WorldWideScience

Sample records for methods provide advantages

  1. Environmental standards provide competitive advantage

    International Nuclear Information System (INIS)

    Chynoweth, E.; Kirshner, E.

    1993-01-01

    Quality organizations are breaking new ground with the development of international standards for environmental management. These promise to provide the platform for chemical companies wanting to establish their environmental credibility with a global audience. open-quotes It will be similar to auditing our customers to ISO 9000 close-quote, says the environmental manager for a European chemical firm. open-quote We will only want to deal with people who have got their environmental act together. And we'll be in a better competitive positions close-quote. The International Organization for Standardization (ISO;Geneva) has set up a taskforce to develop an environmental management standard, which is expected to be completed by the mid-1990s. Observers think the ISO standard will draw heavily on the British Standard Institute's (BSI;London) environmental management standard, BS7750, which will likely be the first system adopted in the world. Published last year, BS7750 has been extensively piloted in the UK (CW, Sept. 30, 1992, p. 62) and is now set to be revised before being offically adopted by BSI. The UK's Chemical Industries Association (CIA;London) is anxious to prevent a proliferation of standards, and its report on BS7750 pilot projects calls for an approach integrating quality, environment, and health and safety. But standard setters, including ISO, appear to be moving in the opposite direction. In the US, the American national Standards Institute (ANSI;Washington) has started work on an environmental management standard

  2. Quantitative fluorescence kinetic analysis of NADH and FAD in human plasma using three- and four-way calibration methods capable of providing the second-order advantage

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Chao [School of Chemistry and Chemical Engineering, Guizhou University, Guiyang 550025 (China); Wu, Hai-Long, E-mail: hlwu@hnu.edu.cn [State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082 (China); Zhou, Chang; Xiang, Shou-Xia; Zhang, Xiao-Hua; Yu, Yong-Jie; Yu, Ru-Qin [State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha 410082 (China)

    2016-03-03

    The metabolic coenzymes reduced nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FAD) are the primary electron donor and acceptor respectively, participate in almost all biological metabolic pathways. This study develops a novel method for the quantitative kinetic analysis of the degradation reaction of NADH and the formation reaction of FAD in human plasma containing an uncalibrated interferent, by using three-way calibration based on multi-way fluorescence technique. In the three-way analysis, by using the calibration set in a static manner, we directly predicted the concentrations of both analytes in the mixture at any time after the start of their reactions, even in the presence of an uncalibrated spectral interferent and a varying background interferent. The satisfactory quantitative results indicate that the proposed method allows one to directly monitor the concentration of each analyte in the mixture as the function of time in real-time and nondestructively, instead of determining the concentration after the analytical separation. Thereafter, we fitted the first-order rate law to their concentration data throughout their reactions. Additionally, a four-way calibration procedure is developed as an alternative for highly collinear systems. The results of the four-way analysis confirmed the results of the three-way analysis and revealed that both the degradation reaction of NADH and the formation reaction of FAD in human plasma fit the first-order rate law. The proposed methods could be expected to provide promising tools for simultaneous kinetic analysis of multiple reactions in complex systems in real-time and nondestructively. - Highlights: • A novel three-way calibration method for the quantitative kinetic analysis of NADH and FAD in human plasma is proposed. • The method can directly monitor the concentration of each analyte in the reaction in real-time and nondestructively. • The method has the second-order advantage. • A

  3. Quantitative fluorescence kinetic analysis of NADH and FAD in human plasma using three- and four-way calibration methods capable of providing the second-order advantage

    International Nuclear Information System (INIS)

    Kang, Chao; Wu, Hai-Long; Zhou, Chang; Xiang, Shou-Xia; Zhang, Xiao-Hua; Yu, Yong-Jie; Yu, Ru-Qin

    2016-01-01

    The metabolic coenzymes reduced nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FAD) are the primary electron donor and acceptor respectively, participate in almost all biological metabolic pathways. This study develops a novel method for the quantitative kinetic analysis of the degradation reaction of NADH and the formation reaction of FAD in human plasma containing an uncalibrated interferent, by using three-way calibration based on multi-way fluorescence technique. In the three-way analysis, by using the calibration set in a static manner, we directly predicted the concentrations of both analytes in the mixture at any time after the start of their reactions, even in the presence of an uncalibrated spectral interferent and a varying background interferent. The satisfactory quantitative results indicate that the proposed method allows one to directly monitor the concentration of each analyte in the mixture as the function of time in real-time and nondestructively, instead of determining the concentration after the analytical separation. Thereafter, we fitted the first-order rate law to their concentration data throughout their reactions. Additionally, a four-way calibration procedure is developed as an alternative for highly collinear systems. The results of the four-way analysis confirmed the results of the three-way analysis and revealed that both the degradation reaction of NADH and the formation reaction of FAD in human plasma fit the first-order rate law. The proposed methods could be expected to provide promising tools for simultaneous kinetic analysis of multiple reactions in complex systems in real-time and nondestructively. - Highlights: • A novel three-way calibration method for the quantitative kinetic analysis of NADH and FAD in human plasma is proposed. • The method can directly monitor the concentration of each analyte in the reaction in real-time and nondestructively. • The method has the second-order advantage. • A

  4. Providing Homeless Adults with Advantage: A Sustainable University Degree Program

    Science.gov (United States)

    Sinatra, Richard; Lanctot, Melissa Kim

    2016-01-01

    A university partnered with the New York City Department of Homeless Services (NYC DHS) to provide cohorts of adults a 60-credit Associate Degree Program in Business Administration over a 2-year period. Results of two cohorts of 30 Advantage Academy Program graduates revealed significant improvement in College Board AccuPlacer (ACPL) Arithmetic…

  5. Child center closures: Does nonprofit status provide a comparative advantage?

    Science.gov (United States)

    Lam, Marcus; Klein, Sacha; Freisthler, Bridget; Weiss, Robert E.

    2013-01-01

    Reliable access to dependable, high quality childcare services is a vital concern for large numbers of American families. The childcare industry consists of private nonprofit, private for-profit, and governmental providers that differ along many dimensions, including quality, clientele served, and organizational stability. Nonprofit providers are theorized to provide higher quality services given comparative tax advantages, higher levels of consumer trust, and management by mission driven entrepreneurs. This study examines the influence of ownership structure, defined as nonprofit, for-profit sole proprietors, for-profit companies, and governmental centers, on organizational instability, defined as childcare center closures. Using a cross sectional data set of 15724 childcare licenses in California for 2007, we model the predicted closures of childcare centers as a function of ownership structure as well as center age and capacity. Findings indicate that for small centers (capacity of 30 or less) nonprofits are more likely to close, but for larger centers (capacity 30+) nonprofits are less likely to close. This suggests that the comparative advantages available for nonprofit organizations may be better utilized by larger centers than by small centers. We consider the implications of our findings for parents, practitioners, and social policy. PMID:23543882

  6. Child center closures: Does nonprofit status provide a comparative advantage?

    Science.gov (United States)

    Lam, Marcus; Klein, Sacha; Freisthler, Bridget; Weiss, Robert E

    2013-03-01

    Reliable access to dependable, high quality childcare services is a vital concern for large numbers of American families. The childcare industry consists of private nonprofit, private for-profit, and governmental providers that differ along many dimensions, including quality, clientele served, and organizational stability. Nonprofit providers are theorized to provide higher quality services given comparative tax advantages, higher levels of consumer trust, and management by mission driven entrepreneurs. This study examines the influence of ownership structure, defined as nonprofit, for-profit sole proprietors, for-profit companies, and governmental centers, on organizational instability, defined as childcare center closures. Using a cross sectional data set of 15724 childcare licenses in California for 2007, we model the predicted closures of childcare centers as a function of ownership structure as well as center age and capacity. Findings indicate that for small centers (capacity of 30 or less) nonprofits are more likely to close, but for larger centers (capacity 30+) nonprofits are less likely to close. This suggests that the comparative advantages available for nonprofit organizations may be better utilized by larger centers than by small centers. We consider the implications of our findings for parents, practitioners, and social policy.

  7. [Internet research methods: advantages and challenges].

    Science.gov (United States)

    Liu, Yi; Tien, Yueh-Hsuan

    2009-12-01

    Compared to traditional research methods, using the Internet to conduct research offers a number of advantages to the researcher, which include increased access to sensitive issues and vulnerable / hidden populations; decreased data entry time requirements; and enhanced data accuracy. However, Internet research also presents certain challenges to the researcher. In this article, the advantages and challenges of Internet research methods are discussed in four principle issue areas: (a) recruitment, (b) data quality, (c) practicality, and (d) ethics. Nursing researchers can overcome problems related to sampling bias and data truthfulness using creative methods; resolve technical problems through collaboration with other disciplines; and protect participant's privacy, confidentiality and data security by maintaining a high level of vigilance. Once such issues have been satisfactorily addressed, the Internet should open a new window for Taiwan nursing research.

  8. Selenium utilization in thioredoxin and catalytic advantage provided by selenocysteine

    International Nuclear Information System (INIS)

    Kim, Moon-Jung; Lee, Byung Cheon; Hwang, Kwang Yeon; Gladyshev, Vadim N.; Kim, Hwa-Young

    2015-01-01

    Thioredoxin (Trx) is a major thiol-disulfide reductase that plays a role in many biological processes, including DNA replication and redox signaling. Although selenocysteine (Sec)-containing Trxs have been identified in certain bacteria, their enzymatic properties have not been characterized. In this study, we expressed a selenoprotein Trx from Treponema denticola, an oral spirochete, in Escherichia coli and characterized this selenoenzyme and its natural cysteine (Cys) homologue using E. coli Trx1 as a positive control. 75 Se metabolic labeling and mutation analyses showed that the SECIS (Sec insertion sequence) of T. denticola selenoprotein Trx is functional in the E. coli Sec insertion system with specific selenium incorporation into the Sec residue. The selenoprotein Trx exhibited approximately 10-fold higher catalytic activity than the Sec-to-Cys version and natural Cys homologue and E. coli Trx1, suggesting that Sec confers higher catalytic activity on this thiol-disulfide reductase. Kinetic analysis also showed that the selenoprotein Trx had a 30-fold higher K m than Cys-containing homologues, suggesting that this selenoenzyme is adapted to work efficiently with high concentrations of substrate. Collectively, the results of this study support the hypothesis that selenium utilization in oxidoreductase systems is primarily due to the catalytic advantage provided by the rare amino acid, Sec. - Highlights: • The first characterization of a selenoprotein Trx is presented. • The selenoenzyme Trx exhibits 10-fold higher catalytic activity than Cys homologues. • Se utilization in Trx is primarily due to the catalytic advantage provided by Sec residue

  9. Selenium utilization in thioredoxin and catalytic advantage provided by selenocysteine

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Moon-Jung [Department of Biochemistry and Molecular Biology, Yeungnam University College of Medicine, Daegu 705-717 (Korea, Republic of); Lee, Byung Cheon [Division of Genetics, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA 02115 (United States); Division of Biotechnology, College of Life Sciences & Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Hwang, Kwang Yeon [Division of Biotechnology, College of Life Sciences & Biotechnology, Korea University, Seoul 136-701 (Korea, Republic of); Gladyshev, Vadim N. [Division of Genetics, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA 02115 (United States); Kim, Hwa-Young, E-mail: hykim@ynu.ac.kr [Department of Biochemistry and Molecular Biology, Yeungnam University College of Medicine, Daegu 705-717 (Korea, Republic of)

    2015-06-12

    Thioredoxin (Trx) is a major thiol-disulfide reductase that plays a role in many biological processes, including DNA replication and redox signaling. Although selenocysteine (Sec)-containing Trxs have been identified in certain bacteria, their enzymatic properties have not been characterized. In this study, we expressed a selenoprotein Trx from Treponema denticola, an oral spirochete, in Escherichia coli and characterized this selenoenzyme and its natural cysteine (Cys) homologue using E. coli Trx1 as a positive control. {sup 75}Se metabolic labeling and mutation analyses showed that the SECIS (Sec insertion sequence) of T. denticola selenoprotein Trx is functional in the E. coli Sec insertion system with specific selenium incorporation into the Sec residue. The selenoprotein Trx exhibited approximately 10-fold higher catalytic activity than the Sec-to-Cys version and natural Cys homologue and E. coli Trx1, suggesting that Sec confers higher catalytic activity on this thiol-disulfide reductase. Kinetic analysis also showed that the selenoprotein Trx had a 30-fold higher K{sub m} than Cys-containing homologues, suggesting that this selenoenzyme is adapted to work efficiently with high concentrations of substrate. Collectively, the results of this study support the hypothesis that selenium utilization in oxidoreductase systems is primarily due to the catalytic advantage provided by the rare amino acid, Sec. - Highlights: • The first characterization of a selenoprotein Trx is presented. • The selenoenzyme Trx exhibits 10-fold higher catalytic activity than Cys homologues. • Se utilization in Trx is primarily due to the catalytic advantage provided by Sec residue.

  10. Advantages and limitations of the SETS method

    International Nuclear Information System (INIS)

    Mahaffy, J.H.

    1983-01-01

    The stability-enchancing two-step (SETS) method has been used successfully in the Transient Reactor Analysis Code (TRAC) for several years. The method consists of a basic semi-implicit step combined with a stabilizer step that, taken together, eliminate the material Courant stability limit associated with standard semi-implicit numerical methods. This approach toward stability requires significantly fewer computational operations than a fully implicit method, but currently maintains the first-order accuracy in space and time of its semi-implicit predecessors

  11. Incentives and provider payment methods.

    Science.gov (United States)

    Barnum, H; Kutzin, J; Saxenian, H

    1995-01-01

    The mode of payment creates powerful incentives affecting provider behavior and the efficiency, equity and quality outcomes of health finance reforms. This article examines provider incentives as well as administrative costs, and institutional conditions for successful implementation associated with provider payment alternatives. The alternatives considered are budget reforms, capitation, fee-for-service, and case-based reimbursement. We conclude that competition, whether through a regulated private sector or within a public system, has the potential to improve the performance of any payment method. All methods generate both adverse and beneficial incentives. Systems with mixed forms of provider payment can provide tradeoffs to offset the disadvantages of individual modes. Low-income countries should avoid complex payment systems requiring higher levels of institutional development.

  12. Autoethnography as a research method: Advantages, limitations and criticisms

    Directory of Open Access Journals (Sweden)

    Mariza G. Méndez

    2014-01-01

    Full Text Available The aim of this article is to review the literature  on autoethnography as a research method. It will first describe what is meant by autoethnography, or evocative narratives, and consider the particular features of this type of method. The paper will go on to explore the advantages, limitations and criticisms this research method has endured since its emergence during the 1980s. Finally, the different approaches to the evaluation of autoethnography will be reviewed.

  13. Advantages and limitations of common testing methods for antioxidants.

    Science.gov (United States)

    Amorati, R; Valgimigli, L

    2015-05-01

    Owing to the importance of antioxidants in the protection of both natural and man-made materials, a large variety of testing methods have been proposed and applied. These include methods based on inhibited autoxidation studies, which are better followed by monitoring the kinetics of oxygen consumption or of the formation of hydroperoxides, the primary oxidation products. Analytical determination of secondary oxidation products (e.g. carbonyl compounds) has also been used. The majority of testing methods, however, do not involve substrate autoxidation. They are based on the competitive bleaching of a probe (e.g. ORAC assay, β-carotene, crocin bleaching assays, and luminol assay), on reaction with a different probe (e.g. spin-trapping and TOSC assay), or they are indirect methods based on the reduction of persistent radicals (e.g. galvinoxyl, DPPH and TEAC assays), or of inorganic oxidizing species (e.g. FRAP, CUPRAC and Folin-Ciocalteu assays). Yet other methods are specific for preventive antioxidants. The relevance, advantages, and limitations of these methods are critically discussed, with respect to their chemistry and the mechanisms of antioxidant activity. A variety of cell-based assays have also been proposed, to investigate the biological activity of antioxidants. Their importance and critical aspects are discussed, along with arguments for the selection of the appropriate testing methods according to the different needs.

  14. Dual mobility cups provide biomechanical advantages in situations at risk for dislocation: a finite element analysis.

    Science.gov (United States)

    Terrier, Alexandre; Latypova, Adeliya; Guillemin, Maika; Parvex, Valérie; Guyen, Olivier

    2017-03-01

    Constrained devices, standard implants with large heads, and dual mobility systems have become popular options to manage instability after total hip arthroplasty (THA). Clinical results with these options have shown variable success rates and significant higher rates of aseptic loosening and mechanical failures with constrained implants. Literature suggests potential advantages of dual mobility, however little is known about its biomechanics. We present a comparative biomechanical study of a standard implant, a constrained implant, and a dual mobility system. A finite element analysis was developed to assess and compare these acetabular options with regard to the range of motion (ROM) to impingement, the angle of dislocation, the resistive torque, the volume of polyethylene (PE) with a stress above 80% of the elastic limit, and the interfacial cup/bone stress. Dual mobility implants provided the greatest ROM to impingement and allowed delaying subluxation and dislocation when compared to standard and constrained implants. Dual mobility also demonstrated the lowest resistive torque at subluxation while the constrained implant provided the greatest one. The lowest critical PE volume was observed with the dual mobility implant, and the highest stress at the interfaces was observed with the constrained implant. This study highlights the biomechanical advantages of dual mobility systems over constrained and standard implants, and is supported by the clinical results reported. Therefore, the use of dual mobility systems in situations at risk for instability should be advocated and constrained implants should be restricted to salvage situations.

  15. Inhibition of Fungal Colonization by Pseudoalteromonas tunicata Provides a Competitive Advantage during Surface Colonization†

    Science.gov (United States)

    Franks, A.; Egan, S.; Holmström, C.; James, S.; Lappin-Scott, H.; Kjelleberg, S.

    2006-01-01

    The marine epiphytic bacterium Pseudoalteromonas tunicata produces a range of extracellular secondary metabolites that inhibit an array of common fouling organisms, including fungi. In this study, we test the hypothesis that the ability to inhibit fungi provides P. tunicata with an advantage during colonization of a surface. Studies on a transposon-generated antifungal-deficient mutant of P. tunicata, FM3, indicated that a long-chain fatty acid-coenzyme A ligase is involved in the production of a broad-range antifungal compound by P. tunicata. Flow cell experiments demonstrated that production of an antifungal compound provided P. tunicata with a competitive advantage against a marine yeast isolate during surface colonization. This compound enabled P. tunicata to disrupt an already established fungal biofilm by decreasing the number of yeast cells attached to the surface by 66% ± 9%. For in vivo experiments, the wild-type and FM3 strains of P. tunicata were used to inoculate the surface of the green alga Ulva australis. Double-gradient denaturing gradient gel electrophoresis analysis revealed that after 48 h, the wild-type P. tunicata had outcompeted the surface-associated fungal community, whereas the antifungal-deficient mutant had no effect on the fungal community. Our data suggest that P. tunicata is an effective competitor against fungal surface communities in the marine environment. PMID:16957232

  16. Inhibition of fungal colonization by Pseudoalteromonas tunicata provides a competitive advantage during surface colonization.

    Science.gov (United States)

    Franks, A; Egan, S; Holmström, C; James, S; Lappin-Scott, H; Kjelleberg, S

    2006-09-01

    The marine epiphytic bacterium Pseudoalteromonas tunicata produces a range of extracellular secondary metabolites that inhibit an array of common fouling organisms, including fungi. In this study, we test the hypothesis that the ability to inhibit fungi provides P. tunicata with an advantage during colonization of a surface. Studies on a transposon-generated antifungal-deficient mutant of P. tunicata, FM3, indicated that a long-chain fatty acid-coenzyme A ligase is involved in the production of a broad-range antifungal compound by P. tunicata. Flow cell experiments demonstrated that production of an antifungal compound provided P. tunicata with a competitive advantage against a marine yeast isolate during surface colonization. This compound enabled P. tunicata to disrupt an already established fungal biofilm by decreasing the number of yeast cells attached to the surface by 66% +/- 9%. For in vivo experiments, the wild-type and FM3 strains of P. tunicata were used to inoculate the surface of the green alga Ulva australis. Double-gradient denaturing gradient gel electrophoresis analysis revealed that after 48 h, the wild-type P. tunicata had outcompeted the surface-associated fungal community, whereas the antifungal-deficient mutant had no effect on the fungal community. Our data suggest that P. tunicata is an effective competitor against fungal surface communities in the marine environment.

  17. Can voter-approved tax levies provide fiscal advantages and stability for local public health agencies?

    Science.gov (United States)

    Schmalzried, Hans D; Fallon, L Fleming

    2013-01-01

    Major funding cuts have occurred throughout the United States public health system during the past several years. Funding for local public health agency (LPHA) services and programs is obtained through a patchwork of sources that vary both within and among states. Even though local city and county sources provide a significant proportion of funding for LPHAs, information available in the literature about these revenues is sparse and is not clearly described. This study focused on a single specific revenue stream included in the local sources (local city and county) category: funds voted on directly by the public. The primary purpose of this study was to examine whether this type of funding source provided fiscal advantages for LPHAs. Specifically, we wanted to see how sensitive levy votes were to changing general economic conditions. A questionnaire to collect LPHA levy data was developed, approved, and mailed to county boards of elections in Ohio (n = 88). Elections officials were asked to provide voting results for all LPHA levy ballot attempts since 1994 regardless of outcome. In the study period (1994 through 2011), 250 LPHA property tax levies were placed on election ballots in Ohio. LPHAs were successful in 155 (62.0%) and unsuccessful in 95 (38.0%) attempts. Over the 18-year period, the most noteworthy outcome was a 94.6% pass rate for renewal levies. Our study demonstrated that voter-approved tax levies provide some fiscal advantages for LPHAs: higher per capita revenues than those who have to rely on other sources of income and predictable revenue streams. This translates into more funds being available for public health programs and services. Property tax levies allow citizens to make direct investments in their local health departments.

  18. ADVANTAGES AND DISADVANTAGES OF THE SONICFILL™ METHOD FOR LATERAL FILLINGS

    Directory of Open Access Journals (Sweden)

    Nicolae BARANOV

    2017-06-01

    Full Text Available The aim of the study was to evaluate the advantages and disadvantages of bulk-fill type fillings realized with SONICFill™ over an 18 month interval, on a batch of patients with different ages and occupations. Materials and methods: the study was performed on a batch of 73 patients who addressed the Clinical of OdontologyEndodontics within the Platform of Practical Training (PIP of the Faculty of Dental Medicine of the ”Apollonia” University of Iaşi, between Octomber 1, 2014 - May 1, 2016, subjected to 91 bulk-fill fillings with SonicFill™ on the posterior teeth. Results and discussion: out of the total number of 73 patients, 56 came from the urban environment, and 17 - from the rural medium, the highest ratio being represented by the 21-30 year age group (45%, closely followed by the 31-40 year one (40%. As for gender distribution within the batch, nearly two-thirds are women, the rest being men. The education level influenced patients’ decision – that of accepting a new method of filling application. As to the types of teeth to which restorations were applied, the highest ratio is represented by lower molars (41%, followed by upper molars (23% and mandibular premolars (20%, the lowest number of restorations being applied to maxillary premolars. Out of the total number of 91 bulk-fill restorations, 28 were applied over a base filling while, in 63 restorations, the basic filling was absent. Conclusions: The SonicFill ™ system for bulk-fill posterior restorations has a number of advantages, such as: high photopolymerization depth, significant reduction of setting contraction, better composite adaptation to the cavity walls, long-term predictable clinical results.

  19. Plan–Provider Integration, Premiums, and Quality in the Medicare Advantage Market

    Science.gov (United States)

    Frakt, Austin B; Pizer, Steven D; Feldman, Roger

    2013-01-01

    Objective. To investigate how integration between Medicare Advantage plans and health care providers is related to plan premiums and quality ratings. Data Source. We used public data from the Centers for Medicare and Medicaid Services (CMS) and the Area Resource File and private data from one large insurer. Premiums and quality ratings are from 2009 CMS administrative files and some control variables are historical. Study Design. We estimated ordinary least-squares models for premiums and plan quality ratings, with state fixed effects and firm random effects. The key independent variable was an indicator of plan–provider integration. Data Collection. With the exception of Medigap premium data, all data were publicly available. We ascertained plan–provider integration through examination of plans’ websites and governance documents. Principal Findings. We found that integrated plan–providers charge higher premiums, controlling for quality. Such plans also have higher quality ratings. We found no evidence that integration is associated with more generous benefits. Conclusions. Current policy encourages plan–provider integration, although potential effects on health insurance products and markets are uncertain. Policy makers and regulators may want to closely monitor changes in premiums and quality after integration and consider whether quality improvement (if any) justifies premium increases (if they occur). PMID:23800017

  20. Plan-provider integration, premiums, and quality in the Medicare Advantage market.

    Science.gov (United States)

    Frakt, Austin B; Pizer, Steven D; Feldman, Roger

    2013-12-01

    To investigate how integration between Medicare Advantage plans and health care providers is related to plan premiums and quality ratings. We used public data from the Centers for Medicare and Medicaid Services (CMS) and the Area Resource File and private data from one large insurer. Premiums and quality ratings are from 2009 CMS administrative files and some control variables are historical. We estimated ordinary least-squares models for premiums and plan quality ratings, with state fixed effects and firm random effects. The key independent variable was an indicator of plan-provider integration. With the exception of Medigap premium data, all data were publicly available. We ascertained plan-provider integration through examination of plans' websites and governance documents. We found that integrated plan-providers charge higher premiums, controlling for quality. Such plans also have higher quality ratings. We found no evidence that integration is associated with more generous benefits. Current policy encourages plan-provider integration, although potential effects on health insurance products and markets are uncertain. Policy makers and regulators may want to closely monitor changes in premiums and quality after integration and consider whether quality improvement (if any) justifies premium increases (if they occur). © Health Research and Educational Trust.

  1. Motor unit recruitment by size does not provide functional advantages for motor performance.

    Science.gov (United States)

    Dideriksen, Jakob L; Farina, Dario

    2013-12-15

    It is commonly assumed that the orderly recruitment of motor units by size provides a functional advantage for the performance of movements compared with a random recruitment order. On the other hand, the excitability of a motor neuron depends on its size and this is intrinsically linked to its innervation number. A range of innervation numbers among motor neurons corresponds to a range of sizes and thus to a range of excitabilities ordered by size. Therefore, if the excitation drive is similar among motor neurons, the recruitment by size is inevitably due to the intrinsic properties of motor neurons and may not have arisen to meet functional demands. In this view, we tested the assumption that orderly recruitment is necessarily beneficial by determining if this type of recruitment produces optimal motor output. Using evolutionary algorithms and without any a priori assumptions, the parameters of neuromuscular models were optimized with respect to several criteria for motor performance. Interestingly, the optimized model parameters matched well known neuromuscular properties, but none of the optimization criteria determined a consistent recruitment order by size unless this was imposed by an association between motor neuron size and excitability. Further, when the association between size and excitability was imposed, the resultant model of recruitment did not improve the motor performance with respect to the absence of orderly recruitment. A consistent observation was that optimal solutions for a variety of criteria of motor performance always required a broad range of innervation numbers in the population of motor neurons, skewed towards the small values. These results indicate that orderly recruitment of motor units in itself does not provide substantial functional advantages for motor control. Rather, the reason for its near-universal presence in human movements is that motor functions are optimized by a broad range of innervation numbers.

  2. Lessons learned: advantages and disadvantages of mixed method research

    DEFF Research Database (Denmark)

    Malina, Mary A.; Nørreklit, Hanne; Selto, Frank H.

    2011-01-01

    on the use and usefulness of a specialized balanced scorecard; and third, to encourage researchers to actually use multiple methods and sources of data to address the very many accounting phenomena that are not fully understood. Design/methodology/approach – This paper is an opinion piece based...... on the authors' experience conducting a series of longitudinal mixed method studies. Findings – The authors suggest that in many studies, using a mixed method approach provides the best opportunity for addressing research questions. Originality/value – This paper provides encouragement to those who may wish......Purpose – The purpose of this paper is first, to discuss the theoretical assumptions, qualities, problems and myopia of the dominating quantitative and qualitative approaches; second, to describe the methodological lessons that the authors learned while conducting a series of longitudinal studies...

  3. Beyond compliance using environmental, health and safety management information systems (EMISs) to provide quantified competitive advantages

    Energy Technology Data Exchange (ETDEWEB)

    Schroeder, J.V.; Mayer, G.

    1999-07-01

    In the last 20 years, federal, state and local regulations have provided regulatory incentives for industry to better manage environmental, health and safety (EHS) practices. In order for voluntary EHS management practices to move beyond compliance and continue improving, specific, quantifiable benefits must result. That is, companies must achieve some competitive advantage from implementing EHS improvements that are considered voluntary. Recently, many private companies and public agencies have been giving significant consideration toward the implementation of an EHS management information system (EMIS). Currently considered voluntary, the automation of EHS data collection, storage, retrieval and reporting is subject to the same benefit expectations that other EHS improvements are subject to. The benefits resulting from an EMIS typically result from a reduction in either direct or indirect costs. Direct costs, consisting primarily of labor hours, permit fees, disposal costs, etc., are definable and easily to quantify. Indirect costs, which are comprised of reduced risks and liabilities, are less easily quantifiable. In fact, many have abandoned hope of ever quantifying expected benefits from indirect costs, and simply lump all indirect benefits into a qualitative, catch-all category called intangible benefits. However, by statistically analyzing individual risk events over an expected project life, anticipated benefits can be objectively and accurately quantified. Through the use of a case study, this paper will describe the process of quantifying direct and indirect benefits resulting from the implementation of an EMIS. The paper will describe the application of a statistical model to estimate indirect benefits and will demonstrate how the results of the benefit quantification can be used to make sound, business based decisions based on a required rate of return/return on investment.

  4. Accelerator-driven thermal fission systems may provide energy supply advantages

    International Nuclear Information System (INIS)

    Linford, R.K.

    1992-01-01

    This presentation discusses the energy supply advantages of using accelerator-driven thermal fission systems. Energy supply issues as related to cost, fuel supply stability, environmental impact, and safety are reviewed. It is concluded that the Los Alamos Accelerator Transmutation of Waste (ATW) concept, discussed here, has the following advantages: improved safety in the form of low inventory and subcriticality; reduced high-level radioactive waste management timescales for both fission products and actinides; and a very long-term fuel supply requiring no enrichment

  5. Invitation to View Method with Advantages and Disadvantages

    Directory of Open Access Journals (Sweden)

    Selçuk BUYRUKOĞLU

    2018-01-01

    Full Text Available Taxpayers and tax administrators sometimes may experience tax dispute. These disputes may arise from the taxpayers as well as from the tax administrators. In resolving tax disputes, tax administrators and tax payers are the first, usually administratively, solution. Because while the tax revenues of the state are possible entered into the state treasury, the taxpayers will benefit from the advantages of administrative solutions. The state and taxpayer herein will be the winner. Invitation to view is one of the administrative remedies for tax disputes. With this practice taxpayers who have caused tax evasion penalty are invited by tax administrators to make a declaration on the condition that the tax examination of the tax disputes is not started and the dispatch process has not been done to the discretion comission. In this study, advantages and disadvantages will be addressed after the definition, legal support, purpose, scope and mechanism of Invitation to view.

  6. Competitive Advantage Provided by Bacterial Motility in the Formation of Nodules by Rhizobium meliloti

    Science.gov (United States)

    Ames, Peter; Bergman, Kostia

    1981-01-01

    The effect of motility on the competitive success of Rhizobium meliloti in nodule production was investigated. A motile strain formed more nodules than expected when mixed at various unfavorable ratios with either flagellated or nonflagellated nonmotile derivatives. We conclude that motility confers a selective advantage on rhizobia when competing with nonmotile strains. PMID:7298580

  7. Does being female provide a neuroprotective advantage following spinal cord injury?

    Directory of Open Access Journals (Sweden)

    Jeffrey P Datto

    2015-01-01

    Full Text Available It has been controversial whether gender has any effect on recovery following spinal cord injury (SCI. Past experimental and clinical research aimed at addressing this subject has led to constrasting findings on whether females hold any advantage in locomotor recovery. Additionally, for studies supporting the notion of a female gender related advantage, a definite cause has not been explained. In a recent study, using large sample sizes for comparative male and female spinal cord injury cohorts, we reported that a significant gender advantage favoring females existed in both tissue preservation and functional recovery after taking into consideration discrepancies in age and weight of the animals across sexes. Prior animal research frequently used sample sizes that were too small to determine significance with certainty and also did not account for two other factors that influence locomotor performance: age and weight. Our finding is important in light of controversy surrounding the effect of gender on outcome and the fact that SCI affects more than ten thousand new individuals annually, a population that is disproportionately male. By deepening our understanding of why a gender advantage exists, potential new therapeutics can be designed to improve recovery for the male population following the initial trauma or putatively augment the neuroprotective privilege in females for enhanced outcomes.

  8. Comparison of poliovirus recombinants: accumulation of point mutations provides further advantages.

    Science.gov (United States)

    Savolainen-Kopra, Carita; Samoilovich, Elena; Kahelin, Heidi; Hiekka, Anna-Kaisa; Hovi, Tapani; Roivainen, Merja

    2009-08-01

    The roles of recombination and accumulation of point mutations in the origin of new poliovirus (PV) characteristics have been hypothesized, but it is not known which are essential to evolution. We studied phenotypic differences between recombinant PV strains isolated from successive stool specimens of an oral PV vaccine recipient. The studied strains included three PV2/PV1 recombinants with increasing numbers of mutations in the VP1 gene, two of the three with an amino acid change I-->T in the DE-loop of VP1, their putative PV1 parent and strains Sabin 1 and 2. Growth of these viruses was examined in three cell lines: colorectal adenocarcinoma, neuroblastoma and HeLa. The main observation was a higher growth rate between 4 and 6 h post-infection of the two recombinants with the I-->T substitution. All recombinants grew at a higher rate than parental strains in the exponential phase of the replication cycle. In a temperature sensitivity test, the I-->T-substituted recombinants replicated equally well at an elevated temperature. Complete genome sequencing of the three recombinants revealed 12 (3), 19 (3) and 27 (3) nucleotide (amino acid) differences from Sabin. Mutations were located in regions defining attenuation, temperature sensitivity, antigenicity and the cis-acting replicating element. The recombination site was in the 5' end of 3D. In a competition assay, the most mutated recombinant beat parental Sabin in all three cell lines, strongly suggesting that this virus has an advantage. Two independent intertypic recombinants, PV3/PV1 and PV3/PV2, also showed similar growth advantages, but they also contained several point mutations. Thus, our data defend the hypothesis that accumulation of certain advantageous mutations plays a key role in gaining increased fitness.

  9. Overexpression of IL-7R alpha provides a competitive advantage during early T-cell development.

    Science.gov (United States)

    Laouar, Yasmina; Crispe, I Nicholas; Flavell, Richard A

    2004-03-15

    Critical checkpoints controlling early thymic T-cell development and homeostasis are set by the proper signaling function of the interleukin 7 receptor (IL-7R) and the pre-T-cell antigen receptor. Although alpha beta T-cell development is observed in IL-7- and IL-7R alpha-deficient mice, the number of thymocytes is significantly reduced, implying a role for the IL-7R in controlling the size of the thymic T-cell compartment. Here, we report the overexpression of IL-7R alpha that occurs in the early T-cell compartment from AKR/J mice, animals that are highly susceptible to the spontaneous development of thymoma. Increased IL-7R alpha was revealed by surface staining, and increased IL-7R alpha mRNA was documented by using reverse transcriptase-polymerase chain reaction (RT-PCR). This resulted in increased survival of AKR/J early thymocytes, shown by the decreased frequency of TUNEL(+) (terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate [dUTP]-fluorescein nick end labeling) cells. In an in vivo thymocyte repopulation model, AKR/J thymocytes had a selective advantage over healthy thymocytes. This advantage occurred at early stages of T-cell development. Our findings support the model that overexpression of growth factor receptors can contribute to proliferation and malignancy.

  10. ADVANTAGES AND DISADVANTAGES OF APPLYING EVOLVED METHODS IN MANAGEMENT ACCOUNTING PRACTICE

    Directory of Open Access Journals (Sweden)

    SABOU FELICIA

    2014-05-01

    Full Text Available The evolved methods of management accounting have been developed with the purpose of removing the disadvantages of the classical methods, they are methods adapted to the new market conditions, which provide much more useful cost-related information so that the management of the company is able to take certain strategic decisions. Out of the category of evolved methods, the most used is the one of standard-costs due to the advantages that it presents, being used widely in calculating the production costs in some developed countries. The main advantages of the standard-cost method are: in-advance knowledge of the production costs and the measures that ensure compliance to these; with the help of the deviations calculated from the standard costs, one manages a systematic control over the costs, thus allowing the making of decision in due time, in as far as the elimination of the deviations and the improvement of the activity are concerned and it is a method of analysis, control and cost forecast; Although the advantages of using standards are significant, there are a few disadvantages to the employment of the standard-cost method: sometimes there can appear difficulties in establishing the deviations from the standard costs, the method does not allow an accurate calculation of the fixed costs. As a result of the study, we can observe the fact that the evolved methods of management accounting, as compared to the classical ones, present a series of advantages linked to a better analysis, control, and foreseeing of costs, whereas the main disadvantage is related to the large amount of work necessary for these methods to be applied.

  11. ADVANTAGES AND DISADVANTAGES OF APPLYING EVOLVED METHODS IN MANAGEMENT ACCOUNTING PRACTICE

    Directory of Open Access Journals (Sweden)

    SABOU FELICIA

    2014-05-01

    Full Text Available The evolved methods of management accounting have been developed with the purpose of removing the disadvantages of the classical methods, they are methods adapted to the new market conditions, which provide much more useful cost-related information so that the management of the company is able to take certain strategic decisions. Out of the category of evolved methods, the most used is the one of standard-costs due to the advantages that it presents, being used widely in calculating the production costs in some developed countries. The main advantages of the standard-cost method are: in-advance knowledge of the production costs and the measures that ensure compliance to these; with the help of the deviations calculated from the standard costs, one manages a systematic control over the costs, thus allowing the making of decision in due time, in as far as the elimination of the deviations and the improvement of the activity are concerned and it is a method of analysis, control and cost forecast; Although the advantages of using standards are significant, there are a few disadvantages to the employment of the standard-cost method: sometimes there can appear difficulties in establishing the deviations from the standard costs, the method does not allow an accurate calculation of the fixed costs. As a result of the study, we can observe the fact that the evolved methods of management accounting, as compared to the classical ones, present a series of advantages linked to a better analysis, control, and foreseeing of costs, whereas the main disadvantage is related to the large amount of work necessary for these methods to be applied

  12. Neighbour tolerance, not suppression, provides competitive advantage to non-native plants.

    Science.gov (United States)

    Golivets, Marina; Wallin, Kimberly F

    2018-05-01

    High competitive ability has often been invoked as a key determinant of invasion success and ecological impacts of non-native plants. Yet our understanding of the strategies that non-natives use to gain competitive dominance remains limited. Particularly, it remains unknown whether the two non-mutually exclusive competitive strategies, neighbour suppression and neighbour tolerance, are equally important for the competitive advantage of non-native plants. Here, we analyse data from 192 peer-reviewed studies on pairwise plant competition within a Bayesian multilevel meta-analytic framework and show that non-native plants outperform their native counterparts due to high tolerance of competition, as opposed to strong suppressive ability. Competitive tolerance ability of non-native plants was driven by neighbour's origin and was expressed in response to a heterospecific native but not heterospecific non-native neighbour. In contrast to natives, non-native species were not more suppressed by hetero- vs. conspecific neighbours, which was partially due to higher intensity of intraspecific competition among non-natives. Heterogeneity in the data was primarily associated with methodological differences among studies and not with phylogenetic relatedness among species. Altogether, our synthesis demonstrates that non-native plants are competitively distinct from native plants and challenges the common notion that neighbour suppression is the primary strategy for plant invasion success. © 2018 John Wiley & Sons Ltd/CNRS.

  13. [Detection of ciguatoxins: advantages and drawbacks of different biological methods].

    Science.gov (United States)

    Boydron-Le Garrec, Raphaële; Benoit, Evelyne; Sauviat, Martin-Pierre; Laurent, Dominique

    2005-01-01

    Ciguatera is a seafood intoxication that results from ingestion of reef fish contaminated with ciguatoxins at levels orally toxic for humans. Precursors of those toxins, gambiertoxins, are produced by benthic dinoflagellates (genus Gambierdiscus), and then accumulated and biotransformed by herbivorous and carnivorous fishes into ciguatoxins, more toxic for humans. In the absence of specific treatment, that disease remains a health problem with otherwise adverse socio-economic impacts. Thus a cost-effective means of detecting ciguatoxins in fish has long been searched for. Many assays have been developed, including in vivo, in vitro, chemical or immunochemical approaches. This review focuses on some biological methods, from the well-standardised mouse assay to the specific radio-labelled ligand binding assay that is performed on rat brain synaptosomes. In addition to the mouse, the chick and the mongoose were still recently used, in particular for preliminary tests before ciguatoxin extraction from fish, since assays in these animals can directly assay the whole flesh. In contrast, various other in vivo methods, such as the kitten, mosquito and diptera larvae assays, were abandoned despite their interesting results. Finally, the mouse neuroblastoma and rat brain synaptosome assays, carried out in vitro as alternative approaches to animal-using assays, are highly sensitive and much more specific than the in vivo methods to detect ciguatoxins.

  14. Methods and advantages of intercomparisons of TLDs for environmental monitoring

    International Nuclear Information System (INIS)

    Ranogajec-Komor, M.; Klemic, G.

    1997-01-01

    One of the most difficult tasks facing the international community is the monitoring of environmental radiation for potential increases due to facility accidents or weapons activity. Monitoring networks have been established to provide a record of natural background radiation as well as measure any radiation releases from a facility. Thermoluminescent dosimeters (TLDs) are an important element of such networks and are the most widely used passive detector for environmental monitoring. In order to reach a high international standard in the application of TLDs in routine environmental monitoring, there is a need for a intercomparisons. (authors)

  15. Redesigning geriatric healthcare: how cross-functional teams and process improvement provide a competitive advantage.

    Science.gov (United States)

    Andrews, B C; Kaye, J; Bowcutt, M; Campbell, J

    2001-01-01

    This study examines the consequences of adding a geriatric subacute unit to the traditional health care mix offered by a nonprofit hospital. Historically, geriatric health care offerings have been limited to either acute care units or long-term care facilities. The study's findings demonstrate that the addition of a subacute unit that is operated by an interdisciplinary team is a competitively rational move for two reasons. First, it provides a continuum of care that integrates services and departments, thereby reducing costs. Second, it provides a supportive environment for patients and their families. As a consequence patients have a higher probability of returning home than patients who are assigned to more traditional modes of care.

  16. Insurer Provide Rating Software and Competitive Advantage: An Evaluation Based on BOP Insurance Applications at Wisconsin Agencies

    OpenAIRE

    Thomas A. Aiuppa; William E. Wehrs

    1993-01-01

    This research examines whether a competitive advantage exists for insurers which provide independent agencies with rating software to generate price quotes. Data relative to the Business Owners line of insurance were collected from several Wisconsin agencies which represent several BOP insurers, some of which provide software for rating BOP applications. The results indicate that providing rating software did not increase insurers’ business volumes, but may decrease their underwriting costs. ...

  17. ADVANTAGES/DISADVANTAGES FOR ISCO METHODS IN-SITU FENTON OXIDATION IN-SITU PERMANGANATE OXIDATION

    Science.gov (United States)

    The advantages and disadvantages of in-situ Fenton oxidation and in-situ permanganate oxidation will be presented. This presentation will provide a brief overview of each technology and a detailed analysis of the advantages and disadvantages of each technology. Included in the ...

  18. Implementing a Progressive Consumption Tax: Advantages of Adopting the VAT Credit-Method System

    OpenAIRE

    Grinberg, Itai

    2006-01-01

    A credit–method value–added tax, a payroll tax, and a business–level wage subsidy can approximate the economic and distributional consequences of a subtraction–method X–tax. Such a credit–method progressive consumption tax has administrative advantages as compared to a subtraction–method progressive consumption tax, once certain political factors are taken into account. Further, unlike a subtraction–method system, a credit–method progressive consumption tax could easily interact with other ta...

  19. Physical Methods for Seed Invigoration: Advantages and Challenges in Seed Technology.

    Science.gov (United States)

    Araújo, Susana de Sousa; Paparella, Stefania; Dondi, Daniele; Bentivoglio, Antonio; Carbonera, Daniela; Balestrazzi, Alma

    2016-01-01

    In the context of seed technology, the use of physical methods for increasing plant production offers advantages over conventional treatments based on chemical substances. The effects of physical invigoration treatments in seeds can be now addressed at multiple levels, ranging from morpho-structural aspects to changes in gene expression and protein or metabolite accumulation. Among the physical methods available, "magneto-priming" and irradiation with microwaves (MWs) or ionizing radiations (IRs) are the most promising pre-sowing seed treatments. "Magneto-priming" is based on the application of magnetic fields and described as an eco-friendly, cheap, non-invasive technique with proved beneficial effects on seed germination, vigor and crop yield. IRs, as γ-rays and X-rays, have been widely regarded as a powerful tool in agricultural sciences and food technology. Gamma-rays delivered at low dose have showed to enhance germination percentage and seedling establishment, acting as an actual 'priming' treatment. Different biological effects have been observed in seeds subjected to MWs and X-rays but knowledge about their impact as seed invigoration agent or stimulatory effects on germination need to be further extended. Ultraviolet (UV) radiations, namely UV-A and UV-C have shown to stimulate positive impacts on seed health, germination, and seedling vigor. For all mentioned physical treatments, extensive fundamental and applied research is still needed to define the optimal dose, exposition time, genotype- and environment-dependent irradiation conditions. Electron paramagnetic resonance has an enormous potential in seed technology not fully explored to monitor seed invigoration treatments and/or identifying the best suitable irradiation dose or time-point to stop the treatment. The present manuscript describes the use of physical methods for seed invigoration, while providing a critical discussion on the constraints and advantages. The future perspectives related to

  20. Physical Methods for Seed Invigoration: Advantages and Challenges in Seed Technology

    Science.gov (United States)

    Araújo, Susana de Sousa; Paparella, Stefania; Dondi, Daniele; Bentivoglio, Antonio; Carbonera, Daniela; Balestrazzi, Alma

    2016-01-01

    In the context of seed technology, the use of physical methods for increasing plant production offers advantages over conventional treatments based on chemical substances. The effects of physical invigoration treatments in seeds can be now addressed at multiple levels, ranging from morpho-structural aspects to changes in gene expression and protein or metabolite accumulation. Among the physical methods available, “magneto-priming” and irradiation with microwaves (MWs) or ionizing radiations (IRs) are the most promising pre-sowing seed treatments. “Magneto-priming” is based on the application of magnetic fields and described as an eco-friendly, cheap, non-invasive technique with proved beneficial effects on seed germination, vigor and crop yield. IRs, as γ-rays and X-rays, have been widely regarded as a powerful tool in agricultural sciences and food technology. Gamma-rays delivered at low dose have showed to enhance germination percentage and seedling establishment, acting as an actual ‘priming’ treatment. Different biological effects have been observed in seeds subjected to MWs and X-rays but knowledge about their impact as seed invigoration agent or stimulatory effects on germination need to be further extended. Ultraviolet (UV) radiations, namely UV-A and UV-C have shown to stimulate positive impacts on seed health, germination, and seedling vigor. For all mentioned physical treatments, extensive fundamental and applied research is still needed to define the optimal dose, exposition time, genotype- and environment-dependent irradiation conditions. Electron paramagnetic resonance has an enormous potential in seed technology not fully explored to monitor seed invigoration treatments and/or identifying the best suitable irradiation dose or time-point to stop the treatment. The present manuscript describes the use of physical methods for seed invigoration, while providing a critical discussion on the constraints and advantages. The future perspectives

  1. Physical methods for seed vigourization: advantages and challenges in seed technology

    Directory of Open Access Journals (Sweden)

    Susana eAraújo

    2016-05-01

    Full Text Available In the context of seed technology, the use of physical methods for increasing plant production offers advantages over conventional treatments based on chemical substances. The effects of physical vigourization treatments in seeds can be now addressed at multiple levels, ranging from morpho-structural aspects to changes in gene expression and protein or metabolite accumulation. Among the physical methods available, magneto-priming and irradiation with microwaves or ionizing radiations are the most promissory pre-sowing seed treatments. Magneto-priming is based on the application of magnetic fields and described as an eco-friendly, cheap, non-invasive technique with proved beneficial effects on seed germination, vigour and crop yield. Ionizing radiations, as gamma-rays and X-rays, have been widely regarded as a powerful tool in agricultural sciences and food technology. Gamma-rays delivered at low dose have showed to enhance germination percentage and seedling establishment, acting as an actual ‘priming’ treatment. Different biological effects have been observed in seeds subjected to microwaves and X-rays but knowledge about their impact as seed vigourization agent or stimulatory effects on germination need to be further extended. Ultraviolet (UV radiations, namely UV-A and UV-C have shown to stimulate positive impacts on seed health, germination and seedling vigour. For all mentioned physical treatments, extensive fundamental and applied research is still needed to define the optimal dose, exposition time, genotype- and environment-dependent irradiation conditions. Electron paramagnetic resonance (EPR has an enormous potential in seed technology not fully explored to monitor seed vigourization treatments and/or identifying the best suitable irradiation dose or time-point to stop the treatment. The present manuscript describes the use of physical methods for seed vigourization, while providing a critical discussion on the constraints and

  2. Quality evaluation of fish and other seafood by traditional and nondestructive instrumental methods: Advantages and limitations.

    Science.gov (United States)

    Hassoun, Abdo; Karoui, Romdhane

    2017-06-13

    Although being one of the most vulnerable and perishable products, fish and other seafoods provide a wide range of health-promoting compounds. Recently, the growing interest of consumers in food quality and safety issues has contributed to the increasing demand for sensitive and rapid analytical technologies. Several traditional physicochemical, textural, sensory, and electrical methods have been used to evaluate freshness and authentication of fish and other seafood products. Despite the importance of these standard methods, they are expensive and time-consuming, and often susceptible to large sources of variation. Recently, spectroscopic methods and other emerging techniques have shown great potential due to speed of analysis, minimal sample preparation, high repeatability, low cost, and, most of all, the fact that these techniques are noninvasive and nondestructive and, therefore, could be applied to any online monitoring system. This review describes firstly and briefly the basic principles of multivariate data analysis, followed by the most commonly traditional methods used for the determination of the freshness and authenticity of fish and other seafood products. A special focus is put on the use of rapid and nondestructive techniques (spectroscopic techniques and instrumental sensors) to address several issues related to the quality of these products. Moreover, the advantages and limitations of each technique are reviewed and some perspectives are also given.

  3. Does E-Commerce Provide a Sustained Competitive Advantage? An Investigation of Survival and Sustainability in Growth-Oriented Enterprises

    Directory of Open Access Journals (Sweden)

    Qingyi Chen

    2015-01-01

    Full Text Available Enterprises should find a new business model for their development, so as to make better use of their own advantages. At the same time, with rapid development of the economy and of science technology, the competition between small and medium-sized enterprises (SMEs and large enterprises is inevitable, so it is very important for small and medium-sized enterprises to find better ways to improve their ability to compete. E-commerce is a new medium of commerce in this 21st century, so as to promote the quantity development of SMEs and enhance the risk management ability of enterprises. However, at present, many of China’s small and medium enterprises face many challenges in the process of electronic commerce’s development, such as, which factors hinder the performance of electronic commerce, and what aspect of enterprises should be improved? This paper is based on the above problems, using theoretical analysis and empirical research methods to explore the root of these problems and find the solutions. In the empirical section, we explore how e-commerce influences sales growth in the short- and long-term. Through analysis of e-commerce performance, we further explore the causality relationship and influence degree. The results show that: first, IT Investment is the most important factor to achieve success, what competitive advantage can be achieved largely depends on whether enterprises will effectively use the network technology; second, the expansion of the enterprise size can promote transaction volume increase of SMEs in the short term; third, internet availability has a positive effect on the trade volume of e-commerce, but the intensity is not obvious, and the effect is relatively stable.

  4. Does Articaine Provide an Advantage over Lidocaine in Patients with Symptomatic Irreversible Pulpitis? A Systematic Review and Meta-analysis.

    Science.gov (United States)

    Kung, Jason; McDonagh, Marian; Sedgley, Christine M

    2015-11-01

    Achieving profound pulpal anesthesia can be difficult in patients with symptomatic irreversible pulpitis. This study provides a systematic review and meta-analysis to address the population, intervention, comparison, outcome (PICO) question: in adults with symptomatic irreversible pulpitis who are undergoing endodontic treatment, what is the comparative efficacy of articaine compared with lidocaine in reducing pain and incidence of adverse events? A protocol was prepared and registered on PROSPERO. Electronic searches were conducted in MEDLINE, Scopus, Cochrane Library, and ClinicalTrials.gov by using strict inclusion and exclusion criteria. Two independent reviewers assessed eligibility for inclusion and quality. Weighted anesthesia success rates and 95% confidence intervals (CIs) were estimated and compared by using a random-effects model. Two hundred seventy-five studies were initially identified from the search; 10 double-blind, randomized clinical trials met the inclusion criteria. For combined studies, articaine was more likely than lidocaine to achieve successful anesthesia (odds ratio [OR], 2.21; 95% CI, 1.41-3.47; P = .0006; I(2) = 40%). Maxillary infiltration subgroup analysis showed no significant difference between articaine and lidocaine (OR, 3.99; 95% CI, 0.50-31.62; P = .19; I(2) = 59%). For combined mandibular anesthesia studies articaine was superior to lidocaine (OR, 2.20; 95% CI, 1.40-3.44; P = .0006; I(2) = 30%), with further subgroup analysis showing no difference for mandibular block anesthesia (OR, 1.44; 95% CI, 0.87-2.38; P = .16; I(2) = 0%). When used for supplemental infiltration after successful mandibular block anesthesia, articaine was significantly more effective than lidocaine (OR, 3.55; 95% CI, 1.97-6.39; P pulpitis. There is a significant advantage to using articaine over lidocaine for supplementary infiltration after mandibular block anesthesia but no advantage when used for mandibular block anesthesia alone or for maxillary

  5. Management Methods and Concepts for Building Competitive Advantage in Hospitality Companies

    Directory of Open Access Journals (Sweden)

    Gierczak Beata

    2014-09-01

    Full Text Available Introduction. Competitive advantage determines the success of modern enterprises, such as hospitality companies, on the market. In turn, competitive advantage is gained as the result of skillful management, taking into account the factors that characterize the company environment. In the management process, methods and concepts that, when properly applied, facilitate the company's innovative activities play the key role, thus contributing to building competitive advantage. The purpose of this paper is to specify and characterize the methods and management concepts most commonly used by hospitality companies in the process of building competitive advantage. The core benefit of these considerations is that they serve to identify those activities of hospitality companies in which the analyzed methods and concepts found practical application. The final part of the article is devoted to an attempt to identify barriers and problems that significantly limit the use of these methods and concepts. Material and methods. In order to achieve this objective, a survey and interviews were carried out in all three- and four-star hotels in the Rzeszów area in the first quarter of 2012. Results. The results revealed that the concept most commonly used by hoteliers was knowledge-based organization (knowledge management, followed by outsourcing, benchmarking and internal competition, respectively. Conclusions. The study also demonstrated that the managers of these hospitality companies significantly lacked substantive knowledge of emerging “market” management methods and concepts.

  6. Advantages and applicability of commonly used homogenisation methods for climate data

    Science.gov (United States)

    Ribeiro, Sara; Caineta, Júlio; Henriques, Roberto; Soares, Amílcar; Costa, Ana Cristina

    2014-05-01

    provided for each method. Their advantages and applicability are discussed based on literature review and on the results of the HOME project. Acknowledgements: The authors gratefully acknowledge the financial support of "Fundação para a Ciência e Tecnologia" (FCT), Portugal, through the research project PTDC/GEO-MET/4026/2012 ("GSIMCLI - Geostatistical simulation with local distributions for the homogenization and interpolation of climate data").

  7. 41 CFR 301-72.1 - Why is common carrier presumed to be the most advantageous method of transportation?

    Science.gov (United States)

    2010-07-01

    ... presumed to be the most advantageous method of transportation? 301-72.1 Section 301-72.1 Public Contracts... Transportation § 301-72.1 Why is common carrier presumed to be the most advantageous method of transportation? Travel by common carrier is presumed to be the most advantageous method of transportation because it...

  8. 41 CFR 301-10.5 - What are the presumptions as to the most advantageous method of transportation?

    Science.gov (United States)

    2010-07-01

    ... presumptions as to the most advantageous method of transportation? 301-10.5 Section 301-10.5 Public Contracts... most advantageous method of transportation? (a) Common carrier. Travel by common carrier is presumed to be the most advantageous method of transportation and must be used when reasonably available. (b...

  9. Comparative advantages and limitations of the basic metrology methods applied to the characterization of nanomaterials.

    Science.gov (United States)

    Linkov, Pavel; Artemyev, Mikhail; Efimov, Anton E; Nabiev, Igor

    2013-10-07

    Fabrication of modern nanomaterials and nanostructures with specific functional properties is both scientifically promising and commercially profitable. The preparation and use of nanomaterials require adequate methods for the control and characterization of their size, shape, chemical composition, crystalline structure, energy levels, pathways and dynamics of physical and chemical processes during their fabrication and further use. In this review, we discuss different instrumental methods for the analysis and metrology of materials and evaluate their advantages and limitations at the nanolevel.

  10. Advantages of a Dynamic RGGG Method in Qualitative and Quantitative Analysis

    International Nuclear Information System (INIS)

    Shin, Seung Ki; Seong, Poong Hyun

    2009-01-01

    Various researches have been conducted in order to analyze dynamic interactions among components and process variables in nuclear power plants which cannot be handled by static reliability analysis methods such as conventional fault tree and event tree techniques. A dynamic reliability graph with general gates (RGGG) method was proposed for an intuitive modeling of dynamic systems and it enables one to easily analyze huge and complex systems. In this paper, advantages of the dynamic RGGG method are assessed through two stages: system modeling and quantitative analysis. And then a software tool for dynamic RGGG method is introduced and an application to a real dynamic system is accompanied

  11. Giving rheumatology patients online home access to their electronic medical record (EMR): advantages, drawbacks and preconditions according to care providers

    NARCIS (Netherlands)

    van der Vaart, R.; Drossaert, Constance H.C.; Taal, Erik; van de Laar, Mart A F J

    2013-01-01

    Technology enables patients home access to their electronic medical record (EMR), via a patient portal. This study aims to analyse (dis)advantages, preconditions and suitable content for this service, according to rheumatology health professionals. A two-phase policy Delphi study was conducted.

  12. Advantages of Analytical Transformations in Monte Carlo Methods for Radiation Transport

    International Nuclear Information System (INIS)

    McKinley, M S; Brooks III, E D; Daffin, F

    2004-01-01

    Monte Carlo methods for radiation transport typically attempt to solve an integral by directly sampling analog or weighted particles, which are treated as physical entities. Improvements to the methods involve better sampling, probability games or physical intuition about the problem. We show that significant improvements can be achieved by recasting the equations with an analytical transform to solve for new, non-physical entities or fields. This paper looks at one such transform, the difference formulation for thermal photon transport, showing a significant advantage for Monte Carlo solution of the equations for time dependent transport. Other related areas are discussed that may also realize significant benefits from similar analytical transformations

  13. SU-E-J-221: Advantages of a New Surface Imaging Calibration Method for SRS Treatments

    International Nuclear Information System (INIS)

    Paxton, A; Manger, R; Pawlicki, T; Kim, G

    2014-01-01

    Purpose: The present calibration method used for the AlignRT surface imaging system relies on the placement of a calibration plate at the linac isocenter using isocenter surrogates (crosshairs, room lasers, etc.). This work investigated the potential advantages of a new calibration method that shifts the AlignRT isocenter to be coincident with the linac MV beam isocenter. Methods: To quantify the potential uncertainties associated with the present calibration method for SRS treatments, the calibration plate was intentionally shifted away from isocenter +/−3mm in the longitudinal and lateral directions and +/−1mm in the longitudinal, lateral, and vertical directions. A head phantom was placed in a mock SRS treatment position and monitored with the AlignRT system. The AlignRT-indicated offsets were recorded at 270, 315, 0, 45, and 90° couch angles for each intentional calibration misalignment. The new isocenter calibration was applied after each misalignment, and the measurements were repeated and compared to the previous results. Results: With intentional longitudinal and lateral shifts of +/−3mm and +/−1mm in the calibration plate, the average indicated offsets at couch rotations of +/−90° were 4.3mm and 1.6mm, respectively. This was in agreement with the theoretical offset of sqrt(2)*(intentional shift of the calibration plate). Since vertical shifts were along the rotation axis of the couch, these shifts had little effect on the offsets with changing couch angle. When the new calibration was applied, the indicated offsets were all within 0.5mm for all couch angles. These offsets were in agreement with the known magnitude of couch walkout. Conclusion: The potential pitfalls of the present calibration method have been established, and the advantages of the new calibration method have been demonstrated. This new calibration method effectively removes the potential miscalibration artifacts of the present calibration method, giving the AlignRT user more

  14. Mixed methods research in pedagogy: Characteristics, advantages and difficulties in application

    Directory of Open Access Journals (Sweden)

    Matović Nataša

    2015-01-01

    Full Text Available The mixed methods research, as a new type of research, is discussed in the context of re-examining the relation between the two approaches, i.e. the possibility of not opposing, but connecting, combining and integrating them within research. The possibility to use such grounding in research as well could be quite important for pedagogy since the nature of the examined phenomena in this field is such that the majority has both quantitative and qualitative aspects. In order to explain the essence of a mixed methods research, the paper analyses its characteristics, first of all, what elements are combined, what is the nature of the relation between the combined elements and why they are combined, as well as its advantages and difficulties in application. The essential thing in a mixed methods research is the fact that combining refers to the research process as a whole, including the ontological and epistemological assumptions it is based on, which implies that the elements that are combined are understood rather broadly. The advantages and difficulties in application are considered in the context of the discussion of the possibility to combine all research elements, neutralise the limitations of quantitative and qualitative research methodology, implement the complex combining procedures etc. [Projekat Ministarstva nauke Republike Srbije, br. 179060: Modeli procenjivanja i strategije unapređivanja kvaliteta obrazovanja

  15. Advantages and Disadvantages of Different Methods of Hospitals' Downsizing: A Narrative Systematic Review

    Directory of Open Access Journals (Sweden)

    Yalda Mousazadeh

    2013-12-01

    Full Text Available Background:Hospitals as key actors in health systems face growing pressures especially cost cutting and search for cost-effective ways to resources management. Downsizing is one of these ways. This study was conducted to identify advantages and disadvantages of different methods of hospital' downsizing. Methods: The search was conducted in databases of Medlib, SID, Pub Med, Science Direct and Google Scholar Meta search engine by keywords of Downsizing, Hospital Downsizing, Hospital Rightsizing, Hospital Restructuring, Staff Downsizing, Hospital Merging, Hospital Reorganization and the Persian equivalents. Resulted 815 articles were studied and refined step by step. Finally, 27 articles were selected for analysis. Results: Five hospital downsizing methods were identified during searching. These methods were reducing the number of employees and beds, outsourcing, integration of hospital units, and the combination of these methods. The most important benefits were cost reduction, increasing patient satisfaction, increasing home care and outpatient services. The most important disadvantage included reducing access, reducing the rate of hospital admissions and increasing employees’ workload and dissatisfaction. Conclusion: Each downsizing method has strengths and weaknesses. Using different methods of downsizing, according to circumstances and applying appropriate interventions after implementation, is necessary for promotion.

  16. Advantages and Disadvantages of Different Methods of Hospitals' Downsizing: A Narrative Systematic Review

    Science.gov (United States)

    Mousazadeh, Yalda; Jannati, Ali; Jabbari Beiramy, Hossein; AsghariJafarabadi, Mohammad; Ebadi, Ali

    2013-01-01

    Background: Hospitals as key actors in health systems face growing pres­sures especially cost cutting and search for costeffective ways to resources management. Downsizing is one of these ways. This study was conducted to identify advantages and disadvantages of different methods of hospital' downsizing. Methods:The search was conducted in databases of Medlib, SID, Pub Med, Science Direct and Google Scholar Meta search engine by keywords of Downsizing, Hospital Downsizing, Hospital Rightsizing, Hospital Restructuring, Staff Downsizing, Hospital Merging, Hospital Reorganization and the Persian equivalents. Resulted 815 articles were studied and refined step by step. Finally, 27 articles were selected for analysis. Results: Five hospital downsizing methods were identified during searching. These methods were reducing the number of employees and beds, outsourcing, integration of hospital units, and the combination of these methods. The most important benefits were cost reduction, increasing patient satisfaction, increasing home care and outpatient services. The most important disadvantage included reducing access, reducing the rate of hospital admissions and increasing employees’ workload and dissatisfaction. Conclusion: Each downsizing method has strengths and weaknesses. Using different methods of downsizing, according to circumstances and applying appropriate interventions after implementation, is necessary for promotion. PMID:24688978

  17. CCND1-CDK4-mediated cell cycle progression provides a competitive advantage for human hematopoietic stem cells in vivo.

    Science.gov (United States)

    Mende, Nicole; Kuchen, Erika E; Lesche, Mathias; Grinenko, Tatyana; Kokkaliaris, Konstantinos D; Hanenberg, Helmut; Lindemann, Dirk; Dahl, Andreas; Platz, Alexander; Höfer, Thomas; Calegari, Federico; Waskow, Claudia

    2015-07-27

    Maintenance of stem cell properties is associated with reduced proliferation. However, in mouse hematopoietic stem cells (HSCs), loss of quiescence results in a wide range of phenotypes, ranging from functional failure to extensive self-renewal. It remains unknown whether the function of human HSCs is controlled by the kinetics of cell cycle progression. Using human HSCs and human progenitor cells (HSPCs), we report here that elevated levels of CCND1-CDK4 complexes promoted the transit from G0 to G1 and shortened the G1 cell cycle phase, resulting in protection from differentiation-inducing signals in vitro and increasing human leukocyte engraftment in vivo. Further, CCND1-CDK4 overexpression conferred a competitive advantage without impacting HSPC numbers. In contrast, accelerated cell cycle progression mediated by elevated levels of CCNE1-CDK2 led to the loss of functional HSPCs in vivo. Collectively, these data suggest that the transition kinetics through the early cell cycle phases are key regulators of human HSPC function and important for lifelong hematopoiesis. © 2015 Mende et al.

  18. Are the new automated methods for bone age estimation advantageous over the manual approaches?

    Science.gov (United States)

    De Sanctis, Vincenzo; Soliman, Ashraf T; Di Maio, Salvatore; Bedair, Said

    2014-12-01

    Bone Age Assessment (BAA) is performed worldwide for the evaluation of endocrine, genetic and chronic diseases, to monitor response to medical therapy and to determine the growth potential of children and adolescents. It is also used for consultation in planning orthopedic procedures, for determination of chronological age for adopted children, youth sports participation and in forensic settings. The main clinical methods for skeletal bone age estimation are the Greulich and Pyle (GP) and the Tanner and Whitehouse (TW) methods. Seventy six per cent (76%) of radiologists or pediatricians usually use the method of GP, 20% that of TW and 4% other methods. The advantages of using the TW method, as opposed to the GP method, are that it overcomes the subjectivity problem and results are more reproducible. However, it is complex and time consuming; for this reason its usage is just about 20% on a world-wide scale. Moreover, there are some evidences that bone age assignments by different physicians can differ significantly. Computerized and Quantitative Ultrasound Technologies (QUS) for assessing skeletal maturity have been developed with the aim of reducing many of the inconsistencies associated with radiographic investigations. In spite of the fact that the volume of automated methods for BAA has increased, the majotity of them are still in an early phase of development. QUS is comparable to the GP based method, but there is not enough established data yet for the healthy population. The Authors wish to stimulate the attention on the accuracy, reliability and consistency of BAA and to initiate a debate on manual versus automated approaches to enhance our assessment for skeletal matutation in children and adolescents.

  19. Diffusible signal factor family signals provide a fitness advantage to Xanthomonas campestris pv. campestris in interspecies competition.

    Science.gov (United States)

    Deng, Yinyue; Wu, Jien; Yin, Wenfang; Li, Peng; Zhou, Jianuan; Chen, Shaohua; He, Fei; Cai, Jun; Zhang, Lian-Hui

    2016-05-01

    Diffusible signal factor (DSF) represents a new class of widely conserved quorum sensing signals, which regulates various biological functions through intra- or interspecies signaling. The previous studies identified that there is an antagonistic interaction between Xanthomonas and Bacillus species bacteria in natural ecosystem, but the detailed molecular mechanism of interspecies competition is not clear. This study showed that Xanthomonas campestris pv. campestris (Xcc) interfered with morphological transition and sporulation of Bacillus thuringiensis in mixed cultures, whereas abrogation of the DSF synthase RpfF reduced the interference. DSF inhibited B. thuringiensis cell division and sporulation through modulation of ftsZ, which encodes an important cell division protein in bacterial cells. In addition, RpfF is essential for production of six DSF-family signals in Xcc, which employ the same signaling pathways to regulate biological functions in Xcc and play similar effects on reduction of cell division, sporulation and antibiotic resistance of B. thuringiensis. Furthermore, abrogation of RpfF decreased the competitive capability of Xcc against B. thuringiensis on the surface of Chinese cabbage leaves. Our findings provide new insights into the role of DSF-family signals in interspecies competition and depict molecular mechanisms with which Xcc competes with B. thuringiensis. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  20. Online Dutch L2 Learning in Adult Education: Educators' and Providers' Viewpoints on Needs, Advantages and Disadvantages

    Science.gov (United States)

    De Paepe, Liesbeth; Zhu, Chang; Depryck, Koen

    2018-01-01

    This study critically addresses the assumptions made by educators and providers in the field of Dutch second language (L2) acquisition about the online learning of Dutch L2. These include assumptions about advantages and disadvantages of online language learning, such as flexibility, learner autonomy, enhanced opportunities for remediation and…

  1. Advantages and limitations of potential methods for the analysis of bacteria in milk: a review.

    Science.gov (United States)

    Tabit, Frederick Tawi

    2016-01-01

    Contamination concerns in the dairy industry are motivated by outbreaks of disease in humans and the inability of thermal processes to eliminate bacteria completely in processed products. HACCP principles are an important tool used in the food industry to identify and control potential food safety hazards in order to meet customer demands and regulatory requirements. Milk testing is of importance to the milk industry regarding quality assurance and monitoring of processed products by researchers, manufacturers and regulatory agencies. Due to the availability of numerous methods used for analysing the microbial quality of milk in literature and differences in priorities of stakeholders, it is sometimes confusing to choose an appropriate method for a particular analysis. The objective of this paper is to review the advantages and disadvantages of selected techniques that can be used in the analysis of bacteria in milk. SSC, HRMA, REP, and RAPD are the top four techniques which are quick and cost-effective and possess adequate discriminatory power for the detection and profiling of bacteria. The following conclusions were arrived at during this review: HRMA, REP and RFLP are the techniques with the most reproducible results, and the techniques with the most discriminatory power are AFLP, PFGE and Raman Spectroscopy.

  2. Rapid Methods for the Detection of Foodborne Bacterial Pathogens: Principles, Applications, Advantages and Limitations

    Directory of Open Access Journals (Sweden)

    Law eJodi Woan-Fei

    2015-01-01

    Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.

  3. Cumulative Advantage in the Skill Development of STEM Graduate Students: A Mixed-Methods Study

    Science.gov (United States)

    Feldon, David F.; Maher, Michelle A.; Roksa, Josipa; Peugh, James

    2016-01-01

    Studies of skill development often describe a process of cumulative advantage, in which small differences in initial skill compound over time, leading to increasing skill gaps between those with an initial advantage and those without. We offer evidence of a similar phenomenon accounting for differential patterns of research skill development in…

  4. Methods for providing intermediates in the synthesis of atorvastatin.

    NARCIS (Netherlands)

    Dömling, Alexander Stephan Siegfried

    2016-01-01

    The invention relates to the field of medicinal chemistry, In particular, it relates to methods for providing intermediates in the synthesis of Atorvastatin, a competitive inhibitor of HMG-Co A reductase. Provided is a process for providing a compound having a Formula (I) or a pharmaceutically

  5. Medicare Program; Revisions to Payment Policies Under the Physician Fee Schedule and Other Revisions to Part B for CY 2017; Medicare Advantage Bid Pricing Data Release; Medicare Advantage and Part D Medical Loss Ratio Data Release; Medicare Advantage Provider Network Requirements; Expansion of Medicare Diabetes Prevention Program Model; Medicare Shared Savings Program Requirements. Final rule.

    Science.gov (United States)

    2016-11-15

    This major final rule addresses changes to the physician fee schedule and other Medicare Part B payment policies, such as changes to the Value Modifier, to ensure that our payment systems are updated to reflect changes in medical practice and the relative value of services, as well as changes in the statute. This final rule also includes changes related to the Medicare Shared Savings Program, requirements for Medicare Advantage Provider Networks, and provides for the release of certain pricing data from Medicare Advantage bids and of data from medical loss ratio reports submitted by Medicare health and drug plans. In addition, this final rule expands the Medicare Diabetes Prevention Program model.

  6. ADVANTAGES OF RAPID METHOD FOR DETERMINING SCALE MASS AND DECARBURIZED LAYER OF ROLLED COIL STEEL

    Directory of Open Access Journals (Sweden)

    E. V. Parusov

    2016-08-01

    Full Text Available Purpose. To determine the universal empirical relationships that allow for operational calculation of scale mass and decarbonized layer depth based on the parameters of the technological process for rolled coil steel production. Methodology. The research is carried out on the industrial batches of the rolled steel of SAE 1006 and SAE 1065 grades. Scale removability was determined in accordance with the procedure of «Bekaert» company by the specifi-cations: GA-03-16, GA-03-18, GS-03-02, GS-06-01. The depth of decarbonized layer was identified in accordance with GOST 1763-68 (M method. Findings. Analysis of experimental data allowed us to determine the rational temperature of coil formation of the investigated steel grades, which provide the best possible removal of scale from the metal surface, a minimal amount of scale, as well as compliance of the metal surface color with the require-ments of European consumers. Originality. The work allowed establishing correlation of the basic quality indicators of the rolled coil high carbon steel (scale mass, depth of decarbonized layer and inter-laminar distance in pearlite with one of the main parameters (coil formation temperature of the deformation and heat treatment mode. The re-sulting regression equations, without metallographic analysis, can be used to determine, with a minimum error, the quantitative values of the total scale mass, depth of decarbonized layer and the average inter-lamellar distance in pearlite of the rolled coil high carbon steel. Practical value. Based on the specifications of «Bekaert» company (GA-03-16, GA-03-18, GS-03-02 and GS-06-01 the method of testing descaling by mechanical means from the surface of the rolled coil steel of low- and high-carbon steel grades was developed and approved in the environment of PJSC «ArcelorMittal Kryvyi Rih». The work resulted in development of the rapid method for determination of total and remaining scale mass on the rolled coil steel

  7. Institutional advantage

    NARCIS (Netherlands)

    Martin, Xavier

    Is there such a thing as institutional advantage—and what does it mean for the study of corporate competitive advantage? In this article, I develop the concept of institutional competitive advantage, as distinct from plain competitive advantage and from comparative institutional advantage. I first

  8. Competing for Iron: Duplication and Amplification of the isd Locus in Staphylococcus lugdunensis HKU09-01 Provides a Competitive Advantage to Overcome Nutritional Limitation.

    Science.gov (United States)

    Heilbronner, Simon; Monk, Ian R; Brozyna, Jeremy R; Heinrichs, David E; Skaar, Eric P; Peschel, Andreas; Foster, Timothy J

    2016-08-01

    Staphylococcus lugdunensis is a coagulase negative bacterial pathogen that is particularly associated with severe cases of infectious endocarditis. Unique amongst the coagulase-negative staphylococci, S. lugdunensis harbors an iron regulated surface determinant locus (isd). This locus facilitates the acquisition of heme as a source of nutrient iron during infection and allows iron limitation caused by "nutritional immunity" to be overcome. The isd locus is duplicated in S. lugdunensis HKU09-01 and we show here that the duplication is intrinsically unstable and undergoes accordion-like amplification and segregation leading to extensive isd copy number variation. Amplification of the locus increased the level of expression of Isd proteins and improved binding of hemoglobin to the cell surface of S. lugdunensis. Furthermore, Isd overexpression provided an advantage when strains were competing for a limited amount of hemoglobin as the sole source of iron. Gene duplications and amplifications (GDA) are events of fundamental importance for bacterial evolution and are frequently associated with antibiotic resistance in many species. As such, GDAs are regarded as evolutionary adaptions to novel selective pressures in hostile environments pointing towards a special importance of isd for S. lugdunensis. For the first time we show an example of a GDA that involves a virulence factor of a Gram-positive pathogen and link the GDA directly to a competitive advantage when the bacteria were struggling with selective pressures mimicking "nutritional immunity".

  9. Competing for Iron: Duplication and Amplification of the isd Locus in Staphylococcus lugdunensis HKU09-01 Provides a Competitive Advantage to Overcome Nutritional Limitation

    Science.gov (United States)

    Heilbronner, Simon; Brozyna, Jeremy R.; Heinrichs, David E.; Skaar, Eric P.; Peschel, Andreas; Foster, Timothy J.

    2016-01-01

    Staphylococcus lugdunensis is a coagulase negative bacterial pathogen that is particularly associated with severe cases of infectious endocarditis. Unique amongst the coagulase-negative staphylococci, S. lugdunensis harbors an iron regulated surface determinant locus (isd). This locus facilitates the acquisition of heme as a source of nutrient iron during infection and allows iron limitation caused by “nutritional immunity” to be overcome. The isd locus is duplicated in S. lugdunensis HKU09-01 and we show here that the duplication is intrinsically unstable and undergoes accordion-like amplification and segregation leading to extensive isd copy number variation. Amplification of the locus increased the level of expression of Isd proteins and improved binding of hemoglobin to the cell surface of S. lugdunensis. Furthermore, Isd overexpression provided an advantage when strains were competing for a limited amount of hemoglobin as the sole source of iron. Gene duplications and amplifications (GDA) are events of fundamental importance for bacterial evolution and are frequently associated with antibiotic resistance in many species. As such, GDAs are regarded as evolutionary adaptions to novel selective pressures in hostile environments pointing towards a special importance of isd for S. lugdunensis. For the first time we show an example of a GDA that involves a virulence factor of a Gram-positive pathogen and link the GDA directly to a competitive advantage when the bacteria were struggling with selective pressures mimicking “nutritional immunity”. PMID:27575058

  10. Requirements for Participative Management as a Source of Sustainable Competitive Advantage and Tipical Management Method

    Directory of Open Access Journals (Sweden)

    Muscalu Emanoil

    2015-12-01

    Full Text Available The economic context in the recent years has undergone major changes in modern methods and techniques used in management. The current competitive environment is characterized by permanent turbulences influencing firstly the managerial act itself. Out of the many methods and techniques applied so far, some turn out to be less adaptable to the current economic and social context.

  11. Method for providing uranium with a protective copper coating

    Science.gov (United States)

    Waldrop, Forrest B.; Jones, Edward

    1981-01-01

    The present invention is directed to a method for providing uranium metal with a protective coating of copper. Uranium metal is subjected to a conventional cleaning operation wherein oxides and other surface contaminants are removed, followed by etching and pickling operations. The copper coating is provided by first electrodepositing a thin and relatively porous flash layer of copper on the uranium in a copper cyanide bath. The resulting copper-layered article is then heated in an air or inert atmosphere to volatilize and drive off the volatile material underlying the copper flash layer. After the heating step an adherent and essentially non-porous layer of copper is electro-deposited on the flash layer of copper to provide an adherent, multi-layer copper coating which is essentially impervious to corrosion by most gases.

  12. System and Method for Providing a Climate Data Persistence Service

    Science.gov (United States)

    Schnase, John L. (Inventor); Ripley, III, William David (Inventor); Duffy, Daniel Q. (Inventor); Thompson, John H. (Inventor); Strong, Savannah L. (Inventor); McInerney, Mark (Inventor); Sinno, Scott (Inventor); Tamkin, Glenn S. (Inventor); Nadeau, Denis (Inventor)

    2018-01-01

    A system, method and computer-readable storage devices for providing a climate data persistence service. A system configured to provide the service can include a climate data server that performs data and metadata storage and management functions for climate data objects, a compute-storage platform that provides the resources needed to support a climate data server, provisioning software that allows climate data server instances to be deployed as virtual climate data servers in a cloud computing environment, and a service interface, wherein persistence service capabilities are invoked by software applications running on a client device. The climate data objects can be in various formats, such as International Organization for Standards (ISO) Open Archival Information System (OAIS) Reference Model Submission Information Packages, Archive Information Packages, and Dissemination Information Packages. The climate data server can enable scalable, federated storage, management, discovery, and access, and can be tailored for particular use cases.

  13. Method for Providing Semiconductors Having Self-Aligned Ion Implant

    Science.gov (United States)

    Neudeck, Philip G. (Inventor)

    2014-01-01

    A method is disclosed that provides a self-aligned nitrogen-implant particularly suited for a Junction Field Effect Transistor (JFET) semiconductor device preferably comprised of a silicon carbide (SiC). This self-aligned nitrogen-implant allows for the realization of durable and stable electrical functionality of high temperature transistors such as JFETs. The method implements the self-aligned nitrogen-implant having predetermined dimensions, at a particular step in the fabrication process, so that the SiC junction field effect transistors are capable of being electrically operating continuously at 500.degree. C. for over 10,000 hours in an air ambient with less than a 10% change in operational transistor parameters.

  14. Method for providing a low density high strength polyurethane foam

    Science.gov (United States)

    Whinnery, Jr., Leroy L.; Goods, Steven H.; Skala, Dawn M.; Henderson, Craig C.; Keifer, Patrick N.

    2013-06-18

    Disclosed is a method for making a polyurethane closed-cell foam material exhibiting a bulk density below 4 lbs/ft.sup.3 and high strength. The present embodiment uses the reaction product of a modified MDI and a sucrose/glycerine based polyether polyol resin wherein a small measured quantity of the polyol resin is "pre-reacted" with a larger quantity of the isocyanate in a defined ratio such that when the necessary remaining quantity of the polyol resin is added to the "pre-reacted" resin together with a tertiary amine catalyst and water as a blowing agent, the polymerization proceeds slowly enough to provide a stable foam body.

  15. Implementation of a new rapid tissue processing method--advantages and challenges

    DEFF Research Database (Denmark)

    Munkholm, Julie; Talman, Maj-Lis; Hasselager, Thomas

    2008-01-01

    Conventional tissue processing of histologic specimens has been carried out in the same manner for many years. It is a time-consuming process involving batch production, resulting in a 1-day delay of the diagnosis. Microwave-assisted tissue processing enables a continuous high flow of histologic...... specimens through the processor with a processing time of as low as 1h. In this article, we present the effects of the automated microwave-assisted tissue processor on the histomorphologic quality and the turnaround time (TAT) for histopathology reports. We present a blind comparative study regarding...... the histomorphologic quality of microwave-processed and conventionally processed tissue samples. A total of 333 specimens were included. The microwave-assisted processing method showed a histomorphologic quality comparable to the conventional method for a number of tissue types, including skin and specimens from...

  16. Intracavitary after loading techniques, advantages and disadvantages with high and low dose-rate methods

    International Nuclear Information System (INIS)

    Walstam, Rune

    1980-01-01

    Even though suggested as early as 1903, it is only when suitable sealed gamma sources became available, afterloading methods could be developed for interstitial as well as intracavitary work. Manual afterloading technique can be used only for low dose rate irradiation, while remote controlled afterloading technique can be used for both low and high dose-rate irradiation. Afterloading units used at the Karolinska Institute, Stockholm, are described, and experience of their use is narrated briefly. (M.G.B.)

  17. Advantages in diagnosis of coronary artery disease by a combination of nuclear medicine methods

    International Nuclear Information System (INIS)

    Schmidt, H.A.E.; Birk, W.; Michele, E.

    1983-01-01

    Investigations on 106 patients with coronary artery disease were performed to improve the diagnosis of myocardial ischemia by combining myocardial scintigraphy and gated blood pool studies. The results show that it is possible to enhance the detection of coronary artery and to classify haemodynamic efficiency. In addition we found that in investigations performed on patients with arrhytmia and under stress conditions the 'hybrid-technique' is superior to the framemode acquisition method. (orig.) [de

  18. Advantages of discussion and cognitive conflict as an instructional method in contemporary teaching of mathematics

    Directory of Open Access Journals (Sweden)

    Mišurac-Zorica Irena

    2012-01-01

    Full Text Available Contemporary theories of teaching and learning mathematics emphasise the importance of learner’s active participation in the teaching process, in which discovery and logical reasoning lead to the construction of student’s knowledge. In this form of teaching, it is important to detect students’ misunderstandings and errors that can occur during learning. Uncovered tacit and false conceptions of students’ knowledge can greatly contribute to the opposite effect in the construction of knowledge. In teaching mathematics, there are many situations which leave students with ambiguities and misunderstandings, and create an impression in children that teaching of mathematics and mathematical knowledge itself is something that is not possible. Discussion and cognitive conflict are methods which have their starting point in the theory of constructivism. The aim of our study has been to determine whether application of the method of discussion and cognitive conflict in learning to divide decimal numbers leads to the enhancement of student’s procedural knowledge and conceptual knowledge about the division of decimal numbers. Longitudinally, we monitored two groups of 117 pupils of the fifth grade. In the first group, which was taught according to the guidelines of contemporary mathematics education, students engaged in discussion, discovering their misunderstandings and errors, and the cognitive conflict resulted in correct concepts. The second group of students were taught traditionally, learning the procedure and then practicing it. The paper presents a descriptive analysis of the process of teaching and quantitative analysis of the performance based on the comparison of conceptual and procedural knowledge of both groups. Results of our work show that the application of contemporary methods of discussion and cognitive conflict affects the increase of procedural and conceptual knowledge of the division of decimal numbers.

  19. Generic Advantages

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Generic Advantages. Scalability an incremental coverage. Standardization. Business Plan Flexibility. Lifecycle Flexibility. Reliability. Service Interoperability. Changed Industry dynamics.

  20. Constructing Tissue Microarrays: Protocols and Methods Considering Potential Advantages and Disadvantages for Downstream Use.

    Science.gov (United States)

    Bingle, Lynne; Fonseca, Felipe P; Farthing, Paula M

    2017-01-01

    Tissue microarrays were first constructed in the 1980s but were used by only a limited number of researchers for a considerable period of time. In the last 10 years there has been a dramatic increase in the number of publications describing the successful use of tissue microarrays in studies aimed at discovering and validating biomarkers. This, along with the increased availability of both manual and automated microarray builders on the market, has encouraged even greater use of this novel and powerful tool. This chapter describes the basic techniques required to build a tissue microarray using a manual method in order that the theory behind the practical steps can be fully explained. Guidance is given to ensure potential disadvantages of the technique are fully considered.

  1. Visualizing 3D Food Microstructure Using Tomographic Methods: Advantages and Disadvantages.

    Science.gov (United States)

    Wang, Zi; Herremans, Els; Janssen, Siem; Cantre, Dennis; Verboven, Pieter; Nicolaï, Bart

    2018-03-25

    X-ray micro-computed tomography (micro-CT) provides the unique ability to capture intact internal microstructure data without significant preparation of the sample. The fundamentals of micro-CT technology are briefly described along with a short introduction to basic image processing, quantitative analysis, and derivative computational modeling. The applications and limitations of micro-CT in industries such as meat, dairy, postharvest, and bread/confectionary are discussed to serve as a guideline to the plausibility of utilizing the technique for detecting features of interest. Component volume fractions, their respective size/shape distributions, and connectivity, for example, can be utilized for product development, manufacturing process tuning and/or troubleshooting. In addition to determining structure-function relations, micro-CT can be used for foreign material detection to further ensure product quality and safety. In most usage scenarios, micro-CT in its current form is perfectly adequate for determining microstructure in a wide variety of food products. However, in low-contrast and low-stability samples, emphasis is placed on the shortcomings of the current systems to set realistic expectations for the intended users.

  2. Absolute advantage

    NARCIS (Netherlands)

    J.G.M. van Marrewijk (Charles)

    2008-01-01

    textabstractA country is said to have an absolute advantage over another country in the production of a good or service if it can produce that good or service using fewer real resources. Equivalently, using the same inputs, the country can produce more output. The concept of absolute advantage can

  3. The Valine Anticodon and Valylatability of Peanut Clump Virus RNAs Are Not Essential but Provide a Modest Competitive Advantage in Plants†

    Science.gov (United States)

    Matsuda, Daiki; Dunoyer, Patrice; Hemmer, Odile; Fritsch, Christiane; Dreher, Theo W.

    2000-01-01

    The role of valine aminoacylation of the two genomic RNAs of Peanut clump virus (PCV) was studied by comparing the amplification in vivo of RNAs with GAC, GΔC, or CCA anticodons in the tRNA-like structure (TLS) present at the 3′ end of each viral RNA. The PCV RNA1 TLS of isolate PCV2 possesses a GAC anticodon and is capable of highly efficient valylation, whereas the RNA2 TLS has a GΔC anticodon that does not support valylation. The presence in RNA1 of GΔC or CCA anticodons that conferred nonvalylatability resulted in about 2- to 4-fold and a 14- to 24-fold reduction, respectively, in RNA accumulations in tobacco BY-2 protoplasts inoculated with the RNA1 variants together with wild-type RNA2(GΔC). No differences in RNA levels were observed among protoplasts inoculated with the three variant RNA2s in the presence of wild-type RNA1(GAC). All combinations of valylatable and nonvalylatable RNAs 1 and 2 were similarly infectious in Nicotiana benthamiana plants, and viral RNAs accumulated to similar levels; all input TLS sequences were present unchanged in apical leaves. In direct competition experiments in N. benthamiana plants, however, both RNA1 and RNA2 with GAC valylatable anticodons outcompeted the nonvalylatable variants. We conclude that valylation provides a small but significant replicational advantage to both PCV RNAs. Sequence analysis of the TLS from RNA2 of a second PCV isolate, PO2A, revealed the presence of an intact GAC valine anticodon, suggesting that the differential valylation of the genomic RNAs of isolate PCV2 is not a general characteristic of PCV. PMID:10954573

  4. A Single Amino Acid Change in the Marburg Virus Matrix Protein VP40 Provides a Replicative Advantage in a Species-Specific Manner

    Science.gov (United States)

    Koehler, Alexander; Kolesnikova, Larissa; Welzel, Ulla; Schudt, Gordian; Herwig, Astrid

    2015-01-01

    of the molecular mechanisms increasing virulence. Using a reverse genetics approach, we demonstrated that a single mutation in MARV VP40 detected in a guinea pig-adapted MARV provided a replicative advantage of rMARVVP40(D184N) in guinea pig cells. Our studies show that this replicative advantage of rMARV VP40D184N was based on the improved functions of VP40 in iVLP assembly and in the regulation of transcription and replication rather than on the ability of VP40 to combat the host innate immunity. PMID:26581998

  5. [Is one picture worth a thousand words? Risk communication in primary care: advantages and shortcomings of different methods].

    Science.gov (United States)

    Neuner-Jehle, S; Wegwarth, O; Steurer, J

    2008-06-11

    Communication about risk, e.g. cardiovascular risk, is a central task of physicians in their daily practice. In this paper we summarize the different methods of risk communication published in the literature. The different methods and their particular advantages and shortcomings are described and some recommendations are formulated. The most significant of them are: verbal qualifiers like, your risk for a cardiovascular event is moderate, is imprecise and difficult to interpret. Information about risk in numerical form is more comprehensible when delivered in natural frequencies compared to percentages, pictorial representations contribute to a better understanding. Probably not one single mode of representation is the most effective way to convey information about risk, but a combination of methods.

  6. USING CONVOLUTIONAL NEURAL NETWORKS FOR LICENSE PLATES RECOGNITION. ADVANTAGES AND DISADVANTAGES IN COMPARISON WITH TEMPLATE-BASED METHOD

    OpenAIRE

    Mikhalevich Y. S.; Tkachenko V. V.

    2016-01-01

    Car license plates recognition problem is one of the typical tasks of computer vision. Video surveillance software usually provides license plates recognition function. Meanwhile, there are many approaches to solve this problem, where template-based methods are the most common. Such methods providing predictable and short enough execution time, and little percent of mistakes. However, such methods are far less effective in case there is a need to recognize car’s license plate, which may be lo...

  7. Comparative Advantage

    DEFF Research Database (Denmark)

    Zhang, Jie; Jensen, Camilla

    2007-01-01

    that are typically explained from the supply-side variables, the comparative advantage of the exporting countries. A simple model is proposed and tested. The results render strong support for the relevance of supply-side factors such as natural endowments, technology, and infrastructure in explaining international...

  8. 32 CFR 199.14 - Provider reimbursement methods.

    Science.gov (United States)

    2010-07-01

    ... physicians. (6) All services provided by nurse anesthetists. (7) All services related to discharges involving... more accurate data became available. (v) No update for inflation. The children's hospital differential... considered lower volume hospitals. (B) Hospitals that subsequently become higher volume hospitals. In any...

  9. Detecting the contagion effect in mass killings; a constructive example of the statistical advantages of unbinned likelihood methods.

    Science.gov (United States)

    Towers, Sherry; Mubayi, Anuj; Castillo-Chavez, Carlos

    2018-01-01

    When attempting to statistically distinguish between a null and an alternative hypothesis, many researchers in the life and social sciences turn to binned statistical analysis methods, or methods that are simply based on the moments of a distribution (such as the mean, and variance). These methods have the advantage of simplicity of implementation, and simplicity of explanation. However, when null and alternative hypotheses manifest themselves in subtle differences in patterns in the data, binned analysis methods may be insensitive to these differences, and researchers may erroneously fail to reject the null hypothesis when in fact more sensitive statistical analysis methods might produce a different result when the null hypothesis is actually false. Here, with a focus on two recent conflicting studies of contagion in mass killings as instructive examples, we discuss how the use of unbinned likelihood methods makes optimal use of the information in the data; a fact that has been long known in statistical theory, but perhaps is not as widely appreciated amongst general researchers in the life and social sciences. In 2015, Towers et al published a paper that quantified the long-suspected contagion effect in mass killings. However, in 2017, Lankford & Tomek subsequently published a paper, based upon the same data, that claimed to contradict the results of the earlier study. The former used unbinned likelihood methods, and the latter used binned methods, and comparison of distribution moments. Using these analyses, we also discuss how visualization of the data can aid in determination of the most appropriate statistical analysis methods to distinguish between a null and alternate hypothesis. We also discuss the importance of assessment of the robustness of analysis results to methodological assumptions made (for example, arbitrary choices of number of bins and bin widths when using binned methods); an issue that is widely overlooked in the literature, but is critical

  10. Methodical Approaches to Communicative Providing of Retailer Branding

    Directory of Open Access Journals (Sweden)

    Andrey Kataev

    2017-07-01

    Full Text Available The thesis is devoted to the rationalization of methodical approaches for provision of branding of retail trade enterprises. The article considers the features of brand perception by retail consumers and clarifies the specifics of customer reviews of stores for the procedures accompanying brand management. It is proved that besides traditional communication mix, the most important tool of communicative influence on buyers is the store itself as a place for comfortable shopping. The shop should have a stimulating effect on all five human senses, including sight, smell, hearing, touch, and taste, which shall help maximize consumer integration into the buying process.

  11. CCND1–CDK4–mediated cell cycle progression provides a competitive advantage for human hematopoietic stem cells in vivo

    Science.gov (United States)

    Mende, Nicole; Kuchen, Erika E.; Lesche, Mathias; Grinenko, Tatyana; Kokkaliaris, Konstantinos D.; Hanenberg, Helmut; Lindemann, Dirk; Dahl, Andreas; Platz, Alexander; Höfer, Thomas; Calegari, Federico

    2015-01-01

    Maintenance of stem cell properties is associated with reduced proliferation. However, in mouse hematopoietic stem cells (HSCs), loss of quiescence results in a wide range of phenotypes, ranging from functional failure to extensive self-renewal. It remains unknown whether the function of human HSCs is controlled by the kinetics of cell cycle progression. Using human HSCs and human progenitor cells (HSPCs), we report here that elevated levels of CCND1–CDK4 complexes promoted the transit from G0 to G1 and shortened the G1 cell cycle phase, resulting in protection from differentiation-inducing signals in vitro and increasing human leukocyte engraftment in vivo. Further, CCND1–CDK4 overexpression conferred a competitive advantage without impacting HSPC numbers. In contrast, accelerated cell cycle progression mediated by elevated levels of CCNE1–CDK2 led to the loss of functional HSPCs in vivo. Collectively, these data suggest that the transition kinetics through the early cell cycle phases are key regulators of human HSPC function and important for lifelong hematopoiesis. PMID:26150472

  12. Position detectors, methods of detecting position, and methods of providing positional detectors

    Science.gov (United States)

    Weinberg, David M.; Harding, L. Dean; Larsen, Eric D.

    2002-01-01

    Position detectors, welding system position detectors, methods of detecting various positions, and methods of providing position detectors are described. In one embodiment, a welding system positional detector includes a base that is configured to engage and be moved along a curved surface of a welding work piece. At least one position detection apparatus is provided and is connected with the base and configured to measure angular position of the detector relative to a reference vector. In another embodiment, a welding system positional detector includes a weld head and at least one inclinometer mounted on the weld head. The one inclinometer is configured to develop positional data relative to a reference vector and the position of the weld head on a non-planar weldable work piece.

  13. Advantages and Limitations of Androgen Receptor-Based Methods for Detecting Anabolic Androgenic Steroid Abuse as Performance Enhancing Drugs

    Science.gov (United States)

    Bailey, Kathy; Yazdi, Tahmineh; Masharani, Umesh; Tyrrell, Blake; Butch, Anthony; Schaufele, Fred

    2016-01-01

    Testosterone (T) and related androgens are performance enhancing drugs (PEDs) abused by some athletes to gain competitive advantage. To monitor unauthorized androgen abuse, doping control programs use mass spectrometry (MS) to detect androgens, synthetic anabolic-androgenic steroids (AASs) and their metabolites in an athlete’s urine. AASs of unknown composition will not be detected by these procedures. Since AASs achieve their anabolic effects by activating the Androgen Receptor (AR), cell-based bioassays that measure the effect of a urine sample on AR activity are under investigation as complementary, pan-androgen detection methods. We evaluated an AR BioAssay as a monitor for androgen activity in urine pre-treated with glucuronidase, which releases T from the inactive T-glucuronide that predominates in urine. AR BioAssay activity levels were expressed as ‘T-equivalent’ concentrations by comparison to a T dose response curve. The T-equivalent concentrations of androgens in the urine of hypogonadal participants supplemented with T (in whom all androgenic activity should arise from T) were quantitatively identical to the T measurements conducted by MS at the UCLA Olympic Analytical Laboratory (0.96 ± 0.22). All 17 AASs studied were active in the AR BioAssay; other steroids were inactive. 12 metabolites of 10 commonly abused AASs, which are used for MS monitoring of AAS doping because of their prolonged presence in urine, had reduced or no AR BioAssay activity. Thus, the AR BioAssay can accurately and inexpensively monitor T, but its ability to monitor urinary AASs will be limited to a period immediately following doping in which the active AASs remain intact. PMID:26998755

  14. Advantages and Limitations of Androgen Receptor-Based Methods for Detecting Anabolic Androgenic Steroid Abuse as Performance Enhancing Drugs.

    Science.gov (United States)

    Bailey, Kathy; Yazdi, Tahmineh; Masharani, Umesh; Tyrrell, Blake; Butch, Anthony; Schaufele, Fred

    2016-01-01

    Testosterone (T) and related androgens are performance enhancing drugs (PEDs) abused by some athletes to gain competitive advantage. To monitor unauthorized androgen abuse, doping control programs use mass spectrometry (MS) to detect androgens, synthetic anabolic-androgenic steroids (AASs) and their metabolites in an athlete's urine. AASs of unknown composition will not be detected by these procedures. Since AASs achieve their anabolic effects by activating the Androgen Receptor (AR), cell-based bioassays that measure the effect of a urine sample on AR activity are under investigation as complementary, pan-androgen detection methods. We evaluated an AR BioAssay as a monitor for androgen activity in urine pre-treated with glucuronidase, which releases T from the inactive T-glucuronide that predominates in urine. AR BioAssay activity levels were expressed as 'T-equivalent' concentrations by comparison to a T dose response curve. The T-equivalent concentrations of androgens in the urine of hypogonadal participants supplemented with T (in whom all androgenic activity should arise from T) were quantitatively identical to the T measurements conducted by MS at the UCLA Olympic Analytical Laboratory (0.96 ± 0.22). All 17 AASs studied were active in the AR BioAssay; other steroids were inactive. 12 metabolites of 10 commonly abused AASs, which are used for MS monitoring of AAS doping because of their prolonged presence in urine, had reduced or no AR BioAssay activity. Thus, the AR BioAssay can accurately and inexpensively monitor T, but its ability to monitor urinary AASs will be limited to a period immediately following doping in which the active AASs remain intact.

  15. A method to provide rapid in situ determination of tip radius in dynamic atomic force microscopy

    International Nuclear Information System (INIS)

    Santos, Sergio; Guang Li; Souier, Tewfik; Gadelrab, Karim; Chiesa, Matteo; Thomson, Neil H.

    2012-01-01

    We provide a method to characterize the tip radius of an atomic force microscopy in situ by monitoring the dynamics of the cantilever in ambient conditions. The key concept is that the value of free amplitude for which transitions from the attractive to repulsive force regimes are observed, strongly depends on the curvature of the tip. In practice, the smaller the value of free amplitude required to observe a transition, the sharper the tip. This general behavior is remarkably independent of the properties of the sample and cantilever characteristics and shows the strong dependence of the transitions on the tip radius. The main advantage of this method is rapid in situ characterization. Rapid in situ characterization enables one to continuously monitor the tip size during experiments. Further, we show how to reproducibly shape the tip from a given initial size to any chosen larger size. This approach combined with the in situ tip size monitoring enables quantitative comparison of materials measurements between samples. These methods are set to allow quantitative data acquisition and make direct data comparison readily available in the community.

  16. Advantage Energy

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-07-01

    Increased focus has been placed on the issues of energy access and energy poverty over the last number of years, most notably indicated by the United Nations (UN) declaring 2012 as the 'International Year of Sustainable Energy for All'. Although attention in these topics has increased, incorrect assumptions and misunderstandings still arise in both the literature and dialogues. Access to energy does not only include electricity, does not only include cook stoves, but must include access to all types of energy that form the overall energy system. This paper chooses to examine this energy system using a typology that breaks it into 3 primary energy subsystems: heat energy, electricity and transportation. Describing the global energy system using these three subsystems provides a way to articulate the differences and similarities for each system's required investments needs by the private and public sectors.

  17. Use of technology to provide competitive advantage

    International Nuclear Information System (INIS)

    Clark, P. D.

    1999-01-01

    The role of technology in plotting a new paradigm is explored by means of reviewing NOVA Chemicals' technology strategy for feedstocks, petrochemicals and polymers. As part of this transformation of technology from that of a servant to a key contributor to the success of the company, the expansion (in a 50/50 joint venture with DOW/Union Carbide) of a mammoth 2.8 billion pound ethylene plant at Joffre, Alberta is 'the jewel in the crown'. This plant, with the two ethylene units already on site will make Joffre in the year 2000 the world's largest single site for the manufacture of ethylene. An 800 million pound Advanced SCLAIRTECH T M polystyrene plant, (a proprietary process for the manufacture of high performance polymers initially developed, but considered 'non-strategic' to their own needs, by DuPont and sold to NOVA Chemicals for $ 45 million in 1994), the largest single train of its kind in the world, is also under construction. Also in the early stages of construction on the site is a large linear alpha olefin plant owned by BP-Amoco to supply co-monomer to the polyethylene plant, To back up these facilities, there is a 400 MW cogeneration unit to supply power and steam. NOVA Chemicals Research and Technology Laboratory is a focused world class research facility with an annual budget of $ 37 million, combined with the active collaboration with all major Canadian universities, and targeted projects with other universities around the world , are all necessary components of creating and acquiring the technology that is required to achieve the corporate goals of the company. The high level of investment in research and technology is seen as the pathway to fundamentally change the business and create value which can be realized in the marketplace. Research and technology also help the company to advance the competitiveness of their own processes, keep the company on the cutting edge of technology, and assure its survival among the leaders of the industry

  18. Educational advantage.

    Science.gov (United States)

    2013-07-01

    This issue of JERHRE examines informed consent requirements as they arise in diverse countries and cultures, and in relation to level of risk of the research and vulnerability of the potential participants. It also examines issues of literacy as they affect informed consent. And it examines whether research participants want to be informed. Adequate informed consent is a statement that is meaningful and understandable by the particular research participant and that allows the participant free choice regarding participation. The way in which an adequate consent procedure is administered must, by definition, depend on the level of literacy of the potential research participants, and the nature and values of the culture of the potential participants. An implication of these requirements is that Western consent procedures are likely to violate ethical standards when employed in non-Western cultures. Educational activities presented below will enable readers to consolidate their knowledge and understanding of these issues. Written informed consent statements are not valid for use with research participants who lack literacy. The level of literacy required depends on the complexity of the research topic. In Clough et al., we find that cultural differences in self-concept, understanding of research methods, level of education, and deference to researchers challenge researchers to modify standard consent procedures to render them valid in some cultural contexts. In Abou Zeina et al., we find an even more complex problem of communicating patients' rights to illiterate patients in an Egyptian public hospital: not only can they not read, but they consider "patients' rights" as the least of their problems. In Iverson et al., we find still different issues concerning the scientific literacy of surrogate decision makers for critically ill patients. And in Ghandour et al., we find in Lebanon, within a very large sample of socioeconomically diverse students, a virtually total lack

  19. Assessing the speed of kill of hookworms, Ancylostoma caninum, by Advantage Multi ® for Dogs using endoscopic methods.

    Science.gov (United States)

    Lee, Alice C Y; Hostetler, Joseph A; Bowman, Dwight D

    2014-08-29

    Endoscopic capsules and endoscopy were used to assess the speed of kill and the clearance of hookworms in dogs experimentally infected with Ancylostoma caninum. A total of four adult dogs were inoculated in two separate cohorts comprised of two 4-year-old females and two 7-year-old males. Dogs were treated topically with Advantage Multi(®) for Dogs 13 days (Cohort 1) or 16 days (Cohort 2) after infection. Endoscopic imaging of the small intestine was carried out both pre- and post-treatment. Examination of the first cohort revealed that the worms had been cleared and the hookworm-induced lacerations were markedly diminished within 48 h of treatment. In the second cohort, endoscopic capsules were given the day of, the day after, and two days after treatment; within 24h of product administration, the worms had been removed with a concurrent reduction in observed lesions. Topical application of Advantage Multi(®) for Dogs rapidly removed worms from the small intestine of the dogs in this study as early as 24h post-treatment, with a marked reduction in the number of mucosal lesions seen. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  20. THE ADVANTAGES OF THE DISTRIBUTION FUNCTION AS A METHOD OF GRAPHICAL REPRESENTATION OF THE ECONOMIC STRUCTURE OF SOCIETY

    Directory of Open Access Journals (Sweden)

    V. A. Kapitanov

    2018-01-01

    Full Text Available The aim of the paper is to compare three different methods of graphical representation of the inequality: using frequency polygons, Lorentz curves and distribution functions. It is shown that for the representation of real (i.e. incomplete data, the last is most appropriate. The method of investigation consists in verifying the conformity of the method of graphical representation of inequality to the following three requirements:1. Insensitivity of the method to the quantization of data.2. Sensitivity to the width of the entire range of income from zero to income of the richest person provided that information about the wealthy members of society might be incomplete.3. Visibility. The curve, describing the inequality must have characteristic points (extremes, bends so that it can be somehow identified. The presence of features in the economic structure of society must be reflected in the qualitative behavior of the curves. The demand is caused by the necessity to draw a conclusion about the mechanism of the movement of goods in society, which led to the appearance of a curve of exactly this form.The work analyzed direct data on the incomes of Russian citizens published by ROSSTAT (Federal State Statistics Service, Forbes magazine and the Federal Tax Service, indirect data on incomes determined by the distribution of car prices (from two independent sources and real estate, as well as data from the Credit Suisse Research Institute about property inequality in Russia. The following main conclusions were made. The course of the curves that characterize the real distribution of the population by income, suggests that in society there is only one mechanism for the movement of goods. This is a mechanism of rank exchange, in which the interaction of rich and poor economic agents is characterized by a shift in market prices in favor of the rich and the greater, the more resources the latter has.The frequency polygons (and therefore the histograms do not

  1. Advantages and Disadvantages of Possible Methods of Managing the Production on the Assembly Lines in the Given Company

    OpenAIRE

    Václavková, Eva

    2014-01-01

    The bachelor thesis deals with methods of lean management, more exactly production planning and managing the production lines assembly. In this thesis, production planning system, kanban cards and heijunka will be described. The aim of this thesis is to describe methods of managing the production lines assembly and to suggest more effective management.

  2. A novel method of providing a library of n-mers or biopolymers

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to a method of providing a library of n-mer sequences, wherein the library is composed of an n-mer sequence. Also the invention concerns a method of providing a library of biopolymer sequences having one or more n-mers in common. Further provided are specific primers...

  3. Description of an Advantageous Optical Label-Free Biosensing Interferometric Read-Out Method to Measure Biological Species

    Directory of Open Access Journals (Sweden)

    Miguel Holgado

    2014-02-01

    Full Text Available In this article we report a new, simple, and reliable optical read-out detection method able to assess Rotavirus present in human sera as well as in the viral pollution sources. It is based on the interference of two interferometers used as biophotonic transducers. The method significantly improves the optical label-free biosensing response measuring both, the concentration of the AgR and its corresponding size. Two different immunoassays were carried out: Bovine Serum Albumin (BSA, and the recognition by its antibody (anti-BSA; and Rotavirus (AgR and the recognition by its antibody (anti-AgR. In the cases studied, and using as model interferometer a simple Fabry-Perot transducer, we demonstrate a biosensing enhancement of two orders of magnitude in the Limit of Detection (LoD. In fact, this read-out optical method may have significant implications to enhance other optical label-free photonic transducers reported in the scientific literature.

  4. [Invasive aspergillosis in hematooncological patients: advantages and disadvantages of various diagnostic methods, treatment options and financial costs of therapy].

    Science.gov (United States)

    Rácil, Z; Mayer, J; Kocmanová, I; Wagnerová, B; Winterová, J; Folber, F; Lengerová, M; Moulis, M; Zácková, D; Smardová, L; Janíková, A; Navrátil, M; Dvoráková, D; Vorlícek, J

    2008-02-01

    Invasive aspergillosis (IA) is a leading invasive fungal infection in hematooncological patients. The aim of this study was to analyse the incidence, diagnostic procedures and treatment of IA in hematooncological department in large hospital in the Czech Republic. A retrospective analysis of medical and laboratory records from patients hospitalised in our department with proven/probable IA between January 2000 and December 2006 was performed. 52 cases of IA in 51 patients were identified (17.3% proven IA/82.7% probable IA). Number of IA cases notably increased during study period (1 case of IA in 2000 vs 21 cases of IA in 2006) and majority of them was of nosocomial origin (61.5%). Pulmonary aspergillosis was diagnosed in 46 cases (88.5%). Patients treated for acute leukemia or undergoing allogeneic stem cell transplantation represent the group at the highest risk of IA (in total 52% of cases). Fever and signs of pulmonary involvement were the most common clinical signs of infection (presented in 92.3% and 69.2 cases respectively). Conventional diagnostic methods including autopsy were able to diagnose only 15 cases of IA (28.8%). In all other cases (71.2%) the diagnosis was done by detection of galactomannan (GM) in serum. Introduction of GM monitoring enabled erlier initiation of antifungal treatment by 4 days. Initial therapy of IA led to the treatment response (partial and complete) in 18 (34.6%) of infections--the highest percentage of response has been seen in voriconazole monotherapy group (42%) and when combination of voriconazole and caspofungin has been used (83%). Salvage therapy was initiated due to the failure of initial treatment in 21 (40.3%) of cases. Patients were treated mostly with combination ofvoriconazole and caspofungin and/or monotherapy with voriconazole has been used with treatment response 55% and 50% respectively. Introduction of new antifungal drugs together with increased number of patients with IA led to the marked increase of total

  5. System and Method for Providing Vertical Profile Measurements of Atmospheric Gases

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A system and method for using an air collection device to collect a continuous air sample as the device descends through the atmosphere are provided. The air...

  6. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    DEFF Research Database (Denmark)

    Sabourin, David; Snakenborg, Detlef; Dufva, Hans Martin

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observ...

  7. Systems and methods for providing power to a load based upon a control strategy

    Science.gov (United States)

    Perisic, Milun; Kajouke, Lateef A; Ransom, Ray M

    2013-12-24

    Systems and methods are provided for an electrical system. The electrical system includes a load, an interface configured to receive a voltage from a voltage source, and a controller configured to receive the voltage from the voltage source through the interface and to provide a voltage and current to the load. Wherein, when the controller is in a constant voltage mode, the controller provides a constant voltage to the load, when the controller is in a constant current mode, the controller provides a constant current to the load, and when the controller is in a constant power mode, the controller provides a constant power to the load.

  8. Method and Apparatus Providing Deception and/or Altered Operation in an Information System Operating System

    Science.gov (United States)

    Cohen, Fred; Rogers, Deanna T.; Neagoe, Vicentiu

    2008-10-14

    A method and/or system and/or apparatus providing deception and/or execution alteration in an information system. In specific embodiments, deceptions and/or protections are provided by intercepting and/or modifying operation of one or more system calls of an operating system.

  9. Provider Payment Trends and Methods in the Massachusetts Health Care System

    OpenAIRE

    Allison Barrett; Timothy Lake

    2010-01-01

    This report investigates provider payment methods in Massachusetts. Payments include fee-for-service, the predominant model; global payments, which pay providers a single fee for all or most required services during a contract period; and pay-for-performance models, which layer quality incentives onto payments.

  10. 47 CFR 51.329 - Notice of network changes: Methods for providing notice.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Notice of network changes: Methods for providing notice. 51.329 Section 51.329 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED...) Filing a public notice with the Commission; or (2) Providing public notice through industry fora...

  11. Achieving a competitive advantage in managed care.

    Science.gov (United States)

    Stahl, D A

    1998-02-01

    When building a competitive advantage to thrive in the managed care arena, subacute care providers are urged to be revolutionary rather than reactionary, proactive rather than passive, optimistic rather than pessimistic and growth-oriented rather than cost-reduction oriented. Weaknesses must be addressed aggressively. To achieve a competitive edge, assess the facility's strengths, understand the marketplace and comprehend key payment methods.

  12. System and Method for Providing a Climate Data Analytic Services Application Programming Interface Distribution Package

    Science.gov (United States)

    Schnase, John L. (Inventor); Duffy, Daniel Q. (Inventor); Tamkin, Glenn S. (Inventor)

    2016-01-01

    A system, method and computer-readable storage devices for providing a climate data analytic services application programming interface distribution package. The example system can provide various components. The system provides a climate data analytic services application programming interface library that enables software applications running on a client device to invoke the capabilities of a climate data analytic service. The system provides a command-line interface that provides a means of interacting with a climate data analytic service by issuing commands directly to the system's server interface. The system provides sample programs that call on the capabilities of the application programming interface library and can be used as templates for the construction of new client applications. The system can also provide test utilities, build utilities, service integration utilities, and documentation.

  13. Competitive versus comparative advantage

    OpenAIRE

    Neary, J. Peter

    2002-01-01

    I explore the interactions between comparative, competitive and absolute advantage in a two-country model of oligopoly in general equilibrium. Comparative advantage always determines the direction of trade, but both competitive and absolute advantage affect resource allocation, trade patterns and trade volumes. Competitive advantage in the sense of more home firms drives foreign firms out of marginal sectors but also makes some marginal home sectors uncompetitive. Absolute advantage in the se...

  14. Interconnection blocks: a method for providing reusable, rapid, multiple, aligned and planar microfluidic interconnections

    International Nuclear Information System (INIS)

    Sabourin, D; Snakenborg, D; Dufva, M

    2009-01-01

    In this paper a method is presented for creating 'interconnection blocks' that are re-usable and provide multiple, aligned and planar microfluidic interconnections. Interconnection blocks made from polydimethylsiloxane allow rapid testing of microfluidic chips and unobstructed microfluidic observation. The interconnection block method is scalable, flexible and supports high interconnection density. The average pressure limit of the interconnection block was near 5.5 bar and all individual results were well above the 2 bar threshold considered applicable to most microfluidic applications

  15. Configurable memory system and method for providing atomic counting operations in a memory device

    Science.gov (United States)

    Bellofatto, Ralph E.; Gara, Alan G.; Giampapa, Mark E.; Ohmacht, Martin

    2010-09-14

    A memory system and method for providing atomic memory-based counter operations to operating systems and applications that make most efficient use of counter-backing memory and virtual and physical address space, while simplifying operating system memory management, and enabling the counter-backing memory to be used for purposes other than counter-backing storage when desired. The encoding and address decoding enabled by the invention provides all this functionality through a combination of software and hardware.

  16. Method of immobilizing weapons plutonium to provide a durable, disposable waste product

    Science.gov (United States)

    Ewing, Rodney C.; Lutze, Werner; Weber, William J.

    1996-01-01

    A method of atomic scale fixation and immobilization of plutonium to provide a durable waste product. Plutonium is provided in the form of either PuO.sub.2 or Pu(NO.sub.3).sub.4 and is mixed with and SiO.sub.2. The resulting mixture is cold pressed and then heated under pressure to form (Zr,Pu)SiO.sub.4 as the waste product.

  17. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 1

    Science.gov (United States)

    2013-11-01

    of Standards and Technology (NIST) Special Publication 800-145 (NIST SP 800-145) defines three types of cloud services : Software as a Service ( SaaS ...among these three models. NIST SP 800-145 describes the three service models as follows: SaaS —The capability provided to the consumer is to use the...Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase I Greg Porter November 2013 TECHNICAL NOTE CMU/SEI-2013-TN-020

  18. On the advantage of the finite fourier transformation method for the solution of a multigroup transport equation by the spherical harmonics method

    International Nuclear Information System (INIS)

    Kobayashi, K.

    1995-01-01

    A simple formulation to derive second order differential equations of the spherical harmonics method is described, and it is shown that there is difficulty in deriving finite difference equations for these differential equations at material interfaces, because the second order differential terms of higher order moments must be expressed by the values in a mesh box. On the other hand, it is shown that there is no such difficulty, if the author uses the finite Fourier transformation method, since the differential equations are transformed into integral equations and the differentiation corresponds simply to a multiplication by the transformation parameter. Solution can be obtained in the form of Fourier series without making use of the inversion integral

  19. HIV Research with Men who Have Sex with Men (MSM: Advantages and Challenges of Different Methods for Most Appropriately Targeting a Key Population

    Directory of Open Access Journals (Sweden)

    Ana Gama

    2017-05-01

    Full Text Available The difficulty in accessing hard-to-reach populations as men who have sex with men presents a dilemma for HIV surveillance as their omission from surveillance systems leaves significant gaps in our understanding of HIV/AIDS epidemics. Several methods for recruiting difficult-to-access populations and collecting data on trends of HIV prevalence and behavioural factors for surveillance and research purposes have emerged. This paper aims to critically review different sampling approaches, from chain-referral and venue-based to respondent-driven, time-location and internet sampling methods, focusing on its main advantages and challenges for conducting HIV research among key populations, such as men who have sex with men. The benefits of using these approaches to recruit participants must be weighed against privacy concerns inherent in any social situation or health condition. Nevertheless, the methods discussed in this paper represent some of the best efforts to effectively reach most-at-risk subgroups of men who have sex with men, contributing to obtain unbiased trends of HIV prevalence and HIV-related risk behaviours among this population group.

  20. Multipotent Mesenchymal Stromal Stem Cell Expansion by Plating Whole Bone Marrow at a Low Cellular Density: A More Advantageous Method for Clinical Use

    Directory of Open Access Journals (Sweden)

    Katia Mareschi

    2012-01-01

    Full Text Available Mesenchymal stem cells (MSCs are a promising source for cell therapy due to their pluripotency and immunomodulant proprieties. As the identification of “optimal” conditions is important to identify a standard procedure for clinical use. Percoll, Ficoll and whole bone marrow directly plated were tested from the same sample as separation methods. The cells were seeded at the following densities: 100 000, 10 000, 1000, 100, 10 cells/cm2. After reaching confluence, the cells were detached, pooled and re-plated at 1000, 500, 100, and 10 cells/cm2. Statistical analyses were performed. Cumulative Population Doublings (PD did not show significant differences for the separation methods and seeding densities but only for the plating density. Some small quantity samples plated in T25 flasks at plating densities of 10 and 100 cells/cm2 did not produce any expansion. However, directly plated whole bone marrow resulted in a more advantageous method in terms of CFU-F number, cellular growth and minimal manipulation. No differences were observed in terms of gross morphology, differentiation potential or immunophenotype. These data suggest that plating whole bone marrow at a low cellular density may represent a good procedure for MSC expansion for clinical use.

  1. Multipotent Mesenchymal Stromal Stem Cell Expansion by Plating Whole Bone Marrow at a Low Cellular Density: A More Advantageous Method for Clinical Use

    Science.gov (United States)

    Mareschi, Katia; Rustichelli, Deborah; Calabrese, Roberto; Gunetti, Monica; Sanavio, Fiorella; Castiglia, Sara; Risso, Alessandra; Ferrero, Ivana; Tarella, Corrado; Fagioli, Franca

    2012-01-01

    Mesenchymal stem cells (MSCs) are a promising source for cell therapy due to their pluripotency and immunomodulant proprieties. As the identification of “optimal” conditions is important to identify a standard procedure for clinical use. Percoll, Ficoll and whole bone marrow directly plated were tested from the same sample as separation methods. The cells were seeded at the following densities: 100 000, 10 000, 1000, 100, 10 cells/cm2. After reaching confluence, the cells were detached, pooled and re-plated at 1000, 500, 100, and 10 cells/cm2. Statistical analyses were performed. Cumulative Population Doublings (PD) did not show significant differences for the separation methods and seeding densities but only for the plating density. Some small quantity samples plated in T25 flasks at plating densities of 10 and 100 cells/cm2 did not produce any expansion. However, directly plated whole bone marrow resulted in a more advantageous method in terms of CFU-F number, cellular growth and minimal manipulation. No differences were observed in terms of gross morphology, differentiation potential or immunophenotype. These data suggest that plating whole bone marrow at a low cellular density may represent a good procedure for MSC expansion for clinical use. PMID:23715383

  2. Synthesis of hydroxyapatite nanorods for application in water defluoridation and optimization of process variables: Advantage of ultrasonication with precipitation method over conventional method.

    Science.gov (United States)

    Mehta, Dhiraj; Mondal, Poonam; Saharan, Virendra Kumar; George, Suja

    2017-07-01

    This research work presents the synthesis of hydroxyapatite (Hap) nanorods for defluoridation of drinking water by using both conventional (CM) and ultrasonication with precipitation (USPM) methods. Calcium nitrate was reacted with potassium phosphate in presence of ammonia for controlled pH to synthesize Hap nanorods, which was characterized using FTIR, XRD, SEM, TG-DTA, and TEM/EDS for determining its phase composition, structural and thermal decomposition behavior. When USPM method was used for synthesis, the yield of the Hap nanorods was improved from 83.24±1.0% to 90.2±1.0%, and complete phase transformation occurred with formation of elongated Hap nanorods. Effects of process parameters such as solution pH, contact time and adsorbent dose were studied through response surface methodology (RSM). A simple quadratic model was developed using Central Composite Design (CCD) and optimum parameters for fluoride adsorption process were determined to be pH 7, contact time 3h and adsorbent dose 7g/L for maximum removal capacity. Fluoride removal efficiency was predicted to be 93.64% which was very close to the experimental value obtained at 92.86% using ultrasonically prepared Hap. Fluoride adsorption isotherms fitted the Freundlich isotherm with an adsorption capacity of 1.49mg/g, while the kinetic studies revealed that the process followed pseudo-second order model. The treated water quality parameters such as residual fluoride, calcium leached, total hardness and alkalinity was investigated, and it was observed that all these parameters were within the permissible limits as per WHO and BIS standards. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Canadian competitive advantage

    International Nuclear Information System (INIS)

    Wills, J.

    1997-01-01

    The evolution of the Canadian petrochemical industry was outlined, emphasizing the proximity to feedstocks as the principal advantage enjoyed by the industry over its international competitors. Annual sales statistics for 1995 were provided. Key players in the Canadian petrochemical industry (Nova, Dow, DuPont, Methanex, Esso, Union Carbide, Shell and Celanese), their share of the market and key products were noted. Manufacturing facilities are located primarily in Alberta, southern Ontario and Quebec. The feedstock supply infrastructure, historical and alternative ethane pricing in Canada and the US, the North American market for petrochemicals, the competitiveness of the industry, tax competitiveness among Canadian provinces and the US, the Canada - US unit labour cost ratio, ethylene facility construction costs in Canada relative to the US Gulf Coast, and projected 1997 financial requirements were reviewed. 19 figs

  4. Contextual Advantage for State Discrimination

    Science.gov (United States)

    Schmid, David; Spekkens, Robert W.

    2018-02-01

    Finding quantitative aspects of quantum phenomena which cannot be explained by any classical model has foundational importance for understanding the boundary between classical and quantum theory. It also has practical significance for identifying information processing tasks for which those phenomena provide a quantum advantage. Using the framework of generalized noncontextuality as our notion of classicality, we find one such nonclassical feature within the phenomenology of quantum minimum-error state discrimination. Namely, we identify quantitative limits on the success probability for minimum-error state discrimination in any experiment described by a noncontextual ontological model. These constraints constitute noncontextuality inequalities that are violated by quantum theory, and this violation implies a quantum advantage for state discrimination relative to noncontextual models. Furthermore, our noncontextuality inequalities are robust to noise and are operationally formulated, so that any experimental violation of the inequalities is a witness of contextuality, independently of the validity of quantum theory. Along the way, we introduce new methods for analyzing noncontextuality scenarios and demonstrate a tight connection between our minimum-error state discrimination scenario and a Bell scenario.

  5. Contextual Advantage for State Discrimination

    Directory of Open Access Journals (Sweden)

    David Schmid

    2018-02-01

    Full Text Available Finding quantitative aspects of quantum phenomena which cannot be explained by any classical model has foundational importance for understanding the boundary between classical and quantum theory. It also has practical significance for identifying information processing tasks for which those phenomena provide a quantum advantage. Using the framework of generalized noncontextuality as our notion of classicality, we find one such nonclassical feature within the phenomenology of quantum minimum-error state discrimination. Namely, we identify quantitative limits on the success probability for minimum-error state discrimination in any experiment described by a noncontextual ontological model. These constraints constitute noncontextuality inequalities that are violated by quantum theory, and this violation implies a quantum advantage for state discrimination relative to noncontextual models. Furthermore, our noncontextuality inequalities are robust to noise and are operationally formulated, so that any experimental violation of the inequalities is a witness of contextuality, independently of the validity of quantum theory. Along the way, we introduce new methods for analyzing noncontextuality scenarios and demonstrate a tight connection between our minimum-error state discrimination scenario and a Bell scenario.

  6. THIRD PARTY LOGISTIC SERVICE PROVIDER SELECTION USING FUZZY AHP AND TOPSIS METHOD

    Directory of Open Access Journals (Sweden)

    Golam Kabir

    2012-03-01

    Full Text Available The use of third party logistic(3PL services providers is increasing globally to accomplish the strategic objectives. In the increasingly competitive environment, logistics strategic management requires systematic and structured approach to have cutting edge over the rival. Logistics service provider selection is a complex multi-criteria decision making process; in which, decision makers have to deals with the optimization of conflicting objectives such as quality, cost, and delivery time. In this paper, fuzzy analytic hierarchy process (FAHP approach based on technique for order preference by similarity to ideal solution (TOPSIS method has been proposed for evaluating and selecting an appropriate logistics service provider, where the ratings of each alternative and importance weight of each criterion are expressed in triangular fuzzy numbers.

  7. A method of providing a barrier in a fracture-containing system

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking into an el......The present invention relates to a method of providing a barrier in a fracture-containing system, comprising: i) Providing a treatment fluid comprising: a) a base fluid; b) an elastomeric material, wherein said elastomeric material comprises at least one polymer capable of crosslinking...... into an elastomer, and c) at least one crosslinking agent; ii) Placing the treatment fluid in a fracture-containing system; iii) Allowing the elastomeric material to crosslink with itself to form a barrier in said fracture-containing system; wherein the elastomeric material and/or the crosslinking agent...... are of neutral buoyancy with regard to the base fluid. The invention is contemplated to having utility not only in the oil-drilling industry but also in the plugging of fractures in sewer drains, pipelines etc....

  8. [The advantages in using cyanoacrylate glue over skin staples as a method of skin graft fixation in the pediatric burns population].

    Science.gov (United States)

    Curings, P; Vincent, P-L; Viard, R; Gir, P; Comparin, J-P; Voulliaume, D

    2017-11-23

    Local postoperative care and burn wound management can present with a certain degree of difficulty in the pediatric population. While the use of skin staples as a method of skin graft fixation is a well-known, rapid and simple method, their removal can be painful and may necessitate some sedation or even general anesthesia. We studied in this article the advantages and economic value of using the cyanoacrylate glue as a fixation method for skin grafts. A comparative study was carried out from 2012 to 2016. Hundred and eighteen infants with burns up to 5% of total body surface area were included in the study. Seventy-two infants had split thickness skin grafts fixed with skin staples. Forty-six infants had split thickness skin grafts fixed with cyanoacrylate glue. We compared the quality of graft, the sedation used during the first postoperative dressing, the length of hospital stay, the amount of glue used and the presence of complications. There is a difference between the two groups studied in terms of age and total burn surface area. The rate of graft take was 100% in both groups. The first postoperative dressing was carried out without the use of powerful analgesia in the cyanoacrylate group, while it was necessary to use general anesthesia in 64% of the skin staples group. The average length of stay in hospital after skin grafting was 4.9 days for the cyanoacrylate glue versus 6.5 days in the skin staples group. No complications were noted in the 2 groups. The use of cyanoacrylate glue allows rapid fixation of skin grafts and avoid general anesthesia for postoperative cares. Subsequently the length of hospital stay is reduced within 25%. The medico-economic value of glue protocol is highly significant compared to skin staples, while having similar good results and without significant problems. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  9. Practical advantages of evolutionary computation

    Science.gov (United States)

    Fogel, David B.

    1997-10-01

    Evolutionary computation is becoming a common technique for solving difficult, real-world problems in industry, medicine, and defense. This paper reviews some of the practical advantages to using evolutionary algorithms as compared with classic methods of optimization or artificial intelligence. Specific advantages include the flexibility of the procedures, as well as their ability to self-adapt the search for optimum solutions on the fly. As desktop computers increase in speed, the application of evolutionary algorithms will become routine.

  10. ELV Recycling Service Provider Selection Using the Hybrid MCDM Method: A Case Application in China

    Directory of Open Access Journals (Sweden)

    Fuli Zhou

    2016-05-01

    Full Text Available With the rapid depletion of natural resources and undesired environmental changes globally, more interest has been shown in the research of green supply chain practices, including end-of-life vehicle (ELV recycling. The ELV recycling is mandatory for auto-manufacturers by legislation for the purpose of minimizing potential environmental damages. The purpose of the present research is to determine the best choice of ELV recycling service provider by employing an integrating hybrid multi-criteria decision making (MCDM method. In this research, economic, environmental and social factors are taken into consideration. The linguistic variables and trapezoidal fuzzy numbers (TFNs are applied into this evaluation to deal with the vague and qualitative information. With the combined weight calculation of criteria based on fuzzy aggregation and Shannon Entropy techniques, the normative multi-criteria optimization technique (FVIKOR method is applied to explore the best solution. An application was performed based on the proposed hybrid MCDM method, and sensitivity analysis was conducted on different decision making scenarios. The present study provides a decision-making approach on ELV recycling business selection under sustainability and green philosophy with high robustness and easy implementation.

  11. Brokers and Competitive Advantage

    OpenAIRE

    Michael D. Ryall; Olav Sorenson

    2007-01-01

    The broker profits by intermediating between two (or more) parties. Using a biform game, we examine whether such a position can confer a competitive advantage, as well as whether any such advantage could persist if actors formed relations strategically. Our analysis reveals that, if one considers exogenous the relations between actors, brokers can enjoy an advantage but only if (1) they do not face substitutes either for the connections they offer or the value they can create, (2) they interm...

  12. System and method of providing quick thermal comfort with reduced energy by using directed spot conditioning

    Science.gov (United States)

    Wang, Mingyu; Kadle, Prasad S.; Ghosh, Debashis; Zima, Mark J.; Wolfe, IV, Edward; Craig, Timothy D

    2016-10-04

    A heating, ventilation, and air conditioning (HVAC) system and a method of controlling a HVAC system that is configured to provide a perceived comfortable ambient environment to an occupant seated in a vehicle cabin. The system includes a nozzle configured to direct an air stream from the HVAC system to the location of a thermally sensitive portion of the body of the occupant. The system also includes a controller configured to determine an air stream temperature and an air stream flow rate necessary to establish the desired heat supply rate for the sensitive portion and provide a comfortable thermal environment by thermally isolating the occupant from the ambient vehicle cabin temperature. The system may include a sensor to determine the location of the sensitive portion. The nozzle may include a thermoelectric device to heat or cool the air stream.

  13. Method of App Selection for Healthcare Providers Based on Consumer Needs.

    Science.gov (United States)

    Lee, Jisan; Kim, Jeongeun

    2018-01-01

    Mobile device applications can be used to manage health. However, healthcare providers hesitate to use them because selection methods that consider the needs of health consumers and identify the most appropriate application are rare. This study aimed to create an effective method of identifying applications that address user needs. Women experiencing dysmenorrhea and premenstrual syndrome were the targeted users. First, we searched for related applications from two major sources of mobile applications. Brainstorming, mind mapping, and persona and scenario techniques were used to create a checklist of relevant criteria, which was used to rate the applications. Of the 2784 applications found, 369 were analyzed quantitatively. Of those, five of the top candidates were evaluated by three groups: application experts, clinical experts, and potential users. All three groups ranked one application the highest; however, the remaining rankings differed. The results of this study suggest that the method created is useful because it considers not only the needs of various users but also the knowledge of application and clinical experts. This study proposes a method for finding and using the best among existing applications and highlights the need for nurses who can understand and combine opinions of users and application and clinical experts.

  14. Discussion of a method for providing general risk information by linking with the nuclear information

    International Nuclear Information System (INIS)

    Shobu, Nobuhiro; Yokomizo, Shirou; Umezawa, Sayaka

    2004-06-01

    'Risk information navigator (http://www.ricotti.jp/risknavi/)', an internet tool for arousing public interest and fostering people's risk literacy, has been developed as the contents for the official website of Techno Community Square 'RICOTTI' (http://www.ricotti.jp) at TOKAI village. In this report we classified the risk information into the fields, Health/Daily Life', 'Society/Crime/Disaster' and Technology/Environment/Energy', for the internet tool contents. According to these categories we discussed a method for providing various risk information on general fields by linking with the information on nuclear field. The web contents are attached to this report with the CD-R media. (author)

  15. Assessment of dietary intake of flavouring substances within the procedure for their safety evaluation: advantages and limitations of estimates obtained by means of a per capita method.

    Science.gov (United States)

    Arcella, D; Leclercq, C

    2005-01-01

    The procedure for the safety evaluation of flavourings adopted by the European Commission in order to establish a positive list of these substances is a stepwise approach which was developed by the Joint FAO/WHO Expert Committee on Food Additives (JECFA) and amended by the Scientific Committee on Food. Within this procedure, a per capita amount based on industrial poundage data of flavourings, is calculated to estimate the dietary intake by means of the maximised survey-derived daily intake (MSDI) method. This paper reviews the MSDI method in order to check if it can provide conservative intake estimates as needed at the first steps of a stepwise procedure. Scientific papers and opinions dealing with the MSDI method were reviewed. Concentration levels reported by the industry were compared with estimates obtained with the MSDI method. It appeared that, in some cases, these estimates could be orders of magnitude (up to 5) lower than those calculated considering concentration levels provided by the industry and regular consumption of flavoured foods and beverages. A critical review of two studies which had been used to support the statement that MSDI is a conservative method for assessing exposure to flavourings among high consumers was performed. Special attention was given to the factors that affect exposure at high percentiles, such as brand loyalty and portion sizes. It is concluded that these studies may not be suitable to validate the MSDI method used to assess intakes of flavours by European consumers due to shortcomings in the assumptions made and in the data used. Exposure assessment is an essential component of risk assessment. The present paper suggests that the MSDI method is not sufficiently conservative. There is therefore a clear need for either using an alternative method to estimate exposure to flavourings in the procedure or for limiting intakes to the levels at which the safety was assessed.

  16. Scandinavian Cooperative Advantage

    DEFF Research Database (Denmark)

    Strand, Robert; Freeman, R. Edward

    2015-01-01

    . We conclude by endorsing the expression “Scandinavian cooperative advantage” in an effort to draw attention to the Scandinavian context and encourage the field of strategic management to shift its focus from achieving a competitive advantage toward achieving a cooperative advantage....

  17. Accessing offshoring advantages

    DEFF Research Database (Denmark)

    Mykhaylenko, Alona; Motika, Agnes; Wæhrens, Brian Vejrum

    2015-01-01

    . Assuming that different levels of synergy may exist between particular offshoring strategic decisions (choosing offshore outsourcing or captive offshoring and the type of function) and different offshoring advantages, this work advocates that the actual fact of realization of certain offshoring advantages...

  18. eHealth provides a novel opportunity to exploit the advantages of the Nordic countries in psychiatric genetic research, building on the public health care system, biobanks, and registries.

    Science.gov (United States)

    Andreassen, Ole A

    2017-07-07

    Nordic countries have played an important role in the recent progress in psychiatric genetics, both with large well-characterized samples and expertise. The Nordic countries have research advantages due to the organization of their societies, including system of personal identifiers, national health registries with information about diseases, treatment and prescriptions, and a public health system with geographical catchment areas. For psychiatric genetic research, the large biobanks and population surveys are a unique added value. Further, the population is motivated to participate in research, and there is a trust in the institutions of the society. These factors have been important for Nordic contributions to biomedical research, and particularly psychiatric genetics. In the era of eHealth, the situation seems even more advantageous for Nordic countries. The system with public health care makes it easy to implement national measures, and most of the Nordic health care sector is already based on electronic information. The potential advantages regarding informed consent, large scale recruitment and follow-up, and longitudinal cohort studies are tremendous. New precision medicine approaches can be tested within the health care system, with an integrated approach, using large hospitals or regions of the country as a test beds. However, data protection and legal framework have to be clarified. In order to succeed, it is important to keep the people's trust, and maintain the high ethical standards and systems for secure data management. Then the full potential of the Nordic countries can be leveraged in the new era of precision medicine including psychiatric genetics. © 2017 Wiley Periodicals, Inc.

  19. Method for providing slip energy control in permanent magnet electrical machines

    Science.gov (United States)

    Hsu, John S.

    2006-11-14

    An electric machine (40) has a stator (43), a permanent magnet rotor (38) with permanent magnets (39) and a magnetic coupling uncluttered rotor (46) for inducing a slip energy current in secondary coils (47). A dc flux can be produced in the uncluttered rotor when the secondary coils are fed with dc currents. The magnetic coupling uncluttered rotor (46) has magnetic brushes (A, B, C, D) which couple flux in through the rotor (46) to the secondary coils (47c, 47d) without inducing a current in the rotor (46) and without coupling a stator rotational energy component to the secondary coils (47c, 47d). The machine can be operated as a motor or a generator in multi-phase or single-phase embodiments and is applicable to the hybrid electric vehicle. A method of providing a slip energy controller is also disclosed.

  20. Gaining Relational Competitive Advantages

    DEFF Research Database (Denmark)

    Hu, Yimei; Zhang, Si; Li, Jizhen

    2015-01-01

    Establishing strategic technological partnerships (STPs) with foreign partners is an increasingly studied topic within the innovation management literature. Partnering firms can jointly create sources of relational competitive advantage. Chinese firms often lack research and development (R......&D) capabilities but are increasingly becoming preferred technological partners for transnational corporations. We investigate an STP between a Scandinavian and a Chinese firm and try to explore how to gain relational competitive advantage by focusing on its two essential stages: relational rent generation...... and appropriation. Based on an explorative case study, we develop a conceptual framework that consists of process, organizational alliance factors, and coordination modes that we propose lead to relational competitive advantage....

  1. Providing the physical basis of SCS curve number method and its proportionality relationship from Richards' equation

    Science.gov (United States)

    Hooshyar, M.; Wang, D.

    2016-12-01

    The empirical proportionality relationship, which indicates that the ratio of cumulative surface runoff and infiltration to their corresponding potentials are equal, is the basis of the extensively used Soil Conservation Service Curve Number (SCS-CN) method. The objective of this paper is to provide the physical basis of the SCS-CN method and its proportionality hypothesis from the infiltration excess runoff generation perspective. To achieve this purpose, an analytical solution of Richards' equation is derived for ponded infiltration in shallow water table environment under the following boundary conditions: 1) the soil is saturated at the land surface; and 2) there is a no-flux boundary which moves downward. The solution is established based on the assumptions of negligible gravitational effect, constant soil water diffusivity, and hydrostatic soil moisture profile between the no-flux boundary and water table. Based on the derived analytical solution, the proportionality hypothesis is a reasonable approximation for rainfall partitioning at the early stage of ponded infiltration in areas with a shallow water table for coarse textured soils.

  2. Content and Methods used to Train Tobacco Cessation Treatment Providers: An International Survey.

    Science.gov (United States)

    Kruse, Gina R; Rigotti, Nancy A; Raw, Martin; McNeill, Ann; Murray, Rachael; Piné-Abata, Hembadoon; Bitton, Asaf; McEwen, Andy

    2017-12-01

    There are limited existing data describing the training methods used to educate tobacco cessation treatment providers around the world. To measure the prevalence of tobacco cessation treatment content, skills training and teaching methods reported by tobacco treatment training programs across the world. Web-based survey in May-September 2013 among tobacco cessation training experts across six geographic regions and four World Bank income levels. Response rate was 73% (84 of 115 countries contacted). Of 104 individual programs from 84 countries, most reported teaching brief advice (78%) and one-to-one counseling (74%); telephone counseling was uncommon (33%). Overall, teaching of knowledge topics was more commonly reported than skills training. Programs in lower income countries less often reported teaching about medications, behavioral treatments and biomarkers and less often reported skills-based training about interviewing clients, medication management, biomarker measurement, assessing client outcomes, and assisting clients with co-morbidities. Programs reported a median 15 hours of training. Face-to-face training was common (85%); online programs were rare (19%). Almost half (47%) included no learner assessment. Only 35% offered continuing education. Nearly all programs reported teaching evidence-based treatment modalities in a face-to-face format. Few programs delivered training online or offered continuing education. Skills-based training was less common among low- and middle-income countries (LMICs). There is a large unmet need for tobacco treatment training protocols which emphasize practical skills, and which are more rapidly scalable than face-to-face training in LMICs.

  3. Development of guidance and methodical documents for providing the decommissioning of radiation-hazardous objects

    International Nuclear Information System (INIS)

    Ermakov, A.

    2015-01-01

    Federal Center for Nuclear and Radiation Safety (JSC FCNRS) developed and approbated guidance and methodical documents for providing the facility to radiologically safe status in the course of Building B decommissioning activity at JSC VNIINM (A.A. Bochvar High-Technology Scientific Research Institute for Inorganic Materials). The scope of application of the documents developed is as follows: - preliminary segregation of radwaste into streams during its collection and preparation for removal from facilities/sites under decommissioning; - express assessment of specific activity (activity) of radwaste generated in the course of dismantling and decontamination activities; - radiological survey of premises and building structures following completion of dismantling and decontamination activities; - SRW processing (compaction, reduction in size), packaging, characterisation and containerisation in order to reduce risks of spread of radioactive contamination. Documents that have been developed can be used both at nuclear facilities/ sites similar to the JSC VNIINM Building B in terms of work stages and types of waste to be generated, and other facilities/ sites taking into consideration their peculiarities. (author)

  4. COMPETITIVE PRODUCT ADVANTAGES

    Directory of Open Access Journals (Sweden)

    Adrian MICU

    2006-01-01

    Full Text Available Cost advantages may be either internal or external. Internal economics of scope, scale, or experience, and external economies of focus or logistical integration, enable a company to produce some products at a lower cost than the competition. The coordination of pricing with suppliers, although not actually economizing resources, can improve the efficiency of pricing by avoiding the incrementalization of a supplier's nonincremental fixed costs and profit. Any of these strategies can generate cost advantages that are, at least in the short run, sustainable. Even cost advantages that are not sustainable, however, can generate temporary savings that are often the key to building more sustainable cost or product advantages later.. Even when a product's physical attributes are not readily differentiable, opportunities to develop product advantages remain. The augmented product that customers buy is more than the particular product or service exchanged. It includes all sorts of ancillary services and intangible relationships that make buying thesame product from one company less difficult, less risky, or more pleasant than buying from a competitor. Superior augmentation of the same basic product can add substantial value in the eyes of consumers, leading them to pay willingly what are often considerable price premiums.

  5. Compositional Advantage and Strategy

    DEFF Research Database (Denmark)

    Li, Xin

    advantage is redefined as the attractiveness of the composition of the producer’s offering in terms of scope and perceived value/price ratio. I identify five ways or basic compositional strategies to improve the value/price ratio. A firm may have an overall compositional strategy that is composed of some......In this paper, I first critique the composition-based view of Yadong Luo and John Child for understanding how resource-poor firms survive and thrive. To remedy the deficiencies in their perspective, I then propose a dynamic theory of compositional advantage and strategy. Here, the compositional...... or all of the five basic compositional strategies. I argue there are three indispensable key success factors for a composition-based competition, i.e., aspiration (ambition-position asymmetry), attitude (being ALERT), and action (turning asymmetry into advantage). I also discuss the particular relevance...

  6. Competitive Advantage through Innovation

    DEFF Research Database (Denmark)

    Brem, Alexander; Maier, Maximilian; Wimschneider, Christine

    2016-01-01

    Purpose The purpose of this paper is to describe how Nespresso achieved competitive advantage through innovation by changing the rules of the game in its industry. Design/methodology/approach Nespresso was analyzed based on public available secondary data, in combination with related academic...... concepts on innovation and competitive advantage. Findings The company succeeded by the thorough application of a strategy that, through perfect alignment, allowed the company to reach a unique market position. However, as described in the case, it took a relatively long time and the company came close...... as a source for competitive advantage. Research limitations/implications Especially given the current market situation, the case offers different starting points for discussion about innovation and long-term company success. Practical implications Especially before the current market situation, the case...

  7. The Effect of Health Information Technology on Health Care Provider Communication: A Mixed-Method Protocol.

    Science.gov (United States)

    Manojlovich, Milisa; Adler-Milstein, Julia; Harrod, Molly; Sales, Anne; Hofer, Timothy P; Saint, Sanjay; Krein, Sarah L

    2015-06-11

    Communication failures between physicians and nurses are one of the most common causes of adverse events for hospitalized patients, as well as a major root cause of all sentinel events. Communication technology (ie, the electronic medical record, computerized provider order entry, email, and pagers), which is a component of health information technology (HIT), may help reduce some communication failures but increase others because of an inadequate understanding of how communication technology is used. Increasing use of health information and communication technologies is likely to affect communication between nurses and physicians. The purpose of this study is to describe, in detail, how health information and communication technologies facilitate or hinder communication between nurses and physicians with the ultimate goal of identifying how we can optimize the use of these technologies to support effective communication. Effective communication is the process of developing shared understanding between communicators by establishing, testing, and maintaining relationships. Our theoretical model, based in communication and sociology theories, describes how health information and communication technologies affect communication through communication practices (ie, use of rich media; the location and availability of computers) and work relationships (ie, hierarchies and team stability). Therefore we seek to (1) identify the range of health information and communication technologies used in a national sample of medical-surgical acute care units, (2) describe communication practices and work relationships that may be influenced by health information and communication technologies in these same settings, and (3) explore how differences in health information and communication technologies, communication practices, and work relationships between physicians and nurses influence communication. This 4-year study uses a sequential mixed-methods design, beginning with a

  8. A method for analyzing the business case for provider participation in the National Cancer Institute's Community Clinical Oncology Program and similar federally funded, provider-based research networks.

    Science.gov (United States)

    Reiter, Kristin L; Song, Paula H; Minasian, Lori; Good, Marjorie; Weiner, Bryan J; McAlearney, Ann Scheck

    2012-09-01

    The Community Clinical Oncology Program (CCOP) plays an essential role in the efforts of the National Cancer Institute (NCI) to increase enrollment in clinical trials. Currently, there is little practical guidance in the literature to assist provider organizations in analyzing the return on investment (ROI), or business case, for establishing and operating a provider-based research network (PBRN) such as the CCOP. In this article, the authors present a conceptual model of the business case for PBRN participation, a spreadsheet-based tool and advice for evaluating the business case for provider participation in a CCOP organization. A comparative, case-study approach was used to identify key components of the business case for hospitals attempting to support a CCOP research infrastructure. Semistructured interviews were conducted with providers and administrators. Key themes were identified and used to develop the financial analysis tool. Key components of the business case included CCOP start-up costs, direct revenue from the NCI CCOP grant, direct expenses required to maintain the CCOP research infrastructure, and incidental benefits, most notably downstream revenues from CCOP patients. The authors recognized the value of incidental benefits as an important contributor to the business case for CCOP participation; however, currently, this component is not calculated. The current results indicated that providing a method for documenting the business case for CCOP or other PBRN involvement will contribute to the long-term sustainability and expansion of these programs by improving providers' understanding of the financial implications of participation. Copyright © 2011 American Cancer Society.

  9. A mixed methods study of patient-provider communication about opioid analgesics.

    Science.gov (United States)

    Hughes, Helen Kinsman; Korthuis, Philip Todd; Saha, Somnath; Eggly, Susan; Sharp, Victoria; Cohn, Jonathan; Moore, Richard; Beach, Mary Catherine

    2015-04-01

    To describe patient-provider communication about opioid pain medicine and explore how these discussions affect provider attitudes toward patients. We audio-recorded 45 HIV providers and 423 patients in routine outpatient encounters at four sites across the country. Providers completed post-visit questionnaires assessing their attitudes toward patients. We identified discussions about opioid pain management and analyzed them qualitatively. We used logistic regression to assess the association between opioid discussion and providers' attitudes toward patients. 48 encounters (11% of the total sample) contained substantive discussion of opioid-related pain management. Most conversations were initiated by patients (n=28, 58%) and ended by the providers (n=36, 75%). Twelve encounters (25%) contained dialog suggesting a difference of opinion or conflict. Providers more often agreed than disagreed to give the prescription (50% vs. 23%), sometimes reluctantly; in 27% (n=13) of encounters, no decision was made. Fewer than half of providers (n=20, 42%) acknowledged the patient's experience of pain. Providers had a lower odds of positive regard for the patient (adjusted OR=0.51, 95% CI: 0.27-0.95) when opioids were discussed. Pain management discussions are common in routine outpatient HIV encounters and providers may regard patients less favorably if opioids are discussed during visits. The sometimes-adversarial nature of these discussions may negatively affect provider attitudes toward patients. Empathy and pain acknowledgment are tools that clinicians can use to facilitate productive discussions of pain management. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. Constructing Regional advantage

    DEFF Research Database (Denmark)

    Asheim, Bjørn T.; Boschma, Ron; Cooke, Phil

    2011-01-01

    This paper presents a regional innovation policy model based on the idea of constructing regional advantage. This policy model brings together concepts like related variety, knowledge bases and policy platforms. Related variety attaches importance to knowledge spillovers across complementary...... economic development within and between regions in action lines appropriate to incorporate the basic principles behind related variety and differentiated knowledge bases....

  11. Advantages of magnification radiography

    International Nuclear Information System (INIS)

    Doi, K.

    1976-01-01

    Geometric arrangements and exposure conditions used in different magnification techniques are described and the following advantages of radiographic magnification technique are discussed: sharpness effect; noise effect; air gap effect; and visual effect. The magnification technique can be used in various diagnostic procedures as a means of improving the image quality of radiographs

  12. Devices and methods of operation thereof for providing stable flow for centrifugal compressors

    Science.gov (United States)

    Skoch, Gary J. (Inventor); Stevens, Mark A. (Inventor); Jett, Thomas A. (Inventor)

    2008-01-01

    Centrifugal compressor flow stabilizing devices and methods of operation thereof are disclosed that act upon the flow field discharging from the impeller of a centrifugal compressor and modify the flow field ahead of the diffuser vanes such that flow conditions contributing to rotating stall and surge are reduced or even eliminated. In some embodiments, shaped rods and methods of operation thereof are disclosed, whereas in other embodiments reverse-tangent air injection devices and methods are disclosed.

  13. Unsafe abortion in urban and rural Tanzania: method, provider and consequences

    DEFF Research Database (Denmark)

    Rasch, Vibeke; Kipingili, Rose

    2009-01-01

    OBJECTIVE: To describe unsafe abortion methods and associated health consequences in Tanzania, where induced abortion is restricted by law but common and known to account for a disproportionate share of hospital admissions. METHOD: Cross-sectional study of women admitted with alleged miscarriage...

  14. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert; De Zelicourt, Axel; Saad, Maged

    2017-01-01

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under

  15. Compositional Advantage and Strategy

    DEFF Research Database (Denmark)

    Li, Xin

    In this paper, I first critique the composition-based view of Yadong Luo and John Child for understanding how resource-poor firms survive and thrive. To remedy the deficiencies in their perspective, I then propose a dynamic theory of compositional advantage and strategy. Here, the compositional...... advantage is redefined as the attractiveness of the composition of the producer’s offering in terms of scope and perceived value/price ratio. I identify five ways or basic compositional strategies to improve the value/price ratio. A firm may have an overall compositional strategy that is composed of some...... of the present theory to understanding Chinese firms. I conclude with managerial implications and suggestions for future research....

  16. Drivers of Collaborative Advantage

    DEFF Research Database (Denmark)

    Weihe, Gudrid

    processes and behavioural dimensions is practically non-existent. This article tries to remedy the current gap in the literature by reviewing research findings on interfirm collaboration (alliances). On that basis a conceptual framework for analyzing partnership processes is developed. Finally......, the antecedents of collaborative advantage are theoretically examined, and the organizational competences contributing to collaborative success are identified. The conclusion is that operational processes and social dynamics are vital drivers of collaborative advantage. Another significant conclusion...... is that public management research can benefit from drawing upon existing alliance research. Alliance scholars have during the past couple of decades accumulated an impressive amount of knowledge on different aspects of inter-firm cooperation, and therefore the learning potential for public management scholars...

  17. Transnasal endoscopy: Technical considerations, advantages and limitations.

    Science.gov (United States)

    Atar, Mustafa; Kadayifci, Abdurrahman

    2014-02-16

    Transnasal endoscopy (TNE) is an upper endoscopy method which is performed by the nasal route using a thin endoscope less than 6 mm in diameter. The primary goal of this method is to improve patient tolerance and convenience of the procedure. TNE can be performed without sedation and thus eliminates the risks associated with general anesthesia. In this way, TNE decreases the cost and total duration of endoscopic procedures, while maintaining the image quality of standard caliber endoscopes, providing good results for diagnostic purposes. However, the small working channel of the ultra-thin endoscope used for TNE makes it difficult to use for therapeutic procedures except in certain conditions which require a thinner endoscope. Biopsy is possible with special forceps less than 2 mm in diameter. Recently, TNE has been used for screening endoscopy in Far East Asia, including Japan. In most controlled studies, TNE was found to have better patient tolerance when compared to unsedated endoscopy. Nasal pain is the most significant symptom associated with endoscopic procedures but can be reduced with nasal pretreatment. Despite the potential advantage of TNE, it is not common in Western countries, usually due to a lack of training in the technique and a lack of awareness of its potential advantages. This paper briefly reviews the technical considerations as well as the potential advantages and limitations of TNE with ultra-thin scopes.

  18. Transnasal endoscopy: Technical considerations, advantages and limitations

    Science.gov (United States)

    Atar, Mustafa; Kadayifci, Abdurrahman

    2014-01-01

    Transnasal endoscopy (TNE) is an upper endoscopy method which is performed by the nasal route using a thin endoscope less than 6 mm in diameter. The primary goal of this method is to improve patient tolerance and convenience of the procedure. TNE can be performed without sedation and thus eliminates the risks associated with general anesthesia. In this way, TNE decreases the cost and total duration of endoscopic procedures, while maintaining the image quality of standard caliber endoscopes, providing good results for diagnostic purposes. However, the small working channel of the ultra-thin endoscope used for TNE makes it difficult to use for therapeutic procedures except in certain conditions which require a thinner endoscope. Biopsy is possible with special forceps less than 2 mm in diameter. Recently, TNE has been used for screening endoscopy in Far East Asia, including Japan. In most controlled studies, TNE was found to have better patient tolerance when compared to unsedated endoscopy. Nasal pain is the most significant symptom associated with endoscopic procedures but can be reduced with nasal pretreatment. Despite the potential advantage of TNE, it is not common in Western countries, usually due to a lack of training in the technique and a lack of awareness of its potential advantages. This paper briefly reviews the technical considerations as well as the potential advantages and limitations of TNE with ultra-thin scopes. PMID:24567791

  19. Analysis of yield advantage in mixed cropping

    NARCIS (Netherlands)

    Ranganathan, R.

    1993-01-01

    It has long been recognized that mixed cropping can give yield advantages over sole cropping, but methods that can identify such yield benefits are still being developed. This thesis presents a method that combines physiological and economic principles in the evaluation of yield advantage.

  20. NMR system and method having a permanent magnet providing a rotating magnetic field

    Science.gov (United States)

    Schlueter, Ross D [Berkeley, CA; Budinger, Thomas F [Berkeley, CA

    2009-05-19

    Disclosed herein are systems and methods for generating a rotating magnetic field. The rotating magnetic field can be used to obtain rotating-field NMR spectra, such as magic angle spinning spectra, without having to physically rotate the sample. This result allows magic angle spinning NMR to be conducted on biological samples such as live animals, including humans.

  1. The duty to provide information in the case of neuroradiological examination methods

    International Nuclear Information System (INIS)

    Deutsch, E.

    1987-01-01

    The author gives a survey on the judicial decisions concerning the obligation to give information in the case of neuroradiological examination methods. The scope and content of the medical explanation depends inter alia on the urgency and the necessity of the medical diagnosis and on the understanding of the patient. (WG) [de

  2. Vehicle Tracking System, Vehicle Infrastructure Provided with Vehicle Tracking System and Method for Tracking

    NARCIS (Netherlands)

    Papp, Z.; Doodeman, G.J.N.; Nelisse, M.W.; Sijs, J.; Theeuwes, J.A.C.; Driessen, B.J.F.

    2010-01-01

    A vehicle tracking system is described comprising - a plurality of sensor nodes (10) that each provide a message (D) indicative for an occupancy status of a detection area of an vehicle infrastructure monitored by said sensor node, said sensor nodes (10) being arranged in the vehicle infrastructure

  3. Compositions and methods for providing plants with tolerance to abiotic stress conditions

    KAUST Repository

    Hirt, Heribert

    2017-07-27

    It has been discovered that the desert endophytic bacterium SA187 SA187 can provide resistance or tolerance to abiotic stress conditions to seeds or plants. Compositions containing SA187 can be used to enhance plant development and yield under environmental stress conditions.

  4. A Novel Resource Management Method of Providing Operating System as a Service for Mobile Transparent Computing

    Directory of Open Access Journals (Sweden)

    Yonghua Xiong

    2014-01-01

    Full Text Available This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU virtualization and mobile agent for mobile transparent computing (MTC to devise a method of managing shared resources and services management (SRSM. It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user’s requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  5. A novel resource management method of providing operating system as a service for mobile transparent computing.

    Science.gov (United States)

    Xiong, Yonghua; Huang, Suzhen; Wu, Min; Zhang, Yaoxue; She, Jinhua

    2014-01-01

    This paper presents a framework for mobile transparent computing. It extends the PC transparent computing to mobile terminals. Since resources contain different kinds of operating systems and user data that are stored in a remote server, how to manage the network resources is essential. In this paper, we apply the technologies of quick emulator (QEMU) virtualization and mobile agent for mobile transparent computing (MTC) to devise a method of managing shared resources and services management (SRSM). It has three layers: a user layer, a manage layer, and a resource layer. A mobile virtual terminal in the user layer and virtual resource management in the manage layer cooperate to maintain the SRSM function accurately according to the user's requirements. An example of SRSM is used to validate this method. Experiment results show that the strategy is effective and stable.

  6. METHODS OF PROVIDING NOISE IMMUNITY IN AUTOMOBILE ANTI-THEFT SYSTEM CONTROL

    Directory of Open Access Journals (Sweden)

    Frolov, V.

    2013-06-01

    Full Text Available In modern ani-theft systems they use frequency and phase modulation. Since the width of the signal is limited, it is possible to intercept the signal and then switch off the alarm at the right time.To ensure the noise immunity and secrecy manufacturers use more sophisticated codes using the methods of cryptography. Significant increase in noise immunity in modern ani-theft systems is possible using broadband signals.

  7. System and Method for Providing Web-Based Remote Application Service

    OpenAIRE

    Shuen-Tai Wang; Yu-Ching Lin; Hsi-Ya Chang

    2017-01-01

    With the development of virtualization technologies, a new type of service named cloud computing service is produced. Cloud users usually encounter the problem of how to use the virtualized platform easily over the web without requiring the plug-in or installation of special software. The object of this paper is to develop a system and a method enabling process interfacing within an automation scenario for accessing remote application by using the web browser. To meet this challenge, we have ...

  8. Cloud Service Provider Methods for Managing Insider Threats: Analysis Phase 2, Expanded Analysis and Recommendations

    Science.gov (United States)

    2014-01-01

    and software as a service ( SaaS )) for staff’s abnormal behavior that may indicate an insider incident. As mentioned above, combining SIEM data...Mellon Software Engineering Institute, contacted commercial and government cloud service providers (CSPs) to better understand the administrative and...availability services . We have observed a number of scenarios in which a customer leaves a CSP’s IaaS, PaaS, or SaaS , but its data remains online for some

  9. Food irradiation: advantages and limitations

    International Nuclear Information System (INIS)

    Hernandes, N.K.; Vital, H. de C.; Sabaa-Srur, A.U.O.

    2003-01-01

    Food irradiation is a physical method of processing food (e.g. freezing, canning). It has been thoroughly researched over the last four decades and is recognized as a safe and wholesome method. It has the potential both of disinfesting dried food to reduce storage losses and disinfesting fruits and vegetables to meet quarantine requirements for export trade. Low doses of irradiation inhibit spoilage losses due to sprouting of root and tuber crops. Food- borne diseases due to contamination by pathogenic microorganisms and parasites of meat, poultry, fish, fishery products and spices are on the increase. Irradiation of these solid foods can decontaminate them of pathogenic organisms and thus provide safe food to the consumer. Irradiation can successfully replace the fumigation treatment of cocoa beans and coffee beans and disinfest dried fish, dates, dried fruits, etc. One of the most important advantages of food irradiation processing is that it is a coldprocess which does not significantly alter physico-chemical characters of the treated product. It can be applied to food after its final packaging. Similar to other physical processes of food processing, (e.g. canning, freezing), irradiation is a capital intensive process. Thus, adequate product volume must be made available in order to maximize the use of the facility and minimize the unit cost of treatment. Lack of harmonization of regulations among the countries which have approved irradiated foods hampers the introduction of this technique for international trade. Action at the international level has to be taken in order to remedy this situation. One of the important limitations of food irradiation processing is its slow acceptance by consumers, due inter alia to a perceived association with radioactivity. The food industry tends to be reluctant to use the technology in view of uncertainties regarding consumer acceptance of treated foods. Several market testing and consumer acceptance studies have been carried

  10. Creating corporate advantage.

    Science.gov (United States)

    Collis, D J; Montgomery, C A

    1998-01-01

    What differentiates truly great corporate strategies from the merely adequate? How can executives at the corporate level create tangible advantage for their businesses that makes the whole more than the sum of the parts? This article presents a comprehensive framework for value creation in the multibusiness company. It addresses the most fundamental questions of corporate strategy: What businesses should a company be in? How should it coordinate activities across businesses? What role should the corporate office play? How should the corporation measure and control performance? Through detailed case studies of Tyco International, Sharp, the Newell Company, and Saatchi and Saatchi, the authors demonstrate that the answers to all those questions are driven largely by the nature of a company's special resources--its assets, skills, and capabilities. These range along a continuum from the highly specialized at one end to the very general at the other. A corporation's location on the continuum constrains the set of businesses it should compete in and limits its choices about the design of its organization. Applying the framework, the authors point out the common mistakes that result from misaligned corporate strategies. Companies mistakenly enter businesses based on similarities in products rather than the resources that contribute to competitive advantage in each business. Instead of tailoring organizational structures and systems to the needs of a particular strategy, they create plain-vanilla corporate offices and infrastructures. The company examples demonstrate that one size does not fit all. One can find great corporate strategies all along the continuum.

  11. Evaluation of Two Statistical Methods Provides Insights into the Complex Patterns of Alternative Polyadenylation Site Switching

    Science.gov (United States)

    Li, Jie; Li, Rui; You, Leiming; Xu, Anlong; Fu, Yonggui; Huang, Shengfeng

    2015-01-01

    Switching between different alternative polyadenylation (APA) sites plays an important role in the fine tuning of gene expression. New technologies for the execution of 3’-end enriched RNA-seq allow genome-wide detection of the genes that exhibit significant APA site switching between different samples. Here, we show that the independence test gives better results than the linear trend test in detecting APA site-switching events. Further examination suggests that the discrepancy between these two statistical methods arises from complex APA site-switching events that cannot be represented by a simple change of average 3’-UTR length. In theory, the linear trend test is only effective in detecting these simple changes. We classify the switching events into four switching patterns: two simple patterns (3’-UTR shortening and lengthening) and two complex patterns. By comparing the results of the two statistical methods, we show that complex patterns account for 1/4 of all observed switching events that happen between normal and cancerous human breast cell lines. Because simple and complex switching patterns may convey different biological meanings, they merit separate study. We therefore propose to combine both the independence test and the linear trend test in practice. First, the independence test should be used to detect APA site switching; second, the linear trend test should be invoked to identify simple switching events; and third, those complex switching events that pass independence testing but fail linear trend testing can be identified. PMID:25875641

  12. Physicians' opinions about partner notification methods: case reporting, patient referral, and provider referral.

    Science.gov (United States)

    Hogben, M; St Lawrence, J S; Montaño, D E; Kasprzyk, D; Leichliter, J S; Phillips, W R

    2004-02-01

    The United States has relied upon partner notification strategies to help break the chain of infection and re-infection for sexually transmitted diseases (STD). Physicians are a vital link in the system of STD control, but little is known of physician opinions about partner notification strategies. We collected opinions about partner notification from a national probability sample of physicians in specialties diagnosing STDs. Physicians responded to 17 questions about three relevant forms of STD partner notification: patient based referral, provider based referral, and case reporting. Exploratory factor analyses showed that responses for each form of partner notification could be grouped into four categories: perceived practice norms, infection control, patient relationships, and time/money. Multivariate analyses of the factors showed that physicians endorsed patient based referral most favourably and provider based referral least favourably. Physicians' opinions about partner notification strategies appear to reflect objective reality in some areas, but not in others. Strategies that improve the fit between physicians' opinions and effective notification are needed: some are discussed here.

  13. Assessing five field sampling methods to monitor Yellowstone National Park's northern ungulate winter range: the advantages and disadvantages of implementing a new sampling protocol

    Science.gov (United States)

    Pamela G. Sikkink; Roy Renkin; Geneva Chong; Art Sikkink

    2013-01-01

    The five field sampling methods tested for this study differed in richness and Simpson's Index values calculated from the raw data. How much the methods differed, and which ones were most similar to each other, depended on which diversity measure and which type of data were used for comparisons. When the number of species (richness) was used as a measure of...

  14. Neural interface methods and apparatus to provide artificial sensory capabilities to a subject

    Energy Technology Data Exchange (ETDEWEB)

    Buerger, Stephen P.; Olsson, III, Roy H.; Wojciechowski, Kenneth E.; Novick, David K.; Kholwadwala, Deepesh K.

    2017-01-24

    Embodiments of neural interfaces according to the present invention comprise sensor modules for sensing environmental attributes beyond the natural sensory capability of a subject, and communicating the attributes wirelessly to an external (ex-vivo) portable module attached to the subject. The ex-vivo module encodes and communicates the attributes via a transcutaneous inductively coupled link to an internal (in-vivo) module implanted within the subject. The in-vivo module converts the attribute information into electrical neural stimuli that are delivered to a peripheral nerve bundle within the subject, via an implanted electrode. Methods and apparatus according to the invention incorporate implantable batteries to power the in-vivo module allowing for transcutaneous bidirectional communication of low voltage (e.g. on the order of 5 volts) encoded signals as stimuli commands and neural responses, in a robust, low-error rate, communication channel with minimal effects to the subjects' skin.

  15. Method for providing uranium articles with a corrosion resistant anodized coating

    International Nuclear Information System (INIS)

    Waldrop, F.B.; Washington, C.A.

    1982-01-01

    Uranium articles are provided with anodized oxide coatings in an aqueous solution of an electrolyte selected from the group consisting of potassium phosphate, potassium hydroxide, ammonium hydroxide, and a mixture of potassium tetraborate and boric acid. The uranium articles are anodized at a temperature greater than about 75 degrees C. With a current flow of less than about 0.036 A/cm2 of surface area while the Ph of the solution is maintained in a range of about 2 to 11.5. The Ph values of the aqueous solution and the low current density utilized during the electrolysis prevent excessive dissolution of the uranium and porosity in the film or watering. The relatively high temperature of the electrolyte bath inhibits hydration and the attendant deleterious pitting so as to enhance corrosion resistance of the anodized coating

  16. A Statistical Method for Aggregated Wind Power Plants to Provide Secondary Frequency Control

    DEFF Research Database (Denmark)

    Hu, Junjie; Ziras, Charalampos; Bindner, Henrik W.

    2017-01-01

    curtailment for aggregated wind power plants providing secondary frequency control (SFC) to the power system. By using historical SFC signals and wind speed data, we calculate metrics for the reserve provision error as a function of the scheduled wind power. We show that wind curtailment can be significantly......The increasing penetration of wind power brings significant challenges to power system operators due to the wind’s inherent uncertainty and variability. Traditionally, power plants and more recently demand response have been used to balance the power system. However, the use of wind power...... as a balancing-power source has also been investigated, especially for wind power dominated power systems such as Denmark. The main drawback is that wind power must be curtailed by setting a lower operating point, in order to offer upward regulation. We propose a statistical approach to reduce wind power...

  17. Pediatric primary care providers' perspectives regarding hospital discharge communication: a mixed methods analysis.

    Science.gov (United States)

    Leyenaar, JoAnna K; Bergert, Lora; Mallory, Leah A; Engel, Richard; Rassbach, Caroline; Shen, Mark; Woehrlen, Tess; Cooperberg, David; Coghlin, Daniel

    2015-01-01

    Effective communication between inpatient and outpatient providers may mitigate risks of adverse events associated with hospital discharge. However, there is an absence of pediatric literature defining effective discharge communication strategies at both freestanding children's hospitals and general hospitals. The objectives of this study were to assess associations between pediatric primary care providers' (PCPs) reported receipt of discharge communication and referral hospital type, and to describe PCPs' perspectives regarding effective discharge communication and areas for improvement. We administered a questionnaire to PCPs referring to 16 pediatric hospital medicine programs nationally. Multivariable models were developed to assess associations between referral hospital type and receipt and completeness of discharge communication. Open-ended questions asked respondents to describe effective strategies and areas requiring improvement regarding discharge communication. Conventional qualitative content analysis was performed to identify emergent themes. Responses were received from 201 PCPs, for a response rate of 63%. Although there were no differences between referral hospital type and PCP-reported receipt of discharge communication (relative risk 1.61, 95% confidence interval 0.97-2.67), PCPs referring to general hospitals more frequently reported completeness of discharge communication relative to those referring to freestanding children's hospitals (relative risk 1.78, 95% confidence interval 1.26-2.51). Analysis of free text responses yielded 4 major themes: 1) structured discharge communication, 2) direct personal communication, 3) reliability and timeliness of communication, and 4) communication for effective postdischarge care. This study highlights potential differences in the experiences of PCPs referring to general hospitals and freestanding children's hospitals, and presents valuable contextual data for future quality improvement initiatives

  18. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  19. Analysis of methods of providing anonymity in facial photographs; a randomised controlled study.

    LENUS (Irish Health Repository)

    Clover, A J P

    2010-09-01

    Clinical images are invaluable in medical teaching and research publications. In the past efforts to conceal patient identity, if any, were limited to a black bar concealing the eyes. However, there is no consensus on this among major journals and publishing houses. This research analyses the effectiveness of blacking out the eyes in facial photographs and evaluates alternative techniques. 126 questionnaires were completed. The average numbers of correct responses out of 30 was 24.64 (82.13%) in the control group, 20.59 (68.63%) in the eyes, 20.42 (68.07%) in the eyes and nose group, and 17.53 (58.43%) in the T-shaped group (eyes, nose and mouth). The traditional method of covering the eyes does significantly decrease recognition, however it is only as effective as covering the nose and mouth. The more of the face that is covered the less likely it is that the person is recognised. However, there are people who remain identifiable no matter how much of the face is covered. This work highlights the importance of obtaining consent prior to publication as well as attempting to hide identity.

  20. RECONSIDERING COMPETITIVE ADVANTAGES

    Directory of Open Access Journals (Sweden)

    Valentina Zaharia

    2011-12-01

    Full Text Available Development of the competitive advantage involves a considerable effort from any organization. In particular, those organizations involved in a strong competitive market require the development of strategies to allocate long-term strategic marketing resources, efficiently and with easily quantifiable results. Faced with a multitude of phenomena and processes sometimes contradictory on different markets of consumption, contemporarily marketing has the mission to develop as creative as possible the business strategy of the organizations, their capacity of interacting with customers and other categories of audience. Such concepts as strategic positioning, relational marketing, management of the relationship with the consumer, marketing integrated research, a.s.o. are only a few of the tools with the help of which the marketing managers will implement successful operational strategies. All these developments are creating a real new paradigm of Marketing aimed to better explain the new types of complex market relationship in which the 21st Century organization is .

  1. Creating advantages with Franchising in healthcare: An explorative mixed methods study on the role of the relationship between the franchisor and units

    OpenAIRE

    Nijmeijer, Karlijn J.; Fabbricotti, Isabelle; Huijsman, Robbert

    2015-01-01

    textabstractBackground Franchising is a promising and increasingly used organizational form to improve strategic, organizational, professional and client-related results in healthcare. However, evidence is scarce regarding how franchises should be operated to actualize such results. This paper aimed to explore the association between the results achieved by healthcare franchises and the working relationships among actors in these franchises. Methods A sequential mixed methods approach was use...

  2. Gamma Knife radiosurgery of olfactory groove meningiomas provides a method to preserve subjective olfactory function.

    Science.gov (United States)

    Gande, Abhiram; Kano, Hideyuki; Bowden, Gregory; Mousavi, Seyed H; Niranjan, Ajay; Flickinger, John C; Lunsford, L Dade

    2014-02-01

    Anosmia is a common outcome after resection of olfactory groove meningioma(s) (OGM) and for some patients represents a significant disability. To evaluate long term tumor control rates and preservation of subjective olfaction after Gamma Knife (GK) stereotactic radiosurgery (SRS) of OGM. We performed a retrospective chart review and telephone assessments of 41 patients who underwent GK SRS between 1987 and 2008. Clinical outcomes were stratified by full, partial or no subjective olfaction, whereas tumor control was assessed by changes in volume greater or lesser than 25%. The median clinical and imaging follow-up were 76 and 65 months, respectively. Prior to SRS, 19 (46%) patients had surgical resections and two (5%) had received fractionated radiation therapy. Twenty four patients (59%) reported a normal sense of smell, 12 (29%) reported a reduced sense of smell and five (12%) had complete anosmia. The median tumor volume was 8.5 cm(3) (range 0.6-56.1), the mean radiation dose at the tumor margin was 13 Gy (range 10-20) and the median estimated dose to the olfactory nerve was 5.1 Gy (range 1.1-18.1). At follow-up, 27 patients (66%) reported intact olfaction (three (7%) described return to a normal sense of smell), nine (22%) described partial anosmia, and five (12%) had complete anosmia. No patient reported deterioration in olfaction after SRS. Thirteen patients (32%) showed significant tumor regression, 26 (63%) had no further growth and two (5%) had progressed. The progression free tumor control rates were 97% at 1 year and 95% at 2, 10 and 20 years. Symptomatic adverse radiation effects occurred in three (7%) patients. Stereotactic radiosurgery provided both long term tumor control and preservation of olfaction.

  3. Private providers' knowledge, attitudes and misconceptions related to long-acting and permanent contraceptive methods: a case study in Bangladesh.

    Science.gov (United States)

    Ugaz, Jorge; Banke, Kathryn; Rahaim, Stephen; Chowdhury, Wahiduzzaman; Williams, Julie

    2016-11-01

    In Bangladesh, use of long-acting and permanent methods of contraception (LAPMs) remains stagnant. Providers' limited knowledge and biases may be a factor. We assessed private providers' knowledge, misconceptions and general attitudes towards LAPM in two urban areas. The ultimate goal is to shape programs and interventions to overcome these obstacles and improve full method choice in Bangladesh. Trained data collectors interviewed a convenience sample of 235 female doctors (obstetricians-gynecologists and general practitioners) and 150 female nurses from 194 commercial (for-profit) health care facilities in Chittagong City Corporation and Dhaka district. Data were collected on the nature of the practice, training received, knowledge about modern contraceptives and attitudes towards LAPM [including intrauterine device (IUDs), implants, female and male sterilization]. All providers, and especially doctors, lacked adequate knowledge regarding side effects for all LAPMs, particularly female and male sterilization. Providers had misconceptions about the effectiveness and convenience of LAPMs compared to short-acting contraceptive methods. Implants and IUDs were generally perceived more negatively than other methods. The majority of providers believed that husbands favor short-acting methods rather than LAPMs and that women should not use a method that their husbands do not approve of. Our findings document knowledge and attitudinal barriers among private for-profit providers in urban areas affecting their provision of accurate information about LAPM choices. Practitioners should be offered the necessary tools to provide women full access to all modern methods, especially LAPMs, in order to contribute to decreasing unmet need and improving full method choice in Bangladesh. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. The Advantages and Disadvantages of Using Qualitative and Quantitative Approaches and Methods in Language "Testing and Assessment" Research: A Literature Review

    Science.gov (United States)

    Rahman, Md Shidur

    2017-01-01

    The researchers of various disciplines often use qualitative and quantitative research methods and approaches for their studies. Some of these researchers like to be known as qualitative researchers; others like to be regarded as quantitative researchers. The researchers, thus, are sharply polarised; and they involve in a competition of pointing…

  5. A Conceptual Mapping Resource Advantage Theory, Competitive Advantage Theory, and Transient Competitive Advantage

    OpenAIRE

    Jasanta PERANGINANGIN

    2015-01-01

    Competitive advantage is the main purposed of the business entity focusing on market base view. Resource advantage theorists put their concern to empowering resources development with resources based view, in the other side needs to redefining competitive advantage. All the competitive advantage are transient, concluded the end of competitive advantage. Redefining competitive advantage by selling migration and shrewdness outward. This research to emphasize innovation capability rarely appears...

  6. Demonstration of different endocervical staining methods and their usefulness in the diagnosis of the chlamydial infection in exfoliated cells advantages and disadvantages.

    Science.gov (United States)

    Mahmutović, Sabina; Beslagić, Edina; Hamzić, Sadeta; Aljicević, Mufida

    2004-02-01

    Microscopic demonstration of chlamydial inclusions within cells offered the first laboratory procedure supporting the clinical diagnosis of chlamydial infection. Our aim is to evaluate the usefulness of different endocervical staining methods in diagnosis of Chlamydia trachomatis (CT) infection within exfoliated cells of the endocervix. The cytological test for the detection of chlamydial inclusions in genital tract infection, though not as sensitive and specific as isolation in the cell culture monolayers, is still of the diagnostic value. The present study discusses the collection of clinical smears for microscopic examination, their preparation; fixation and staining of slides by a variety of staining methods that have been used to detect Chlamydia in clinical smears and biopsies. Most of these methods such as Giemsa stain, Papanicolaou, iodine, and immunofluorescence (IF) using monoclonal antibodies, are based on the combination of dyes designed to obtain optimum differentiation of the various structures. The utilization of different endocervical smear stains together with the clinical information can be used to identify women at high risk for CT infection.

  7. A comparison of genotyping-by-sequencing analysis methods on low-coverage crop datasets shows advantages of a new workflow, GB-eaSy.

    Science.gov (United States)

    Wickland, Daniel P; Battu, Gopal; Hudson, Karen A; Diers, Brian W; Hudson, Matthew E

    2017-12-28

    Genotyping-by-sequencing (GBS), a method to identify genetic variants and quickly genotype samples, reduces genome complexity by using restriction enzymes to divide the genome into fragments whose ends are sequenced on short-read sequencing platforms. While cost-effective, this method produces extensive missing data and requires complex bioinformatics analysis. GBS is most commonly used on crop plant genomes, and because crop plants have highly variable ploidy and repeat content, the performance of GBS analysis software can vary by target organism. Here we focus our analysis on soybean, a polyploid crop with a highly duplicated genome, relatively little public GBS data and few dedicated tools. We compared the performance of five GBS pipelines using low-coverage Illumina sequence data from three soybean populations. To address issues identified with existing methods, we developed GB-eaSy, a GBS bioinformatics workflow that incorporates widely used genomics tools, parallelization and automation to increase the accuracy and accessibility of GBS data analysis. Compared to other GBS pipelines, GB-eaSy rapidly and accurately identified the greatest number of SNPs, with SNP calls closely concordant with whole-genome sequencing of selected lines. Across all five GBS analysis platforms, SNP calls showed unexpectedly low convergence but generally high accuracy, indicating that the workflows arrived at largely complementary sets of valid SNP calls on the low-coverage data analyzed. We show that GB-eaSy is approximately as good as, or better than, other leading software solutions in the accuracy, yield and missing data fraction of variant calling, as tested on low-coverage genomic data from soybean. It also performs well relative to other solutions in terms of the run time and disk space required. In addition, GB-eaSy is built from existing open-source, modular software packages that are regularly updated and commonly used, making it straightforward to install and maintain

  8. Creating Advantages with Franchising in Healthcare: An Explorative Mixed Methods Study on the Role of the Relationship between the Franchisor and Units

    Science.gov (United States)

    Nijmeijer, Karlijn Jojanneke; Fabbricotti, Isabelle Natalina; Huijsman, Robbert

    2015-01-01

    Background Franchising is a promising and increasingly used organizational form to improve strategic, organizational, professional and client-related results in healthcare. However, evidence is scarce regarding how franchises should be operated to actualize such results. This paper aimed to explore the association between the results achieved by healthcare franchises and the working relationships among actors in these franchises. Methods A sequential mixed methods approach was used to obtain both in-depth and broader quantifiable insights into a little-investigated phenomenon. We first employed a qualitative multiple embedded case study. Data were collected through observations, document analyses, and 96 in-depth semi-structured interviews in three Dutch healthcare franchises. Within-case and cross-case comparative analyses were conducted. Subsequently, a cross-sectional survey was developed based on the qualitative study and disseminated among 19 healthcare franchises. 40 franchisors and 346 unit actors filled in the questionnaire. Findings It seems important to have open, committed, cooperative franchise relationships in which professional franchisees and unit managers feel and trust that they have the opportunity to introduce ideas and articulate their needs to the franchisor. Such relationships help ensure satisfaction, survival, and quality of care, because they serve to foster synergy realization and local fit and prevent reinventing the wheel and professional resistance. PMID:25664581

  9. Advantages of later motherhood.

    Science.gov (United States)

    Myrskylä, M; Barclay, K; Goisis, A

    2017-01-01

    In high-income countries childbearing has been increasingly postponed since the 1970s and it is crucial to understand the consequences of this demographic shift. The literature has tended to characterize later motherhood as a significant health threat for children and parents. We contribute to this debate by reviewing recent evidence suggesting that an older maternal age can also have positive effects. Literature linking the age at parenthood with the sociodemographic characteristics of the parents, with macrolevel interactions, and with subjective well-being. Comprehensive review of the existing literature. Recent studies show that there can also be advantages associated with later motherhood. First, whilst in past older mothers had low levels of education and large families, currently older mothers tend to have higher education and smaller families than their younger peers. Consequently, children born to older mothers in the past tended to have worse outcomes than children born to younger mothers, whilst the opposite is true in recent cohorts. Second, postponement of childbearing means that the child is born at a later date and in a later birth cohort, and may benefit from secular changes in the macroenvironment. Evidence shows that when the positive trends in the macroenvironment are strong they overweigh the negative effects of reproductive ageing. Third, existing studies show that happiness increases around and after childbirth among older mothers, whereas for younger mothers the effect does not exist or is short-lived. There are important sociodemographic pathways associated with postponement of childbearing which might compensate or even more than compensate for the biological disadvantages associated with reproductive ageing.

  10. Advantages of Oscillatory Hydraulic Tomography

    Science.gov (United States)

    Kitanidis, P. K.; Bakhos, T.; Cardiff, M. A.; Barrash, W.

    2012-12-01

    Characterizing the subsurface is significant for most hydrogeologic studies, such as those involving site remediation and groundwater resource explo¬ration. A variety of hydraulic and geophysical methods have been developed to estimate hydraulic conductivity and specific storage. Hydraulic methods based on the analysis of conventional pumping tests allow the estimation of conductivity and storage without need for approximate petrophysical relations, which is an advantage over most geophysical methods that first estimate other properties and then infer values of hydraulic parameters. However, hydraulic methods have the disadvantage that the head-change signal decays with distance from the pumping well and thus becomes difficult to separate from noise except in close proximity to the source. Oscillatory hydraulic tomography (OHT) is an emerging technology to im¬age the subsurface. This method utilizes the idea of imposing sinusoidally varying pressure or discharge signals at several points, collecting head observations at several other points, and then processing these data in a tomographic fashion to estimate conductivity and storage coefficients. After an overview of the methodology, including a description of the most important potential advantages and challenges associated with this approach, two key promising features of the approach will be discussed. First, the signal at an observation point is orthogonal to and thus can be separated from nuisance inputs like head fluctuation from production wells, evapotranspiration, irrigation, and changes in the level of adjacent streams. Second, although the signal amplitude may be weak, one can extract the phase and amplitude of the os¬cillatory signal by collecting measurements over a longer time, thus compensating for the effect of large distance through longer sampling period.

  11. Creating advantages with franchising in healthcare: an explorative mixed methods study on the role of the relationship between the franchisor and units.

    Directory of Open Access Journals (Sweden)

    Karlijn Jojanneke Nijmeijer

    Full Text Available Franchising is a promising and increasingly used organizational form to improve strategic, organizational, professional and client-related results in healthcare. However, evidence is scarce regarding how franchises should be operated to actualize such results. This paper aimed to explore the association between the results achieved by healthcare franchises and the working relationships among actors in these franchises.A sequential mixed methods approach was used to obtain both in-depth and broader quantifiable insights into a little-investigated phenomenon. We first employed a qualitative multiple embedded case study. Data were collected through observations, document analyses, and 96 in-depth semi-structured interviews in three Dutch healthcare franchises. Within-case and cross-case comparative analyses were conducted. Subsequently, a cross-sectional survey was developed based on the qualitative study and disseminated among 19 healthcare franchises. 40 franchisors and 346 unit actors filled in the questionnaire.It seems important to have open, committed, cooperative franchise relationships in which professional franchisees and unit managers feel and trust that they have the opportunity to introduce ideas and articulate their needs to the franchisor. Such relationships help ensure satisfaction, survival, and quality of care, because they serve to foster synergy realization and local fit and prevent reinventing the wheel and professional resistance.

  12. Creating advantages with franchising in healthcare: an explorative mixed methods study on the role of the relationship between the franchisor and units.

    Science.gov (United States)

    Nijmeijer, Karlijn Jojanneke; Fabbricotti, Isabelle Natalina; Huijsman, Robbert

    2015-01-01

    Franchising is a promising and increasingly used organizational form to improve strategic, organizational, professional and client-related results in healthcare. However, evidence is scarce regarding how franchises should be operated to actualize such results. This paper aimed to explore the association between the results achieved by healthcare franchises and the working relationships among actors in these franchises. A sequential mixed methods approach was used to obtain both in-depth and broader quantifiable insights into a little-investigated phenomenon. We first employed a qualitative multiple embedded case study. Data were collected through observations, document analyses, and 96 in-depth semi-structured interviews in three Dutch healthcare franchises. Within-case and cross-case comparative analyses were conducted. Subsequently, a cross-sectional survey was developed based on the qualitative study and disseminated among 19 healthcare franchises. 40 franchisors and 346 unit actors filled in the questionnaire. It seems important to have open, committed, cooperative franchise relationships in which professional franchisees and unit managers feel and trust that they have the opportunity to introduce ideas and articulate their needs to the franchisor. Such relationships help ensure satisfaction, survival, and quality of care, because they serve to foster synergy realization and local fit and prevent reinventing the wheel and professional resistance.

  13. Home Court Advantage.

    Science.gov (United States)

    Cohen, Andrew

    1995-01-01

    Provides low-cost tips for keeping gymnasiums aesthetically pleasing as well as revenue supporting for their multi-team functions. Use of banners, logos for chairs and end-wall padding, scorer tables with illuminated front panels for advertisements, and logo and advertising space built into speakers are discussed as are bleacher maintenance and…

  14. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    Directory of Open Access Journals (Sweden)

    B. V. Savchinskiy

    2010-03-01

    Full Text Available On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  15. THE SIMULATION DIAGNOSTIC METHODS AND REGENERATION WAYS OF REINFORCED - CONCRETE CONSTRUCTIONS OF BRIDGES IN PROVIDING THEIR OPERATING RELIABILITY AND LONGEVITY

    OpenAIRE

    B. V. Savchinskiy

    2010-01-01

    On the basis of analysis of existing diagnostic methods and regeneration ways of reinforced-concrete constructions of bridges the recommendations on introduction of new modern technologies of renewal of reinforced-concrete constructions of bridges in providing their operating reliability and longevity are offered.

  16. A Mixed-Methods Investigation of Early Childhood Professional Development for Providers and Recipients in the United States

    Science.gov (United States)

    Linder, Sandra M.; Rembert, Kellye; Simpson, Amber; Ramey, M. Deanna

    2016-01-01

    This multi-phase mixed-methods study explores provider and recipient perceptions of the current state of early childhood professional development in a southeastern area of the United States. Professional development for the early childhood workforce has been shown to positively influence the quality of early childhood classrooms. This study…

  17. Perceptions of vaginal microbicides as an HIV prevention method among health care providers in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Mantell Joanne E

    2007-03-01

    Full Text Available Abstract Background The promise of microbicides as an HIV prevention method will not be realized if not supported by health care providers. They are the primary source of sexual health information for potential users, in both the public and private health sectors. Therefore, the aim of this study was to determine perceptions of vaginal microbicides as a potential HIV prevention method among health care providers in Durban and Hlabisa, South Africa, using a combination of quantitative and qualitative methods. Results During 2004, semi structured interviews with 149 health care providers were conducted. Fifty seven percent of hospital managers, 40% of pharmacists and 35% of nurses possessed some basic knowledge of microbicides, such as the product being used intra-vaginally before sex to prevent HIV infection. The majority of them were positive about microbicides and were willing to counsel users regarding potential use. Providers from both public and private sectors felt that an effective microbicide should be available to all people, regardless of HIV status. Providers felt that the product should be accessed over-the-counter in pharmacies and in retail stores. They also felt a need for potential microbicides to be available free of charge, and packaged with clear instructions. The media was seen by health care providers as being an effective strategy for promoting microbicides. Conclusion Overall, health care providers were very positive about the possible introduction of an effective microbicide for HIV prevention. The findings generated by this study illustrated the need for training health care providers prior to making the product accessible, as well as the importance of addressing the potential barriers to use of the product by women. These are important concerns in the health care community, and this study also served to educate them for the day when research becomes reality.

  18. Calculation of the energy provided by a PV generator. Comparative study: Conventional methods vs. artificial neural networks

    International Nuclear Information System (INIS)

    Almonacid, F.; Rus, C.; Perez-Higueras, P.; Hontoria, L.

    2011-01-01

    The use of photovoltaics for electricity generation purposes has recorded one of the largest increases in the field of renewable energies. The energy production of a grid-connected PV system depends on various factors. In a wide sense, it is considered that the annual energy provided by a generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. However, a range of factors is influencing the expected outcome by reducing the generation of energy. The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network developed by the R and D Group for Solar and Automatic Energy at the University of Jaen. The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study, mainly due to the fact that this method takes also into account some second order effects, such as low irradiance, angular and spectral effects. -- Research highlights: → It is considered that the annual energy provided by a PV generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. → A range of factors are influencing the expected outcome by reducing the generation of energy (mismatch losses, dirt and dust, Ohmic losses,.). → The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network. → The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study. While classical methods have only taken into account temperature losses, the method based in

  19. Home advantage in professional tennis

    NARCIS (Netherlands)

    Koning, Ruud H.

    2011-01-01

    Home advantage is a pervasive phenomenon in sport. It has been established in team sports such as basketball, baseball, American football, and European soccer. Attention to home advantage in individual sports has so far been limited. The aim of this study was to examine home advantage in

  20. A combined usage of stochastic and quantitative risk assessment methods in the worksites: Application on an electric power provider

    International Nuclear Information System (INIS)

    Marhavilas, P.K.; Koulouriotis, D.E.

    2012-01-01

    An individual method cannot build either a realistic forecasting model or a risk assessment process in the worksites, and future perspectives should focus on the combined forecasting/estimation approach. The main purpose of this paper is to gain insight into a risk prediction and estimation methodological framework, using the combination of three different methods, including the proportional quantitative-risk-assessment technique (PRAT), the time-series stochastic process (TSP), and the method of estimating the societal-risk (SRE) by F–N curves. In order to prove the usefulness of the combined usage of stochastic and quantitative risk assessment methods, an application on an electric power provider industry is presented to, using empirical data.

  1. Linking environmental protection in practice. Advantages of a systematical method of sustainable building, from initiative to demolition; Aansluitende milieuzorg in de praktijk. Voordelen van een systematische aanpak van duurzaam bouwen, van initiatief tot sloop

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-07-01

    Based on the results of four building projects the advantages of a systematical method (so-called linking environmental protection or in Dutch 'aansluitende milieuzorg') for sustainable construction of buildings are discussed. By formulating sound agreements and making sure that every party involved in the building process knows its tasks, responsibilities and competencies the whole process from initiative to demolition can be streamlined. By applying the right tools in every phase of the project the environmental effectiveness will be optimal.

  2. Mechanistic Basis of Cocrystal Dissolution Advantage.

    Science.gov (United States)

    Cao, Fengjuan; Amidon, Gordon L; Rodríguez-Hornedo, Naír; Amidon, Gregory E

    2018-01-01

    Current interest in cocrystal development resides in the advantages that the cocrystal may have in solubility and dissolution compared with the parent drug. This work provides a mechanistic analysis and comparison of the dissolution behavior of carbamazepine (CBZ) and its 2 cocrystals, carbamazepine-saccharin (CBZ-SAC) and carbamazepine-salicylic acid (CBZ-SLC) under the influence of pH and micellar solubilization. A simple mathematical equation is derived based on the mass transport analyses to describe the dissolution advantage of cocrystals. The dissolution advantage is the ratio of the cocrystal flux to drug flux and is defined as the solubility advantage (cocrystal to drug solubility ratio) times the diffusivity advantage (cocrystal to drug diffusivity ratio). In this work, the effective diffusivity of CBZ in the presence of surfactant was determined to be different and less than those of the cocrystals. The higher effective diffusivity of drug from the dissolved cocrystals, the diffusivity advantage, can impart a dissolution advantage to cocrystals with lower solubility than the parent drug while still maintaining thermodynamic stability. Dissolution conditions where cocrystals can display both thermodynamic stability and a dissolution advantage can be obtained from the mass transport models, and this information is useful for both cocrystal selection and formulation development. Copyright © 2018 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  3. COMPETITIVE ADVANTAGE IN THE ENTERPRISE PERFORMANCE

    Directory of Open Access Journals (Sweden)

    PRUNEA Ana Daniela

    2014-07-01

    Full Text Available Rapid changes in market characteristics and the technological innovations are common and faster challenges, resulting in products, processes and technologies. The competitive advantage is volatile, difficult to obtain and more difficult to maintain and strengthened with consumers who through their individual choices polarization confirms the recognition performance and award competitive advantages, thus causing the competitive ranking of companies present in a particular market. The competitive advantage lies in the focus of the performance of companies in competitive markets and innovation is a source for obtaining and consolidating it. Companies will need to demonstrate the capacity to adapt to changes in the business environment so as to maintain the helded positions. This paper treats this aspect behavior that companies should adopt to get on the account of innovation a sustainable competitive advantage. I started of the work in the elaboration from the theory of developed by Michael Porter in his book "Competitive Advantage: Creating and Sustaining Superior Performance" we applied methods listed thus trying to point out possible ways of creating competitive advantage by companies. We have presented the sources of competitive advantage and the factors on which depends its creation. Walking theoretical research revealed how lack of competitive advantage leads to a lack of competitiveness of companies and the benefits that arise with the creation of this type of asset. Among the most important benefits is to increase performances. Once the competitive advantage is achieved, it must be maintained and updated market conditions and the methods that can be created a sustainable competitive advantage represent the answers to many of the companies questions are fighting for survival in an environment of fierce competition. The implementation of methods for obtaining competitive advantages, but also exist dangers, that every company should know them

  4. The greenhouse advantage of natural gas appliances

    International Nuclear Information System (INIS)

    Coombe, N.

    2000-01-01

    The life cycle report prepared recently by Energetics for the AGA, Assessment of Greenhouse Gas Emissions from Natural Gas, demonstrates clearly the greenhouse advantage natural gas has over coal in generating electricity. This study also goes one step further in applying this life cycle approach to the use of space and water heating within the home. The study shows the significant green-house advantage that natural gas appliances have over electric appliances. Findings from other studies also support this claim. The natural gas suppliers are encouraged to take advantage of the marketing opportunity that these studies provide, offering the householders the fuel that will significantly reduce their contribution to greenhouse emission

  5. Evaluation of protection factors provided by full-face masks using man-test method at workplace

    International Nuclear Information System (INIS)

    Izumi, Yukio; Kinouchi, Nobuyuki; Ikezawa, Yoshio.

    1994-01-01

    From a practical angle of view to estimate the protection factors (PFs) provided by full-face masks, a number of protection factors were measured with a man-test apparatus just before the wearers started to do radiation work in radiation controlled area. PFs of the total number of 2,279 cases were measured under five simulated working conditions. The measured PFs were widely distributed from 2.3 to 6,700. About 95% of workers obtained PFs more than 50, and about 64% showed much higher PFs more than 1,000 due to good fitting. In the case of some persons, the measured PFs irregularly varied and changed to a large degree. This method is a reliable technique that has been confirmed to protect unexpected internal exposure. From the results obtained, the method should be necessary to provide a better mask and higher PF for each worker. (author)

  6. A METHOD AND AN APPARATUS FOR PROVIDING TIMING SIGNALS TO A NUMBER OF CIRCUITS, AN INTEGRATED CIRCUIT AND A NODE

    DEFF Research Database (Denmark)

    2006-01-01

    A method of providing or transporting a timing signal between a number of circuits, electrical or optical, where each circuit is fed by a node. The nodes forward timing signals between each other, and at least one node is adapted to not transmit a timing signal before having received a timing...... signal from at least two nodes. In this manner, the direction of the timing skew between nodes and circuits is known and data transport between the circuits made easier....

  7. Advantages and risks in service standardization

    Directory of Open Access Journals (Sweden)

    Veres Zoltán

    2004-01-01

    Full Text Available Comparing the advantages and risks in standardizing services, there can be no clear-cut answer concerning the strategy to be followed. Exploiting advantages in the long run is only worth it for a provider of a service that is able to build up a powerful brand image. However, the more successful a service concept, the stronger the temptation to imitation. The success of imitators will sooner or later bring about multibrand loyalty.

  8. A Similarity-Ranking Method on Semantic Computing for Providing Information-Services in Station-Concierge System

    Directory of Open Access Journals (Sweden)

    Motoki Yokoyama

    2017-07-01

    Full Text Available The prevalence of smartphones and wireless broadband networks have been progressing as a new Railway infomration environment. According to the spread of such devices and information technology, various types of information can be obtained from databases connected to the Internet. One scenario of obtaining such a wide variety of information resources is in the phase of user’s transportation. This paper proposes an information provision system, named the Station Concierge System that matches the situation and intention of passengers. The purpose of this system is to estimate the needs of passengers like station staff or hotel concierge and to provide information resources that satisfy user’s expectations dynamically. The most important module of the system is constructed based on a new information ranking method for passenger intention prediction and service recommendation. This method has three main features, which are (1 projecting a user to semantic vector space by using her current context, (2 predicting the intention of a user based on selecting a semantic vector subspace, and (3 ranking the services by a descending order of relevant scores to the user’ intention. By comparing the predicted results of our method with those of two straightforward computation methods, the experimental studies show the effectiveness and efficiency of the proposed method. Using this system, users can obtain transit information and service map that dynamically matches their context.

  9. Competitive advantage and corporate communications

    Directory of Open Access Journals (Sweden)

    Mitić Sanja

    2013-01-01

    Full Text Available Strategic importance of corporate communications and its role in the development of competitive advantage has attracted interest of numerous researchers in the fields of organization, management, marketing and public relations. Recent studies particularly emphasise the growing importance of soft factors, such as reputation in the development of competitive advantage. Concept of reputation is strongly connected with stakeholder theory, which stresses the importance of corporate communications for competitive advantage of firms. The paper focuses on competitive advantage and the link among strategy, reputation and corporate communications.

  10. Strategic advantages of high-rise construction

    Directory of Open Access Journals (Sweden)

    Yaskova Natalya

    2018-01-01

    Full Text Available Traditional methods to assess the competitiveness of different types of real estate in the context of huge changes of new technological way of life don’t provide building solutions that would be correct from a strategic perspective. There are many challenges due to changes in the consumers’ behavior in the housing area. A multiplicity of life models, a variety of opportunities and priorities, traditions and new trends in construction should be assessed in terms of prospective benefits in the environment of the emerging new world order. At the same time, the mane discourse of high-rise construction mainly relates to its design features, technical innovations, and architectural accents. We need to clarify the criteria for economic evaluation of high-rise construction in order to provide decisions with clear and quantifiable contexts. The suggested approach to assessing the strategic advantage of high-rise construction and the prospects for capitalization of high-rise buildings poses new challenges for the economy to identify adequate quantitative assessment methods of the high-rise buildings economic efficiency, taking into account all stages of their life cycle.

  11. Strategic advantages of high-rise construction

    Science.gov (United States)

    Yaskova, Natalya

    2018-03-01

    Traditional methods to assess the competitiveness of different types of real estate in the context of huge changes of new technological way of life don't provide building solutions that would be correct from a strategic perspective. There are many challenges due to changes in the consumers' behavior in the housing area. A multiplicity of life models, a variety of opportunities and priorities, traditions and new trends in construction should be assessed in terms of prospective benefits in the environment of the emerging new world order. At the same time, the mane discourse of high-rise construction mainly relates to its design features, technical innovations, and architectural accents. We need to clarify the criteria for economic evaluation of high-rise construction in order to provide decisions with clear and quantifiable contexts. The suggested approach to assessing the strategic advantage of high-rise construction and the prospects for capitalization of high-rise buildings poses new challenges for the economy to identify adequate quantitative assessment methods of the high-rise buildings economic efficiency, taking into account all stages of their life cycle.

  12. Behavioural responses to hypoxia provide a non-invasive method for distinguishing between stress coping styles in fish

    DEFF Research Database (Denmark)

    Laursen, Danielle Caroline; Olsén, Hanna L.; Ruiz-Gomez, Maria de Lourdes

    2011-01-01

    . These individual differences may result in suboptimal production and compromised welfare in aquaculture. An approach to overcome these problems could be to sort fish and optimise rearing conditions according to coping style. It has been previously demonstrated that the proactive and reactive coping styles in fish......, these fish provided an opportunity for verifying a method for sorting fish with respect to coping style by exposure to hypoxia. Groups consisting of 24 individually tagged fish, 12 HR and 12 LR were exposed to hypoxia in a two choice system. The system consisted of a “home” tank provided with cover connected...... to a second brightly “illuminated” tank via a closable doorway. During the experiment, the doorway between the two tanks was opened and hypoxic conditions were gradually induced in the “home” tank by bubbling with nitrogen. The latency time to move away from hypoxic conditions to normoxic conditions...

  13. The paradox of compassionate work: a mixed-methods study of satisfying and fatiguing experiences of animal health care providers.

    Science.gov (United States)

    Polachek, Alicia J; Wallace, Jean E

    2018-03-01

    Compassionate work appears paradoxical as it may provide great rewards, but may also come at great costs to care providers. This paper explores the paradox of compassionate work by examining what interactions contribute to compassion satisfaction and what interactions contribute to compassion fatigue. This mixed-methods, cross-sectional study uses qualitative interview data from animal health care providers (N = 20) to identify work interactions that they find satisfying or stressful. Quantitative survey data (N = 572) are used to test hypotheses generated from the interviews regarding predictors of compassion satisfaction and compassion fatigue. Interview transcripts were analyzed using a directed content analysis approach. Survey data were analyzed using ordinary least squares regression. The results highlight the complex nature of compassionate work. As hypothesized, making a difference to animals and building relationships with animal patients and human clients relate to greater compassion satisfaction. Human client barriers to animal care and witnessing client grief relate to greater compassion fatigue, as predicted. None of the predictors relate to less compassion fatigue, but forming relationships with animal patients relates to both greater compassion satisfaction and compassion fatigue. This paper enhances our understanding of provider-client-patient interactions and highlights the paradox of compassionate work.

  14. runjags: An R Package Providing Interface Utilities, Model Templates, Parallel Computing Methods and Additional Distributions for MCMC Models in JAGS

    Directory of Open Access Journals (Sweden)

    Matthew J. Denwood

    2016-07-01

    Full Text Available The runjags package provides a set of interface functions to facilitate running Markov chain Monte Carlo models in JAGS from within R. Automated calculation of appropriate convergence and sample length diagnostics, user-friendly access to commonly used graphical outputs and summary statistics, and parallelized methods of running JAGS are provided. Template model specifications can be generated using a standard lme4-style formula interface to assist users less familiar with the BUGS syntax. Automated simulation study functions are implemented to facilitate model performance assessment, as well as drop-k type cross-validation studies, using high performance computing clusters such as those provided by parallel. A module extension for JAGS is also included within runjags, providing the Pareto family of distributions and a series of minimally-informative priors including the DuMouchel and half-Cauchy priors. This paper outlines the primary functions of this package, and gives an illustration of a simulation study to assess the sensitivity of two equivalent model formulations to different prior distributions.

  15. DETECTION OF REPORTS FALSIFICATION PROVIDED TO A BANK BY A BORROWER USING THE METHOD OF DYNAMIC PARAMETERS ANALYSIS

    Directory of Open Access Journals (Sweden)

    M. S. Lyuft

    2015-01-01

    Full Text Available Summary. The main stop-factors in a landing were formed in the article according to the procedure of the European Bank for Reconstruction and Development by the means of questioning the leading Russian banks that finance small-scale business. It is given the description of this method, also it is identified the main weaknesses of the EBRD methodology. There is a description of the main methods of the borrowing company’s analytical balance and thereupon it is made the conclusion about the necessity of the analysis of the balance’s principal factors across time. The analysis of indicators and factors in the dynamics enables us to see trends in the development of the company, and to identify deviations in the coefficients. Either materiality or difference from normal values of these coefficients may indicate the factors of the borrowers’ misconduct, and in particular it gives evidence concerning falsification of reports provided to a bank. There are stages of information processing for falsification’s detection, excluding the interest from decision-makers about the possibility of lending in the results of a transaction. The formula that determinates the value of net profit falsification has been made on basis of dynamic parameters of the analytical balance and the connection with the administrative profit-and-loss report. Further, the article provides the second method of a determination of the net profit falsification already based on data of the parameters in dynamics namely business profitability rate. The process of calculation Payment To Income - payment to income - an indicator, in order to obtain good data on who falsify net income. Are key strengths of this method of identifying and conclusions paragraph article.

  16. Digital photography provides a fast, reliable, and noninvasive method to estimate anthocyanin pigment concentration in reproductive and vegetative plant tissues.

    Science.gov (United States)

    Del Valle, José C; Gallardo-López, Antonio; Buide, Mª Luisa; Whittall, Justen B; Narbona, Eduardo

    2018-03-01

    Anthocyanin pigments have become a model trait for evolutionary ecology as they often provide adaptive benefits for plants. Anthocyanins have been traditionally quantified biochemically or more recently using spectral reflectance. However, both methods require destructive sampling and can be labor intensive and challenging with small samples. Recent advances in digital photography and image processing make it the method of choice for measuring color in the wild. Here, we use digital images as a quick, noninvasive method to estimate relative anthocyanin concentrations in species exhibiting color variation. Using a consumer-level digital camera and a free image processing toolbox, we extracted RGB values from digital images to generate color indices. We tested petals, stems, pedicels, and calyces of six species, which contain different types of anthocyanin pigments and exhibit different pigmentation patterns. Color indices were assessed by their correlation to biochemically determined anthocyanin concentrations. For comparison, we also calculated color indices from spectral reflectance and tested the correlation with anthocyanin concentration. Indices perform differently depending on the nature of the color variation. For both digital images and spectral reflectance, the most accurate estimates of anthocyanin concentration emerge from anthocyanin content-chroma ratio, anthocyanin content-chroma basic, and strength of green indices. Color indices derived from both digital images and spectral reflectance strongly correlate with biochemically determined anthocyanin concentration; however, the estimates from digital images performed better than spectral reflectance in terms of r 2 and normalized root-mean-square error. This was particularly noticeable in a species with striped petals, but in the case of striped calyces, both methods showed a comparable relationship with anthocyanin concentration. Using digital images brings new opportunities to accurately quantify the

  17. Development of quality indicators for low-risk labor care provided by midwives using a RAND-modified Delphi method.

    Science.gov (United States)

    Ueda, Kayo; Ohtera, Shosuke; Kaso, Misato; Nakayama, Takeo

    2017-09-22

    In childbirth, most deliveries are low-risk, defined as spontaneous labor at full term without special high-risk facts or complications, especially in high-resource countries where maternal and perinatal mortality rates are very low. Indeed, the majority of mothers and infants have no serious conditions during labor. However, the quality of care provided is not assured, and performance may vary by birthing facility and provider. The overuse of technology in childbirth in some parts of the world is almost certainly based on assumptions like, "something can go wrong at any minute." There is a need to assess the quality of care provided for mothers and infants in low-risk labor. We aimed to develop specific quality indicators for low-risk labor care provided primarily by midwives in Japan. We used a RAND-modified Delphi method, which integrates evidence review with expert consensus development. The procedure comprises five steps: (1) literature review, including clinical practice guidelines, to extract and develop quality indicator candidates; (2) formation of a multidisciplinary panel; (3) independent panel ratings (Round 1); (4) panel meeting and independent panel ratings (Round 2); and (5) independent panel ratings (Round 3). The three independent panel ratings (Rounds 1-3) were held between July and December 2012. The assembled multidisciplinary panel comprised eight clinicians (two pediatricians, three obstetricians, and three midwives) and three mothers who were nonclinicians. Evidentiary review extracted 166 key recommendations from 32 clinical practice guidelines, and 31 existing quality indicators were added. After excluding duplicate recommendations and quality indicators, the panel discussed 25 candidate indicators. Of these, 18 were adopted, one was modified, six were not adopted, and four were added during the meeting, respectively. We established 23 quality indicators for low-risk labor care provided by midwives in labor units in Japan.

  18. A mixed-methods examination of communication between oncologists and primary care providers among primary care physicians in underserved communities.

    Science.gov (United States)

    Shen, Megan Johnson; Binz-Scharf, Maria; D'Agostino, Tom; Blakeney, Natasha; Weiss, Elisa; Michaels, Margo; Patel, Shilpa; McKee, M Diane; Bylund, Carma L

    2015-03-15

    Research has demonstrated that communication and care coordination improve cancer patient outcomes. To improve communication and care coordination, it is important to understand primary care providers' (PCPs') perceptions of communication with oncologists as well as PCPs' communication needs. A mixed-methods approach was used in the present study. In the qualitative phase of the study, 18 PCPs practicing in underserved, minority communities were interviewed about their experiences communicating with oncologists. In the quantitative phase of the study, 128 PCPs completed an online survey about their preferences, experiences, and satisfaction with communication with oncologists. Results indicated a PCP-oncologist gap in communication occurred between diagnosis and treatment. PCPs wanted more communication with oncologists, updates on their patients' prognosis throughout treatment, and to be contacted via telephone or email and saw their role as crucial in providing supportive care for their patients. Although PCPs recognize that they play a critical, proactive role in supporting patients throughout the continuum of their cancer care experience, existing norms regarding postreferral engagement and oncologist-PCP communication often hinder activation of this role among PCPs. Expected standards regarding the method, frequency, and quality of postreferral communication should be jointly articulated and made accountable between PCPs and oncologists to help improve cancer patients' quality of care, particularly in minority communities. © 2014 American Cancer Society.

  19. Advantaged Bidders in Franchise Auctions

    OpenAIRE

    van den Berg, V.A.C.

    2012-01-01

    Consider a government that auctions a franchise for, e.g., an airport, telecommunication network, or utility. Consider an 'incumbent bidder' that owns a complement or substitute. With an auction on the transfer (i.e. payment) to the government, the incumbent is advantaged.If the government regulates the market with an auction on the price asked to consumers, it depends who is advantaged. With complements, the incumbent is advantaged: it can set a lower price on the new franchise, as this inc...

  20. Logistics potentials in business competitive advantage creation

    Directory of Open Access Journals (Sweden)

    Rafał Matwiejczuk

    2013-12-01

    Full Text Available Background: Companies constantly search for ways to achieve and sustain long-term competitive advantage. Among the factors influencing the competitive advantage creation there are so called logistics potentials, which constitute a component part of a business strategic potentials. Logistics resources, logistics capabilities and logistics competences are the main components of the logistics potentials structure and hierarchy. Methods: In order to recognize the logistics potentials which determine the competitive advantage creation one may use the assumptions and elements of contemporary management concepts, including strategic management. In particular the article deals with Resource-Based View (RBV, Dynamic Capabilities Concept (DCC and - first of all - Competence-Based Management (CBM. Results and conclusions: Several significant research projects have presented a wide scope and a large number of possibilities of logistics potentials (and logistics competences in particular influence on business competitive advantage creation. The article briefly presents the research results conducted by: (1 Michigan State University (USA, (2 European Logistics Association (ELA in cooperation with A.T. Kearney, (3 Computer Sciences Corporation and (4 Capgemini. The research results have pointed out to differentiated but at the same distinctive symptoms of logistics competences influence on competitive advantage creation. The article also refers to the results of the research carried out by the Chair of Logistics & Marketing at Opole University (Poland in companies operating in Poland. The research has been mainly dealing with the significance of logistics competences in competitive advantage creation.

  1. Family building using embryo adoption: relationships and contact arrangements between provider and recipient families-a mixed-methods study.

    Science.gov (United States)

    Frith, Lucy; Blyth, Eric; Lui, Steve

    2017-05-01

    What contact arrangements are established between providers and recipients of embryos using Snowflakes® Embryo Adoption Program? Contact arrangements varied considerably and were generally positively described, although some challenges were acknowledged. Reproductive technologies create new and diverse family forms, and the ways in which families created by embryo adoption are negotiated in practice have not been extensively investigated. This exploratory, mixed-methods study had two phases: (i) an online survey (open May-September 2013) and (ii) qualitative semi-structured interviews by email (conducted between 2014 and 2015), exploring participants' experiences of contact with their embryo provider or recipient. Phase I included 17 providers (14 women and 3 men) and 28 recipients (27 women and 1 man). Phase II included 8 providers (5 women and 3 men) and 12 recipients (10 women and 2 men). All participants, except one, were located in the US. This study illustrates how embryo adoption in the US, as a form of conditional donation, can operate and how the participants define and negotiate these emerging relationships. All families were open with their children about how they were conceived and early contact between recipients and providers (frequently before birth) was valued. On the whole, participants were happy with the amount and type of contact they had, and where the current contact did not involve the children, it was seen as a way of keeping the channels open for future contact when the children were older. Participants often portrayed the opportunities for contact as being in the best interests of the child. The study participants are a particular group who had chosen to either receive or give their embryos via a conditional embryo adoption agency in the US and had established contact. Therefore, this is not a representative sample of those who provide or receive embryos for family building. This embryo adoption model clearly fulfils a need; some people

  2. Innovation strategies and competitive advantage

    OpenAIRE

    Gërguri, Shqipe; Rexhepi, Gadaf; Ramadani, Veland

    2013-01-01

    Companies today operate in a very dynamic, uncertain and competitive environment. They compete in "nicety" that are so small but so important. Companies are trying to achieve competitive advantage in order to help them obtain a better and a stable position in the marketplace. The best way for companies to achieve a competitive advantage is through innovation. This paper addresses the meaning of innovation what does innovation present, types of innovation specifically discussing the right way ...

  3. Perceived versus Actual Competitive Advantage

    OpenAIRE

    Langemeier, Michael R.; Yeager, Elizabeth

    2014-01-01

    This paper examined the relationship between farm characteristics and perceived sources of competitive advantage, and cost-based and revenue-based efficiency indices. Gross farm income and the percentage of labor devoted to crop production were significant and positively correlated with cost and revenue efficiency while the perception of the cowherd being the most important part of the operation was negatively correlated with efficiency. In general, perceived sources of competitive advantage ...

  4. Competitive advantage and corporate communications

    OpenAIRE

    Mitić Sanja; Ognjanov Galjina

    2013-01-01

    Strategic importance of corporate communications and its role in the development of competitive advantage has attracted interest of numerous researchers in the fields of organization, management, marketing and public relations. Recent studies particularly emphasise the growing importance of soft factors, such as reputation in the development of competitive advantage. Concept of reputation is strongly connected with stakeholder theory, which stresses the importance of corporate communications ...

  5. STRATEGIES FOR ACHIEVING COMPETITIVE ADVANTAGE

    OpenAIRE

    Jusuf ZEKIRI; Alexandru NEDELEA

    2011-01-01

    This paper is organized in three parts. A brief overview of the importance of strategies within companies, as well as literature review is presented along with traditional approaches on strategies for achieving competitive advantage, and new approaches for gaining a competitive advantage. The main objective of the paper is to outline and discuss the relevant issues and challenges from a theoretical viewpoint related with the possible strategy formulation of companies in order to achieve a com...

  6. Corporate Finance and Comparative Advantage

    OpenAIRE

    Peter Egger; Christian Keuschnigg

    2009-01-01

    Since innovative firms are often financially constrained, access to external funds is important for the expansion of innovative industries. This paper reports four important results. First, comparative advantage is shaped by factor endowments as well as fundamental determinants of corporate finance. In particular, a larger equity ratio of firms and tough governance standards relax finance constraints and create a comparative advantage in innovative industries. Second, factor price equalizatio...

  7. An analytical solution of Richards' equation providing the physical basis of SCS curve number method and its proportionality relationship

    Science.gov (United States)

    Hooshyar, Milad; Wang, Dingbao

    2016-08-01

    The empirical proportionality relationship, which indicates that the ratio of cumulative surface runoff and infiltration to their corresponding potentials are equal, is the basis of the extensively used Soil Conservation Service Curve Number (SCS-CN) method. The objective of this paper is to provide the physical basis of the SCS-CN method and its proportionality hypothesis from the infiltration excess runoff generation perspective. To achieve this purpose, an analytical solution of Richards' equation is derived for ponded infiltration in shallow water table environment under the following boundary conditions: (1) the soil is saturated at the land surface; and (2) there is a no-flux boundary which moves downward. The solution is established based on the assumptions of negligible gravitational effect, constant soil water diffusivity, and hydrostatic soil moisture profile between the no-flux boundary and water table. Based on the derived analytical solution, the proportionality hypothesis is a reasonable approximation for rainfall partitioning at the early stage of ponded infiltration in areas with a shallow water table for coarse textured soils.

  8. Evaluating the impact of healthcare provider training to improve tuberculosis management: a systematic review of methods and outcome indicators used.

    Science.gov (United States)

    Wu, Shishi; Roychowdhury, Imara; Khan, Mishal

    2017-03-01

    Developing human resources capacity is vital for tuberculosis (TB) control in low- and middle-income countries. Although investments in TB healthcare provider (HCP) training programmes have increased, it is unclear whether these are robustly evaluated. The objective of this systematic review was to synthesize the methods and outcome indicators used to assess TB HCP training programmes. A systematic scoping review of publications reporting on evaluations of training programmes for TB HCPs - including doctors, nurses, paramedics, and lay health workers - was conducted through a search in three electronic databases, Google Scholar, and five websites of non-profit organizations. Data on the study location, population trained, outcomes assessed, and evaluation approach were extracted. After screening 499 unique publications, 21 were eligible for inclusion in the analysis. The majority of evaluations were conducted in Africa. The most common evaluation methods were a review of patient records (n=8, 38%) and post-training interview with trainees (n=7, 33%). In terms of outcomes, more than half of the studies (n=12, 57%) evaluated knowledge acquisition of trainees, with only six (29%) assessing on-the-job behaviour change. Even though more funds have been invested in TB HCP training, publications from robust evaluations assessing the impact on quality of care and behaviour change are limited. Copyright © 2016. Published by Elsevier Ltd.

  9. Team dynamics, clinical work satisfaction, and patient care coordination between primary care providers: A mixed methods study.

    Science.gov (United States)

    Song, Hummy; Ryan, Molly; Tendulkar, Shalini; Fisher, Josephine; Martin, Julia; Peters, Antoinette S; Frolkis, Joseph P; Rosenthal, Meredith B; Chien, Alyna T; Singer, Sara J

    Team-based care is essential for delivering high-quality, comprehensive, and coordinated care. Despite considerable research about the effects of team-based care on patient outcomes, few studies have examined how team dynamics relate to provider outcomes. The aim of this study was to examine relationships among team dynamics, primary care provider (PCP) clinical work satisfaction, and patient care coordination between PCPs in 18 Harvard-affiliated primary care practices participating in Harvard's Academic Innovations Collaborative. First, we administered a cross-sectional survey to all 548 PCPs (267 attending clinicians, 281 resident physicians) working at participating practices; 65% responded. We assessed the relationship of team dynamics with PCPs' clinical work satisfaction and perception of patient care coordination between PCPs, respectively, and the potential mediating effect of patient care coordination on the relationship between team dynamics and work satisfaction. In addition, we embedded a qualitative evaluation within the quantitative evaluation to achieve a convergent mixed methods design to help us better understand our findings and illuminate relationships among key variables. Better team dynamics were positively associated with clinical work satisfaction and quality of patient care coordination between PCPs. Coordination partially mediated the relationship between team dynamics and satisfaction for attending clinicians, suggesting that higher satisfaction depends, in part, on better teamwork, yielding more coordinated patient care. We found no mediating effects for resident physicians. Qualitative results suggest that sources of satisfaction from positive team dynamics for PCPs may be most relevant to attending clinicians. Improving primary care team dynamics could improve clinical work satisfaction among PCPs and patient care coordination between PCPs. In addition to improving outcomes that directly concern health care providers, efforts to

  10. Advantages of high-dose rate (HDR) brachytherapy in treatment of prostate cancer

    Science.gov (United States)

    Molokov, A. A.; Vanina, E. A.; Tseluyko, S. S.

    2017-09-01

    One of the modern methods of preserving organs radiation treatment is brachytherapy. This article analyzes the results of prostate brachytherapy. These studies of the advantages of high dose brachytherapy lead to the conclusion that this method of radiation treatment for prostate cancer has a favorable advantage in comparison with remote sensing methods, and is competitive, preserving organs in comparison to surgical methods of treatment. The use of the method of polyfocal transperineal biopsy during the brachytherapy session provides information on the volumetric spread of prostate cancer and adjust the dosimetry plan taking into account the obtained data.

  11. Online Shopping: Advantages over the Offline Alternative

    OpenAIRE

    Dr Joshua Chang

    2003-01-01

    The advent of the Internet as a shopping medium has enabled shoppers to gain shopping benefits such as convenience and time-saving, better information, and price savings. This paper aims to provide a better understanding of the benefits of Internet shopping by identifying and discussing the advantages of Internet shopping over traditional storefront shopping.

  12. [The advantage of multidisciplinary treatment of presbycusis].

    Science.gov (United States)

    Bouccara, Didier; Madjlessi, Arach; Mosnier, Isabelle

    2010-01-01

    Attributable to the ageing of the hearing system, presbycusis presents a wide variability in the general population. Early detection is necessary in order to be able to provide the patient with a suitable hearing aid. Collaboration between otolaryngologists and geriatricians proves to be advantageous as a consultation for a memory complaint may be the opportunity to detect presbycusis and vice versa.

  13. How Successful Is Medicare Advantage?

    Science.gov (United States)

    Newhouse, Joseph P; McGuire, Thomas G

    2014-01-01

    Context Medicare Part C, or Medicare Advantage (MA), now almost 30 years old, has generally been viewed as a policy disappointment. Enrollment has vacillated but has never come close to the penetration of managed care plans in the commercial insurance market or in Medicaid, and because of payment policy decisions and selection, the MA program is viewed as having added to cost rather than saving funds for the Medicare program. Recent changes in Medicare policy, including improved risk adjustment, however, may have changed this picture. Methods This article summarizes findings from our group's work evaluating MA's recent performance and investigating payment options for improving its performance even more. We studied the behavior of both beneficiaries and plans, as well as the effects of Medicare policy. Findings Beneficiaries make “mistakes” in their choice of MA plan options that can be explained by behavioral economics. Few beneficiaries make an active choice after they enroll in Medicare. The high prevalence of “zero-premium” plans signals inefficiency in plan design and in the market's functioning. That is, Medicare premium policies interfere with economically efficient choices. The adverse selection problem, in which healthier, lower-cost beneficiaries tend to join MA, appears much diminished. The available measures, while limited, suggest that, on average, MA plans offer care of equal or higher quality and for less cost than traditional Medicare (TM). In counties, greater MA penetration appears to improve TM's performance. Conclusions Medicare policies regarding lock-in provisions and risk adjustment that were adopted in the mid-2000s have mitigated the adverse selection problem previously plaguing MA. On average, MA plans appear to offer higher value than TM, and positive spillovers from MA into TM imply that reimbursement should not necessarily be neutral. Policy changes in Medicare that reform the way that beneficiaries are charged for MA plan

  14. ELECTRONIC BANKING ADVANTAGES FOR FINANCIAL SERVICES DELIVERY

    Directory of Open Access Journals (Sweden)

    Paun Dragos

    2010-12-01

    Full Text Available E-banking is a fully automatic service for traditionally banking customers products based on information technology platforms. E-banking services provide customer access to accounts, the ability to move their money between different accounts or making payments via e-channels. The advantages generated by this services have determined an accelerate developing of this industry over the entire world. This paper examines some of the advantages of electronic banking products together with the characteristic management issues generated by the implementation of this new channel for financial services delivery.

  15. Evidence-based practice beliefs and behaviors of nurses providing cancer pain management: a mixed-methods approach.

    Science.gov (United States)

    Eaton, Linda H; Meins, Alexa R; Mitchell, Pamela H; Voss, Joachim; Doorenbos, Ardith Z

    2015-03-01

    To describe evidence-based practice (EBP) beliefs and behaviors of nurses who provide cancer pain management. Descriptive, cross-sectional with a mixed-methods approach. Two inpatient oncology units in the Pacific Northwest. 40 RNs.
 Data collected by interviews and web-based surveys. EBP beliefs, EBP implementation, evidence-based pain management. Nurses agreed with the positive aspects of EBP and their implementation ability, although implementation level was low. They were satisfied with their pain management practices. Oncology nursing certification was associated with innovativeness, and innovativeness was associated with EBP beliefs. Themes identified were (a) limited definition of EBP, (b) varied evidence-based pain management decision making, (c) limited identification of evidence-based pain management practices, and (d) integration of nonpharmacologic interventions into patient care. Nurses' low level of EBP implementation in the context of pain management was explained by their trust that standards of care and medical orders were evidence-based. Nurses' EBP beliefs and behaviors should be considered when developing strategies for sustaining evidence-based pain management practices. Implementation of the EBP process by nurses may not be realistic in the inpatient setting; therefore, hospital pain management policies need to be evidence-based and reinforced with nurses.

  16. Ultrasound-assisted phase-transfer catalysis method in an aqueous medium to promote the Knoevenagel reaction: advantages over the conventional and microwave-assisted solvent-free/catalyst-free method.

    Science.gov (United States)

    De-la-Torre, Pedro; Osorio, Edison; Alzate-Morales, Jans H; Caballero, Julio; Trilleras, Jorge; Astudillo-Saavedra, Luis; Brito, Iván; Cárdenas, Alejandro; Quiroga, Jairo; Gutiérrez, Margarita

    2014-09-01

    Given the broad spectrum of uses of acrylonitrile derivatives as fluorescent probes, AChE inhibitors, and others, it is necessary to find easy, efficient and simple methods to synthesize and diversify these compounds. We report the results of a comparative study of the effects of three techniques on the reactions between heterocyclic aldehydes and 2-(benzo[d]thiazol-2-yl)acetonitrile: stirring; ultrasound coupled to PTC conditions (US-PTC); and MW irradiation (MWI) under solvent and catalyst-free conditions. The effects of conditions on reaction parameters were evaluated and compared in terms of reaction time, yield, purity and outcomes. The US-PTC method is more efficient than the MWI and conventional methods. The reaction times were considerably shorter, with high yields (>90%) and good levels of purity. In addition, X-ray diffraction analysis and quantum mechanical calculations, at the level of density functional theory (DFT), ratify obtaining acrylonitrile isomers with E configurations. The crystal structure of 3c is stabilized by weak C-Ho⋯N intermolecular interactions (Ho⋯NC=2.45 Å, Co⋯NC=3.348(3) Å, Ho⋯NC=162°), forming centrosymmetric ring R2(2) (20) along the crystallographic a axis. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Energy Advantages for Green Schools

    Science.gov (United States)

    Griffin, J. Tim

    2012-01-01

    Because of many advantages associated with central utility systems, school campuses, from large universities to elementary schools, have used district energy for decades. District energy facilities enable thermal and electric utilities to be generated with greater efficiency and higher system reliability, while requiring fewer maintenance and…

  18. Competitive Intelligence and Social Advantage.

    Science.gov (United States)

    Davenport, Elisabeth; Cronin, Blaise

    1994-01-01

    Presents an overview of issues concerning civilian competitive intelligence (CI). Topics discussed include competitive advantage in academic and research environments; public domain information and libraries; covert and overt competitive intelligence; data diversity; use of the Internet; cooperative intelligence; and implications for library and…

  19. Advertising Dynamics and Competitive Advantage

    OpenAIRE

    Ulrich Doraszelski; Sarit Markovich

    2004-01-01

    Can advertising lead to a sustainable competitive advantage? To answer this question, we propose a dynamic model of advertising competition where firms repeatedly advertise, compete in the product market, and make entry as well as exit decisions. Within this dynamic framework, we study two different models of advertising: In the first model, advertising influences the goodwill consumers extend towards a firm ("goodwill advertising"), whereas in the second model it influences the share of cons...

  20. Interest alignment and competitive advantage

    OpenAIRE

    Gottschalg, Oliver; Zollo, Mauricio

    2006-01-01

    This paper articulates a theory of the conditions under which the alignment between individual and collective interests generates sustainable competitive advantage. The theory is based on the influence of tacitness, context-specificity and casual ambiguity in the determinants of different types of motivation (extrinsic, normative intrinsic and hedonic intrinsic), under varying conditions of environmental dynamism. The analysis indicates the need to consider mitivational processes as a complem...

  1. Provable quantum advantage in randomness processing

    OpenAIRE

    Dale, H; Jennings, D; Rudolph, T

    2015-01-01

    Quantum advantage is notoriously hard to find and even harder to prove. For example the class of functions computable with classical physics actually exactly coincides with the class computable quantum-mechanically. It is strongly believed, but not proven, that quantum computing provides exponential speed-up for a range of problems, such as factoring. Here we address a computational scenario of "randomness processing" in which quantum theory provably yields, not only resource reduction over c...

  2. Comparative advantages of mechanical biosensors.

    Science.gov (United States)

    Arlett, J L; Myers, E B; Roukes, M L

    2011-04-01

    Mechanical interactions are fundamental to biology. Mechanical forces of chemical origin determine motility and adhesion on the cellular scale, and govern transport and affinity on the molecular scale. Biological sensing in the mechanical domain provides unique opportunities to measure forces, displacements and mass changes from cellular and subcellular processes. Nanomechanical systems are particularly well matched in size with molecular interactions, and provide a basis for biological probes with single-molecule sensitivity. Here we review micro- and nanoscale biosensors, with a particular focus on fast mechanical biosensing in fluid by mass- and force-based methods, and the challenges presented by non-specific interactions. We explain the general issues that will be critical to the success of any type of next-generation mechanical biosensor, such as the need to improve intrinsic device performance, fabrication reproducibility and system integration. We also discuss the need for a greater understanding of analyte-sensor interactions on the nanoscale and of stochastic processes in the sensing environment.

  3. Size-specific dose estimate (SSDE) provides a simple method to calculate organ dose for pediatric CT examinations

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Bria M.; Brady, Samuel L., E-mail: samuel.brady@stjude.org; Kaufman, Robert A. [Department of Radiological Sciences, St Jude Children' s Research Hospital, Memphis, Tennessee 38105 (United States); Mirro, Amy E. [Department of Biomedical Engineering, Washington University, St Louis, Missouri 63130 (United States)

    2014-07-15

    Purpose: To investigate the correlation of size-specific dose estimate (SSDE) with absorbed organ dose, and to develop a simple methodology for estimating patient organ dose in a pediatric population (5–55 kg). Methods: Four physical anthropomorphic phantoms representing a range of pediatric body habitus were scanned with metal oxide semiconductor field effect transistor (MOSFET) dosimeters placed at 23 organ locations to determine absolute organ dose. Phantom absolute organ dose was divided by phantom SSDE to determine correlation between organ dose and SSDE. Organ dose correlation factors (CF{sub SSDE}{sup organ}) were then multiplied by patient-specific SSDE to estimate patient organ dose. The CF{sub SSDE}{sup organ} were used to retrospectively estimate individual organ doses from 352 chest and 241 abdominopelvic pediatric CT examinations, where mean patient weight was 22 kg ± 15 (range 5–55 kg), and mean patient age was 6 yrs ± 5 (range 4 months to 23 yrs). Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm; thus, showing appropriate scalability of the phantoms across the entire pediatric population in this study. IndividualCF{sub SSDE}{sup organ} were determined for a total of 23 organs in the chest and abdominopelvic region across nine weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7–1.4) and abdominopelvic region (average 0.9; range 0.7–1.3) was near unity. For organ/tissue that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1–0.4) for both the chest and abdominopelvic regions, respectively. A means to estimate patient organ dose was demonstrated. Calculated patient organ dose, using patient SSDE and CF{sub SSDE}{sup organ}, was compared to

  4. The Patient-Provider Relationship Is Associated with Hepatitis C Treatment Eligibility: A Prospective Mixed-Methods Cohort Study.

    Directory of Open Access Journals (Sweden)

    Shari S Rogal

    Full Text Available Hepatitis C virus (HCV treatment has the potential to cure the leading cause of cirrhosis and hepatocellular carcinoma. However, only those deemed eligible for treatment have the possibility of this cure. Therefore, understanding the determinants of HCV treatment eligibility is critical. Given that effective communication with and trust in healthcare providers significantly influences treatment eligibility decisions in other diseases, we aimed to understand patient-provider interactions in the HCV treatment eligibility process. This prospective cohort study was conducted in the VA Pittsburgh Healthcare System. Patients were recruited after referral for gastroenterology consultation for HCV treatment with interferon and ribavirin. Consented patients completed semi-structured interviews and validated measures of depression, substance and alcohol use, and HCV knowledge. Two coders analyzed the semi-structured interviews. Factors associated with patient eligibility for interferon-based therapy were assessed using multivariate logistic regression. Of 339 subjects included in this analysis, only 56 (16.5% were deemed eligible for HCV therapy by gastroenterology (GI providers. In the multivariate logistic regression, patients who were older (OR = 0.96, 95%CI = 0.92-0.99, p = .049, reported concerns about the GI provider (OR = 0.40, 95%CI = 0.10-0.87, p = 0.02 and had depression symptoms (OR = 0.32, 95%CI = 0.17-0.63, p = 0.001 were less likely to be eligible. Patients described barriers that included feeling stigmatized and poor provider interpersonal or communication skills. In conclusion, we found that patients' perceptions of the relationship with their GI providers were associated with treatment eligibility. Establishing trust and effective communication channels between patients and providers may lower barriers to potential HCV cure.

  5. BUSINESS COMPETITORS AND COMPETITIVE ADVANTAGE

    Directory of Open Access Journals (Sweden)

    SUCIU TITUS

    2013-08-01

    Full Text Available The paper presents the concept of competition, both from the perspective of the economic sector –where it is characteristic for pure monopole, oligopoly, monopole competition and pure competition, as well asfrom the market’s point of view – where it determines the strategies, objectives, advantages and weaknesses of acompany. The main point of the paper is the criticism of the pure and perfect competition theory. Concluding,the author insists on innovation, especially on the model of open innovation.

  6. Ecology. The advantages of togetherness.

    Science.gov (United States)

    Cox, E; Bonner, J

    2001-04-20

    What would be the advantage of unicellular organisms becoming multicellular? For organisms that feed on organic food (heterotrophs), the most efficient way to produce energy is to metabolize the food by aerobic respiration, but the fastest way is to metabolize it by fermentation. In their Perspective, Cox and Bonner discuss a mathematical model (Pfeiffer et al.), which shows that when these two kinds of organisms (respirators and fermenters) compete for a limited food source, the respirators manage best when they are grouped in clusters rather than remaining as separate cells. In this way, multicellularity could have originated.

  7. Advantages of computed tomographic guidance

    International Nuclear Information System (INIS)

    Casola, G.; Vansonnenberg, E.

    1987-01-01

    Both ultrasound and CT are successfully used to guide interventional procedures throughout the body. There are advantages and disadvantages to each modality and choosing one over the other will vary from case to case. Major factors influencing choice are discussed in this paper. As a general rule CT guidance is usually required for lesions in the thorax, the adrenals, the pancreas, lymph nodes, and for percutaneous abscess drainage. The authors feel that a complimentary use of ultrasound and CT is essential to optimize success and cost-effectiveness; therefore, the interventional radiologist should be familiar with both imaging modalities

  8. A Post-Final Assignment for the Methods Course: Providing an Incentive to Professional Growth for Future Teachers.

    Science.gov (United States)

    Bentley, Michael L.

    This paper describes J. Rosengren's post-final assignment and M. Harmin's truth signs activity that were incorporated into a secondary science methods course for preservice teachers. The strength of the post-final assignment is that it is a strategy for extending student learning past the end of a course and even beyond the initial teaching…

  9. New Technologies Provide Quantum Changes in the Scale, Speed, and Success of SELEX Methods and Aptamer Characterization

    Directory of Open Access Journals (Sweden)

    Abdullah Ozer

    2014-01-01

    Full Text Available Single-stranded oligonucleotide aptamers have attracted great attention in the past decade because of their diagnostic and therapeutic potential. These versatile, high affinity and specificity reagents are selected by an iterative in vitro process called SELEX, Systematic Evolution of Ligands by Exponential Enrichment. Numerous SELEX methods have been developed for aptamer selections; some that are simple and straightforward, and some that are specialized and complicated. The method of SELEX is crucial for selection of an aptamer with desired properties; however, success also depends on the starting aptamer library, the target molecule, aptamer enrichment monitoring assays, and finally, the analysis and characterization of selected aptamers. Here, we summarize key recent developments in aptamer selection methods, as well as other aspects of aptamer selection that have significant impact on the outcome. We discuss potential pitfalls and limitations in the selection process with an eye to aid researchers in the choice of a proper SELEX strategy, and we highlight areas where further developments and improvements are desired. We believe carefully designed multiplexed selection methods, when complemented with high-throughput downstream analysis and characterization assays, will yield numerous high-affinity aptamers to protein and small molecule targets, and thereby generate a vast array of reagents for probing basic biological mechanisms and implementing new diagnostic and therapeutic applications in the near future.

  10. 47 CFR 52.31 - Deployment of long-term database methods for number portability by CMRS providers.

    Science.gov (United States)

    2010-10-01

    ... require software but not hardware changes to provide portability (“Hardware Capable Switches”), within 60... queries, so that they can deliver calls from their networks to any party that has retained its number after switching from one telecommunications carrier to another. (c) [Reserved] (d) In the event a...

  11. An optical device capable of providing a structural color, and a corresponding method of manufacturing such a device

    DEFF Research Database (Denmark)

    2014-01-01

    ) with respect to the average surface positions. The position, size, and randomness of the protrusions are arranged so as to provide, at least up to a maximum angle of incidence (A_in) with respect to a normal to the surface, an angle-independent substantially homogeneous structural color perception for a normal...

  12. An overview of filtration methods that can provide protection from the macrofouling zebra mussel at hydroelectric facilities

    Energy Technology Data Exchange (ETDEWEB)

    Smythe, A.G.; Short, T.M. [Acres International Corp., Amherst, NY (United States)

    1995-12-31

    The non-indigenous freshwater zebra and quagga mussels (Dreissena, spp.) threaten to foul freshwater conduits throughout much of the United States and southern Canada. Initially, many electric facilities within the lower Great Lakes drainage were fouled. More recently, other systems both in and out of the Great Lakes, have been exposed to infested water facilitated by canals and boat traffic and impacted by the mussels. Mussels have clogged conduits and fouled equipment and monitoring sensors in relatively distant regions including the Hudson River, the Mississippi River south to New Orleans, and the Arkansas River into Oklahoma. Chemicals can effectively control the mussels, however, filtration methods promise to be a relatively cost effective, environmentally safe alternative control approach. Information on traditional filtration methods will be presented in this paper along with recent research results for in-line filters.

  13. Sustainable competitive advantage for accountable care organizations.

    Science.gov (United States)

    Macfarlane, Michael Alex

    2014-01-01

    In the current period of health industry reform, accountable care organizations (ACOs) have emerged as a new model for the delivery of high-quality and cost-effective healthcare. However, few ACOs operate in direct competition with one another, and the accountable care business model has yet to present a means of continually developing new marginal value for patients and network partners. With value-based purchasing and patient consumerism strengthening as market forces, ACOs must build organizational sustainability and competitive advantage to meet the value demands set by customers and competitors. This essay proposes a strategy, adapted from the disciplines of agile software development and Lean product development, through which ACOs can engage internal and external customers in the development of new products that will provide sustainability and competitive advantage to the organization by decreasing waste in development, promoting specialized knowledge, and closely targeting customer value.

  14. Evaluation of Effective Factors on e-Loyalty in Organizations Providing Electronic Services using Fuzzy AHP Method

    Directory of Open Access Journals (Sweden)

    fatemeh mohammadi

    2012-12-01

    Full Text Available In today's business world, proper identification of customer’s requirements and a quick response to these requirements is a key to commercial success. Increasing customer loyalty affects the profitability and organizations can ensure their long-term interests by means of planning. In today's competitive world, the services provided by the competing company have to be more similar to each other and can be hard to surprise customers within completely new service in the long term, because the newest services are quickly imitated by competitors and marketed. Hence investment in customer loyalty is an effective and profitable investment for companies. One criticism that has entered into the e-service is customer loyalty. In order to study the causes of e-loyalty for organization providing e-services, this research identified the factors affecting customer loyalty in e-services and with questionnaire prepared and by using fuzzy hierarchical decision-making process acquires the weight of each factor and ultimately rank them. The results show that the quality of service provided to e-services customers is the most important factor in creating e-loyalty.

  15. Mixed Methods Survey of Zoonotic Disease Awareness and Practice among Animal and Human Healthcare Providers in Moshi, Tanzania.

    Directory of Open Access Journals (Sweden)

    Helen L Zhang

    2016-03-01

    Full Text Available Zoonoses are common causes of human and livestock illness in Tanzania. Previous studies have shown that brucellosis, leptospirosis, and Q fever account for a large proportion of human febrile illness in northern Tanzania, yet they are infrequently diagnosed. We conducted this study to assess awareness and knowledge regarding selected zoonoses among healthcare providers in Moshi, Tanzania; to determine what diagnostic and treatment protocols are utilized; and obtain insights into contextual factors contributing to the apparent under-diagnosis of zoonoses.We conducted a questionnaire about zoonoses knowledge, case reporting, and testing with 52 human health practitioners and 10 livestock health providers. Immediately following questionnaire administration, we conducted semi-structured interviews with 60 of these respondents, using the findings of a previous fever etiology study to prompt conversation. Sixty respondents (97% had heard of brucellosis, 26 (42% leptospirosis, and 20 (32% Q fever. Animal sector respondents reported seeing cases of animal brucellosis (4, rabies (4, and anthrax (3 in the previous 12 months. Human sector respondents reported cases of human brucellosis (15, 29%, rabies (9, 18% and anthrax (6, 12%. None reported leptospirosis or Q fever cases. Nineteen respondents were aware of a local diagnostic test for human brucellosis. Reports of tests for human leptospirosis or Q fever, or for any of the study pathogens in animals, were rare. Many respondents expressed awareness of malaria over-diagnosis and zoonoses under-diagnosis, and many identified low knowledge and testing capacity as reasons for zoonoses under-diagnosis.This study revealed differences in knowledge of different zoonoses and low case report frequencies of brucellosis, leptospirosis, and Q fever. There was a lack of known diagnostic services for leptospirosis and Q fever. These findings emphasize a need for improved diagnostic capacity alongside healthcare

  16. ANALYSIS OF METHODS PROVIDING ACCURACY FOR TOOLS AND TECHNIQUES VIBRATION MEASUREMENT IN THE PROCESS OF MAINTAINING AIRWORTHINESS OF AIRCRAFT

    Directory of Open Access Journals (Sweden)

    Anatoliy Alexandrovich Bogoyavlenskiy

    2017-01-01

    Full Text Available On the basis of system approach the structure of the aviation activity areas on air transport related to monitoring and measurements of vibration parameters is presented.The technology analysis of laboratory tests of the onboard equipment control of vibration parameters is carried out. The issues related to ensuring the unity of measurements of vibration parameters are researched and summarized.While dealing with the works on metrological certification described in the article, the risks arising from aviation activity on air transport are taken into account. The certification methods of measuring channels of vibration parametersused on stands for testing GTE at the repairing of aircraft engines are developed. The methods are implemented when con- ducting initial and periodic certifications of test benches for twelve types of aircraft GTE in repair organizations. The reliability of the results of the conducted research due to the fact that they were carried out with the use of certified measure- ment equipment, included in the State register of measuring instruments. The research is conducted for a sufficiently high statistical confidence level with the boundaries 0.95. The studies have shown that running on air transport measurements of vibration parameters are metrologically se- cured, the unity of measurements and their traceability from the national primary reference to special measuring instru- ments, test equipment, and onboard controls of the aircraft is maintained.

  17. Parenting Advantage in the MNC

    DEFF Research Database (Denmark)

    Nell, Phillip C.; Ambos, Björn

    2013-01-01

    subsidiaries located in Europe. Our results indicate that the external embeddedness of the MNC is an antecedent to headquarters' value creation. We find that headquarters' investments into their own relationships with the subsidiaries' contexts are positively related to the value added by headquarters....... Furthermore, this relationship is stronger when the subsidiary itself is strongly embedded. We discuss implications for the MNC literature, embeddedness research, and the literature on parenting and headquarters' roles......What determines the value an MNC's headquarters adds to its own affiliates? In this paper, we shed light on this question by linking the embeddedness view of the multinational corporation to the literature on parenting advantage. We test our hypotheses on an original dataset of 124 manufacturing...

  18. Nuclear energy. Risk or advantage

    International Nuclear Information System (INIS)

    Boettiger, Helmut

    2011-01-01

    Nuclear energy is controversial. But what's all about really in the controversy? It's about more than safty or electricity prices. Nuclear energy is not only a technical or political question, but also a moral, a human. The discussion enter various rational and irrational arguments, beside straightforward arguments various misleading and mendacious exist. The present publication is comprehensively dedicated to the thema of nuclear energy - its pro and contra - and considers its risks and advantages. Thereby the sources of energy, the processes in the nuclear reactor, and the risk potentials (Harrisburg, Chernobyl, Fukushima) are illustratively and reproducibly presented. Extensively the text explains the forms of the radiation, its doses, and the tolerance of it. Also to the theme waste and final disposal an explaining chapter is dedicated and the question for the exit from nuclear energy elucidated. Finally the author appoints with the question ''How considers mankind nuclear energy world-wide'' the international comparison.

  19. Marketing channels and competitive advantage

    Directory of Open Access Journals (Sweden)

    Jovičić Dragoljub

    2005-01-01

    Full Text Available Issue that can already be seen and will be very clear in the future is that the central problem in the market of tube caps will not be the product or the price or promotion, but marketing channels. Therefore, the competitive advantage will most probably be built on marketing channels and not the production - as it has been so far, so, the questions of choice functioning and modification of marketing channels, as well as selection of the most appropriate members of channels will become more and more important. Accordingly, it may freely be said that the choice, i.e. the movement of marketing channels represents one of the strategic decisions which has to be made by a company management and which will subsequently very significantly influence the functioning and efficacy of not only the system of distribution, but also the entire business transactions.

  20. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group.

    Directory of Open Access Journals (Sweden)

    Tiago R Simões

    Full Text Available Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes that radiated during the Late Cretaceous (95-66 million years ago. They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus.

  1. Mosasauroid phylogeny under multiple phylogenetic methods provides new insights on the evolution of aquatic adaptations in the group

    Science.gov (United States)

    Vernygora, Oksana; Paparella, Ilaria; Jimenez-Huidobro, Paulina; Caldwell, Michael W.

    2017-01-01

    Mosasauroids were a successful lineage of squamate reptiles (lizards and snakes) that radiated during the Late Cretaceous (95–66 million years ago). They can be considered one of the few lineages in the evolutionary history of tetrapods to have acquired a fully aquatic lifestyle, similarly to whales, ichthyosaurs and plesiosaurs. Despite a long history of research on this group, their phylogenetic relationships have only been tested so far using traditional (unweighted) maximum parsimony. However, hypotheses of mosasauroid relationships and the recently proposed multiple origins of aquatically adapted pelvic and pedal features in this group can be more thoroughly tested by methods that take into account variation in branch lengths and evolutionary rates. In this study, we present the first mosasauroid phylogenetic analysis performed under different analytical methods, including maximum likelihood, Bayesian inference, and implied weighting maximum parsimony. The results indicate a lack of congruence in the topological position of halisaurines and Dallasaurus. Additionally, the genus Prognathodon is paraphyletic under all hypotheses. Interestingly, a number of traditional mosasauroid clades become weakly supported, or unresolved, under Bayesian analyses. The reduced resolutions in some consensus trees create ambiguities concerning the evolution of fully aquatic pelvic/pedal conditions under many analyses. However, when enough resolution was obtained, reversals of the pelvic/pedal conditions were favoured by parsimony and likelihood ancestral state reconstructions instead of independent origins of aquatic features in mosasauroids. It is concluded that most of the observed discrepancies among the results can be associated with different analytical procedures, but also due to limited postcranial data on halisaurines, yaguarasaurines and Dallasaurus. PMID:28467456

  2. Leveraging long read sequencing from a single individual to provide a comprehensive resource for benchmarking variant calling methods.

    Science.gov (United States)

    Mu, John C; Tootoonchi Afshar, Pegah; Mohiyuddin, Marghoob; Chen, Xi; Li, Jian; Bani Asadi, Narges; Gerstein, Mark B; Wong, Wing H; Lam, Hugo Y K

    2015-09-28

    A high-confidence, comprehensive human variant set is critical in assessing accuracy of sequencing algorithms, which are crucial in precision medicine based on high-throughput sequencing. Although recent works have attempted to provide such a resource, they still do not encompass all major types of variants including structural variants (SVs). Thus, we leveraged the massive high-quality Sanger sequences from the HuRef genome to construct by far the most comprehensive gold set of a single individual, which was cross validated with deep Illumina sequencing, population datasets, and well-established algorithms. It was a necessary effort to completely reanalyze the HuRef genome as its previously published variants were mostly reported five years ago, suffering from compatibility, organization, and accuracy issues that prevent their direct use in benchmarking. Our extensive analysis and validation resulted in a gold set with high specificity and sensitivity. In contrast to the current gold sets of the NA12878 or HS1011 genomes, our gold set is the first that includes small variants, deletion SVs and insertion SVs up to a hundred thousand base-pairs. We demonstrate the utility of our HuRef gold set to benchmark several published SV detection tools.

  3. 24 CFR 1000.54 - What procedures apply to complaints arising out of any of the methods of providing for Indian...

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false What procedures apply to complaints arising out of any of the methods of providing for Indian preference? 1000.54 Section 1000.54 Housing and... ACTIVITIES General § 1000.54 What procedures apply to complaints arising out of any of the methods of...

  4. Evolutionary advantages of adaptive rewarding

    International Nuclear Information System (INIS)

    Szolnoki, Attila; Perc, Matjaž

    2012-01-01

    Our well-being depends on both our personal success and the success of our society. The realization of this fact makes cooperation an essential trait. Experiments have shown that rewards can elevate our readiness to cooperate, but since giving a reward inevitably entails paying a cost for it, the emergence and stability of such behavior remains elusive. Here we show that allowing for the act of rewarding to self-organize in dependence on the success of cooperation creates several evolutionary advantages that instill new ways through which collaborative efforts are promoted. Ranging from indirect territorial battle to the spontaneous emergence and destruction of coexistence, phase diagrams and the underlying spatial patterns reveal fascinatingly rich social dynamics that explain why this costly behavior has evolved and persevered. Comparisons with adaptive punishment, however, uncover an Achilles heel of adaptive rewarding, coming from over-aggression, which in turn hinders optimal utilization of network reciprocity. This may explain why, despite its success, rewarding is not as firmly embedded into our societal organization as punishment. (paper)

  5. [Advantages and disadvantages of femtosecond laser assisted LASIK and SMILE].

    Science.gov (United States)

    Zhang, F J; Sun, M S

    2018-01-11

    With the development of excimer laser and femtosecond laser equipment, application of diversified and customized surgical decision in modern corneal refractive surgery has been an inevitable trend. However, how to make a personalized decision with an accurate surgical design to achieve better visual quality becomes the main focus in clinical applications. Small-incision lenticule extraction (SMILE) and femtosecond assisted laser in situ keratomileusis (FS-LASIK) have been commonly acknowledged as the mainstream of corneal refractive surgery for ametropia correction nowadays. Both methods have been verified by clinical practice for many years. This article compares and elaborates the different characteristics with advantages and disadvantages of the two methods so as to provide some reasonable treatment options for refractive surgery. (Chin J Ophthalmol, 2018, 54: 7-10) .

  6. THE RELATIONSHIP BETWEEN ORGANISATIONAL RESOURCES, CAPABILITIES, SYSTEMS AND COMPETITIVE ADVANTAGE

    Directory of Open Access Journals (Sweden)

    Raduan Che Rose

    2012-01-01

    Full Text Available The main objective that business organisations in particular should strive to attain is achieving a competitive advantage position relative to their competitors.. This research empirically examined the importance of and emphasis placed on organisational resources, capabilities and systems in their relationships with competitive advantage. The overall findings indicated significant, positive effects of organisational resources, capabilities and systems collectively on competitive advantage, providing support and corroboration to the resource-based view (RBV. The total variance in competitive advantage accounted for by the multiple linear regression (MLR model was 56.2%. In short, the findings from this study have not only contributed to the literature on the issue of the relationship between organisational resources, capabilities, systems and competitive advantage, but also provided vital information to both practitioners and policy makers on the subject matter.

  7. Medicare Provider Data - Hospice Providers

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Hospice Utilization and Payment Public Use File provides information on services provided to Medicare beneficiaries by hospice providers. The Hospice PUF...

  8. Perceptions of methicillin-resistant Staphylococcus aureus and hand hygiene provider training and patient education: results of a mixed method study of health care providers in Department of Veterans Affairs spinal cord injury and disorder units.

    Science.gov (United States)

    Hill, Jennifer N; Hogan, Timothy P; Cameron, Kenzie A; Guihan, Marylou; Goldstein, Barry; Evans, Martin E; Evans, Charlesnika T

    2014-08-01

    The goal of this study was to assess current practices for training of spinal cord injury and disorder (SCI/D) health care workers and education of veterans with SCI/D in Department of Veterans Affairs (VA) spinal cord injury (SCI) centers on methicillin-resistant Staphylococcus aureus (MRSA) prevention. Mixed methods. A Web-based survey was distributed to 673 VA SCI/D providers across 24 SCI centers; 21 acute care and 1 long-term care facility participated. There were 295 that responded, 228 had complete data and were included in this analysis. Semistructured interviews were conducted with 30 SCI/D providers across 9 SCI centers. Nurses, physicians, and therapists represent most respondents (92.1%, n = 210); over half (56.6%, n = 129) were nurses. Of providers, 75.9% (n = 173) reported receiving excellent or good training on how to educate patients about MRSA. However, nurses were more likely to report having excellent or good training for how to educate patients about MRSA (P = .005). Despite this, only 63.6% (n = 82) of nurses perceived the education they provide patients on how MRSA is transmitted as excellent or good. Despite health care workers reporting receiving excellent or good training on MRSA-related topics, this did not translate to excellent or good education for patients, suggesting that health care workers need additional training for educating patients. Population-specific MRSA prevention educational materials may also assist providers in educating patients about MRSA prevention for individuals with SCI/D. Published by Mosby, Inc.

  9. Advantages of robotics in benign gynecologic surgery.

    Science.gov (United States)

    Truong, Mireille; Kim, Jin Hee; Scheib, Stacey; Patzkowsky, Kristin

    2016-08-01

    The purpose of this article is to review the literature and discuss the advantages of robotics in benign gynecologic surgery. Minimally invasive surgery has become the preferred route over abdominal surgery. The laparoscopic or robotic approach is recommended when vaginal surgery is not feasible. Thus far, robotic gynecologic surgery data have demonstrated feasibility, safety, and equivalent clinical outcomes in comparison with laparoscopy and better clinical outcomes compared with laparotomy. Robotics was developed to overcome challenges of laparoscopy and has led to technological advantages such as improved ergonomics, visualization with three-dimensional capabilities, dexterity and range of motion with instrument articulation, and tremor filtration. To date, applications of robotics in benign gynecology include hysterectomy, myomectomy, endometriosis surgery, sacrocolpopexy, adnexal surgery, tubal reanastomosis, and cerclage. Though further data are needed, robotics may provide additional benefits over other approaches in the obese patient population and in higher complexity cases. Challenges that arose in the earlier adoption stage such as the steep learning curve, costs, and operative times are becoming more optimized with greater experience, with implementation of robotics in high-volume centers and with improved training of surgeons and robotic teams. Robotic laparoendoscopic single-site surgery, albeit still in its infancy where technical advantages compared with laparoscopic single-site surgery are still unclear, may provide a cost-reducing option compared with multiport robotics. The cost may even approach that of laparoscopy while still conferring similar perioperative outcomes. Advances in robotic technology such as the single-site platform and telesurgery, have the potential to revolutionize the field of minimally invasive gynecologic surgery. Higher quality evidence is needed to determine the advantages and disadvantages of robotic surgery in benign

  10. Glycoprotein Enrichment Analytical Techniques: Advantages and Disadvantages.

    Science.gov (United States)

    Zhu, R; Zacharias, L; Wooding, K M; Peng, W; Mechref, Y

    2017-01-01

    Protein glycosylation is one of the most important posttranslational modifications. Numerous biological functions are related to protein glycosylation. However, analytical challenges remain in the glycoprotein analysis. To overcome the challenges associated with glycoprotein analysis, many analytical techniques were developed in recent years. Enrichment methods were used to improve the sensitivity of detection, while HPLC and mass spectrometry methods were developed to facilitate the separation of glycopeptides/proteins and enhance detection, respectively. Fragmentation techniques applied in modern mass spectrometers allow the structural interpretation of glycopeptides/proteins, while automated software tools started replacing manual processing to improve the reliability and throughput of the analysis. In this chapter, the current methodologies of glycoprotein analysis were discussed. Multiple analytical techniques are compared, and advantages and disadvantages of each technique are highlighted. © 2017 Elsevier Inc. All rights reserved.

  11. STRATEGIES FOR COMPETETIVE ADVANTAGE IN ELECTRONIC COMMERCE

    Directory of Open Access Journals (Sweden)

    Siamak Azadi

    2011-11-01

    Full Text Available Despite rapid and sustained development of electronic commerce, many companies doing e-business are still in the investment and brand-building phase and have yet to show a profit. However, as e-businesses shift their focus from  building a customer base to increasing revenue growth and profitability, they should reevaluate their current business strategies, if any, and develop strategies that provide a clear path to profitability. This study uses McCarthy’s four marketing mix model and Porter’s five competitive forces model to identify strategies for Internet companies that respond to the five competitive forces and thereby achieve a competitive advantage. The study provides significant new insights into the development and implementation of e-business strategies that contribute to increased profit.

  12. Mixed Methods for Implementation Research: Application to Evidence-Based Practice Implementation and Staff Turnover in Community Based Organizations Providing Child Welfare Services

    Science.gov (United States)

    Aarons, Gregory A.; Fettes, Danielle L.; Sommerfeld, David H.; Palinkas, Lawrence

    2013-01-01

    Many public sector services systems and provider organizations are in some phase of learning about or implementing evidence-based interventions. Child welfare service systems represent a context where implementation spans system, management, and organizational concerns. Research utilizing mixed methods that combine qualitative and quantitative design, data collection, and analytic approaches are particularly well-suited to understanding both the process and outcomes of dissemination and implementation efforts in child welfare systems. This paper describes the process of using mixed methods in implementation research and provides an applied example of an examination of factors impacting staff retention during an evidence-based intervention implementation in a statewide child welfare system. We integrate qualitative data with previously published quantitative analyses of job autonomy and staff turnover during this statewide implementation project in order to illustrate the utility of mixed method approaches in providing a more comprehensive understanding of opportunities and challenges in implementation research. PMID:22146861

  13. Mixed methods for implementation research: application to evidence-based practice implementation and staff turnover in community-based organizations providing child welfare services.

    Science.gov (United States)

    Aarons, Gregory A; Fettes, Danielle L; Sommerfeld, David H; Palinkas, Lawrence A

    2012-02-01

    Many public sector service systems and provider organizations are in some phase of learning about or implementing evidence-based interventions. Child welfare service systems represent a context where implementation spans system, management, and organizational concerns. Research utilizing mixed methods that combine qualitative and quantitative design, data collection, and analytic approaches are particularly well suited to understanding both the process and outcomes of dissemination and implementation efforts in child welfare systems. This article describes the process of using mixed methods in implementation research and provides an applied example of an examination of factors impacting staff retention during an evidence-based intervention implementation in a statewide child welfare system. The authors integrate qualitative data with previously published quantitative analyses of job autonomy and staff turnover during this statewide implementation project in order to illustrate the utility of mixed method approaches in providing a more comprehensive understanding of opportunities and challenges in implementation research.

  14. Accuracy of the visual estimation method as a predictor of food intake in Alzheimer's patients provided with different types of food.

    Science.gov (United States)

    Amano, Nobuko; Nakamura, Tomiyo

    2018-02-01

    The visual estimation method is commonly used in hospitals and other care facilities to evaluate food intake through estimation of plate waste. In Japan, no previous studies have investigated the validity and reliability of this method under the routine conditions of a hospital setting. The present study aimed to evaluate the validity and reliability of the visual estimation method, in long-term inpatients with different levels of eating disability caused by Alzheimer's disease. The patients were provided different therapeutic diets presented in various food types. This study was performed between February and April 2013, and 82 patients with Alzheimer's disease were included. Plate waste was evaluated for the 3 main daily meals, for a total of 21 days, 7 consecutive days during each of the 3 months, originating a total of 4851 meals, from which 3984 were included. Plate waste was measured by the nurses through the visual estimation method, and by the hospital's registered dietitians through the actual measurement method. The actual measurement method was first validated to serve as a reference, and the level of agreement between both methods was then determined. The month, time of day, type of food provided, and patients' physical characteristics were considered for analysis. For the 3984 meals included in the analysis, the level of agreement between the measurement methods was 78.4%. Disagreement of measurements consisted of 3.8% of underestimation and 17.8% of overestimation. Cronbach's α (0.60, P visual estimation method was within the acceptable range. The visual estimation method was found to be a valid and reliable method for estimating food intake in patients with different levels of eating impairment. The successful implementation and use of the method depends upon adequate training and motivation of the nurses and care staff involved. Copyright © 2017 European Society for Clinical Nutrition and Metabolism. Published by Elsevier Ltd. All rights reserved.

  15. Game on: creating competitive advantages.

    Science.gov (United States)

    Riskind, Patricia; Foreman, M Shane

    2004-01-01

    Whether you are opening a new imaging center or trying to keep an existing center competitive, there are 3 critical factors: customer service, marketing, and a "what's next?" attitude. Customer service: Outstanding customer service is what sticks in the minds of referring physicians and patients. Not only does providing better service differentiate you from the competition, but it also boosts employee morale and motivates people to acquire new skills. Marketing: From the front office staff to the radiologists,promoting the center should be part of every employee's job description. Simply paying lip service to the concept of marketing will not cut it. A "what's next?" attitude: Complacency is a luxury that does not exist in today's competitive health care arena. Three facilities provide examples of how these factors applied to their success.

  16. Competitive advantage and competitive dynamics

    OpenAIRE

    Milisavljević Momčilo

    2002-01-01

    Understanding competitors means locating and defining their main elements. The first element is participants - companies that compete and create a network of rivalry. Apart from our company it includes other participants in the market (investors, consumers, distributors, providers and producers of substitute and complementary products). The other element is additional value - net profit and loss which every competitor brings to the others. Measuring of additional value requires measurement of...

  17. INTERACTIVE LEARNING: ADVANTAGES AND DISADVANTAGES

    Directory of Open Access Journals (Sweden)

    O. Kustovska

    2016-10-01

    Full Text Available In the article the use of interactive technologies in the educational process of the university, allowing students to develop innovative thinking, away from stereotypes, develop imagination, communication skills and expertise, intellectual, emotional, motivational and other areas of personality. Implementing the principles of technological learning, interactive educational technology and provides interactive computer learning tools, and interactivity of educational process when the basic conceptual provisions defined training based on interactive communication.

  18. Nurses' creativity: advantage or disadvantage.

    Science.gov (United States)

    Shahsavari Isfahani, Sara; Hosseini, Mohammad Ali; Fallahi Khoshknab, Masood; Peyrovi, Hamid; Khanke, Hamid Reza

    2015-02-01

    Recently, global nursing experts have been aggressively encouraging nurses to pursue creativity and innovation in nursing to improve nursing outcomes. Nurses' creativity plays a significant role in health and well-being. In most health systems across the world, nurses provide up to 80% of the primary health care; therefore, they are critically positioned to provide creative solutions for current and future global health challenges. The purpose of this study was to explore Iranian nurses' perceptions and experiences toward the expression of creativity in clinical settings and the outcomes of their creativity for health care organizations. A qualitative approach using content analysis was adopted. Data were collected through in-depth semistructured interviews with 14 nurses who were involved in the creative process in educational hospitals affiliated to Jahrom and Tehran Universities of Medical Sciences in Iran. Four themes emerged from the data analysis, including a) Improvement in quality of patient care, b) Improvement in nurses' quality of work, personal and social life, c) Promotion of organization, and d) Unpleasant outcomes. The findings indicated that nurses' creativity in health care organizations can lead to major changes of nursing practice, improvement of care and organizational performance. Therefore, policymakers, nurse educators, nursing and hospital managers should provide a nurturing environment that is conducive to creative thinking, giving the nurses opportunity for flexibility, creativity, support for change, and risk taking.

  19. PBMR Project - Pebble Fuel Advantages

    International Nuclear Information System (INIS)

    Slabber, Johan; Matzie, Regis; Casperson, Sten; Kriel, Willem

    2006-01-01

    An overview is presented of all the important issues that influenced the choice of pebble fuel for the High-temperature Gas-cooled Reactor (HTGR) concept developed by South Africa. Each of these issues is then discussed in detail and compared with other fuel configurations proposed for direct cycle High-temperature Reactor (HTR) applications. The comparisons are provided using objective data generated by analyses done for the design of the Pebble Bed Modular Reactor (PBMR) and data that is available in open literature for the other fuel configurations

  20. Structuring the competitive advantage of printing company

    OpenAIRE

    Kukharuk A. D.

    2013-01-01

    The nature of the concept of "competitive advantage of the company" if analyzed. The concept of "structuring a competitive advantage" is suggested. The model of structuring of printing company’s competitive advantage based on fundamentals of stakeholder theory is developed.

  1. 76 FR 56262 - Community Advantage Pilot Program

    Science.gov (United States)

    2011-09-12

    ... SMALL BUSINESS ADMINISTRATION [Docket No. SBA 2011-0003] Community Advantage Pilot Program AGENCY: U.S. Small Business Administration (SBA). ACTION: Notice of change to Community Advantage Pilot... Community Advantage Pilot Program. In that notice, SBA modified or waived as appropriate certain regulations...

  2. Impact of an online medical internet site on knowledge and practice of health care providers: a mixed methods study of the Spinal Cord Injury Rehabilitation Evidence project.

    Science.gov (United States)

    Eng, Janice J; Noonan, Vanessa K; Townson, Andrea F; Higgins, Caroline E; Rogers, Jess; Wolfe, Dalton L

    2014-12-23

    It is not known whether ongoing access to a broad-based Internet knowledge resource can influence the practice of health care providers. We undertook a study to evaluate the impact of a Web-based knowledge resource on increasing access to evidence and facilitating best practice of health care providers. The objective of this study was to evaluate (1) the impact of the Spinal Cord Injury Rehabilitation Evidence (SCIRE) project on access to information for health care providers and researchers and (2) how SCIRE influenced health care providers' management of clients. A 4-part mixed methods evaluation was undertaken: (1) monitoring website traffic and utilization using Google Analytics, (2) online survey of users who accessed the SCIRE website, (3) online survey of targeted end-users, that is, rehabilitation health care providers known to work with spinal cord injury (SCI) clients, as well as researchers, and (4) focus groups with health care providers who had previously accessed SCIRE. The online format allowed the content for a relatively specialized field to have far reach (eg, 26 countries and over 6500 users per month). The website survey and targeted end-user survey confirmed that health care providers, as well as researchers perceived that the website increased their access to SCI evidence. Access to SCIRE not only improved knowledge of SCI evidence but helped inform changes to the health providers' clinical practice and improved their confidence in treating SCI clients. The SCIRE information directly influenced the health providers' clinical decision making, in terms of choice of intervention, equipment needs, or assessment tool. A Web-based knowledge resource may be a relatively inexpensive method to increase access to evidence-based information, increase knowledge of the evidence, inform changes to the health providers' practice, and influence their clinical decision making.

  3. Advantages and disadvantages of leasing

    Directory of Open Access Journals (Sweden)

    Katarzyna Wiśniewska

    2012-12-01

    Full Text Available The article is systematization of knowledge on leasing as a source of financing for enterprises. This paper defines the leasing and presented its nature according to the norms of civil, tax and accounting law. It shows the basic classification of leases and briefly describes each type. This article discusses the key benefits gained from using the financial tools and the most common business problems. Presented the consequences arising from the signing of the lease. Description was written based on literature studies on the issues of lease. Concerns the benefits and drawbacks arising from the lease agreement for use of this form of financing for enterprises. The article can help entrepreneurs in making the correct choice of the method of financing.

  4. Filmless MRI. Advantages and disadvantages

    International Nuclear Information System (INIS)

    Vorbeck, F.; Al-Zayer, F.; Jung, B.; Breitenseher, M.; Imhof, H.

    1999-01-01

    At our hospital, an average MRI examination comprises 170 images. These examinations were evaluated exclusively on digital reporting systems with two high-resolution monitors for a period of 1 year. A retrospective analysis of this reporting method in comparision with films on a conventional viewing wall was performed with subjective and objective data. Radiologists and technicians were requested to evaluate the system on a subjective scale from 1 to 5 for seven topics (image analysis, inspection, time for reporting, handling, comparison with previous reports, quality of PC laser prints, training period). Moreover, personal interviews were conducted and protocols taken. Patient and image frequency, film costs, data transfer time and amount of system failures were evaluated as objective data. The most important results were: Two thirds of the film checking radiologists prefer the conventional viewing walls over the computer monitors. However, 70% of the residents prefer using the computer monitor for reporting. Seventy percent of the interviewed radiologists considered comparison with former examinations on film very difficult. Digitizing of former MRI examinations was not a convincing method; printing on a standard PC laser printer was considered to yield insufficient quality. The different acceptance between radiologists and residents seems to be related to different experiences. The reduction in film costs (48.6%) will improve further with complete PACS installation in the whole hospital. Data transfer rates are still poor; further improvement of network performance is necessary for convenient work. One whole MRI examination and report could be stored on CD-ROM for a cost of less than 2 euros. This could be a future means of cheap archiving and documentation suitable for viewing on any PC with DICOM III viewer. Images and reports could stay with the patient as in the past. (orig.) [de

  5. Neural responses to advantageous and disadvantageous inequity

    Directory of Open Access Journals (Sweden)

    Klaus eFliessbach

    2012-06-01

    Full Text Available In this paper we study neural responses to inequitable distributions of rewards despite equal performance. We specifically focus on differences between advantageous (AI and disadvantageous inequity (DI. AI and DI were realized in a hyperscanning fMRI experiment with pairs of subjects simultaneously performing a task in adjacent scanners and observing both subjects' rewards. Results showed i hypoactivation of the ventral striatum under DI but not under AI; ii inequity induced activation of medial and dorsolateral prefrontal regions, that were stronger under DI than AI; iii correlations between subjective evaluations of DI and amygdala activity, and between AI evaluation and right ventrolateral prefrontal activity. Our study provides neurophysiological evidence for different cognitive processes that occur when exposed to DI and AI, respectively. Our data is compatible with the assumption that any form of inequity represents a norm violation, but that important differences between AI and DI emerge from an asymmetric involvement of status concerns.

  6. Rethinking Marketing for Sustainable Competitive Advantages

    Directory of Open Access Journals (Sweden)

    Akın KOÇAK

    2012-12-01

    Full Text Available When formal marketing thought developed in the early 1900s, dominant perspective of marketing was about taking things “to market”. After 1950 marketing thought moved to a “market to” orientation. This orientation reflects “product dominant logic”. After radical changes in information technology, knowledge asymmetry between firm and customer is decreased and customer becomes operant resource instead of a resource to be acted on. Therefore, new marketing paradigm has been emerged and main focus moved from “value in exchange” to “value in use” and customer becomes collaborative partner. Firm can only provide value proposition. New definition of marketing comprises “customer relationship”, “share holders”, and “value creation”. Apart from evolving of marketing thought, theories of competitive advantages have been also change form industry perspective to internal resource and dynamic capabilities.

  7. The academic advantage: gender disparities in patenting.

    Science.gov (United States)

    Sugimoto, Cassidy R; Ni, Chaoqun; West, Jevin D; Larivière, Vincent

    2015-01-01

    We analyzed gender disparities in patenting by country, technological area, and type of assignee using the 4.6 million utility patents issued between 1976 and 2013 by the United States Patent and Trade Office (USPTO). Our analyses of fractionalized inventorships demonstrate that women's rate of patenting has increased from 2.7% of total patenting activity to 10.8% over the nearly 40-year period. Our results show that, in every technological area, female patenting is proportionally more likely to occur in academic institutions than in corporate or government environments. However, women's patents have a lower technological impact than that of men, and that gap is wider in the case of academic patents. We also provide evidence that patents to which women--and in particular academic women--contributed are associated with a higher number of International Patent Classification (IPC) codes and co-inventors than men. The policy implications of these disparities and academic setting advantages are discussed.

  8. Future generations of CANDU: advantages and development with passive safety

    International Nuclear Information System (INIS)

    Duffey, R. B.

    2006-01-01

    Atomic Energy of Canada Limited (AECL) advances water reactor and CANDLT technology using an evolutionary development strategy. This strategy ensures that innovations are based firmly on current experience and keeps our development programs focused on one reactor concept, reducing risks, development costs, and product development cycle times. It also assures our customers that our products will never become obsolete or unsupported, and the continuous line of water reactor development is secure and supported into the future. Using the channel reactor advantage of modularity, the subdivided core has the advantage of passive safety by heat removal to the low- pressure moderator. With continuous improvements, the Advanced CANDU Reactor TM (ACR-1000TM) concept will likely remain highly competitive for a number of years and leads naturally to the next phase of CANDU development, namely the Generation IV CANDU -SCWR concept. This is conventional water technology, since supercritical boilers and turbines have been operating for some time in coal-fired power plants. Significant cost, safety, and performance advantages would result from the CANDU-SCWR concept, plus the flexibility of a range of plant sizes suitable for both small and large electric grids, and the ability for co-generation of electric power, process heat, and hydrogen. In CANDU-SCWR, novel developments are included in the primary circuit layout and channel design. The R and D in Canada is integrated with the Generation IV international Forum (GIF) plans, and has started on examining replaceable insulating liners that would ensure channel life, and on providing completely passive reactor decay heat removal directly to the moderator heat sink without forced cooling. In the interests of sustainability, hydrogen production by a CANDU- SCWR is also be included as part of the system requirements, where the methods for hydrogen production will depend on the outlet temperature of the reactor

  9. Solar thermal upper stage: Economic advantage and development status

    Science.gov (United States)

    Adams, Alan M.

    1995-01-01

    A solar thermal upper stage (STUS) is envisioned as a propulsive concept for the future. The STUS will be used for low Earth orbit (LEO) to geostationary-Earth orbit (GEO) transfer and for planetary exploration missions. The STUS offers significant performance gains over conventional chemical propulsion systems. These performance gains translate into a more economical, more efficient method of placing useful payloads in space and maximizing the benefits derived from space activity. This paper will discuss the economical advantages of an STUS compared to conventional chemical propulsion systems, the potential market for an STUS, and the recent activity in the development of an STUS. The results of this assessment combined with the performance gains, will provide a strong justification for the development of an STUS.

  10. Organizational and provider level factors in implementation of trauma-informed care after a city-wide training: an explanatory mixed methods assessment.

    Science.gov (United States)

    Damian, April Joy; Gallo, Joseph; Leaf, Philip; Mendelson, Tamar

    2017-11-21

    While there is increasing support for training youth-serving providers in trauma-informed care (TIC) as a means of addressing high prevalence of U.S. childhood trauma, we know little about the effects of TIC training on organizational culture and providers' professional quality of life. This mixed-methods study evaluated changes in organizational- and provider-level factors following participation in a citywide TIC training. Government workers and nonprofit professionals (N = 90) who participated in a nine-month citywide TIC training completed a survey before and after the training to assess organizational culture and professional quality of life. Survey data were analyzed using multiple regression analyses. A subset of participants (n = 16) was interviewed using a semi-structured format, and themes related to organizational and provider factors were identified using qualitative methods. Analysis of survey data indicated significant improvements in participants' organizational culture and professional satisfaction at training completion. Participants' perceptions of their own burnout and secondary traumatic stress also increased. Four themes emerged from analysis of the interview data, including "Implementation of more flexible, less-punitive policies towards clients," "Adoption of trauma-informed workplace design," "Heightened awareness of own traumatic stress and need for self-care," and "Greater sense of camaraderie and empathy for colleagues." Use of a mixed-methods approach provided a nuanced understanding of the impact of TIC training and suggested potential benefits of the training on organizational and provider-level factors associated with implementation of trauma-informed policies and practices. Future trainings should explicitly address organizational factors such as safety climate and morale, managerial support, teamwork climate and collaboration, and individual factors including providers' compassion satisfaction, burnout, and secondary

  11. Validation of a new method for testing provider clinical quality in rural settings in low- and middle-income countries: the observed simulated patient.

    Directory of Open Access Journals (Sweden)

    Tin Aung

    Full Text Available BACKGROUND: Assessing the quality of care provided by individual health practitioners is critical to identifying possible risks to the health of the public. However, existing assessment methods can be inaccurate, expensive, or infeasible in many developing country settings, particularly in rural areas and especially for children. Following an assessment of the strengths and weaknesses of the existing methods for provider assessment, we developed a synthesis method combining components of direct observation, clinical vignettes, and medical mannequins which we have termed "Observed Simulated Patient" or OSP. An OSP assessment involves a trained actor playing the role of a 'mother', a life-size doll representing a 5-year old boy, and a trained observer. The provider being assessed was informed in advance of the role-playing, and told to conduct the diagnosis and treatment as he normally would while verbally describing the examinations. METHODOLOGY/PRINCIPAL FINDINGS: We tested the validity of OSP by conducting parallel scoring of medical providers in Myanmar, assessing the quality of their diagnosis and treatment of pediatric malaria, first by direct observation of true patients and second by OSP. Data were collected from 20 private independent medical practitioners in Mon and Kayin States, Myanmar between December 26, 2010 and January 12, 2011. All areas of assessment showed agreement between OSP and direct observation above 90% except for history taking related to past experience with malaria medicines. In this area, providers did not ask questions of the OSP to the same degree that they questioned real patients (agreement 82.8%. CONCLUSIONS/SIGNIFICANCE: The OSP methodology may provide a valuable option for quality assessment of providers in places, or for health conditions, where other assessment tools are unworkable.

  12. Posterior coronal plating for tibial fractures: technique and advantages

    Directory of Open Access Journals (Sweden)

    Montu Jain

    2014-04-01

    Full Text Available Objective:Tibial shaft fractures are straightforward to treat but when associated with soft tissue injury particularly at the nail entry/plate insertion site or there is significant comminution proximally or a large butterfly fragment/a second split component in the posterior coronal plane, it is a challenge to the treating surgeon. The aim of the present report is to describe the technique of posterior coronal plating in such a scenario and its advantages. Methods:Between July 2008 and June 2011, 12 patients were pro spectively treated by this approach using 4.5 mm broad dynamic compression plates. Results:The time of bony consolidation and full weight bearing averaged 21.7 weeks (range, 16-26 weeks. Patients were followed up for at least 24 months (range, 24-48 months. At 1 year postoper atively, no loss in reduction or alignment was observed. Mean Hospital for Lower Extremity Measurement Functional Score was 72.8 (range, 64-78. All patients were satisfied with their treatment outcomes. Conclusion:Direct posterior approach and fixation using prone position helps to visualise the fracture fragments and provide rigid fixation. The approach is simple and extensile easily, apart from advantages of less soft tissue and hardware problems compared to standard medial or lateral plating. Key words: Tibial fractures; Bone plates; Orthopedic procedures

  13. Determinação de proteínas totais via espectrofometria: vantagens e desvantagens dos métodos existentes Determination of total protein by spectrophotometry: advantages and disadvantages of proposed methods

    Directory of Open Access Journals (Sweden)

    Dimas A. M. Zaia

    1998-11-01

    Full Text Available Spectrophotometric determination of total protein is used in several areas such as clinical analysis, food science and technology, biochemistry, protein chemistry, physiology. Five spectrophotometric methods are mostly used: biuret, Lowry, Bradford, Smith and UV absorption. In this review a general overview of these methods is presented (interferences, applications; other methodologies are also discussed.

  14. The copper intrauterine device for emergency contraception: an opportunity to provide the optimal emergency contraception method and transition to highly effective contraception.

    Science.gov (United States)

    Dermish, Amna I; Turok, David K

    2013-07-01

    Worldwide, 40% of all pregnancies are unintended. Widespread, over-the-counter availability of oral emergency contraception (EC) has not reduced unintended pregnancy rates. The EC visit presents an opportunity to initiate a highly effective method of contraception in a population at high risk of unintended pregnancy who are actively seeking to avoid pregnancy. The copper intrauterine device (IUD), the most effective method of EC, continues to provide contraception as effective as sterilization for up to 12 years, and it should be offered as the first-line method of EC wherever possible. Increased demand for and supply of the copper IUD for EC may have an important role in reducing rates of unintended pregnancy. The EC visit should include access to the copper IUD as optimal care but should ideally include access to all highly effective methods of contraception.

  15. Consumer Insight as Competitive Advantage Using Big Data and Analytics

    Directory of Open Access Journals (Sweden)

    Adnan Veysel Ertemel

    2015-12-01

    Full Text Available Digital revolution serves as a competitive advantage to businesses that are able to analyze consumer behavior in order to gain insights for their strategic advantage. After the advent of Internet, the past two decades witnessed generation of vast amount of business data. The amount of data is so huge that traditional database management system approaches falls short of managing and analyzing this data. This paper explores the characteristics of this phenomenon called Big Data together with Analytics as a tool for marketers to gain insights about consumer behavior and hence provide competitive advantage to the businesses. It also discusses some best practices as case studies.

  16. Organizational and provider level factors in implementation of trauma-informed care after a city-wide training: an explanatory mixed methods assessment

    Directory of Open Access Journals (Sweden)

    April Joy Damian

    2017-11-01

    Full Text Available Abstract Background While there is increasing support for training youth-serving providers in trauma-informed care (TIC as a means of addressing high prevalence of U.S. childhood trauma, we know little about the effects of TIC training on organizational culture and providers’ professional quality of life. This mixed-methods study evaluated changes in organizational- and provider-level factors following participation in a citywide TIC training. Methods Government workers and nonprofit professionals (N = 90 who participated in a nine-month citywide TIC training completed a survey before and after the training to assess organizational culture and professional quality of life. Survey data were analyzed using multiple regression analyses. A subset of participants (n = 16 was interviewed using a semi-structured format, and themes related to organizational and provider factors were identified using qualitative methods. Results Analysis of survey data indicated significant improvements in participants’ organizational culture and professional satisfaction at training completion. Participants’ perceptions of their own burnout and secondary traumatic stress also increased. Four themes emerged from analysis of the interview data, including “Implementation of more flexible, less-punitive policies towards clients,” “Adoption of trauma-informed workplace design,” “Heightened awareness of own traumatic stress and need for self-care,” and “Greater sense of camaraderie and empathy for colleagues.” Conclusion Use of a mixed-methods approach provided a nuanced understanding of the impact of TIC training and suggested potential benefits of the training on organizational and provider-level factors associated with implementation of trauma-informed policies and practices. Future trainings should explicitly address organizational factors such as safety climate and morale, managerial support, teamwork climate and collaboration, and

  17. Airtraq optical laryngoscope: advantages and disadvantages.

    Science.gov (United States)

    Saracoglu, Kemal Tolga; Eti, Zeynep; Gogus, Fevzi Yilmaz

    2013-06-01

    Difficult or unsuccesful tracheal intubation is one of the important causes for morbidity and mortality in susceptible patients. Almost 30% of the anesthesia-related deaths are induced by the complications of difficult airway management and more than 85% of all respiratory related complications cause brain injury or death. Nowadays, due to the advances in technology, new videolaryngoscopic devices became available. Airtraq is a novel single-use laryngoscope which provides glottis display without any deviation in the normal position of the oral, pharyngeal or the tracheal axes. With the help of the display lens glottis and the surrounding structures are visualised and under direct view of its tip the tracheal tube is introduced between the vocal cords. In patients having restricted neck motion or limited mouth opening (provided that it is greater than 3 cm) Airtraq offers the advantage of a better display. Moreover the video image can be transfered to an external monitor thus an experienced specialist can provide assistance and an educational course can be conducted simultaneously. On the other hand the Airtraq videolaryngoscopic devices possess certain disadvantages including the need of experience and the time demand for the operator to learn how to use them properly, the rapid deterioration of their display in the presence of a swelling or a secretion and the fact that they are rather complicated and expensive devices. The Airtraq device has already documented benefits in the management of difficult airways, however serial utilization obviously necessitates experience.

  18. Explaining foreign ownership by comparative and competitive advantage. Empirical evidence.

    OpenAIRE

    Bellak, Christian

    1999-01-01

    This paper provides empirical evidence on the determinants of foreign ownership in manufacturing industries. Foreign ownership, according to the theory of international production, is the result of the combination of comparative and competitive advantage. An adequate examination of the ownership structure of an industry requires the ability to establish empirically the extent to which international competitiveness of firms rests on comparative and competitive advantage. Analysis is based on a...

  19. Digital linear accelerator: The advantages for radiotherapy

    International Nuclear Information System (INIS)

    Andric, S.; Maksimovic, M.; Dekic, M.; Clark, T.

    1998-01-01

    Technical performances of Digital Linear Accelerator were presented to point out its advantages for clinical radiotherapy treatment. The accelerator installation is earned out at Military Medical Academy, Radiotherapy Department, by Medes and Elekta companies. The unit offers many technical advantages with possibility of introduction new conformal treatment techniques as stereotactic radiosurgery, total body and total skin irradiation. In the paper are underlined advantages in relation to running conventional accelerator units at Yugoslav radiotherapy departments, both from technical and medical point of view. (author)

  20. Acceptability of multipurpose human papillomavirus vaccines among providers and mothers of adolescent girls: A mixed-methods study in five countries

    Directory of Open Access Journals (Sweden)

    Nadja A. Vielot

    2017-06-01

    Full Text Available Introduction: Multipurpose vaccines (MPVs could be formulated to prevent multiple sexually transmitted infections simultaneously. Little is known about acceptability of MPVs among vaccine health care providers (HCPs or mothers of adolescent girls. Methods: 151 adolescent vaccine providers and 118 mothers of adolescent girls aged 9–14 were recruited from five geographically-diverse countries: Argentina, Malaysia, South Africa, South Korea, and Spain. We assessed providers’ preferences for single-purpose human papillomavirus (HPV vaccine versus MPVs (including HPV+herpes simplex virus (HSV−2, HPV+HIV, or HPV+HSV-2+HIV via quantitative surveys. Maternal MPV attitudes were assessed in four focus group discussions (FGDs in each country. Results: Most providers preferred MPVs over single-purpose HPV vaccination, with preference ranging from 61% in Malaysia to 96% in South Africa. HPV+HSV-2+HIV was the most preferred MPV formulation (56–82%. Overall, 53% of the mothers preferred MPVs over single-purpose HPV vaccines, with strongest support in South Africa (90% and lowest support in South Korea (29%. Convenience and trust in the health care system were commonly-cited reasons for MPV acceptability. Safety and efficacy concerns were common barriers to accepting MPVs, though specific concerns differed by country. Across FGDs, additional safety and efficacy information on MPVs were requested, particularly from trusted sources like HCPs. Conclusions: Though maternal acceptability of MPVs varied by country, MPV acceptability would be enhanced by having HCPs provide parents with additional MPV vaccine safety and efficacy information. While most providers preferred MPVs, future health behavior research should identify acceptability barriers, and targeted provider interventions should equip providers to improve vaccination discussions with parents. Keywords: Vaccines, Acceptability, Multipurpose, Human papillomavirus, Sexually transmitted

  1. The use of packed water in urban drinking water and its advantages to other methods of separating drinking water from undrinkable water (The case study : Ferdows city in south Khorasan)

    OpenAIRE

    Mehdi Akhgari; Ahmad Mansuri; Saeed Mansuri; Sara Mirzaei

    2014-01-01

    Today,more than one billion people of the world don't have access to safe drinking water.  Therefore, due to the population increase andconsequently increasing water needs, and the reduction of drinking watersources available, separating drinking water and non-drinking water seemsnecessary. In this article, the use of packed water is compared to other methods,such as two networks (drinkable and non-drinkable) water supply, public waterstations, purifying drinking water, and transferring high ...

  2. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, December 2015

    International Nuclear Information System (INIS)

    Cabellos, Oscar; De Saint Jean, Cyrille; Hursin, Mathieu; Pelloni, Sandro; Ivanov, Evgeny; Kodeli, Ivan; Leconte, Pierre; Palmiotti, Giuseppe; Salvatores, Massimo; Sobes, Vladimir; Yokoyama, Kenji

    2015-12-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the fifth formal Subgroup 39 meeting held at the Institute Curie, Paris, France, on 4 December 2015. It comprises a Summary Record of the meeting, and all the available presentations (slides) given by the participants: A - Sensitivity methods: - 1: Short update on deliverables (K. Yokoyama); - 2: Does one shot Bayesian is equivalent to successive update? Bayesian inference: some matrix linear algebra (C. De Saint Jean); - 3: Progress in Methodology (G. Palmiotti); - SG39-3: Use of PIA approach. Possible application to neutron propagation experiments (S. Pelloni); - 4: Update on sensitivity coefficient methods (E. Ivanov); - 5: Stress test for U-235 fission (H. Wu); - 6: Methods and approaches development at ORNL for providing feedback from integral benchmark experiments for improvement of nuclear data files (V. Sobes); B - Integral experiments: - 7a: Update on SEG analysis (G. Palmiotti); - 7b:Status of MANTRA (G. Palmiotti); - 7c: Possible new experiments at NRAD (G. Palmiotti); - 8: B-eff experiments (I. Kodeli); - 9: On going CEA activities related to dedicated integral experiments for nuclear date validation in the Fast energy range (P. Leconte); - 10: PROTEUS Experiments: an update (M. Hursin); - 11: Short updates on neutron propagation experiments, STEK, CIELO status (O. Cabellos)

  3. Presentations provided

    Energy Technology Data Exchange (ETDEWEB)

    Hashemian, H; Beverly, D [Analysis and Measurement Services Corp., Knoxville, TN (United States)

    1999-12-31

    The following topics covered in detail at the workshop included: temperature instrumentation; pressure instrumentation; in-situ calibration and response time testing of RTDs and pressure transmitters; on-line performance monitoring and preventive maintenance of critical equipment; automated measurement of critical parameters; nuclear power plant infrastructure, management and Quality Assurance issues and recent developments for WWER and RBMK reactors. Conclusions drawn were: aging can adversely affect the performance of nuclear plant pressure transmitters; current testing interval of once in every fuel cycle is adequate for aging management; in-situ response time measurements and on-line calibration testing methods have been developed and validated for nuclear plant pressure transmitters; NUREG/CR-5851 should be taken into account for details of aging research on pressure transmitters

  4. Presentations provided

    International Nuclear Information System (INIS)

    Hashemian, H.; Beverly, D.

    1998-01-01

    The following topics covered in detail at the workshop included: temperature instrumentation; pressure instrumentation; in-situ calibration and response time testing of RTDs and pressure transmitters; on-line performance monitoring and preventive maintenance of critical equipment; automated measurement of critical parameters; nuclear power plant infrastructure, management and Quality Assurance issues and recent developments for WWER and RBMK reactors. Conclusions drawn were: aging can adversely affect the performance of nuclear plant pressure transmitters; current testing interval of once in every fuel cycle is adequate for aging management; in-situ response time measurements and on-line calibration testing methods have been developed and validated for nuclear plant pressure transmitters; NUREG/CR-5851 should be taken into account for details of aging research on pressure transmitters

  5. Cognitive advantage in bilingualism: an example of publication bias?

    Science.gov (United States)

    de Bruin, Angela; Treccani, Barbara; Della Sala, Sergio

    2015-01-01

    It is a widely held belief that bilinguals have an advantage over monolinguals in executive-control tasks, but is this what all studies actually demonstrate? The idea of a bilingual advantage may result from a publication bias favoring studies with positive results over studies with null or negative effects. To test this hypothesis, we looked at conference abstracts from 1999 to 2012 on the topic of bilingualism and executive control. We then determined which of the studies they reported were subsequently published. Studies with results fully supporting the bilingual-advantage theory were most likely to be published, followed by studies with mixed results. Studies challenging the bilingual advantage were published the least. This discrepancy was not due to differences in sample size, tests used, or statistical power. A test for funnel-plot asymmetry provided further evidence for the existence of a publication bias. © The Author(s) 2014.

  6. Competitive advantage, what does it really mean?

    NARCIS (Netherlands)

    dr. Haijing de Haan; Hongjue Yan

    2013-01-01

    Competitive advantage is probably the most popular business concept today (Mooney, 2007). This article aims to investigate critically the discourse on competitive advantage, as expressed by business literature, by locating its meanings in the public higher education sector. This research reveals

  7. Strategic Positioning for Sustainable Competitive Advantage: An ...

    African Journals Online (AJOL)

    Organizational learning is increasingly being considered as one of the fundamental sources of competitive advantage within the context of strategic management. However, most literature has not clearly linked organizational learning with sustainable competitive advantage. This paper, therefore, explores and discusses the ...

  8. Analisis Dampak Servant Leadership Terhadap Competitive Advantage

    OpenAIRE

    Oktavia, Pek Nike

    2014-01-01

    Penelitian ini bertujuan untuk mengetahui apakah terdapat dampak antara Servant Leadership terhadap Competitve Advantage, Employee Empowerment dan Organizational Learning. Variabel Servant Leadership diukur dari lima indikator, yaitu altruistic calling, emotional healing, wisdom, persuasive mapping, dan organizational stewardship. Variabel Competitive Advantage diukur dari lima indikator, yaitu price/cost, quality, delivery dependability, time to market, dan product innovation. Variabel Emplo...

  9. Wiring assembly and method of forming a channel in a wiring assembly for receiving conductor and providing separate regions of conductor contact with the channel

    Energy Technology Data Exchange (ETDEWEB)

    Stelzer, Gerald; Meinke, Rainer; Senti, Mark

    2018-03-06

    A conductor assembly and method for constructing an assembly of the type which, when conducting current, generates a magnetic field or which, in the presence of a changing magnetic field, induces a voltage. In one embodiment the method provides a first insulative layer tubular in shape and including a surface along which a conductor segment may be positioned. A channel formed in the surface of the insulative layer defines a first conductor path and includes a surface of first contour in cross section along a first plane transverse to the conductor path. A segment of conductor having a surface of second contour in cross section is positioned at least partly in the channel and extends along the conductor path. Along the first plane, contact between the conductor surface of second contour and the channel surface of first contour includes at least two separate regions of contact.

  10. Human rights versus societal norms: a mixed methods study among healthcare providers on social stigma related to adolescent abortion and contraceptive use in Kisumu, Kenya.

    Science.gov (United States)

    Håkansson, Miranda; Oguttu, Monica; Gemzell-Danielsson, Kristina; Makenzius, Marlene

    2018-01-01

    Adolescent pregnancy represents a serious public health issue in sub-Saharan Africa, and stigmatising attitudes are contributing factors. This study investigates stigmatising attitudes related to adolescent pregnancy, abortion and contraceptive use among healthcare providers working with postabortion care (PAC) in a low-resource setting in Kenya. A mixed methods approach in a convergent design was utilised to capture attitudes related to abortion and contraceptive use among 86 (f=62; m=19) PAC providers in Kisumu, Kenya. Two Likert-scale questionnaires were used: the 18-item Stigmatising Attitudes, Beliefs and Actions Scale (SABAS) and the 7-item Contraceptive Use Stigma Scale (CUSS). 74 PAC providers responded to the SABAS, 44 to the CUSS and 12 participated in two focus group discussions. Descriptive statistics, psychometric tests of instruments and qualitative content analysis were conducted and reported in accordance with Consolidated Criteria for Reporting Qualitative Research. Cronbach's α coefficients for the total instrument was 0.88 (SABAS) and 0.84 (CUSS). The majority, 92% (68/74) agreed that a woman who has had an abortion should be treated equally to everyone else, 27% (20/74) considered abortion a sin and 30% (22/74) believed she will make abortion a habit. Contraceptive use among adolescent women was associated with promiscuity (39%; 17/44), hence contraceptives should only be available to married women (36%; 16/44), and 20% (9/44) believed that contraceptive use causes infertility. The providers encouraged women's autonomy and their rights to sexual and reproductive health; however, unclear regulations reinforce religious and cultural beliefs, which hampers implementation of evidence-based contraceptive counselling. Stigmatising attitudes towards young women in need of abortion and contraception is common among PAC providers. Their work is characterised by a conflict between human rights and societal norms, thus highlighting the need for

  11. Development of a reject classification method, applied to the diagnotic of a nuclear reactor core: processing of thermal signals providing from out-of-reactor simulation

    International Nuclear Information System (INIS)

    Smolarz, A.

    1982-07-01

    Development of an evolution detection algorithm which aim is to extend the application field of the form recognition analysis to the diagnosis and follow-up of a complex system: study of the data from the out-of-reactor test loop with forced convection in sodium, study and description of a reject classification algorithm developed in the general point of view of evolution detection. This method is tested with theoretical data and with experimental data provided by the second test loop ISIS [fr

  12. The Academic Advantage: Gender Disparities in Patenting

    Science.gov (United States)

    Sugimoto, Cassidy R.; Ni, Chaoqun; West, Jevin D.; Larivière, Vincent

    2015-01-01

    We analyzed gender disparities in patenting by country, technological area, and type of assignee using the 4.6 million utility patents issued between 1976 and 2013 by the United States Patent and Trade Office (USPTO). Our analyses of fractionalized inventorships demonstrate that women’s rate of patenting has increased from 2.7% of total patenting activity to 10.8% over the nearly 40-year period. Our results show that, in every technological area, female patenting is proportionally more likely to occur in academic institutions than in corporate or government environments. However, women’s patents have a lower technological impact than that of men, and that gap is wider in the case of academic patents. We also provide evidence that patents to which women—and in particular academic women—contributed are associated with a higher number of International Patent Classification (IPC) codes and co-inventors than men. The policy implications of these disparities and academic setting advantages are discussed. PMID:26017626

  13. Advantages and limitations of peer assessment

    Directory of Open Access Journals (Sweden)

    Karmen Goršak, Karmen Pižorn

    2010-12-01

    Full Text Available This article examines current theoretical work and research findings regarding the effectiveness of peer assessment. The main purpose of the article is to define peer asses sment and its subcategory peer feedback and to present the advantages and limitations of peer assessment derived from different research findings. In addition, conditions and strategies to successfully guarantee the benefits of peer assessment are presented. The main research studies, mentioned in this article, have been carried out in different disciplines in higher education programmes and their findings reveal positive students’ and teachers’ attitude to peer assessment as well as high correlation between peers’ and te achers’ grades. The main results of the studies show a positive effect of peer assessment on student’s active role in the process of learning and assessment, the development of social and professional skills, student’s autonomy, critical thinking, peer and selfassessment skills. Recommendations for implementing peer assessment within foreign language tea ching, as well as implications for future research work are provided.

  14. The academic advantage: gender disparities in patenting.

    Directory of Open Access Journals (Sweden)

    Cassidy R Sugimoto

    Full Text Available We analyzed gender disparities in patenting by country, technological area, and type of assignee using the 4.6 million utility patents issued between 1976 and 2013 by the United States Patent and Trade Office (USPTO. Our analyses of fractionalized inventorships demonstrate that women's rate of patenting has increased from 2.7% of total patenting activity to 10.8% over the nearly 40-year period. Our results show that, in every technological area, female patenting is proportionally more likely to occur in academic institutions than in corporate or government environments. However, women's patents have a lower technological impact than that of men, and that gap is wider in the case of academic patents. We also provide evidence that patents to which women--and in particular academic women--contributed are associated with a higher number of International Patent Classification (IPC codes and co-inventors than men. The policy implications of these disparities and academic setting advantages are discussed.

  15. Using integration technology as a strategic advantage.

    Science.gov (United States)

    Fry, P A

    1993-08-01

    The underlying premise of the Managed Competition Act previously cited is that through managed competition providers will be forced to lower care costs while increasing the level of positive care outcomes. Because it may also be that tomorrow's hospitals will find a severe rationing of technology, what can they do to prepare? Most of the systems in place today already have built within them all the necessary potential to address this premise and technology requirement with no change, no conversion, no expense for new equipment and software, and no disruption in day-to-day operations, just a little re-engineering. Today, however, these systems are similar to a 20-mule team pulling in different directions: all the power is there, but the wagon remains motionless and totally unable to reach its objective. It takes a skilled wagonmaster to bring them together, to make the mules work as a cohesive unit, to make the power of 20 mules greater than the sum of 20 mules. So it is and will be for the hospital of tomorrow. System integration is no longer a question of whether but of when. Those hospitals that use it today as a strategic advantage will be in a better position tomorrow to use it as a competitive strategic advantage in an environment that will reward low cost and high positive care outcomes and will penalize those that cannot compete. The technology is already here and economically within reach of nearly every hospital, just waiting to be used. The question that must nag all of us who want to make the health care system of America better is, Why not make the when now? Rich Helppie, president of Superior Consultant Company, summarized the solution well: The old ways will not give way to the new overnight. The re-engineering process in healthcare must evolve. Compared to the last 20 years, however, such evolution may appear to be a massive, forthright, complete, comprehensive, drastic and rapid revolution. Survival is the name of the game, and for healthcare

  16. Applications versus properties of Mg–Al layered double hydroxides provided by their syntheses methods: Alkoxide and alkoxide-free sol–gel syntheses and hydrothermal precipitation

    KAUST Repository

    Chubar, Natalia

    2013-12-01

    A tremendous number of studies have examined layered double hydroxides (LDH) for their technological applications in the ion exchange removal of toxic ions, recovery of valuable substances, catalysis, CO2 capture, as a layered host for storage/delivery of biologically active molecules, additives to plastics and building materials, and other functions. Numerous publications always conclude that the materials (prepared, as a rule, using the oldest synthesis method) are very promising for each investigated application; however, the main chemical industries producing these materials advertise them mainly (or only) as plastic additives. The authors performed extensive research using many of the appropriate methods to compare the structure, surface and adsorptive properties of three Mg-Al LHDs produced by advanced synthesis methods. One industrial sample (by Sasol, Germany) prepared by the alkoxide sol-gel method and two novel Mg-Al LDHs synthesised in-house by alkoxide-free sol-gel and hydrothermal precipitation approaches were investigated. Reasons for the very different adsorptive selectivity of the three LDHs towards arsenate, selenate, phosphate, arsenite and selenite have been provided, highlighting the role of speciation of the interlayer carbonate, aluminium, magnesium, interlayer hydration and moisture content in the adsorptive selectivity towards each toxic anion. This work is the first report presenting the regularities of the LDHs structure, surface and anion exchange properties as a function of their syntheses method. It establishes the links to potential technological applications of each investigated LDH and explains the necessary properties required to make the technological application cost-effective and efficient. The paper might accelerate industrial applications of these advanced materials. © 2013 Elsevier B.V.

  17. Competitive advantage of PET/MRI

    Energy Technology Data Exchange (ETDEWEB)

    Jadvar, Hossein, E-mail: jadvar@usc.edu; Colletti, Patrick M.

    2014-01-15

    Multimodality imaging has made great strides in the imaging evaluation of patients with a variety of diseases. Positron emission tomography/computed tomography (PET/CT) is now established as the imaging modality of choice in many clinical conditions, particularly in oncology. While the initial development of combined PET/magnetic resonance imaging (PET/MRI) was in the preclinical arena, hybrid PET/MR scanners are now available for clinical use. PET/MRI combines the unique features of MRI including excellent soft tissue contrast, diffusion-weighted imaging, dynamic contrast-enhanced imaging, fMRI and other specialized sequences as well as MR spectroscopy with the quantitative physiologic information that is provided by PET. Most evidence for the potential clinical utility of PET/MRI is based on studies performed with side-by-side comparison or software-fused MRI and PET images. Data on distinctive utility of hybrid PET/MRI are rapidly emerging. There are potential competitive advantages of PET/MRI over PET/CT. In general, PET/MRI may be preferred over PET/CT where the unique features of MRI provide more robust imaging evaluation in certain clinical settings. The exact role and potential utility of simultaneous data acquisition in specific research and clinical settings will need to be defined. It may be that simultaneous PET/MRI will be best suited for clinical situations that are disease-specific, organ-specific, related to diseases of the children or in those patients undergoing repeated imaging for whom cumulative radiation dose must be kept as low as reasonably achievable. PET/MRI also offers interesting opportunities for use of dual modality probes. Upon clear definition of clinical utility, other important and practical issues related to business operational model, clinical workflow and reimbursement will also be resolved.

  18. Competitive advantage of PET/MRI.

    Science.gov (United States)

    Jadvar, Hossein; Colletti, Patrick M

    2014-01-01

    Multimodality imaging has made great strides in the imaging evaluation of patients with a variety of diseases. Positron emission tomography/computed tomography (PET/CT) is now established as the imaging modality of choice in many clinical conditions, particularly in oncology. While the initial development of combined PET/magnetic resonance imaging (PET/MRI) was in the preclinical arena, hybrid PET/MR scanners are now available for clinical use. PET/MRI combines the unique features of MRI including excellent soft tissue contrast, diffusion-weighted imaging, dynamic contrast-enhanced imaging, fMRI and other specialized sequences as well as MR spectroscopy with the quantitative physiologic information that is provided by PET. Most evidence for the potential clinical utility of PET/MRI is based on studies performed with side-by-side comparison or software-fused MRI and PET images. Data on distinctive utility of hybrid PET/MRI are rapidly emerging. There are potential competitive advantages of PET/MRI over PET/CT. In general, PET/MRI may be preferred over PET/CT where the unique features of MRI provide more robust imaging evaluation in certain clinical settings. The exact role and potential utility of simultaneous data acquisition in specific research and clinical settings will need to be defined. It may be that simultaneous PET/MRI will be best suited for clinical situations that are disease-specific, organ-specific, related to diseases of the children or in those patients undergoing repeated imaging for whom cumulative radiation dose must be kept as low as reasonably achievable. PET/MRI also offers interesting opportunities for use of dual modality probes. Upon clear definition of clinical utility, other important and practical issues related to business operational model, clinical workflow and reimbursement will also be resolved. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  19. Competitive advantage of PET/MRI

    International Nuclear Information System (INIS)

    Jadvar, Hossein; Colletti, Patrick M.

    2014-01-01

    Multimodality imaging has made great strides in the imaging evaluation of patients with a variety of diseases. Positron emission tomography/computed tomography (PET/CT) is now established as the imaging modality of choice in many clinical conditions, particularly in oncology. While the initial development of combined PET/magnetic resonance imaging (PET/MRI) was in the preclinical arena, hybrid PET/MR scanners are now available for clinical use. PET/MRI combines the unique features of MRI including excellent soft tissue contrast, diffusion-weighted imaging, dynamic contrast-enhanced imaging, fMRI and other specialized sequences as well as MR spectroscopy with the quantitative physiologic information that is provided by PET. Most evidence for the potential clinical utility of PET/MRI is based on studies performed with side-by-side comparison or software-fused MRI and PET images. Data on distinctive utility of hybrid PET/MRI are rapidly emerging. There are potential competitive advantages of PET/MRI over PET/CT. In general, PET/MRI may be preferred over PET/CT where the unique features of MRI provide more robust imaging evaluation in certain clinical settings. The exact role and potential utility of simultaneous data acquisition in specific research and clinical settings will need to be defined. It may be that simultaneous PET/MRI will be best suited for clinical situations that are disease-specific, organ-specific, related to diseases of the children or in those patients undergoing repeated imaging for whom cumulative radiation dose must be kept as low as reasonably achievable. PET/MRI also offers interesting opportunities for use of dual modality probes. Upon clear definition of clinical utility, other important and practical issues related to business operational model, clinical workflow and reimbursement will also be resolved

  20. Examining inequalities in uptake of maternal health care and choice of provider in underserved urban areas of Mumbai, India: a mixed methods study.

    Science.gov (United States)

    Alcock, Glyn; Das, Sushmita; Shah More, Neena; Hate, Ketaki; More, Sharda; Pantvaidya, Shanti; Osrin, David; Houweling, Tanja A J

    2015-09-28

    Discussions of maternity care in developing countries tend to emphasise service uptake and overlook choice of provider. Understanding how families choose among health providers is essential to addressing inequitable access to care. Our objectives were to quantify the determinants and choice of maternity care provider in Mumbai's informal urban settlements, and to explore the reasons underlying their choices. The study was conducted in informal urban communities in eastern Mumbai. We developed regression models using data from a census of married women aged 15-49 to test for associations between maternal characteristics and uptake of care and choice of provider. We then conducted seven focus group discussions and 16 in-depth interviews with purposively selected participants, and used grounded theory methods to examine the reasons for their choices. Three thousand eight hundred forty-eight women who had given birth in the preceding 2 years were interviewed in the census. The odds of institutional prenatal and delivery care increased with education, economic status, and duration of residence in Mumbai, and decreased with parity. Tertiary public hospitals were the commonest site of care, but there was a preference for private hospitals with increasing socio-economic status. Women were more likely to use tertiary public hospitals for delivery if they had fewer children and were Hindu. The odds of delivery in the private sector increased with maternal education, wealth, age, recent arrival in Mumbai, and Muslim faith. Four processes were identified in choosing a health care provider: exploring the options, defining a sphere of access, negotiating autonomy, and protective reasoning. Women seeking a positive health experience and outcome adopted strategies to select the best or most suitable, accessible provider. In Mumbai's informal settlements, institutional maternity care is the norm, except among recent migrants. Poor perceptions of primary public health facilities

  1. District health manager and mid-level provider perceptions of practice environments in acute obstetric settings in Tanzania: a mixed-method study.

    Science.gov (United States)

    Ng'ang'a, Njoki; Byrne, Mary Woods; Kruk, Margaret E; Shemdoe, Aloisia; de Pinho, Helen

    2016-08-08

    In sub-Saharan Africa, the capacity of human resources for health (HRH) managers to create positive practice environments that enable motivated, productive, and high-performing HRH is weak. We implemented a unique approach to examining HRH management practices by comparing perspectives offered by mid-level providers (MLPs) of emergency obstetric care (EmOC) in Tanzania to those presented by local health authorities, known as council health management teams (CHMTs). This study was guided by the basic strategic human resources management (SHRM) component model. A convergent mixed-method design was utilized to assess qualitative and quantitative data from the Health Systems Strengthening for Equity: The Power and Potential of Mid-Level Providers project. Survey data was obtained from 837 mid-level providers, 83 of whom participated in a critical incident interview whose aim was to elicit negative events in the practice environment that induced intention to leave their job. HRH management practices were assessed quantitatively in 48 districts with 37 members of CHMTs participating in semi-structured interviews. The eight human resources management practices enumerated in the basic SHRM component model were implemented unevenly. On the one hand, members of CHMTs and mid-level providers agreed that there were severe shortages of health workers, deficient salaries, and an overwhelming workload. On the other hand, members of CHMTs and mid-level providers differed in their perspectives on rewards and allocation of opportunities for in-service training. Although written standards of performance and supervision requirements were available in most districts, they did not reflect actual duties. Members of CHMTs reported high levels of autonomy in key HRH management practices, but mid-level providers disputed the degree to which the real situation on the ground was factored into job-related decision-making by CHMTs. The incongruence in perspectives offered by members of CHMTs

  2. The relation between proactive environmental strategies and competitive advantage

    Science.gov (United States)

    Butnariu, A.; Avasilcăi, S.

    2015-11-01

    There are two distinct orientations of the environmental management that companies may adopt: the model of compliance and the strategic model. The strategic model treats environmental expenses as investments that will lead to competitive advantage for the company. Nevertheless, there are few scientific works that prove the relation between corporate environmental investments and competitive advantage. Thereby, in order to bring clarifications about the profound implications of environmental investments, in the first stage of our research we have proposed the hypothesis that the environmental investments would probably lead to competitive advantage by creating capabilities that are mediators of this relation. In the second stage we have tested this hypothesis, using the research method of survey. A questionnaire was sent to managers in textile Romanian industry, and 109 answers were received. The data was analysed using the linear multiple regression method and the results confirm our hypothesis.

  3. Exploring the sequential lineup advantage using WITNESS.

    Science.gov (United States)

    Goodsell, Charles A; Gronlund, Scott D; Carlson, Curt A

    2010-12-01

    Advocates claim that the sequential lineup is an improvement over simultaneous lineup procedures, but no formal (quantitatively specified) explanation exists for why it is better. The computational model WITNESS (Clark, Appl Cogn Psychol 17:629-654, 2003) was used to develop theoretical explanations for the sequential lineup advantage. In its current form, WITNESS produced a sequential advantage only by pairing conservative sequential choosing with liberal simultaneous choosing. However, this combination failed to approximate four extant experiments that exhibited large sequential advantages. Two of these experiments became the focus of our efforts because the data were uncontaminated by likely suspect position effects. Decision-based and memory-based modifications to WITNESS approximated the data and produced a sequential advantage. The next step is to evaluate the proposed explanations and modify public policy recommendations accordingly.

  4. Measuring Coding Intensity in Medicare Advantage - SUPP.

    Data.gov (United States)

    U.S. Department of Health & Human Services — In 2004, Medicare implemented a risk-adjustment system that pays Medicare Advantage (MA) plans based on diagnoses reported for their enrollees, giving the plans an...

  5. AquAdvantage Salmon Genetically modified organism

    OpenAIRE

    Núñez Saurí, Ester; Universitat Autònoma de Barcelona. Facultat de Veterinària

    2014-01-01

    Póster AquAdvantage Salmon is a genetically modified organism developed by AquBounty Technologies. The objective of this transgenic organism is to increase the growth rate to obtain the same of conventional salmon faster.

  6. Tanzania's Revealed Comparative Advantage and Structural ...

    African Journals Online (AJOL)

    example, the contribution from vegetable products fell by 7%, and that from textiles .... 43 -‐ Furskins and artificial fur, manufactures thereof ... example, while Tanzania has comparative advantage in raw hides and skins (see Figure 6), it.

  7. The Temporal Limits of Technological Advantage

    Science.gov (United States)

    2017-06-01

    technologically advanced capabilities. “ Technology , in fact, is one of the keys to understanding relations between Hitler’s regime and the German business ...strategy sought to “leverage US advantages in technologies 2 like big data, stealth, advanced manufacturing (e.g. 3-D printing), robotics, and... history has had different parameters and different results, examining historical situations in which a technological advantage has been achieved

  8. MOLDOVA: MISSED ADVANTAGES OF EURASIAN INTEGRATION

    Directory of Open Access Journals (Sweden)

    Ludmila Vasiljevna Fokina

    2015-01-01

    Full Text Available The article is devoted to potentially missed advantages of Eurasian integration (EAEU for Moldova. Special attention is given to the branches in which the country could get evident advantages including agriculture, power engineering, external trade ties with the EAEU countries. Possible positive effects of Eurasian integration in solution of the Transnistrian problem, in the sphere of labour migration and other fields are also shown.

  9. COMPETITIVE ADVANTAGE IN THE ENTERPRISE PERFORMANCE

    OpenAIRE

    PRUNEA Ana Daniela

    2014-01-01

    Rapid changes in market characteristics and the technological innovations are common and faster challenges, resulting in products, processes and technologies. The competitive advantage is volatile, difficult to obtain and more difficult to maintain and strengthened with consumers who through their individual choices polarization confirms the recognition performance and award competitive advantages, thus causing the competitive ranking of companies present in a particular market. The competiti...

  10. ENTERPRISE IRELAND: Design for Competitive Advantage Conference

    OpenAIRE

    Dee, Peter

    2003-01-01

    A stimulating conference bringing together world leading experts on design to address the importance of brand development strategies to achieve competitive advantage. Peter Dee - Strategic Design and Marketing Consultant, specialised in the creation of brand development strategies for Enterprise Ireland’s Design Unit. Peter was responsible for the design and development of the the brand identity for the Enterprise Ireland Design for Competitive Advantage Conference in Dublin.

  11. Theoretical aspects of competitive advantage and competition

    OpenAIRE

    Hudakova, Ivana

    2009-01-01

    The concept of competitive advantage is well-known for many of us and a number of literary resources focused on entrepreneurship and functioning of economies deal with it, either directly or indirectly. The understanding of the term competitive advantage though sometimes varies. One can only perceive it when looking at it as a whole, a live organism that is constantly developing in a complex dynamic entrepreneurial environment, the individual parts of which do not function when separated from...

  12. Health care providers' perceived barriers to and need for the implementation of a national integrated health care standard on childhood obesity in the Netherlands - a mixed methods approach.

    Science.gov (United States)

    Schalkwijk, Annemarie A H; Nijpels, Giel; Bot, Sandra D M; Elders, Petra J M

    2016-03-08

    In 2010, a national integrated health care standard for (childhood) obesity was published and disseminated in the Netherlands. The aim of this study is to gain insight into the needs of health care providers and the barriers they face in terms of implementing this integrated health care standard. A mixed-methods approach was applied using focus groups, semi-structured, face-to-face interviews and an e-mail-based internet survey. The study's participants included: general practitioners (GPs) (focus groups); health care providers in different professions (face-to-face interviews) and health care providers, including GPs; youth health care workers; pediatricians; dieticians; psychologists and physiotherapists (survey). First, the transcripts from the focus groups were analyzed thematically. The themes identified in this process were then used to analyze the interviews. The results of the analysis of the qualitative data were used to construct the statements used in the e-mail-based internet survey. Responses to items were measured on a 5-point Likert scale and were categorized into three outcomes: 'agree' or 'important' (response categories 1 and 2), 'disagree' or 'not important'. Twenty-seven of the GPs that were invited (51 %) participated in four focus groups. Seven of the nine health care professionals that were invited (78 %) participated in the interviews and 222 questionnaires (17 %) were returned and included in the analysis. The following key barriers were identified with regard to the implementation of the integrated health care standard: reluctance to raise the subject; perceived lack of motivation and knowledge on the part of the parents; previous negative experiences with lifestyle programs; financial constraints and the lack of a structured multidisciplinary approach. The main needs identified were: increased knowledge and awareness on the part of both health care providers and parents/children; a social map of effective intervention; structural

  13. Competitive strategy for providers.

    Science.gov (United States)

    Hackett, M C

    1996-01-01

    National Health Service (NHS) Trusts are struggling to determine a long-term strategic direction for their organizations in response to the competitive pressures generated by the NHS reforms. The development of long-term strategic direction and the methods to implement this are presenting real challenges to the Trusts which have inherited service configurations based on bureaucratic planning frameworks rather than service configurations suited to a more competitive environment. Examines the strategic choices available to these organizations; explores the importance of identifying positive strategic choices; and discusses the advantages and disadvantages in the context of the NHS internal market.

  14. Relative Advantage: Strength for Favorable Conflict Resolution

    Science.gov (United States)

    2014-05-22

    by their extremes but by their limitations…Second: War’s original aims and methods are constantly revised by the stresses and actions of war…Third...monograph. Originally published following the Vietnam Conflict, this work provides a discussion on the “intellectual difficulty in connecting military...Derailing the Tokyo Express, Jack Coombe asserts that, “the islands of Palau, Yap, and Ulithi; and the Philippines, [were] all part of a gigantic dagger

  15. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, December 2016

    International Nuclear Information System (INIS)

    Cabellos, Oscar; ); PELLONI, Sandro; Ivanov, Evgeny; Sobes, Vladimir; Fukushima, M.; Yokoyama, Kenji; Palmiotti, Giuseppe; Kodeli, Ivo

    2016-12-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the eighth Subgroup 39 meeting, held at the OECD NEA, Boulogne-Billancourt, France, on 1-2 December 2016. It comprises all the available presentations (slides) given by the participants: A - Presentations: Welcome and actions review (Oscar CABELLOS); B - Methods: - Detailed comparison of Progressive Incremental Adjustment (PIA) sequence results involving adjustments of spectral indices and coolant density effects on the basis of the SG33 benchmark (Sandro PELLONI); - ND assessment alternatives: Validation matrix vs XS adjustment (Evgeny IVANOV); - Implementation of Resonance Parameter Sensitivity Coefficients Calculation in CE TSUNAMI-3D (Vladimir SOBES); C - Experiment analysis, sensitivity calculations and benchmarks: - Benchmark tests of ENDF/B-VIII.0 beta 1 using sodium void reactivity worth of FCA-XXVII-1 assembly (M. FUKUSHIMA, Kenji YOKOYAMA); D - Adjustments: - Cross-section adjustment based on JENDL-4.0 using new experiments on the basis of the SG33 benchmark (Kenji YOKOYAMA); - Comparison of adjustment trends with the Cielo evaluation (Sandro PELLONI); - Expanded adjustment in support of CIELO initiative (Giuseppe PALMIOTTI); - First preliminary results of the adjustment exercise using ASPIS Fe88 and SNEAK-7A/7B k_e_f_f and b_e_f_f benchmarks (Ivo KODELI); E - Future actions, deliverables: - Discussion on future of SG39 and possible new subgroup (Giuseppe PALMIOTTI); - WPEC sub-group proposal: Investigation of Covariance Data in

  16. The advantages of using photographs and video images in ...

    African Journals Online (AJOL)

    Background: The purpose of this study was to evaluate the advantages of a telephone consultation with a specialist in paediatric surgery after taking photographs and video images by a general practitioner for the diagnosis of some diseases. Materials and Methods: This was a prospective study of the reliability of paediatric ...

  17. Advantage of irradiation in food industry, technical and economical constraints

    International Nuclear Information System (INIS)

    Dupuy, P.

    1986-01-01

    Irradiation is an effective method to extend the conservation and to increase the hygienic security of food. Nevertheless the use of irradiation remains limited in food industry. The prospects of different applications are evaluated, referring to the other alternative technologies. The advantage of adequate irradiation facilities incorporated or not into the plants are compared [fr

  18. Bilingual Education and L3 Learning: Metalinguistic Advantage or Not?

    Science.gov (United States)

    Rutgers, Dieuwerke; Evans, Michael

    2017-01-01

    Metalinguistic skills are highlighted in the literature as providing bilinguals with an advantage in additional language (L3) learning. The extent to which this may apply to bilingual education and content-and-language-integrated-learning settings, however, is as yet little understood. This article reports on a study exploring and comparing the…

  19. Competitive Advantage and the Existence of the Multinational Corporation

    DEFF Research Database (Denmark)

    Geisler Asmussen, Christian; Foss, Nicolai Juul

    2014-01-01

    This article provides a counterpoint to Hashai and Buckley's article ‘Is competitive advantage a necessary condition for the emergence of the multinational enterprise?’ We agree with their conclusion that it is, in fact, not a necessary condition, but argue that the theoretical reasons behind thi...

  20. [The precautionary principle: advantages and risks].

    Science.gov (United States)

    Tubiana, M

    2001-04-01

    innovation, highly restrictive administrative procedures, and a waste of funds on the search for the utopian goal of zero risk. Other drawbacks are more insidious. The precautionary principle could contribute to a general feeling of anxiety and unease in the population. It could be used by campaigns to manipulate public opinion in favor of a particular commercial interest or ideology. Furthermore, practitioners and public policy makers could be led to make choices not dictated by a search for the optimal solution but rather a solution that would protect them from future accusations (the so-called umbrella phenomenon). On the international level, the precautionary principle must not be used to mask protectionism. Nevertheless, a clear advantage of the precautionary principle is that it requires decision-makers to explain the rationale behind their decisions, to quantify the risks, and to provide objective information. However, the physician must not be tempted to make patients sign documents certifying that they have been given all relevant information on his or her diagnosis and treatment. This example underlines the role of legal texts and jurisprudence in the application of the precautionary principle. Finally, the precautionary principle implies new obligations for the State. In the field of health and healthcare, the State must undertake actions based on fully open and undisguised decision-making and provide complete information to the public. A pplication of the precautionary principle requires much discernment because the final outcome can be beneficial or harmful, depending on the way it is implemented. The precautionary principle, and its applications, must be precise and detailed within a well-defined framework.

  1. National and International Library Collaboration: Necessity, Advantages

    Directory of Open Access Journals (Sweden)

    Timothy Mark

    2007-11-01

    Full Text Available The advantages of cooperation between research library associations can be demonstrated quite clearly. Where cooperation becomes essential is where there is a common cause to champion or an initiative to pursue for the common good. Thanks in part to the power of information communications technology, research is becoming increasingly international in scope. The members of interdisciplinary and multidisciplinary research teams are frequently drawn from across the world. Correspondingly, scholarly publishing (especially in medicine and the sciences is dominated by a few multinational publishers. In this context, issues that play a vital role in global scholarly communication - such as copyright, journal pricing, the managing of datasets, digital preservation and open access - are issues for the research library community everywhere in the world. Certainly there are many challenges at the local or regional level. However there are definite roles that research library associations can play most effectively at the national or international level. It is clear that by sharing expertise, building partnerships and alliances, it is possible to address common issues much more effectively than when working alone. What is special is that potentially the most powerful form of cooperation is advocacy at the national and international levels. It is essential for research library associations to work together at the political level to move their agenda forward. Examples are lobbying about copyright legislation (nationally, or within the EC or at WIPO; or promoting the cause of Open Access. The unique value of LIBER is to provide a forum and a platform for European research library associations to explore and benefit from cooperation and their shared strength.

  2. Searching for the Advantages of Virus Sex

    Science.gov (United States)

    Turner, Paul E.

    2003-02-01

    Sex (genetic exchange) is a nearly universal phenomenon in biological populations. But this is surprising given the costs associated with sex. For example, sex tends to break apart co-adapted genes, and sex causes a female to inefficiently contribute only half the genes to her offspring. Why then did sex evolve? One famous model poses that sex evolved to combat Muller's ratchet, the mutational load that accrues when harmful mutations drift to high frequencies in populations of small size. In contrast, the Fisher-Muller Hypothesis predicts that sex evolved to promote genetic variation that speeds adaptation in novel environments. Sexual mechanisms occur in viruses, which feature high rates of deleterious mutation and frequent exposure to novel or changing environments. Thus, confirmation of one or both hypotheses would shed light on the selective advantages of virus sex. Experimental evolution has been used to test these classic models in the RNA bacteriophage φ6, a virus that experiences sex via reassortment of its chromosomal segments. Empirical data suggest that sex might have originated in φ6 to assist in purging deleterious mutations from the genome. However, results do not support the idea that sex evolved because it provides beneficial variation in novel environments. Rather, experiments show that too much sex can be bad for φ6 promiscuity allows selfish viruses to evolve and spread their inferior genes to subsequent generations. Here I discuss various explanations for the evolution of segmentation in RNA viruses, and the added cost of sex when large numbers of viruses co-infect the same cell.

  3. The "Performance of Rotavirus and Oral Polio Vaccines in Developing Countries" (PROVIDE) study: description of methods of an interventional study designed to explore complex biologic problems.

    Science.gov (United States)

    Kirkpatrick, Beth D; Colgate, E Ross; Mychaleckyj, Josyf C; Haque, Rashidul; Dickson, Dorothy M; Carmolli, Marya P; Nayak, Uma; Taniuchi, Mami; Naylor, Caitlin; Qadri, Firdausi; Ma, Jennie Z; Alam, Masud; Walsh, Mary Claire; Diehl, Sean A; Petri, William A

    2015-04-01

    Oral vaccines appear less effective in children in the developing world. Proposed biologic reasons include concurrent enteric infections, malnutrition, breast milk interference, and environmental enteropathy (EE). Rigorous study design and careful data management are essential to begin to understand this complex problem while assuring research subject safety. Herein, we describe the methodology and lessons learned in the PROVIDE study (Dhaka, Bangladesh). A randomized clinical trial platform evaluated the efficacy of delayed-dose oral rotavirus vaccine as well as the benefit of an injectable polio vaccine replacing one dose of oral polio vaccine. This rigorous infrastructure supported the additional examination of hypotheses of vaccine underperformance. Primary and secondary efficacy and immunogenicity measures for rotavirus and polio vaccines were measured, as well as the impact of EE and additional exploratory variables. Methods for the enrollment and 2-year follow-up of a 700 child birth cohort are described, including core laboratory, safety, regulatory, and data management practices. Intense efforts to standardize clinical, laboratory, and data management procedures in a developing world setting provide clinical trials rigor to all outcomes. Although this study infrastructure requires extensive time and effort, it allows optimized safety and confidence in the validity of data gathered in complex, developing country settings. © The American Society of Tropical Medicine and Hygiene.

  4. ADVANTAGES AND THERMODYNAMIC LIMITATIONS OF THE EXPERIMENTAL SORPTION ISOSTERIC METHOD

    Directory of Open Access Journals (Sweden)

    FARID B. CORTÉS

    2013-01-01

    Full Text Available Una revisión de las ventajas y las limitaciones termodinámicas presentes en el método experimental sorción isostérica (SIM muestra que el SIM no garantiza una cantidad adsorbida constante. Las isósteras calculadas que consideran comportamiento de gas ideal muestran que en el SIM la masa de gas en el volumen muerto del sistema al incrementar la presión de equilibrio debido a los materiales desorbidos. El SIM es útil y efectivo para obtener datos termodinámicos de alta precisión para la sorción de gases en materiales micro y nanoporosos a bajas presiones y temperaturas. Por el contrario, cuando la presión y la temperatura son altas la desorción no es despreciable, por lo tanto el SIM no es aplicable. Los errores en los cálculos del calor isostérico usando SIM pueden ser reducidos usando procedimientos experimentales tradicionales como las isobaras e isotermas de adsorción para generar las isósteras a altas presiones y temperaturas. Como alternativa, correcciones por presión y temperatura, o un experimento que, después de cada incremento de temperatura permita a la dosis de gas compensar la masa desorbida, garantizaría una cantidad adsorbida constante y, por consiguiente, un comportamiento isostérico mediante medidas directas.

  5. Human resources for health strategies adopted by providers in resource-limited settings to sustain long-term delivery of ART: a mixed-methods study from Uganda.

    Science.gov (United States)

    Zakumumpa, Henry; Taiwo, Modupe Oladunni; Muganzi, Alex; Ssengooba, Freddie

    2016-10-19

    Human resources for health (HRH) constraints are a major barrier to the sustainability of antiretroviral therapy (ART) scale-up programs in Sub-Saharan Africa. Many prior approaches to HRH constraints have taken a top-down trend of generalized global strategies and policy guidelines. The objective of the study was to examine the human resources for health strategies adopted by front-line providers in Uganda to sustain ART delivery beyond the initial ART scale-up phase between 2004 and 2009. A two-phase mixed-methods approach was adopted. In the first phase, a survey of a nationally representative sample of health facilities (n = 195) across Uganda was conducted. The second phase involved in-depth interviews (n = 36) with ART clinic managers and staff of 6 of the 195 health facilities purposively selected from the first study phase. Quantitative data was analysed based on descriptive statistics, and qualitative data was analysed by coding and thematic analysis. The identified strategies were categorized into five themes: (1) providing monetary and non-monetary incentives to health workers on busy ART clinic days; (2) workload reduction through spacing ART clinic appointments; (3) adopting training workshops in ART management as a motivation strategy for health workers; (4) adopting non-physician-centred staffing models; and (5) devising ART program leadership styles that enhanced health worker commitment. Facility-level strategies for responding to HRH constraints are feasible and can contribute to efforts to increase country ownership of HIV programs in resource-limited settings. Consideration of the human resources for health strategies identified in the study by ART program planners and managers could enhance the long-term sustainment of ART programs by providers in resource-limited settings.

  6. Usability evaluation of pharmacogenomics clinical decision support aids and clinical knowledge resources in a computerized provider order entry system: a mixed methods approach.

    Science.gov (United States)

    Devine, Emily Beth; Lee, Chia-Ju; Overby, Casey L; Abernethy, Neil; McCune, Jeannine; Smith, Joe W; Tarczy-Hornoch, Peter

    2014-07-01

    Pharmacogenomics (PGx) is positioned to have a widespread impact on the practice of medicine, yet physician acceptance is low. The presentation of context-specific PGx information, in the form of clinical decision support (CDS) alerts embedded in a computerized provider order entry (CPOE) system, can aid uptake. Usability evaluations can inform optimal design, which, in turn, can spur adoption. The study objectives were to: (1) evaluate an early prototype, commercial CPOE system with PGx-CDS alerts in a simulated environment, (2) identify potential improvements to the system user interface, and (3) understand the contexts under which PGx knowledge embedded in an electronic health record is useful to prescribers. Using a mixed methods approach, we presented seven cardiologists and three oncologists with five hypothetical clinical case scenarios. Each scenario featured a drug for which a gene encoding drug metabolizing enzyme required consideration of dosage adjustment. We used Morae(®) to capture comments and on-screen movements as participants prescribed each drug. In addition to PGx-CDS alerts, 'Infobutton(®)' and 'Evidence' icons provided participants with clinical knowledge resources to aid decision-making. Nine themes emerged. Five suggested minor improvements to the CPOE user interface; two suggested presenting PGx information through PGx-CDS alerts using an 'Infobutton' or 'Evidence' icon. The remaining themes were strong recommendations to provide succinct, relevant guidelines and dosing recommendations of phenotypic information from credible and trustworthy sources; any more information was overwhelming. Participants' median rating of PGx-CDS system usability was 2 on a Likert scale ranging from 1 (strongly agree) to 7 (strongly disagree). Usability evaluation results suggest that participants considered PGx information important for improving prescribing decisions; and that they would incorporate PGx-CDS when information is presented in relevant and

  7. Commit to Building on New England's "Employability" Advantage!

    Science.gov (United States)

    Gittell, Ross

    2017-01-01

    Higher education has provided New England with an economic advantage, as the region without strong natural resource advantages has relied on its higher education institutions (HEIs) and brainpower. A higher education-based economic advantage has enabled the region to develop strong well-paying technology and knowledge-based industries tied to New…

  8. Using data mining techniques to explore physicians' therapeutic decisions when clinical guidelines do not provide recommendations: methods and example for type 2 diabetes

    Directory of Open Access Journals (Sweden)

    Toussi Massoud

    2009-06-01

    Full Text Available Abstract Background Clinical guidelines carry medical evidence to the point of practice. As evidence is not always available, many guidelines do not provide recommendations for all clinical situations encountered in practice. We propose an approach for identifying knowledge gaps in guidelines and for exploring physicians' therapeutic decisions with data mining techniques to fill these knowledge gaps. We demonstrate our method by an example in the domain of type 2 diabetes. Methods We analyzed the French national guidelines for the management of type 2 diabetes to identify clinical conditions that are not covered or those for which the guidelines do not provide recommendations. We extracted patient records corresponding to each clinical condition from a database of type 2 diabetic patients treated at Avicenne University Hospital of Bobigny, France. We explored physicians' prescriptions for each of these profiles using C5.0 decision-tree learning algorithm. We developed decision-trees for different levels of detail of the therapeutic decision, namely the type of treatment, the pharmaco-therapeutic class, the international non proprietary name, and the dose of each medication. We compared the rules generated with those added to the guidelines in a newer version, to examine their similarity. Results We extracted 27 rules from the analysis of a database of 463 patient records. Eleven rules were about the choice of the type of treatment and thirteen rules about the choice of the pharmaco-therapeutic class of each drug. For the choice of the international non proprietary name and the dose, we could extract only a few rules because the number of patient records was too low for these factors. The extracted rules showed similarities with those added to the newer version of the guidelines. Conclusion Our method showed its usefulness for completing guidelines recommendations with rules learnt automatically from physicians' prescriptions. It could be used

  9. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, November 2014

    International Nuclear Information System (INIS)

    Aufiero, Manuele; Ivanov, Evgeny; Hoefer, Axel; Yokoyama, Kenji; Da Cruz, Dirceu Ferreira; KODELI, Ivan-Alexander; Hursin, Mathieu; Pelloni, Sandro; Palmiotti, Giuseppe; Salvatores, Massimo; Barnes, Andrew; Cabellos De Francisco, Oscar; ); Ivanova, Tatiana; )

    2014-11-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the third formal Subgroup meeting held at the NEA, Issy-les-Moulineaux, France, on 27-28 November 2014. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Sensitivity methods: 1 - Perturbation/sensitivity calculations with Serpent (M. Aufiero); 2 - Comparison of deterministic and Monte Carlo sensitivity analysis of SNEAK-7A and FLATTOP-Pu Benchmarks (I. Kodeli); B - Integral experiments: 1 - PROTEUS experiments: selected experiments sensitivity profiles and availability, (M. Hursin, M. Salvatores - PROTEUS Experiments, HCLWR configurations); 2 - SINBAD Benchmark Database and FNS/JAEA Liquid Oxygen TOF Experiment Analysis (I. Kodeli); 3 - STEK experiment Opportunity for Validation of Fission Products Nuclear Data (D. Da Cruz); 4 - SEG (tailored adjoint flux shapes) (M. Savatores - comments) 5 - IPPE transmission experiments (Fe, 238 U) (T. Ivanova); 6 - RPI semi-integral (Fe, 238 U) (G. Palmiotti - comments); 7 - New experiments, e.g. in connection with the new NSC Expert Group on 'Improvement of Integral Experiments Data for Minor Actinide Management' (G. Palmiotti - Some comments from the Expert Group) 8 - Additional PSI adjustment studies accounting for nonlinearity (S. Pelloni); 9 - Adjustment methodology issues (G. Palmiotti); C - Am-241 and fission product issues: 1 - Am-241 validation for criticality-safety calculations (A. Barnes - Visio

  10. Competitive advantage: an analytical framework based on entrepreneurship

    Institute of Scientific and Technical Information of China (English)

    LIU Zhibiao

    2006-01-01

    This article observes and studies the role and effect of entrepreneurship within the theoretical framework of resource-based view(RBV).It advances competitive advantage theory based on entrepreneurship by proving the distinctiveness of entrepreneurship. Distinctive cognition competence of entrepreneurs provides them with personal specific assets,which determines both the competence to explore new business opportunities and the competence to integrate resources for risk activities.The characteristics of such intangible resource as entrepreneurship,such as its distinctiveness,limitedness of competition,and incomplete mobility of factors,are the most important sources of competitive advantage of enterprises in the strategic management theory of RBV.

  11. Perceptions of health care providers and patients on quality of care in maternal and neonatal health in fourteen Bangladesh government healthcare facilities: a mixed-method study.

    Science.gov (United States)

    Islam, Farzana; Rahman, Aminur; Halim, Abdul; Eriksson, Charli; Rahman, Fazlur; Dalal, Koustuv

    2015-06-19

    Bangladesh has achieved remarkable progress in healthcare with a steady decline in maternal and under-5 child mortality rates in efforts to achieve Millennium Development Goals 4 and 5. However, the mortality rates are still very high compared with high-income countries. The quality of healthcare needs improve to reduce mortality rates further. It is essential to investigate the current quality of healthcare before implementing any interventions. The study was conducted to explore the perception of healthcare providers about the quality of maternal and neonatal health (MNH) care. The study also investigated patient satisfaction with the MNH care received from district and sub-district hospitals. Both qualitative and quantitative methods were used in the study. Two district and 12 sub-district hospitals in Thakurgaon and Jamalpur in Bangladesh were the study settings. Fourteen group discussions and 56 in-depth interviews were conducted among the healthcare providers. Client exit interviews were conducted with 112 patients and their attendants from maternity, labor, and neonatal wards before being discharged from the hospitals. Eight physicians and four anthropologists collected data between November and December 2011 using pretested guidelines. The hospital staff identified several key factors that affected the quality of patient care: shortage of staff and logistics; lack of laboratory support; under use of patient-management protocols; a lack of training; and insufficient supervision. Doctors were unable to provide optimal care because of the high volume of patients. The exit interviews revealed that 85 % of respondents were satisfied with the hospital services received. Seven out of 14 respondents were satisfied with the cleanliness of the hospital facilities. More than half of the respondents were satisfied with the drugs they received. In half of the facilities, patients did not get an opportunity to ask the healthcare providers questions about their health

  12. Competing through operations and supply: The role of classic and extended resource-based advantage

    OpenAIRE

    Lewis, Michael; Brandon-Jones, Alistair; Slack, Nigel; Howard, Mickey

    2010-01-01

    Purpose: The paper seeks to analyze the evolution of competitive advantage using both "classic" and "extended" resource-based theory (RBT). The aim is to examine the different ways in which "classic" and "extended" resource-based advantage develops and how they might combine to create long-term advantage. Design/methodology/approach: A single case study method is used to examine the process by which competitive advantage has accumulated over a 50-year period at Food Services Group Inc., a hig...

  13. An analysis of home advantage in Iranian football super league

    Directory of Open Access Journals (Sweden)

    Rasool Hemayat TALAB

    2016-12-01

    Full Text Available Aim: The purpose of this study was to investigate home advantage in Iranian Football Super League. Methods: The information regarding wins, losses, goals for, goals against, yellow cards, red cards and gained points in matches at home and away of Super League teams of Iran was obtained using the internet website www.Soccerway.com and was analyzed. Results: The results showed that the mean of wins, goals for and points gained from matches in the home have been more than matches away, but in matches away, the mean of losses, yellow cards, red cards and goals against have been higher. Also, the percentage of home advantage in Iranian Football Super League was close to international norms.  Conclusion: According to the results, sport psychologist, coaches and people who are involved in football are recommended to pay more attention to this advantage and make short and long term plans to do psychological readiness and competitive performance.

  14. Maize ROP2 GTPase provides a competitive advantage to the male gametophyte.

    Science.gov (United States)

    Arthur, K M; Vejlupkova, Z; Meeley, R B; Fowler, J E

    2003-12-01

    Rop GTPases have been implicated in the regulation of plant signal transduction and cell morphogenesis. To explore ROP2 function in maize, we isolated five Mutator transposon insertions (rop2::Mu alleles). Transmission frequency through the male gametophyte, but not the female, was lower than expected in three of the rop2::Mu mutants. These three alleles formed an allelic series on the basis of the relative transmission rate of each when crossed as trans-heterozygotes. A dramatic reduction in the level of ROP2-mRNA in pollen was associated with the three alleles causing a transmission defect, whereas a rop2::Mu allele that did not result in a defect had wild-type transcript levels, thus confirming that mutation of rop2 causes the mutant phenotype. These data strongly support a role for rop2 in male gametophyte function, perhaps surprisingly, given the expression in pollen of the nearly identical duplicate gene rop9. However, the transmission defect was apparent only when a rop2::Mu heterozygote was used as the pollen donor or when a mixture of wild-type and homozygous mutant pollen was used. Thus, mutant pollen is at a competitive disadvantage compared to wild-type pollen, although mutant pollen grains lacked an obvious cellular defect. Our data demonstrate the importance in vivo of a specific Rop, rop2, in the male gametophyte.

  15. Pyruvate decarboxylase provides growing pollen tubes with a competitive advantage in petunia.

    Science.gov (United States)

    Gass, Nathalie; Glagotskaia, Tatiana; Mellema, Stefan; Stuurman, Jeroen; Barone, Mario; Mandel, Therese; Roessner-Tunali, Ute; Kuhlemeier, Cris

    2005-08-01

    Rapid pollen tube growth places unique demands on energy production and biosynthetic capacity. The aim of this work is to understand how primary metabolism meets the demands of such rapid growth. Aerobically grown pollen produce ethanol in large quantities. The ethanolic fermentation pathway consists of two committed enzymes: pyruvate decarboxylase (PDC) and alcohol dehydrogenase (ADH). Because adh mutations do not affect male gametophyte function, the obvious question is why pollen synthesize an abundant enzyme if they could do just as well without. Using transposon tagging in Petunia hybrida, we isolated a null mutant in pollen-specific Pdc2. Growth of the mutant pollen tubes through the style is reduced, and the mutant allele shows reduced transmission through the male, when in competition with wild-type pollen. We propose that not ADH but rather PDC is the critical enzyme in a novel, pollen-specific pathway. This pathway serves to bypass pyruvate dehydrogenase enzymes and thereby maintain biosynthetic capacity and energy production under the unique conditions prevailing during pollen-pistil interaction.

  16. Colour change on different body regions provides thermal and signalling advantages in bearded dragon lizards

    Science.gov (United States)

    Cadena, Viviana; Porter, Warren P.; Kearney, Michael R.

    2016-01-01

    Many terrestrial ectotherms are capable of rapid colour change, yet it is unclear how these animals accommodate the multiple functions of colour, particularly camouflage, communication and thermoregulation, especially when functions require very different colours. Thermal benefits of colour change depend on an animal's absorptance of solar energy in both UV–visible (300–700 nm) and near-infrared (NIR; 700–2600 nm) wavelengths, yet colour research has focused almost exclusively on the former. Here, we show that wild-caught bearded dragon lizards (Pogona vitticeps) exhibit substantial UV–visible and NIR skin reflectance change in response to temperature for dorsal but not ventral (throat and upper chest) body regions. By contrast, lizards showed the greatest temperature-independent colour change on the beard and upper chest during social interactions and as a result of circadian colour change. Biophysical simulations of heat transfer predicted that the maximum temperature-dependent change in dorsal reflectivity could reduce the time taken to reach active body temperature by an average of 22 min per active day, saving 85 h of basking time throughout the activity season. Our results confirm that colour change may serve a thermoregulatory function, and competing thermoregulation and signalling requirements may be met by partitioning colour change to different body regions in different circumstances.

  17. L-fucose utilization provides Campylobacter jejuni with a competitive advantage.

    Science.gov (United States)

    Stahl, Martin; Friis, Lorna M; Nothaft, Harald; Liu, Xin; Li, Jianjun; Szymanski, Christine M; Stintzi, Alain

    2011-04-26

    Campylobacter jejuni is a prevalent gastrointestinal pathogen in humans and a common commensal of poultry. When colonizing its hosts, C. jejuni comes into contact with intestinal carbohydrates, including L-fucose, released from mucin glycoproteins. Several strains of C. jejuni possess a genomic island (cj0480c-cj0490) that is up-regulated in the presence of both L-fucose and mucin and allows for the utilization of L-fucose as a substrate for growth. Strains possessing this genomic island show increased growth in the presence of L-fucose and mutation of cj0481, cj0486, and cj0487 results in the loss of the ability to grow on this substrate. Furthermore, mutants in the putative fucose permease (cj0486) are deficient in fucose uptake and demonstrate a competitive disadvantage when colonizing the piglet model of human disease, which is not paralleled in the colonization of poultry. This identifies a previously unrecorded metabolic pathway in select strains of C. jejuni associated with a virulent lifestyle.

  18. A genomic island provides Acidithiobacillus ferrooxidans ATCC 53993 additional copper resistance: a possible competitive advantage.

    Science.gov (United States)

    Orellana, Luis H; Jerez, Carlos A

    2011-11-01

    There is great interest in understanding how extremophilic biomining bacteria adapt to exceptionally high copper concentrations in their environment. Acidithiobacillus ferrooxidans ATCC 53993 genome possesses the same copper resistance determinants as strain ATCC 23270. However, the former strain contains in its genome a 160-kb genomic island (GI), which is absent in ATCC 23270. This GI contains, amongst other genes, several genes coding for an additional putative copper ATPase and a Cus system. A. ferrooxidans ATCC 53993 showed a much higher resistance to CuSO(4) (>100 mM) than that of strain ATCC 23270 (<25 mM). When a similar number of bacteria from each strain were mixed and allowed to grow in the absence of copper, their respective final numbers remained approximately equal. However, in the presence of copper, there was a clear overgrowth of strain ATCC 53993 compared to ATCC 23270. This behavior is most likely explained by the presence of the additional copper-resistance genes in the GI of strain ATCC 53993. As determined by qRT-PCR, it was demonstrated that these genes are upregulated when A. ferrooxidans ATCC 53993 is grown in the presence of copper and were shown to be functional when expressed in copper-sensitive Escherichia coli mutants. Thus, the reason for resistance to copper of two strains of the same acidophilic microorganism could be determined by slight differences in their genomes, which may not only lead to changes in their capacities to adapt to their environment, but may also help to select the more fit microorganisms for industrial biomining operations. © Springer-Verlag 2011

  19. The Relational View of Interorganizational Competitive Advantage

    DEFF Research Database (Denmark)

    Hu, Yimei; Zhang, Si; Li, Jizhen

    Collaborating with external partners on R&D and forming strategic partnership for R&D have been popular phenomena for long, which leads new development in existing theories. Though the relational view of competitive advantage has been proposed for more than a decade, few in-depth empirical...... they generate relational rents (interorganizational competitive advantage) from this alliance? Based on this case study, we will propose some implications for the R&D collaboration between Chinese and Scandinavian countries. Also, the case will help us to test and enrich the existing theories...... on interorganizational competitive advantage. At the end of the paper, based on existing theories and the case study result, we will propose our conceptual framework on researching R&D strategic alliance between Scandinavian and Chinese firms....

  20. Using data mining techniques to explore physicians' therapeutic decisions when clinical guidelines do not provide recommendations: methods and example for type 2 diabetes.

    Science.gov (United States)

    Toussi, Massoud; Lamy, Jean-Baptiste; Le Toumelin, Philippe; Venot, Alain

    2009-06-10

    Clinical guidelines carry medical evidence to the point of practice. As evidence is not always available, many guidelines do not provide recommendations for all clinical situations encountered in practice. We propose an approach for identifying knowledge gaps in guidelines and for exploring physicians' therapeutic decisions with data mining techniques to fill these knowledge gaps. We demonstrate our method by an example in the domain of type 2 diabetes. We analyzed the French national guidelines for the management of type 2 diabetes to identify clinical conditions that are not covered or those for which the guidelines do not provide recommendations. We extracted patient records corresponding to each clinical condition from a database of type 2 diabetic patients treated at Avicenne University Hospital of Bobigny, France. We explored physicians' prescriptions for each of these profiles using C5.0 decision-tree learning algorithm. We developed decision-trees for different levels of detail of the therapeutic decision, namely the type of treatment, the pharmaco-therapeutic class, the international non proprietary name, and the dose of each medication. We compared the rules generated with those added to the guidelines in a newer version, to examine their similarity. We extracted 27 rules from the analysis of a database of 463 patient records. Eleven rules were about the choice of the type of treatment and thirteen rules about the choice of the pharmaco-therapeutic class of each drug. For the choice of the international non proprietary name and the dose, we could extract only a few rules because the number of patient records was too low for these factors. The extracted rules showed similarities with those added to the newer version of the guidelines. Our method showed its usefulness for completing guidelines recommendations with rules learnt automatically from physicians' prescriptions. It could be used during the development of guidelines as a complementary source from

  1. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, May 2014

    International Nuclear Information System (INIS)

    Aliberti, G.; Archier, P.; Dunn, M.; Dupont, E.; Hill, I.; ); Garcia, A.; Hursin, M.; Pelloni, S.; Ivanova, T.; Kodeli, I.; Palmiotti, G.; Salvatores, M.; Touran, N.; Wenming, Wang; Yokoyama, K.

    2014-05-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the second Subgroup meeting, held at the NEA, Issy-les-Moulineaux, France, on 13 May 2014. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Welcome: Review of actions (M. Salvatores); B - Inter-comparison of sensitivity coefficients: 1 - Sensitivity Computation with Monte Carlo Methods (T. Ivanova); 2 - Sensitivity analysis of FLATTOP-Pu (I. Kodeli); 3 - Sensitivity coefficients by means of SERPENT-2 (S. Pelloni); 4 - Demonstration - Database for ICSBEP (DICE) and Database and Analysis Tool for IRPhE (IDAT) (I. Hill); C - Specific new experiments: 1 - PROTEUS FDWR-II (HCLWR) program summary (M. Hursin); 2 - STEK and SEG Experiments, M. Salvatores 3 - Experiments related to "2"3"5U, "2"3"8U, "5"6Fe and "2"3Na, G. Palmiotti); 4 - Validation of Iron Cross Sections against ASPIS Experiments (JEF/DOC-420) (I. Kodeli); 5 - Benchmark analysis of Iron Cross-sections (EFFDOC-1221) (I. Kodeli 6 - Integral Beta-effective Measurements (K. Yokoyama on behalf of M. Ishikawa); D - Adjustment results: 1 - Impacts of Covariance Data and Interpretation of Adjustment Trends of ADJ2010, (K. Yokoyama); 2 - Revised Recommendations from ADJ2010 Adjustment (K. Yokoyama); 3 - Comparisons and Discussions on Adjustment trends from JEFF (CEA) (P. Archier); 4 - Feedback on CIELO Isotopes from ENDF/B-VII.0 Adjustment (G. Palmiotti); 5 - Demonstration - Plot comparisons of participants' results (E

  2. Capacity building of nurses providing neonatal care in Rio de Janeiro, Brazil: methods for the POINTS of care project to enhance nursing education and reduce adverse neonatal outcomes

    Directory of Open Access Journals (Sweden)

    Darlow Brian A

    2012-03-01

    Full Text Available Abstract Background Increased survival of preterm infants in developing countries has often been accompanied by increased morbidity. A previous study found rates of severe retinopathy of prematurity varied widely between different neonatal units in Rio de Janeiro. Nurses have a key role in the care of high-risk infants but often do not have access to ongoing education programmes. We set out to design a quality improvement project that would provide nurses with the training and tools to decrease neonatal mortality and morbidity. The purpose of this report is to describe the methods and make the teaching package (POINTS of care--six modules addressing Pain control; optimal Oxygenation; Infection control; Nutrition interventions; Temperature control; Supportive care available to others. Methods/Design Six neonatal units, caring for 40% of preterm infants in Rio de Janeiro were invited to participate. In Phase 1 of the study multidisciplinary workshops were held in each neonatal unit to identify the neonatal morbidities of interest and to plan for data collection. In Phase 2 the teaching package was developed and tested. Phase 3 consisted of 12 months data collection utilizing a simple tick-sheet for recording. In Phase 4 (the Intervention all nurses were asked to complete all six modules of the POINTS of care package, which was supplemented by practical demonstrations. Phase 5 consisted of a further 12 months data collection. In Phase 1 it was agreed to include inborn infants with birthweight ≤ 1500 g or gestational age of ≤ 34 weeks. The primary outcome was death before discharge and secondary outcomes included retinopathy of prematurity and bronchopulmonary dysplasia. Assuming 400-450 infants in both pre- and post-intervention periods the study had 80% power at p = Discussion The results of the POINTS of Care intervention will be presented in a separate publication. Trial registration Current Controlled Trials: ISRCTN83110114

  3. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, November 2013

    International Nuclear Information System (INIS)

    De Saint Jean, C.; Dupont, E.; ); Dyrda, J.; Hursin, M.; Pelloni, S.; Ishikawa, M.; Ivanov, E.; Ivanova, T.; Kim, D.H.; Ee, Y.O.; Kodeli, I.; Leal, L.; Leichtle, D.; Palmiotti, G.; Salvatores, M.; Pronyaev, V.; Simakov, S.; )

    2013-11-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the first formal Subgroup 39 meeting held at the NEA, Issy-les-Moulineaux, France, on 28-29 November 2013. It comprises a Summary Record of the meeting and all the available presentations (slides) given by the participants: A - Recent data adjustments performances and trends: 1 - Recommendations from ADJ2010 adjustment (M. Ishikawa); 2 - Feedback on CIELO isotopes from ENDF/B-VII.0 adjustment (G. Palmiotti); 3 - Sensitivity and uncertainty results on FLATTOP-Pu (I. Kodeli); 4 - SG33 benchmark: Comparative adjustment results (S. Pelloni) 5 - Integral benchmarks for data assimilation: selection of a consistent set and establishment of integral correlations (E. Ivanov); 6 - PROTEUS experimental data (M. Hursin); 7 - Additional information on High Conversion Light Water Reactor (HCLWR aka FDWR-II) experiments (14 January 2014); 8 - Data assimilation of benchmark experiments for homogenous thermal/epithermal uranium systems (J. Dyrda); B - Methodology issues: 1 - Adjustment methodology issues (G. Palmiotti); 2 - Marginalisation, methodology issues and nuclear data parameter adjustment (C. De Saint Jean); 3 - Nuclear data parameter adjustment (G. Palmiotti). A list of issues and actions conclude the document

  4. The Development of a Community-Based, Pharmacist-Provided Falls Prevention MTM Intervention for Older Adults: Relationship Building, Methods, and Rationale

    Directory of Open Access Journals (Sweden)

    David A. Mott

    2014-01-01

    Full Text Available The objectives of this article are to discuss the process of community engagement experienced to plan and implement a pilot study of a pharmacist-provided MTM intervention focused on reducing the use of medications associated with falling, and to present the research methods that emerged from the community engagement process to evaluate the feasibility, acceptance, and preliminary impact of the intervention. Key lessons learned from the community engagement process also are presented and discussed. The relationship building and planning process took twelve months. The RE-AIM framework broadly guided the planning process since an overarching goal for the community partners was developing a program that could be implemented and sustained in the future. The planning phase focused on identifying research questions that were of most interest to the community partners, the population to study, the capacity of partners to perform activities, and process evaluation. Much of the planning phase was accomplished with face-to-face meetings. After all study processes, study materials, and data collection tools were developed, a focus group of older adults who represented the likely targets of the MTM intervention provided feedback related to the concept and process of the intervention. Nine key lessons were identified from the community engagement process. One key to successful community engagement is partners taking the time to educate each other about experiences, processes, and successes and failures. Additionally, partners must actively listen to each other to better understand barriers and facilitators that likely will impact the planning and implementation processes. Successful community engagement will be important to develop both formative and summative evaluation processes that will help to produce valid evidence about the effectiveness of pharmacists in modifying drug therapy and preventing falls as well as to promote the adoption and

  5. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, May 2015

    International Nuclear Information System (INIS)

    Wang, Wenming; Yokoyama, Kenji; Kim, Do Heon; Kodeli, Ivan-Alexander; Hursin, Mathieu; Pelloni, Sandro; Palmiotti, Giuseppe; Salvatores, Massimo; Touran, Nicholas; Cabellos De Francisco, Oscar; )

    2015-05-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. This document is the proceedings of the fourth Subgroup meeting, held at the NEA, Issy-les-Moulineaux, France, on 19-20 May 2015. It comprises a Summary Record of the meeting, two papers on deliverables and all the available presentations (slides) given by the participants: 1 - Status of Deliverables: '1. Methodology' (K. Yokoyama); 2 - Status of Deliverables: '2. Comments on covariance data' (K. Yokoyama); 3 - PROTEUS HCLWR Experiments (M. Hursin); 4 - Preliminary UQ Efforts for TWR Design (N. Touran); 5 - Potential use of beta-eff and other benchmark for adjustment (I. Kodeli); 6 - k_e_f_f uncertainties for a simple case of Am"2"4"1 using different codes and evaluated files (I. Kodeli); 7 - k_e_f_f uncertainties for a simple case of Am"2"4"1 using TSUNAMI (O. Cabellos); 8 - REWIND: Ranking Experiments by Weighting to Improve Nuclear Data (G. Palmiotti); 9 - Recent analysis on NUDUNA/MOCABA applications to reactor physics parameters (E. Castro); 10 - INL exploratory study for SEG (A. Hummel); 11 - The Development of Nuclear Data Adjustment Code at CNDC (H. Wu); 12 - SG39 Perspectives (M. Salvatores). A list of issues and actions conclude the document

  6. Thoracoscopic versus robotic approaches: advantages and disadvantages.

    Science.gov (United States)

    Wei, Benjamin; D'Amico, Thomas A

    2014-05-01

    The overall advantages of thoracoscopy over thoracotomy in terms of patient recovery have been fairly well established. The use of robotics, however, is a newer and less proven modality in the realm of thoracic surgery. Robotics offers distinct advantages and disadvantages in comparison with video-assisted thoracoscopic surgery. Robotic technology is now used for a variety of complex cardiac, urologic, and gynecologic procedures including mitral valve repair and microsurgical treatment of male infertility. This article addresses the potential benefits and limitations of using the robotic platform for the performance of a variety of thoracic operations. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. THE TAX ADVANTAGES OF INCOME TAX PAYERS

    Directory of Open Access Journals (Sweden)

    SUCIU GHEORGHE

    2015-04-01

    Full Text Available The paper analyzes the cost of financing through financial and operational leasing due to the deductibility of depreciation and interest. The shareholders of any company aim to obtain profit and to increase their ownership equity. In order for this to happen, the company must have profit, for which a corporate tax must be paid. A good management translates into choosing the most advantageous means of financing, which will lead to paying a lower corporate tax. Leasing and the non-taxation of reinvested profits are two means through which companies can obtain significant fiscal advantages, by increasing the deductible expenses, or by paying lower taxes.

  8. Advantages on dry interim storage for spent nuclear fuel

    Energy Technology Data Exchange (ETDEWEB)

    Romanato, L.S. [Centro Tecnologico da Marinha em Sao Paulo, Av. Professor Lineu Prestes 2468, 05508-900 Sao Paulo (Brazil); Rzyski, B.M. [IPEN/ CNEN-SP, 05508-000 Sao Paulo (Brazil)]. e-mail: romanato@ctmsp.mar.mil.br

    2006-07-01

    When the nuclear fuel lose its ability to efficiently create energy it is removed from the core reactor and moved to a storage unit waiting for a final destination. Generally, the spent nuclear fuel (SNF) remains inside concrete basins with water within the reactors facility for the radioactive activity decay. Water cools the generated heat and shields radioactivity emissions. After some period of time in water basins the SNF can be sent to a definitive deposition in a geological repository and handled as radioactive waste or to reprocessing installations, or still wait for a future solution. Meanwhile, SNF remains stored for a period of time in dry or wet installations, depending on the method adopted by the nuclear power plant or other plans of the country. In many SNF wet storage sites the capacity can be fulfilled very quickly. If so, additional area or other alternative storage system should be given. There are many options to provide capacity increase in the wet storage area, but dry storages are worldwide preferred since it reduces corrosion concerns. In the wet storage the temperature and water purity should be constantly controlled whereas in the dry storage the SNF stands protected in specially designed canisters. Dry interim storages are practical and approved in many countries especially that have the 'wait and see' philosophy (wait to see new technologies development). This paper shows the advantages of dry interim storages sites in comparison with the wet ones and the nowadays problems as terrorism. (Author)

  9. Advantages on dry interim storage for spent nuclear fuel

    International Nuclear Information System (INIS)

    Romanato, L.S.; Rzyski, B.M.

    2006-01-01

    When the nuclear fuel lose its ability to efficiently create energy it is removed from the core reactor and moved to a storage unit waiting for a final destination. Generally, the spent nuclear fuel (SNF) remains inside concrete basins with water within the reactors facility for the radioactive activity decay. Water cools the generated heat and shields radioactivity emissions. After some period of time in water basins the SNF can be sent to a definitive deposition in a geological repository and handled as radioactive waste or to reprocessing installations, or still wait for a future solution. Meanwhile, SNF remains stored for a period of time in dry or wet installations, depending on the method adopted by the nuclear power plant or other plans of the country. In many SNF wet storage sites the capacity can be fulfilled very quickly. If so, additional area or other alternative storage system should be given. There are many options to provide capacity increase in the wet storage area, but dry storages are worldwide preferred since it reduces corrosion concerns. In the wet storage the temperature and water purity should be constantly controlled whereas in the dry storage the SNF stands protected in specially designed canisters. Dry interim storages are practical and approved in many countries especially that have the 'wait and see' philosophy (wait to see new technologies development). This paper shows the advantages of dry interim storages sites in comparison with the wet ones and the nowadays problems as terrorism. (Author)

  10. Operation of roof pond systems, considering its advantages and disadvantages

    Energy Technology Data Exchange (ETDEWEB)

    Noohi, Samira; Rezaei, Davood [Faculty of engineering, Zanjan University (Iran, Islamic Republic of)], email: noohi.sam@gmail.com, email: d_rezaei@znu.ac.ir

    2011-07-01

    With the coming shortage of fossil fuels it is important to develop energy efficient buildings to reduce both energy consumption and pollution at the same time. The roof pond system is a passive solar system which gathers heat from the sun and can distribute it to the living space to cool it or heat it by changing the operating cycle. Although not recent, this method has not been widely implemented due to certain limitations and the aim of this paper is to assess the different advantages and disadvantages of this system over other passive solar heating systems. This study showed that a roof pond has a low impact on the building, provides controllable energy delivery and variations in indoor temperature are low; however it requires an active solar system as a backup and vegetation can limit sunlight penetration. This study highlighted that the efficiency of the roof system pond depends on climate conditions and that it is best suited to lower latitude and low humidity areas.

  11. Economic valuation of the ecosystem services provided by a protected area in the Brazilian Cerrado: application of the contingent valuation method.

    Science.gov (United States)

    Resende, F M; Fernandes, G W; Andrade, D C; Néder, H D

    2017-11-01

    Considering that the economic valuation of ecosystem services is a useful approach to support the conservation of natural areas, we aimed to estimate the monetary value of the benefits provided by a protected area in southeast Brazil, the Serra do Cipó National Park. We calculated the visitor's willingness to pay to conserve the ecosystems of the protected area using the contingent valuation method. Located in a region under intense anthropogenic pressure, the Serra do Cipó National Park is mostly composed of rupestrian grassland ecosystems, in addition to other Cerrado physiognomies. We conducted a survey consisting of 514 interviews with visitors of the region and found that the mean willingness to pay was R$ 7.16 year-1, which corresponds to a total of approximately R$ 716,000.00 year-1. We detected that per capita income, the household size, the level of interest in environmental issues and the place of origin influenced the likelihood that individuals are willing to contribute to the conservation of the park, as well as the value of the stated willingness to pay. This study conveys the importance of conserving rupestrian grassland and other Cerrado physiognomies to decision makers and society.

  12. Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files. SG39 meeting, May 2016

    International Nuclear Information System (INIS)

    Herman, Michal Wladyslaw; Cabellos De Francisco, Oscar; Beck, Bret; Ignatyuk, Anatoly V.; Palmiotti, Giuseppe; Grudzevich, Oleg T.; Salvatores, Massimo; Chadwick, Mark; Pelloni, Sandro; Diez De La Obra, Carlos Javier; Wu, Haicheng; Sobes, Vladimir; Rearden, Bradley T.; Yokoyama, Kenji; Hursin, Mathieu; Penttila, Heikki; Kodeli, Ivan-Alexander; Plevnik, Lucijan; Plompen, Arjan; Gabrielli, Fabrizio; Leal, Luiz Carlos; Aufiero, Manuele; Fiorito, Luca; Hummel, Andrew; Siefman, Daniel; Leconte, Pierre

    2016-05-01

    The aim of WPEC subgroup 39 'Methods and approaches to provide feedback from nuclear and covariance data adjustment for improvement of nuclear data files' is to provide criteria and practical approaches to use effectively the results of sensitivity analyses and cross section adjustments for feedback to evaluators and differential measurement experimentalists in order to improve the knowledge of neutron cross sections, uncertainties, and correlations to be used in a wide range of applications. WPEC subgroup 40-CIELO (Collaborative International Evaluated Library Organization) provides a new working paradigm to facilitate evaluated nuclear reaction data advances. It brings together experts from across the international nuclear reaction data community to identify and document discrepancies among existing evaluated data libraries, measured data, and model calculation interpretations, and aims to make progress in reconciling these discrepancies to create more accurate ENDF-formatted files. SG40-CIELO focusses on 6 important isotopes: "1H, "1"6O, "5"6Fe, "2"3"5","2"3"8U, "2"3"9Pu. This document is the proceedings of the seventh formal Subgroup 39 meeting and of the Joint SG39+SG40 Session held at the NEA, OECD Conference Center, Paris, France on 10-11 May 2016. It comprises a Summary Record of the meeting, and all the available presentations (slides) given by the participants: A - Welcome and actions review (Oscar CABELLOS); B - Methods: - XGPT: uncertainty propagation and data assimilation from continuous energy covariance matrix and resonance parameters covariances (Manuele AUFIERO); - Optimal experiment utilization (REWINDing PIA), (G. Palmiotti); C - Experiment analysis, sensitivity calculations and benchmarks: - Tripoli-4 analysis of SEG experiments (Andrew HUMMEL); - Tripoli-4 analysis of BERENICE experiments (P. DUFAY, Cyrille DE SAINT JEAN); - Preparation of sensitivities of k-eff, beta-eff and shielding benchmarks for adjustment exercise (Ivo KODELI); - SA and

  13. Method for manufacturing carrier containing e.g. proteins for human during oral drug delivery operation for food and drug administration application in pharmaceutical industry, involves providing active ingredient to core layer

    DEFF Research Database (Denmark)

    2015-01-01

    NOVELTY - The method involves preparing a multi-layered film comprising a core layer and a barrier layer, where the core layer comprises active ingredient. The multi-layered film is subjected to a hot embossing step using an embossing stamp including protrusions that allows for generation...... delivery operation for a food and drug administration (FDA) application in a pharmaceutical industry. ADVANTAGE - The method enables allowing an individual micro-structure stuck in an embossing stamp to be demolded under the conditions such that demolding operation is done by treating elastically...

  14. Comparative Advantages of Spin-off Firms: An Evolutionary Perspective

    Directory of Open Access Journals (Sweden)

    Bilgehan Uzunca

    2011-11-01

    Full Text Available As predicted by evolutionary economics, historical antecedents matter when it comes to the relationship between survival of entrants and organizational capabilities. Spinoff firms provide an exemplary case of such relationship where the founders’ pre-entry capabilities that are inherited from the parent firm increases their survival chances. Looking closer and deeper to the evolutionary spinoff success mechanisms, I examine three specific genetic features which make spinoff firms more advantageous compared to other entrants; namely 1 Genotype: Transfer of blueprint, 2 Phenotype: Organizational learning, and 3 Memes: Informal relations and social capital. A detailed theoretical analysis of each mechanism prevails how they function and provide sustainable competitive advantage to spinoff firms. Testable hypotheses are provided about each mechanism.

  15. Operational advantages of using Cyber Electronic Warfare (CEW) in the battlefield

    Science.gov (United States)

    Yasar, Nurgul; Yasar, Fatih M.; Topcu, Yucel

    2012-06-01

    While cyberspace is emerging as a new battlefield, conventional Electronic Warfare (EW) methods and applications are likely to change. Cyber Electronic Warfare (CEW) concept which merges cyberspace capabilities with traditional EW methods, is a new and enhanced form of the electronic attack. In this study, cyberspace domain of the battlefield is emphazised and the feasibility of integrating Cyber Warfare (CW) concept into EW measures is researched. The SWOT (Strengths, Weaknesses, Opportunities and Threats) analysis method is used to state the operational advantages of using CEW concept in the battlefield. The operational advantages of CEW are assessed by means of its effects on adversary air defense systems, communication networks and information systems. Outstanding technological and operational difficulties are pointed out as well. As a result, a comparison of CEW concept and conventional EW applications is presented. It is concluded that, utilization of CEW concept is feasible at the battlefield and it may yield important operational advantages. Even though the computers of developed military systems are less complex than normal computers, they are not subjected to cyber threats since they are closed systems. This concept intends to show that these closed systems are also open to the cyber threats. As a result of the SWOT analysis, CEW concept provides Air Forces to be used in cyber operations effectively. On the other hand, since its Collateral Damage Criteria (CDC) is low, the usage of cyber electronic attack systems seems to grow up.

  16. Advantages of polarization experiments at RHIC

    International Nuclear Information System (INIS)

    Underwood, D.G.

    1991-01-01

    We point out various spin experiments that could be done if the polarized beam option is pursued at RHIC. The advantages of RHIC for investigating several current and future physics problems are discussed. In particular, the gluon spin dependent structure function of the nucleon could be measured cleanly and systematically. Relevant experience developed in conjunction with the Fermilab Polarized Beam program is also presented

  17. Advantages of the production contractor concept

    Energy Technology Data Exchange (ETDEWEB)

    Gisvold, K.M. [Golar-Nor Offshore, Trondheim (Norway)

    1994-12-31

    This paper presents some thoughts on the Production Contractor concept. It starts with an attempt to define the prerequisites for such contractorship to exist and develop, going on to examine the considerations that the oil company and the contractor respectively have to go through, and finally trying to summarize what emerges as the advantages of production contracting. Examples are given to emphasize particular points

  18. Distance learning: its advantages and disadvantages

    OpenAIRE

    KEGEYAN SVETLANA ERIHOVNA

    2016-01-01

    Distance learning has become popular in higher institutions because of its flexibility and availability to learners and teachers at anytime, regardless of geographic location. With so many definitions and phases of distance education, this paper only focuses on the delivery mode of distance education (the use of information technology), background, and its disadvantages and advantages for today’s learners.

  19. On the measurement of comparative advantage

    NARCIS (Netherlands)

    Hoen, A.R.; Oosterhaven, J.

    This paper shows-that the standard measure of revealed comparative advantage (RCA), ranging from 0 to infinity, has problematic properties. Due to its multiplicative specification, it has a moving mean larger than its expected value of 1, while its distribution strongly depends on the number of

  20. On the measurement of comparative advantage

    NARCIS (Netherlands)

    Hoen, Alex R.

    2001-01-01

    This article shows that the distribution of the standard measure of revealed comparative advantage (RCA), which runs from 0 to 8, has problematic properties. Due to its multiplicative specification, it has a moving mean without a useful interpretation, while its distribution depends on the number of

  1. Overview of research in the ADVANTAGE project

    DEFF Research Database (Denmark)

    Angjelichinoski, Marko; Cosovic, Mirsad; Kalalas, Charalampos

    2016-01-01

    The European Marie Curie Project ADVANTAGE (Advanced Communications and Information processing in smart grid systems) was launched in 2014. It represents a major inter-disciplinary research project into the topic of Smart Grid technology. A key aspect of the project is to bring together and train...

  2. Advantages and disadvantages by using safety culture

    DEFF Research Database (Denmark)

    Dyhrberg, Mette Bang

    2003-01-01

    Safety culture is a major issue in accident research. A recently finished ph.d.-study has evaluated the symbolic safety culture approach and found four advantages and two disadvantages. These are presented and discussed in this contribution. It is concluded that the approach can be useful...

  3. Advantages and disadvantages of developing nuclear power

    International Nuclear Information System (INIS)

    Wang Zhixin

    1987-01-01

    To solve the problem of the shortage of electricity in China, an objective assessment of the advantages and disadvantages of generating electricity from different energy sources is necessary. Nuclear power is evaluated against hydro-, oil-, gas- and coal-power. It is proposed to develop nuclear power in a planned way as a sensible long term strategy

  4. Creating Competitive Advantage through Effective Management Education.

    Science.gov (United States)

    Longenecker, Clinton O.; Ariss, Sonny S.

    2002-01-01

    Managers trained in executive education programs (n=203) identified ways in which management education can increase an organization's competitive advantage: exposure to new ideas and practices, skill development, and motivation. Characteristics of effective management education included experience-based learning orientation, credible instructors,…

  5. home advantage in the commonwealth games

    African Journals Online (AJOL)

    The occurrence of home advantage in sport is generally well doc- umented and has been shown to exist in a ... there are 53 Commonwealth nations, there are at present 71. Commonwealth Games Associations ... market share values for each host nation were analysed relative to the distance travelled by them (in terms of ...

  6. Robustness of the Sequential Lineup Advantage

    Science.gov (United States)

    Gronlund, Scott D.; Carlson, Curt A.; Dailey, Sarah B.; Goodsell, Charles A.

    2009-01-01

    A growing movement in the United States and around the world involves promoting the advantages of conducting an eyewitness lineup in a sequential manner. We conducted a large study (N = 2,529) that included 24 comparisons of sequential versus simultaneous lineups. A liberal statistical criterion revealed only 2 significant sequential lineup…

  7. Business Intelligence Solutions for Gaining Competitive Advantage

    Directory of Open Access Journals (Sweden)

    2007-01-01

    Full Text Available Business Intelligence is the process for increasing the competitive advantage of a company by intelligent use of available data in decision-making. Only a revolutionary Business Intelligence solution, like the proposed portal-based, can solve the complex issues faced when evaluating decision support applications and ensures the availability of any business-critical information.

  8. Advantages of the production contractor concept

    International Nuclear Information System (INIS)

    Gisvold, K.M.

    1994-01-01

    This paper presents some thoughts on the Production Contractor concept. It starts with an attempt to define the prerequisites for such contractorship to exist and develop, going on to examine the considerations that the oil company and the contractor respectively have to go through, and finally trying to summarize what emerges as the advantages of production contracting. Examples are given to emphasize particular points

  9. Advantages of Intelligent SDH/SONET Networks

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Advantages of Intelligent SDH/SONET Networks. GMPLS simplifies network management, thus reducing operating expenses (“staff”) and minimizing errors. Same benefits as computerization of banking, accounts, etc. Auto-discovery simplifies equipment installation ...

  10. Project safety as a sustainable competitive advantage.

    Science.gov (United States)

    Rechenthin, David

    2004-01-01

    To be consistently profitable, a construction company must complete projects in scope, on schedule, and on budget. At the same time, the nature of the often high-risk work performed by construction companies can result in high accident rates. Clients and other stakeholders are placing increasing pressure on companies to decrease those accident rates. Clients routinely demand copies of safety plans and evidence of past results at the "pre-qualification" or "request for proposal" stages of the procurement process. Are high accident rates and the associated costs just a part of business? Companies that deliver on scope, schedule, and budget have a competitive advantage. Is it possible for projects with low accident rates to use it as a competitive advantage? Is the value added by safety just a temporary or parity issue, or does a successful safety program offer significant advantage to the company and the client? This article concludes that in the case of a high-risk industry, such as the construction industry, an organization with a successful safety program can promote safety performance as a sustainable competitive advantage. It is a choice the company can make.

  11. 77 FR 67433 - Community Advantage Pilot Program

    Science.gov (United States)

    2012-11-09

    ... comments. SUMMARY: The Community Advantage (``CA'') Pilot Program is a pilot program to increase SBA... small businesses and entrepreneurs in underserved markets, SBA is issuing this Notice to extend the term... Pilot Program was introduced to increase the number of SBA-guaranteed loans made to small businesses in...

  12. A pill for the partner via the chlamydia patient? Results from a mixed method study among sexual health care providers in the Netherlands.

    Science.gov (United States)

    Nanhoe, Anita C; Visser, Maartje; Omlo, Jurriaan J; Watzeels, Anita J C M; van den Broek, Ingrid V; Götz, Hannelore M

    2018-05-29

    Chlamydia prevalence in the Netherlands remains high despite targeted efforts. Effective Partner Notification (PN) and Partner Treatment (PT) can interrupt transmission and prevent re-infections. Patient Initiated Partner Treatment (PIPT) may strengthen chlamydia control. This study explores the current practice of PN and PT, and benefits of, and barriers and facilitators for PIPT among professionals in sexual health care in the Netherlands. A qualitative study was performed among GPs, GP-assistants (GPAs), physicians and nurses working at Sexual Health Clinics (SHC) and key-informants on ethnical diversity using topic lists in focus groups (N = 40) and semi-structured questionnaires in individual interviews (N = 9). Topics included current practices regarding PN and PT, attitude regarding PIPT, and perceived barriers and facilitators for PIPT. Interviews were taped, transcribed verbatim, and coded using ATLAS.ti. A quantitative online questionnaire on the same topics was sent to all physicians and nurses employed at Dutch SHC (complete response rate 26% (84/321)). The qualitative study showed that all professionals support the need for more attention to PN, and that they saw advantages in PIPT. Mentioned barriers included unwilling PN-behaviour, Dutch legislation, several medical considerations and inadequate skills of GPs. Also, concerns about limited knowledge of cultural sensitivity around PN and PT were raised. Mentioned facilitators of PIPT were reliable home based test-kits, phone-contact between professionals and notified partners, more consultation time for GPs or GPAs and additional training. The online questionnaire showed that SHC employees agreed that partners should be treated as soon as possible, but also that they were reluctant towards PIPT without counselling and testing. Professionals saw advantages in PIPT, but they also identified barriers hampering the potential introduction of PIPT. Improving PN and counselling skills with specific

  13. Stimulus-dependent effects on right ear advantage in schizophrenia

    Directory of Open Access Journals (Sweden)

    Smucny J

    2012-09-01

    Full Text Available Jason Smucny,1,3 Korey Wylie,3 Jason Tregellas1–31Neuroscience Program, University of Colorado Anschutz Medical Campus, 2Research Science, Denver VA Medical, Center, 3Department of Psychiatry, University of Colorado Anschutz Medical Campus, Aurora, CO, USABackground: When presented with different sounds in each ear (dichotic listening, healthy subjects typically show a preference for stimuli heard in the right ear, an effect termed "right ear advantage". Previous studies examining right ear advantage in schizophrenia have been inconsistent, showing either decreased or increased advantage relative to comparison subjects. Given evidence for enhanced semantic processing in schizophrenia, some of this inconsistency may be due to the type of stimuli presented (words or syllables. The present study examined right ear advantage in patients and controls using both words and syllables as stimuli.Methods: Right ear advantage was compared between 20 patients with schizophrenia and 17 healthy controls. Two versions of the task were used, ie, a consonant-vowel pairing task and a fused rhymed words task.Results: A significant group × task interaction was observed. Relative to healthy controls, patients showed a greater difference on the syllable-based task compared with the word-based task. The number of distractors marked during the syllable-based task was inversely correlated with score on the Global Assessment of Function Scale.Conclusion: The findings are consistent with a left hemisphere dysfunction in schizophrenia, but also suggest that differences may be stimulus-specific, with a relative sparing of the deficit in the context of word stimuli. Performance may be related to measures of social, occupational, and psychological function.Keywords: schizophrenia, right ear advantage, dichotic, distraction

  14. Improving communication when seeking informed consent: a randomised controlled study of a computer-based method for providing information to prospective clinical trial participants.

    Science.gov (United States)

    Karunaratne, Asuntha S; Korenman, Stanley G; Thomas, Samantha L; Myles, Paul S; Komesaroff, Paul A

    2010-04-05

    To assess the efficacy, with respect to participant understanding of information, of a computer-based approach to communication about complex, technical issues that commonly arise when seeking informed consent for clinical research trials. An open, randomised controlled study of 60 patients with diabetes mellitus, aged 27-70 years, recruited between August 2006 and October 2007 from the Department of Diabetes and Endocrinology at the Alfred Hospital and Baker IDI Heart and Diabetes Institute, Melbourne. Participants were asked to read information about a mock study via a computer-based presentation (n = 30) or a conventional paper-based information statement (n = 30). The computer-based presentation contained visual aids, including diagrams, video, hyperlinks and quiz pages. Understanding of information as assessed by quantitative and qualitative means. Assessment scores used to measure level of understanding were significantly higher in the group that completed the computer-based task than the group that completed the paper-based task (82% v 73%; P = 0.005). More participants in the group that completed the computer-based task expressed interest in taking part in the mock study (23 v 17 participants; P = 0.01). Most participants from both groups preferred the idea of a computer-based presentation to the paper-based statement (21 in the computer-based task group, 18 in the paper-based task group). A computer-based method of providing information may help overcome existing deficiencies in communication about clinical research, and may reduce costs and improve efficiency in recruiting participants for clinical trials.

  15. MO-E-17A-04: Size-Specific Dose Estimate (SSDE) Provides a Simple Method to Calculate Organ Dose for Pediatric CT Examinations

    International Nuclear Information System (INIS)

    Moore, B; Brady, S; Kaufman, R; Mirro, A

    2014-01-01

    Purpose: Investigate the correlation of SSDE with organ dose in a pediatric population. Methods: Four anthropomorphic phantoms, representing a range of pediatric body habitus, were scanned with MOSFET dosimeters placed at 23 organ locations to determine absolute organ dosimetry. Phantom organ dosimetry was divided by phantom SSDE to determine correlation between organ dose and SSDE. Correlation factors were then multiplied by patient SSDE to estimate patient organ dose. Patient demographics consisted of 352 chest and 241 abdominopelvic CT examinations, 22 ± 15 kg (range 5−55 kg) mean weight, and 6 ± 5 years (range 4 mon to 23 years) mean age. Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm. 23 organ correlation factors were determined in the chest and abdominopelvic region across nine pediatric weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7−1.4) and abdominopelvic (average 0.9; range 0.7−1.3) was near unity. For organs that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1−0.4) for both the chest and abdominopelvic regions, respectively. Pediatric organ dosimetry was compared to published values and was found to agree in the chest to better than an average of 5% (27.6/26.2) and in the abdominopelvic region to better than 2% (73.4/75.0). Conclusion: Average correlation of SSDE and organ dosimetry was found to be better than ± 10% for fully covered organs within the scan volume. This study provides a list of organ dose correlation factors for the chest and abdominopelvic regions, and describes a simple methodology to estimate individual pediatric patient organ dose based on patient SSDE

  16. MO-E-17A-04: Size-Specific Dose Estimate (SSDE) Provides a Simple Method to Calculate Organ Dose for Pediatric CT Examinations

    Energy Technology Data Exchange (ETDEWEB)

    Moore, B; Brady, S; Kaufman, R [St Jude Children' s Research Hospital, Memphis, TN (United States); Mirro, A [Washington University, St. Louis, MO (United States)

    2014-06-15

    Purpose: Investigate the correlation of SSDE with organ dose in a pediatric population. Methods: Four anthropomorphic phantoms, representing a range of pediatric body habitus, were scanned with MOSFET dosimeters placed at 23 organ locations to determine absolute organ dosimetry. Phantom organ dosimetry was divided by phantom SSDE to determine correlation between organ dose and SSDE. Correlation factors were then multiplied by patient SSDE to estimate patient organ dose. Patient demographics consisted of 352 chest and 241 abdominopelvic CT examinations, 22 ± 15 kg (range 5−55 kg) mean weight, and 6 ± 5 years (range 4 mon to 23 years) mean age. Patient organ dose estimates were compared to published pediatric Monte Carlo study results. Results: Phantom effective diameters were matched with patient population effective diameters to within 4 cm. 23 organ correlation factors were determined in the chest and abdominopelvic region across nine pediatric weight subcategories. For organs fully covered by the scan volume, correlation in the chest (average 1.1; range 0.7−1.4) and abdominopelvic (average 0.9; range 0.7−1.3) was near unity. For organs that extended beyond the scan volume (i.e., skin, bone marrow, and bone surface), correlation was determined to be poor (average 0.3; range: 0.1−0.4) for both the chest and abdominopelvic regions, respectively. Pediatric organ dosimetry was compared to published values and was found to agree in the chest to better than an average of 5% (27.6/26.2) and in the abdominopelvic region to better than 2% (73.4/75.0). Conclusion: Average correlation of SSDE and organ dosimetry was found to be better than ± 10% for fully covered organs within the scan volume. This study provides a list of organ dose correlation factors for the chest and abdominopelvic regions, and describes a simple methodology to estimate individual pediatric patient organ dose based on patient SSDE.

  17. Advantages and Limitations of Current Imaging Techniques for Characterizing Liposome Morphology

    Directory of Open Access Journals (Sweden)

    Annie-Louise Robson

    2018-02-01

    Full Text Available There are currently a number of imaging techniques available for evaluating the morphology of liposomes and other nanoparticles, with each having its own advantages and disadvantages that should be considered when interpreting data. Controlling and validating the morphology of nanoparticles is of key importance for the effective clinical translation of liposomal formulations. There are a number of physical characteristics of liposomes that determine their in vivo behavior, including size, surface characteristics, lamellarity, and homogeneity. Despite the great importance of the morphology of nanoparticles, it is generally not well-characterized and is difficult to control. Appropriate imaging techniques provide important details regarding the morphological characteristics of nanoparticles, and should be used in conjunction with other methods to assess physicochemical parameters. In this review, we will discuss the advantages and limitations of available imaging techniques used to evaluate liposomal formulations.

  18. An exploration into the home field, global advantage and liability of unfamiliarness hypotheses in multinational banking

    Directory of Open Access Journals (Sweden)

    Fadzlan Sufian

    2011-09-01

    Full Text Available This paper seeks to expand the efficiency paradigm of the eclectic theory in multinational banking within the context of a developing country banking sector. We employ the Data Envelopment Analysis (DEA method to examine the efficiency of multinational banks operating in the Malaysian banking sector from 1995 to 2007. We then employ the panel regression analysis to examine the impact of origins on bank efficiency. We find foreign banks from North America to be the most efficient banking group, providing support to the ‘limited form’ of the global advantage hypothesis. On the other hand, we do not find evidence on both the liability of unfamiliarness and home field advantage hypotheses.

  19. Sports drug testing using complementary matrices: Advantages and limitations.

    Science.gov (United States)

    Thevis, Mario; Geyer, Hans; Tretzel, Laura; Schänzer, Wilhelm

    2016-10-25

    Today, routine doping controls largely rely on testing whole blood, serum, and urine samples. These matrices allow comprehensively covering inorganic as well as low and high molecular mass organic analytes relevant to doping controls and are collecting and transferring from sampling sites to accredited anti-doping laboratories under standardized conditions. Various aspects including time and cost-effectiveness as well as intrusiveness and invasiveness of the sampling procedure but also analyte stability and breadth of the contained information have been motivation to consider and assess values potentially provided and added to modern sports drug testing programs by alternative matrices. Such alternatives could be dried blood spots (DBS), dried plasma spots (DPS), oral fluid (OF), exhaled breath (EB), and hair. In this review, recent developments and test methods concerning these alternative matrices and expected or proven contributions as well as limitations of these specimens in the context of the international anti-doping fight are presented and discussed, guided by current regulations for prohibited substances and methods of doping as established by the World Anti-Doping Agency (WADA). Focusing on literature published between 2011 and 2015, examples for doping control analytical assays concerning non-approved substances, anabolic agents, peptide hormones/growth factors/related substances and mimetics, β 2 -agonists, hormone and metabolic modulators, diuretics and masking agents, stimulants, narcotics, cannabinoids, glucocorticoids, and beta-blockers were selected to outline the advantages and limitations of the aforementioned alternative matrices as compared to conventional doping control samples (i.e. urine and blood/serum). Copyright © 2016 Elsevier B.V. All rights reserved.

  20. COMPETITIVE ADVANTAGES ENTERPRISES IN KOOPERATION RELATIONS

    Directory of Open Access Journals (Sweden)

    O. Mikitiuk

    2013-09-01

    Full Text Available Formation of new approaches to the definition of competitive advantage requires different ways to implement them according to market conditions. These paths can be cooperative relations entities that are implemented in the competitive advantage of enterprises in the new stage of development of a competitive society. The result of the interaction of small businesses with industrial and economic structures is the formation and development of such forms of cooperation entities as subcontracting, franchising, leasing, venture finance. The content of these forms is to integrate (interlacing of the functional areas of business including production of functional form is subcontracting relationships, forms of supply – franchising, industrial and financial shape – leasing as a form of innovative functional integration relations is venture financing.

  1. Developing a competitive advantage in the market for radiology services.

    Science.gov (United States)

    Kropf, R; Szafran, A J

    1988-01-01

    This article describes how managers of outpatient diagnostic radiology services can develop a competitive advantage by increasing the value of services to patients and referring physicians. A method is presented to identify changes to services that increase their value. The method requires the definition of the "value chains" of patients and referring physicians. Particular attention is paid to the use of information systems technology to suggest and implement service changes. A narrow range of health services was selected because the approach requires a detailed understanding of consumers and how they use services. The approach should, however, be examined carefully by managers seeking to develop a competitive advantage for a wide range of health services.

  2. Advantages of polarization experiments at RHIC

    International Nuclear Information System (INIS)

    Underwood, D.G.

    1990-01-01

    We point out various spin experiments that could be done if the polarized beam option is pursued at RHIC. The advantages of RHIC for investigating several current and future physics problems are discussed. In particular, the gluon spin dependent structure function of the nucleon could be measured cleanly and systematically. Relevant experience developed in conjunction with the Fermilab Polarized Beam program is also presented. 8 refs., 2 tabs

  3. COMPETITORS ACCOUNTING AS A COMPETITIVE ADVANTAGE TOOL

    OpenAIRE

    YÜCENURŞEN, Mehmet; DUMAN, Haluk; APAK, İbrahim; KALAV, Ömer

    2016-01-01

    In recent years, it seems that businesses adopt customer-oriented marketing strategies. According to the adopted strategies to keep customer satisfaction at the highest level, businesses have been focused to developt new product, to find new customers, to improve distribution and promotion activity etc. Besides, businesses have recognized that they should analize their competitor’s activity and movement to make high profit and growth. Porter's competitive advantage that it is possib...

  4. Manufacturing strategies for time based competitive advantages

    OpenAIRE

    Lin, Yong; Ma, Shihua; Zhou, Li

    2012-01-01

    Purpose – The main purpose of this paper is to investigate the current manufacturing strategies and practices of bus manufacturers in China, and to propose a framework of manufacturing strategies for time-based competitive advantages.\\ud Design/methodology/approach – The conceptual research framework is devised from a review of the literature, and case studies are used to investigate the manufacturing strategies and practices in place in the case companies. Data is collected through semi-stru...

  5. Economic Development and "National Competitive Advantage"

    OpenAIRE

    J.T., Goode

    2002-01-01

    Despite the preponderance of economic theory and research which argues to the contrary, the notion that national economies stand in a fundamentally competitive relationship with one another remains surprisingly widespread. In recent years, some of the most influential impetus for this misperception has come from Michael Porter's conceptualization of "the competitive advantage of nations" in relation to economic development and date theory. It is argued that Porter neither proposes nor demonst...

  6. The Employment Advantages of Skilled Urban Areas

    OpenAIRE

    Diaz Escobar, Ana Maria

    2011-01-01

    This paper explores whether the agglomeration of human capital leads to social employment advantages in urban labor markets of a developing country: Colombia. I estimate the social effects of human capital agglomeration by comparing employment opportunities of individuals located in urban areas in which the level of education differs. Results show that employment opportunities are higher on average in skilled urban areas. Three explanations have been offered: human capital externalities, prod...

  7. Finance, Comparative Advantage, and Resource Allocation

    OpenAIRE

    Jaud, Melise; Kukenova, Madina; Strieborny, Martin

    2013-01-01

    The authors show that exported products exit the US market sooner if they violate the Heckscher-Ohlin notion of comparative advantage. Crucially, this pattern is stronger when exporting country has a well-developed banking system, measured by a high ratio of bank credit over the GDP. Banks thus push firms away from exports that are facing an uphill battle on a competitive foreign market du...

  8. Advantages and disadvantages of digital education

    OpenAIRE

    Mąkosa, Paweł

    2013-01-01

    The digitization of education in Poland is spreading into more and more areas. Therefore, it becomes necessary to analyse all its aspects, both advantages and disadvantages. In the performed reflection, an attempt to present the current state of the access to computers, the Internet and e-course books in Polish schools has been made. On the basis of the secondary analysis of various recent studies as well as own research performed, it has been determined that the level of digitization of educ...

  9. The Advantages and Disadvantages of Outsourcing

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Nowadays, the increasing globalization and internationalization bring huge changes to business environment, which has been changed from a lot of dispersed local markets to a single economic market. These changes make businessmen have to think about their international business strategies, such as outsourcing. This article will analyze the advantages and disadvantages of outsourcing in the context of global manufacturing strategy in order to help managers handle it more effectively.

  10. Interest alignment rents and competitive advantage

    OpenAIRE

    M. ZOLLO; O. GOTTSCHALG

    2007-01-01

    This paper articulates a theory of the conditions under which the alignment between individual and collective interests generates sustainable competitive advantage. The theory is based on the influence of tacitness, context specificity, and causal ambiguity in the determinants of different types of motivation (extrinsic, normative intrinsic, and hedonic instinsic) under varying conditions of environmental dynamism. The analysis indicates the need to consider motivational processes as a comple...

  11. The "Private School Advantage" in Argentina

    Directory of Open Access Journals (Sweden)

    Gustavo E. Fischman

    2001-08-01

    Full Text Available Local actors' perceptions of curricular and management changes in two private schools and one neighboring public secondary school in the city of Buenos Aires, Argentina, are analyzed. An exploration was conducted of how, within an ideologically and politically pro-reform context and a widespread acceptance of the "private school advantage," principals, teachers, and students in these schools evaluated the changes (or lack of them in management, teaching, and curriculum orientations of the secondary education sector.

  12. How to Achieve a Competitive Advantage

    OpenAIRE

    Adina Musetescu

    2013-01-01

    In order to succeed in any market a company has to decide which strategy is more appropriate to use, which means identifying the sources of a potential competitive advantage such as skills or resources. Superior skills in creating a special product can represent the element that is setting the company apart from its competitors. That is easily translated into a very good quality of the products. The resources of the company refer to the great number of retailers (a good distribution chain tha...

  13. The "Private School Advantage" in Argentina

    OpenAIRE

    Gustavo E. Fischman

    2001-01-01

    Local actors' perceptions of curricular and management changes in two private schools and one neighboring public secondary school in the city of Buenos Aires, Argentina, are analyzed. An exploration was conducted of how, within an ideologically and politically pro-reform context and a widespread acceptance of the "private school advantage," principals, teachers, and students in these schools evaluated the changes (or lack of them) in management, teaching, and curriculum orientations of the se...

  14. Hidden Advantages and Disadvantages of Social Class.

    Science.gov (United States)

    Goudeau, Sébastien; Croizet, Jean-Claude

    2017-02-01

    Three studies conducted among fifth and sixth graders examined how school contexts disrupt the achievement of working-class students by staging unfair comparison with their advantaged middle-class peers. In regular classrooms, differences in performance among students are usually showcased in a way that does not acknowledge the advantage (i.e., higher cultural capital) experienced by middle-class students, whose upbringing affords them more familiarity with the academic culture than their working-class peers have. Results of Study 1 revealed that rendering differences in performance visible in the classroom by having students raise their hands was enough to undermine the achievement of working-class students. In Studies 2 and 3, we manipulated students' familiarity with an arbitrary standard as a proxy for social class. Our results suggest that classroom settings that make differences in performance visible undermine the achievement of the students who are less familiar with academic culture. In Study 3, we showed that being aware of the advantage in familiarity with a task restores the performance of the students who have less familiarity with the task.

  15. Explaining Asian Americans’ academic advantage over whites

    Science.gov (United States)

    Hsin, Amy; Xie, Yu

    2014-01-01

    The superior academic achievement of Asian Americans is a well-documented phenomenon that lacks a widely accepted explanation. Asian Americans’ advantage in this respect has been attributed to three groups of factors: (i) socio-demographic characteristics, (ii) cognitive ability, and (iii) academic effort as measured by characteristics such as attentiveness and work ethic. We combine data from two nationally representative cohort longitudinal surveys to compare Asian-American and white students in their educational trajectories from kindergarten through high school. We find that the Asian-American educational advantage is attributable mainly to Asian students exerting greater academic effort and not to advantages in tested cognitive abilities or socio-demographics. We test explanations for the Asian–white gap in academic effort and find that the gap can be further attributed to (i) cultural differences in beliefs regarding the connection between effort and achievement and (ii) immigration status. Finally, we highlight the potential psychological and social costs associated with Asian-American achievement success. PMID:24799702

  16. Explaining Asian Americans' academic advantage over whites.

    Science.gov (United States)

    Hsin, Amy; Xie, Yu

    2014-06-10

    The superior academic achievement of Asian Americans is a well-documented phenomenon that lacks a widely accepted explanation. Asian Americans' advantage in this respect has been attributed to three groups of factors: (i) socio-demographic characteristics, (ii) cognitive ability, and (iii) academic effort as measured by characteristics such as attentiveness and work ethic. We combine data from two nationally representative cohort longitudinal surveys to compare Asian-American and white students in their educational trajectories from kindergarten through high school. We find that the Asian-American educational advantage is attributable mainly to Asian students exerting greater academic effort and not to advantages in tested cognitive abilities or socio-demographics. We test explanations for the Asian-white gap in academic effort and find that the gap can be further attributed to (i) cultural differences in beliefs regarding the connection between effort and achievement and (ii) immigration status. Finally, we highlight the potential psychological and social costs associated with Asian-American achievement success.

  17. Demonstration of quantum advantage in machine learning

    Science.gov (United States)

    Ristè, Diego; da Silva, Marcus P.; Ryan, Colm A.; Cross, Andrew W.; Córcoles, Antonio D.; Smolin, John A.; Gambetta, Jay M.; Chow, Jerry M.; Johnson, Blake R.

    2017-04-01

    The main promise of quantum computing is to efficiently solve certain problems that are prohibitively expensive for a classical computer. Most problems with a proven quantum advantage involve the repeated use of a black box, or oracle, whose structure encodes the solution. One measure of the algorithmic performance is the query complexity, i.e., the scaling of the number of oracle calls needed to find the solution with a given probability. Few-qubit demonstrations of quantum algorithms, such as Deutsch-Jozsa and Grover, have been implemented across diverse physical systems such as nuclear magnetic resonance, trapped ions, optical systems, and superconducting circuits. However, at the small scale, these problems can already be solved classically with a few oracle queries, limiting the obtained advantage. Here we solve an oracle-based problem, known as learning parity with noise, on a five-qubit superconducting processor. Executing classical and quantum algorithms using the same oracle, we observe a large gap in query count in favor of quantum processing. We find that this gap grows by orders of magnitude as a function of the error rates and the problem size. This result demonstrates that, while complex fault-tolerant architectures will be required for universal quantum computing, a significant quantum advantage already emerges in existing noisy systems.

  18. Motivation or demotivation of health workers providing maternal health services in rural areas in Vietnam: findings from a mixed-methods study.

    Science.gov (United States)

    Thu, Nguyen Thi Hoai; Wilson, Andrew; McDonald, Fiona

    2015-12-02

    Motivation is an important driver for health professionals to maintain their professional competencies, continue in the workforce and make a positive contribution to their workplace. While there is some research about the motivation of health workers in low- to middle-income countries, maternal morbidity and mortality remains high and this can be lowered by improving the quality of maternal health services and the training and maintenance of the skills of maternal health workers. This study examines the impact of motivation on maintenance of professional competence among maternal health workers in Vietnam using mixed methods. The study consisted of a survey using a self-administered questionnaire of 240 health workers in five districts across two Vietnamese provinces and in-depth interviews with 43 health workers and health managers at the commune, district and provincial level to explore external factors that influenced motivation. The questionnaire includes a 23-item motivation instrument based on the Kenyan health context, modified for Vietnamese language and culture. The 240 responses represented an estimated 95% of the target sample. Multivariate analysis showed that three factors contributed to the motivation of health workers: access to training (β = -0.14, P = 0.03), ability to perform key tasks (β = 0.22, P = 0.001) and shift schedule (β = -0.13, P = 0.05). Motivation was higher in health workers self-identifying as competent or who were enabled to provide more maternal care services. Motivation was lower in those who worked more frequent night shifts and those who had received training in the last 12 months. The interviews identified that the latter was because they felt the training was irrelevant to them, and in some cases, they do not have the opportunity to practice their learnt skills. The qualitative data also showed other factors relating to service context and organisational management practices contributed to

  19. Competitive Priorities and Competitive Advantage in Jordanian Manufacturing

    OpenAIRE

    Awwad, Abdulkareem S.; Al Khattab, Adel A.; Anchor, J.R

    2013-01-01

    The purpose of this research was to explore and predict the relationship between the competitive priorities (quality, cost, flexibility and delivery) and the competitive advantage of firms in the Jordanian Industrial Sector. A population of 88 Jordanian manufacturing firms, registered on the Amman Stock Exchange, was targeted using a cross-sectional survey employing a questionnaire method of data collection. The results of the data analysis indicate a significant relationship between competit...

  20. Biomass as a fuel: Advantages, limitations and possibilities

    International Nuclear Information System (INIS)

    McBurney, B.

    1997-01-01

    This presentation briefly outlines major issues related to the use of biomass fuels. Advantages and disadvantages of biomass fuels are identified, as well as major factors that may facilitate greater use of biomass fuels. Highlights of the US DOE Biomass Power Program, program activities, and demonstration projects are presented. Some statistical and economic data are provided, including biomass fueled electric capacity, biomass energy consumption by sector, and fuel cost savings and greenhouse gas emissions reductions for four biomass co-fired units

  1. Competitive Advantage and the Existence of the MNC

    DEFF Research Database (Denmark)

    Geisler Asmussen, Christian; Foss, Nicolai Juul

    This paper provides a counterpoint to Buckley and Hashai’s paper “Is competitive advantage a necessary condition for the emergence of the Multinational Enterprise?”. We agree with their conclusion that it is, in fact, not a necessary condition, but argue that the theoretical reasons behind this a...... strongly applaud Buckley and Hashai’s attempt to add more rigor to International Business theory and call for future work to extend this debate....

  2. Network operations support systems as a competitive advantage

    OpenAIRE

    Soh, Andrew K. L.

    2005-01-01

    The overall purpose of this paper is to perfom an analysis of TELUS and to examine if Network Operation Support Systems (OSS) can provide TELUS with a sustainable competitive advantage. The paper begins with the first three chapter exploring overviews of the components of the Canadian Telecommunications services industry, TELUS and its products, and the markets and revenues. The next chapter is an industry analysis of the industry landscape and its players. Michael Porter's Five Forces model ...

  3. SYSTEM ORGANIZATION OF MATERIAL PROVIDING OF BUILDING

    Directory of Open Access Journals (Sweden)

    A. V. Rаdkеvich

    2014-04-01

    Full Text Available Purpose. Development of scientific-methodical bases to the design of rational management of material streams in the field of building providing taking into account intersystem connections with the enterprises of building industry. Methodology. The analysis of last few years of functioning of building industry in Ukraine allows distinguishing a number of problems that negatively influence the steady development of building, as the component of the state economics system. Therefore the research of existent organization methods of the system of building objects providing with material resources is extremely necessary. In connection with this the article justifies the use of method of hierarchies analysis (Saati method for finding the optimal task solution of fixing the enterprises of building industry after building objects. Findings. Results give an opportunity to guidance of building organization to estimate and choose advantageous suppliers - enterprises of building industry, to conduct their rating, estimation taking into account basic descriptions, such as: quality, price, reliability of deliveries, specialization, financial status etc. Originality. On the basis of Saati method the methodologies of organization are improved, planning and managements of the reliable system of providing of building necessary material resources that meet the technological requirements of implementation of building and installation works. Practical value. Contribution to the decisions of many intricate organizational problems that are accompanied by the problems of development of building, provided due to organization of the reliable system of purchase of material resources.

  4. Risks, Benefits, and Importance of Collecting Sexual Orientation and Gender Identity Data in Healthcare Settings: A Multi-Method Analysis of Patient and Provider Perspectives.

    Science.gov (United States)

    Maragh-Bass, Allysha C; Torain, Maya; Adler, Rachel; Schneider, Eric; Ranjit, Anju; Kodadek, Lisa M; Shields, Ryan; German, Danielle; Snyder, Claire; Peterson, Susan; Schuur, Jeremiah; Lau, Brandyn; Haider, Adil H

    2017-04-01

    Research suggests that LGBT populations experience barriers to healthcare. Organizations such as the Institute of Medicine recommend routine documentation of sexual orientation (SO) and gender identity (GI) in healthcare, to reduce LGBT disparities. We explore patient views regarding the importance of SO/GI collection, and patient and provider views on risks and benefits of routine SO/GI collection in various settings. We surveyed LGBT/non-LGBT patients and providers on their views on SO/GI collection. Weighted data were analyzed with descriptive statistics; content analysis was conducted with open-ended responses. One-half of the 1516 patients and 60% of 429 providers were female; 64% of patients and 71% of providers were White. Eighty percent of providers felt that collecting SO data would offend patients, whereas only 11% of patients reported that they would be offended. Patients rated it as more important for primary care providers to know the SO of all patients compared with emergency department (ED) providers knowing the SO of all patients (41.3% vs. 31.6%; P discrimination risk most frequently (49.7%; N = 781), whereas provider comments cited patient discomfort/offense most frequently (54.5%; N = 433). Patients see the importance of SO/GI more in primary care than ED settings. However, many LGBT patients seek ED care due to factors including uninsurance; therefore, the ED may represent an initial point of contact for SO/GI collection. Therefore, patient-centered approaches to collecting SO/GI are needed. Patients and providers differed in perceived risks and benefits to routine SO/GI collection. Provider training in LGBT health may address patients' bias/discrimination concerns, and ultimately reduce LGBT health disparities.

  5. Biomechanical reconstructions and selective advantages of neck poses and feeding strategies of Sauropods with the example of Mamenchisaurus youngi.

    Directory of Open Access Journals (Sweden)

    Andreas Christian

    Full Text Available A very long neck is a characteristic feature of most sauropod dinosaurs. In the genus Mamenchisaurus, neck length is extreme, greater than 40 percent of total body length. However, the posture, utilization, and selective advantage of very long necks in sauropods are still controversial. An excellently preserved skeleton of Mamenchisaurus youngi, including a complete neck, provides an opportunity for a comprehensive biomechanical analysis of neck posture and mobility. The biomechanical evidence indicates that Mamenchisaurus youngi had a nearly straight, near horizontal neck posture and browsed at low or medium heights. The results differ from the findings for some other sauropod species, like Euhelopus, Diplodocus, and Giraffatitan (Brachiosaurus that had been analyzed in previous studies with similar methods. The selective advantage of extreme neck length in sauropods is likely advantageous for different feeding strategies.

  6. Statistical modelling and RCS detrending methods provide similar estimates of long-term trend in radial growth of common beech in north-eastern France

    OpenAIRE

    Bontemps , Jean-Daniel; Esper , Jan

    2011-01-01

    International audience; Dendrochronological methods have greatly contributed to the documentation of past long-term trends in forest growth. These methods primarily focus on the high-frequency signals of tree ring chronologies. They require the removal of the ageing trend in tree growth, known as 'standardisation' or 'detrending', as a prerequisite to the estimation of such trends. Because the approach is sequential, it may however absorb part of the low-frequency historical signal. In this s...

  7. Does cultural integration explain a mental health advantage for adolescents?

    Science.gov (United States)

    Bhui, Kamaldeep S; Lenguerrand, Erik; Maynard, Maria J; Stansfeld, Stephen A; Harding, Seeromanie

    2012-01-01

    Background A mental health advantage has been observed among adolescents in urban areas. This prospective study tests whether cultural integration measured by cross-cultural friendships explains a mental health advantage for adolescents. Methods A prospective cohort of adolescents was recruited from 51 secondary schools in 10 London boroughs. Cultural identity was assessed by friendship choices within and across ethnic groups. Cultural integration is one of four categories of cultural identity. Using gender-specific linear-mixed models we tested whether cultural integration explained a mental health advantage, and whether gender and age were influential. Demographic and other relevant factors, such as ethnic group, socio-economic status, family structure, parenting styles and perceived racism were also measured and entered into the models. Mental health was measured by the Strengths and Difficulties Questionnaire as a ‘total difficulties score’ and by classification as a ‘probable clinical case’. Results A total of 6643 pupils in first and second years of secondary school (ages 11–13 years) took part in the baseline survey (2003/04) and 4785 took part in the follow-up survey in 2005–06. Overall mental health improved with age, more so in male rather than female students. Cultural integration (friendships with own and other ethnic groups) was associated with the lowest levels of mental health problems especially among male students. This effect was sustained irrespective of age, ethnicity and other potential explanatory variables. There was a mental health advantage among specific ethnic groups: Black Caribbean and Black African male students (Nigerian/Ghanaian origin) and female Indian students. This was not fully explained by cultural integration, although cultural integration was independently associated with better mental health. Conclusions Cultural integration was associated with better mental health, independent of the mental health advantage

  8. Advantages of semiconductor CZT for medical imaging

    Science.gov (United States)

    Wagenaar, Douglas J.; Parnham, Kevin; Sundal, Bjorn; Maehlum, Gunnar; Chowdhury, Samir; Meier, Dirk; Vandehei, Thor; Szawlowski, Marek; Patt, Bradley E.

    2007-09-01

    Cadmium zinc telluride (CdZnTe, or CZT) is a room-temperature semiconductor radiation detector that has been developed in recent years for a variety of applications. CZT has been investigated for many potential uses in medical imaging, especially in the field of single photon emission computed tomography (SPECT). CZT can also be used in positron emission tomography (PET) as well as photon-counting and integration-mode x-ray radiography and computed tomography (CT). The principal advantages of CZT are 1) direct conversion of x-ray or gamma-ray energy into electron-hole pairs; 2) energy resolution; 3) high spatial resolution and hence high space-bandwidth product; 4) room temperature operation, stable performance, high density, and small volume; 5) depth-of-interaction (DOI) available through signal processing. These advantages will be described in detail with examples from our own CZT systems. The ability to operate at room temperature, combined with DOI and very small pixels, make the use of multiple, stationary CZT "mini-gamma cameras" a realistic alternative to today's large Anger-type cameras that require motion to obtain tomographic sampling. The compatibility of CZT with Magnetic Resonance Imaging (MRI)-fields is demonstrated for a new type of multi-modality medical imaging, namely SPECT/MRI. For pre-clinical (i.e., laboratory animal) imaging, the advantages of CZT lie in spatial and energy resolution, small volume, automated quality control, and the potential for DOI for parallax removal in pinhole imaging. For clinical imaging, the imaging of radiographically dense breasts with CZT enables scatter rejection and hence improved contrast. Examples of clinical breast images with a dual-head CZT system are shown.

  9. Advantages of floating covers with LLDPE Liners

    International Nuclear Information System (INIS)

    Munoz Gomez, J. M.

    2014-01-01

    Using floating covers in irrigation pounds and waste dam gives many advantages. It is a very interesting investment for those place with a high evaporation ratio. this is an easy system which improves several aspects in irrigation or drinkable water reservoirs, mainly it saves water and it saves clean-works (time and cost). It is also used in waste dam to deodorization. Time ago this application was developed with PVC liners and TPO liners, now the innovation is LLDPE liners which improve mechanical properties, durability and an easier installation. This paper develops the state of art of this design technology, and the back ground of our experience. (Author)

  10. Advantages of super-light structures

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl

    2009-01-01

    Super-light structures with pearl-chain reinforcement is a new revolutionary technology that opens possibilities of building load-bearing structures much cheaper and with several other advantages compared to traditional constructions of concrete and steel. Some benefits are: 1 Half price or less. 2...... Architectural expressions never seen before. 3 Material savings of more than 50 %. 4 Energy and CO2 savings of more than 50 %. 5 No Scaffolding and cheaper moulds. 6 Improved durability. 7 Extreme thermal insulation. 8 Better indoor-climate. 9 User friendly operation and maintenance. 10 Increased safety...

  11. Technology Survey Assistance Tool Focusing on Their Advantages

    Science.gov (United States)

    Nishiyama, Risa; Takeuchi, Hironori; Watanabe, Hideo; Nasukawa, Tetsuya

    It is important for R&D managers, consultants, and other people seeking broad knowledge in technology fields to survey technical literature such as research papers, white papers, and technology news articles. One of the important kinds of information for those people regards the effectiveness of new technologies in their own businesses. General search engines are good at selecting documents revealing the details of a specific technology or a technology field, but it is hard to obtain useful information about how a technology will apply to individual business cases from such search results. There is a need for a technology survey assistance tool that helps users find technologies with suitable capabilities. In this paper, two technical tasks were tackled to develop the prototype of this assistance tool: Extraction of advantage phrases and scoring for the advantage phrases to find novel applications in the target technology field. We describe a new method to identify advantage phrases in technical documents and our scoring function that gives higher scores to novel applications of the technology. The results of evaluations showed our phrase identification method with only a few phrasal patterns performs almost as well as human annotators, and the proposed scoring conforms better to the decisions made by professionals than random sort.

  12. The essence and market advantages of the direct sales of goods and services

    OpenAIRE

    A.O. Dvigun

    2011-01-01

    The article deals with the economic substance of the method of direct selling of goods and services, analyzes the features of this method as a marketing strategy, discusses the advantages and prospects of technology introduction of direct sales.

  13. Advantages of going modular in HTRs

    International Nuclear Information System (INIS)

    Reutler, H.; Lohnert, G.H.

    1984-01-01

    A multitude of problems that are encountered in large HTR power plans, constructively as well as concerning plant safety, can be related to the mere physical size of a large reactor core. In limiting the thermal power of an HTR-module to approximately 200 MW an inherent limitation of the fuel element temperature below critical values can be guaranteed for all possible core heat up accidents. Consequently, a significant failure rate of coated particles can be excluded and, hence, out of physical reasons, no intolerable fission product release from the core will ever have to be considered. The HTR-module is so qualified and very well suited for all possible plant sides which have to be taken into consideration for medium sized plants for the production of process steam and electricity. The cost investigations show considerable cost advantages for modular HTRs. For German conditions it was found that even a four-modular plant (800 MW/thermal) is competitive with a fossile-fueled plant of the same size, the specific plant costs were evaluated to be DM 4700/kW (electric). Moreover the investigations show that the increase of the power of the modular unit yields only small cost advantages, therefore in a modularized power plant it even would be possible to reduce the power of a modular unit below 200 MW without having to cope with severe economic penalties, if the distance from technological or safety limits is felt to be too small. (orig.)

  14. Advantages of digital imaging for radiological diagnostic

    International Nuclear Information System (INIS)

    Trapero, M. A.; Gonzalez, S.; Albillos, J. C.; Martel, J.; Rebollo, M.

    2006-01-01

    The advantages and limitations of radiological digital images in comparison with analogic ones are analyzed. We discuss three main topics: acquisition, post-procedure manipulation, and visualization, archive and communication. Digital acquisition with computed radiology systems present a global sensitivity very close to conventional film for diagnostic purposes. However, flat panel digital systems seems to achieve some advantages in particular clinical situations. A critical issue is the radiation dose-reduction that can be accomplished without reducing image quality nor diagnostic exactitude. The post-procedure manipulation allows, particularly in multiplanar modalities like CT or MR, to extract all implicit diagnostic information in the images: Main procedures are multiplanar and three-dimensional reformations, dynamic acquisitions, functional studies and image fusion. The use of PACS for visualization, archive and communication of images, improves the effectiveness and the efficiency of the workflow, allows a more comfortable diagnosis for the radiologist and gives way to improvements in the communication of images, allowing tele consulting and the tele radiology. (Author) 6 refs

  15. Cooperative resources lead to sustainable competitive advantage

    Directory of Open Access Journals (Sweden)

    Fernando Vieira

    2016-11-01

    Full Text Available The objective of this research is to analyze how organizational resources contribute to cooperatives achieving a sustainable competitive advantage. The theoretical approach of this study is the Resource Based View and VRIO model advocated by Barney and Hesterly (2007. The research was characterized as descriptive and quantitative, through data collection from secondary sources and a survey. The data collection tool was a questionnaire devised by Peacock, Sehnem and Hoffmann (2011. Data collection took place between the months of September 2014 and March 2015. The study sample was composed of a total of 215 cooperatives from across the country, divided into 13 segments. Secondary data was subjected to content analysis. The primary data was analyzed using statistical inference, namely: descriptive statistics, mean, Pearson correlation, Varimax rotation and the Kruskal-Wallis test. The main results showed that human resources are seen as important to achieving a sustainable competitive advantage. This research contributed to and enables new studies concerning the growth of cooperatives taking into account the use of internal resources.

  16. The advantages of digital radiography in department of radiology

    International Nuclear Information System (INIS)

    Mao Lijuan; Luo Xiaomei; Wu Tengfang

    2009-01-01

    Objective: To investigate the advantages of digital radiography in department of radiology by comparing digital radiography with common radiography. Methods: Test card was used for testing the spatial resolution of DR and common radiography. 1000 films of chest by DR and 1000 films of chest by common radiography were compared in image quality, dose of radiation, the rate of waste film, and the advantages of DR was analyzed. Results: Compared to common radiography, DR had a high sensitivity, high DQE (quantum detection efficiency), high spatial resolution and density resolution. The speed of acquisition and X-ray conversion efficiency were fast. The function of post-processing was strong and the rate of disease detection was high. Conclusion: DR is better than common radiography in all respects, it will be widely applied. (authors)

  17. Physiological Biometric Authentication Systems Advantages Disadvantages And Future Development A Review

    Directory of Open Access Journals (Sweden)

    Israa M. Alsaadi

    2015-08-01

    Full Text Available Abstract With the fast increasing of the electronic crimes and their related issues deploying a reliable user authentication system became a significant task for both of access control and securing users private data. Human biometric characteristics such as face finger iris scanning voice signature and other features provide a dependable security level for both of the personal and the public use. Many biometric authentication systems have been approached for long time. Due to the uniqueness of human biometrics witch played a master role in degrading imposters attacks. Such authentication models have overcome other traditional security methods like passwords and PIN. This paper aims to briefly address the psychological biometric authentication techniques. Also a brief summary to the advantages disadvantages and future developments of each method is provided in this paper.

  18. Cognitive advantages and disadvantages in early and late bilinguals.

    Science.gov (United States)

    Pelham, Sabra D; Abrams, Lise

    2014-03-01

    Previous research has documented advantages and disadvantages of early bilinguals, defined as learning a 2nd language by school age and using both languages since that time. Relative to monolinguals, early bilinguals manifest deficits in lexical access but benefits in executive function. We investigated whether becoming bilingual after childhood (late bilinguals) can produce the cognitive advantages and disadvantages typical of early bilinguals. Participants were 30 monolingual English speakers, 30 late English-Spanish bilinguals, and 30 early Spanish-English bilinguals who completed a picture naming task (lexical access) and an attentional network task (executive function). Late and early bilinguals manifested equivalent cognitive effects in both tasks, demonstrating lexical access deficits and executive function benefits. These findings provide support for the hypothesis that cognitive effects associated with bilingualism arise as the result of proficient, habitual use of 2 languages and not of developmental changes associated with becoming bilingual during childhood.

  19. Methods, Devices and Computer Program Products Providing for Establishing a Model for Emulating a Physical Quantity Which Depends on at Least One Input Parameter, and Use Thereof

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention proposes methods, devices and computer program products. To this extent, there is defined a set X including N distinct parameter values x_i for at least one input parameter x, N being an integer greater than or equal to 1, first measured the physical quantity Pm1 for each...

  20. Refinements of the attending equations for several spectral methods that provide improved quantification of B-carotene and/or lycopene in selected foods

    Science.gov (United States)

    Developing and maintaining maximal levels of carotenoids in fruits and vegetables that contain them is a concern of the produce industry. Toward this end, reliable methods for quantifying lycopene and B-carotene, two of the major health-enhancing carotenoids, are necessary. The goal of this resear...

  1. Method for applying a thin film barrier stack to a device with microstructures, and device provided with such a thin film barrier stack

    NARCIS (Netherlands)

    2005-01-01

    A method for applying a thin film barrier stack to a device with microstructures, such as, for instance, an OLED, wherein the thin film barrier stack forms a barrier to at least moisture and oxygen, wherein the stack is built up from a combination of org. and inorg. layers, characterized in that a

  2. Poly-1,2-azepine, method of producing a film of such a polymer on a substrate and a substrate provided with such a polymer

    NARCIS (Netherlands)

    1990-01-01

    Gas-phase photopolymerisation of phenylazides results in a new type of polymer, a poly-1,2-azepine. This polymer can be provided on a substrate according to a predetermined pattern by exposing it via a mask. After oxidation an electrically conductive polymer is obtained.

  3. Introduction of Mercury-free Gold Extraction Methods to Medium-Scale Miners and Education of Health Care Providers to Reduce the use of Mercury in Sorata, Bolivia

    Directory of Open Access Journals (Sweden)

    Peter W. U. Appel

    2015-01-01

    Conclusions. The gold ores tested during the project proved amenable to mercury-free gold extraction using borax smelting. The miners also realized that gold recovery increased when performing mercury-free gold extraction. The miners decided to stop using mercury and a follow-up project cleaned their mining equipment for mercury and modified the processing lines. The health care providers were also successfully trained.

  4. Reconciling patient and provider priorities for improving the care of critically ill patients: A consensus method and qualitative analysis of decision making.

    Science.gov (United States)

    McKenzie, Emily; Potestio, Melissa L; Boyd, Jamie M; Niven, Daniel J; Brundin-Mather, Rebecca; Bagshaw, Sean M; Stelfox, Henry T

    2017-12-01

    Providers have traditionally established priorities for quality improvement; however, patients and their family members have recently become involved in priority setting. Little is known about how to reconcile priorities of different stakeholder groups into a single prioritized list that is actionable for organizations. To describe the decision-making process for establishing consensus used by a diverse panel of stakeholders to reconcile two sets of quality improvement priorities (provider/decision maker priorities n=9; patient/family priorities n=19) into a single prioritized list. We employed a modified Delphi process with a diverse group of panellists to reconcile priorities for improving care of critically ill patients in the intensive care unit (ICU). Proceedings were audio-recorded, transcribed and analysed using qualitative content analysis to explore the decision-making process for establishing consensus. Nine panellists including three providers, three decision makers and three family members of previously critically ill patients. Panellists rated and revised 28 priorities over three rounds of review and reached consensus on the "Top 5" priorities for quality improvement: transition of patient care from ICU to hospital ward; family presence and effective communication; delirium screening and management; early mobilization; and transition of patient care between ICU providers. Four themes were identified as important for establishing consensus: storytelling (sharing personal experiences), amalgamating priorities (negotiating priority scope), considering evaluation criteria and having a priority champion. Our study demonstrates the feasibility of incorporating families of patients into a multistakeholder prioritization exercise. The approach described can be used to guide consensus building and reconcile priorities of diverse stakeholder groups. © 2017 The Authors Health Expectations Published by John Wiley & Sons Ltd.

  5. Perspectives on financial incentives to health service providers for increasing breast feeding and smoking quit rates during pregnancy: a mixed methods study.

    Science.gov (United States)

    Hoddinott, Pat; Thomson, Gill; Morgan, Heather; Crossland, Nicola; MacLennan, Graeme; Dykes, Fiona; Stewart, Fiona; Bauld, Linda; Campbell, Marion K

    2015-11-13

    To explore the acceptability, mechanisms and consequences of provider incentives for smoking cessation and breast feeding as part of the Benefits of Incentives for Breastfeeding and Smoking cessation in pregnancy (BIBS) study. Cross-sectional survey and qualitative interviews. Scotland and North West England. Early years professionals: 497 survey respondents included 156 doctors; 197 health visitors/maternity staff; 144 other health staff. Qualitative interviews or focus groups were conducted with 68 pregnant/postnatal women/family members; 32 service providers; 22 experts/decision-makers; 63 conference attendees. Early years professionals were surveyed via email about the acceptability of payments to local health services for reaching smoking cessation in pregnancy and breastfeeding targets. Agreement was measured on a 5-point scale using multivariable ordered logit models. A framework approach was used to analyse free-text survey responses and qualitative data. Health professional net agreement for provider incentives for smoking cessation targets was 52.9% (263/497); net disagreement was 28.6% (142/497). Health visitors/maternity staff were more likely than doctors to agree: OR 2.35 (95% CI 1.51 to 3.64; pgaming, box-ticking bureaucracies and health inequalities were counterbalances to potential benefits. Provider incentives are favoured by non-medical staff. Solutions which increase trust and collaboration towards shared goals, without negatively impacting on relationships or increasing bureaucracy are required. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  6. The advantageous way of getting the lowest uncertainty values of elemental concentration by INAA

    International Nuclear Information System (INIS)

    Cincu, Em.; Manea, I.; Manu, V.; Barbos, D.

    2007-01-01

    Analysts in a NAA accredited laboratory bear full responsibility for the report on the material they investigated. The document has to contain the most accurate values that can be, as confidence to further use of the material on the market. To this end, analysts are expected to use the standardization method providing the lowest element concentration uncertainty and carefully quantify every factor that may contribute to the validity of the results. The question is which method is the most advantageous one from this perspective and in what conditions. This paper presents a comparison between results of the elemental analysis of a CRM sample by INAA, as obtained through two standardization methods and three calculations variants applied to the same experimental data. The results were discussed in terms of uncertainty and of the E n statistical criterion recommended for inter-comparison exercises. The influence of the nuclear reaction and decay data was studied in several cases. (author)

  7. Competitive Advantages of Indonesian Plywood Industry: A Perspective from Porter???s Five Forces Model

    OpenAIRE

    Makkarennu

    2015-01-01

    The Understanding industry structure is of great concern to industry strategic since depending against the competitive forces and shaping them in a company???s favor area essential to strategy. Competitive advantages provide the framework for assessing strategy and understanding the source of competitive advantage. This paper applies Porter Five Forces Model to identify the positioning of competitive advantages of plywood industry in South Sulawesi, Indonesia. Qualitative research was carried...

  8. The use of microbead-based spoligotyping for Mycobacterium tuberculosis complex to evaluate the quality of the conventional method: Providing guidelines for Quality Assurance when working on membranes

    Directory of Open Access Journals (Sweden)

    Garzelli Carlo

    2011-04-01

    Full Text Available Abstract Background The classical spoligotyping technique, relying on membrane reverse line-blot hybridization of the spacers of the Mycobacterium tuberculosis CRISPR locus, is used world-wide (598 references in Pubmed on April 8th, 2011. However, until now no inter-laboratory quality control study had been undertaken to validate this technique. We analyzed the quality of membrane-based spoligotyping by comparing it to the recently introduced and highly robust microbead-based spoligotyping. Nine hundred and twenty-seven isolates were analyzed totaling 39,861 data points. Samples were received from 11 international laboratories with a worldwide distribution. Methods The high-throughput microbead-based Spoligotyping was performed on CTAB and thermolyzate DNA extracted from isolated Mycobacterium tuberculosis complex (MTC strains coming from the genotyping participating centers. Information regarding how the classical Spoligotyping method was performed by center was available. Genotype discriminatory analyses were carried out by comparing the spoligotypes obtained by both methods. The non parametric U-Mann Whitney homogeneity test and the Spearman rank correlation test were performed to validate the observed results. Results Seven out of the 11 laboratories (63 %, perfectly typed more than 90% of isolates, 3 scored between 80-90% and a single center was under 80% reaching 51% concordance only. However, this was mainly due to discordance in a single spacer, likely having a non-functional probe on the membrane used. The centers using thermolyzate DNA performed as well as centers using the more extended CTAB extraction procedure. Few centers shared the same problematic spacers and these problematic spacers were scattered over the whole CRISPR locus (Mostly spacers 15, 14, 18, 37, 39, 40. Conclusions We confirm that classical spoligotyping is a robust method with generally a high reliability in most centers. The applied DNA extraction procedure (CTAB

  9. Hydrodynamic advantages of swimming by salp chains.

    Science.gov (United States)

    Sutherland, Kelly R; Weihs, Daniel

    2017-08-01

    Salps are marine invertebrates comprising multiple jet-propelled swimming units during a colonial life-cycle stage. Using theory, we show that asynchronous swimming with multiple pulsed jets yields substantial hydrodynamic benefit due to the production of steady swimming velocities, which limit drag. Laboratory comparisons of swimming kinematics of aggregate salps ( Salpa fusiformis and Weelia cylindrica ) using high-speed video supported that asynchronous swimming by aggregates results in a smoother velocity profile and showed that this smoother velocity profile is the result of uncoordinated, asynchronous swimming by individual zooids. In situ flow visualizations of W. cylindrica swimming wakes revealed that another consequence of asynchronous swimming is that fluid interactions between jet wakes are minimized. Although the advantages of multi-jet propulsion have been mentioned elsewhere, this is the first time that the theory has been quantified and the role of asynchronous swimming verified using experimental data from the laboratory and the field. © 2017 The Author(s).

  10. The competitive advantage of sanctioning institutions.

    Science.gov (United States)

    Gürerk, Ozgür; Irlenbusch, Bernd; Rockenbach, Bettina

    2006-04-07

    Understanding the fundamental patterns and determinants of human cooperation and the maintenance of social order in human societies is a challenge across disciplines. The existing empirical evidence for the higher levels of cooperation when altruistic punishment is present versus when it is absent systematically ignores the institutional competition inherent in human societies. Whether punishment would be deliberately adopted and would similarly enhance cooperation when directly competing with nonpunishment institutions is highly controversial in light of recent findings on the detrimental effects of punishment. We show experimentally that a sanctioning institution is the undisputed winner in a competition with a sanction-free institution. Despite initial aversion, the entire population migrates successively to the sanctioning institution and strongly cooperates, whereas the sanction-free society becomes fully depopulated. The findings demonstrate the competitive advantage of sanctioning institutions and exemplify the emergence and manifestation of social order driven by institutional selection.

  11. The kinematic advantage of electric cars

    Science.gov (United States)

    Meyn, Jan-Peter

    2015-11-01

    Acceleration of a common car with with a turbocharged diesel engine is compared to the same type with an electric motor in terms of kinematics. Starting from a state of rest, the electric car reaches a distant spot earlier than the diesel car, even though the latter has a better specification for engine power and average acceleration from 0 to 100 km h-1. A three phase model of acceleration as a function of time fits the data of the electric car accurately. The first phase is a quadratic growth of acceleration in time. It is shown that the tenfold higher coefficient for the first phase accounts for most of the kinematic advantage of the electric car.

  12. The environmental advantage in the competitive equation

    International Nuclear Information System (INIS)

    Horst, T.J.; Blake, E.T.

    1992-01-01

    The role of environmental issues in the utility business has undergone a dramatic transition in the past few years and this new role is the basis for new definitions and new responses. Policies or products that protect the environment are now an advantage to those companies that properly capture environmental issues in their strategic planning process. This paper will focus on the underpinnings of this shift in the role of environmental protection in business and go beyond the issues of today to suggest some paradigms for the future. The current status of environmental concern is evident in the time and resources committed to environmental protection. Public officials take more proactive environmental positions; Corporations recognize environmental values in competitive equation; Citizens express willingness to pay for environmentally responsible services and products; Environmental issues tie business to the community; and Environmental planning tradeoffs are becoming more complex

  13. The POP Program: the patient education advantage.

    Science.gov (United States)

    Claeys, M; Mosher, C; Reesman, D

    1998-01-01

    In 1992, a preoperative education program was developed for total joint replacement patients in a small community hospital. The goals of the program were to increase educational opportunities for the joint replacement patients, prepare patients for hospitalization, plan for discharge needs, and increase efficiency of the orthopaedic program. Since 1992, approximately 600 patients have attended the education program. Outcomes have included positive responses from patients regarding their preparedness for surgery, increased participation in their plan of care, coordinated discharge planning, decreased length of stay, and progression across the continuum of care. A multidisciplinary approach to preparing patients for surgery allows for a comprehensive and efficient education program. Marketing of successful programs can enhance an institution's competitive advantage and help ensure the hospital's viability in the current health care arena.

  14. Costs and advantages of nuclear energy

    International Nuclear Information System (INIS)

    Almoguera, R.

    2006-01-01

    Recent studies on nuclear energy competitiveness show that considering only the economics this option is the most economic one to generate the base load electricity in most of the countries which do not have plenty of alternative fuels, being this advantage both for the actual prices formation and for their stability on the long term. Should we add the strategic and environmental benefits linked to: Kioto emissions limits, short and long term supply security, national wealth increase due to quality and price of the supply and enhancement of related enterprises, the goodness of nuclear energy to supply a significant share of the electricity demand in most of the countries is evident. For the investors to make decisions for this option, some conditions have to be assured: regulatory stability, favourable national energy policy and expectation for the future, predictable and proven licensing process and expectation for moderate interest rates in the long term. (Author)

  15. The advantages of hydraulic packing extraction

    International Nuclear Information System (INIS)

    Baker, R.S.

    1991-01-01

    Today's competitive environment, coupled with industry's desire to improve the efficiency of plant maintenance and operations, has management continually seeking ways to save time, money, and, at nuclear plants, radiation exposure. One area where a tremendous improvement in efficiency can be realized is valve packing removal. For example, industry experience indicates that up to 70% of the time it takes to repack a valve can be spent just removing the old packing. In some case, the bonnets of small valves are removed to facilitate packing removal and prevent stem and stuffing box damage that can occur when using packing removal picks. In other cases, small valves are simply removed and discarded because it costs less to replace the valves than to remove the packing using conventional methods. Hydraulic packing extraction greatly reduces packing removal time and will not damage the stem nor stuffing box, thus eliminating the need for bonnet removal or valve replacement. This paper will review some of the more common problems associated with manual packing extraction techniques. It will explain how hydraulic packing extraction eliminates or greatly reduces the impact of each of the problem areas. A discussion will be provided of some actual industry operating experiences related to success stories using hydraulic packing extraction. The paper will also briefly describe the operating parameters associated with hydraulic packing extraction tools. Throughout the paper, actual operating experiences from the nuclear power, fossil power, petrochemical, and refinery industries will be used to support the conclusion that hydraulic packing extraction is an alternative that can save time, money, and exposure

  16. Patient-provider communication styles in HIV treatment programs in Bamako, Mali: A mixed-methods study to define dimensions and measure patient preferences

    Directory of Open Access Journals (Sweden)

    Emily A. Hurley

    2017-12-01

    Full Text Available Effective patient-provider communication (PPC promotes patient adherence and retention in long-term care. Sub-Saharan Africa faces unprecedented demand for chronic care for HIV patients on antiretroviral therapy (ART, yet adherence and retention remain challenging. In high-income countries, research describing patient preferences for different PPC styles has guided interventions to improve PPC and patient outcomes. However, research on PPC preferences in sub-Saharan Africa is limited. We sought to define PPC dimensions relevant to ART programs in Bamako, Mali through recordings of clinical interactions, in-depth interviews and focus-group discussions with 69 patients and 17 providers. To assess preferences toward contrasting PPC styles within dimensions, we conducted a vignette-based survey with 141 patients across five ART facilities. Qualitative analysis revealed two PPC dimensions similar to those described in the literature on patient-centered communication (level of psychosocial regard, balance of power, and one unique dimension that emerged from the data (guiding patient behavior: easy/tough/sharp. Significantly more survey participants chose the vignette demonstrating high psychosocial regard (52.2% compared to a biomedical style (22.5% (p<0.001. Within balance of power, a statistically similar proportion of participants chose the vignette demonstrating shared power (40.2% compared to a provider-dominated style (35.8%. In guiding patient behavior, a similar proportion of participants preferred the vignette depicting the “easy” (38.4% and/or “tough” style (40.6%, but significantly fewer preferred the “sharp” style (14.5% (p<0.001. Highly educated participants chose biomedical and shared power styles more frequently, while less educated participants more frequently indicated “no preference”. Working to understand, develop, and tailor PPC styles to patients in chronic care may help support patient retention and ultimately

  17. Diffeomorphic Anatomical Registration Through Exponentiated Lie Algebra provides reduced effect of scanner for cortex volumetry with atlas-based method in healthy subjects.

    Science.gov (United States)

    Goto, Masami; Abe, Osamu; Aoki, Shigeki; Hayashi, Naoto; Miyati, Tosiaki; Takao, Hidemasa; Iwatsubo, Takeshi; Yamashita, Fumio; Matsuda, Hiroshi; Mori, Harushi; Kunimatsu, Akira; Ino, Kenji; Yano, Keiichi; Ohtomo, Kuni

    2013-07-01

    This study aimed to investigate whether the effect of scanner for cortex volumetry with atlas-based method is reduced using Diffeomorphic Anatomical Registration Through Exponentiated Lie Algebra (DARTEL) normalization compared with standard normalization. Three-dimensional T1-weighted magnetic resonance images (3D-T1WIs) of 21 healthy subjects were obtained and evaluated for effect of scanner in cortex volumetry. 3D-T1WIs of the 21 subjects were obtained with five MRI systems. Imaging of each subject was performed on each of five different MRI scanners. We used the Voxel-Based Morphometry 8 tool implemented in Statistical Parametric Mapping 8 and WFU PickAtlas software (Talairach brain atlas theory). The following software default settings were used as bilateral region-of-interest labels: "Frontal Lobe," "Hippocampus," "Occipital Lobe," "Orbital Gyrus," "Parietal Lobe," "Putamen," and "Temporal Lobe." Effect of scanner for cortex volumetry using the atlas-based method was reduced with DARTEL normalization compared with standard normalization in Frontal Lobe, Occipital Lobe, Orbital Gyrus, Putamen, and Temporal Lobe; was the same in Hippocampus and Parietal Lobe; and showed no increase with DARTEL normalization for any region of interest (ROI). DARTEL normalization reduces the effect of scanner, which is a major problem in multicenter studies.

  18. Diffeomorphic Anatomical Registration Through Exponentiated Lie Algebra provides reduced effect of scanner for cortex volumetry with atlas-based method in healthy subjects

    Energy Technology Data Exchange (ETDEWEB)

    Goto, Masami; Ino, Kenji; Yano, Keiichi [University of Tokyo Hospital, Department of Radiological Technology, Bunkyo-ku, Tokyo (Japan); Abe, Osamu [Nihon University School of Medicine, Department of Radiology, Itabashi-ku, Tokyo (Japan); Aoki, Shigeki [Juntendo University, Department of Radiology, Bunkyo-ku, Tokyo (Japan); Hayashi, Naoto [University of Tokyo Hospital, Department of Computational Diagnostic Radiology and Preventive Medicine, Bunkyo-ku, Tokyo (Japan); Miyati, Tosiaki [Kanazawa University, Graduate School of Medical Science, Kanazawa (Japan); Takao, Hidemasa; Mori, Harushi; Kunimatsu, Akira; Ohtomo, Kuni [University of Tokyo Hospital, Department of Radiology and Department of Computational Diagnostic Radiology and Preventive Medicine, Bunkyo-ku, Tokyo (Japan); Iwatsubo, Takeshi [University of Tokyo, Department of Neuropathology, Bunkyo-ku, Tokyo (Japan); Yamashita, Fumio [Iwate Medical University, Department of Radiology, Yahaba, Iwate (Japan); Matsuda, Hiroshi [Integrative Brain Imaging Center National Center of Neurology and Psychiatry, Department of Nuclear Medicine, Kodaira, Tokyo (Japan); Collaboration: Japanese Alzheimer' s Disease Neuroimaging Initiative

    2013-07-15

    This study aimed to investigate whether the effect of scanner for cortex volumetry with atlas-based method is reduced using Diffeomorphic Anatomical Registration Through Exponentiated Lie Algebra (DARTEL) normalization compared with standard normalization. Three-dimensional T1-weighted magnetic resonance images (3D-T1WIs) of 21 healthy subjects were obtained and evaluated for effect of scanner in cortex volumetry. 3D-T1WIs of the 21 subjects were obtained with five MRI systems. Imaging of each subject was performed on each of five different MRI scanners. We used the Voxel-Based Morphometry 8 tool implemented in Statistical Parametric Mapping 8 and WFU PickAtlas software (Talairach brain atlas theory). The following software default settings were used as bilateral region-of-interest labels: ''Frontal Lobe,'' ''Hippocampus,'' ''Occipital Lobe,'' ''Orbital Gyrus,'' ''Parietal Lobe,'' ''Putamen,'' and ''Temporal Lobe.'' Effect of scanner for cortex volumetry using the atlas-based method was reduced with DARTEL normalization compared with standard normalization in Frontal Lobe, Occipital Lobe, Orbital Gyrus, Putamen, and Temporal Lobe; was the same in Hippocampus and Parietal Lobe; and showed no increase with DARTEL normalization for any region of interest (ROI). DARTEL normalization reduces the effect of scanner, which is a major problem in multicenter studies. (orig.)

  19. Diffeomorphic Anatomical Registration Through Exponentiated Lie Algebra provides reduced effect of scanner for cortex volumetry with atlas-based method in healthy subjects

    International Nuclear Information System (INIS)

    Goto, Masami; Ino, Kenji; Yano, Keiichi; Abe, Osamu; Aoki, Shigeki; Hayashi, Naoto; Miyati, Tosiaki; Takao, Hidemasa; Mori, Harushi; Kunimatsu, Akira; Ohtomo, Kuni; Iwatsubo, Takeshi; Yamashita, Fumio; Matsuda, Hiroshi

    2013-01-01

    This study aimed to investigate whether the effect of scanner for cortex volumetry with atlas-based method is reduced using Diffeomorphic Anatomical Registration Through Exponentiated Lie Algebra (DARTEL) normalization compared with standard normalization. Three-dimensional T1-weighted magnetic resonance images (3D-T1WIs) of 21 healthy subjects were obtained and evaluated for effect of scanner in cortex volumetry. 3D-T1WIs of the 21 subjects were obtained with five MRI systems. Imaging of each subject was performed on each of five different MRI scanners. We used the Voxel-Based Morphometry 8 tool implemented in Statistical Parametric Mapping 8 and WFU PickAtlas software (Talairach brain atlas theory). The following software default settings were used as bilateral region-of-interest labels: ''Frontal Lobe,'' ''Hippocampus,'' ''Occipital Lobe,'' ''Orbital Gyrus,'' ''Parietal Lobe,'' ''Putamen,'' and ''Temporal Lobe.'' Effect of scanner for cortex volumetry using the atlas-based method was reduced with DARTEL normalization compared with standard normalization in Frontal Lobe, Occipital Lobe, Orbital Gyrus, Putamen, and Temporal Lobe; was the same in Hippocampus and Parietal Lobe; and showed no increase with DARTEL normalization for any region of interest (ROI). DARTEL normalization reduces the effect of scanner, which is a major problem in multicenter studies. (orig.)

  20. A new approach combining different MRI methods to provide detailed view on swelling dynamics of xanthan tablets influencing drug release at different pH and ionic strength.

    Science.gov (United States)

    Mikac, Ursa; Sepe, Ana; Kristl, Julijana; Baumgartner, Sasa

    2010-08-03

    The key element in drug release from hydrophilic matrix tablets is the gel layer that regulates the penetration of water and controls drug dissolution and diffusion. We have selected magnetic resonance imaging (MRI) as the method of choice for visualizing the dynamic processes occurring during the swelling of xanthan tablets in a variety of media. The aims were (i) to develop a new method using MRI for accurate determination of penetration, swelling and erosion fronts, (ii) to investigate the effects of pH and ionic strength on swelling, and (iii) to study the influence of structural changes in xanthan gel on drug release. Two dimensional (2D) MRI and one dimensional single point imaging (SPI) of swollen xanthan tablets were recorded, together with T(2) mapping. The border between dry and hydrated glassy xanthan-the penetration front-was determined from 1D SPI signal intensity profiles. The erosion front was obtained from signal intensity profiles of 2D MR images. The swelling front, where xanthan is transformed from a glassy to a rubbery state (gel formation), was determined from T(2) profiles. Further, the new combination of MRI methods for swelling front determination enables to explain the appearance of the unusual "bright front" observed on 2D MR images in tablets swollen in HCl pH 1.2 media, which represents the position of swelling front. All six media studied, differing in pH and ionic strength, penetrate through the whole tablet in 4h+/-0.3h, but formation of the gel layer is significantly delayed. Unexpectedly, the position of the swelling front was the same, independently of the different xanthan gel structures formed under different conditions of pH and ionic strength. The position of the erosion front, on the other hand, is strongly dependent on pH and ionic strength, as reflected in different thicknesses of the gel layers. The latter are seen to be the consequence of the different hydrodynamic radii of the xanthan molecules, which affect the drug

  1. Immediately sequential bilateral cataract surgery: advantages and disadvantages.

    Science.gov (United States)

    Singh, Ranjodh; Dohlman, Thomas H; Sun, Grace

    2017-01-01

    The number of cataract surgeries performed globally will continue to rise to meet the needs of an aging population. This increased demand will require healthcare systems and providers to find new surgical efficiencies while maintaining excellent surgical outcomes. Immediately sequential bilateral cataract surgery (ISBCS) has been proposed as a solution and is increasingly being performed worldwide. The purpose of this review is to discuss the advantages and disadvantages of ISBCS. When appropriate patient selection occurs and guidelines are followed, ISBCS is comparable with delayed sequential bilateral cataract surgery in long-term patient satisfaction, visual acuity and complication rates. In addition, the risk of bilateral postoperative endophthalmitis and concerns of poorer refractive outcomes have not been supported by the literature. ISBCS is cost-effective for the patient, healthcare payors and society, but current reimbursement models in many countries create significant financial barriers for facilities and surgeons. As demand for cataract surgery rises worldwide, ISBCS will become increasingly important as an alternative to delayed sequential bilateral cataract surgery. Advantages include potentially decreased wait times for surgery, patient convenience and cost savings for healthcare payors. Although they are comparable in visual acuity and complication rates, hurdles that prevent wide adoption include liability concerns as ISBCS is not an established standard of care, economic constraints for facilities and surgeons and inability to fine-tune intraocular lens selection in the second eye. Given these considerations, an open discussion regarding the advantages and disadvantages of ISBCS is important for appropriate patient selection.

  2. Semimanufacture intended to be mounted on a vibrating wall or a vibrating panel for actively damping vibrations of the wall, wall or panel provided with such semimanufacture, system provided with a semimanufacture and a control unit, wall or panel provided with a control unit and method for damping audible vibrations of a wall or panel

    NARCIS (Netherlands)

    de Goeje, Marius; van Overbeek, Michiel Wilbert R.M.; van der Waal, Adri; Berkhoff, Arthur P.; Nederveen, Peter J.

    2005-01-01

    A semimanufacture intended to be mounted on a vibrating wall or a vibrating panel for actively damping the vibrations in the wall or the panel with frequencies which are at least partly audible, wherein the semimanufacture is provided with a plate wherein the plate is integrated with: at least one

  3. The half-truth of first-mover advantage.

    Science.gov (United States)

    Suarez, Fernando; Lanzolla, Gianvito

    2005-04-01

    Many executives take for granted that the first company in a new product category gets an unbeatable head start and reaps long-lasting benefits. But that doesn't always happen. The authors of this article discovered that much depends on the pace at which the category's technology is changing and the speed at which the market is evolving. By analyzing these two factors, companies can improve their odds of succeeding as first movers with the resources they possess. Gradual evolution in both the technology and the market provides a first mover with the best conditions for creating a dominant position that is long lasting (Hoover in the vacuum cleaner industry is a good example). In such calm waters, a company can defend its advantages even without exceptional skills or extensive financial resources. When the market is changing rapidly and the product isn't, a first entrant with extensive resources can obtain a long-lasting advantage (as Sony did with its Walkman personal stereo); a company with only limited resources probably must settle for a short-term benefit. When the market is static but the product is changing constantly, first-mover advantages of either kind--durable or short-lived--are unlikely. Only companies with very deep pockets can survive (think of Sony and the digital cameras it pioneered). Rapid churn in both the technology and the market creates the worst conditions. But if companies have an acute sense of when to exit-as Netscape demonstrated when it agreed to be acquired by AOL-a worthwhile short-term gain is possible. Before venturing into a newly forming market, you need to analyze the environment, assess your resources, then determine which type offirst-mover advantage is most achievable. Once you've gone into the water, you have no choice but to swim.

  4. Advantages and disadvantages of stiffness instructions when studying postural control.

    Science.gov (United States)

    Bonnet, Cédrick T

    2016-05-01

    To understand the maintenance of upright stance, researchers try to discover the fundamental mechanisms and attentional resources devoted to postural control and eventually to the performance of other tasks (e.g., counting in the head). During their studies, some researchers require participants to stand as steady as possible and other simply ask participants to stand naturally. Surprisingly, a clear and direct explanation of the usefulness of the steadiness requirement seems to be lacking, both in experimental and methodological discussions. Hence, the objective of the present note was to provide advantages and disadvantages of this steadiness requirement in studies of postural control. The advantages may be to study fundamental postural control, to eliminate useless postural variability, to control spurious body motions and to control the participants' thoughts. As disadvantages, this steadiness requirement only leads to study postural control in unnatural upright stance, it changes the focus of attention (internal vs. external) and the nature of postural control (unconscious vs. conscious), it increases the difficulty of a supposedly easy control task and it eliminates or reduces the opportunity to record exploratory behaviors. When looking carefully at the four advantages of the steadiness requirement, one can believe that they are, in fact, more disadvantageous than advantageous. Overall therefore, this requirement seems illegitimate and it is proposed that researchers should not use it in the study of postural control. They may use this requirement only if they search to know the limit until which participants can consciously reduce their postural sway. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Offshoring and access to location-specific advantages - the impact of governance mode and function

    DEFF Research Database (Denmark)

    Mykhaylenko, Alona; Motika, Agnes; Wæhrens, Brian Vejrum

    how access to particular offshoring advantages may provide this link. The results of a quantitative survey of more than 1000 Scandinavian firms show that certain offshoring factors (governance mode and type of offshored function) indeed impact the access a company acquires to certain offshoring...... advantages, which may explain the unpredictability of previous performance outcomes....

  6. 50 CFR 86.112 - What are the advantages of doing a survey?

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false What are the advantages of doing a survey... INFRASTRUCTURE GRANT (BIG) PROGRAM How States Will Complete Access Needs Surveys § 86.112 What are the advantages of doing a survey? Surveys provide the information necessary to fully understand the needs of boaters...

  7. The Female Stroke Survival Advantage: Relation to Age

    DEFF Research Database (Denmark)

    Olsen, Tom Skyhøj; Dehlendorff, Christian; Andersen, Klaus Kaae

    2009-01-01

    Background: Age-related hormonal factors are thought to be related to the gender gap in longevity. Testing the hypothesis that survival is best in young premenopausal women we studied the effect of age on 1-week mortality in stroke patients. Methods: A registry was started in 2001 with the aim...... in women. While mortality increased almost linearly in women over the entire age range, it increased steeply in men from the age of 50 and at the age of 80 years survival was 80% better in women. Conclusion: The female stroke survival advantage applies to all ages. It increases with age due to a steeply...

  8. Green synthesis of nanoparticles: Their advantages and disadvantages

    Science.gov (United States)

    Parveen, Khadeeja; Banse, Viktoria; Ledwani, Lalita

    2016-04-01

    The nanotechnology and biomedical sciences opens the possibility for a wide variety of biological research topics and medical uses at the molecular and cellular level. The biosynthesis of nanoparticles has been proposed as a cost-effective and environmentally friendly alternative to chemical and physical methods. Plant-mediated synthesis of nanoparticles is a green chemistry approach that connects nanotechnology with plants. Novel methods of ideally synthesizing NPs are thus thought that are formed at ambient temperatures, neutral pH, low costs and environmentally friendly fashion. Keeping these goals in view nanomaterials have been synthesized using various routes. Among the biological alternatives, plants and plant extracts seem to be the best option. Plants are nature's "chemical factories". They are cost efficient and require low maintenance. The advantages and disadvantages of nanotechnology can be easily enumerated. This study attempts to review the diversity of the field, starting with the history of nanotechnology, the properties of the nanoparticle, various strategies of synthesis, the many advantages and disadvantages of different methods and its application.

  9. On the issue of methodology of estimating the regional competitive advantages by types of activity

    Directory of Open Access Journals (Sweden)

    Azat Rashitovich Safiullin

    2015-06-01

    Full Text Available Objective to develop the research methodology of the competitive position of territories by types of economic activities to define the relevant types of economic activities and to diagnose their competitive advantages. Methods a differentiated approach to the analysis of competitiveness based on matrix models of competitive positioning which allows to identify the relevant types of economic activities of the territory. This approach determined the choice of specific research methods dialectics abstraction systematic logical structural comparative and statistical. The application of the above methods helped to ensure the validity of the analysis results theoretical and practical conclusions. Results in the study were used the experience and knowledge gained during an earlier undertaken series of projects relating to the assessment of economy efficiency of Tatarstan Republic in 20052011.Previous reports dealt with the change of the selected industries positions of the Republic the structure and dynamics of the competitive position of these industries compared to the leading Russian regions. A distinctive feature of the research results presented in this article is a comparative analysis of competitive advantages of economic activities of Tatarstan Republic based on the matrix model of competitive positioning. Scientific novelty for the first time the matrix model of diagnostics of competitive advantages of the territory by the type of economic activity was proposed which allows to identify the priority industrial portfolio and provide targeted management actions to enhance its investment attractiveness. Practical value the main provisions and conclusions of the article can be used by legislative and executive authorities of the Russian Federation business community research institutions and organizations to develop strategies and programs of socioeconomic development and territorial planning schemes priority directions of industrial and investment

  10. Advantageous grain boundaries in iron pnictide superconductors

    Science.gov (United States)

    Katase, Takayoshi; Ishimaru, Yoshihiro; Tsukamoto, Akira; Hiramatsu, Hidenori; Kamiya, Toshio; Tanabe, Keiichi; Hosono, Hideo

    2011-01-01

    High critical temperature superconductors have zero power consumption and could be used to produce ideal electric power lines. The principal obstacle in fabricating superconducting wires and tapes is grain boundaries—the misalignment of crystalline orientations at grain boundaries, which is unavoidable for polycrystals, largely deteriorates critical current density. Here we report that high critical temperature iron pnictide superconductors have advantages over cuprates with respect to these grain boundary issues. The transport properties through well-defined bicrystal grain boundary junctions with various misorientation angles (θGB) were systematically investigated for cobalt-doped BaFe2As2 (BaFe2As2:Co) epitaxial films fabricated on bicrystal substrates. The critical current density through bicrystal grain boundary (JcBGB) remained high (>1 MA cm−2) and nearly constant up to a critical angle θc of ∼9°, which is substantially larger than the θc of ∼5° for YBa2Cu3O7–δ. Even at θGB>θc, the decay of JcBGB was much slower than that of YBa2Cu3O7–δ. PMID:21811238

  11. BILATERAL COMPARATIVE ADVANTAGES: INDONESIA AND MALAYSIA CASE

    Directory of Open Access Journals (Sweden)

    Ni Putu Wiwin Setyari

    2015-03-01

    Full Text Available This studytried tolook more closely at market integration, through export prices channel, inIndonesiaandMalaysia. Severalpreviousstudiestendtorejectthe existence oflawofoneprice(LOP. The law of one price (LOP states that price a given product should be the same in different parts of the world if valued in common currency. However, empirical studies uniformly shows LOP does not describe most markets. Someimportantfactorsthat are consideredinstrumentalin this regardaretransportation costsandprice stickiness. However, there isone characteristicthat is oftenoverlookedin the discussion ofLOP, namelychanges incomparative advantage. The specific objectiveofthispaperis to look atcomparative advantagecorrelationbetween the two countriesandtheir effect onpriceconvergence. Correlationof both selected commodities –using therankspearman's test -indicates the nature ofthemutualsubstitutionof productsthatcarrythe possibility of"price competition" so thatthe pricepointtoconvergeto one another. Tests on theexportprice ofsomeselected productsinboth countriesindicatedthe occurrence ofpriceconvergence, seen from thetwoanalytical techniques: σconvergenceandco-integrationusingJohansen's test. This conclusion is generated by attempted to control the "identical assumption" is to examines prices for similar products (homogeneous using SITC 3-digit, which is produced from the "same" or close locations, with the export destination to the same trading partner

  12. Prochlorococcus: Advantages and Limits of Minimalism

    Science.gov (United States)

    Partensky, Frédéric; Garczarek, Laurence

    2010-01-01

    Prochlorococcus is the key phytoplanktonic organism of tropical gyres, large ocean regions that are depleted of the essential macronutrients needed for photosynthesis and cell growth. This cyanobacterium has adapted itself to oligotrophy by minimizing the resources necessary for life through a drastic reduction of cell and genome sizes. This rarely observed strategy in free-living organisms has conferred on Prochlorococcus a considerable advantage over other phototrophs, including its closest relative Synechococcus, for life in this vast yet little variable ecosystem. However, this strategy seems to reach its limits in the upper layer of the S Pacific gyre, the most oligotrophic region of the world ocean. By losing some important genes and/or functions during evolution, Prochlorococcus has seemingly become dependent on co-occurring microorganisms. In this review, we present some of the recent advances in the ecology, biology, and evolution of Prochlorococcus, which because of its ecological importance and tiny genome is rapidly imposing itself as a model organism in environmental microbiology.

  13. Grounding Animal Rights in Mutual Advantage Contractarianism

    Directory of Open Access Journals (Sweden)

    Matthew Taylor

    2014-09-01

    Full Text Available Contrary to critics and advocates of contractarianism alike, I argue that mutual advantage contractarianism entails rights and protections for animals. In section one I outline the criteria that must be met in order for an individual to qualify for moral rights on the contractarian view. I then introduce an alternative form of ‘rights,’ which I call ‘protectorate status,’ from which an individual can receive protections indirectly. In section two I suggest guidelines for assigning animal rights based on two ways of categorizing animals. On the basis of the categorization according to benefit derived, I argue that animals used for companionship, security, hunting assistance, transportation, entertainment, medical service, nourishment, or clothing will tend to qualify for basic rights against starvation, predation, and disease. On the basis of the categorization according to species, I argue that, on top of the basic rights above, dogs tend to qualify for rights against abuse, and against frivolous medical experimentation, as well as further negotiated rights. Cows have the basic rights against starvation, predation, and disease, but squirrels and bears have no rights. In section three I argue that some animals qualify for protectorate status, which would establish various protections for different animals, but would also generally prohibit cruelty towards animals.

  14. The barriers to and enablers of providing reasonably adjusted health services to people with intellectual disabilities in acute hospitals: evidence from a mixed-methods study.

    Science.gov (United States)

    Tuffrey-Wijne, Irene; Goulding, Lucy; Giatras, Nikoletta; Abraham, Elisabeth; Gillard, Steve; White, Sarah; Edwards, Christine; Hollins, Sheila

    2014-04-16

    To identify the factors that promote and compromise the implementation of reasonably adjusted healthcare services for patients with intellectual disabilities in acute National Health Service (NHS) hospitals. A mixed-methods study involving interviews, questionnaires and participant observation (July 2011-March 2013). Six acute NHS hospital trusts in England. Reasonable adjustments for people with intellectual disabilities were identified through the literature. Data were collected on implementation and staff understanding of these adjustments. Data collected included staff questionnaires (n=990), staff interviews (n=68), interviews with adults with intellectual disabilities (n=33), questionnaires (n=88) and interviews (n=37) with carers of patients with intellectual disabilities, and expert panel discussions (n=42). Hospital strategies that supported implementation of reasonable adjustments did not reliably translate into consistent provision of such adjustments. Good practice often depended on the knowledge, understanding and flexibility of individual staff and teams, leading to the delivery of reasonable adjustments being haphazard throughout the organisation. Major barriers included: lack of effective systems for identifying and flagging patients with intellectual disabilities, lack of staff understanding of the reasonable adjustments that may be needed, lack of clear lines of responsibility and accountability for implementing reasonable adjustments, and lack of allocation of additional funding and resources. Key enablers were the Intellectual Disability Liaison Nurse and the ward manager. The evidence suggests that ward culture, staff attitudes and staff knowledge are crucial in ensuring that hospital services are accessible to vulnerable patients. The authors suggest that flagging the need for specific reasonable adjustments, rather than the vulnerable condition itself, may address some of the barriers. Further research is recommended that describes and

  15. Features of formation of competitive advantages: a strategic dimension

    OpenAIRE

    O.Р. Pashchenko

    2015-01-01

    The article examines the features of formation of competitive advantages, the depth of theoretical and methodological basis for the formation of competitive advantages at an enterprise. The author has reviewed the approaches to the formation of stable and long-term competitive advantages. The author has also overviewed the requirements which are to be met by competitive advantages of a company and the factors that affect the possibility of competitive advantages. The author develops her ow...

  16. Competitive advantage on a warming planet.

    Science.gov (United States)

    Lash, Jonathan; Wellington, Fred

    2007-03-01

    Whether you're in a traditional smokestack industry or a "clean" business like investment banking, your company will increasingly feel the effects of climate change. Even people skeptical about global warming's dangers are recognizing that, simply because so many others are concerned, the phenomenon has wide-ranging implications. Investors already are discounting share prices of companies poorly positioned to compete in a warming world. Many businesses face higher raw material and energy costs as more and more governments enact policies placing a cost on emissions. Consumers are taking into account a company's environmental record when making purchasing decisions. There's also a burgeoning market in greenhouse gas emission allowances (the carbon market), with annual trading in these assets valued at tens of billions of dollars. Companies that manage and mitigate their exposure to the risks associated with climate change while seeking new opportunities for profit will generate a competitive advantage over rivals in a carbon-constrained future. This article offers a systematic approach to mapping and responding to climate change risks. According to Jonathan Lash and Fred Wellington of the World Resources Institute, an environmental think tank, the risks can be divided into six categories: regulatory (policies such as new emissions standards), products and technology (the development and marketing of climate-friendly products and services), litigation (lawsuits alleging environmental harm), reputational (how a company's environmental policies affect its brand), supply chain (potentially higher raw material and energy costs), and physical (such as an increase in the incidence of hurricanes). The authors propose a four-step process for responding to climate change risk: Quantify your company's carbon footprint; identify the risks and opportunities you face; adapt your business in response; and do it better than your competitors.

  17. Papers of BIOCAP Canada Foundation's 1. national conference : capturing Canada's green advantage

    International Nuclear Information System (INIS)

    2005-02-01

    This conference provided a forum for the exchange of perspectives on energy options and greenhouse gas (GHG) offsets. It showcased emerging knowledge from Canadian biosphere GHG management research. The goal of the conference was to provide new options geared towards utilizing the biosphere, to review current knowledge and identify areas for further research in the provision of policy and industry-relevant solutions. Issues concerning agriculture, forestry and bioenergy were reviewed with reference to long-term cumulative socio-economic advantages. Sustainable development and the economic impacts surrounding current environmental policies were discussed. Carbon management, sequestration and carbon credit programs were reviewed, with reference to economic and implementation challenges. Environmental management challenges and future directions of biomass development, sustainable forest management and new research on bioenergy were presented. Methods of improving efficiency and reducing emissions via the use of biofuels were reviewed. Eighty papers were presented at this conference, 13 of which have been catalogued separately for inclusion in this database

  18. Knowledge in Value Creation Process for Increasing Competitive Advantage

    Directory of Open Access Journals (Sweden)

    Anna ZÁVODSKÁ

    2012-12-01

    Full Text Available The aim of this paper is to compare companies by using value creation model and to determine knowledge in these processes. The framework for the value creation process shows problems of case companies in different phases of this process. Knowledge is compared in each of the individual phases of the process and its role in different types of companies. There is identified role of knowledge for increasing competitive advantage. The methodology involves case study from which data are derived and analyzed. The analysis shows that the framework for the value creation process can be used as an analytical tool for value overview in different phases and there is a need for different approaches to improve business and create new value for customers. Based on the analyzed problems, proposed recommendations for improvement are made. These recommendations are based on providing value innovation for customers (end users of software product. Value innovation of software product is considered as crucial for improvement of the companies in machinery industry. Company A has created new value through remote service. This remote service provides several advantages. Customers can prevent problems in machines by implementing software product which is still analyzing and evaluating data from machines. Company B and C were not able to create major value innovation for several years.

  19. Knowledge in Value Creation Process for Increasing Competitive Advantage

    Directory of Open Access Journals (Sweden)

    Veronika ŠRAMOVÁ

    2013-07-01

    Full Text Available The aim of this paper is to compare companies by using value creation model and to determine knowledge in these processes. The framework for the value creation process shows problems of case companies in different phases of this process. Knowledge is compared in each of the individual phases of the process and its role in different types of companies. There is identified role of knowledge for increasing competitive advantage. The methodology involves case study from which data are derived and analyzed. The analysis shows that the framework for the value creation process can be used as an analytical tool for value overview in different phases and there is a need for different approaches to improve business and create new value for customers. Based on the analyzed problems, proposed recommendations for improvement are made. These recommendations are based on providing value innovation for customers (end users of software product. Value innovation of software product is considered as crucial for improvement of the companies in machinery industry. Company A has created new value through remote service. This remote service provides several advantages. Customers can prevent problems in machines by implementing software product which is still analyzing and evaluating data from machines. Company B and C were not able to create major value innovation for several years.

  20. Coping with divided attention: the advantage of familiarity.

    Science.gov (United States)

    Griffiths, S W; Brockmark, S; Höjesjö, J; Johnsson, J I

    2004-04-07

    The ability of an animal to perform a task successfully is limited by the amount of attention being simultaneously focused on other activities. One way in which individuals might reduce the cost of divided attention is by preferentially focusing on the most beneficial tasks. In territorial animals where aggression is lower among familiar individuals, the decision to associate preferentially with familiar conspecifics may therefore confer advantages by allowing attention to be switched from aggression to predator vigilance and feeding. Wild juvenile brown trout were used to test the prediction that familiar fishes respond more quickly than unfamiliar fishes to a simulated predator attack. Our results confirm this prediction by demonstrating that familiar trout respond 14% faster than unfamiliar individuals to a predator attack. The results also show that familiar fishes consume a greater number of food items, foraging at more than twice the rate of unfamiliar conspecifics. To the best of our knowledge, these results provide the first evidence that familiarity-biased association confers advantages through the immediate fitness benefits afforded by faster predator-evasion responses and the long-term benefits provided by increased feeding opportunities.

  1. The Science Advantage of a Redder Filter for WFIRST

    Science.gov (United States)

    Bauer, James; Stauffer, John; Milam, Stefanie N.; Holler, Bryan J.

    2018-01-01

    WFIRST will be capable of providing Hubble-quality imaging performance over several thousand square degrees of the sky. The wide-area, high spatial resolution survey data from WFIRST will be unsurpassed for probably many decades into the future. With the current baseline design, the WFIRST filter complement will extend from the bluest wavelength allowed by the optical design to a reddest filter (F184W) that has a red cutoff at 2.0 microns. Extension of the imaging capabilities even slightly beyond the 2.0 micron wavelength cut-off would provide significant advantages over the presently proposed science for objects both near and far. The inclusion of a Ks (2.0-2.3 micron) filter would result in a wider range and more comprehensive set of Solar System investigations. It would also extend the range of higher-redshift population studies. In this poster, we outline some of the science advantages for adding a K filter, similar in bandpass to the 2MASS Ks filter, in order to extend the wavelength range for WFIRST as far to the red as the thermal performance of the spacecraft allows.

  2. Clinical advantages of single port laparoscopic hepatectomy.

    Science.gov (United States)

    Han, Jae Hyun; You, Young Kyoung; Choi, Ho Joong; Hong, Tae Ho; Kim, Dong Goo

    2018-01-21

    To evaluate the clinical advantages of single-port laparoscopic hepatectomy (SPLH) compare to multi-port laparoscopic hepatectomy (MPLH). We retrospectively reviewed the medical records of 246 patients who underwent laparoscopic liver resection between January 2008 and December 2015 at our hospital. We divided the surgical technique into two groups; SPLH and MPLH. We performed laparoscopic liver resection for both benign and malignant disease. Major hepatectomy such as right and left hepatectomy was also done with sufficient disease-free margin. The operative time, the volume of blood loss, transfusion rate, and the conversion rate to MPLH or open surgery was evaluated. The post-operative parameters included the meal start date after operation, the number of postoperative days spent in the hospital, and surgical complications was also evaluated. Of the 246 patients, 155 patients underwent SPLH and 91 patients underwent MPLH. Conversion rate was 22.6% in SPLH and 19.8% in MPLH ( P = 0.358). We performed major hepatectomy, which was defined as resection of more than 2 sections, in 13.5% of patients in the SPLH group and in 13.3% of patients in the MPLH group ( P = 0.962). Mean operative time was 136.9 ± 89.2 min in the SPLH group and 231.2 ± 149.7 min in the MPLH group ( P started earlier in the SPLH group (1.06 ± 0.27 d after operation) than in the MPLH group (1.63 ± 1.27 d) ( P < 0.001). The mean hospital stay after operation was non-significantly shorter in the SPLH group than in the MPLH group (7.82 ± 2.79 d vs 7.97 ± 3.69 d, P = 0.744). The complication rate was not significantly different ( P = 0.397) and there was no major perioperative complication or mortality case in both groups. Single-port laparoscopic liver surgery seems to be a feasible approach for various kinds of liver diseases.

  3. E3 Success Story - Whirlpool Trains Staff on Lean and Green Advantage

    Science.gov (United States)

    Whirlpool Corporation invited Green Suppliers Network representatives to its Monterrey facility to provide training on the Lean and Green Advantage. The project sought to expand E3 initiatives to every part of the company's operations.

  4. IT OUTSOURCING: METHODOLOGY FOR SUPPLIER SELECTION CRITERIA FOR COMPETITIVE ADVANTAGE

    Directory of Open Access Journals (Sweden)

    Sergio Alexandre Simões

    2012-04-01

    Full Text Available Abstract: Two criteria are usually adopted to select the provider of IT: lower prices or better service qualification of the supplier. This article proposes a strategic approach: the company should hire the provider that best leverage their competitive advantages. This approach implied the need to develop a methodology. To support it, the authors analyzed four models, Porter, RBV (Resource-Based View, Balanced Scorecard and the Weapons and Field Competition. Preferred the latter to be the most complete, qualiquantitative technique and able to accurately align the goals of the IT service firm's to competitive contracting strategy. The methodology was developed and applied to an insurance company and in face of the excellent results, decided to write this article to disclose it.

  5. Developing people: a strategy for competitive advantage.

    Science.gov (United States)

    King, S

    1995-05-01

    This article will provide vital insights, acquired in a recent study with eight manufacturing companies, to guide the development of a human resource development strategy. This study was a pilot for a larger study, planned for the fall of 1995 with 50 manufacturing companies randomly chosen from the Directory of Massachusetts High Technology Companies.

  6. The Advantages of Single-Sex Education

    Science.gov (United States)

    Hughes, Teresa A.

    2006-01-01

    Traditionally, single-sex education has been provided in the form of private schooling. Title IX regulations have loosened as a result of the No Child Left Behind Legislation; therefore, public school districts now have the legal right to create single-sex classes or single-sex schools if they deem it to be in the best interest of their students.…

  7. Advantages of enteral nutrition over parenteral nutrition

    OpenAIRE

    Seres, David S.; Valcarcel, Monika; Guillaume, Alexandra

    2013-01-01

    It is a strong and commonly held belief among nutrition clinicians that enteral nutrition is preferable to parenteral nutrition. We provide a narrative review of more recent studies and technical reviews comparing enteral nutrition with parenteral nutrition. Despite significant weaknesses in the existing data, current literature continues to support the use of enteral nutrition in patients requiring nutrition support, over parenteral nutrition.

  8. The Pursuit of Sustainable Competitive Advantage : A Profile of the Starbucks Corporation

    OpenAIRE

    White, Benjamin; Moraschinelli, Ettore

    2009-01-01

    Title: The Pursuit of Sustainable Competitive Advantage – A Profile of the Starbucks Corporation Authors: Benjamin Adam White & Ettore Moraschinelli Advisor: Jean-Charles Languilaire Date: 2009 May 29 Program: International Business and Entrepreneurship Purpose: To study sustainable competitive advantages using Starbucks as a case study. Methods: The qualitative method was utilized to collect the secondary data used in this type of thesis, being a case study. This approach applied to both...

  9. Transnational nursing programs: models, advantages and challenges.

    Science.gov (United States)

    Wilson, Michael

    2002-07-01

    Conducting transnational programs can be a very rewarding activity for a School, Faculty or University. Apart from increasing the profile of the university, the conduct of transnational programs can also provide the university with openings for business opportunities, consultative activities, and collaborative research. It can also be a costly exercise placing an enormous strain on limited resources with little reward for the provider. Transnational ventures can become nonviable entities in a very short period of time due to unanticipated global economic trends. Transnational courses offered by Faculties of Business and Computing are commonplace, however, there is a growing number of health science programs, particularly nursing that are being offered transnational. This paper plans an overview of several models employed for the delivery of transnational nursing courses and discusses several key issues pertaining to conducting courses outside the host university's country.

  10. COMPETITIVE ADVANTAGES IN A NANOTECHNOLOGY VALUE CHAIN

    OpenAIRE

    Adriana Radan UNGUREANU

    2015-01-01

    The value chain analysis is one of the most important methods for understanding the industrial world. The main task of the value chain that links producers and buyers consists in understanding where or how exactly the value added is generated. In the case of products incorporating nanotechnology, most of them are still in the trial phase into laboratories, but there are some examples of good practices where nanoproducts discovered their way to the market. This paper tries to present two cases...

  11. Entrepreneurial Advantages and Disadvantages of Belonging

    OpenAIRE

    Egbert, Henrik

    1998-01-01

    The article analyzes the influence of religious network structures on entrepreneurial success. Members of the religious community of the Bohras in Tanga, Tanzania are contrasted with entrepreneurs of other ethnic origins. It is shown that the religious network provides, through a loan scheme, the opportunities to start and run a business successfully. In this respect, the importance of the Islamic business ethic is underlined. Finally, the macro-economic effects of the network are outlined.

  12. A photon spectrometric dose-rate constant determination for the Advantage Pd-103 brachytherapy source

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Zhe Jay; Bongiorni, Paul; Nath, Ravinder [Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, Connecticut 06520 (United States)

    2010-02-15

    Purpose: Although several dosimetric characterizations using Monte Carlo simulation and thermoluminescent dosimetry (TLD) have been reported for the new Advantage Pd-103 source (IsoAid, LLC, Port Richey, FL), no AAPM consensus value has been established for the dosimetric parameters of the source. The aim of this work was to perform an additional dose-rate constant ({Lambda}) determination using a recently established photon spectrometry technique (PST) that is independent of the published TLD and Monte Carlo techniques. Methods: Three Model IAPD-103A Advantage Pd-103 sources were used in this study. The relative photon energy spectrum emitted by each source along the transverse axis was measured using a high-resolution germanium spectrometer designed for low-energy photons. For each source, the dose-rate constant was determined from its emitted energy spectrum. The PST-determined dose-rate constant ({sub PST}{Lambda}) was then compared to those determined by TLD ({sub TLD}{Lambda}) and Monte Carlo ({sub MC}{Lambda}) techniques. A likely consensus {Lambda} value was estimated as the arithmetic mean of the average {Lambda} values determined by each of three different techniques. Results: The average {sub PST}{Lambda} value for the three Advantage sources was found to be (0.676{+-}0.026) cGyh{sup -1} U{sup -1}. Intersource variation in {sub PST}{Lambda} was less than 0.01%. The {sub PST}{Lambda} was within 2% of the reported {sub MC}{Lambda} values determined by PTRAN, EGSnrc, and MCNP5 codes. It was 3.4% lower than the reported {sub TLD}{Lambda}. A likely consensus {Lambda} value was estimated to be (0.688{+-}0.026) cGyh{sup -1} U{sup -1}, similar to the AAPM consensus values recommended currently for the Theragenics (Buford, GA) Model 200 (0.686{+-}0.033) cGyh{sup -1} U{sup -1}, the NASI (Chatsworth, CA) Model MED3633 (0.688{+-}0.033) cGyh{sup -1} U{sup -1}, and the Best Medical (Springfield, VA) Model 2335 (0.685{+-}0.033) cGyh{sup -1} U{sup -1} {sup 103}Pd

  13. A photon spectrometric dose-rate constant determination for the Advantage Pd-103 brachytherapy source

    International Nuclear Information System (INIS)

    Chen, Zhe Jay; Bongiorni, Paul; Nath, Ravinder

    2010-01-01

    Purpose: Although several dosimetric characterizations using Monte Carlo simulation and thermoluminescent dosimetry (TLD) have been reported for the new Advantage Pd-103 source (IsoAid, LLC, Port Richey, FL), no AAPM consensus value has been established for the dosimetric parameters of the source. The aim of this work was to perform an additional dose-rate constant (Λ) determination using a recently established photon spectrometry technique (PST) that is independent of the published TLD and Monte Carlo techniques. Methods: Three Model IAPD-103A Advantage Pd-103 sources were used in this study. The relative photon energy spectrum emitted by each source along the transverse axis was measured using a high-resolution germanium spectrometer designed for low-energy photons. For each source, the dose-rate constant was determined from its emitted energy spectrum. The PST-determined dose-rate constant ( PST Λ) was then compared to those determined by TLD ( TLD Λ) and Monte Carlo ( MC Λ) techniques. A likely consensus Λ value was estimated as the arithmetic mean of the average Λ values determined by each of three different techniques. Results: The average PST Λ value for the three Advantage sources was found to be (0.676±0.026) cGyh -1 U -1 . Intersource variation in PST Λ was less than 0.01%. The PST Λ was within 2% of the reported MC Λ values determined by PTRAN, EGSnrc, and MCNP5 codes. It was 3.4% lower than the reported TLD Λ. A likely consensus Λ value was estimated to be (0.688±0.026) cGyh -1 U -1 , similar to the AAPM consensus values recommended currently for the Theragenics (Buford, GA) Model 200 (0.686±0.033) cGyh -1 U -1 , the NASI (Chatsworth, CA) Model MED3633 (0.688±0.033) cGyh -1 U -1 , and the Best Medical (Springfield, VA) Model 2335 (0.685±0.033) cGyh -1 U -1 103 Pd sources. Conclusions: An independent Λ determination has been performed for the Advantage Pd-103 source. The PST Λ obtained in this work provides additional information

  14. FORMATION OF COMPETITIVE ADVANTAGES OF ENTERPRISES IN TERMS OF GLOBALIZATION: COMPETITIVE DYNAMICS AND AN INTELLECTUAL COMPONENT

    Directory of Open Access Journals (Sweden)

    Oleg Tarasenko

    2017-12-01

    Full Text Available The purpose of the article is to investigate the current state of scientific thought in relation to the formation of intellectual capital of an enterprise in the innovation process, achievement by the enterprise of corresponding competitive advantages and their protection. Methodology. The methodological basis of the article is the systematic approach, which provided a comprehensive definition of the scope of this research – intellectual property and its protection as a complex economic and legal category. This made it possible to systematically define the purpose, level of abstraction, hierarchy, forms of manifestation, and key attributes of the subject of research. Application of principles of modelling of business processes also allowed studying the influence of factors of the external environment on the sequence of information flows in the process of forming competitive advantages on the basis of intellectual property. In addition, having determined the scientific basis, the collective and local monographic studies of leading scientists concerning the specificity of the formation of competitive advantages of innovative enterprises, including on the basis of intellectual capital, were also taken into account. Results. The article studies, describes and, correspondingly, formalizes modern processes of formation of competitive advantages in the conditions of Smart Economy: knowledge management, their patenting, modern significance, and the influence of patenting on the role of intellectual property in the investigated phenomena, as well as management of relevant information flows. Practical implications. The research demonstrates ways of forming competitive advantages in the modern economy, and the results of the analysis of relevant statistics explain patterns of economic and legal processes in the field of relevant practical activities. This allows assessing the actual state of the subject of the research, determining the development

  15. Changing Patterns of Publication Productivity: Accumulative Advantage or Institutional Isomorphism?

    Science.gov (United States)

    Dey, Eric L.; Milem, Jeffrey F.; Berger, Joseph B.

    1997-01-01

    Investigates two competing perspectives, accumulated advantage and institutional isomorphism, on the relationship between publication productivity and institutional hierarchy. Accumulated advantage refers to the continuing attraction of students, faculty, and research dollars to prestige universities. Institutional isomorphism denotes the tendency…

  16. Islamic Banking in Nigeria: Perception of its Relative Advantage by ...

    African Journals Online (AJOL)

    Islamic Banking in Nigeria: Perception of its Relative Advantage by Consumer Segments in Anambra State. ... perceived relative advantage of Islamic banking concept by those consumer groups in. Awka ... AJOL African Journals Online.

  17. Advantages of 18F FDG-PET/CT over Conventional Staging for Sarcoma Patients.

    Science.gov (United States)

    Németh, Zsuzsanna; Boér, Katalin; Borbély, Katalin

    2017-10-09

    The effective management of patients with sarcomas requires accurate diagnosis and staging. Imaging, such as ultrasonography (US), computed tomography (CT), magnetic resonance imaging (MRI) are the most freqently used methods for the detection of the lesion location, size, morphology and structural changes to adjacent tissues; however, these modalities provide little information about tumour biology. MRI is a robust and useful modality in tumour staging of sarcomas, however metabolic-fluorodeoxyglucose positron emission tomography/ computer tomography ( 18 F-FDG PET/CT) provides greater accuracy to overall staging in combination with MRI [1]. The advantages of 18 F-FDG PET/CT method compared with CT and MRI is that it provides a whole body imaging, maps the viability of the tumour or the metabolic activity of the tissue. Additionally, PET detects the most agressive part of the tumour, demonstrates the biological behaviour of the tumour and therefore has a predictive value. Little data ara available on the role of 18 F-FDG PET/CT in the management of sarcomas. The present manuscript aims to provide a review of the major indications of 18 F-FDG PET/CT for diagnosis, staging, restaging and monitoring response to therapy and to compare its usefulness with the conventional imaging modalities in the management of patients with sarcomas.

  18. Urging medical students to publish: Advantages, disadvantages and new challenges.

    Science.gov (United States)

    Rached, Gaëlle; Hobeika, Charbel; Karam, Elias; Kourié, Hampig Raphael; Kattan, Joseph

    2018-06-01

    As soon as they get accepted into medical school, students find themselves facing numerous expectations: coping with tremendous study burden, competing with others for the best rank, completing internships and participating in the race for publishing are only to name a few. This big juggle makes it hard for the medical student to focus on research. It is often easier to postpone publication and involvement in research to "later". In fact there are many advantages to publishing in the current publication system but there are many disadvantages as well. With the widespread of social media and open access systems, new challenges have arisen. The aim of this paper is to discuss the advantages and disadvantages of publishing in the current system while highlighting the new challenges that the students might need to overcome. Its aim is to provide medical students with information to enhance their understanding of the current publication system and thus most importantly, probe their desire to publish. Copyright © 2018 Société Française du Cancer. Published by Elsevier Masson SAS. All rights reserved.

  19. Ecological advantages of partial migration as a conditional strategy.

    Science.gov (United States)

    Vélez-Espino, Luis A; McLaughlin, Robert L; Robillard, Melissa

    2013-05-01

    Partial migration is a widespread phenomenon characterized by migrant and resident forms from the same population. In phenotypically plastic taxa with indeterminate growth, resident and migrant ecophenotypes can differ in size and life history traits in ways expected to maximize fitness in the different habitats they exploit. Studies of partial migration in different taxa have advocated either density-dependence or environmental stochasticity as explanations for partial migration. We used a demographic approach for a virtual Brook Trout population to demonstrate the ecological consequences of partial migration under interacting density dependence and environmental stochasticity. The maintenance of partial migration as a conditional strategy in species/populations where resident and migrant forms exhibit life history asymmetries provides ecological advantages. We show that density-dependent migration is expected to increase population fitness under constant environmental conditions or low environmental variation, but decreases population fitness under high environmental variation. These conditions favor intermediate levels of migration as an advantageous tactic. However, there are threshold rates of return migration below which partial migration is no longer a viable tactic. Our modeling approach also allowed the exploration of the distribution of the population by life stage and habitat in response to the strength of density dependence, costs of migration, and return rates, and demonstrated the importance of the conservation of ecophenotypes in partially migratory populations. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. The introvert advantage how to thrive in an extrovert world

    CERN Document Server

    Laney, Marti Olsen

    2002-01-01

    At least one out of four people prefers to avoid the limelight, tends to listen more than they speak, feels alone in large groups, and requires lots of private time to restore their energy. They're introverts, and here is the book to help them boost their confidence while learning strategies for successfully living in an extrovert world. After dispelling common myths about introverts-they're not necessarily shy, aloof, or antisocial--The Introvert Advantage explains the real issues. Introverts are hardwired from birth to focus inward, so outside stimulation-chitchat, phone calls, parties, office meetings-can easily become "too much." The Introvert Advantage dispels introverts' belief that something is wrong with them and instead helps them recognize their inner strengths-their analytical skills, ability to think outside the box, and strong powers of concentration. It helps readers understand introversion and shows them how to determine where they fall on the introvert/extrovert continuum. It provides tools ...