuclear Information System (INIS)

    Cabellos, Oscar; ); PELLONI, Sandro; Ivanov, Evgeny; Sobes, Vladimir; Fukushima, M.; Yokoyama, Kenji; Palmiotti, Giuseppe; Kodeli, Ivo

    2016-12-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the eighth Subgroup 39 meeting, held at the OECD NEA, Boulogne-Billancourt, France, on 1-2 December 2016. It comprises all the available presentations (slides) given by the participants: A - Presentations: Welcome and actions review (Oscar CABELLOS); B - Methods: - Detailed comparison of Progressive Incremental Adjustment (PIA) sequence results involving adjustments of spectral indices and coolant density effects on the basis of the SG33 benchmark (Sandro PELLONI); - ND assessment alternatives: Validation matrix vs XS adjustment (Evgeny IVANOV); - Implementation of Resonance Parameter Sensitivity Coefficients Calculation in CE TSUNAMI-3D (Vladimir SOBES); C - Experiment analysis, sensitivity calculations and benchmarks: - Benchmark tests of ENDF/B-VIII.0 beta 1 using sodium void reactivity worth of FCA-XXVII-1 assembly (M. FUKUSHIMA, Kenji YOKOYAMA); D - Adjustments: - Cross-section adjustment based on JENDL-4.0 using new experiments on the basis of the SG33 benchmark (Kenji YOKOYAMA); - Comparison of adjustment trends with the Cielo evaluation (Sandro PELLONI); - Expanded adjustment in support of CIELO initiative (Giuseppe PALMIOTTI); - First preliminary results of the adjustment exercise using ASPIS Fe88 and SNEAK-7A/7B k_e_f_f and b_e_f_f benchmarks (Ivo KODELI); E - Future actions, deliverables: - Discussion on future of SG39 and possible new subgroup (Giuseppe PALMIOTTI); - WPEC sub-group proposal: Investigation of Covariance Data in

  11. A COMPARISON OF SEMANTIC SIMILARITY MODELS IN EVALUATING CONCEPT SIMILARITY

    Directory of Open Access Journals (Sweden)

    Q. X. Xu

    2012-08-01

    Full Text Available The semantic similarities are important in concept definition, recognition, categorization, interpretation, and integration. Many semantic similarity models have been established to evaluate semantic similarities of objects or/and concepts. To find out the suitability and performance of different models in evaluating concept similarities, we make a comparison of four main types of models in this paper: the geometric model, the feature model, the network model, and the transformational model. Fundamental principles and main characteristics of these models are introduced and compared firstly. Land use and land cover concepts of NLCD92 are employed as examples in the case study. The results demonstrate that correlations between these models are very high for a possible reason that all these models are designed to simulate the similarity judgement of human mind.

  12. Testing Self-Similarity Through Lamperti Transformations

    KAUST Repository

    Lee, Myoungji

    2016-07-14

    Self-similar processes have been widely used in modeling real-world phenomena occurring in environmetrics, network traffic, image processing, and stock pricing, to name but a few. The estimation of the degree of self-similarity has been studied extensively, while statistical tests for self-similarity are scarce and limited to processes indexed in one dimension. This paper proposes a statistical hypothesis test procedure for self-similarity of a stochastic process indexed in one dimension and multi-self-similarity for a random field indexed in higher dimensions. If self-similarity is not rejected, our test provides a set of estimated self-similarity indexes. The key is to test stationarity of the inverse Lamperti transformations of the process. The inverse Lamperti transformation of a self-similar process is a strongly stationary process, revealing a theoretical connection between the two processes. To demonstrate the capability of our test, we test self-similarity of fractional Brownian motions and sheets, their time deformations and mixtures with Gaussian white noise, and the generalized Cauchy family. We also apply the self-similarity test to real data: annual minimum water levels of the Nile River, network traffic records, and surface heights of food wrappings. © 2016, International Biometric Society.

  13. Similarity increases altruistic punishment in humans.

    Science.gov (United States)

    Mussweiler, Thomas; Ockenfels, Axel

    2013-11-26

    Humans are attracted to similar others. As a consequence, social networks are homogeneous in sociodemographic, intrapersonal, and other characteristics--a principle called homophily. Despite abundant evidence showing the importance of interpersonal similarity and homophily for human relationships, their behavioral correlates and cognitive foundations are poorly understood. Here, we show that perceived similarity substantially increases altruistic punishment, a key mechanism underlying human cooperation. We induced (dis)similarity perception by manipulating basic cognitive mechanisms in an economic cooperation game that included a punishment phase. We found that similarity-focused participants were more willing to punish others' uncooperative behavior. This influence of similarity is not explained by group identity, which has the opposite effect on altruistic punishment. Our findings demonstrate that pure similarity promotes reciprocity in ways known to encourage cooperation. At the same time, the increased willingness to punish norm violations among similarity-focused participants provides a rationale for why similar people are more likely to build stable social relationships. Finally, our findings show that altruistic punishment is differentially involved in encouraging cooperation under pure similarity vs. in-group conditions.

  14. The "Performance of Rotavirus and Oral Polio Vaccines in Developing Countries" (PROVIDE) study: description of methods of an interventional study designed to explore complex biologic problems.

    Science.gov (United States)

    Kirkpatrick, Beth D; Colgate, E Ross; Mychaleckyj, Josyf C; Haque, Rashidul; Dickson, Dorothy M; Carmolli, Marya P; Nayak, Uma; Taniuchi, Mami; Naylor, Caitlin; Qadri, Firdausi; Ma, Jennie Z; Alam, Masud; Walsh, Mary Claire; Diehl, Sean A; Petri, William A

    2015-04-01

    Oral vaccines appear less effective in children in the developing world. Proposed biologic reasons include concurrent enteric infections, malnutrition, breast milk interference, and environmental enteropathy (EE). Rigorous study design and careful data management are essential to begin to understand this complex problem while assuring research subject safety. Herein, we describe the methodology and lessons learned in the PROVIDE study (Dhaka, Bangladesh). A randomized clinical trial platform evaluated the efficacy of delayed-dose oral rotavirus vaccine as well as the benefit of an injectable polio vaccine replacing one dose of oral polio vaccine. This rigorous infrastructure supported the additional examination of hypotheses of vaccine underperformance. Primary and secondary efficacy and immunogenicity measures for rotavirus and polio vaccines were measured, as well as the impact of EE and additional exploratory variables. Methods for the enrollment and 2-year follow-up of a 700 child birth cohort are described, including core laboratory, safety, regulatory, and data management practices. Intense efforts to standardize clinical, laboratory, and data management procedures in a developing world setting provide clinical trials rigor to all outcomes. Although this study infrastructure requires extensive time and effort, it allows optimized safety and confidence in the validity of data gathered in complex, developing country settings. © The American Society of Tropical Medicine and Hygiene.

  15. Investigating Correlation between Protein Sequence Similarity and Semantic Similarity Using Gene Ontology Annotations.

    Science.gov (United States)

    Ikram, Najmul; Qadir, Muhammad Abdul; Afzal, Muhammad Tanvir

    2018-01-01

    Sequence similarity is a commonly used measure to compare proteins. With the increasing use of ontologies, semantic (function) similarity is getting importance. The correlation between these measures has been applied in the evaluation of new semantic similarity methods, and in protein function prediction. In this research, we investigate the relationship between the two similarity methods. The results suggest absence of a strong correlation between sequence and semantic similarities. There is a large number of proteins with low sequence similarity and high semantic similarity. We observe that Pearson's correlation coefficient is not sufficient to explain the nature of this relationship. Interestingly, the term semantic similarity values above 0 and below 1 do not seem to play a role in improving the correlation. That is, the correlation coefficient depends only on the number of common GO terms in proteins under comparison, and the semantic similarity measurement method does not influence it. Semantic similarity and sequence similarity have a distinct behavior. These findings are of significant effect for future works on protein comparison, and will help understand the semantic similarity between proteins in a better way.

  16. Human resources for health strategies adopted by providers in resource-limited settings to sustain long-term delivery of ART: a mixed-methods study from Uganda.

    Science.gov (United States)

    Zakumumpa, Henry; Taiwo, Modupe Oladunni; Muganzi, Alex; Ssengooba, Freddie

    2016-10-19

    Human resources for health (HRH) constraints are a major barrier to the sustainability of antiretroviral therapy (ART) scale-up programs in Sub-Saharan Africa. Many prior approaches to HRH constraints have taken a top-down trend of generalized global strategies and policy guidelines. The objective of the study was to examine the human resources for health strategies adopted by front-line providers in Uganda to sustain ART delivery beyond the initial ART scale-up phase between 2004 and 2009. A two-phase mixed-methods approach was adopted. In the first phase, a survey of a nationally representative sample of health facilities (n = 195) across Uganda was conducted. The second phase involved in-depth interviews (n = 36) with ART clinic managers and staff of 6 of the 195 health facilities purposively selected from the first study phase. Quantitative data was analysed based on descriptive statistics, and qualitative data was analysed by coding and thematic analysis. The identified strategies were categorized into five themes: (1) providing monetary and non-monetary incentives to health workers on busy ART clinic days; (2) workload reduction through spacing ART clinic appointments; (3) adopting training workshops in ART management as a motivation strategy for health workers; (4) adopting non-physician-centred staffing models; and (5) devising ART program leadership styles that enhanced health worker commitment. Facility-level strategies for responding to HRH constraints are feasible and can contribute to efforts to increase country ownership of HIV programs in resource-limited settings. Consideration of the human resources for health strategies identified in the study by ART program planners and managers could enhance the long-term sustainment of ART programs by providers in resource-limited settings.

  17. Usability evaluation of pharmacogenomics clinical decision support aids and clinical knowledge resources in a computerized provider order entry system: a mixed methods approach.

    Science.gov (United States)

    Devine, Emily Beth; Lee, Chia-Ju; Overby, Casey L; Abernethy, Neil; McCune, Jeannine; Smith, Joe W; Tarczy-Hornoch, Peter

    2014-07-01

    Pharmacogenomics (PGx) is positioned to have a widespread impact on the practice of medicine, yet physician acceptance is low. The presentation of context-specific PGx information, in the form of clinical decision support (CDS) alerts embedded in a computerized provider order entry (CPOE) system, can aid uptake. Usability evaluations can inform optimal design, which, in turn, can spur adoption. The study objectives were to: (1) evaluate an early prototype, commercial CPOE system with PGx-CDS alerts in a simulated environment, (2) identify potential improvements to the system user interface, and (3) understand the contexts under which PGx knowledge embedded in an electronic health record is useful to prescribers. Using a mixed methods approach, we presented seven cardiologists and three oncologists with five hypothetical clinical case scenarios. Each scenario featured a drug for which a gene encoding drug metabolizing enzyme required consideration of dosage adjustment. We used Morae(®) to capture comments and on-screen movements as participants prescribed each drug. In addition to PGx-CDS alerts, 'Infobutton(®)' and 'Evidence' icons provided participants with clinical knowledge resources to aid decision-making. Nine themes emerged. Five suggested minor improvements to the CPOE user interface; two suggested presenting PGx information through PGx-CDS alerts using an 'Infobutton' or 'Evidence' icon. The remaining themes were strong recommendations to provide succinct, relevant guidelines and dosing recommendations of phenotypic information from credible and trustworthy sources; any more information was overwhelming. Participants' median rating of PGx-CDS system usability was 2 on a Likert scale ranging from 1 (strongly agree) to 7 (strongly disagree). Usability evaluation results suggest that participants considered PGx information important for improving prescribing decisions; and that they would incorporate PGx-CDS when information is presented in relevant and

  18. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, November 2014

    International Nuclear Information System (INIS)

    Aufiero, Manuele; Ivanov, Evgeny; Hoefer, Axel; Yokoyama, Kenji; Da Cruz, Dirceu Ferreira; KODELI, Ivan-Alexander; Hursin, Mathieu; Pelloni, Sandro; Palmiotti, Giuseppe; Salvatores, Massimo; Barnes, Andrew; Cabellos De Francisco, Oscar; ); Ivanova, Tatiana; )

    2014-11-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the third formal Subgroup meeting held at the NEA, Issy-les-Moulineaux, France, on 27-28 November 2014. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Sensitivity methods: 1 - Perturbation/sensitivity calculations with Serpent (M. Aufiero); 2 - Comparison of deterministic and Monte Carlo sensitivity analysis of SNEAK-7A and FLATTOP-Pu Benchmarks (I. Kodeli); B - Integral experiments: 1 - PROTEUS experiments: selected experiments sensitivity profiles and availability, (M. Hursin, M. Salvatores - PROTEUS Experiments, HCLWR configurations); 2 - SINBAD Benchmark Database and FNS/JAEA Liquid Oxygen TOF Experiment Analysis (I. Kodeli); 3 - STEK experiment Opportunity for Validation of Fission Products Nuclear Data (D. Da Cruz); 4 - SEG (tailored adjoint flux shapes) (M. Savatores - comments) 5 - IPPE transmission experiments (Fe, 238 U) (T. Ivanova); 6 - RPI semi-integral (Fe, 238 U) (G. Palmiotti - comments); 7 - New experiments, e.g. in connection with the new NSC Expert Group on 'Improvement of Integral Experiments Data for Minor Actinide Management' (G. Palmiotti - Some comments from the Expert Group) 8 - Additional PSI adjustment studies accounting for nonlinearity (S. Pelloni); 9 - Adjustment methodology issues (G. Palmiotti); C - Am-241 and fission product issues: 1 - Am-241 validation for criticality-safety calculations (A. Barnes - Visio

  19. Perceptions of health care providers and patients on quality of care in maternal and neonatal health in fourteen Bangladesh government healthcare facilities: a mixed-method study.

    Science.gov (United States)

    Islam, Farzana; Rahman, Aminur; Halim, Abdul; Eriksson, Charli; Rahman, Fazlur; Dalal, Koustuv

    2015-06-19

    Bangladesh has achieved remarkable progress in healthcare with a steady decline in maternal and under-5 child mortality rates in efforts to achieve Millennium Development Goals 4 and 5. However, the mortality rates are still very high compared with high-income countries. The quality of healthcare needs improve to reduce mortality rates further. It is essential to investigate the current quality of healthcare before implementing any interventions. The study was conducted to explore the perception of healthcare providers about the quality of maternal and neonatal health (MNH) care. The study also investigated patient satisfaction with the MNH care received from district and sub-district hospitals. Both qualitative and quantitative methods were used in the study. Two district and 12 sub-district hospitals in Thakurgaon and Jamalpur in Bangladesh were the study settings. Fourteen group discussions and 56 in-depth interviews were conducted among the healthcare providers. Client exit interviews were conducted with 112 patients and their attendants from maternity, labor, and neonatal wards before being discharged from the hospitals. Eight physicians and four anthropologists collected data between November and December 2011 using pretested guidelines. The hospital staff identified several key factors that affected the quality of patient care: shortage of staff and logistics; lack of laboratory support; under use of patient-management protocols; a lack of training; and insufficient supervision. Doctors were unable to provide optimal care because of the high volume of patients. The exit interviews revealed that 85 % of respondents were satisfied with the hospital services received. Seven out of 14 respondents were satisfied with the cleanliness of the hospital facilities. More than half of the respondents were satisfied with the drugs they received. In half of the facilities, patients did not get an opportunity to ask the healthcare providers questions about their health

  20. Self-similar cosmological models

    Energy Technology Data Exchange (ETDEWEB)

    Chao, W Z [Cambridge Univ. (UK). Dept. of Applied Mathematics and Theoretical Physics

    1981-07-01

    The kinematics and dynamics of self-similar cosmological models are discussed. The degrees of freedom of the solutions of Einstein's equations for different types of models are listed. The relation between kinematic quantities and the classifications of the self-similarity group is examined. All dust local rotational symmetry models have been found.

  1. Dynamic similarity in erosional processes

    Science.gov (United States)

    Scheidegger, A.E.

    1963-01-01

    A study is made of the dynamic similarity conditions obtaining in a variety of erosional processes. The pertinent equations for each type of process are written in dimensionless form; the similarity conditions can then easily be deduced. The processes treated are: raindrop action, slope evolution and river erosion. ?? 1963 Istituto Geofisico Italiano.

  2. Notions of similarity for systems biology models.

    Science.gov (United States)

    Henkel, Ron; Hoehndorf, Robert; Kacprowski, Tim; Knüpfer, Christian; Liebermeister, Wolfram; Waltemath, Dagmar

    2018-01-01

    Systems biology models are rapidly increasing in complexity, size and numbers. When building large models, researchers rely on software tools for the retrieval, comparison, combination and merging of models, as well as for version control. These tools need to be able to quantify the differences and similarities between computational models. However, depending on the specific application, the notion of 'similarity' may greatly vary. A general notion of model similarity, applicable to various types of models, is still missing. Here we survey existing methods for the comparison of models, introduce quantitative measures for model similarity, and discuss potential applications of combined similarity measures. To frame model comparison as a general problem, we describe a theoretical approach to defining and computing similarities based on a combination of different model aspects. The six aspects that we define as potentially relevant for similarity are underlying encoding, references to biological entities, quantitative behaviour, qualitative behaviour, mathematical equations and parameters and network structure. We argue that future similarity measures will benefit from combining these model aspects in flexible, problem-specific ways to mimic users' intuition about model similarity, and to support complex model searches in databases. © The Author 2016. Published by Oxford University Press.

  3. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, May 2014

    International Nuclear Information System (INIS)

    Aliberti, G.; Archier, P.; Dunn, M.; Dupont, E.; Hill, I.; ); Garcia, A.; Hursin, M.; Pelloni, S.; Ivanova, T.; Kodeli, I.; Palmiotti, G.; Salvatores, M.; Touran, N.; Wenming, Wang; Yokoyama, K.

    2014-05-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the second Subgroup meeting, held at the NEA, Issy-les-Moulineaux, France, on 13 May 2014. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Welcome: Review of actions (M. Salvatores); B - Inter-comparison of sensitivity coefficients: 1 - Sensitivity Computation with Monte Carlo Methods (T. Ivanova); 2 - Sensitivity analysis of FLATTOP-Pu (I. Kodeli); 3 - Sensitivity coefficients by means of SERPENT-2 (S. Pelloni); 4 - Demonstration - Database for ICSBEP (DICE) and Database and Analysis Tool for IRPhE (IDAT) (I. Hill); C - Specific new experiments: 1 - PROTEUS FDWR-II (HCLWR) program summary (M. Hursin); 2 - STEK and SEG Experiments, M. Salvatores 3 - Experiments related to "2"3"5U, "2"3"8U, "5"6Fe and "2"3Na, G. Palmiotti); 4 - Validation of Iron Cross Sections against ASPIS Experiments (JEF/DOC-420) (I. Kodeli); 5 - Benchmark analysis of Iron Cross-sections (EFFDOC-1221) (I. Kodeli 6 - Integral Beta-effective Measurements (K. Yokoyama on behalf of M. Ishikawa); D - Adjustment results: 1 - Impacts of Covariance Data and Interpretation of Adjustment Trends of ADJ2010, (K. Yokoyama); 2 - Revised Recommendations from ADJ2010 Adjustment (K. Yokoyama); 3 - Comparisons and Discussions on Adjustment trends from JEFF (CEA) (P. Archier); 4 - Feedback on CIELO Isotopes from ENDF/B-VII.0 Adjustment (G. Palmiotti); 5 - Demonstration - Plot comparisons of participants' results (E

  4. Capacity building of nurses providing neonatal care in Rio de Janeiro, Brazil: methods for the POINTS of care project to enhance nursing education and reduce adverse neonatal outcomes

    Directory of Open Access Journals (Sweden)

    Darlow Brian A

    2012-03-01

    Full Text Available Abstract Background Increased survival of preterm infants in developing countries has often been accompanied by increased morbidity. A previous study found rates of severe retinopathy of prematurity varied widely between different neonatal units in Rio de Janeiro. Nurses have a key role in the care of high-risk infants but often do not have access to ongoing education programmes. We set out to design a quality improvement project that would provide nurses with the training and tools to decrease neonatal mortality and morbidity. The purpose of this report is to describe the methods and make the teaching package (POINTS of care--six modules addressing Pain control; optimal Oxygenation; Infection control; Nutrition interventions; Temperature control; Supportive care available to others. Methods/Design Six neonatal units, caring for 40% of preterm infants in Rio de Janeiro were invited to participate. In Phase 1 of the study multidisciplinary workshops were held in each neonatal unit to identify the neonatal morbidities of interest and to plan for data collection. In Phase 2 the teaching package was developed and tested. Phase 3 consisted of 12 months data collection utilizing a simple tick-sheet for recording. In Phase 4 (the Intervention all nurses were asked to complete all six modules of the POINTS of care package, which was supplemented by practical demonstrations. Phase 5 consisted of a further 12 months data collection. In Phase 1 it was agreed to include inborn infants with birthweight ≤ 1500 g or gestational age of ≤ 34 weeks. The primary outcome was death before discharge and secondary outcomes included retinopathy of prematurity and bronchopulmonary dysplasia. Assuming 400-450 infants in both pre- and post-intervention periods the study had 80% power at p = Discussion The results of the POINTS of Care intervention will be presented in a separate publication. Trial registration Current Controlled Trials: ISRCTN83110114

  5. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, November 2013

    International Nuclear Information System (INIS)

    De Saint Jean, C.; Dupont, E.; ); Dyrda, J.; Hursin, M.; Pelloni, S.; Ishikawa, M.; Ivanov, E.; Ivanova, T.; Kim, D.H.; Ee, Y.O.; Kodeli, I.; Leal, L.; Leichtle, D.; Palmiotti, G.; Salvatores, M.; Pronyaev, V.; Simakov, S.; )

    2013-11-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the first formal Subgroup 39 meeting held at the NEA, Issy-les-Moulineaux, France, on 28-29 November 2013. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Recent data adjustments performances and trends: 1 - Recommendations from ADJ2010 adjustment (M. Ishikawa); 2 - Feedback on CIELO isotopes from ENDF/B-VII.0 adjustment (G. Palmiotti); 3 - Sensitivity and uncertainty results on FLATTOP-Pu (I. Kodeli); 4 - SG33 benchmark: Comparative adjustment results (S. Pelloni) 5 - Integral benchmarks for data assimilation: selection of a consistent set and establishment of integral correlations (E. Ivanov); 6 - PROTEUS experimental data (M. Hursin); 7 - Additional information on High Conversion Light Water Reactor (HCLWR aka FDWR-II) experiments (14 January 2014); 8 - Data assimilation of benchmark experiments for homogenous thermal/epithermal uranium systems (J. Dyrda); B - Methodology issues: 1 - Adjustment methodology issues (G. Palmiotti); 2 - Marginalisation, methodology issues and nuclear data parameter adjustment (C. De Saint Jean); 3 - Nuclear data parameter adjustment (G. Palmiotti). A list of issues and actions conclude the document

  6. The Development of a Community-Based, Pharmacist-Provided Falls Prevention MTM Intervention for Older Adults: Relationship Building, Methods, and Rationale

    Directory of Open Access Journals (Sweden)

    David A. Mott

    2014-01-01

    Full Text Available The objectives of this article are to discuss the process of community engagement experienced to plan and implement a pilot study of a pharmacist-provided MTM intervention focused on reducing the use of medications associated with falling, and to present the research methods that emerged from the community engagement process to evaluate the feasibility, acceptance, and preliminary impact of the intervention. Key lessons learned from the community engagement process also are presented and discussed. The relationship building and planning process took twelve months. The RE-AIM framework broadly guided the planning process since an overarching goal for the community partners was developing a program that could be implemented and sustained in the future. The planning phase focused on identifying research questions that were of most interest to the community partners, the population to study, the capacity of partners to perform activities, and process evaluation. Much of the planning phase was accomplished with face-to-face meetings. After all study processes, study materials, and data collection tools were developed, a focus group of older adults who represented the likely targets of the MTM intervention provided feedback related to the concept and process of the intervention. Nine key lessons were identified from the community engagement process. One key to successful community engagement is partners taking the time to educate each other about experiences, processes, and successes and failures. Additionally, partners must actively listen to each other to better understand barriers and facilitators that likely will impact the planning and implementation processes. Successful community engagement will be important to develop both formative and summative evaluation processes that will help to produce valid evidence about the effectiveness of pharmacists in modifying drug therapy and preventing falls as well as to promote the adoption and

  7. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, May 2015

    International Nuclear Information System (INIS)

    Wang, Wenming; Yokoyama, Kenji; Kim, Do Heon; Kodeli, Ivan-Alexander; Hursin, Mathieu; Pelloni, Sandro; Palmiotti, Giuseppe; Salvatores, Massimo; Touran, Nicholas; Cabellos De Francisco, Oscar; )

    2015-05-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the fourth Subgroup meeting, held at the NEA, Issy-les-Moulineaux, France, on 19-20 May 2015. It comprises a Summary Record of the meeting, two papers on deliverables and all the available presentations (slides) given by the participants: 1 - Status of Deliverables: '1. Methodology' (K. Yokoyama); 2 - Status of Deliverables: '2. Comments on covariance data' (K. Yokoyama); 3 - PROTEUS HCLWR Experiments (M. Hursin); 4 - Preliminary UQ Efforts for TWR Design (N. Touran); 5 - Potential use of beta-eff and other benchmark for adjustment (I. Kodeli); 6 - k_e_f_f uncertainties for a simple case of Am"2"4"1 using different codes and evaluated files (I. Kodeli); 7 - k_e_f_f uncertainties for a simple case of Am"2"4"1 using TSUNAMI (O. Cabellos); 8 - REWIND: Ranking Experiments by Weighting to Improve Nuclear Data (G. Palmiotti); 9 - Recent analysis on NUDUNA/MOCABA applications to reactor physics parameters (E. Castro); 10 - INL exploratory study for SEG (A. Hummel); 11 - The Development of Nuclear Data Adjustment Code at CNDC (H. Wu); 12 - SG39 Perspectives (M. Salvatores). A list of issues and actions conclude the document

  8. Information filtering based on transferring similarity.

    Science.gov (United States)

    Sun, Duo; Zhou, Tao; Liu, Jian-Guo; Liu, Run-Ran; Jia, Chun-Xiao; Wang, Bing-Hong

    2009-07-01

    In this Brief Report, we propose an index of user similarity, namely, the transferring similarity, which involves all high-order similarities between users. Accordingly, we design a modified collaborative filtering algorithm, which provides remarkably higher accurate predictions than the standard collaborative filtering. More interestingly, we find that the algorithmic performance will approach its optimal value when the parameter, contained in the definition of transferring similarity, gets close to its critical value, before which the series expansion of transferring similarity is convergent and after which it is divergent. Our study is complementary to the one reported in [E. A. Leicht, P. Holme, and M. E. J. Newman, Phys. Rev. E 73, 026120 (2006)], and is relevant to the missing link prediction problem.

  9. Correlation between social proximity and mobility similarity.

    Science.gov (United States)

    Fan, Chao; Liu, Yiding; Huang, Junming; Rong, Zhihai; Zhou, Tao

    2017-09-20

    Human behaviors exhibit ubiquitous correlations in many aspects, such as individual and collective levels, temporal and spatial dimensions, content, social and geographical layers. With rich Internet data of online behaviors becoming available, it attracts academic interests to explore human mobility similarity from the perspective of social network proximity. Existent analysis shows a strong correlation between online social proximity and offline mobility similarity, namely, mobile records between friends are significantly more similar than between strangers, and those between friends with common neighbors are even more similar. We argue the importance of the number and diversity of common friends, with a counter intuitive finding that the number of common friends has no positive impact on mobility similarity while the diversity plays a key role, disagreeing with previous studies. Our analysis provides a novel view for better understanding the coupling between human online and offline behaviors, and will help model and predict human behaviors based on social proximity.

  10. Economic valuation of the ecosystem services provided by a protected area in the Brazilian Cerrado: application of the contingent valuation method.

    Science.gov (United States)

    Resende, F M; Fernandes, G W; Andrade, D C; Néder, H D

    2017-11-01

    Considering that the economic valuation of ecosystem services is a useful approach to support the conservation of natural areas, we aimed to estimate the monetary value of the benefits provided by a protected area in southeast Brazil, the Serra do Cipó National Park. We calculated the visitor's willingness to pay to conserve the ecosystems of the protected area using the contingent valuation method. Located in a region under intense anthropogenic pressure, the Serra do Cipó National Park is mostly composed of rupestrian grassland ecosystems, in addition to other Cerrado physiognomies. We conducted a survey consisting of 514 interviews with visitors of the region and found that the mean willingness to pay was R$ 7.16 year-1, which corresponds to a total of approximately R$ 716,000.00 year-1. We detected that per capita income, the household size, the level of interest in environmental issues and the place of origin influenced the likelihood that individuals are willing to contribute to the conservation of the park, as well as the value of the stated willingness to pay. This study conveys the importance of conserving rupestrian grassland and other Cerrado physiognomies to decision makers and society.

  11. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, May 2016

    International Nuclear Information System (INIS)

    Herman, Michal Wladyslaw; Cabellos De Francisco, Oscar; Beck, Bret; Ignatyuk, Anatoly V.; Palmiotti, Giuseppe; Grudzevich, Oleg T.; Salvatores, Massimo; Chadwick, Mark; Pelloni, Sandro; Diez De La Obra, Carlos Javier; Wu, Haicheng; Sobes, Vladimir; Rearden, Bradley T.; Yokoyama, Kenji; Hursin, Mathieu; Penttila, Heikki; Kodeli, Ivan-Alexander; Plevnik, Lucijan; Plompen, Arjan; Gabrielli, Fabrizio; Leal, Luiz Carlos; Aufiero, Manuele; Fiorito, Luca; Hummel, Andrew; Siefman, Daniel; Leconte, Pierre

    2016-05-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. WPEC subgroup 40-CIELO (Collaborative International Evaluated Library Organization) provides a new working paradigm to facilitate evaluated nuclear reaction data advances. It brings together experts from across the international nuclear reaction data community to identify and document discrepancies among existing evaluated data libraries, measured data, and model calculation interpretations, and aims to make progress in reconciling these discrepancies to create more accurate ENDF-formatted files. SG40-CIELO focusses on 6 important isotopes: "1H, "1"6O, "5"6Fe, "2"3"5","2"3"8U, "2"3"9Pu. This document is the proceedings of the seventh formal Subgroup 39 meeting and of the Joint SG39+SG40 Session held at the NEA, OECD Conference Center, Paris, France on 10-11 May 2016. It comprises a Summary Record of the meeting, and all the available presentations (slides) given by the participants: A - Welcome and actions review (Oscar CABELLOS); B - Methods: - XGPT: uncertainty propagation and data assimilation from continuous energy covariance matrix and resonance parameters covariances (Manuele AUFIERO); - Optimal experiment utilization (REWINDing PIA), (G. Palmiotti); C - Experiment analysis, sensitivity calculations and benchmarks: - Tripoli-4 analysis of SEG experiments (Andrew HUMMEL); - Tripoli-4 analysis of BERENICE experiments (P. DUFAY, Cyrille DE SAINT JEAN); - Preparation of sensitivities of k-eff, beta-eff and shielding benchmarks for adjustment exercise (Ivo KODELI); - SA and

  12. A Similarity Search Using Molecular Topological Graphs

    Directory of Open Access Journals (Sweden)

    Yoshifumi Fukunishi

    2009-01-01

    Full Text Available A molecular similarity measure has been developed using molecular topological graphs and atomic partial charges. Two kinds of topological graphs were used. One is the ordinary adjacency matrix and the other is a matrix which represents the minimum path length between two atoms of the molecule. The ordinary adjacency matrix is suitable to compare the local structures of molecules such as functional groups, and the other matrix is suitable to compare the global structures of molecules. The combination of these two matrices gave a similarity measure. This method was applied to in silico drug screening, and the results showed that it was effective as a similarity measure.

  13. Similarity-based pattern analysis and recognition

    CERN Document Server

    Pelillo, Marcello

    2013-01-01

    This accessible text/reference presents a coherent overview of the emerging field of non-Euclidean similarity learning. The book presents a broad range of perspectives on similarity-based pattern analysis and recognition methods, from purely theoretical challenges to practical, real-world applications. The coverage includes both supervised and unsupervised learning paradigms, as well as generative and discriminative models. Topics and features: explores the origination and causes of non-Euclidean (dis)similarity measures, and how they influence the performance of traditional classification alg

  14. SpolSimilaritySearch - A web tool to compare and search similarities between spoligotypes of Mycobacterium tuberculosis complex.

    Science.gov (United States)

    Couvin, David; Zozio, Thierry; Rastogi, Nalin

    2017-07-01

    Spoligotyping is one of the most commonly used polymerase chain reaction (PCR)-based methods for identification and study of genetic diversity of Mycobacterium tuberculosis complex (MTBC). Despite its known limitations if used alone, the methodology is particularly useful when used in combination with other methods such as mycobacterial interspersed repetitive units - variable number of tandem DNA repeats (MIRU-VNTRs). At a worldwide scale, spoligotyping has allowed identification of information on 103,856 MTBC isolates (corresponding to 98049 clustered strains plus 5807 unique isolates from 169 countries of patient origin) contained within the SITVIT2 proprietary database of the Institut Pasteur de la Guadeloupe. The SpolSimilaritySearch web-tool described herein (available at: http://www.pasteur-guadeloupe.fr:8081/SpolSimilaritySearch) incorporates a similarity search algorithm allowing users to get a complete overview of similar spoligotype patterns (with information on presence or absence of 43 spacers) in the aforementioned worldwide database. This tool allows one to analyze spread and evolutionary patterns of MTBC by comparing similar spoligotype patterns, to distinguish between widespread, specific and/or confined patterns, as well as to pinpoint patterns with large deleted blocks, which play an intriguing role in the genetic epidemiology of M. tuberculosis. Finally, the SpolSimilaritySearch tool also provides with the country distribution patterns for each queried spoligotype. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. One dimensional beam. Asymptotic and self similar solutions

    International Nuclear Information System (INIS)

    Feix, M.R.; Duranceau, J.L.; Besnard, D.

    1982-06-01

    Rescaling transformations provide a useful tool to solve nonlinear problems described by partial derivative equations. A brief review of this method is presented together with the connection with the self similar solutions obtained by compacting the independent variable with one of them (the time). The general theory is reported through examples found in Plasma Physics with a careful distinction between systems described by Hamiltonian and others where irreversible phenomena, like diffusion, are taken into account

  16. Similarity indices I: what do they measure

    International Nuclear Information System (INIS)

    Johnston, J.W.

    1976-11-01

    A method for estimating the effects of environmental effusions on ecosystems is described. The characteristics of 25 similarity indices used in studies of ecological communities were investigated. The type of data structure, to which these indices are frequently applied, was described as consisting of vectors of measurements on attributes (species) observed in a set of samples. A general similarity index was characterized as the result of a two-step process defined on a pair of vectors. In the first step an attribute similarity score is obtained for each attribute by comparing the attribute values observed in the pair of vectors. The result is a vector of attribute similarity scores. These are combined in the second step to arrive at the similarity index. The operation in the first step was characterized as a function, g, defined on pairs of attribute values. The second operation was characterized as a function, F, defined on the vector of attribute similarity scores from the first step. Usually, F was a simple sum or weighted sum of the attribute similarity scores. It is concluded that similarity indices should not be used as the test statistic to discriminate between two ecological communities

  17. Similarity indices I: what do they measure.

    Energy Technology Data Exchange (ETDEWEB)

    Johnston, J.W.

    1976-11-01

    A method for estimating the effects of environmental effusions on ecosystems is described. The characteristics of 25 similarity indices used in studies of ecological communities were investigated. The type of data structure, to which these indices are frequently applied, was described as consisting of vectors of measurements on attributes (species) observed in a set of samples. A general similarity index was characterized as the result of a two-step process defined on a pair of vectors. In the first step an attribute similarity score is obtained for each attribute by comparing the attribute values observed in the pair of vectors. The result is a vector of attribute similarity scores. These are combined in the second step to arrive at the similarity index. The operation in the first step was characterized as a function, g, defined on pairs of attribute values. The second operation was characterized as a function, F, defined on the vector of attribute similarity scores from the first step. Usually, F was a simple sum or weighted sum of the attribute similarity scores. It is concluded that similarity indices should not be used as the test statistic to discriminate between two ecological communities.

  18. Optimal neighborhood indexing for protein similarity search.

    Science.gov (United States)

    Peterlongo, Pierre; Noé, Laurent; Lavenier, Dominique; Nguyen, Van Hoa; Kucherov, Gregory; Giraud, Mathieu

    2008-12-16

    Similarity inference, one of the main bioinformatics tasks, has to face an exponential growth of the biological data. A classical approach used to cope with this data flow involves heuristics with large seed indexes. In order to speed up this technique, the index can be enhanced by storing additional information to limit the number of random memory accesses. However, this improvement leads to a larger index that may become a bottleneck. In the case of protein similarity search, we propose to decrease the index size by reducing the amino acid alphabet. The paper presents two main contributions. First, we show that an optimal neighborhood indexing combining an alphabet reduction and a longer neighborhood leads to a reduction of 35% of memory involved into the process, without sacrificing the quality of results nor the computational time. Second, our approach led us to develop a new kind of substitution score matrices and their associated e-value parameters. In contrast to usual matrices, these matrices are rectangular since they compare amino acid groups from different alphabets. We describe the method used for computing those matrices and we provide some typical examples that can be used in such comparisons. Supplementary data can be found on the website http://bioinfo.lifl.fr/reblosum. We propose a practical index size reduction of the neighborhood data, that does not negatively affect the performance of large-scale search in protein sequences. Such an index can be used in any study involving large protein data. Moreover, rectangular substitution score matrices and their associated statistical parameters can have applications in any study involving an alphabet reduction.

  19. Optimal neighborhood indexing for protein similarity search

    Directory of Open Access Journals (Sweden)

    Nguyen Van

    2008-12-01

    Full Text Available Abstract Background Similarity inference, one of the main bioinformatics tasks, has to face an exponential growth of the biological data. A classical approach used to cope with this data flow involves heuristics with large seed indexes. In order to speed up this technique, the index can be enhanced by storing additional information to limit the number of random memory accesses. However, this improvement leads to a larger index that may become a bottleneck. In the case of protein similarity search, we propose to decrease the index size by reducing the amino acid alphabet. Results The paper presents two main contributions. First, we show that an optimal neighborhood indexing combining an alphabet reduction and a longer neighborhood leads to a reduction of 35% of memory involved into the process, without sacrificing the quality of results nor the computational time. Second, our approach led us to develop a new kind of substitution score matrices and their associated e-value parameters. In contrast to usual matrices, these matrices are rectangular since they compare amino acid groups from different alphabets. We describe the method used for computing those matrices and we provide some typical examples that can be used in such comparisons. Supplementary data can be found on the website http://bioinfo.lifl.fr/reblosum. Conclusion We propose a practical index size reduction of the neighborhood data, that does not negatively affect the performance of large-scale search in protein sequences. Such an index can be used in any study involving large protein data. Moreover, rectangular substitution score matrices and their associated statistical parameters can have applications in any study involving an alphabet reduction.

  20. Domain similarity based orthology detection.

    Science.gov (United States)

    Bitard-Feildel, Tristan; Kemena, Carsten; Greenwood, Jenny M; Bornberg-Bauer, Erich

    2015-05-13

    Orthologous protein detection software mostly uses pairwise comparisons of amino-acid sequences to assert whether two proteins are orthologous or not. Accordingly, when the number of sequences for comparison increases, the number of comparisons to compute grows in a quadratic order. A current challenge of bioinformatic research, especially when taking into account the increasing number of sequenced organisms available, is to make this ever-growing number of comparisons computationally feasible in a reasonable amount of time. We propose to speed up the detection of orthologous proteins by using strings of domains to characterize the proteins. We present two new protein similarity measures, a cosine and a maximal weight matching score based on domain content similarity, and new software, named porthoDom. The qualities of the cosine and the maximal weight matching similarity measures are compared against curated datasets. The measures show that domain content similarities are able to correctly group proteins into their families. Accordingly, the cosine similarity measure is used inside porthoDom, the wrapper developed for proteinortho. porthoDom makes use of domain content similarity measures to group proteins together before searching for orthologs. By using domains instead of amino acid sequences, the reduction of the search space decreases the computational complexity of an all-against-all sequence comparison. We demonstrate that representing and comparing proteins as strings of discrete domains, i.e. as a concatenation of their unique identifiers, allows a drastic simplification of search space. porthoDom has the advantage of speeding up orthology detection while maintaining a degree of accuracy similar to proteinortho. The implementation of porthoDom is released using python and C++ languages and is available under the GNU GPL licence 3 at http://www.bornberglab.org/pages/porthoda .

  1. Improving communication when seeking informed consent: a randomised controlled study of a computer-based method for providing information to prospective clinical trial participants.

    Science.gov (United States)

    Karunaratne, Asuntha S; Korenman, Stanley G; Thomas, Samantha L; Myles, Paul S; Komesaroff, Paul A

    2010-04-05

    To assess the efficacy, with respect to participant understanding of information, of a computer-based approach to communication about complex, technical issues that commonly arise when seeking informed consent for clinical research trials. An open, randomised controlled study of 60 patients with diabetes mellitus, aged 27-70 years, recruited between August 2006 and October 2007 from the Department of Diabetes and Endocrinology at the Alfred Hospital and Baker IDI Heart and Diabetes Institute, Melbourne. Participants were asked to read information about a mock study via a computer-based presentation (n = 30) or a conventional paper-based information statement (n = 30). The computer-based presentation contained visual aids, including diagrams, video, hyperlinks and quiz pages. Understanding of information as assessed by quantitative and qualitative means. Assessment scores used to measure level of understanding were significantly higher in the group that completed the computer-based task than the group that completed the paper-based task (82% v 73%; P = 0.005). More participants in the group that completed the computer-based task expressed interest in taking part in the mock study (23 v 17 participants; P = 0.01). Most participants from both groups preferred the idea of a computer-based presentation to the paper-based statement (21 in the computer-based task group, 18 in the paper-based task group). A computer-based method of providing information may help overcome existing deficiencies in communication about clinical research, and may reduce costs and improve efficiency in recruiting participants for clinical trials.

  2. MO-E-17A-04: Size-Specific Dose Estimate (SSDE) Provides a Simple Method to Calculate Organ Dose for Pediatric CT Examinations

    International Nuclear Information System (INIS)

    Moore, B; Brady, S; Kaufman, R; Mirro, A

    2014-01-01

    Purpose: Investigate the correlation of SSDE with organ dose in a pediatric population. Methods: Four anthropomorphic phantoms, representing a range of pediatric body habitus, were scanned with MOSFET dosimeters placed at 23 organ locations to determine absolute organ dosimetry. Phantom organ dosimetry was divided by phantom SSDE to determine correlation between organ dose and SSDE. Correlation factors were then multiplied by patient SSDE to estimate patient organ dose. Patient demographics consisted of 352 chest and 241 abdominopelvic CT examinations, 22 ± 15 kg (range 5−55 kg) mean weight, and 6 ± 5 years (range 4 mon to 23 years) mean age. Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm. 23 organ correlation factors were determined in the chest and abdominopelvic region across nine pediatric weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7−1.4) and abdominopelvic (average 0.9; range 0.7−1.3) was near unity. For organs that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1−0.4) for both the chest and abdominopelvic regions, respectively. Pediatric organ dosimetry was compared to published values and was found to agree in the chest to better than an average of 5% (27.6/26.2) and in the abdominopelvic region to better than 2% (73.4/75.0). Conclusion: Average correlation of SSDE and organ dosimetry was found to be better than ± 10% for fully covered organs within the scan volume. This study provides a list of organ dose correlation factors for the chest and abdominopelvic regions, and describes a simple methodology to estimate individual pediatric patient organ dose based on patient SSDE

  3. MO-E-17A-04: Size-Specific Dose Estimate (SSDE) Provides a Simple Method to Calculate Organ Dose for Pediatric CT Examinations

    Energy Technology Data Exchange (ETDEWEB)

    Moore, B; Brady, S; Kaufman, R [St Jude Children' s Research Hospital, Memphis, TN (United States); Mirro, A [Washington University, St. Louis, MO (United States)

    2014-06-15

    Purpose: Investigate the correlation of SSDE with organ dose in a pediatric population. Methods: Four anthropomorphic phantoms, representing a range of pediatric body habitus, were scanned with MOSFET dosimeters placed at 23 organ locations to determine absolute organ dosimetry. Phantom organ dosimetry was divided by phantom SSDE to determine correlation between organ dose and SSDE. Correlation factors were then multiplied by patient SSDE to estimate patient organ dose. Patient demographics consisted of 352 chest and 241 abdominopelvic CT examinations, 22 ± 15 kg (range 5−55 kg) mean weight, and 6 ± 5 years (range 4 mon to 23 years) mean age. Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm. 23 organ correlation factors were determined in the chest and abdominopelvic region across nine pediatric weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7−1.4) and abdominopelvic (average 0.9; range 0.7−1.3) was near unity. For organs that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1−0.4) for both the chest and abdominopelvic regions, respectively. Pediatric organ dosimetry was compared to published values and was found to agree in the chest to better than an average of 5% (27.6/26.2) and in the abdominopelvic region to better than 2% (73.4/75.0). Conclusion: Average correlation of SSDE and organ dosimetry was found to be better than ± 10% for fully covered organs within the scan volume. This study provides a list of organ dose correlation factors for the chest and abdominopelvic regions, and describes a simple methodology to estimate individual pediatric patient organ dose based on patient SSDE.

  4. Outsourced Similarity Search on Metric Data Assets

    DEFF Research Database (Denmark)

    Yiu, Man Lung; Assent, Ira; Jensen, Christian S.

    2012-01-01

    . Outsourcing offers the data owner scalability and a low initial investment. The need for privacy may be due to the data being sensitive (e.g., in medicine), valuable (e.g., in astronomy), or otherwise confidential. Given this setting, the paper presents techniques that transform the data prior to supplying......This paper considers a cloud computing setting in which similarity querying of metric data is outsourced to a service provider. The data is to be revealed only to trusted users, not to the service provider or anyone else. Users query the server for the most similar data objects to a query example...

  5. Link-Based Similarity Measures Using Reachability Vectors

    Directory of Open Access Journals (Sweden)

    Seok-Ho Yoon

    2014-01-01

    Full Text Available We present a novel approach for computing link-based similarities among objects accurately by utilizing the link information pertaining to the objects involved. We discuss the problems with previous link-based similarity measures and propose a novel approach for computing link based similarities that does not suffer from these problems. In the proposed approach each target object is represented by a vector. Each element of the vector corresponds to all the objects in the given data, and the value of each element denotes the weight for the corresponding object. As for this weight value, we propose to utilize the probability of reaching from the target object to the specific object, computed using the “Random Walk with Restart” strategy. Then, we define the similarity between two objects as the cosine similarity of the two vectors. In this paper, we provide examples to show that our approach does not suffer from the aforementioned problems. We also evaluate the performance of the proposed methods in comparison with existing link-based measures, qualitatively and quantitatively, with respect to two kinds of data sets, scientific papers and Web documents. Our experimental results indicate that the proposed methods significantly outperform the existing measures.

  6. Notions of similarity for computational biology models

    KAUST Repository

    Waltemath, Dagmar

    2016-03-21

    Computational models used in biology are rapidly increasing in complexity, size, and numbers. To build such large models, researchers need to rely on software tools for model retrieval, model combination, and version control. These tools need to be able to quantify the differences and similarities between computational models. However, depending on the specific application, the notion of similarity may greatly vary. A general notion of model similarity, applicable to various types of models, is still missing. Here, we introduce a general notion of quantitative model similarities, survey the use of existing model comparison methods in model building and management, and discuss potential applications of model comparison. To frame model comparison as a general problem, we describe a theoretical approach to defining and computing similarities based on different model aspects. Potentially relevant aspects of a model comprise its references to biological entities, network structure, mathematical equations and parameters, and dynamic behaviour. Future similarity measures could combine these model aspects in flexible, problem-specific ways in order to mimic users\\' intuition about model similarity, and to support complex model searches in databases.

  7. Notions of similarity for computational biology models

    KAUST Repository

    Waltemath, Dagmar; Henkel, Ron; Hoehndorf, Robert; Kacprowski, Tim; Knuepfer, Christian; Liebermeister, Wolfram

    2016-01-01

    Computational models used in biology are rapidly increasing in complexity, size, and numbers. To build such large models, researchers need to rely on software tools for model retrieval, model combination, and version control. These tools need to be able to quantify the differences and similarities between computational models. However, depending on the specific application, the notion of similarity may greatly vary. A general notion of model similarity, applicable to various types of models, is still missing. Here, we introduce a general notion of quantitative model similarities, survey the use of existing model comparison methods in model building and management, and discuss potential applications of model comparison. To frame model comparison as a general problem, we describe a theoretical approach to defining and computing similarities based on different model aspects. Potentially relevant aspects of a model comprise its references to biological entities, network structure, mathematical equations and parameters, and dynamic behaviour. Future similarity measures could combine these model aspects in flexible, problem-specific ways in order to mimic users' intuition about model similarity, and to support complex model searches in databases.

  8. Trajectory similarity join in spatial networks

    KAUST Repository

    Shang, Shuo

    2017-09-07

    The matching of similar pairs of objects, called similarity join, is fundamental functionality in data management. We consider the case of trajectory similarity join (TS-Join), where the objects are trajectories of vehicles moving in road networks. Thus, given two sets of trajectories and a threshold θ, the TS-Join returns all pairs of trajectories from the two sets with similarity above θ. This join targets applications such as trajectory near-duplicate detection, data cleaning, ridesharing recommendation, and traffic congestion prediction. With these applications in mind, we provide a purposeful definition of similarity. To enable efficient TS-Join processing on large sets of trajectories, we develop search space pruning techniques and take into account the parallel processing capabilities of modern processors. Specifically, we present a two-phase divide-and-conquer algorithm. For each trajectory, the algorithm first finds similar trajectories. Then it merges the results to achieve a final result. The algorithm exploits an upper bound on the spatiotemporal similarity and a heuristic scheduling strategy for search space pruning. The algorithm\\'s per-trajectory searches are independent of each other and can be performed in parallel, and the merging has constant cost. An empirical study with real data offers insight in the performance of the algorithm and demonstrates that is capable of outperforming a well-designed baseline algorithm by an order of magnitude.

  9. Motivation or demotivation of health workers providing maternal health services in rural areas in Vietnam: findings from a mixed-methods study.

    Science.gov (United States)

    Thu, Nguyen Thi Hoai; Wilson, Andrew; McDonald, Fiona

    2015-12-02

    Motivation is an important driver for health professionals to maintain their professional competencies, continue in the workforce and make a positive contribution to their workplace. While there is some research about the motivation of health workers in low- to middle-income countries, maternal morbidity and mortality remains high and this can be lowered by improving the quality of maternal health services and the training and maintenance of the skills of maternal health workers. This study examines the impact of motivation on maintenance of professional competence among maternal health workers in Vietnam using mixed methods. The study consisted of a survey using a self-administered questionnaire of 240 health workers in five districts across two Vietnamese provinces and in-depth interviews with 43 health workers and health managers at the commune, district and provincial level to explore external factors that influenced motivation. The questionnaire includes a 23-item motivation instrument based on the Kenyan health context, modified for Vietnamese language and culture. The 240 responses represented an estimated 95% of the target sample. Multivariate analysis showed that three factors contributed to the motivation of health workers: access to training (β = -0.14, P = 0.03), ability to perform key tasks (β = 0.22, P = 0.001) and shift schedule (β = -0.13, P = 0.05). Motivation was higher in health workers self-identifying as competent or who were enabled to provide more maternal care services. Motivation was lower in those who worked more frequent night shifts and those who had received training in the last 12 months. The interviews identified that the latter was because they felt the training was irrelevant to them, and in some cases, they do not have the opportunity to practice their learnt skills. The qualitative data also showed other factors relating to service context and organisational management practices contributed to

  10. Revisiting Inter-Genre Similarity

    DEFF Research Database (Denmark)

    Sturm, Bob L.; Gouyon, Fabien

    2013-01-01

    We revisit the idea of ``inter-genre similarity'' (IGS) for machine learning in general, and music genre recognition in particular. We show analytically that the probability of error for IGS is higher than naive Bayes classification with zero-one loss (NB). We show empirically that IGS does...... not perform well, even for data that satisfies all its assumptions....

  11. Fast business process similarity search

    NARCIS (Netherlands)

    Yan, Z.; Dijkman, R.M.; Grefen, P.W.P.J.

    2012-01-01

    Nowadays, it is common for organizations to maintain collections of hundreds or even thousands of business processes. Techniques exist to search through such a collection, for business process models that are similar to a given query model. However, those techniques compare the query model to each

  12. Unveiling Music Structure Via PLSA Similarity Fusion

    DEFF Research Database (Denmark)

    Arenas-García, Jerónimo; Meng, Anders; Petersen, Kaare Brandt

    2007-01-01

    Nowadays there is an increasing interest in developing methods for building music recommendation systems. In order to get a satisfactory performance from such a system, one needs to incorporate as much information about songs similarity as possible; however, how to do so is not obvious. In this p......Nowadays there is an increasing interest in developing methods for building music recommendation systems. In order to get a satisfactory performance from such a system, one needs to incorporate as much information about songs similarity as possible; however, how to do so is not obvious...... observed similarities can be satisfactorily explained using the latent semantics. Additionally, this approach significantly simplifies the song retrieval phase, leading to a more practical system implementation. The suitability of the PLSA model for representing music structure is studied in a simplified...

  13. Similarity-based Polymorphic Shellcode Detection

    Directory of Open Access Journals (Sweden)

    Denis Yurievich Gamayunov

    2013-02-01

    Full Text Available In the work the method for polymorphic shellcode dedection based on the set of known shellcodes is proposed. The method’s main idea is in sequential applying of deobfuscating transformations to a data analyzed and then recognizing similarity with malware samples. The method has been tested on the sets of shellcodes generated using Metasploit Framework v.4.1.0 and PELock Obfuscator and shows 87 % precision with zero false positives rate.

  14. Clustering biomolecular complexes by residue contacts similarity

    NARCIS (Netherlands)

    Garcia Lopes Maia Rodrigues, João; Trellet, Mikaël; Schmitz, Christophe; Kastritis, Panagiotis; Karaca, Ezgi; Melquiond, Adrien S J; Bonvin, Alexandre M J J; Garcia Lopes Maia Rodrigues, João

    Inaccuracies in computational molecular modeling methods are often counterweighed by brute-force generation of a plethora of putative solutions. These are then typically sieved via structural clustering based on similarity measures such as the root mean square deviation (RMSD) of atomic positions.

  15. Music Retrieval based on Melodic Similarity

    NARCIS (Netherlands)

    Typke, R.

    2007-01-01

    This thesis introduces a method for measuring melodic similarity for notated music such as MIDI files. This music search algorithm views music as sets of notes that are represented as weighted points in the two-dimensional space of time and pitch. Two point sets can be compared by calculating how

  16. Appropriate Similarity Measures for Author Cocitation Analysis

    NARCIS (Netherlands)

    N.J.P. van Eck (Nees Jan); L. Waltman (Ludo)

    2007-01-01

    textabstractWe provide a number of new insights into the methodological discussion about author cocitation analysis. We first argue that the use of the Pearson correlation for measuring the similarity between authors’ cocitation profiles is not very satisfactory. We then discuss what kind of

  17. Risks, Benefits, and Importance of Collecting Sexual Orientation and Gender Identity Data in Healthcare Settings: A Multi-Method Analysis of Patient and Provider Perspectives.

    Science.gov (United States)

    Maragh-Bass, Allysha C; Torain, Maya; Adler, Rachel; Schneider, Eric; Ranjit, Anju; Kodadek, Lisa M; Shields, Ryan; German, Danielle; Snyder, Claire; Peterson, Susan; Schuur, Jeremiah; Lau, Brandyn; Haider, Adil H

    2017-04-01

    Research suggests that LGBT populations experience barriers to healthcare. Organizations such as the Institute of Medicine recommend routine documentation of sexual orientation (SO) and gender identity (GI) in healthcare, to reduce LGBT disparities. We explore patient views regarding the importance of SO/GI collection, and patient and provider views on risks and benefits of routine SO/GI collection in various settings. We surveyed LGBT/non-LGBT patients and providers on their views on SO/GI collection. Weighted data were analyzed with descriptive statistics; content analysis was conducted with open-ended responses. One-half of the 1516 patients and 60% of 429 providers were female; 64% of patients and 71% of providers were White. Eighty percent of providers felt that collecting SO data would offend patients, whereas only 11% of patients reported that they would be offended. Patients rated it as more important for primary care providers to know the SO of all patients compared with emergency department (ED) providers knowing the SO of all patients (41.3% vs. 31.6%; P discrimination risk most frequently (49.7%; N = 781), whereas provider comments cited patient discomfort/offense most frequently (54.5%; N = 433). Patients see the importance of SO/GI more in primary care than ED settings. However, many LGBT patients seek ED care due to factors including uninsurance; therefore, the ED may represent an initial point of contact for SO/GI collection. Therefore, patient-centered approaches to collecting SO/GI are needed. Patients and providers differed in perceived risks and benefits to routine SO/GI collection. Provider training in LGBT health may address patients' bias/discrimination concerns, and ultimately reduce LGBT health disparities.

  18. Learning semantic and visual similarity for endomicroscopy video retrieval.

    Science.gov (United States)

    Andre, Barbara; Vercauteren, Tom; Buchner, Anna M; Wallace, Michael B; Ayache, Nicholas

    2012-06-01

    Content-based image retrieval (CBIR) is a valuable computer vision technique which is increasingly being applied in the medical community for diagnosis support. However, traditional CBIR systems only deliver visual outputs, i.e., images having a similar appearance to the query, which is not directly interpretable by the physicians. Our objective is to provide a system for endomicroscopy video retrieval which delivers both visual and semantic outputs that are consistent with each other. In a previous study, we developed an adapted bag-of-visual-words method for endomicroscopy retrieval, called "Dense-Sift," that computes a visual signature for each video. In this paper, we present a novel approach to complement visual similarity learning with semantic knowledge extraction, in the field of in vivo endomicroscopy. We first leverage a semantic ground truth based on eight binary concepts, in order to transform these visual signatures into semantic signatures that reflect how much the presence of each semantic concept is expressed by the visual words describing the videos. Using cross-validation, we demonstrate that, in terms of semantic detection, our intuitive Fisher-based method transforming visual-word histograms into semantic estimations outperforms support vector machine (SVM) methods with statistical significance. In a second step, we propose to improve retrieval relevance by learning an adjusted similarity distance from a perceived similarity ground truth. As a result, our distance learning method allows to statistically improve the correlation with the perceived similarity. We also demonstrate that, in terms of perceived similarity, the recall performance of the semantic signatures is close to that of visual signatures and significantly better than those of several state-of-the-art CBIR methods. The semantic signatures are thus able to communicate high-level medical knowledge while being consistent with the low-level visual signatures and much shorter than them

  19. An Alfven eigenmode similarity experiment

    International Nuclear Information System (INIS)

    Heidbrink, W W; Fredrickson, E; Gorelenkov, N N; Hyatt, A W; Kramer, G; Luo, Y

    2003-01-01

    The major radius dependence of Alfven mode stability is studied by creating plasmas with similar minor radius, shape, magnetic field (0.5 T), density (n e ≅3x10 19 m -3 ), electron temperature (1.0 keV) and beam ion population (near-tangential 80 keV deuterium injection) on both NSTX and DIII-D. The major radius of NSTX is half the major radius of DIII-D. The super-Alfvenic beam ions that drive the modes have overlapping values of v f /v A in the two devices. Observed beam-driven instabilities include toroidicity-induced Alfven eigenmodes (TAE). The stability threshold for the TAE is similar in the two devices. As expected theoretically, the most unstable toroidal mode number n is larger in DIII-D

  20. Understanding similarity of groundwater systems with empirical copulas

    Science.gov (United States)

    Haaf, Ezra; Kumar, Rohini; Samaniego, Luis; Barthel, Roland

    2016-04-01

    Within the classification framework for groundwater systems that aims for identifying similarity of hydrogeological systems and transferring information from a well-observed to an ungauged system (Haaf and Barthel, 2015; Haaf and Barthel, 2016), we propose a copula-based method for describing groundwater-systems similarity. Copulas are an emerging method in hydrological sciences that make it possible to model the dependence structure of two groundwater level time series, independently of the effects of their marginal distributions. This study is based on Samaniego et al. (2010), which described an approach calculating dissimilarity measures from bivariate empirical copula densities of streamflow time series. Subsequently, streamflow is predicted in ungauged basins by transferring properties from similar catchments. The proposed approach is innovative because copula-based similarity has not yet been applied to groundwater systems. Here we estimate the pairwise dependence structure of 600 wells in Southern Germany using 10 years of weekly groundwater level observations. Based on these empirical copulas, dissimilarity measures are estimated, such as the copula's lower- and upper corner cumulated probability, copula-based Spearman's rank correlation - as proposed by Samaniego et al. (2010). For the characterization of groundwater systems, copula-based metrics are compared with dissimilarities obtained from precipitation signals corresponding to the presumed area of influence of each groundwater well. This promising approach provides a new tool for advancing similarity-based classification of groundwater system dynamics. Haaf, E., Barthel, R., 2015. Methods for assessing hydrogeological similarity and for classification of groundwater systems on the regional scale, EGU General Assembly 2015, Vienna, Austria. Haaf, E., Barthel, R., 2016. An approach for classification of hydrogeological systems at the regional scale based on groundwater hydrographs EGU General Assembly

  1. Compressional Alfven Eigenmode Similarity Study

    Science.gov (United States)

    Heidbrink, W. W.; Fredrickson, E. D.; Gorelenkov, N. N.; Rhodes, T. L.

    2004-11-01

    NSTX and DIII-D are nearly ideal for Alfven eigenmode (AE) similarity experiments, having similar neutral beams, fast-ion to Alfven speed v_f/v_A, fast-ion pressure, and shape of the plasma, but with a factor of 2 difference in the major radius. Toroidicity-induced AE with ˜100 kHz frequencies were compared in an earlier study [1]; this paper focuses on higher frequency AE with f ˜ 1 MHz. Compressional AE (CAE) on NSTX have a polarization, dependence on the fast-ion distribution function, frequency scaling, and low-frequency limit that are qualitatively consistent with CAE theory [2]. Global AE (GAE) are also observed. On DIII-D, coherent modes in this frequency range are observed during low-field (0.6 T) similarity experiments. Experiments will compare the CAE stability limits on DIII-D with the NSTX stability limits, with the aim of determining if CAE will be excited by alphas in a reactor. Predicted differences in the frequency splitting Δ f between excited modes will also be used. \\vspace0.25em [1] W.W. Heidbrink, et al., Plasmas Phys. Control. Fusion 45, 983 (2003). [2] E.D. Fredrickson, et al., Princeton Plasma Physics Laboratory Report PPPL-3955 (2004).

  2. [Similarity system theory to evaluate similarity of chromatographic fingerprints of traditional Chinese medicine].

    Science.gov (United States)

    Liu, Yongsuo; Meng, Qinghua; Jiang, Shumin; Hu, Yuzhu

    2005-03-01

    The similarity evaluation of the fingerprints is one of the most important problems in the quality control of the traditional Chinese medicine (TCM). Similarity measures used to evaluate the similarity of the common peaks in the chromatogram of TCM have been discussed. Comparative studies were carried out among correlation coefficient, cosine of the angle and an improved extent similarity method using simulated data and experimental data. Correlation coefficient and cosine of the angle are not sensitive to the differences of the data set. They are still not sensitive to the differences of the data even after normalization. According to the similarity system theory, an improved extent similarity method was proposed. The improved extent similarity is more sensitive to the differences of the data sets than correlation coefficient and cosine of the angle. And the character of the data sets needs not to be changed compared with log-transformation. The improved extent similarity can be used to evaluate the similarity of the chromatographic fingerprints of TCM.

  3. Parallel trajectory similarity joins in spatial networks

    KAUST Repository

    Shang, Shuo

    2018-04-04

    The matching of similar pairs of objects, called similarity join, is fundamental functionality in data management. We consider two cases of trajectory similarity joins (TS-Joins), including a threshold-based join (Tb-TS-Join) and a top-k TS-Join (k-TS-Join), where the objects are trajectories of vehicles moving in road networks. Given two sets of trajectories and a threshold θ, the Tb-TS-Join returns all pairs of trajectories from the two sets with similarity above θ. In contrast, the k-TS-Join does not take a threshold as a parameter, and it returns the top-k most similar trajectory pairs from the two sets. The TS-Joins target diverse applications such as trajectory near-duplicate detection, data cleaning, ridesharing recommendation, and traffic congestion prediction. With these applications in mind, we provide purposeful definitions of similarity. To enable efficient processing of the TS-Joins on large sets of trajectories, we develop search space pruning techniques and enable use of the parallel processing capabilities of modern processors. Specifically, we present a two-phase divide-and-conquer search framework that lays the foundation for the algorithms for the Tb-TS-Join and the k-TS-Join that rely on different pruning techniques to achieve efficiency. For each trajectory, the algorithms first find similar trajectories. Then they merge the results to obtain the final result. The algorithms for the two joins exploit different upper and lower bounds on the spatiotemporal trajectory similarity and different heuristic scheduling strategies for search space pruning. Their per-trajectory searches are independent of each other and can be performed in parallel, and the mergings have constant cost. An empirical study with real data offers insight in the performance of the algorithms and demonstrates that they are capable of outperforming well-designed baseline algorithms by an order of magnitude.

  4. Parallel trajectory similarity joins in spatial networks

    KAUST Repository

    Shang, Shuo; Chen, Lisi; Wei, Zhewei; Jensen, Christian S.; Zheng, Kai; Kalnis, Panos

    2018-01-01

    The matching of similar pairs of objects, called similarity join, is fundamental functionality in data management. We consider two cases of trajectory similarity joins (TS-Joins), including a threshold-based join (Tb-TS-Join) and a top-k TS-Join (k-TS-Join), where the objects are trajectories of vehicles moving in road networks. Given two sets of trajectories and a threshold θ, the Tb-TS-Join returns all pairs of trajectories from the two sets with similarity above θ. In contrast, the k-TS-Join does not take a threshold as a parameter, and it returns the top-k most similar trajectory pairs from the two sets. The TS-Joins target diverse applications such as trajectory near-duplicate detection, data cleaning, ridesharing recommendation, and traffic congestion prediction. With these applications in mind, we provide purposeful definitions of similarity. To enable efficient processing of the TS-Joins on large sets of trajectories, we develop search space pruning techniques and enable use of the parallel processing capabilities of modern processors. Specifically, we present a two-phase divide-and-conquer search framework that lays the foundation for the algorithms for the Tb-TS-Join and the k-TS-Join that rely on different pruning techniques to achieve efficiency. For each trajectory, the algorithms first find similar trajectories. Then they merge the results to obtain the final result. The algorithms for the two joins exploit different upper and lower bounds on the spatiotemporal trajectory similarity and different heuristic scheduling strategies for search space pruning. Their per-trajectory searches are independent of each other and can be performed in parallel, and the mergings have constant cost. An empirical study with real data offers insight in the performance of the algorithms and demonstrates that they are capable of outperforming well-designed baseline algorithms by an order of magnitude.

  5. Can intubation harm the brain in critical care situations? A new simple technique may provide a method for controlling brain temperature

    DEFF Research Database (Denmark)

    Einer-Jensen, N.; Baptiste, K.E.; Madsen, F.

    2002-01-01

    Many animal species are able to keep the brain temperature some degrees centigrade lower than the deep body temperature when exposed to environmental heat stress. The lower temperature is based on cooling of the nasal venous blood through the respiratory airflow and local counter-current transfer...... of heat between venous and arterial blood in the cavernous sinus-carotid artery complex. Anaesthetized, intubated animals do not have any air flow through the nasal cavities. However, when the nasal cavities were flushed with oxygen, the deep brain temperature dropped within minutes and returned...... to previous values when the oxygen flushing was stopped. Cooling was found in animals with a rete a similar cooling mechanism is present in man (no rete) under mirabile (pigs), and in animals without a rete (rats). intensive care, a simple flushing of the nasal cavities with gas will protect the brain against...

  6. Methods, Devices and Computer Program Products Providing for Establishing a Model for Emulating a Physical Quantity Which Depends on at Least One Input Parameter, and Use Thereof

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention proposes methods, devices and computer program products. To this extent, there is defined a set X including N distinct parameter values x_i for at least one input parameter x, N being an integer greater than or equal to 1, first measured the physical quantity Pm1 for each...

  7. Refinements of the attending equations for several spectral methods that provide improved quantification of B-carotene and/or lycopene in selected foods

    Science.gov (United States)

    Developing and maintaining maximal levels of carotenoids in fruits and vegetables that contain them is a concern of the produce industry. Toward this end, reliable methods for quantifying lycopene and B-carotene, two of the major health-enhancing carotenoids, are necessary. The goal of this resear...

  8. Method for applying a thin film barrier stack to a device with microstructures, and device provided with such a thin film barrier stack

    NARCIS (Netherlands)

    2005-01-01

    A method for applying a thin film barrier stack to a device with microstructures, such as, for instance, an OLED, wherein the thin film barrier stack forms a barrier to at least moisture and oxygen, wherein the stack is built up from a combination of org. and inorg. layers, characterized in that a

  9. Poly-1,2-azepine, method of producing a film of such a polymer on a substrate and a substrate provided with such a polymer

    NARCIS (Netherlands)

    1990-01-01

    Gas-phase photopolymerisation of phenylazides results in a new type of polymer, a poly-1,2-azepine. This polymer can be provided on a substrate according to a predetermined pattern by exposing it via a mask. After oxidation an electrically conductive polymer is obtained.

  10. Trajectory similarity join in spatial networks

    KAUST Repository

    Shang, Shuo; Chen, Lisi; Wei, Zhewei; Jensen, Christian S.; Zheng, Kai; Kalnis, Panos

    2017-01-01

    With these applications in mind, we provide a purposeful definition of similarity. To enable efficient TS-Join processing on large sets of trajectories, we develop search space pruning techniques and take into account the parallel processing capabilities of modern processors. Specifically, we present a two-phase divide-and-conquer algorithm. For each trajectory, the algorithm first finds similar trajectories. Then it merges the results to achieve a final result. The algorithm exploits an upper bound on the spatiotemporal similarity and a heuristic scheduling strategy for search space pruning. The algorithm's per-trajectory searches are independent of each other and can be performed in parallel, and the merging has constant cost. An empirical study with real data offers insight in the performance of the algorithm and demonstrates that is capable of outperforming a well-designed baseline algorithm by an order of magnitude.

  11. Phonological similarity in working memory span tasks.

    Science.gov (United States)

    Chow, Michael; Macnamara, Brooke N; Conway, Andrew R A

    2016-08-01

    In a series of four experiments, we explored what conditions are sufficient to produce a phonological similarity facilitation effect in working memory span tasks. By using the same set of memoranda, but differing the secondary-task requirements across experiments, we showed that a phonological similarity facilitation effect is dependent upon the semantic relationship between the memoranda and the secondary-task stimuli, and is robust to changes in the representation, ordering, and pool size of the secondary-task stimuli. These findings are consistent with interference accounts of memory (Brown, Neath, & Chater, Psychological Review, 114, 539-576, 2007; Oberauer, Lewandowsky, Farrell, Jarrold, & Greaves, Psychonomic Bulletin & Review, 19, 779-819, 2012), whereby rhyming stimuli provide a form of categorical similarity that allows distractors to be excluded from retrieval at recall.

  12. Introduction of Mercury-free Gold Extraction Methods to Medium-Scale Miners and Education of Health Care Providers to Reduce the use of Mercury in Sorata, Bolivia

    Directory of Open Access Journals (Sweden)

    Peter W. U. Appel

    2015-01-01

    Conclusions. The gold ores tested during the project proved amenable to mercury-free gold extraction using borax smelting. The miners also realized that gold recovery increased when performing mercury-free gold extraction. The miners decided to stop using mercury and a follow-up project cleaned their mining equipment for mercury and modified the processing lines. The health care providers were also successfully trained.

  13. Reconciling patient and provider priorities for improving the care of critically ill patients: A consensus method and qualitative analysis of decision making.

    Science.gov (United States)

    McKenzie, Emily; Potestio, Melissa L; Boyd, Jamie M; Niven, Daniel J; Brundin-Mather, Rebecca; Bagshaw, Sean M; Stelfox, Henry T

    2017-12-01

    Providers have traditionally established priorities for quality improvement; however, patients and their family members have recently become involved in priority setting. Little is known about how to reconcile priorities of different stakeholder groups into a single prioritized list that is actionable for organizations. To describe the decision-making process for establishing consensus used by a diverse panel of stakeholders to reconcile two sets of quality improvement priorities (provider/decision maker priorities n=9; patient/family priorities n=19) into a single prioritized list. We employed a modified Delphi process with a diverse group of panellists to reconcile priorities for improving care of critically ill patients in the intensive care unit (ICU). Proceedings were audio-recorded, transcribed and analysed using qualitative content analysis to explore the decision-making process for establishing consensus. Nine panellists including three providers, three decision makers and three family members of previously critically ill patients. Panellists rated and revised 28 priorities over three rounds of review and reached consensus on the "Top 5" priorities for quality improvement: transition of patient care from ICU to hospital ward; family presence and effective communication; delirium screening and management; early mobilization; and transition of patient care between ICU providers. Four themes were identified as important for establishing consensus: storytelling (sharing personal experiences), amalgamating priorities (negotiating priority scope), considering evaluation criteria and having a priority champion. Our study demonstrates the feasibility of incorporating families of patients into a multistakeholder prioritization exercise. The approach described can be used to guide consensus building and reconcile priorities of diverse stakeholder groups. © 2017 The Authors Health Expectations Published by John Wiley & Sons Ltd.

  14. Perspectives on financial incentives to health service providers for increasing breast feeding and smoking quit rates during pregnancy: a mixed methods study.

    Science.gov (United States)

    Hoddinott, Pat; Thomson, Gill; Morgan, Heather; Crossland, Nicola; MacLennan, Graeme; Dykes, Fiona; Stewart, Fiona; Bauld, Linda; Campbell, Marion K

    2015-11-13

    To explore the acceptability, mechanisms and consequences of provider incentives for smoking cessation and breast feeding as part of the Benefits of Incentives for Breastfeeding and Smoking cessation in pregnancy (BIBS) study. Cross-sectional survey and qualitative interviews. Scotland and North West England. Early years professionals: 497 survey respondents included 156 doctors; 197 health visitors/maternity staff; 144 other health staff. Qualitative interviews or focus groups were conducted with 68 pregnant/postnatal women/family members; 32 service providers; 22 experts/decision-makers; 63 conference attendees. Early years professionals were surveyed via email about the acceptability of payments to local health services for reaching smoking cessation in pregnancy and breastfeeding targets. Agreement was measured on a 5-point scale using multivariable ordered logit models. A framework approach was used to analyse free-text survey responses and qualitative data. Health professional net agreement for provider incentives for smoking cessation targets was 52.9% (263/497); net disagreement was 28.6% (142/497). Health visitors/maternity staff were more likely than doctors to agree: OR 2.35 (95% CI 1.51 to 3.64; pgaming, box-ticking bureaucracies and health inequalities were counterbalances to potential benefits. Provider incentives are favoured by non-medical staff. Solutions which increase trust and collaboration towards shared goals, without negatively impacting on relationships or increasing bureaucracy are required. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  15. The use of microbead-based spoligotyping for Mycobacterium tuberculosis complex to evaluate the quality of the conventional method: Providing guidelines for Quality Assurance when working on membranes

    Directory of Open Access Journals (Sweden)

    Garzelli Carlo

    2011-04-01

    Full Text Available Abstract Background The classical spoligotyping technique, relying on membrane reverse line-blot hybridization of the spacers of the Mycobacterium tuberculosis CRISPR locus, is used world-wide (598 references in Pubmed on April 8th, 2011. However, until now no inter-laboratory quality control study had been undertaken to validate this technique. We analyzed the quality of membrane-based spoligotyping by comparing it to the recently introduced and highly robust microbead-based spoligotyping. Nine hundred and twenty-seven isolates were analyzed totaling 39,861 data points. Samples were received from 11 international laboratories with a worldwide distribution. Methods The high-throughput microbead-based Spoligotyping was performed on CTAB and thermolyzate DNA extracted from isolated Mycobacterium tuberculosis complex (MTC strains coming from the genotyping participating centers. Information regarding how the classical Spoligotyping method was performed by center was available. Genotype discriminatory analyses were carried out by comparing the spoligotypes obtained by both methods. The non parametric U-Mann Whitney homogeneity test and the Spearman rank correlation test were performed to validate the observed results. Results Seven out of the 11 laboratories (63 %, perfectly typed more than 90% of isolates, 3 scored between 80-90% and a single center was under 80% reaching 51% concordance only. However, this was mainly due to discordance in a single spacer, likely having a non-functional probe on the membrane used. The centers using thermolyzate DNA performed as well as centers using the more extended CTAB extraction procedure. Few centers shared the same problematic spacers and these problematic spacers were scattered over the whole CRISPR locus (Mostly spacers 15, 14, 18, 37, 39, 40. Conclusions We confirm that classical spoligotyping is a robust method with generally a high reliability in most centers. The applied DNA extraction procedure (CTAB

  16. Semantic similarity between ontologies at different scales

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Qingpeng; Haglin, David J.

    2016-04-01

    In the past decade, existing and new knowledge and datasets has been encoded in different ontologies for semantic web and biomedical research. The size of ontologies is often very large in terms of number of concepts and relationships, which makes the analysis of ontologies and the represented knowledge graph computational and time consuming. As the ontologies of various semantic web and biomedical applications usually show explicit hierarchical structures, it is interesting to explore the trade-offs between ontological scales and preservation/precision of results when we analyze ontologies. This paper presents the first effort of examining the capability of this idea via studying the relationship between scaling biomedical ontologies at different levels and the semantic similarity values. We evaluate the semantic similarity between three Gene Ontology slims (Plant, Yeast, and Candida, among which the latter two belong to the same kingdom—Fungi) using four popular measures commonly applied to biomedical ontologies (Resnik, Lin, Jiang-Conrath, and SimRel). The results of this study demonstrate that with proper selection of scaling levels and similarity measures, we can significantly reduce the size of ontologies without losing substantial detail. In particular, the performance of Jiang-Conrath and Lin are more reliable and stable than that of the other two in this experiment, as proven by (a) consistently showing that Yeast and Candida are more similar (as compared to Plant) at different scales, and (b) small deviations of the similarity values after excluding a majority of nodes from several lower scales. This study provides a deeper understanding of the application of semantic similarity to biomedical ontologies, and shed light on how to choose appropriate semantic similarity measures for biomedical engineering.

  17. Providing Compassion through Flow

    Directory of Open Access Journals (Sweden)

    Lydia Royeen

    2015-07-01

    Full Text Available Meg Kral, MS, OTR/L, CLT, is the cover artist for the Summer 2015 issue of The Open Journal of Occupational Therapy. Her untitled piece of art is an oil painting and is a re-creation of a photograph taken while on vacation. Meg is currently supervisor of outpatient services at Rush University Medical Center. She is lymphedema certified and has a specific interest in breast cancer lymphedema. Art and occupational therapy serve similar purposes for Meg: both provide a sense of flow. She values the outcomes, whether it is a piece of art or improved functional status

  18. Similarity solutions for phase-change problems

    Science.gov (United States)

    Canright, D.; Davis, S. H.

    1989-01-01

    A modification of Ivantsov's (1947) similarity solutions is proposed which can describe phase-change processes which are limited by diffusion. The method has application to systems that have n-components and possess cross-diffusion and Soret and Dufour effects, along with convection driven by density discontinuities at the two-phase interface. Local thermal equilibrium is assumed at the interface. It is shown that analytic solutions are possible when the material properties are constant.

  19. Diffeomorphic Anatomical Registration Through Exponentiated Lie Algebra provides reduced effect of scanner for cortex volumetry with atlas-based method in healthy subjects.

    Science.gov (United States)

    Goto, Masami; Abe, Osamu; Aoki, Shigeki; Hayashi, Naoto; Miyati, Tosiaki; Takao, Hidemasa; Iwatsubo, Takeshi; Yamashita, Fumio; Matsuda, Hiroshi; Mori, Harushi; Kunimatsu, Akira; Ino, Kenji; Yano, Keiichi; Ohtomo, Kuni

    2013-07-01

    This study aimed to investigate whether the effect of scanner for cortex volumetry with atlas-based method is reduced using Diffeomorphic Anatomical Registration Through Exponentiated Lie Algebra (DARTEL) normalization compared with standard normalization. Three-dimensional T1-weighted magnetic resonance images (3D-T1WIs) of 21 healthy subjects were obtained and evaluated for effect of scanner in cortex volumetry. 3D-T1WIs of the 21 subjects were obtained with five MRI systems. Imaging of each subject was performed on each of five different MRI scanners. We used the Voxel-Based Morphometry 8 tool implemented in Statistical Parametric Mapping 8 and WFU PickAtlas software (Talairach brain atlas theory). The following software default settings were used as bilateral region-of-interest labels: "Frontal Lobe," "Hippocampus," "Occipital Lobe," "Orbital Gyrus," "Parietal Lobe," "Putamen," and "Temporal Lobe." Effect of scanner for cortex volumetry using the atlas-based method was reduced with DARTEL normalization compared with standard normalization in Frontal Lobe, Occipital Lobe, Orbital Gyrus, Putamen, and Temporal Lobe; was the same in Hippocampus and Parietal Lobe; and showed no increase with DARTEL normalization for any region of interest (ROI). DARTEL normalization reduces the effect of scanner, which is a major problem in multicenter studies.

  20. Diffeomorphic Anatomical Registration Through Exponentiated Lie Algebra provides reduced effect of scanner for cortex volumetry with atlas-based method in healthy subjects

    Energy Technology Data Exchange (ETDEWEB)

    Goto, Masami; Ino, Kenji; Yano, Keiichi [University of Tokyo Hospital, Department of Radiological Technology, Bunkyo-ku, Tokyo (Japan); Abe, Osamu [Nihon University School of Medicine, Department of Radiology, Itabashi-ku, Tokyo (Japan); Aoki, Shigeki [Juntendo University, Department of Radiology, Bunkyo-ku, Tokyo (Japan); Hayashi, Naoto [University of Tokyo Hospital, Department of Computational Diagnostic Radiology and Preventive Medicine, Bunkyo-ku, Tokyo (Japan); Miyati, Tosiaki [Kanazawa University, Graduate School of Medical Science, Kanazawa (Japan); Takao, Hidemasa; Mori, Harushi; Kunimatsu, Akira; Ohtomo, Kuni [University of Tokyo Hospital, Department of Radiology and Department of Computational Diagnostic Radiology and Preventive Medicine, Bunkyo-ku, Tokyo (Japan); Iwatsubo, Takeshi [University of Tokyo, Department of Neuropathology, Bunkyo-ku, Tokyo (Japan); Yamashita, Fumio [Iwate Medical University, Department of Radiology, Yahaba, Iwate (Japan); Matsuda, Hiroshi [Integrative Brain Imaging Center National Center of Neurology and Psychiatry, Department of Nuclear Medicine, Kodaira, Tokyo (Japan); Collaboration: Japanese Alzheimer' s Disease Neuroimaging Initiative

    2013-07-15

    This study aimed to investigate whether the effect of scanner for cortex volumetry with atlas-based method is reduced using Diffeomorphic Anatomical Registration Through Exponentiated Lie Algebra (DARTEL) normalization compared with standard normalization. Three-dimensional T1-weighted magnetic resonance images (3D-T1WIs) of 21 healthy subjects were obtained and evaluated for effect of scanner in cortex volumetry. 3D-T1WIs of the 21 subjects were obtained with five MRI systems. Imaging of each subject was performed on each of five different MRI scanners. We used the Voxel-Based Morphometry 8 tool implemented in Statistical Parametric Mapping 8 and WFU PickAtlas software (Talairach brain atlas theory). The following software default settings were used as bilateral region-of-interest labels: ''Frontal Lobe,'' ''Hippocampus,'' ''Occipital Lobe,'' ''Orbital Gyrus,'' ''Parietal Lobe,'' ''Putamen,'' and ''Temporal Lobe.'' Effect of scanner for cortex volumetry using the atlas-based method was reduced with DARTEL normalization compared with standard normalization in Frontal Lobe, Occipital Lobe, Orbital Gyrus, Putamen, and Temporal Lobe; was the same in Hippocampus and Parietal Lobe; and showed no increase with DARTEL normalization for any region of interest (ROI). DARTEL normalization reduces the effect of scanner, which is a major problem in multicenter studies. (orig.)

  1. Diffeomorphic Anatomical Registration Through Exponentiated Lie Algebra provides reduced effect of scanner for cortex volumetry with atlas-based method in healthy subjects

    International Nuclear Information System (INIS)

    Goto, Masami; Ino, Kenji; Yano, Keiichi; Abe, Osamu; Aoki, Shigeki; Hayashi, Naoto; Miyati, Tosiaki; Takao, Hidemasa; Mori, Harushi; Kunimatsu, Akira; Ohtomo, Kuni; Iwatsubo, Takeshi; Yamashita, Fumio; Matsuda, Hiroshi

    2013-01-01

    This study aimed to investigate whether the effect of scanner for cortex volumetry with atlas-based method is reduced using Diffeomorphic Anatomical Registration Through Exponentiated Lie Algebra (DARTEL) normalization compared with standard normalization. Three-dimensional T1-weighted magnetic resonance images (3D-T1WIs) of 21 healthy subjects were obtained and evaluated for effect of scanner in cortex volumetry. 3D-T1WIs of the 21 subjects were obtained with five MRI systems. Imaging of each subject was performed on each of five different MRI scanners. We used the Voxel-Based Morphometry 8 tool implemented in Statistical Parametric Mapping 8 and WFU PickAtlas software (Talairach brain atlas theory). The following software default settings were used as bilateral region-of-interest labels: ''Frontal Lobe,'' ''Hippocampus,'' ''Occipital Lobe,'' ''Orbital Gyrus,'' ''Parietal Lobe,'' ''Putamen,'' and ''Temporal Lobe.'' Effect of scanner for cortex volumetry using the atlas-based method was reduced with DARTEL normalization compared with standard normalization in Frontal Lobe, Occipital Lobe, Orbital Gyrus, Putamen, and Temporal Lobe; was the same in Hippocampus and Parietal Lobe; and showed no increase with DARTEL normalization for any region of interest (ROI). DARTEL normalization reduces the effect of scanner, which is a major problem in multicenter studies. (orig.)

  2. A new approach combining different MRI methods to provide detailed view on swelling dynamics of xanthan tablets influencing drug release at different pH and ionic strength.

    Science.gov (United States)

    Mikac, Ursa; Sepe, Ana; Kristl, Julijana; Baumgartner, Sasa

    2010-08-03

    The key element in drug release from hydrophilic matrix tablets is the gel layer that regulates the penetration of water and controls drug dissolution and diffusion. We have selected magnetic resonance imaging (MRI) as the method of choice for visualizing the dynamic processes occurring during the swelling of xanthan tablets in a variety of media. The aims were (i) to develop a new method using MRI for accurate determination of penetration, swelling and erosion fronts, (ii) to investigate the effects of pH and ionic strength on swelling, and (iii) to study the influence of structural changes in xanthan gel on drug release. Two dimensional (2D) MRI and one dimensional single point imaging (SPI) of swollen xanthan tablets were recorded, together with T(2) mapping. The border between dry and hydrated glassy xanthan-the penetration front-was determined from 1D SPI signal intensity profiles. The erosion front was obtained from signal intensity profiles of 2D MR images. The swelling front, where xanthan is transformed from a glassy to a rubbery state (gel formation), was determined from T(2) profiles. Further, the new combination of MRI methods for swelling front determination enables to explain the appearance of the unusual "bright front" observed on 2D MR images in tablets swollen in HCl pH 1.2 media, which represents the position of swelling front. All six media studied, differing in pH and ionic strength, penetrate through the whole tablet in 4h+/-0.3h, but formation of the gel layer is significantly delayed. Unexpectedly, the position of the swelling front was the same, independently of the different xanthan gel structures formed under different conditions of pH and ionic strength. The position of the erosion front, on the other hand, is strongly dependent on pH and ionic strength, as reflected in different thicknesses of the gel layers. The latter are seen to be the consequence of the different hydrodynamic radii of the xanthan molecules, which affect the drug

  3. Semimanufacture intended to be mounted on a vibrating wall or a vibrating panel for actively damping vibrations of the wall, wall or panel provided with such semimanufacture, system provided with a semimanufacture and a control unit, wall or panel provided with a control unit and method for damping audible vibrations of a wall or panel

    NARCIS (Netherlands)

    de Goeje, Marius; van Overbeek, Michiel Wilbert R.M.; van der Waal, Adri; Berkhoff, Arthur P.; Nederveen, Peter J.

    2005-01-01

    A semimanufacture intended to be mounted on a vibrating wall or a vibrating panel for actively damping the vibrations in the wall or the panel with frequencies which are at least partly audible, wherein the semimanufacture is provided with a plate wherein the plate is integrated with: at least one

  4. Alaska, Gulf spills share similarities

    International Nuclear Information System (INIS)

    Usher, D.

    1991-01-01

    The accidental Exxon Valdez oil spill in Alaska and the deliberate dumping of crude oil into the Persian Gulf as a tactic of war contain both glaring differences and surprising similarities. Public reaction and public response was much greater to the Exxon Valdez spill in pristine Prince William Sound than to the war-related tragedy in the Persian Gulf. More than 12,000 workers helped in the Alaskan cleanup; only 350 have been involved in Kuwait. But in both instances, environmental damages appear to be less than anticipated. Natures highly effective self-cleansing action is primarily responsible for minimizing the damages. One positive action growing out of the two incidents is increased international cooperation and participation in oil-spill clean-up efforts. In 1990, in the aftermath of the Exxon Valdez spill, 94 nations signed an international accord on cooperation in future spills. The spills can be historic environmental landmarks leading to creation of more sophisticated response systems worldwide

  5. Does a patient-managed insulin intensification strategy with insulin glargine and insulin glulisine provide similar glycemic control as a physician-managed strategy? Results of the START (Self-Titration With Apidra to Reach Target) Study: a randomized noninferiority trial.

    Science.gov (United States)

    Harris, Stewart B; Yale, Jean-François; Berard, Lori; Stewart, John; Abbaszadeh, Babak; Webster-Bogaert, Susan; Gerstein, Hertzel C

    2014-01-01

    OBJECTIVE Diabetes self-management is universally regarded as a foundation of diabetes care. We determined whether comparable glycemic control could be achieved by self-titration versus physician titration of a once-daily bolus insulin dose in patients with type 2 diabetes who are unable to achieve optimal glycemia control with a basal insulin. RESEARCH DESIGN AND METHODS Patients with type 2 diabetes, an HbA1c level >7% (53 mmol/mol), and either nocturnal hypoglycemia episodes or an insufficient basal insulin glargine level (with or without oral agents) to achieve a fasting plasma glucose level ≤6 mmol/L (108 mg/dL) were studied. Participants all had bolus insulin glulisine added at breakfast and were allocated to either algorithm-guided patient self-titration or physician titration. The primary outcome was an HbA1c level ≤7% (53 mmol/mol) without severe hypoglycemia. RESULTS After a mean (SD) follow-up of 159.4 days (36.2 days), 28.4% of participants in the self-titration arm vs. 21.2% in the physician titration arm achieved an HbA1c level of ≤7% (53 mmol/mol) without severe hypoglycemia (between-group absolute difference 7.2%; 95% CI -3.2 to 17.7). The lower end of this 95% confidence interval was within the predetermined noninferiority boundary of -5% (P noninferiority = 0.011). CONCLUSIONS In stable patients with type 2 diabetes who are receiving doses of basal insulin glargine who require bolus insulin, a simple bolus insulin patient-managed titration algorithm is as effective as a physician-managed algorithm.

  6. A new measure for functional similarity of gene products based on Gene Ontology

    Directory of Open Access Journals (Sweden)

    Lengauer Thomas

    2006-06-01

    Full Text Available Abstract Background Gene Ontology (GO is a standard vocabulary of functional terms and allows for coherent annotation of gene products. These annotations provide a basis for new methods that compare gene products regarding their molecular function and biological role. Results We present a new method for comparing sets of GO terms and for assessing the functional similarity of gene products. The method relies on two semantic similarity measures; simRel and funSim. One measure (simRel is applied in the comparison of the biological processes found in different groups of organisms. The other measure (funSim is used to find functionally related gene products within the same or between different genomes. Results indicate that the method, in addition to being in good agreement with established sequence similarity approaches, also provides a means for the identification of functionally related proteins independent of evolutionary relationships. The method is also applied to estimating functional similarity between all proteins in Saccharomyces cerevisiae and to visualizing the molecular function space of yeast in a map of the functional space. A similar approach is used to visualize the functional relationships between protein families. Conclusion The approach enables the comparison of the underlying molecular biology of different taxonomic groups and provides a new comparative genomics tool identifying functionally related gene products independent of homology. The proposed map of the functional space provides a new global view on the functional relationships between gene products or protein families.

  7. The barriers to and enablers of providing reasonably adjusted health services to people with intellectual disabilities in acute hospitals: evidence from a mixed-methods study.

    Science.gov (United States)

    Tuffrey-Wijne, Irene; Goulding, Lucy; Giatras, Nikoletta; Abraham, Elisabeth; Gillard, Steve; White, Sarah; Edwards, Christine; Hollins, Sheila

    2014-04-16

    To identify the factors that promote and compromise the implementation of reasonably adjusted healthcare services for patients with intellectual disabilities in acute National Health Service (NHS) hospitals. A mixed-methods study involving interviews, questionnaires and participant observation (July 2011-March 2013). Six acute NHS hospital trusts in England. Reasonable adjustments for people with intellectual disabilities were identified through the literature. Data were collected on implementation and staff understanding of these adjustments. Data collected included staff questionnaires (n=990), staff interviews (n=68), interviews with adults with intellectual disabilities (n=33), questionnaires (n=88) and interviews (n=37) with carers of patients with intellectual disabilities, and expert panel discussions (n=42). Hospital strategies that supported implementation of reasonable adjustments did not reliably translate into consistent provision of such adjustments. Good practice often depended on the knowledge, understanding and flexibility of individual staff and teams, leading to the delivery of reasonable adjustments being haphazard throughout the organisation. Major barriers included: lack of effective systems for identifying and flagging patients with intellectual disabilities, lack of staff understanding of the reasonable adjustments that may be needed, lack of clear lines of responsibility and accountability for implementing reasonable adjustments, and lack of allocation of additional funding and resources. Key enablers were the Intellectual Disability Liaison Nurse and the ward manager. The evidence suggests that ward culture, staff attitudes and staff knowledge are crucial in ensuring that hospital services are accessible to vulnerable patients. The authors suggest that flagging the need for specific reasonable adjustments, rather than the vulnerable condition itself, may address some of the barriers. Further research is recommended that describes and

  8. Similarity principles for equipment qualification by experience

    International Nuclear Information System (INIS)

    Kana, D.D.; Pomerening, D.J.

    1988-07-01

    A methodology is developed for seismic qualification of nuclear plant equipment by applying similarity principles to existing experience data. Experience data are available from previous qualifications by analysis or testing, or from actual earthquake events. Similarity principles are defined in terms of excitation, equipment physical characteristics, and equipment response. Physical similarity is further defined in terms of a critical transfer function for response at a location on a primary structure, whose response can be assumed directly related to ultimate fragility of the item under elevated levels of excitation. Procedures are developed for combining experience data into composite specifications for qualification of equipment that can be shown to be physically similar to the reference equipment. Other procedures are developed for extending qualifications beyond the original specifications under certain conditions. Some examples for application of the procedures and verification of them are given for certain cases that can be approximated by a two degree of freedom simple primary/secondary system. Other examples are based on use of actual test data available from previous qualifications. Relationships of the developments with other previously-published methods are discussed. The developments are intended to elaborate on the rather broad revised guidelines developed by the IEEE 344 Standards Committee for equipment qualification in new nuclear plants. However, the results also contribute to filling a gap that exists between the IEEE 344 methodology and that previously developed by the Seismic Qualification Utilities Group. The relationship of the results to safety margin methodology is also discussed. (author)

  9. Evaluating gender similarities and differences using metasynthesis.

    Science.gov (United States)

    Zell, Ethan; Krizan, Zlatan; Teeter, Sabrina R

    2015-01-01

    Despite the common lay assumption that males and females are profoundly different, Hyde (2005) used data from 46 meta-analyses to demonstrate that males and females are highly similar. Nonetheless, the gender similarities hypothesis has remained controversial. Since Hyde's provocative report, there has been an explosion of meta-analytic interest in psychological gender differences. We utilized this enormous collection of 106 meta-analyses and 386 individual meta-analytic effects to reevaluate the gender similarities hypothesis. Furthermore, we employed a novel data-analytic approach called metasynthesis (Zell & Krizan, 2014) to estimate the average difference between males and females and to explore moderators of gender differences. The average, absolute difference between males and females across domains was relatively small (d = 0.21, SD = 0.14), with the majority of effects being either small (46%) or very small (39%). Magnitude of differences fluctuated somewhat as a function of the psychological domain (e.g., cognitive variables, social and personality variables, well-being), but remained largely constant across age, culture, and generations. These findings provide compelling support for the gender similarities hypothesis, but also underscore conditions under which gender differences are most pronounced. PsycINFO Database Record (c) 2015 APA, all rights reserved.

  10. A shortest-path graph kernel for estimating gene product semantic similarity

    Directory of Open Access Journals (Sweden)

    Alvarez Marco A

    2011-07-01

    Full Text Available Abstract Background Existing methods for calculating semantic similarity between gene products using the Gene Ontology (GO often rely on external resources, which are not part of the ontology. Consequently, changes in these external resources like biased term distribution caused by shifting of hot research topics, will affect the calculation of semantic similarity. One way to avoid this problem is to use semantic methods that are "intrinsic" to the ontology, i.e. independent of external knowledge. Results We present a shortest-path graph kernel (spgk method that relies exclusively on the GO and its structure. In spgk, a gene product is represented by an induced subgraph of the GO, which consists of all the GO terms annotating it. Then a shortest-path graph kernel is used to compute the similarity between two graphs. In a comprehensive evaluation using a benchmark dataset, spgk compares favorably with other methods that depend on external resources. Compared with simUI, a method that is also intrinsic to GO, spgk achieves slightly better results on the benchmark dataset. Statistical tests show that the improvement is significant when the resolution and EC similarity correlation coefficient are used to measure the performance, but is insignificant when the Pfam similarity correlation coefficient is used. Conclusions Spgk uses a graph kernel method in polynomial time to exploit the structure of the GO to calculate semantic similarity between gene products. It provides an alternative to both methods that use external resources and "intrinsic" methods with comparable performance.

  11. Popularity versus similarity in growing networks

    Science.gov (United States)

    Krioukov, Dmitri; Papadopoulos, Fragkiskos; Kitsak, Maksim; Serrano, Mariangeles; Boguna, Marian

    2012-02-01

    Preferential attachment is a powerful mechanism explaining the emergence of scaling in growing networks. If new connections are established preferentially to more popular nodes in a network, then the network is scale-free. Here we show that not only popularity but also similarity is a strong force shaping the network structure and dynamics. We develop a framework where new connections, instead of preferring popular nodes, optimize certain trade-offs between popularity and similarity. The framework admits a geometric interpretation, in which preferential attachment emerges from local optimization processes. As opposed to preferential attachment, the optimization framework accurately describes large-scale evolution of technological (Internet), social (web of trust), and biological (E.coli metabolic) networks, predicting the probability of new links in them with a remarkable precision. The developed framework can thus be used for predicting new links in evolving networks, and provides a different perspective on preferential attachment as an emergent phenomenon.

  12. Similarity, trust in institutions, affect, and populism

    DEFF Research Database (Denmark)

    Scholderer, Joachim; Finucane, Melissa L.

    -based evaluations are fundamental to human information processing, they can contribute significantly to other judgments (such as the risk, cost-effectiveness, trustworthiness) of the same stimulus object. Although deliberation and analysis are certainly important in some decision-making circumstances, reliance...... on affect is a quicker, easier, and a more efficient way of navigating in a complex and uncertain world. Hence, many theorists give affect a direct and primary role in motivating behavior. Taken together, the results provide uncannily strong support for the value-similarity hypothesis, strengthening...... types of information about gene technology. The materials were attributed to different institutions. The results indicated that participants' trust in an institution was a function of the similarity between the position advocated in the materials and participants' own attitudes towards gene technology...

  13. On Similarity Invariance of Balancing for Nonlinear Systems

    NARCIS (Netherlands)

    Scherpen, Jacquelien M.A.

    1995-01-01

    A previously obtained balancing method for nonlinear systems is investigated on similarity in variance by generalization of the observations on the similarity invariance of the linear balanced realization theory. For linear systems it is well known that the Hankel singular values are similarity

  14. The HMMER Web Server for Protein Sequence Similarity Search.

    Science.gov (United States)

    Prakash, Ananth; Jeffryes, Matt; Bateman, Alex; Finn, Robert D

    2017-12-08

    Protein sequence similarity search is one of the most commonly used bioinformatics methods for identifying evolutionarily related proteins. In general, sequences that are evolutionarily related share some degree of similarity, and sequence-search algorithms use this principle to identify homologs. The requirement for a fast and sensitive sequence search method led to the development of the HMMER software, which in the latest version (v3.1) uses a combination of sophisticated acceleration heuristics and mathematical and computational optimizations to enable the use of profile hidden Markov models (HMMs) for sequence analysis. The HMMER Web server provides a common platform by linking the HMMER algorithms to databases, thereby enabling the search for homologs, as well as providing sequence and functional annotation by linking external databases. This unit describes three basic protocols and two alternate protocols that explain how to use the HMMER Web server using various input formats and user defined parameters. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  15. Semantic Similarity between Web Documents Using Ontology

    Science.gov (United States)

    Chahal, Poonam; Singh Tomer, Manjeet; Kumar, Suresh

    2018-06-01

    The World Wide Web is the source of information available in the structure of interlinked web pages. However, the procedure of extracting significant information with the assistance of search engine is incredibly critical. This is for the reason that web information is written mainly by using natural language, and further available to individual human. Several efforts have been made in semantic similarity computation between documents using words, concepts and concepts relationship but still the outcome available are not as per the user requirements. This paper proposes a novel technique for computation of semantic similarity between documents that not only takes concepts available in documents but also relationships that are available between the concepts. In our approach documents are being processed by making ontology of the documents using base ontology and a dictionary containing concepts records. Each such record is made up of the probable words which represents a given concept. Finally, document ontology's are compared to find their semantic similarity by taking the relationships among concepts. Relevant concepts and relations between the concepts have been explored by capturing author and user intention. The proposed semantic analysis technique provides improved results as compared to the existing techniques.

  16. Semantic Similarity between Web Documents Using Ontology

    Science.gov (United States)

    Chahal, Poonam; Singh Tomer, Manjeet; Kumar, Suresh

    2018-03-01

    The World Wide Web is the source of information available in the structure of interlinked web pages. However, the procedure of extracting significant information with the assistance of search engine is incredibly critical. This is for the reason that web information is written mainly by using natural language, and further available to individual human. Several efforts have been made in semantic similarity computation between documents using words, concepts and concepts relationship but still the outcome available are not as per the user requirements. This paper proposes a novel technique for computation of semantic similarity between documents that not only takes concepts available in documents but also relationships that are available between the concepts. In our approach documents are being processed by making ontology of the documents using base ontology and a dictionary containing concepts records. Each such record is made up of the probable words which represents a given concept. Finally, document ontology's are compared to find their semantic similarity by taking the relationships among concepts. Relevant concepts and relations between the concepts have been explored by capturing author and user intention. The proposed semantic analysis technique provides improved results as compared to the existing techniques.

  17. Similarity from multi-dimensional scaling: solving the accuracy and diversity dilemma in information filtering.

    Directory of Open Access Journals (Sweden)

    Wei Zeng

    Full Text Available Recommender systems are designed to assist individual users to navigate through the rapidly growing amount of information. One of the most successful recommendation techniques is the collaborative filtering, which has been extensively investigated and has already found wide applications in e-commerce. One of challenges in this algorithm is how to accurately quantify the similarities of user pairs and item pairs. In this paper, we employ the multidimensional scaling (MDS method to measure the similarities between nodes in user-item bipartite networks. The MDS method can extract the essential similarity information from the networks by smoothing out noise, which provides a graphical display of the structure of the networks. With the similarity measured from MDS, we find that the item-based collaborative filtering algorithm can outperform the diffusion-based recommendation algorithms. Moreover, we show that this method tends to recommend unpopular items and increase the global diversification of the networks in long term.

  18. Similarity from multi-dimensional scaling: solving the accuracy and diversity dilemma in information filtering.

    Science.gov (United States)

    Zeng, Wei; Zeng, An; Liu, Hao; Shang, Ming-Sheng; Zhang, Yi-Cheng

    2014-01-01

    Recommender systems are designed to assist individual users to navigate through the rapidly growing amount of information. One of the most successful recommendation techniques is the collaborative filtering, which has been extensively investigated and has already found wide applications in e-commerce. One of challenges in this algorithm is how to accurately quantify the similarities of user pairs and item pairs. In this paper, we employ the multidimensional scaling (MDS) method to measure the similarities between nodes in user-item bipartite networks. The MDS method can extract the essential similarity information from the networks by smoothing out noise, which provides a graphical display of the structure of the networks. With the similarity measured from MDS, we find that the item-based collaborative filtering algorithm can outperform the diffusion-based recommendation algorithms. Moreover, we show that this method tends to recommend unpopular items and increase the global diversification of the networks in long term.

  19. Use of a multiscale method of structural similarity for the assessment of image quality in optimization processes in pediatric tcmc; Empleo de un método multiescala de similitud estructural para la valoración de la calidad de imagen en procesos de optimización en tcmc pediátrico

    Energy Technology Data Exchange (ETDEWEB)

    Giner Sala, M.; García Castañón, P.; Pozo Rodríguez, G.; Chamorro Serrano, P.; España López, M.L.

    2015-07-01

    The aim of this report is the objective evaluation of the clinical image quality through the implementation of a multiscale method of structural similarity (MS-SSIM*) and the assessment of noise. The method has been applied to analyze multislice computed tomography (MSCT) chest pediatric images obtained with different optimization methods. To cover the broad chest diametrical ranges for pediatric patients, two phantoms have been used a cylindrical polymetil methacrylate (PMMA) phantom of 16 cm diameter and an anthropomorphic phantom. Three different CT scans have been acquired for each phantom, with the same scout view. The first scan has been adquired with the standard protocol using intensity modulation with patient thickness, Z-DOM (reference image). Then, images from two different optimization procedures have been evaluated: first, intensity modulation with bismuth protectors and then reduced intensity relative to the reference exposure in the standard procedure. The results show lower noise and greater similarity to the reference image on the images acquired with intensity modulation and bismuth versus those acquired by reducing the intensity up to 25%. Multiscale similarity algorithm can provide relevant image quality information without subjectivity or dependence of viewing conditions. [Spanish] El objetivo del presente estudio es la evaluación objetiva de la calidad de imagen clínica mediante la aplicación de un método multiescala de similitud estructural (MS-SSIM*) y la evaluación de ruido, en la imagen obtenida tras procesos de optimización en procedimientos pediátricos de tomografía computarizada multicorte (TCMC) de tórax. Con objeto de cubrir el amplio rango diametral del tórax pediátrico se han utilizado dos maniquíes, uno de polymetil metacrilato (PMMA) de 16 cm de diámetro y otro antropomórfico. Se han realizado tres adquisiciones TC diferentes, para cada maniquí, bajo el mismo topograma, la primera de ellas con el procedimiento est

  20. Generalized similarity method in unsteady two-dimensional MHD ...

    African Journals Online (AJOL)

    user

    International Journal of Engineering, Science and Technology. Vol. 1, No. 1, 2009 ... temperature two-dimensional MHD laminar boundary layer of incompressible fluid. ...... Φ η is Blasius solution for stationary boundary layer on the plate,. ( ). 0.

  1. Generalized similarity method in unsteady two-dimensional MHD ...

    African Journals Online (AJOL)

    Further, electric field is neglected and value of magnetic Reynolds number is significantly less then one i.e. problem is considered in induction-less approximation. According to temperature differences under 50oC physical properties of fluid are constant. Introduced assumptions simplify considered problem in sake of ...

  2. Prioritization of candidate disease genes by combining topological similarity and semantic similarity.

    Science.gov (United States)

    Liu, Bin; Jin, Min; Zeng, Pan

    2015-10-01

    The identification of gene-phenotype relationships is very important for the treatment of human diseases. Studies have shown that genes causing the same or similar phenotypes tend to interact with each other in a protein-protein interaction (PPI) network. Thus, many identification methods based on the PPI network model have achieved good results. However, in the PPI network, some interactions between the proteins encoded by candidate gene and the proteins encoded by known disease genes are very weak. Therefore, some studies have combined the PPI network with other genomic information and reported good predictive performances. However, we believe that the results could be further improved. In this paper, we propose a new method that uses the semantic similarity between the candidate gene and known disease genes to set the initial probability vector of a random walk with a restart algorithm in a human PPI network. The effectiveness of our method was demonstrated by leave-one-out cross-validation, and the experimental results indicated that our method outperformed other methods. Additionally, our method can predict new causative genes of multifactor diseases, including Parkinson's disease, breast cancer and obesity. The top predictions were good and consistent with the findings in the literature, which further illustrates the effectiveness of our method. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Generalized sample entropy analysis for traffic signals based on similarity measure

    Science.gov (United States)

    Shang, Du; Xu, Mengjia; Shang, Pengjian

    2017-05-01

    Sample entropy is a prevailing method used to quantify the complexity of a time series. In this paper a modified method of generalized sample entropy and surrogate data analysis is proposed as a new measure to assess the complexity of a complex dynamical system such as traffic signals. The method based on similarity distance presents a different way of signals patterns match showing distinct behaviors of complexity. Simulations are conducted over synthetic data and traffic signals for providing the comparative study, which is provided to show the power of the new method. Compared with previous sample entropy and surrogate data analysis, the new method has two main advantages. The first one is that it overcomes the limitation about the relationship between the dimension parameter and the length of series. The second one is that the modified sample entropy functions can be used to quantitatively distinguish time series from different complex systems by the similar measure.

  4. A new similarity index for nonlinear signal analysis based on local extrema patterns

    Science.gov (United States)

    Niknazar, Hamid; Motie Nasrabadi, Ali; Shamsollahi, Mohammad Bagher

    2018-02-01

    Common similarity measures of time domain signals such as cross-correlation and Symbolic Aggregate approximation (SAX) are not appropriate for nonlinear signal analysis. This is because of the high sensitivity of nonlinear systems to initial points. Therefore, a similarity measure for nonlinear signal analysis must be invariant to initial points and quantify the similarity by considering the main dynamics of signals. The statistical behavior of local extrema (SBLE) method was previously proposed to address this problem. The SBLE similarity index uses quantized amplitudes of local extrema to quantify the dynamical similarity of signals by considering patterns of sequential local extrema. By adding time information of local extrema as well as fuzzifying quantized values, this work proposes a new similarity index for nonlinear and long-term signal analysis, which extends the SBLE method. These new features provide more information about signals and reduce noise sensitivity by fuzzifying them. A number of practical tests were performed to demonstrate the ability of the method in nonlinear signal clustering and classification on synthetic data. In addition, epileptic seizure detection based on electroencephalography (EEG) signal processing was done by the proposed similarity to feature the potentials of the method as a real-world application tool.

  5. Marriage Matters: Spousal Similarity in Life Satisfaction

    OpenAIRE

    Ulrich Schimmack; Richard Lucas

    2006-01-01

    Examined the concurrent and cross-lagged spousal similarity in life satisfaction over a 21-year period. Analyses were based on married couples (N = 847) in the German Socio-Economic Panel (SOEP). Concurrent spousal similarity was considerably higher than one-year retest similarity, revealing spousal similarity in the variable component of life satisfac-tion. Spousal similarity systematically decreased with length of retest interval, revealing simi-larity in the changing component of life sati...

  6. Similarity of trajectories taking into account geographic context

    Directory of Open Access Journals (Sweden)

    Maike Buchin

    2014-12-01

    Full Text Available The movements of animals, people, and vehicles are embedded in a geographic context. This context influences the movement and may cause the formation of certain behavioral responses. Thus, it is essential to include context parameters in the study of movement and the development of movement pattern analytics. Advances in sensor technologies and positioning devices provide valuable data not only of moving agents but also of the circumstances embedding the movement in space and time. Developing knowledge discovery methods to investigate the relation between movement and its surrounding context is a major challenge in movement analysis today. In this paper we show how to integrate geographic context into the similarity analysis of movement data. For this, we discuss models for geographic context of movement data. Based on this we develop simple but efficient context-aware similarity measures for movement trajectories, which combine a spatial and a contextual distance. These are based on well-known similarity measures for trajectories, such as the Hausdorff, Fréchet, or equal time distance. We validate our approach by applying these measures to movement data of hurricanes and albatross.

  7. Self-Similar Spin Images for Point Cloud Matching

    Science.gov (United States)

    Pulido, Daniel

    The rapid growth of Light Detection And Ranging (Lidar) technologies that collect, process, and disseminate 3D point clouds have allowed for increasingly accurate spatial modeling and analysis of the real world. Lidar sensors can generate massive 3D point clouds of a collection area that provide highly detailed spatial and radiometric information. However, a Lidar collection can be expensive and time consuming. Simultaneously, the growth of crowdsourced Web 2.0 data (e.g., Flickr, OpenStreetMap) have provided researchers with a wealth of freely available data sources that cover a variety of geographic areas. Crowdsourced data can be of varying quality and density. In addition, since it is typically not collected as part of a dedicated experiment but rather volunteered, when and where the data is collected is arbitrary. The integration of these two sources of geoinformation can provide researchers the ability to generate products and derive intelligence that mitigate their respective disadvantages and combine their advantages. Therefore, this research will address the problem of fusing two point clouds from potentially different sources. Specifically, we will consider two problems: scale matching and feature matching. Scale matching consists of computing feature metrics of each point cloud and analyzing their distributions to determine scale differences. Feature matching consists of defining local descriptors that are invariant to common dataset distortions (e.g., rotation and translation). Additionally, after matching the point clouds they can be registered and processed further (e.g., change detection). The objective of this research is to develop novel methods to fuse and enhance two point clouds from potentially disparate sources (e.g., Lidar and crowdsourced Web 2.0 datasets). The scope of this research is to investigate both scale and feature matching between two point clouds. The specific focus of this research will be in developing a novel local descriptor

  8. Spherical anharmonic oscillator in self-similar approximation

    International Nuclear Information System (INIS)

    Yukalova, E.P.; Yukalov, V.I.

    1992-01-01

    The method of self-similar approximation is applied here for calculating the eigenvalues of the three-dimensional spherical anharmonic oscillator. The advantage of this method is in its simplicity and high accuracy. The comparison with other known analytical methods proves that this method is more simple and accurate. 25 refs

  9. METHOD FOR PROVIDING SHAPED BIODEGRADABLE AND ELASTOMERIC STRUCTURES OF (CO) POLYMERS OF 1,3-TRIMETHYLENE CARBONATE (TMC), SHAPED BIODEGRADABLE AND ELASTOMERIC STRUCTURES, AND THE USE OF THESE STRUCTURES

    NARCIS (Netherlands)

    Grijpma, D.W.; Pêgo, A.P.; Feijen, Jan

    2004-01-01

    The present invention relates to methods for providing shaped biodegradable and elastomeric structures of (co)polymers of 1,3­trimethylene carbonate (TMC) with improved (mechanical) properties which can be used for tissue or tissue component support, generation or regeneration. Such shaped

  10. Gait Recognition Using Image Self-Similarity

    Directory of Open Access Journals (Sweden)

    Chiraz BenAbdelkader

    2004-04-01

    Full Text Available Gait is one of the few biometrics that can be measured at a distance, and is hence useful for passive surveillance as well as biometric applications. Gait recognition research is still at its infancy, however, and we have yet to solve the fundamental issue of finding gait features which at once have sufficient discrimination power and can be extracted robustly and accurately from low-resolution video. This paper describes a novel gait recognition technique based on the image self-similarity of a walking person. We contend that the similarity plot encodes a projection of gait dynamics. It is also correspondence-free, robust to segmentation noise, and works well with low-resolution video. The method is tested on multiple data sets of varying sizes and degrees of difficulty. Performance is best for fronto-parallel viewpoints, whereby a recognition rate of 98% is achieved for a data set of 6 people, and 70% for a data set of 54 people.

  11. Self-similarity in applied superconductivity

    International Nuclear Information System (INIS)

    Dresner, Lawrence

    1981-09-01

    Self-similarity is a descriptive term applying to a family of curves. It means that the family is invariant to a one-parameter group of affine (stretching) transformations. The property of self-similarity has been exploited in a wide variety of problems in applied superconductivity, namely, (i) transient distribution of the current among the filaments of a superconductor during charge-up, (ii) steady distribution of current among the filaments of a superconductor near the current leads, (iii) transient heat transfer in superfluid helium, (iv) transient diffusion in cylindrical geometry (important in studying the growth rate of the reacted layer in A15 materials), (v) thermal expulsion of helium from quenching cable-in-conduit conductors, (vi) eddy current heating of irregular plates by slow, ramped fields, and (vii) the specific heat of type-II superconductors. Most, but not all, of the applications involve differential equations, both ordinary and partial. The novel methods explained in this report should prove of great value in other fields, just as they already have done in applied superconductivity. (author)

  12. Predicting the performance of fingerprint similarity searching.

    Science.gov (United States)

    Vogt, Martin; Bajorath, Jürgen

    2011-01-01

    Fingerprints are bit string representations of molecular structure that typically encode structural fragments, topological features, or pharmacophore patterns. Various fingerprint designs are utilized in virtual screening and their search performance essentially depends on three parameters: the nature of the fingerprint, the active compounds serving as reference molecules, and the composition of the screening database. It is of considerable interest and practical relevance to predict the performance of fingerprint similarity searching. A quantitative assessment of the potential that a fingerprint search might successfully retrieve active compounds, if available in the screening database, would substantially help to select the type of fingerprint most suitable for a given search problem. The method presented herein utilizes concepts from information theory to relate the fingerprint feature distributions of reference compounds to screening libraries. If these feature distributions do not sufficiently differ, active database compounds that are similar to reference molecules cannot be retrieved because they disappear in the "background." By quantifying the difference in feature distribution using the Kullback-Leibler divergence and relating the divergence to compound recovery rates obtained for different benchmark classes, fingerprint search performance can be quantitatively predicted.

  13. Popularity versus similarity in growing networks.

    Science.gov (United States)

    Papadopoulos, Fragkiskos; Kitsak, Maksim; Serrano, M Ángeles; Boguñá, Marián; Krioukov, Dmitri

    2012-09-27

    The principle that 'popularity is attractive' underlies preferential attachment, which is a common explanation for the emergence of scaling in growing networks. If new connections are made preferentially to more popular nodes, then the resulting distribution of the number of connections possessed by nodes follows power laws, as observed in many real networks. Preferential attachment has been directly validated for some real networks (including the Internet), and can be a consequence of different underlying processes based on node fitness, ranking, optimization, random walks or duplication. Here we show that popularity is just one dimension of attractiveness; another dimension is similarity. We develop a framework in which new connections optimize certain trade-offs between popularity and similarity, instead of simply preferring popular nodes. The framework has a geometric interpretation in which popularity preference emerges from local optimization. As opposed to preferential attachment, our optimization framework accurately describes the large-scale evolution of technological (the Internet), social (trust relationships between people) and biological (Escherichia coli metabolic) networks, predicting the probability of new links with high precision. The framework that we have developed can thus be used for predicting new links in evolving networks, and provides a different perspective on preferential attachment as an emergent phenomenon.

  14. BSSF: a fingerprint based ultrafast binding site similarity search and function analysis server

    Directory of Open Access Journals (Sweden)

    Jiang Hualiang

    2010-01-01

    Full Text Available Abstract Background Genome sequencing and post-genomics projects such as structural genomics are extending the frontier of the study of sequence-structure-function relationship of genes and their products. Although many sequence/structure-based methods have been devised with the aim of deciphering this delicate relationship, there still remain large gaps in this fundamental problem, which continuously drives researchers to develop novel methods to extract relevant information from sequences and structures and to infer the functions of newly identified genes by genomics technology. Results Here we present an ultrafast method, named BSSF(Binding Site Similarity & Function, which enables researchers to conduct similarity searches in a comprehensive three-dimensional binding site database extracted from PDB structures. This method utilizes a fingerprint representation of the binding site and a validated statistical Z-score function scheme to judge the similarity between the query and database items, even if their similarities are only constrained in a sub-pocket. This fingerprint based similarity measurement was also validated on a known binding site dataset by comparing with geometric hashing, which is a standard 3D similarity method. The comparison clearly demonstrated the utility of this ultrafast method. After conducting the database searching, the hit list is further analyzed to provide basic statistical information about the occurrences of Gene Ontology terms and Enzyme Commission numbers, which may benefit researchers by helping them to design further experiments to study the query proteins. Conclusions This ultrafast web-based system will not only help researchers interested in drug design and structural genomics to identify similar binding sites, but also assist them by providing further analysis of hit list from database searching.

  15. Correct Bayesian and frequentist intervals are similar

    International Nuclear Information System (INIS)

    Atwood, C.L.

    1986-01-01

    This paper argues that Bayesians and frequentists will normally reach numerically similar conclusions, when dealing with vague data or sparse data. It is shown that both statistical methodologies can deal reasonably with vague data. With sparse data, in many important practical cases Bayesian interval estimates and frequentist confidence intervals are approximately equal, although with discrete data the frequentist intervals are somewhat longer. This is not to say that the two methodologies are equally easy to use: The construction of a frequentist confidence interval may require new theoretical development. Bayesians methods typically require numerical integration, perhaps over many variables. Also, Bayesian can easily fall into the trap of over-optimism about their amount of prior knowledge. But in cases where both intervals are found correctly, the two intervals are usually not very different. (orig.)

  16. Image Steganalysis with Binary Similarity Measures

    Directory of Open Access Journals (Sweden)

    Kharrazi Mehdi

    2005-01-01

    Full Text Available We present a novel technique for steganalysis of images that have been subjected to embedding by steganographic algorithms. The seventh and eighth bit planes in an image are used for the computation of several binary similarity measures. The basic idea is that the correlation between the bit planes as well as the binary texture characteristics within the bit planes will differ between a stego image and a cover image. These telltale marks are used to construct a classifier that can distinguish between stego and cover images. We also provide experimental results using some of the latest steganographic algorithms. The proposed scheme is found to have complementary performance vis-à-vis Farid's scheme in that they outperform each other in alternate embedding techniques.

  17. Modeling Timbre Similarity of Short Music Clips.

    Science.gov (United States)

    Siedenburg, Kai; Müllensiefen, Daniel

    2017-01-01

    There is evidence from a number of recent studies that most listeners are able to extract information related to song identity, emotion, or genre from music excerpts with durations in the range of tenths of seconds. Because of these very short durations, timbre as a multifaceted auditory attribute appears as a plausible candidate for the type of features that listeners make use of when processing short music excerpts. However, the importance of timbre in listening tasks that involve short excerpts has not yet been demonstrated empirically. Hence, the goal of this study was to develop a method that allows to explore to what degree similarity judgments of short music clips can be modeled with low-level acoustic features related to timbre. We utilized the similarity data from two large samples of participants: Sample I was obtained via an online survey, used 16 clips of 400 ms length, and contained responses of 137,339 participants. Sample II was collected in a lab environment, used 16 clips of 800 ms length, and contained responses from 648 participants. Our model used two sets of audio features which included commonly used timbre descriptors and the well-known Mel-frequency cepstral coefficients as well as their temporal derivates. In order to predict pairwise similarities, the resulting distances between clips in terms of their audio features were used as predictor variables with partial least-squares regression. We found that a sparse selection of three to seven features from both descriptor sets-mainly encoding the coarse shape of the spectrum as well as spectrotemporal variability-best predicted similarities across the two sets of sounds. Notably, the inclusion of non-acoustic predictors of musical genre and record release date allowed much better generalization performance and explained up to 50% of shared variance ( R 2 ) between observations and model predictions. Overall, the results of this study empirically demonstrate that both acoustic features related

  18. Local-global alignment for finding 3D similarities in protein structures

    Science.gov (United States)

    Zemla, Adam T [Brentwood, CA

    2011-09-20

    A method of finding 3D similarities in protein structures of a first molecule and a second molecule. The method comprises providing preselected information regarding the first molecule and the second molecule. Comparing the first molecule and the second molecule using Longest Continuous Segments (LCS) analysis. Comparing the first molecule and the second molecule using Global Distance Test (GDT) analysis. Comparing the first molecule and the second molecule using Local Global Alignment Scoring function (LGA_S) analysis. Verifying constructed alignment and repeating the steps to find the regions of 3D similarities in protein structures.

  19. Systematic characterizations of text similarity in full text biomedical publications.

    Science.gov (United States)

    Sun, Zhaohui; Errami, Mounir; Long, Tara; Renard, Chris; Choradia, Nishant; Garner, Harold

    2010-09-15

    Computational methods have been used to find duplicate biomedical publications in MEDLINE. Full text articles are becoming increasingly available, yet the similarities among them have not been systematically studied. Here, we quantitatively investigated the full text similarity of biomedical publications in PubMed Central. 72,011 full text articles from PubMed Central (PMC) were parsed to generate three different datasets: full texts, sections, and paragraphs. Text similarity comparisons were performed on these datasets using the text similarity algorithm eTBLAST. We measured the frequency of similar text pairs and compared it among different datasets. We found that high abstract similarity can be used to predict high full text similarity with a specificity of 20.1% (95% CI [17.3%, 23.1%]) and sensitivity of 99.999%. Abstract similarity and full text similarity have a moderate correlation (Pearson correlation coefficient: -0.423) when the similarity ratio is above 0.4. Among pairs of articles in PMC, method sections are found to be the most repetitive (frequency of similar pairs, methods: 0.029, introduction: 0.0076, results: 0.0043). In contrast, among a set of manually verified duplicate articles, results are the most repetitive sections (frequency of similar pairs, results: 0.94, methods: 0.89, introduction: 0.82). Repetition of introduction and methods sections is more likely to be committed by the same authors (odds of a highly similar pair having at least one shared author, introduction: 2.31, methods: 1.83, results: 1.03). There is also significantly more similarity in pairs of review articles than in pairs containing one review and one nonreview paper (frequency of similar pairs: 0.0167 and 0.0023, respectively). While quantifying abstract similarity is an effective approach for finding duplicate citations, a comprehensive full text analysis is necessary to uncover all potential duplicate citations in the scientific literature and is helpful when

  20. Improved collaborative filtering recommendation algorithm of similarity measure

    Science.gov (United States)

    Zhang, Baofu; Yuan, Baoping

    2017-05-01

    The Collaborative filtering recommendation algorithm is one of the most widely used recommendation algorithm in personalized recommender systems. The key is to find the nearest neighbor set of the active user by using similarity measure. However, the methods of traditional similarity measure mainly focus on the similarity of user common rating items, but ignore the relationship between the user common rating items and all items the user rates. And because rating matrix is very sparse, traditional collaborative filtering recommendation algorithm is not high efficiency. In order to obtain better accuracy, based on the consideration of common preference between users, the difference of rating scale and score of common items, this paper presents an improved similarity measure method, and based on this method, a collaborative filtering recommendation algorithm based on similarity improvement is proposed. Experimental results show that the algorithm can effectively improve the quality of recommendation, thus alleviate the impact of data sparseness.

  1. Cultural similarity, cultural competence, and nurse workforce diversity.

    Science.gov (United States)

    McGinnis, Sandra L; Brush, Barbara L; Moore, Jean

    2010-11-01

    Proponents of health workforce diversity argue that increasing the number of minority health care providers will enhance cultural similarity between patients and providers as well as the health system's capacity to provide culturally competent care. Measuring cultural similarity has been difficult, however, given that current benchmarks of workforce diversity categorize health workers by major racial/ethnic classifications rather than by cultural measures. This study examined the use of national racial/ethnic categories in both patient and registered nurse (RN) populations and found them to be a poor indicator of cultural similarity. Rather, we found that cultural similarity between RN and patient populations needs to be established at the level of local labor markets and broadened to include other cultural parameters such as country of origin, primary language, and self-identified ancestry. Only then can the relationship between cultural similarity and cultural competence be accurately determined and its outcomes measured.

  2. Block generators for the similarity renormalization group

    Energy Technology Data Exchange (ETDEWEB)

    Huether, Thomas; Roth, Robert [TU Darmstadt (Germany)

    2016-07-01

    The Similarity Renormalization Group (SRG) is a powerful tool to improve convergence behavior of many-body calculations using NN and 3N interactions from chiral effective field theory. The SRG method decouples high and low-energy physics, through a continuous unitary transformation implemented via a flow equation approach. The flow is determined by a generator of choice. This generator governs the decoupling pattern and, thus, the improvement of convergence, but it also induces many-body interactions. Through the design of the generator we can optimize the balance between convergence and induced forces. We explore a new class of block generators that restrict the decoupling to the high-energy sector and leave the diagonalization in the low-energy sector to the many-body method. In this way one expects a suppression of induced forces. We analyze the induced many-body forces and the convergence behavior in light and medium-mass nuclei in No-Core Shell Model and In-Medium SRG calculations.

  3. Large margin classification with indefinite similarities

    KAUST Repository

    Alabdulmohsin, Ibrahim; Cisse, Moustapha; Gao, Xin; Zhang, Xiangliang

    2016-01-01

    Classification with indefinite similarities has attracted attention in the machine learning community. This is partly due to the fact that many similarity functions that arise in practice are not symmetric positive semidefinite, i.e. the Mercer

  4. Testing Self-Similarity Through Lamperti Transformations

    KAUST Repository

    Lee, Myoungji; Genton, Marc G.; Jun, Mikyoung

    2016-01-01

    extensively, while statistical tests for self-similarity are scarce and limited to processes indexed in one dimension. This paper proposes a statistical hypothesis test procedure for self-similarity of a stochastic process indexed in one dimension and multi

  5. Personality similarity and life satisfaction in couples

    OpenAIRE

    Furler Katrin; Gomez Veronica; Grob Alexander

    2013-01-01

    The present study examined the association between personality similarity and life satisfaction in a large nationally representative sample of 1608 romantic couples. Similarity effects were computed for the Big Five personality traits as well as for personality profiles with global and differentiated indices of similarity. Results showed substantial actor and partner effects indicating that both partners' personality traits were related to both partners' life satisfaction. Personality similar...

  6. Computational prediction of drug-drug interactions based on drugs functional similarities.

    Science.gov (United States)

    Ferdousi, Reza; Safdari, Reza; Omidi, Yadollah

    2017-06-01

    Therapeutic activities of drugs are often influenced by co-administration of drugs that may cause inevitable drug-drug interactions (DDIs) and inadvertent side effects. Prediction and identification of DDIs are extremely vital for the patient safety and success of treatment modalities. A number of computational methods have been employed for the prediction of DDIs based on drugs structures and/or functions. Here, we report on a computational method for DDIs prediction based on functional similarity of drugs. The model was set based on key biological elements including carriers, transporters, enzymes and targets (CTET). The model was applied for 2189 approved drugs. For each drug, all the associated CTETs were collected, and the corresponding binary vectors were constructed to determine the DDIs. Various similarity measures were conducted to detect DDIs. Of the examined similarity methods, the inner product-based similarity measures (IPSMs) were found to provide improved prediction values. Altogether, 2,394,766 potential drug pairs interactions were studied. The model was able to predict over 250,000 unknown potential DDIs. Upon our findings, we propose the current method as a robust, yet simple and fast, universal in silico approach for identification of DDIs. We envision that this proposed method can be used as a practical technique for the detection of possible DDIs based on the functional similarities of drugs. Copyright © 2017. Published by Elsevier Inc.

  7. Method

    Directory of Open Access Journals (Sweden)

    Ling Fiona W.M.

    2017-01-01

    Full Text Available Rapid prototyping of microchannel gain lots of attention from researchers along with the rapid development of microfluidic technology. The conventional methods carried few disadvantages such as high cost, time consuming, required high operating pressure and temperature and involve expertise in operating the equipment. In this work, new method adapting xurography method is introduced to replace the conventional method of fabrication of microchannels. The novelty in this study is replacing the adhesion film with clear plastic film which was used to cut the design of the microchannel as the material is more suitable for fabricating more complex microchannel design. The microchannel was then mold using polymethyldisiloxane (PDMS and bonded with a clean glass to produce a close microchannel. The microchannel produced had a clean edge indicating good master mold was produced using the cutting plotter and the bonding between the PDMS and glass was good where no leakage was observed. The materials used in this method is cheap and the total time consumed is less than 5 hours where this method is suitable for rapid prototyping of microchannel.

  8. Therapy Provider Phase Information

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Therapy Provider Phase Information dataset is a tool for providers to search by their National Provider Identifier (NPI) number to determine their phase for...

  9. Composition and similarity of global anomodont-bearing tetrapod faunas

    Science.gov (United States)

    Fröbisch, Jörg

    2009-08-01

    Anomodont synapsids represent the dominant herbivores of Permian and Triassic terrestrial vertebrate ecosystems. Their taxonomic diversity and morphological disparity in combination with their cosmopolitan distribution makes them an ideal study object for macroevolutionary patterns across the most devastating extinction event in earth history. This study provides a thorough review of anomodont-bearing tetrapod faunas to form the basis for a faunal similarity analysis and future studies of anomodont diversity. The stratigraphic correlation and composition of all known anomodont assemblages is revisited, including a discussion of the validity of the globally distributed anomodont species. The similarity analysis of anomodont faunas is performed on the basis of presence-absence data of anomodont taxa, using explorative methods such as cluster analysis (UPGMA) and non-metric multidimensional scaling (NMDS). The recovered faunal groupings indicate a common biostratigraphic age and furthermore reflect biogeographic patterns. Even though endemism and faunal provinciality was a constant element in anomodont faunas of the Permian and Triassic, the available evidence indicates that the end-Permian extinction resulted in a distinct uniformity that was unique to Early Triassic anomodont faunas. This is in particular characterized by the global distribution and overwhelming abundance of the disaster taxon Lystrosaurus. In contrast, cosmopolitan anomodonts also existed in the Late Permian (e.g., Diictodon) and Middle Triassic (e.g., Shansiodon), but those taxa coexisted with endemic faunal elements rather than dominated the fauna as Lystrosaurus did.

  10. Semantic similarity measures in the biomedical domain by leveraging a web search engine.

    Science.gov (United States)

    Hsieh, Sheau-Ling; Chang, Wen-Yung; Chen, Chi-Huang; Weng, Yung-Ching

    2013-07-01

    Various researches in web related semantic similarity measures have been deployed. However, measuring semantic similarity between two terms remains a challenging task. The traditional ontology-based methodologies have a limitation that both concepts must be resided in the same ontology tree(s). Unfortunately, in practice, the assumption is not always applicable. On the other hand, if the corpus is sufficiently adequate, the corpus-based methodologies can overcome the limitation. Now, the web is a continuous and enormous growth corpus. Therefore, a method of estimating semantic similarity is proposed via exploiting the page counts of two biomedical concepts returned by Google AJAX web search engine. The features are extracted as the co-occurrence patterns of two given terms P and Q, by querying P, Q, as well as P AND Q, and the web search hit counts of the defined lexico-syntactic patterns. These similarity scores of different patterns are evaluated, by adapting support vector machines for classification, to leverage the robustness of semantic similarity measures. Experimental results validating against two datasets: dataset 1 provided by A. Hliaoutakis; dataset 2 provided by T. Pedersen, are presented and discussed. In dataset 1, the proposed approach achieves the best correlation coefficient (0.802) under SNOMED-CT. In dataset 2, the proposed method obtains the best correlation coefficient (SNOMED-CT: 0.705; MeSH: 0.723) with physician scores comparing with measures of other methods. However, the correlation coefficients (SNOMED-CT: 0.496; MeSH: 0.539) with coder scores received opposite outcomes. In conclusion, the semantic similarity findings of the proposed method are close to those of physicians' ratings. Furthermore, the study provides a cornerstone investigation for extracting fully relevant information from digitizing, free-text medical records in the National Taiwan University Hospital database.

  11. Multi-Scale Scattering Transform in Music Similarity Measuring

    Science.gov (United States)

    Wang, Ruobai

    Scattering transform is a Mel-frequency spectrum based, time-deformation stable method, which can be used in evaluating music similarity. Compared with Dynamic time warping, it has better performance in detecting similar audio signals under local time-frequency deformation. Multi-scale scattering means to combine scattering transforms of different window lengths. This paper argues that, multi-scale scattering transform is a good alternative of dynamic time warping in music similarity measuring. We tested the performance of multi-scale scattering transform against other popular methods, with data designed to represent different conditions.

  12. method

    Directory of Open Access Journals (Sweden)

    L. M. Kimball

    2002-01-01

    Full Text Available This paper presents an interior point algorithm to solve the multiperiod hydrothermal economic dispatch (HTED. The multiperiod HTED is a large scale nonlinear programming problem. Various optimization methods have been applied to the multiperiod HTED, but most neglect important network characteristics or require decomposition into thermal and hydro subproblems. The algorithm described here exploits the special bordered block diagonal structure and sparsity of the Newton system for the first order necessary conditions to result in a fast efficient algorithm that can account for all network aspects. Applying this new algorithm challenges a conventional method for the use of available hydro resources known as the peak shaving heuristic.

  13. ProCKSI: a decision support system for Protein (Structure Comparison, Knowledge, Similarity and Information

    Directory of Open Access Journals (Sweden)

    Błażewicz Jacek

    2007-10-01

    Full Text Available Abstract Background We introduce the decision support system for Protein (Structure Comparison, Knowledge, Similarity and Information (ProCKSI. ProCKSI integrates various protein similarity measures through an easy to use interface that allows the comparison of multiple proteins simultaneously. It employs the Universal Similarity Metric (USM, the Maximum Contact Map Overlap (MaxCMO of protein structures and other external methods such as the DaliLite and the TM-align methods, the Combinatorial Extension (CE of the optimal path, and the FAST Align and Search Tool (FAST. Additionally, ProCKSI allows the user to upload a user-defined similarity matrix supplementing the methods mentioned, and computes a similarity consensus in order to provide a rich, integrated, multicriteria view of large datasets of protein structures. Results We present ProCKSI's architecture and workflow describing its intuitive user interface, and show its potential on three distinct test-cases. In the first case, ProCKSI is used to evaluate the results of a previous CASP competition, assessing the similarity of proposed models for given targets where the structures could have a large deviation from one another. To perform this type of comparison reliably, we introduce a new consensus method. The second study deals with the verification of a classification scheme for protein kinases, originally derived by sequence comparison by Hanks and Hunter, but here we use a consensus similarity measure based on structures. In the third experiment using the Rost and Sander dataset (RS126, we investigate how a combination of different sets of similarity measures influences the quality and performance of ProCKSI's new consensus measure. ProCKSI performs well with all three datasets, showing its potential for complex, simultaneous multi-method assessment of structural similarity in large protein datasets. Furthermore, combining different similarity measures is usually more robust than

  14. Pythoscape: a framework for generation of large protein similarity networks.

    Science.gov (United States)

    Barber, Alan E; Babbitt, Patricia C

    2012-11-01

    Pythoscape is a framework implemented in Python for processing large protein similarity networks for visualization in other software packages. Protein similarity networks are graphical representations of sequence, structural and other similarities among proteins for which pairwise all-by-all similarity connections have been calculated. Mapping of biological and other information to network nodes or edges enables hypothesis creation about sequence-structure-function relationships across sets of related proteins. Pythoscape provides several options to calculate pairwise similarities for input sequences or structures, applies filters to network edges and defines sets of similar nodes and their associated data as single nodes (termed representative nodes) for compression of network information and output data or formatted files for visualization.

  15. Genetic and 'cultural' similarity in wild chimpanzees.

    Science.gov (United States)

    Langergraber, Kevin E; Boesch, Christophe; Inoue, Eiji; Inoue-Murayama, Miho; Mitani, John C; Nishida, Toshisada; Pusey, Anne; Reynolds, Vernon; Schubert, Grit; Wrangham, Richard W; Wroblewski, Emily; Vigilant, Linda

    2011-02-07

    The question of whether animals possess 'cultures' or 'traditions' continues to generate widespread theoretical and empirical interest. Studies of wild chimpanzees have featured prominently in this discussion, as the dominant approach used to identify culture in wild animals was first applied to them. This procedure, the 'method of exclusion,' begins by documenting behavioural differences between groups and then infers the existence of culture by eliminating ecological explanations for their occurrence. The validity of this approach has been questioned because genetic differences between groups have not explicitly been ruled out as a factor contributing to between-group differences in behaviour. Here we investigate this issue directly by analysing genetic and behavioural data from nine groups of wild chimpanzees. We find that the overall levels of genetic and behavioural dissimilarity between groups are highly and statistically significantly correlated. Additional analyses show that only a very small number of behaviours vary between genetically similar groups, and that there is no obvious pattern as to which classes of behaviours (e.g. tool-use versus communicative) have a distribution that matches patterns of between-group genetic dissimilarity. These results indicate that genetic dissimilarity cannot be eliminated as playing a major role in generating group differences in chimpanzee behaviour.

  16. Promoting physical activity and health literacy: study protocol for a longitudinal, mixed methods evaluation of a cross-provider workplace-related intervention in Germany (The AtRisk study

    Directory of Open Access Journals (Sweden)

    Andrea Schaller

    2016-07-01

    Full Text Available Abstract Background Physical activity and health literacy are topics of utmost importance in the prevention of chronic diseases. The present article describes the study protocol for evaluating a cross-provider workplace-related intervention promoting physical activity and health literacy. Methods The RE-AIM Framework will be the conceptual framework of the AtRisk study. A controlled natural experiment and a qualitative study will be conducted. The cross-provider intervention is based on the cooperation of the German Pension Fund Rhineland and cooperating German Statutory Health Insurances. It combines two components: a behavior-oriented lifestyle intervention and the assignment of a health coach. The single-provider intervention only includes the behavior-oriented lifestyle intervention. The quantitative study (natural experiment encompasses three measuring points (T0 = start of the behavior-oriented lifestyle intervention (baseline; T1 = end of the behavior-oriented lifestyle intervention (16 weeks; T2 = 6 month follow-up and will compare the effectiveness of the cross-provider workplace-related intervention compared with the single provider intervention. Participants are employees with health related risk factors. ANCOVA will be used to evaluate the effect of the intervention on the outcome variables leisure time physical (primary outcome activity and health literacy (secondary outcome. The qualitative study comprises semi-structured interviews, systematic field notes of stakeholder meetings and document analyses. Discussion The AtRisk study will contribute towards the claim for cross-provider interventions and workplace-related approaches described in the new Preventive Health Care Act. The results of this study will inform providers, payers and policy makers about the effectiveness of a cross-provider workplace-related lifestyle intervention compared to a single-provider intervention. Beyond, the study will identify challenges

  17. Centrifugal fans: Similarity, scaling laws, and fan performance

    Science.gov (United States)

    Sardar, Asad Mohammad

    fan-impeller/diffuser section in water was observed with a flow visualization technique using a shear-thickening dye (in addition to a conventional dye). Full dynamic similarity was maintained between RVAC operation in water as when operated in air. Recommendations are provided both for further investigation of critical flow regions with more sophisticated measurement methods and for improved fan-scroll design to reduce possible aeroacoustic noise with improved aerodynamic performance.

  18. Destination-Promoted And Visitor-Generated Images – Do They Represent Similar Stories?

    DEFF Research Database (Denmark)

    Tussyadiah, Iis

    2010-01-01

    Drawing on the concept of mediation and scripting, this chapter applies a content-extraction method in an attempt to identify similarities and differences between images used by destination marketers and those shared by tourists at the visit and post-visit stages, and, most importantly, to identify...... the values created by the shared images for audiences in tourism settings. The official image data were selected from photo galleries of the Greater Philadelphia Tourism Marketing Corporation (GPTMC) website (gophila.com), resulting in 412 samples. Similarities of images provided on the GoPhila photo...... galleries within and between categories prove that destination marketing organizations have typically used similar types of images to communicate notions of the tourist experience to reinforce the desired image in the minds of potential travellers. On the other hand, based on the high similarities...

  19. Preliminary Assessment of ATR-C Capabilities to Provide Integral Benchmark Data for Key Structural/Matrix Materials that May be Used for Nuclear Data Testing and Analytical Methods Validation

    Energy Technology Data Exchange (ETDEWEB)

    John D. Bess

    2009-03-01

    The purpose of this research is to provide a fundamental computational investigation into the possible integration of experimental activities with the Advanced Test Reactor Critical (ATR-C) facility with the development of benchmark experiments. Criticality benchmarks performed in the ATR-C could provide integral data for key matrix and structural materials used in nuclear systems. Results would then be utilized in the improvement of nuclear data libraries and as a means for analytical methods validation. It is proposed that experiments consisting of well-characterized quantities of materials be placed in the Northwest flux trap position of the ATR-C. The reactivity worth of the material could be determined and computationally analyzed through comprehensive benchmark activities including uncertainty analyses. Experiments were modeled in the available benchmark model of the ATR using MCNP5 with the ENDF/B-VII.0 cross section library. A single bar (9.5 cm long, 0.5 cm wide, and 121.92 cm high) of each material could provide sufficient reactivity difference in the core geometry for computational modeling and analysis. However, to provide increased opportunity for the validation of computational models, additional bars of material placed in the flux trap would increase the effective reactivity up to a limit of 1$ insertion. For simplicity in assembly manufacture, approximately four bars of material could provide a means for additional experimental benchmark configurations, except in the case of strong neutron absorbers and many materials providing positive reactivity. Future tasks include the cost analysis and development of the experimental assemblies, including means for the characterization of the neutron flux and spectral indices. Oscillation techniques may also serve to provide additional means for experimentation and validation of computational methods and acquisition of integral data for improving neutron cross sections. Further assessment of oscillation

  20. Preliminary Assessment of ATR-C Capabilities to Provide Integral Benchmark Data for Key Structural/Matrix Materials that May be Used for Nuclear Data Testing and Analytical Methods Validation

    Energy Technology Data Exchange (ETDEWEB)

    John D. Bess

    2009-07-01

    The purpose of this document is to identify some suggested types of experiments that can be performed in the Advanced Test Reactor Critical (ATR-C) facility. A fundamental computational investigation is provided to demonstrate possible integration of experimental activities in the ATR-C with the development of benchmark experiments. Criticality benchmarks performed in the ATR-C could provide integral data for key matrix and structural materials used in nuclear systems. Results would then be utilized in the improvement of nuclear data libraries and as a means for analytical methods validation. It is proposed that experiments consisting of well-characterized quantities of materials be placed in the Northwest flux trap position of the ATR-C. The reactivity worth of the material could be determined and computationally analyzed through comprehensive benchmark activities including uncertainty analyses. Experiments were modeled in the available benchmark model of the ATR using MCNP5 with the ENDF/B-VII.0 cross section library. A single bar (9.5 cm long, 0.5 cm wide, and 121.92 cm high) of each material could provide sufficient reactivity difference in the core geometry for computational modeling and analysis. However, to provide increased opportunity for the validation of computational models, additional bars of material placed in the flux trap would increase the effective reactivity up to a limit of 1$ insertion. For simplicity in assembly manufacture, approximately four bars of material could provide a means for additional experimental benchmark configurations, except in the case of strong neutron absorbers and many materials providing positive reactivity. Future tasks include the cost analysis and development of the experimental assemblies, including means for the characterization of the neutron flux and spectral indices. Oscillation techniques may also serve to provide additional means for experimentation and validation of computational methods and acquisition of

  1. Enhancement of chemical entity identification in text using semantic similarity validation.

    Directory of Open Access Journals (Sweden)

    Tiago Grego

    Full Text Available With the amount of chemical data being produced and reported in the literature growing at a fast pace, it is increasingly important to efficiently retrieve this information. To tackle this issue text mining tools have been applied, but despite their good performance they still provide many errors that we believe can be filtered by using semantic similarity. Thus, this paper proposes a novel method that receives the results of chemical entity identification systems, such as Whatizit, and exploits the semantic relationships in ChEBI to measure the similarity between the entities found in the text. The method assigns a single validation score to each entity based on its similarities with the other entities also identified in the text. Then, by using a given threshold, the method selects a set of validated entities and a set of outlier entities. We evaluated our method using the results of two state-of-the-art chemical entity identification tools, three semantic similarity measures and two text window sizes. The method was able to increase precision without filtering a significant number of correctly identified entities. This means that the method can effectively discriminate the correctly identified chemical entities, while discarding a significant number of identification errors. For example, selecting a validation set with 75% of all identified entities, we were able to increase the precision by 28% for one of the chemical entity identification tools (Whatizit, maintaining in that subset 97% the correctly identified entities. Our method can be directly used as an add-on by any state-of-the-art entity identification tool that provides mappings to a database, in order to improve their results. The proposed method is included in a freely accessible web tool at www.lasige.di.fc.ul.pt/webtools/ice/.

  2. On self-similar Tolman models

    International Nuclear Information System (INIS)

    Maharaj, S.D.

    1988-01-01

    The self-similar spherically symmetric solutions of the Einstein field equation for the case of dust are identified. These form a subclass of the Tolman models. These self-similar models contain the solution recently presented by Chi [J. Math. Phys. 28, 1539 (1987)], thereby refuting the claim of having found a new solution to the Einstein field equations

  3. On distributional assumptions and whitened cosine similarities

    DEFF Research Database (Denmark)

    Loog, Marco

    2008-01-01

    Recently, an interpretation of the whitened cosine similarity measure as a Bayes decision rule was proposed (C. Liu, "The Bayes Decision Rule Induced Similarity Measures,'' IEEE Trans. Pattern Analysis and Machine Intelligence, vol. 29, no. 6, pp. 1086-1090, June 2007. This communication makes th...

  4. Self-Similar Traffic In Wireless Networks

    OpenAIRE

    Jerjomins, R.; Petersons, E.

    2005-01-01

    Many studies have shown that traffic in Ethernet and other wired networks is self-similar. This paper reveals that wireless network traffic is also self-similar and long-range dependant by analyzing big amount of data captured from the wireless router.

  5. Evaluation of GO-based functional similarity measures using S. cerevisiae protein interaction and expression profile data

    Directory of Open Access Journals (Sweden)

    Du LinFang

    2008-11-01

    Full Text Available Abstract Background Researchers interested in analysing the expression patterns of functionally related genes usually hope to improve the accuracy of their results beyond the boundaries of currently available experimental data. Gene ontology (GO data provides a novel way to measure the functional relationship between gene products. Many approaches have been reported for calculating the similarities between two GO terms, known as semantic similarities. However, biologists are more interested in the relationship between gene products than in the scores linking the GO terms. To highlight the relationships among genes, recent studies have focused on functional similarities. Results In this study, we evaluated five functional similarity methods using both protein-protein interaction (PPI and expression data of S. cerevisiae. The receiver operating characteristics (ROC and correlation coefficient analysis of these methods showed that the maximum method outperformed the other methods. Statistical comparison of multiple- and single-term annotated proteins in biological process ontology indicated that genes with multiple GO terms may be more reliable for separating true positives from noise. Conclusion This study demonstrated the reliability of current approaches that elevate the similarity of GO terms to the similarity of proteins. Suggestions for further improvements in functional similarity analysis are also provided.

  6. Event Shape Sorting: selecting events with similar evolution

    Directory of Open Access Journals (Sweden)

    Tomášik Boris

    2017-01-01

    Full Text Available We present novel method for the organisation of events. The method is based on comparing event-by-event histograms of a chosen quantity Q that is measured for each particle in every event. The events are organised in such a way that those with similar shape of the Q-histograms end-up placed close to each other. We apply the method on histograms of azimuthal angle of the produced hadrons in ultrarelativsitic nuclear collisions. By selecting events with similar azimuthal shape of their hadron distribution one chooses events which are likely that they underwent similar evolution from the initial state to the freeze-out. Such events can more easily be compared to theoretical simulations where all conditions can be controlled. We illustrate the method on data simulated by the AMPT model.

  7. Chromatographic fingerprint similarity analysis for pollutant source identification

    International Nuclear Information System (INIS)

    Xie, Juan-Ping; Ni, Hong-Gang

    2015-01-01

    In the present study, a similarity analysis method was proposed to evaluate the source-sink relationships among environmental media for polybrominated diphenyl ethers (PBDEs), which were taken as the representative contaminants. Chromatographic fingerprint analysis has been widely used in the fields of natural products chemistry and forensic chemistry, but its application to environmental science has been limited. We established a library of various sources of media containing contaminants (e.g., plastics), recognizing that the establishment of a more comprehensive library allows for a better understanding of the sources of contamination. We then compared an environmental complex mixture (e.g., sediment, soil) with the profiles in the library. These comparisons could be used as the first step in source tracking. The cosine similarities between plastic and soil or sediment ranged from 0.53 to 0.68, suggesting that plastic in electronic waste is an important source of PBDEs in the environment, but it is not the only source. A similarity analysis between soil and sediment indicated that they have a source-sink relationship. Generally, the similarity analysis method can encompass more relevant information of complex mixtures in the environment than a profile-based approach that only focuses on target pollutants. There is an inherent advantage to creating a data matrix containing all peaks and their relative levels after matching the peaks based on retention times and peak areas. This data matrix can be used for source identification via a similarity analysis without quantitative or qualitative analysis of all chemicals in a sample. - Highlights: • Chromatographic fingerprint analysis can be used as the first step in source tracking. • Similarity analysis method can encompass more relevant information of pollution. • The fingerprints strongly depend on the chromatographic conditions. • A more effective and robust method for identifying similarities is required

  8. Surf similarity and solitary wave runup

    DEFF Research Database (Denmark)

    Fuhrman, David R.; Madsen, Per A.

    2008-01-01

    The notion of surf similarity in the runup of solitary waves is revisited. We show that the surf similarity parameter for solitary waves may be effectively reduced to the beach slope divided by the offshore wave height to depth ratio. This clarifies its physical interpretation relative to a previ...... functional dependence on their respective surf similarity parameters. Important equivalencies in the runup of sinusoidal and solitary waves are thus revealed.......The notion of surf similarity in the runup of solitary waves is revisited. We show that the surf similarity parameter for solitary waves may be effectively reduced to the beach slope divided by the offshore wave height to depth ratio. This clarifies its physical interpretation relative...... to a previous parameterization, which was not given in an explicit form. Good coherency with experimental (breaking) runup data is preserved with this simpler parameter. A recasting of analytical (nonbreaking) runup expressions for sinusoidal and solitary waves additionally shows that they contain identical...

  9. Similarity in Bilateral Isolated Internal Orbital Fractures.

    Science.gov (United States)

    Chen, Hung-Chang; Cox, Jacob T; Sanyal, Abanti; Mahoney, Nicholas R

    2018-04-13

    In evaluating patients sustaining bilateral isolated internal orbital fractures, the authors have observed both similar fracture locations and also similar expansion of orbital volumes. In this study, we aim to investigate if there is a propensity for the 2 orbits to fracture in symmetrically similar patterns when sustaining similar trauma. A retrospective chart review was performed studying all cases at our institution of bilateral isolated internal orbital fractures involving the medial wall and/or the floor at the time of presentation. The similarity of the bilateral fracture locations was evaluated using the Fisher's exact test. The bilateral expanded orbital volumes were analyzed using the Wilcoxon signed-rank test to assess for orbital volume similarity. Twenty-four patients with bilateral internal orbital fractures were analyzed for fracture location similarity. Seventeen patients (70.8%) had 100% concordance in the orbital subregion fractured, and the association between the right and the left orbital fracture subregion locations was statistically significant (P < 0.0001). Fifteen patients were analyzed for orbital volume similarity. The average orbital cavity volume was 31.2 ± 3.8 cm on the right and 32.0 ± 3.7 cm on the left. There was a statistically significant difference between right and left orbital cavity volumes (P = 0.0026). The data from this study suggest that an individual who suffers isolated bilateral internal orbital fractures has a statistically significant similarity in the location of their orbital fractures. However, there does not appear to be statistically significant similarity in the expansion of the orbital volumes in these patients.

  10. UNSOLVED AND LATENT CRIME: DIFFERENCES AND SIMILARITIES

    Directory of Open Access Journals (Sweden)

    Mikhail Kleymenov

    2017-01-01

    Full Text Available УДК 343Purpose of the article is to study the specific legal and informational nature of the unsolved crime in comparison with the phenomenon of delinquency, special study and analysis to improve the efficiency of law enforcement.Methods of research are abstract-logical, systematic, statistical, study of documents. The main results of research. Unsolved crime has specific legal, statistical and informational na-ture as the crime phenomenon, which is expressed in cumulative statistical population of unsolved crimes. An array of unsolved crimes is the sum of the number of acts, things of which is suspended and not terminated. The fault of the perpetrator in these cases is not proven, they are not considered by the court, it is not a conviction. Unsolved crime must be registered. Latent crime has a different informational nature. The main symptom of latent crimes is the uncertainty for the subjects of law enforcement, which delegated functions of identification, registration and accounting. Latent crime is not recorded. At the same time, there is a "border" area between the latent and unsolved crimes, which includes covered from the account of the crime. In modern Russia the majority of crimes covered from accounting by passing the decision about refusal in excitation of criminal case. Unsolved crime on their criminogenic consequences represents a significant danger to the public is higher compared to latent crime.It is conducted in the article a special analysis of the differences and similarities in the unsolved latent crime for the first time in criminological literature.The analysis proves the need for radical changes in the current Russian assessment of the state of crime and law enforcement to solve crimes. The article argues that an unsolved crime is a separate and, in contrast to latent crime, poorly understood phenomenon. However unsolved latent crime and have common features and areas of interaction.

  11. Medical service provider networks.

    Science.gov (United States)

    Mougeot, Michel; Naegelen, Florence

    2018-05-17

    In many countries, health insurers or health plans choose to contract either with any willing providers or with preferred providers. We compare these mechanisms when two medical services are imperfect substitutes in demand and are supplied by two different firms. In both cases, the reimbursement is higher when patients select the in-network provider(s). We show that these mechanisms yield lower prices, lower providers' and insurer's profits, and lower expense than in the uniform-reimbursement case. Whatever the degree of product differentiation, a not-for-profit insurer should prefer selective contracting and select a reimbursement such that the out-of-pocket expense is null. Although all providers join the network under any-willing-provider contracting in the absence of third-party payment, an asymmetric equilibrium may exist when this billing arrangement is implemented. Copyright © 2018 John Wiley & Sons, Ltd.

  12. Patient Similarity in Prediction Models Based on Health Data: A Scoping Review

    Science.gov (United States)

    Sharafoddini, Anis; Dubin, Joel A

    2017-01-01

    Background Physicians and health policy makers are required to make predictions during their decision making in various medical problems. Many advances have been made in predictive modeling toward outcome prediction, but these innovations target an average patient and are insufficiently adjustable for individual patients. One developing idea in this field is individualized predictive analytics based on patient similarity. The goal of this approach is to identify patients who are similar to an index patient and derive insights from the records of similar patients to provide personalized predictions.. Objective The aim is to summarize and review published studies describing computer-based approaches for predicting patients’ future health status based on health data and patient similarity, identify gaps, and provide a starting point for related future research. Methods The method involved (1) conducting the review by performing automated searches in Scopus, PubMed, and ISI Web of Science, selecting relevant studies by first screening titles and abstracts then analyzing full-texts, and (2) documenting by extracting publication details and information on context, predictors, missing data, modeling algorithm, outcome, and evaluation methods into a matrix table, synthesizing data, and reporting results. Results After duplicate removal, 1339 articles were screened in abstracts and titles and 67 were selected for full-text review. In total, 22 articles met the inclusion criteria. Within included articles, hospitals were the main source of data (n=10). Cardiovascular disease (n=7) and diabetes (n=4) were the dominant patient diseases. Most studies (n=18) used neighborhood-based approaches in devising prediction models. Two studies showed that patient similarity-based modeling outperformed population-based predictive methods. Conclusions Interest in patient similarity-based predictive modeling for diagnosis and prognosis has been growing. In addition to raw/coded health

  13. Measure of Node Similarity in Multilayer Networks.

    Directory of Open Access Journals (Sweden)

    Anders Mollgaard

    Full Text Available The weight of links in a network is often related to the similarity of the nodes. Here, we introduce a simple tunable measure for analysing the similarity of nodes across different link weights. In particular, we use the measure to analyze homophily in a group of 659 freshman students at a large university. Our analysis is based on data obtained using smartphones equipped with custom data collection software, complemented by questionnaire-based data. The network of social contacts is represented as a weighted multilayer network constructed from different channels of telecommunication as well as data on face-to-face contacts. We find that even strongly connected individuals are not more similar with respect to basic personality traits than randomly chosen pairs of individuals. In contrast, several socio-demographics variables have a significant degree of similarity. We further observe that similarity might be present in one layer of the multilayer network and simultaneously be absent in the other layers. For a variable such as gender, our measure reveals a transition from similarity between nodes connected with links of relatively low weight to dis-similarity for the nodes connected by the strongest links. We finally analyze the overlap between layers in the network for different levels of acquaintanceships.

  14. The baryonic self similarity of dark matter

    International Nuclear Information System (INIS)

    Alard, C.

    2014-01-01

    The cosmological simulations indicates that dark matter halos have specific self-similar properties. However, the halo similarity is affected by the baryonic feedback. By using momentum-driven winds as a model to represent the baryon feedback, an equilibrium condition is derived which directly implies the emergence of a new type of similarity. The new self-similar solution has constant acceleration at a reference radius for both dark matter and baryons. This model receives strong support from the observations of galaxies. The new self-similar properties imply that the total acceleration at larger distances is scale-free, the transition between the dark matter and baryons dominated regime occurs at a constant acceleration, and the maximum amplitude of the velocity curve at larger distances is proportional to M 1/4 . These results demonstrate that this self-similar model is consistent with the basics of modified Newtonian dynamics (MOND) phenomenology. In agreement with the observations, the coincidence between the self-similar model and MOND breaks at the scale of clusters of galaxies. Some numerical experiments show that the behavior of the density near the origin is closely approximated by a Einasto profile.

  15. Classification of Unknown Thermocouple Types Using Similarity Factor Measurement

    Directory of Open Access Journals (Sweden)

    Seshu K. DAMARLA

    2011-01-01

    Full Text Available In contrast to classification using PCA method, a new methodology is proposed for type identification of unknown thermocouple. The new methodology is based on calculating the degree of similarity between two multivariate datasets using two types of similarity factors. One similarity factor is based on principle component analysis and the angles between the principle component subspaces while the other is based on the Mahalanobis distance between the datasets. Datasets containing thermo-emfs against given temperature ranges are formed for each type of thermocouple (e.g. J, K, S, T, R, E, B and N type by experimentation are considered as reference datasets. Datasets corresponding to unknown type are captured. Similarity factor between the datasets one of which being the unknown type and the other being each known type are compared. When maximum similarity factor occurs, then the class of unknown type is allocated to that of known type.

  16. Natural texture retrieval based on perceptual similarity measurement

    Science.gov (United States)

    Gao, Ying; Dong, Junyu; Lou, Jianwen; Qi, Lin; Liu, Jun

    2018-04-01

    A typical texture retrieval system performs feature comparison and might not be able to make human-like judgments of image similarity. Meanwhile, it is commonly known that perceptual texture similarity is difficult to be described by traditional image features. In this paper, we propose a new texture retrieval scheme based on texture perceptual similarity. The key of the proposed scheme is that prediction of perceptual similarity is performed by learning a non-linear mapping from image features space to perceptual texture space by using Random Forest. We test the method on natural texture dataset and apply it on a new wallpapers dataset. Experimental results demonstrate that the proposed texture retrieval scheme with perceptual similarity improves the retrieval performance over traditional image features.

  17. Investigation of psychophysical similarity measures for selection of similar images in the diagnosis of clustered microcalcifications on mammograms

    Energy Technology Data Exchange (ETDEWEB)

    Muramatsu, Chisako; Li Qiang; Schmidt, Robert; Shiraishi, Junji; Doi, Kunio [Department of Radiology, University of Chicago, 5841 South Maryland Avenue, Chicago, Illinois 60637 (United States) and Department of Intelligent Image Information, Gifu University, 1-1 Yanagido, Gifu (Japan); Department of Radiology, Duke Advanced Imaging Labs, Duke University, 2424 Erwin Road, Suite 302, Durham, North Carolina 27705 (United States); Department of Radiology, University of Chicago, 5841 South Maryland Avenue, Chicago, Illinois 60637 (United States)

    2008-12-15

    The presentation of images with lesions of known pathology that are similar to an unknown lesion may be helpful to radiologists in the diagnosis of challenging cases for improving the diagnostic accuracy and also for reducing variation among different radiologists. The authors have been developing a computerized scheme for automatically selecting similar images with clustered microcalcifications on mammograms from a large database. For similar images to be useful, they must be similar from the point of view of the diagnosing radiologists. In order to select such images, subjective similarity ratings were obtained for a number of pairs of clustered microcalcifications by breast radiologists for establishment of a ''gold standard'' of image similarity, and the gold standard was employed for determination and evaluation of the selection of similar images. The images used in this study were obtained from the Digital Database for Screening Mammography developed by the University of South Florida. The subjective similarity ratings for 300 pairs of images with clustered microcalcifications were determined by ten breast radiologists. The authors determined a number of image features which represent the characteristics of clustered microcalcifications that radiologists would use in their diagnosis. For determination of objective similarity measures, an artificial neural network (ANN) was employed. The ANN was trained with the average subjective similarity ratings as teacher and selected image features as input data. The ANN was trained to learn the relationship between the image features and the radiologists' similarity ratings; therefore, once the training was completed, the ANN was able to determine the similarity, called a psychophysical similarity measure, which was expected to be close to radiologists' impressions, for an unknown pair of clustered microcalcifications. By use of a leave-one-out test method, the best combination of features

  18. Investigation of psychophysical similarity measures for selection of similar images in the diagnosis of clustered microcalcifications on mammograms

    International Nuclear Information System (INIS)

    Muramatsu, Chisako; Li Qiang; Schmidt, Robert; Shiraishi, Junji; Doi, Kunio

    2008-01-01

    The presentation of images with lesions of known pathology that are similar to an unknown lesion may be helpful to radiologists in the diagnosis of challenging cases for improving the diagnostic accuracy and also for reducing variation among different radiologists. The authors have been developing a computerized scheme for automatically selecting similar images with clustered microcalcifications on mammograms from a large database. For similar images to be useful, they must be similar from the point of view of the diagnosing radiologists. In order to select such images, subjective similarity ratings were obtained for a number of pairs of clustered microcalcifications by breast radiologists for establishment of a ''gold standard'' of image similarity, and the gold standard was employed for determination and evaluation of the selection of similar images. The images used in this study were obtained from the Digital Database for Screening Mammography developed by the University of South Florida. The subjective similarity ratings for 300 pairs of images with clustered microcalcifications were determined by ten breast radiologists. The authors determined a number of image features which represent the characteristics of clustered microcalcifications that radiologists would use in their diagnosis. For determination of objective similarity measures, an artificial neural network (ANN) was employed. The ANN was trained with the average subjective similarity ratings as teacher and selected image features as input data. The ANN was trained to learn the relationship between the image features and the radiologists' similarity ratings; therefore, once the training was completed, the ANN was able to determine the similarity, called a psychophysical similarity measure, which was expected to be close to radiologists' impressions, for an unknown pair of clustered microcalcifications. By use of a leave-one-out test method, the best combination of features was selected. The correlation

  19. Decoding Decoders: Finding Optimal Representation Spaces for Unsupervised Similarity Tasks

    OpenAIRE

    Zhelezniak, Vitalii; Busbridge, Dan; Shen, April; Smith, Samuel L.; Hammerla, Nils Y.

    2018-01-01

    Experimental evidence indicates that simple models outperform complex deep networks on many unsupervised similarity tasks. We provide a simple yet rigorous explanation for this behaviour by introducing the concept of an optimal representation space, in which semantically close symbols are mapped to representations that are close under a similarity measure induced by the model's objective function. In addition, we present a straightforward procedure that, without any retraining or architectura...

  20. New similarity of triangular fuzzy number and its application.

    Science.gov (United States)

    Zhang, Xixiang; Ma, Weimin; Chen, Liping

    2014-01-01

    The similarity of triangular fuzzy numbers is an important metric for application of it. There exist several approaches to measure similarity of triangular fuzzy numbers. However, some of them are opt to be large. To make the similarity well distributed, a new method SIAM (Shape's Indifferent Area and Midpoint) to measure triangular fuzzy number is put forward, which takes the shape's indifferent area and midpoint of two triangular fuzzy numbers into consideration. Comparison with other similarity measurements shows the effectiveness of the proposed method. Then, it is applied to collaborative filtering recommendation to measure users' similarity. A collaborative filtering case is used to illustrate users' similarity based on cloud model and triangular fuzzy number; the result indicates that users' similarity based on triangular fuzzy number can obtain better discrimination. Finally, a simulated collaborative filtering recommendation system is developed which uses cloud model and triangular fuzzy number to express users' comprehensive evaluation on items, and result shows that the accuracy of collaborative filtering recommendation based on triangular fuzzy number is higher.

  1. On self-similarity of crack layer

    Science.gov (United States)

    Botsis, J.; Kunin, B.

    1987-01-01

    The crack layer (CL) theory of Chudnovsky (1986), based on principles of thermodynamics of irreversible processes, employs a crucial hypothesis of self-similarity. The self-similarity hypothesis states that the value of the damage density at a point x of the active zone at a time t coincides with that at the corresponding point in the initial (t = 0) configuration of the active zone, the correspondence being given by a time-dependent affine transformation of the space variables. In this paper, the implications of the self-similarity hypothesis for qusi-static CL propagation is investigated using polystyrene as a model material and examining the evolution of damage distribution along the trailing edge which is approximated by a straight segment perpendicular to the crack path. The results support the self-similarity hypothesis adopted by the CL theory.

  2. Bilateral Trade Flows and Income Distribution Similarity

    Science.gov (United States)

    2016-01-01

    Current models of bilateral trade neglect the effects of income distribution. This paper addresses the issue by accounting for non-homothetic consumer preferences and hence investigating the role of income distribution in the context of the gravity model of trade. A theoretically justified gravity model is estimated for disaggregated trade data (Dollar volume is used as dependent variable) using a sample of 104 exporters and 108 importers for 1980–2003 to achieve two main goals. We define and calculate new measures of income distribution similarity and empirically confirm that greater similarity of income distribution between countries implies more trade. Using distribution-based measures as a proxy for demand similarities in gravity models, we find consistent and robust support for the hypothesis that countries with more similar income-distributions trade more with each other. The hypothesis is also confirmed at disaggregated level for differentiated product categories. PMID:27137462

  3. Lagrangian-similarity diffusion-deposition model

    International Nuclear Information System (INIS)

    Horst, T.W.

    1979-01-01

    A Lagrangian-similarity diffusion model has been incorporated into the surface-depletion deposition model. This model predicts vertical concentration profiles far downwind of the source that agree with those of a one-dimensional gradient-transfer model

  4. Similarity search processing. Paralelization and indexing technologies.

    Directory of Open Access Journals (Sweden)

    Eder Dos Santos

    2015-08-01

    The next Scientific-Technical Report addresses the similarity search and the implementation of metric structures on parallel environments. It also presents the state of the art related to similarity search on metric structures and parallelism technologies. Comparative analysis are also proposed, seeking to identify the behavior of a set of metric spaces and metric structures over processing platforms multicore-based and GPU-based.

  5. Are calanco landforms similar to river basins?

    Science.gov (United States)

    Caraballo-Arias, N A; Ferro, V

    2017-12-15

    In the past badlands have been often considered as ideal field laboratories for studying landscape evolution because of their geometrical similarity to larger fluvial systems. For a given hydrological process, no scientific proof exists that badlands can be considered a model of river basin prototypes. In this paper the measurements carried out on 45 Sicilian calanchi, a type of badlands that appears as a small-scale hydrographic unit, are used to establish their morphological similarity with river systems whose data are available in the literature. At first the geomorphological similarity is studied by identifying the dimensionless groups, which can assume the same value or a scaled one in a fixed ratio, representing drainage basin shape, stream network and relief properties. Then, for each property, the dimensionless groups are calculated for the investigated calanchi and the river basins and their corresponding scale ratio is evaluated. The applicability of Hack's, Horton's and Melton's laws for establishing similarity criteria is also tested. The developed analysis allows to conclude that a quantitative morphological similarity between calanco landforms and river basins can be established using commonly applied dimensionless groups. In particular, the analysis showed that i) calanchi and river basins have a geometrically similar shape respect to the parameters Rf and Re with a scale factor close to 1, ii) calanchi and river basins are similar respect to the bifurcation and length ratios (λ=1), iii) for the investigated calanchi the Melton number assumes values less than that (0.694) corresponding to the river case and a scale ratio ranging from 0.52 and 0.78 can be used, iv) calanchi and river basins have similar mean relief ratio values (λ=1.13) and v) calanchi present active geomorphic processes and therefore fall in a more juvenile stage with respect to river basins. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Providing free autopoweroff plugs

    DEFF Research Database (Denmark)

    Jensen, Carsten Lynge; Hansen, Lars Gårn; Fjordbak, Troels

    2012-01-01

    Experimental evidence of the effect of providing households with cheap energy saving technology is sparse. We present results from a field experiment in which autopoweroff plugs were provided free of charge to randomly selected households. We use propensity score matching to find treatment effects...

  7. Concept similarity in publications precedes cross-disciplinary collaboration.

    Science.gov (United States)

    Post, Andrew R; Harrison, James H

    2008-11-06

    Innovative science frequently occurs as a result of cross-disciplinary collaboration, the importance of which is reflected by recent NIH funding initiatives that promote communication and collaboration. If shared research interests between collaborators are important for the formation of collaborations,methods for identifying these shared interests across scientific domains could potentially reveal new and useful collaboration opportunities. MEDLINE represents a comprehensive database of collaborations and research interests, as reflected by article co-authors and concept content. We analyzed six years of citations using information retrieval based methods to compute articles conceptual similarity, and found that articles by basic and clinical scientists who later collaborated had significantly higher average similarity than articles by similar scientists who did not collaborate.Refinement of these methods and characterization of found conceptual overlaps could allow automated discovery of collaboration opportunities that are currently missed.

  8. Identifying mechanistic similarities in drug responses

    KAUST Repository

    Zhao, C.

    2012-05-15

    Motivation: In early drug development, it would be beneficial to be able to identify those dynamic patterns of gene response that indicate that drugs targeting a particular gene will be likely or not to elicit the desired response. One approach would be to quantitate the degree of similarity between the responses that cells show when exposed to drugs, so that consistencies in the regulation of cellular response processes that produce success or failure can be more readily identified.Results: We track drug response using fluorescent proteins as transcription activity reporters. Our basic assumption is that drugs inducing very similar alteration in transcriptional regulation will produce similar temporal trajectories on many of the reporter proteins and hence be identified as having similarities in their mechanisms of action (MOA). The main body of this work is devoted to characterizing similarity in temporal trajectories/signals. To do so, we must first identify the key points that determine mechanistic similarity between two drug responses. Directly comparing points on the two signals is unrealistic, as it cannot handle delays and speed variations on the time axis. Hence, to capture the similarities between reporter responses, we develop an alignment algorithm that is robust to noise, time delays and is able to find all the contiguous parts of signals centered about a core alignment (reflecting a core mechanism in drug response). Applying the proposed algorithm to a range of real drug experiments shows that the result agrees well with the prior drug MOA knowledge. © The Author 2012. Published by Oxford University Press. All rights reserved.

  9. Credential Service Provider (CSP)

    Data.gov (United States)

    Department of Veterans Affairs — Provides a VA operated Level 1 and Level 2 credential for individuals who require access to VA applications, yet cannot obtain a credential from another VA accepted...

  10. MAX Provider Characteristics

    Data.gov (United States)

    U.S. Department of Health & Human Services — The MAX Provider Characteristics (PC) File Implementation Report describes the design, implementation, and results of the MAXPC prototype, which was based on three...

  11. An integrated multicriteria decision-making approach for evaluating nuclear fuel cycle systems for long-term sustainability on the basis of an equilibrium model: Technique for order of preference by similarity to ideal solution, preference ranking organization method for enrichment evaluation, and multiattribute utility theory combined with analytic hierarchy process

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Sae Rom [Dept of Quantum Energy Chemical Engineering, Korea University of Science and Technology (KUST), Daejeon (Korea, Republic of); Choi, Sung Yeol [Ulsan National Institute of Science and Technology, Ulju (Korea, Republic of); Ko, Wonil [Nonproliferation System Development Division, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2017-02-15

    The focus on the issues surrounding spent nuclear fuel and lifetime extension of old nuclear power plants continues to grow nowadays. A transparent decision-making process to identify the best suitable nuclear fuel cycle (NFC) is considered to be the key task in the current situation. Through this study, an attempt is made to develop an equilibrium model for the NFC to calculate the material flows based on 1 TWh of electricity production, and to perform integrated multicriteria decision-making method analyses via the analytic hierarchy process technique for order of preference by similarity to ideal solution, preference ranking organization method for enrichment evaluation, and multiattribute utility theory methods. This comparative study is aimed at screening and ranking the three selected NFC options against five aspects: sustainability, environmental friendliness, economics, proliferation resistance, and technical feasibility. The selected fuel cycle options include pressurized water reactor (PWR) once-through cycle, PWR mixed oxide cycle, or pyroprocessing sodium-cooled fast reactor cycle. A sensitivity analysis was performed to prove the robustness of the results and explore the influence of criteria on the obtained ranking. As a result of the comparative analysis, the pyroprocessing sodium-cooled fast reactor cycle is determined to be the most competitive option among the NFC scenarios.

  12. An integrated multicriteria decision-making approach for evaluating nuclear fuel cycle systems for long-term sustainability on the basis of an equilibrium model: Technique for order of preference by similarity to ideal solution, preference ranking organization method for enrichment evaluation, and multiattribute utility theory combined with analytic hierarchy process

    International Nuclear Information System (INIS)

    Yoon, Sae Rom; Choi, Sung Yeol; Ko, Wonil

    2017-01-01

    The focus on the issues surrounding spent nuclear fuel and lifetime extension of old nuclear power plants continues to grow nowadays. A transparent decision-making process to identify the best suitable nuclear fuel cycle (NFC) is considered to be the key task in the current situation. Through this study, an attempt is made to develop an equilibrium model for the NFC to calculate the material flows based on 1 TWh of electricity production, and to perform integrated multicriteria decision-making method analyses via the analytic hierarchy process technique for order of preference by similarity to ideal solution, preference ranking organization method for enrichment evaluation, and multiattribute utility theory methods. This comparative study is aimed at screening and ranking the three selected NFC options against five aspects: sustainability, environmental friendliness, economics, proliferation resistance, and technical feasibility. The selected fuel cycle options include pressurized water reactor (PWR) once-through cycle, PWR mixed oxide cycle, or pyroprocessing sodium-cooled fast reactor cycle. A sensitivity analysis was performed to prove the robustness of the results and explore the influence of criteria on the obtained ranking. As a result of the comparative analysis, the pyroprocessing sodium-cooled fast reactor cycle is determined to be the most competitive option among the NFC scenarios

  13. An Integrated Multicriteria Decision-Making Approach for Evaluating Nuclear Fuel Cycle Systems for Long-term Sustainability on the Basis of an Equilibrium Model: Technique for Order of Preference by Similarity to Ideal Solution, Preference Ranking Organization Method for Enrichment Evaluation, and Multiattribute Utility Theory Combined with Analytic Hierarchy Process

    Directory of Open Access Journals (Sweden)

    Saerom Yoon

    2017-02-01

    Full Text Available The focus on the issues surrounding spent nuclear fuel and lifetime extension of old nuclear power plants continues to grow nowadays. A transparent decision-making process to identify the best suitable nuclear fuel cycle (NFC is considered to be the key task in the current situation. Through this study, an attempt is made to develop an equilibrium model for the NFC to calculate the material flows based on 1 TWh of electricity production, and to perform integrated multicriteria decision-making method analyses via the analytic hierarchy process technique for order of preference by similarity to ideal solution, preference ranking organization method for enrichment evaluation, and multiattribute utility theory methods. This comparative study is aimed at screening and ranking the three selected NFC options against five aspects: sustainability, environmental friendliness, economics, proliferation resistance, and technical feasibility. The selected fuel cycle options include pressurized water reactor (PWR once-through cycle, PWR mixed oxide cycle, or pyroprocessing sodium-cooled fast reactor cycle. A sensitivity analysis was performed to prove the robustness of the results and explore the influence of criteria on the obtained ranking. As a result of the comparative analysis, the pyroprocessing sodium-cooled fast reactor cycle is determined to be the most competitive option among the NFC scenarios.

  14. Clustering by reordering of similarity and Laplacian matrices: Application to galaxy clusters

    Science.gov (United States)

    Mahmoud, E.; Shoukry, A.; Takey, A.

    2018-04-01

    Similarity metrics, kernels and similarity-based algorithms have gained much attention due to their increasing applications in information retrieval, data mining, pattern recognition and machine learning. Similarity Graphs are often adopted as the underlying representation of similarity matrices and are at the origin of known clustering algorithms such as spectral clustering. Similarity matrices offer the advantage of working in object-object (two-dimensional) space where visualization of clusters similarities is available instead of object-features (multi-dimensional) space. In this paper, sparse ɛ-similarity graphs are constructed and decomposed into strong components using appropriate methods such as Dulmage-Mendelsohn permutation (DMperm) and/or Reverse Cuthill-McKee (RCM) algorithms. The obtained strong components correspond to groups (clusters) in the input (feature) space. Parameter ɛi is estimated locally, at each data point i from a corresponding narrow range of the number of nearest neighbors. Although more advanced clustering techniques are available, our method has the advantages of simplicity, better complexity and direct visualization of the clusters similarities in a two-dimensional space. Also, no prior information about the number of clusters is needed. We conducted our experiments on two and three dimensional, low and high-sized synthetic datasets as well as on an astronomical real-dataset. The results are verified graphically and analyzed using gap statistics over a range of neighbors to verify the robustness of the algorithm and the stability of the results. Combining the proposed algorithm with gap statistics provides a promising tool for solving clustering problems. An astronomical application is conducted for confirming the existence of 45 galaxy clusters around the X-ray positions of galaxy clusters in the redshift range [0.1..0.8]. We re-estimate the photometric redshifts of the identified galaxy clusters and obtain acceptable values

  15. Improving glycaemic control and life skills in adolescents with type 1 diabetes: A randomised, controlled intervention study using the Guided Self-Determination-Young method in triads of adolescents, parents and health care providers integrated into routine paediatric outpatient clinics

    Directory of Open Access Journals (Sweden)

    Esbensen Bente

    2011-06-01

    Full Text Available Abstract Background Adolescents with type 1 diabetes face demanding challenges due to conflicting priorities between psychosocial needs and diabetes management. This conflict often results in poor glycaemic control and discord between adolescents and parents. Adolescent-parent conflicts are thus a barrier for health care providers (HCPs to overcome in their attempts to involve both adolescents and parents in improvement of glycaemic control. Evidence-based interventions that involve all three parties (i.e., adolescents, parents and HCPs and are integrated into routine outpatient clinic visits are lacking. The Guided Self-Determination method is proven effective in adult care and has been adapted to adolescents and parents (Guided Self-Determination-Young (GSD-Y for use in paediatric diabetes outpatient clinics. Our objective is to test whether GSD-Y used in routine paediatric outpatient clinic visits will reduce haemoglobin A1c (HbA1c concentrations and improve adolescents' life skills compared with a control group. Methods/Design Using a mixed methods design comprising a randomised controlled trial and a nested qualitative evaluation, we will recruit 68 adolescents age 13 - 18 years with type 1 diabetes (HbA1c > 8.0% and their parents from 2 Danish hospitals and randomise into GSD-Y or control groups. During an 8-12 month period, the GSD-Y group will complete 8 outpatient GSD-Y visits, and the control group will completes an equal number of standard visits. The primary outcome is HbA1c. Secondary outcomes include the following: number of self-monitored blood glucose values and levels of autonomous motivation, involvement and autonomy support from parents, autonomy support from HCPs, perceived competence in managing diabetes, well-being, and diabetes-related problems. Primary and secondary outcomes will be evaluated within and between groups by comparing data from baseline, after completion of the visits, and again after a 6-month follow-up. To

  16. Measure of Node Similarity in Multilayer Networks

    DEFF Research Database (Denmark)

    Møllgaard, Anders; Zettler, Ingo; Dammeyer, Jesper

    2016-01-01

    The weight of links in a network is often related to the similarity of thenodes. Here, we introduce a simple tunable measure for analysing the similarityof nodes across different link weights. In particular, we use the measure toanalyze homophily in a group of 659 freshman students at a large...... university.Our analysis is based on data obtained using smartphones equipped with customdata collection software, complemented by questionnaire-based data. The networkof social contacts is represented as a weighted multilayer network constructedfrom different channels of telecommunication as well as data...... might bepresent in one layer of the multilayer network and simultaneously be absent inthe other layers. For a variable such as gender, our measure reveals atransition from similarity between nodes connected with links of relatively lowweight to dis-similarity for the nodes connected by the strongest...

  17. A Novel Hybrid Similarity Calculation Model

    Directory of Open Access Journals (Sweden)

    Xiaoping Fan

    2017-01-01

    Full Text Available This paper addresses the problems of similarity calculation in the traditional recommendation algorithms of nearest neighbor collaborative filtering, especially the failure in describing dynamic user preference. Proceeding from the perspective of solving the problem of user interest drift, a new hybrid similarity calculation model is proposed in this paper. This model consists of two parts, on the one hand the model uses the function fitting to describe users’ rating behaviors and their rating preferences, and on the other hand it employs the Random Forest algorithm to take user attribute features into account. Furthermore, the paper combines the two parts to build a new hybrid similarity calculation model for user recommendation. Experimental results show that, for data sets of different size, the model’s prediction precision is higher than the traditional recommendation algorithms.

  18. Universal self-similarity of propagating populations.

    Science.gov (United States)

    Eliazar, Iddo; Klafter, Joseph

    2010-07-01

    This paper explores the universal self-similarity of propagating populations. The following general propagation model is considered: particles are randomly emitted from the origin of a d-dimensional Euclidean space and propagate randomly and independently of each other in space; all particles share a statistically common--yet arbitrary--motion pattern; each particle has its own random propagation parameters--emission epoch, motion frequency, and motion amplitude. The universally self-similar statistics of the particles' displacements and first passage times (FPTs) are analyzed: statistics which are invariant with respect to the details of the displacement and FPT measurements and with respect to the particles' underlying motion pattern. Analysis concludes that the universally self-similar statistics are governed by Poisson processes with power-law intensities and by the Fréchet and Weibull extreme-value laws.

  19. Universal self-similarity of propagating populations

    Science.gov (United States)

    Eliazar, Iddo; Klafter, Joseph

    2010-07-01

    This paper explores the universal self-similarity of propagating populations. The following general propagation model is considered: particles are randomly emitted from the origin of a d -dimensional Euclidean space and propagate randomly and independently of each other in space; all particles share a statistically common—yet arbitrary—motion pattern; each particle has its own random propagation parameters—emission epoch, motion frequency, and motion amplitude. The universally self-similar statistics of the particles’ displacements and first passage times (FPTs) are analyzed: statistics which are invariant with respect to the details of the displacement and FPT measurements and with respect to the particles’ underlying motion pattern. Analysis concludes that the universally self-similar statistics are governed by Poisson processes with power-law intensities and by the Fréchet and Weibull extreme-value laws.

  20. Similarity joins in relational database systems

    CERN Document Server

    Augsten, Nikolaus

    2013-01-01

    State-of-the-art database systems manage and process a variety of complex objects, including strings and trees. For such objects equality comparisons are often not meaningful and must be replaced by similarity comparisons. This book describes the concepts and techniques to incorporate similarity into database systems. We start out by discussing the properties of strings and trees, and identify the edit distance as the de facto standard for comparing complex objects. Since the edit distance is computationally expensive, token-based distances have been introduced to speed up edit distance comput

  1. Measure of Node Similarity in Multilayer Networks

    DEFF Research Database (Denmark)

    Møllgaard, Anders; Zettler, Ingo; Dammeyer, Jesper

    2016-01-01

    university.Our analysis is based on data obtained using smartphones equipped with customdata collection software, complemented by questionnaire-based data. The networkof social contacts is represented as a weighted multilayer network constructedfrom different channels of telecommunication as well as data...... might bepresent in one layer of the multilayer network and simultaneously be absent inthe other layers. For a variable such as gender, our measure reveals atransition from similarity between nodes connected with links of relatively lowweight to dis-similarity for the nodes connected by the strongest...

  2. Cultural similarity and adjustment of expatriate academics

    DEFF Research Database (Denmark)

    Selmer, Jan; Lauring, Jakob

    2009-01-01

    The findings of a number of recent empirical studies of business expatriates, using different samples and methodologies, seem to support the counter-intuitive proposition that cultural similarity may be as difficult to adjust to as cultural dissimilarity. However, it is not obvious...... and non-EU countries. Results showed that although the perceived cultural similarity between host and home country for the two groups of investigated respondents was different, there was neither any difference in their adjustment nor in the time it took for them to become proficient. Implications...

  3. Vere-Jones' self-similar branching model

    International Nuclear Information System (INIS)

    Saichev, A.; Sornette, D.

    2005-01-01

    Motivated by its potential application to earthquake statistics as well as for its intrinsic interest in the theory of branching processes, we study the exactly self-similar branching process introduced recently by Vere-Jones. This model extends the ETAS class of conditional self-excited branching point-processes of triggered seismicity by removing the problematic need for a minimum (as well as maximum) earthquake size. To make the theory convergent without the need for the usual ultraviolet and infrared cutoffs, the distribution of magnitudes m ' of daughters of first-generation of a mother of magnitude m has two branches m ' ' >m with exponent β+d, where β and d are two positive parameters. We investigate the condition and nature of the subcritical, critical, and supercritical regime in this and in an extended version interpolating smoothly between several models. We predict that the distribution of magnitudes of events triggered by a mother of magnitude m over all generations has also two branches m ' ' >m with exponent β+h, with h=d√(1-s), where s is the fraction of triggered events. This corresponds to a renormalization of the exponent d into h by the hierarchy of successive generations of triggered events. For a significant part of the parameter space, the distribution of magnitudes over a full catalog summed over an average steady flow of spontaneous sources (immigrants) reproduces the distribution of the spontaneous sources with a single branch and is blind to the exponents β,d of the distribution of triggered events. Since the distribution of earthquake magnitudes is usually obtained with catalogs including many sequences, we conclude that the two branches of the distribution of aftershocks are not directly observable and the model is compatible with real seismic catalogs. In summary, the exactly self-similar Vere-Jones model provides an attractive new approach to model triggered seismicity, which alleviates delicate questions on the role of

  4. Provider software buyer's guide.

    Science.gov (United States)

    1994-03-01

    To help long term care providers find new ways to improve quality of care and efficiency, Provider magazine presents the fourth annual listing of software firms marketing computer programs for all areas of nursing facility operations. On the following five pages, more than 80 software firms display their wares, with programs such as minimum data set and care planning, dietary, accounting and financials, case mix, and medication administration records. The guide also charts compatible hardware, integration ability, telephone numbers, company contacts, and easy-to-use reader service numbers.

  5. Nuclear markers reveal that inter-lake cichlids' similar morphologies do not reflect similar genealogy.

    Science.gov (United States)

    Kassam, Daud; Seki, Shingo; Horic, Michio; Yamaoka, Kosaku

    2006-08-01

    The apparent inter-lake morphological similarity among East African Great Lakes' cichlid species/genera has left evolutionary biologists asking whether such similarity is due to sharing of common ancestor or mere convergent evolution. In order to answer such question, we first used Geometric Morphometrics, GM, to quantify morphological similarity and then subsequently used Amplified Fragment Length Polymorphism, AFLP, to determine if similar morphologies imply shared ancestry or convergent evolution. GM revealed that not all presumed morphological similar pairs were indeed similar, and the dendrogram generated from AFLP data indicated distinct clusters corresponding to each lake and not inter-lake morphological similar pairs. Such results imply that the morphological similarity is due to convergent evolution and not shared ancestry. The congruency of GM and AFLP generated dendrograms imply that GM is capable of picking up phylogenetic signal, and thus GM can be potential tool in phylogenetic systematics.

  6. Retrospective group fusion similarity search based on eROCE evaluation metric.

    Science.gov (United States)

    Avram, Sorin I; Crisan, Luminita; Bora, Alina; Pacureanu, Liliana M; Avram, Stefana; Kurunczi, Ludovic

    2013-03-01

    In this study, a simple evaluation metric, denoted as eROCE was proposed to measure the early enrichment of predictive methods. We demonstrated the superior robustness of eROCE compared to other known metrics throughout several active to inactive ratios ranging from 1:10 to 1:1000. Group fusion similarity search was investigated by varying 16 similarity coefficients, five molecular representations (binary and non-binary) and two group fusion rules using two reference structure set sizes. We used a dataset of 3478 actives and 43,938 inactive molecules and the enrichment was analyzed by means of eROCE. This retrospective study provides optimal similarity search parameters in the case of ALDH1A1 inhibitors. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. What HERA may provide?

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Hannes [DESY, Hamburg (Germany); De Roeck, Albert [CERN, Genf (Switzerland); Bartles, Jochen [Univ. Hamburg (DE). Institut fuer Theoretische Physik II] (and others)

    2008-09-15

    More than 100 people participated in a discussion session at the DIS08 workshop on the topic What HERA may provide. A summary of the discussion with a structured outlook and list of desirable measurements and theory calculations is given. (orig.)

  8. What HERA may provide?

    International Nuclear Information System (INIS)

    Jung, Hannes; De Roeck, Albert; Bartles, Jochen

    2008-09-01

    More than 100 people participated in a discussion session at the DIS08 workshop on the topic What HERA may provide. A summary of the discussion with a structured outlook and list of desirable measurements and theory calculations is given. (orig.)

  9. Provider of Services File

    Data.gov (United States)

    U.S. Department of Health & Human Services — The POS file consists of two data files, one for CLIA labs and one for 18 other provider types. The file names are CLIA and OTHER. If downloading the file, note it...

  10. A Feature-Based Structural Measure: An Image Similarity Measure for Face Recognition

    Directory of Open Access Journals (Sweden)

    Noor Abdalrazak Shnain

    2017-08-01

    Full Text Available Facial recognition is one of the most challenging and interesting problems within the field of computer vision and pattern recognition. During the last few years, it has gained special attention due to its importance in relation to current issues such as security, surveillance systems and forensics analysis. Despite this high level of attention to facial recognition, the success is still limited by certain conditions; there is no method which gives reliable results in all situations. In this paper, we propose an efficient similarity index that resolves the shortcomings of the existing measures of feature and structural similarity. This measure, called the Feature-Based Structural Measure (FSM, combines the best features of the well-known SSIM (structural similarity index measure and FSIM (feature similarity index measure approaches, striking a balance between performance for similar and dissimilar images of human faces. In addition to the statistical structural properties provided by SSIM, edge detection is incorporated in FSM as a distinctive structural feature. Its performance is tested for a wide range of PSNR (peak signal-to-noise ratio, using ORL (Olivetti Research Laboratory, now AT&T Laboratory Cambridge and FEI (Faculty of Industrial Engineering, São Bernardo do Campo, São Paulo, Brazil databases. The proposed measure is tested under conditions of Gaussian noise; simulation results show that the proposed FSM outperforms the well-known SSIM and FSIM approaches in its efficiency of similarity detection and recognition of human faces.

  11. 7 CFR 51.1997 - Similar type.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Similar type. 51.1997 Section 51.1997 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946...

  12. Efficient Similarity Retrieval in Music Databases

    DEFF Research Database (Denmark)

    Ruxanda, Maria Magdalena; Jensen, Christian Søndergaard

    2006-01-01

    Audio music is increasingly becoming available in digital form, and the digital music collections of individuals continue to grow. Addressing the need for effective means of retrieving music from such collections, this paper proposes new techniques for content-based similarity search. Each music...

  13. Similarity search of business process models

    NARCIS (Netherlands)

    Dumas, M.; García-Bañuelos, L.; Dijkman, R.M.

    2009-01-01

    Similarity search is a general class of problems in which a given object, called a query object, is compared against a collection of objects in order to retrieve those that most closely resemble the query object. This paper reviews recent work on an instance of this class of problems, where the

  14. Cross-kingdom similarities in microbiome functions

    NARCIS (Netherlands)

    Mendes, R.; Raaijmakers, J.M.

    2015-01-01

    Recent advances in medical research have revealed how humans rely on their microbiome for diverse traits and functions. Similarly, microbiomes of other higher organisms play key roles in disease, health, growth and development of their host. Exploring microbiome functions across kingdoms holds

  15. Measuring structural similarity in large online networks.

    Science.gov (United States)

    Shi, Yongren; Macy, Michael

    2016-09-01

    Structural similarity based on bipartite graphs can be used to detect meaningful communities, but the networks have been tiny compared to massive online networks. Scalability is important in applications involving tens of millions of individuals with highly skewed degree distributions. Simulation analysis holding underlying similarity constant shows that two widely used measures - Jaccard index and cosine similarity - are biased by the distribution of out-degree in web-scale networks. However, an alternative measure, the Standardized Co-incident Ratio (SCR), is unbiased. We apply SCR to members of Congress, musical artists, and professional sports teams to show how massive co-following on Twitter can be used to map meaningful affiliations among cultural entities, even in the absence of direct connections to one another. Our results show how structural similarity can be used to map cultural alignments and demonstrate the potential usefulness of social media data in the study of culture, politics, and organizations across the social and behavioral sciences. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Phonological Similarity in American Sign Language.

    Science.gov (United States)

    Hildebrandt, Ursula; Corina, David

    2002-01-01

    Investigates deaf and hearing subjects' ratings of American Sign Language (ASL) signs to assess whether linguistic experience shapes judgments of sign similarity. Findings are consistent with linguistic theories that posit movement and location as core structural elements of syllable structure in ASL. (Author/VWL)

  17. Structural similarity and category-specificity

    DEFF Research Database (Denmark)

    Gerlach, Christian; Law, Ian; Paulson, Olaf B

    2004-01-01

    It has been suggested that category-specific recognition disorders for natural objects may reflect that natural objects are more structurally (visually) similar than artefacts and therefore more difficult to recognize following brain damage. On this account one might expect a positive relationshi...

  18. Measurement of Similarity in Academic Contexts

    Directory of Open Access Journals (Sweden)

    Omid Mahian

    2017-06-01

    Full Text Available We propose some reflections, comments and suggestions about the measurement of similar and matched content in scientific papers and documents, and the need to develop appropriate tools and standards for an ethically fair and equitable treatment of authors.

  19. Similarity of Experience and Empathy in Preschoolers.

    Science.gov (United States)

    Barnett, Mark A.

    The present study examined the role of similarity of experience in young children's affective reactions to others. Some preschoolers played one of two games (Puzzle Board or Buckets) and were informed that they had either failed or succeeded; others merely observed the games being played and were given no evaluative feedback. Subsequently, each…

  20. Cultural Similarities and Differences on Idiom Translation

    Institute of Scientific and Technical Information of China (English)

    黄频频; 陈于全

    2010-01-01

    Both English and Chinese are abound with idioms. Idioms are an important part of the hnguage and culture of a society. English and Chinese idioms carved with cultural characteristics account for a great part in the tramlation. This paper studies the translation of idioms concerning their cultural similarities, cultural differences and transhtion principles.

  1. Learning by similarity in coordination problems

    Czech Academy of Sciences Publication Activity Database

    Steiner, Jakub; Stewart, C.

    -, č. 324 (2007), s. 1-40 ISSN 1211-3298 R&D Projects: GA MŠk LC542 Institutional research plan: CEZ:AV0Z70850503 Keywords : similarity * learning * case-based reasoning Subject RIV: AH - Economics http://www.cerge-ei.cz/pdf/wp/Wp324.pdf

  2. Outsourced similarity search on metric data assets

    KAUST Repository

    Yiu, Man Lung; Assent, Ira; Jensen, Christian Sø ndergaard; Kalnis, Panos

    2012-01-01

    for the most similar data objects to a query example. Outsourcing offers the data owner scalability and a low-initial investment. The need for privacy may be due to the data being sensitive (e.g., in medicine), valuable (e.g., in astronomy), or otherwise

  3. Protein structure similarity from principle component correlation analysis

    Directory of Open Access Journals (Sweden)

    Chou James

    2006-01-01

    Full Text Available Abstract Background Owing to rapid expansion of protein structure databases in recent years, methods of structure comparison are becoming increasingly effective and important in revealing novel information on functional properties of proteins and their roles in the grand scheme of evolutionary biology. Currently, the structural similarity between two proteins is measured by the root-mean-square-deviation (RMSD in their best-superimposed atomic coordinates. RMSD is the golden rule of measuring structural similarity when the structures are nearly identical; it, however, fails to detect the higher order topological similarities in proteins evolved into different shapes. We propose new algorithms for extracting geometrical invariants of proteins that can be effectively used to identify homologous protein structures or topologies in order to quantify both close and remote structural similarities. Results We measure structural similarity between proteins by correlating the principle components of their secondary structure interaction matrix. In our approach, the Principle Component Correlation (PCC analysis, a symmetric interaction matrix for a protein structure is constructed with relationship parameters between secondary elements that can take the form of distance, orientation, or other relevant structural invariants. When using a distance-based construction in the presence or absence of encoded N to C terminal sense, there are strong correlations between the principle components of interaction matrices of structurally or topologically similar proteins. Conclusion The PCC method is extensively tested for protein structures that belong to the same topological class but are significantly different by RMSD measure. The PCC analysis can also differentiate proteins having similar shapes but different topological arrangements. Additionally, we demonstrate that when using two independently defined interaction matrices, comparison of their maximum

  4. Extending the Similarity-Attraction Effect : The effects of When-Similarity in mediated communication

    NARCIS (Netherlands)

    Kaptein, M.C.; Castaneda, D.; Fernandez, N.; Nass, C.

    2014-01-01

    The feeling of connectedness experienced in computer-mediated relationships can be explained by the similarity-attraction effect (SAE). Though SAE is well established in psychology, the effects of some types of similarity have not yet been explored. In 2 studies, we demonstrate similarity-attraction

  5. A New Similarity Measure between Intuitionistic Fuzzy Sets and Its Application to Pattern Recognition

    Directory of Open Access Journals (Sweden)

    Yafei Song

    2014-01-01

    Full Text Available As a generation of ordinary fuzzy set, the concept of intuitionistic fuzzy set (IFS, characterized both by a membership degree and by a nonmembership degree, is a more flexible way to cope with the uncertainty. Similarity measures of intuitionistic fuzzy sets are used to indicate the similarity degree between intuitionistic fuzzy sets. Although many similarity measures for intuitionistic fuzzy sets have been proposed in previous studies, some of those cannot satisfy the axioms of similarity or provide counterintuitive cases. In this paper, a new similarity measure and weighted similarity measure between IFSs are proposed. It proves that the proposed similarity measures satisfy the properties of the axiomatic definition for similarity measures. Comparison between the previous similarity measures and the proposed similarity measure indicates that the proposed similarity measure does not provide any counterintuitive cases. Moreover, it is demonstrated that the proposed similarity measure is capable of discriminating difference between patterns.

  6. The exact probability law for the approximated similarity from the ...

    African Journals Online (AJOL)

    The exact probability law for the approximated similarity from the Minhashing method. Soumaila Dembele, Gane Samb Lo. Abstract. We propose a probabilistic setting in which we study the probability law of the Rajaraman and Ullman RU algorithm and a modied version of it denoted by RUM. These algorithms aim at ...

  7. Assimilation as Attraction: Computing Distance, Similarity, and Locality in Phonology

    Science.gov (United States)

    Wayment, Adam

    2009-01-01

    This dissertation explores similarity effects in assimilation, proposing an Attraction Framework to analyze cases of parasitic harmony where a trigger-target pair only results in harmony if the trigger and target agree on other features. Attraction provides a natural model of these effects by relating the pressure for assimilation to the…

  8. Building Service Provider Capabilities

    DEFF Research Database (Denmark)

    Brandl, Kristin; Jaura, Manya; Ørberg Jensen, Peter D.

    2015-01-01

    In this paper we study whether and how the interaction between clients and the service providers contributes to the development of capabilities in service provider firms. In situations where such a contribution occurs, we analyze how different types of activities in the production process...... process. We find that clients influence the development of human capital capabilities and management capabilities in reciprocally produced services. While in sequential produced services clients influence the development of organizational capital capabilities and management capital capabilities....... of the services, such as sequential or reciprocal task activities, influence the development of different types of capabilities. We study five cases of offshore-outsourced knowledge-intensive business services that are distinguished according to their reciprocal or sequential task activities in their production...

  9. Engaging with community-based public and private mid-level providers for promoting the use of modern contraceptive methods in rural Pakistan: results from two innovative birth spacing interventions.

    Science.gov (United States)

    Azmat, Syed Khurram; Hameed, Waqas; Hamza, Hasan Bin; Mustafa, Ghulam; Ishaque, Muhammad; Abbas, Ghazunfer; Khan, Omar Farooq; Asghar, Jamshaid; Munroe, Erik; Ali, Safdar; Hussain, Wajahat; Ali, Sajid; Ahmed, Aftab; Ali, Moazzam; Temmerman, Marleen

    2016-03-17

    Family planning (FP) interventions aimed at reducing population growth have negligible during the last two decades in Pakistan. Innovative FP interventions that help reduce the growing population burden are the need of the hour. Marie Stopes Society--Pakistan implemented an operational research project--'Evidence for Innovating to Save Lives', to explore effective and viable intervention models that can promote healthy timing and spacing of pregnancy in rural and under-served communities of Sindh, Punjab and Khyber Pakhtunkhwa provinces of Pakistan. We conducted a quasi-experimental (pre- and post-intervention with control arm) study to assess the effectiveness of each of the two intervention models, (1) Suraj model (meaning 'Sun' in English), which uses social franchises (SF) along with a demand-side financing (DSF) approach using free vouchers, and (2) Community Midwife (CMW) model, in promoting the use of modern contraceptive methods compared to respective controls. Baseline and endline cross-sectional household surveys were conducted, 24 months apart, by recruiting 5566 and 6316 married women of reproductive age (MWRA) respectively. We used Stata version 8 to report the net effect of interventions on outcome indicators using difference-in-differences analysis. Multivariate Cox proportional hazard regression analysis was used to assess the net effect of the intervention on current contraceptive use, keeping time constant and adjusting for other variables in the model. The Suraj model was effective in significantly increasing awareness about FP methods among MWRA by 14% percentage points, current contraceptive use by 5% percentage points and long term modern method--intrauterine device (IUD) use by 6% percentage points. The CMW model significantly increased contraceptive awareness by 28% percentage points, ever use of contraceptives by 7% percentage points and, IUD use by 3% percentage points. Additionally the Suraj intervention led to a 35% greater prevalence

  10. Providing x-rays

    International Nuclear Information System (INIS)

    Mallozzi, P.J.; Epstein, H.M.

    1985-01-01

    This invention provides an apparatus for providing x-rays to an object that may be in an ordinary environment such as air at approximately atmospheric pressure. The apparatus comprises: means (typically a laser beam) for directing energy onto a target to produce x-rays of a selected spectrum and intensity at the target; a fluid-tight enclosure around the target; means for maintaining the pressure in the first enclosure substantially below atmospheric pressure; a fluid-tight second enclosure adjoining the first enclosure, the common wall portion having an opening large enough to permit x-rays to pass through but small enough to allow the pressure reducing means to evacuate gas from the first enclosure at least as fast as it enters through the opening; the second enclosure filled with a gas that is highly transparent to x-rays; the wall of the second enclosure to which the x-rays travel having a portion that is highly transparent to x-rays (usually a beryllium or plastic foil), so that the object to which the x-rays are to be provided may be located outside the second enclosure and adjacent thereto and thus receive the x-rays substantially unimpeded by air or other intervening matter. The apparatus is particularly suited to obtaining EXAFS (extended x-ray fine structure spectroscopy) data on a material

  11. Why healthcare providers merge.

    Science.gov (United States)

    Postma, Jeroen; Roos, Anne-Fleur

    2016-04-01

    In many OECD countries, healthcare sectors have become increasingly concentrated as a result of mergers. However, detailed empirical insight into why healthcare providers merge is lacking. Also, we know little about the influence of national healthcare policies on mergers. We fill this gap in the literature by conducting a survey study on mergers among 848 Dutch healthcare executives, of which 35% responded (resulting in a study sample of 239 executives). A total of 65% of the respondents was involved in at least one merger between 2005 and 2012. During this period, Dutch healthcare providers faced a number of policy changes, including increasing competition, more pressure from purchasers, growing financial risks, de-institutionalisation of long-term care and decentralisation of healthcare services to municipalities. Our empirical study shows that healthcare providers predominantly merge to improve the provision of healthcare services and to strengthen their market position. Also efficiency and financial reasons are important drivers of merger activity in healthcare. We find that motives for merger are related to changes in health policies, in particular to the increasing pressure from competitors, insurers and municipalities.

  12. PROVIDING WOMEN, KEPT MEN

    Science.gov (United States)

    Mojola, Sanyu A

    2014-01-01

    This paper draws on ethnographic and interview based fieldwork to explore accounts of intimate relationships between widowed women and poor young men that emerged in the wake of economic crisis and a devastating HIV epidemic among the Luo ethnic group in Western Kenya. I show how the cooptation of widow inheritance practices in the wake of an overwhelming number of widows as well as economic crisis resulted in widows becoming providing women and poor young men becoming kept men. I illustrate how widows in this setting, by performing a set of practices central to what it meant to be a man in this society – pursuing and providing for their partners - were effectively doing masculinity. I will also show how young men, rather than being feminized by being kept, deployed other sets of practices to prove their masculinity and live in a manner congruent with cultural ideals. I argue that ultimately, women’s practice of masculinity in large part seemed to serve patriarchal ends. It not only facilitated the fulfillment of patriarchal expectations of femininity – to being inherited – but also served, in the end, to provide a material base for young men’s deployment of legitimizing and culturally valued sets of masculine practice. PMID:25489121

  13. Contingency and similarity in response selection.

    Science.gov (United States)

    Prinz, Wolfgang

    2018-05-09

    This paper explores issues of task representation in choice reaction time tasks. How is it possible, and what does it take, to represent such a task in a way that enables a performer to do the task in line with the prescriptions entailed in the instructions? First, a framework for task representation is outlined which combines the implementation of task sets and their use for performance with different kinds of representational operations (pertaining to feature compounds for event codes and code assemblies for task sets, respectively). Then, in a second step, the framework is itself embedded in the bigger picture of the classical debate on the roles of contingency and similarity for the formation of associations. The final conclusion is that both principles are needed and that the operation of similarity at the level of task sets requires and presupposes the operation of contingency at the level of event codes. Copyright © 2018 The Author. Published by Elsevier Inc. All rights reserved.

  14. Stochastic self-similar and fractal universe

    International Nuclear Information System (INIS)

    Iovane, G.; Laserra, E.; Tortoriello, F.S.

    2004-01-01

    The structures formation of the Universe appears as if it were a classically self-similar random process at all astrophysical scales. An agreement is demonstrated for the present hypotheses of segregation with a size of astrophysical structures by using a comparison between quantum quantities and astrophysical ones. We present the observed segregated Universe as the result of a fundamental self-similar law, which generalizes the Compton wavelength relation. It appears that the Universe has a memory of its quantum origin as suggested by R. Penrose with respect to quasi-crystal. A more accurate analysis shows that the present theory can be extended from the astrophysical to the nuclear scale by using generalized (stochastically) self-similar random process. This transition is connected to the relevant presence of the electromagnetic and nuclear interactions inside the matter. In this sense, the presented rule is correct from a subatomic scale to an astrophysical one. We discuss the near full agreement at organic cell scale and human scale too. Consequently the Universe, with its structures at all scales (atomic nucleus, organic cell, human, planet, solar system, galaxy, clusters of galaxy, super clusters of galaxy), could have a fundamental quantum reason. In conclusion, we analyze the spatial dimensions of the objects in the Universe as well as space-time dimensions. The result is that it seems we live in an El Naschie's E-infinity Cantorian space-time; so we must seriously start considering fractal geometry as the geometry of nature, a type of arena where the laws of physics appear at each scale in a self-similar way as advocated long ago by the Swedish school of astrophysics

  15. Quasi-Similarity Model of Synthetic Jets

    Czech Academy of Sciences Publication Activity Database

    Tesař, Václav; Kordík, Jozef

    2009-01-01

    Roč. 149, č. 2 (2009), s. 255-265 ISSN 0924-4247 R&D Projects: GA AV ČR IAA200760705; GA ČR GA101/07/1499 Institutional research plan: CEZ:AV0Z20760514 Keywords : jets * synthetic jets * similarity solution Subject RIV: BK - Fluid Dynamics Impact factor: 1.674, year: 2009 http://www.sciencedirect.com

  16. Multidimensional Scaling Visualization using Parametric Similarity Indices

    OpenAIRE

    Machado, J. A. Tenreiro; Lopes, António M.; Galhano, A.M.

    2015-01-01

    In this paper, we apply multidimensional scaling (MDS) and parametric similarity indices (PSI) in the analysis of complex systems (CS). Each CS is viewed as a dynamical system, exhibiting an output time-series to be interpreted as a manifestation of its behavior. We start by adopting a sliding window to sample the original data into several consecutive time periods. Second, we define a given PSI for tracking pieces of data. We then compare the windows for different values of the parameter, an...

  17. The fluid similarity of the boiling crisis

    International Nuclear Information System (INIS)

    Katsaounis, A.

    1986-01-01

    Most of the measurements related to the boiling crisis have, until now, been undertaken for a wide parameter variation in the water, and were mainly related to the water-cooled reactor. This article investigates, whether or how the measuring results can be transferred to other fluids. Derived dimensionless similarity figures and those taken from literature are verified by measurements from complex geometries in water and freon 12. (orig.) [de

  18. The fluid similarity of the boiling crisis

    International Nuclear Information System (INIS)

    Katsaounis, A.

    1987-01-01

    Most of the measurements related to the boiling crisis have, until now, been undertaken for a wide parameter variation in the water, and were mainly related to the water-cooled reactor. This article investigates, whether or how the measuring results can be transferred to other fluids. Derived dimensionless similarity figures and those taken from literature are verified by measurements from complex geometries in water and freon 12. (orig./GL) [de

  19. Competitive strategy for providers.

    Science.gov (United States)

    Hackett, M C

    1996-01-01

    National Health Service (NHS) Trusts are struggling to determine a long-term strategic direction for their organizations in response to the competitive pressures generated by the NHS reforms. The development of long-term strategic direction and the methods to implement this are presenting real challenges to the Trusts which have inherited service configurations based on bureaucratic planning frameworks rather than service configurations suited to a more competitive environment. Examines the strategic choices available to these organizations; explores the importance of identifying positive strategic choices; and discusses the advantages and disadvantages in the context of the NHS internal market.

  20. BLAST and FASTA similarity searching for multiple sequence alignment.

    Science.gov (United States)

    Pearson, William R

    2014-01-01

    BLAST, FASTA, and other similarity searching programs seek to identify homologous proteins and DNA sequences based on excess sequence similarity. If two sequences share much more similarity than expected by chance, the simplest explanation for the excess similarity is common ancestry-homology. The most effective similarity searches compare protein sequences, rather than DNA sequences, for sequences that encode proteins, and use expectation values, rather than percent identity, to infer homology. The BLAST and FASTA packages of sequence comparison programs provide programs for comparing protein and DNA sequences to protein databases (the most sensitive searches). Protein and translated-DNA comparisons to protein databases routinely allow evolutionary look back times from 1 to 2 billion years; DNA:DNA searches are 5-10-fold less sensitive. BLAST and FASTA can be run on popular web sites, but can also be downloaded and installed on local computers. With local installation, target databases can be customized for the sequence data being characterized. With today's very large protein databases, search sensitivity can also be improved by searching smaller comprehensive databases, for example, a complete protein set from an evolutionarily neighboring model organism. By default, BLAST and FASTA use scoring strategies target for distant evolutionary relationships; for comparisons involving short domains or queries, or searches that seek relatively close homologs (e.g. mouse-human), shallower scoring matrices will be more effective. Both BLAST and FASTA provide very accurate statistical estimates, which can be used to reliably identify protein sequences that diverged more than 2 billion years ago.