WorldWideScience

Sample records for mercury resistance operon

  1. Evidence of mercury trapping in biofilm-EPS and mer operon-based volatilization of inorganic mercury in a marine bacterium Bacillus cereus BW-201B.

    Dash, Hirak R; Basu, Subham; Das, Surajit

    2017-04-01

    Biofilm-forming mercury-resistant marine bacterium Bacillus cereus BW-201B has been explored to evident that the bacterial biofilm-EPS (exopolymers) trap inorganic mercury but subsequently release EPS-bound mercury for induction of mer operon-mediated volatilization of inorganic mercury. The isolate was able to tolerate 50 ppm of mercury and forms biofilm in presence of mercury. mer operon-mediated volatilization was confirmed, and -SH was found to be the key functional group of bacterial EPS responsible for mercury binding. Biofilm-EPS-bound mercury was found to be internalized to the bacterial system as confirmed by reversible conformational change of -SH group and increased expression level of merA gene in a timescale experiment. Biofilm-EPS trapped Hg after 24 h of incubation, and by 96 h, the volatilization process reaches to its optimum confirming the internalization of EPS-bound mercury to the bacterial cells. Biofilm disintegration at the same time corroborates the results.

  2. Biomolecular Mechanisms of Mercury Transfers and Transformations by Proteins of the Mer Operon

    Miller, S. M.; Hong, B.; Nauss, R.; Momany, C.; Summers, A. O.; Feng, X.; Harwood, I.; Stroud, R.

    2008-12-01

    Aerobic bacteria exhibiting resistance to the toxic effects of Hg(II) and organomercurials [RHg(I), e.g. MeHg(I)] and are widely found in both pristine and mercury contaminated environments. Resistance, afforded by a plasmid- or transposon-associated mer operon, involves an unusual pathway where Hg(II) and organomercurials [RHg(I)] undergo facilitated entry into the bacterial cytoplasm via an integral membrane transport protein (MerT) and are then "detoxified" by the concerted effort of two enzymes, organomercurial lyase (MerB), which catalyzes dealkylation (i.e., demethylation) of RHg(I) to Hg(II) and a hydrocarbon, and mercuric ion reductase (MerA), which catalyzes reduction of Hg(II) to Hg(0) as the ultimate detoxification for the organism. With a widespread distribution, these bacterial transformations play a significant role in the fate of mercury in the environment. Our focus is on elucidation of the molecular mechanisms for the transport and catalytic transformations of RHg(I) and Hg(II) by these proteins and the factors that influence the overall efficiency of the process. Current efforts are focused primarily on elucidating details of RHg(I) binding and dealkylation by MerB as well as the mechanism for transfer of the Hg(II) product to MerA. Key findings include the demonstration of a non-cysteine residue as essential for the catalytic activity and demonstration that direct transfer of Hg(II) to MerA proceeds more rapidly and more completely than transfer to small MW thiols such as cysteines or glutathione. Reuslts of these studies as well as an overview of our current understanding of the whole system will be presented.

  3. A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

    Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

    2014-01-01

    The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

  4. Molecular mechanisms of plasmid-determined mercury and cadmium resistances in bacteria

    Nucifora, G.

    1989-01-01

    The structural basis for induction of the broad spectrum mercurial resistance operon of pDU1358 with inorganic mercury and with phenylmercury acetate was addressed by DNA sequencing analysis (that showed that a major difference occurred in the 3' 29 base pairs of the ital merR gene compared to the merR genes of Tn501 and R100) and by lac-fusion transcription experiments regulated by merR in trans. The lac-fusion results were compared with those from a narrow spectrum operon, and the pDU1358 merR deleted at the 3' end. A hybrid mer operon containing the merR gene from pDU1358 and lacking the merB gene was inducible by both phenylmercury and inorganic Hg 2+ , showing that organomercurial lyase is not needed for induction by organomercurials. A mutant form of pDU1358 merR missing the C-terminal 17 amino acids responded to inorganic Hg 2+ but not to phenylmercury, indicating that the C-terminal region of the MerR protein of the pDU1358 mer operon is required for the recognition of phenylmercury acetate. The down regulation of the mer operon by the merD gene was also measured in trans with complementing mer operons of pDU1358 or R100 or merD - mutants. In the presence of the merD gene, beta-galactosidase activity was lowered by 2 to 4 fold. The merD gene gene product was visualized by autoradiography. The Cd 2+ resistance determinant cadA of S. aureus was investigated. The nucleotide sequence of the DNA fragment containing the cadA determinant revealed two open reading frames the larger one of which is essential for expression of cadmium resistance

  5. vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

    Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

    2014-01-01

    We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

  6. Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.

    Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D

    2015-01-01

    Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

  7. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

  8. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

    Cataldi Angel A

    2011-07-01

    Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

  9. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted

  10. The role of the Staphylococcal VraTSR regulatory system on vancomycin resistance and vanA operon expression in vancomycin-resistant Staphylococcus aureus.

    Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan

    2014-01-01

    Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory

  11. Isolation, screening and identification of mercury resistant bacteria from mercury contaminated soil

    Kowalczyk Anna; Wilińska Magdalena; Chyc Marek; Bojko Monika; Latowski Dariusz

    2016-01-01

    New bacterial strains resistant to high concentration of mercury were obtained and character iz ed focusing on their potential application in bioremediation. The biological material was isolated from soil contaminated with mercury. The ability to removal of Hg from the liquid medium and the effect of the various pH and mercury concentrations in the environment on bacterial strains growth kinetics were tested. The selected strains were identified by analysis of the 16S ribosome subunit coding ...

  12. Aerobic Mercury-resistant bacteria alter Mercury speciation and retention in the Tagus Estuary (Portugal).

    Figueiredo, Neusa L; Canário, João; O'Driscoll, Nelson J; Duarte, Aida; Carvalho, Cristina

    2016-02-01

    Aerobic mercury-resistant bacteria were isolated from the sediments of two highly mercury-polluted areas of the Tagus Estuary (Barreiro and Cala do Norte) and one natural reserve area (Alcochete) in order to test their capacity to transform mercury. Bacterial species were identified using 16S rRNA amplification and sequencing techniques and the results indicate the prevalence of Bacillus sp. Resistance patterns to mercurial compounds were established by the determination of minimal inhibitory concentrations. Representative Hg-resistant bacteria were further tested for transformation pathways (reduction, volatilization and methylation) in cultures containing mercury chloride. Bacterial Hg-methylation was carried out by Vibrio fluvialis, Bacillus megaterium and Serratia marcescens that transformed 2-8% of total mercury into methylmercury in 48h. In addition, most of the HgR bacterial isolates showed Hg(2+)-reduction andHg(0)-volatilization resulting 6-50% mercury loss from the culture media. In summary, the results obtained under controlled laboratory conditions indicate that aerobic Hg-resistant bacteria from the Tagus Estuary significantly affect both the methylation and reduction of mercury and may have a dual face by providing a pathway for pollution dispersion while forming methylmercury, which is highly toxic for living organisms. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Characterization of a marine-isolated mercury-resistant Pseudomonas putida strain SP1 and its potential application in marine mercury reduction

    Zhang, Weiwei; Chen, Lingxin; Liu, Dongyan [Chinese Academy of Sciences, Yantai, SD (China). Yantai Inst. of Coastal Zone Research (YICCAS); Chinese Academy of Sciences, Yantai, SD (China). Shandong Provincial Key Lab. of Coastal Zone Environmental Processes

    2012-02-15

    The Pseudomonas putida strain SP1 was isolated from marine environment and was found to be resistant to 280 {mu}M HgCl{sub 2}. SP1 was also highly resistant to other metals, including CdCl{sub 2}, CoCl{sub 2}, CrCl{sub 3}, CuCl{sub 2}, PbCl{sub 2}, and ZnSO{sub 4}, and the antibiotics ampicillin (Ap), kanamycin (Kn), chloramphenicol (Cm), and tetracycline (Tc). mer operon, possessed by most mercury-resistant bacteria, and other diverse types of resistant determinants were all located on the bacterial chromosome. Cold vapor atomic absorption spectrometry and a volatilization test indicated that the isolated P. putida SP1 was able to volatilize almost 100% of the total mercury it was exposed to and could potentially be used for bioremediation in marine environments. The optimal pH for the growth of P. putida SP1 in the presence of HgCl{sub 2} and the removal of HgCl{sub 2} by P. putida SP1 was between 8.0 and 9.0, whereas the optimal pH for the expression of merA, the mercuric reductase enzyme in mer operon that reduces reactive Hg{sup 2+} to volatile and relatively inert monoatomic Hg{sup 0} vapor, was around 5.0. LD50 of P. putida SP1 to flounder and turbot was 1.5 x 10{sup 9} CFU. Biofilm developed by P. putida SP1 was 1- to 3-fold lower than biofilm developed by an aquatic pathogen Pseudomonas fluorescens TSS. The results of this study indicate that P. putida SP1 is a low virulence strain that can potentially be applied in the bioremediation of HgCl{sub 2} contamination over a broad range of pH. (orig.)

  14. Class IIa bacteriocin resistance in Enterococcus faecalis V583: The mannose PTS operon mediates global transcriptional responses

    Opsata Mona

    2010-08-01

    Full Text Available Abstract Background The class IIa bacteriocin, pediocin PA-1, has clear potential as food preservative and in the medical field to be used against Gram negative pathogen species as Enterococcus faecalis and Listeria monocytogenes. Resistance towards class IIa bacteriocins appear in laboratory and characterization of these phenotypes is important for their application. To gain insight into bacteriocin resistance we studied mutants of E. faecalis V583 resistant to pediocin PA-1 by use of transcriptomic analyses. Results Mutants of E. faecalis V583 resistant to pediocin PA-1 were isolated, and their gene expression profiles were analyzed and compared to the wild type using whole-genome microarray. Significantly altered transcription was detected from about 200 genes; most of them encoding proteins involved in energy metabolism and transport. Glycolytic genes were down-regulated in the mutants, but most of the genes showing differential expression were up-regulated. The data indicate that the mutants were relieved from glucose repression and putative catabolic responsive elements (cre could be identified in the upstream regions of 70% of the differentially expressed genes. Bacteriocin resistance was caused by reduced expression of the mpt operon encoding the mannose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS, and the same transcriptional changes were seen in a mptD-inactivated mutant. This mutant also had decreased transcription of the whole mpt operon, showing that the PTS is involved in its own transcriptional regulation. Conclusion Our data confirm the important role of mannose PTS in class IIa bacteriocin sensitivity and we demonstrate its importance involving global carbon catabolite control.

  15. High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon

    Berendsen, Erwin M; Koning, Rosella A; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P; Wells-Bennik, Marjon H J

    2016-01-01

    Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA(2mob), present on a Tn1546

  16. High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon

    Berendsen, Erwin M.; Koning, Rosella A.; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P.; Wells-Bennik, Marjon H. J.

    2016-01-01

    Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA2mob, present on a Tn1546 transposon in Bacillus subtilis, leads to profoundly increased wet heat resistance of B. subtilis spores. Such Tn1546 transposon elements including the spoVA2mob operon were also found in several strains of Bacillus amyloliquefaciens and Bacillus licheniformis, and these strains were shown to produce spores with significantly higher resistances to wet heat than their counterparts lacking this transposon. In this study, the locations and compositions of Tn1546 transposons encompassing the spoVA2mob operons in B. amyloliquefaciens and B. licheniformis were analyzed. Introduction of these spoVA2mob operons into B. subtilis 168 (producing spores that are not highly heat resistant) rendered mutant 168 strains that produced high-level heat resistant spores, demonstrating that these elements in B. amyloliquefaciens and B. licheniformis are responsible for high level heat resistance of spores. Assessment of growth of the nine strains of each species between 5.2°C and 57.7°C showed some differences between strains, especially at lower temperatures, but all strains were able to grow at 57.7°C. Strains of B. amyloliquefaciens and B. licheniformis that contain the Tn1546 elements (and produce high-level heat resistant spores) grew at temperatures similar to those of their Tn1546-negative counterparts that produce low-level heat resistant spores. The findings presented in this study allow for detection of B. amyloliquefaciens and B. licheniformis strains that produce highly heat resistant spores in the food chain. PMID:27994575

  17. Unusual rise in mercury-resistant bacteria in coastal environs

    Ramaiah, N.; De, J.

    A sharp rise in mercury-resistant bacteria (MRB) capable of tolerating very high concentration of Hg was observed over the last 3-4 years in the coastal environs of India. While none or negligible colony-forming units (CFU) of bacteria were counted...

  18. Mercury

    Vilas, F.; Chapman, C.R.; Matthews, M.S.

    1988-01-01

    Papers are presented on future observations of and missions to Mercury, the photometry and polarimetry of Mercury, the surface composition of Mercury from reflectance spectrophotometry, the Goldstone radar observations of Mercury, the radar observations of Mercury, the stratigraphy and geologic history of Mercury, the geomorphology of impact craters on Mercury, and the cratering record on Mercury and the origin of impacting objects. Consideration is also given to the tectonics of Mercury, the tectonic history of Mercury, Mercury's thermal history and the generation of its magnetic field, the rotational dynamics of Mercury and the state of its core, Mercury's magnetic field and interior, the magnetosphere of Mercury, and the Mercury atmosphere. Other papers are on the present bounds on the bulk composition of Mercury and the implications for planetary formation processes, the building stones of the planets, the origin and composition of Mercury, the formation of Mercury from planetesimals, and theoretical considerations on the strange density of Mercury

  19. Isolation, screening and identification of mercury resistant bacteria from mercury contaminated soil

    Kowalczyk Anna

    2016-01-01

    Full Text Available New bacterial strains resistant to high concentration of mercury were obtained and character iz ed focusing on their potential application in bioremediation. The biological material was isolated from soil contaminated with mercury. The ability to removal of Hg from the liquid medium and the effect of the various pH and mercury concentrations in the environment on bacterial strains growth kinetics were tested. The selected strains were identified by analysis of the 16S ribosome subunit coding sequenc es as Pseudomonas syringae. The analysis of Hg concentration in liquid medium as effect of microbial metabolism demonstrated that P. syringae is able to remove almost entire metal from medium after 120 hours of incubation. Obtained results revealed new ability of the isolated strain P. syringae. Analyzed properties of this soil bacteria species able to reduce concentration of Hg ors immobi lize this metal are promising for industrial wastewater treatment and bioremediation of the soils polluted especially by mercury lamps scrapping, measuring instruments, dry batteries, detonators or burning fuels made from crude oil, which may also contain mercury. Selected bacteria strains provide efficient and relatively low-cost bioremediation of the areas and waters contaminated with Hg.

  20. The effect of aqueous speciation and cellular ligand binding on the biotransformation and bioavailability of methylmercury in mercury-resistant bacteria.

    Ndu, Udonna; Barkay, Tamar; Schartup, Amina Traore; Mason, Robert P; Reinfelder, John R

    2016-02-01

    Mercury resistant bacteria play a critical role in mercury biogeochemical cycling in that they convert methylmercury (MeHg) and inorganic mercury to elemental mercury, Hg(0). To date there are very few studies on the effects of speciation and bioavailability of MeHg in these organisms, and even fewer studies on the role that binding to cellular ligands plays on MeHg uptake. The objective of this study was to investigate the effects of thiol complexation on the uptake of MeHg by measuring the intracellular demethylation-reduction (transformation) of MeHg to Hg(0) in Hg-resistant bacteria. Short-term intracellular transformation of MeHg was quantified by monitoring the loss of volatile Hg(0) generated during incubations of bacteria containing the complete mer operon (including genes from putative mercury transporters) exposed to MeHg in minimal media compared to negative controls with non-mer or heat-killed cells. The results indicate that the complexes MeHgOH, MeHg-cysteine, and MeHg-glutathione are all bioavailable in these bacteria, and without the mer operon there is very little biological degradation of MeHg. In both Pseudomonas stutzeri and Escherichia coli, there was a pool of MeHg that was not transformed to elemental Hg(0), which was likely rendered unavailable to Mer enzymes by non-specific binding to cellular ligands. Since the rates of MeHg accumulation and transformation varied more between the two species of bacteria examined than among MeHg complexes, microbial bioavailability, and therefore microbial demethylation, of MeHg in aquatic systems likely depends more on the species of microorganism than on the types and relative concentrations of thiols or other MeHg ligands present.

  1. Identification of an operon involved in fluoride resistance in Enterobacter cloacae FRM

    Liu, Xiaoqing; Tian, Jian; Liu, Lihui; Zhu, Tao; Yu, Xiaoxia; Chu, Xiaoyu; Yao, Bin; Wu, Ningfeng; Fan, Yunliu

    2017-01-01

    Fluorine is ubiquitous and the most active non-metal element in nature. While many microorganisms have developed fluoride resistance as a result of the widespread and prolonged application of oral hygiene products, the mechanisms used by these organisms to overcome fluoride toxicity are incompletely understood. In this study, a fluoride-resistant strain, Enterobacter cloacae FRM, was identified which could grow well at a fluoride concentration of 4,000?mg/L. According to comparative genomics,...

  2. Tolerance to various toxicants by marine bacteria highly resistant to mercury

    De, J.; Ramaiah, N.; Mesquita, A.; Verlecar, X.N.

    of growth in media containing 5 ppm mercury. Plasmid-curing assays done in this study ascertained that resistance to mercury antibiotics, and toxic xenobiotics is mediated by chromosomally borne genes and/or transposable elements rather than by plasmids...

  3. Construction of a modular arsenic resistance operon in E. coli and the production of arsenic nanoparticles

    Matthew Charles Edmundson

    2015-10-01

    Full Text Available Arsenic is a widespread contaminant of both land and water around the world. Current methods of decontamination such as phytoremediation and chemical adsorbents can be resource and time intensive, and may not be suitable for some areas such as remote communities where cost and transportation are major issues. Bacterial decontamination, with strict controls preventing environmental release, may offer a cost-effective alternative or provide a financial incentive when used in combination with other remediation techniques. In this study we have produced E. coli strains containing arsenic resistance genes from a number of sources, overexpressing them and testing their effects on arsenic resistance. While the lab E. coli strain JM109 (the wild-type is resistant up to 20 mM sodium arsenate the strain containing our plasmid pEC20 is resistant up to 80 mM. When combined with our construct pArsRBCC arsenic-containing nanoparticles were observed at the cell surface; the elements of pEC20 and pArsRBCC were therefore combined in a modular construct, pArs, in order to evaluate the roles and synergistic effects of the components of the original plasmids in arsenic resistance and nanoparticle formation. We also investigated the use of introducing the lac operator in order to more tightly control expression from pArs. We demonstrate that our strains are able to reduce toxic forms of arsenic into stable, insoluble metallic As(0, providing one way to remove arsenate contamination, and which may also be of benefit for other heavy metals.

  4. Functional characterization of a cadmium resistance operon in Staphylococcus aureus ATCC12600: CadC does not function as a repressor.

    Hoogewerf, Arlene J; Dyk, Lisa A Van; Buit, Tyler S; Roukema, David; Resseguie, Emily; Plaisier, Christina; Le, Nga; Heeringa, Lee; Griend, Douglas A Vander

    2015-02-01

    Sequencing of a cadmium resistance operon from a Staphylococcus aureus ATCC12600 plasmid revealed that it is identical to a cadCA operon found in MRSA strains. Compared to plasmid-cured and cadC-mutant strains, cadC-positive ATCC12600 cells had increased resistance to cadmium (1 mg ml(-1) cadmium sulfate) and zinc (4 mg ml(-1) zinc sulfate), but not to other metal ions. After growth in media containing 20 µg ml(-1) cadmium sulfate, cadC-mutant cells contained more intracellular cadmium than cadC-positive ATCC12600 cells, suggesting that cadC absence results in impaired cadmium efflux. Electrophoretic mobility shift assays were performed with CadC proteins encoded by the S. aureus ATCC12600 plasmid and by the cadC gene of pI258, which is known to act as a transcriptional repressor and shares only 47% protein sequence identity with ATCC12600 CadC. Mobility shifts occurred when pI258 CadC protein was incubated with the promoter DNA-regions from the pI258 and S. aureus ATCC12600 cadCA operons, but did not occur with S. aureus ATCC12600 CadC protein, indicating that the ATCC12600 CadC protein does not interact with promoter region DNA. This cadCA operon, found in MRSA strains and previously functionally uncharacterized, increases resistance to cadmium and zinc by an efflux mechanism, and CadC does not function as a transcriptional repressor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Isolation and characterization of chromium, mercury and cadmium resistant bacteria

    Bhatti, K.P.; Noor, A.R.

    2009-01-01

    Ten heavy metal resistant strains were isolated from samples of soil, water and rhizosphere of plant Cynadon Dectylon of Kasur sector. Among these bacteria, four strains Cr-l, Cr- 2, Cr-3 and Cr-4 were showed the resistant to chromium up to 300 mg/L, two strains Cd-1 and Cd-2 resisted cadmium up to 100 mg/L, two strains Cd-3 and Cd-4 resisted cadmium up to 50 mg/L and two strains (Hg-l, Hg-2) were observed resistant to mercury up to 100 mg/L. Their morphological and colonial characteristics were investigated. The families of isolated bacteria are reported i.e. Azotobacteriaceae(C r-l), Enterobacteriacea(eC r-2, Cr-3, Cr-4, Hg-2) and Neisseriaceae(Cd-I, Cd-2, Cd-3, Cd-4, Hg-2). (author)

  6. Mercury resistance and mercuric reductase activities and expression among chemotrophic thermophilic Aquificae.

    Freedman, Zachary; Zhu, Chengsheng; Barkay, Tamar

    2012-09-01

    Mercury (Hg) resistance (mer) by the reduction of mercuric to elemental Hg is broadly distributed among the Bacteria and Archaea and plays an important role in Hg detoxification and biogeochemical cycling. MerA is the protein subunit of the homodimeric mercuric reductase (MR) enzyme, the central function of the mer system. MerA sequences in the phylum Aquificae form the deepest-branching lineage in Bayesian phylogenetic reconstructions of all known MerA homologs. We therefore hypothesized that the merA homologs in two thermophilic Aquificae, Hydrogenobaculum sp. strain Y04AAS1 (AAS1) and Hydrogenivirga sp. strain 128-5-R1-1 (R1-1), specified Hg resistance. Results supported this hypothesis, because strains AAS1 and R1-1 (i) were resistant to >10 μM Hg(II), (ii) transformed Hg(II) to Hg(0) during cellular growth, and (iii) possessed Hg-dependent NAD(P)H oxidation activities in crude cell extracts that were optimal at temperatures corresponding with the strains' optimal growth temperatures, 55°C for AAS1 and 70°C for R1-1. While these characteristics all conformed with the mer system paradigm, expression of the Aquificae mer operons was not induced by exposure to Hg(II) as indicated by unity ratios of merA transcripts, normalized to gyrA transcripts for hydrogen-grown AAS1 cultures, and by similar MR specific activities in thiosulfate-grown cultures with and without Hg(II). The Hg(II)-independent expression of mer in the deepest-branching lineage of MerA from bacteria whose natural habitats are Hg-rich geothermal environments suggests that regulated expression of mer was a later innovation likely in environments where microorganisms were intermittently exposed to toxic concentrations of Hg.

  7. Isolation of Mercury-Resistant Fungi from Mercury-Contaminated Agricultural Soil

    Reginawanti Hindersah

    2018-02-01

    Full Text Available Illegal gold mining and the resulting gold mine tailing ponds on Buru Island in Maluku, Indonesia have increased Mercury (Hg levels in agricultural soil and caused massive environmental damage. High levels of Hg in soil lowers plant productivity and threatens the equilibrium of the food web. One possible method of handling Hg-contaminated soils is through bioremediation, which could eliminate Hg from the rhizosphere (root zone. In this study, indigenous fungi isolated from Hg-contaminated soil exhibited Hg-resistance in vitro. Soil samples were collected from the rhizosphere of pioneer plants which grew naturally in areas contaminated with gold mine tailing. The fungi’s capacity for Hg-resistance was confirmed by their better growth in chloramphenicol-boosted potato dextrose agar media which contained various HgCl2 concentrations. Four isolates exhibited resistance of up to 25 mg kg−1 of Hg, and in an experiment with young Chinese cabbage (Brassica rapa L. test plants, two fungi species (including Aspergillus were demonstrated to increase the soil’s availability of Hg. The results suggest that Hg-resistant indigenous fungi can mobilize mercury in the soil and serve as potential bioremediation agents for contaminated agricultural land.

  8. Association of methionine requirement with methyl mercury resistant mutants of yeast

    Singh, A.; Sherman, F.

    1974-01-25

    It has been known for several years that strains resistant to mercury can be obtained in several bacterial species. Soon after the correlation between resistance to antibiotics and to mercury was recognized, it was established that genetic elements conferring resistance to antibiotics, mercury and other heavy metals in Escherichia coli and Samonella typhimurium and Staphylococcus aureus reside on extrachromosomal resistance transfer factors or plasmids. Among fungi, mercury resistant strains of Botrytis cinerea, Penicillium notatum, Sclerotinia fructicola, Stemphylium sarcinaeforme, and Saccharomyces cerevisiae have been reported. In most cases, this was accomplished by training the normal strains for growth on media supplemented with successively increasing concentrations of mercury compounds, and in some cases the resistance was lost when subcultured on mercury-free media. It is noteworthy that in none of the mercury-adapted strains of fungi has the genetic basis of resistance been determined. In this report we describe a method of isolation and characterization of methyl mercury resistant mutants of S. cerevisiae. This study was undertaken with the view that the examination of physiological changes associated with genetically defined resistant mutants will be useful in studying the mechanisms of cellular detoxification of organic mercurials.

  9. Modeling Mercury in Proteins

    Smith, Jeremy C [ORNL; Parks, Jerry M [ORNL

    2016-01-01

    Mercury (Hg) is a naturally occurring element that is released into the biosphere both by natural processes and anthropogenic activities. Although its reduced, elemental form Hg(0) is relatively non-toxic, other forms such as Hg2+ and, in particular, its methylated form, methylmercury, are toxic, with deleterious effects on both ecosystems and humans. Microorganisms play important roles in the transformation of mercury in the environment. Inorganic Hg2+ can be methylated by certain bacteria and archaea to form methylmercury. Conversely, bacteria also demethylate methylmercury and reduce Hg2+ to relatively inert Hg(0). Transformations and toxicity occur as a result of mercury interacting with various proteins. Clearly, then, understanding the toxic effects of mercury and its cycling in the environment requires characterization of these interactions. Computational approaches are ideally suited to studies of mercury in proteins because they can provide a detailed picture and circumvent issues associated with toxicity. Here we describe computational methods for investigating and characterizing how mercury binds to proteins, how inter- and intra-protein transfer of mercury is orchestrated in biological systems, and how chemical reactions in proteins transform the metal. We describe quantum chemical analyses of aqueous Hg(II), which reveal critical factors that determine ligand binding propensities. We then provide a perspective on how we used chemical reasoning to discover how microorganisms methylate mercury. We also highlight our combined computational and experimental studies of the proteins and enzymes of the mer operon, a suite of genes that confers mercury resistance in many bacteria. Lastly, we place work on mercury in proteins in the context of what is needed for a comprehensive multi-scale model of environmental mercury cycling.

  10. Mercury

    Mercury is an element that is found in air, water and soil. It has several forms. Metallic mercury is a shiny, silver-white, odorless liquid. If ... with other elements to form powders or crystals. Mercury is in many products. Metallic mercury is used ...

  11. Characterization of marine bacteria highly resistant to mercury exhibiting multiple resistances to toxic chemicals

    De, J.; Ramaiah, N.

    , GP15 and GP16) and one Pseudomonas aeruginosa (CH07) which showed comparatively higher resistance to toxic heavy metals and xenobiotics and were used in more detailed experiments. Antibiotic sensitivity of all three isolates after plasmid curing... using Nucleospin Plasmid isolation kit (Macherey Nagel, Germany) and agarose gel electrophoresis. To further confirm the presence/absence of plasmid, two different plasmid curing assays were performed to note the loss, if any, of mercury resistance...

  12. Mercury and antibiotic resistance in Enterobacteriaceae: an experimental study on pigs

    Laub-Kupersztejn, R; Thomas, J; Pohl, P

    1974-01-01

    Tests on faeces from 5 different groups of pigs, showed that 47.2% of the coliforms present were resistant to mercury ions. None of the 3127 bacteria examined were resistant to cadmium ions. The resistance of these strains to mercury was mainly associated with resistance to one or more antibiotics (98%). Feeding the animals with ampicillin (20 ppm) led to modification of the Escherichia coli in the alimentary tract, with ampicillin and mercury resistant strains emerging in great number. These resistance characters could be wholly, or partially, transferred to a sensitive strain of E. coli, thus suggesting that they were mediated by R-factors. The existence of a plasmid resistant only to mercury ions was demonstrated. 9 references, 4 tables.

  13. Mercury resistant bacteria from effluents of paint factory : characterisation and mercury uptake ability

    Yasmin, A.; Afrasayab, S.; Hasnain, S.

    1998-01-01

    Twelve Hg-resistant strains [SHg-13,SHg-14, SHg-15, SHg-16, SHg-17, SHg-18, SHg-19, SHg-20, SHg-21, SHg-22, SHg-23, SHg-24] were isolated from the polluted water sample taken from the outlets of ICI paint factory. They could tolerate 350-500 mu g ml/sup -1/ of HgCl/sub 2/ in the solid medium and 25-125 mu g mg/sup -1/ of HgCl/sub 2/ in the liquid medium. All strains had off-white, convex [except SHg-20 which had orange flat colonies] and circular colonies. SHg-13, SHg-15 and SHg-17 were Gram variable rods, while rest of strains had Gram -ve rods. They were strictly aerobic bacteria except SHg-16, SHg-18, SHg-22 and SHg-24 which were facilitative anaerobes. On the basis of morphological and biochemical characters strains SHg-13, Shg-14, SHg-15, SHg-17, SHg-19, SHg-20, SHg-21, SHg-23 were affiliated with family Pseudomonadaceae, whereas strains SHg-16, SHg-18, SHg-22 and SHg-24 could be grouped with family Vibranoaceae. All strains could grow in pH range from 6-9 with different optimum, SHg-14 and SHg-16 yielded maximum growth at 28 deg. C while SHg-17, SHg-18, SHg-20, SHg-22 and SHg-23 showed optimum growth at 32 deg. C, whereas rest of the strains yielded maximum growth at 37 deg. C. They conferred resistance to ampicillin and chloramphenicol, but were sensitive to streptomycin [except SHg-20, SHg-23], kanamycin [except SHg-24] and tetracycline [excluding SHg-13, SHg-18]. These isolates could tolerate a number of other metallic salts. Excluding Shg-19 all strains harbor single plasmid. These strains had the ability to uptake/transform mercury. Maximum mercury uptake was observed by SHg-14 and SHg-15. (author)

  14. Mercury

    de Vries, Irma

    2017-01-01

    Mercury is a naturally occurring metal that exists in several physical and chemical forms. Inorganic mercury refers to compounds formed after the combining of mercury with elements such as chlorine, sulfur, or oxygen. After combining with carbon by covalent linkage, the compounds formed are called

  15. PSYCHROPHILIC PSEUDOMONAS SP. RESISTANT TO MERCURY FROM PAVLODAR, KAZAKHSTAN

    As mercury circulates and deposits globally, the remediation of extensive mercury contamination surrounding a chloralkali plant in Pavlodar, Kazakhstan is critical. High-levels of mercury contamination exist within the confines of the plant, at nearby off-site waste storage and e...

  16. Molecular characterization of mercury resistant bacteria inhabiting polluted water bodies of different geographical locations in India

    Jan, A.T.; Azam, M.; Ali, A.; Haq, Q.M.

    2012-01-01

    Mercury pollution is a major environmental problem that arises as a result of natural processes as well as from anthropogenic sources. In response to toxic mercury compounds, microbes have developed astonishing array of resistance systems to detoxify them. To address this challenge, this study was

  17. Detoxification of toxic heavy metals by marine bacteria highly resistant to mercury

    De; Ramaiah, N.; Vardanyan, L.

    Pollution in industrial areas is a serious environmental concern, and interest in bacterial resistance to heavy metals is of practical significance. Mercury (Hg), Cadmium (Cd), and lead (Pb) are known to cause damage to living organisms, including...

  18. OCCURRENCE OF MICROORGANISMS RESISTANT TO MERCURY IN MERCURY CONTAMINATED SOILS AND SEDIMENTS IN PAVLODAR, KAZAKHSTAN

    There is extensive mercury contamination of soil surrounding a chloralkali plant in Pavlodar, Kazakhstan that operated from 1970 to 1990. High-level mercury contamination exists within the confines of the plant, at nearby off-site waste storage and evaporation ponds, and in Balky...

  19. OCCURRENCE OF MERCURY-RESISTANT MICROORGANISMS IN MERCURY-CONTAMINATED SOILS AND SEDIMENTS IN PAVLODAR, KAZAKHSTAN

    There is extensive mercury contamination of soil surrounding a chloralkali plant in Pavlodar, Kazakhstan that operated from 1970 to 1990. High-level mercury contamination exists within the confines of the plant, at nearby off-site waste storage and evaporation ponds, and in Balky...

  20. THE BEHAVIOR OF MICROORGANISMS RESISTANT TO MERCURY FROM PAVLODAR, KAZAKHSTAN

    There is extensive mercury contamination surrounding a chloralkali plant in Pavlodar, Kazakhstan that operated from 1970 to 1990. High-level mercury contamination exists within the confines of the plant, at nearby off-site waste storage and evaporation ponds, in Balkyldak Lake w...

  1. Mercury

    ... that mercuric chloride and methylmercury are possible human carcinogens. top How does mercury affect children? Very young ... billion parts of drinking water (2 ppb). The Food and Drug Administration (FDA) has set a maximum ...

  2. The Cut-off Value of Blood Mercury Concentration in Relation to Insulin Resistance

    Seok-Hoon Lee

    2017-09-01

    Full Text Available Background : Increased blood mercury concentration is associated with inflammation, and chronic inflammation can cause insulin resistance. We examined the cut-off value of blood mercury in relation to an increased score on the homeostasis model assessment for insulin resistance (HOMA-IR. Methods : We used data from the Korean National Health and Nutrition Examination Survey (2008–2010. Relevant data from 5,184 subjects (2,523 men and 2,661 women were analyzed cross-sectionally. General linear analysis was performed to evaluate the relationship between HOMA-IR score and blood mercury concentration. In addition, we determined the cut-off value of blood mercury concentration in relation to increased HOMA-IR score (> 2.34 using an ROC curve. Results : The mean value of blood mercury concentration in men and women was 5.88 μg/L and 4.11 μg/L, respectively. In men, comparing to the first quartile, HOMA-IR score increased significantly in the third and fourth blood mercury quartiles. In women, however, the increase in HOMA-IR score was not significant. The cut-off value that best represented the association between increased HOMA-IR score and blood mercury concentration in men was found to be 4.71 μg/L. Conclusion : Blood mercury concentration was associated with increased HOMA-IR score in men, and the cut-off value of blood mercury concentration that was correlated with increased HOMA-IR score was around 4.71 μg/L.

  3. Mercury

    Mahoney, T J

    2014-01-01

    This gazetteer and atlas on Mercury lists, defines and illustrates every named (as opposed to merely catalogued) object and term as related to Mercury within a single reference work. It contains a glossary of terminology used, an index of all the headwords in the gazetteer, an atlas comprising maps and images with coordinate grids and labels identifying features listed in the gazetteer, and appendix material on the IAU nomenclature system and the transcription systems used for non-roman alphabets. This book is useful for the general reader, writers and editors dealing with astronomical themes, and those astronomers concerned with any aspect of astronomical nomenclature.

  4. Mercury

    Balogh, André; Steiger, Rudolf

    2008-01-01

    Mercury, the planet closest to the Sun, is different in several respects from the other three terrestrial planets. In appearance, it resembles the heavily cratered surface of the Moon, but its density is high, it has a magnetic field and magnetosphere, but no atmosphere or ionosphere. This book reviews the progress made in Mercury studies since the flybys by Mariner 10 in 1974-75, based on the continued research using the Mariner 10 archive, on observations from Earth, and on increasingly realistic models of its interior evolution.

  5. Agmatine deiminase pathway genes in Lactobacillus brevis are linked to the tyrosine decarboxylation operon in a putative acid resistance locus

    Lucas, Patrick M.; Blancato, Victor S.; Claisse, Olivier; Magni, Christian; Lolkema, Juke S.; Lonvaud-Funel, Aline

    In lactic acid bacteria (LAB), amino acids and their derivatives may be converted into amine-containing compounds designated biogenic amines, in pathways providing metabolic energy and/ or acid resistance to the bacteria. In a previous study, a pathway converting tyrosine to tyramine was detected in

  6. Identification and molecular analysis of mercury resistant bacteria in ...

    Mercury (Hg) is one of the most important toxic pollutants widespread in the environment. It is being extensively used in industrial applications (chlor-alkali electrolysis, fungicides, disinfectants, dental products, etc), resulting in local hot spots of pollution and serious effects on biota and humans. The aim of this study was to ...

  7. SEVERAL MECHANISMS OF MERCURY RESISTANCE FOUND IN SOIL ISOLATES FROM PAVLODAR, KAZAKHSTAN

    Abdrashitova, Svetlava A., M.A. Ilyushchenko, A. Yu Kalmykv, S.A. Aitkeldieva, Wendy J. Davis-Hoover and Richard Devereux. In press. Several Mechanisms of Mercury Resistance Found in Soil Isolates from Pavlodar, Kazakhstan (Abstract). To be presented at the Battelle Conference on...

  8. Stochastic simulations of the tetracycline operon

    Kaznessis Yiannis N

    2011-01-01

    Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

  9. Stochastic simulations of the tetracycline operon

    2011-01-01

    Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

  10. Multidrug-Resistant CTX-M-(15, 9, 2)- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance).

    Andrade, Leonardo N; Siqueira, Thiago E S; Martinez, Roberto; Darini, Ana Lucia C

    2018-01-01

    Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes ( sil operon: silE, silS, silR, silC, silF, silB, silA , and silP ) and acquired extended-spectrum cephalosporin and carbapenem resistance genes ( bla CTX-M and bla KPC ) in Enterobacter cloacae Complex (EcC) ( n = 27) and Enterobacter aerogenes ( n = 8) isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump) and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump), arsB (arsenite-efflux pump), terF (tellurite resistance protein), and merA (mercuric reductase) were also investigated. Outstandingly, 21/27 (78%) EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA -positive EcC isolates. Interestingly, 8/20 (40%) E. hormaechei and 5/6 (83%) E. asburiae co-harbored silA/pcoD genes and bla CTX-M-(15,2,or9) and/or bla KPC-2 genes. Frequent occurrences of arsB, terF , and merA genes were detected, especially in silA/pcoD -positive, multidrug-resistant (MDR) and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

  11. Multidrug-Resistant CTX-M-(15, 9, 2- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance

    Leonardo N. Andrade

    2018-03-01

    Full Text Available Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes (sil operon: silE, silS, silR, silC, silF, silB, silA, and silP and acquired extended-spectrum cephalosporin and carbapenem resistance genes (blaCTX−M and blaKPC in Enterobacter cloacae Complex (EcC (n = 27 and Enterobacter aerogenes (n = 8 isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump, arsB (arsenite-efflux pump, terF (tellurite resistance protein, and merA (mercuric reductase were also investigated. Outstandingly, 21/27 (78% EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA-positive EcC isolates. Interestingly, 8/20 (40% E. hormaechei and 5/6 (83% E. asburiae co-harbored silA/pcoD genes and blaCTX−M−(15,2,or9 and/or blaKPC−2 genes. Frequent occurrences of arsB, terF, and merA genes were detected, especially in silA/pcoD-positive, multidrug-resistant (MDR and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

  12. Spectroscopy of Cu(II)-PcoC and the multicopper oxidase function of PcoA, two essential components of Escherichia coli pco copper resistance operon.

    Huffman, David L; Huyett, Jennifer; Outten, F Wayne; Doan, Peter E; Finney, Lydia A; Hoffman, Brian M; O'Halloran, Thomas V

    2002-08-06

    The plasmid-encoded pco copper resistance operon in Escherichia coli consists of seven genes that are expressed from two pco promoters in response to elevated copper; however, little is known about how they mediate resistance to excess environmental copper. Two of the genes encode the soluble periplasmic proteins PcoA and PcoC. We show here that inactivation of PcoC, and PcoA to a lesser extent, causes cells to become more sensitive to copper than wild-type nonresistant strains, consistent with a tightly coupled detoxification pathway. Periplasmic extracts show copper-inducible oxidase activity, attributed to the multicopper oxidase function of PcoA. PcoC, a much smaller protein than PcoA, binds one Cu(II) and exhibits a weak electronic transition characteristic of a type II copper center. ENDOR and ESEEM spectroscopy of Cu(II)-PcoC and the (15)N- and Met-CD(3)-labeled samples are consistent with a tetragonal ligand environment of three nitrogens and one aqua ligand "in the plane". A weakly associated S-Met and aqua are likely axial ligands. At least one N is a histidine and is likely trans to the in-plane aqua ligand. The copper chemistry of PcoC and the oxidase function of PcoA are consistent with the emerging picture of the chromosomally encoded copper homeostasis apparatus in the E. coli cell envelope [Outten, F. W., Huffman, D. L., Hale, J. A., and O'Halloran, T. V. (2001) J. Biol. Chem. 276, 30670-30677]. We propose a model for the plasmid system in which Cu(I)-PcoC functions in this copper efflux pathway as a periplasmic copper binding protein that docks with the multiple repeats of Met-rich domains in PcoA to effect oxidation of Cu(I) to the less toxic Cu(II) form. The solvent accessibility of the Cu(II) in PcoC may allow for metal transfer to other plasmid and chromosomal factors and thus facilitate removal of Cu(II) from the cell envelope.

  13. Bilateral Comparison of Mercury and Gallium Fixed-Point Cells Using Standard Platinum Resistance Thermometer

    Bojkovski, J.; Veliki, T.; Zvizdić, D.; Drnovšek, J.

    2011-08-01

    The objective of project EURAMET 1127 (Bilateral comparison of triple point of mercury and melting point of gallium) in the field of thermometry is to compare realization of a triple point of mercury (-38.8344 °C) and melting point of gallium (29.7646 °C) between the Slovenian national laboratory MIRS/UL-FE/LMK and the Croatian national laboratory HMI/FSB-LPM using a long-stem 25 Ω standard platinum resistance thermometer (SPRT). MIRS/UL/FE-LMK participated in a number of intercomparisons on the level of EURAMET. On the other hand, the HMI/LPM-FSB laboratory recently acquired new fixed-point cells which had to be evaluated in the process of intercomparisons. A quartz-sheathed SPRT has been selected and calibrated at HMI/LPM-FSB at the triple point of mercury, the melting point of gallium, and the water triple point. A second set of measurements was made at MIRS/UL/FE-LMK. After its return, the SPRT was again recalibrated at HMI/LPM-FSB. In the comparison, the W value of the SPRT has been used. Results of the bilateral intercomparison confirmed that the new gallium cell of the HMI/LPM-FSB has a value that is within uncertainty limits of both laboratories that participated in the exercise, while the mercury cell experienced problems. After further research, a small leakage in the mercury fixed-point cell has been found.

  14. Sheet resistance effects in mercury cadmium telluride implanted photodiodes

    Fiorito, G.; Gasparrini, G.; Svelto, F.

    1977-01-01

    The frequency response of Hg + implanted Hgsub(1-x)Cdsub(x)Te photodiodes is discussed. This analysis, evaluating both the response to fast laser pulses and the 3 dB rolloff of the diode shot-noise spectrum, showed the necessity of adopting a distributed equivalent circuit model taking into account the implanted layer sheet resistance. Frequency behaviour, in fact, proved not to match a simple p-n junction model based on a lumped standard equivalent circuit. On this basis apparent anomalies previously reported can be explained, and useful suggestions can be obtained for design and fabrication of fast detectors. (author)

  15. Diversity and characterization of mercury-resistant bacteria in snow, freshwater and sea-ice brine from the High Arctic

    Møller, Annette; Barkay, Tamar; Abu Al-Soud, Waleed

    2011-01-01

    It is well-established that atmospheric deposition transports mercury from lower latitudes to the Arctic. The role of bacteria in the dynamics of the deposited mercury, however, is unknown. We characterized mercury-resistant bacteria from High Arctic snow, freshwater and sea-ice brine. Bacterial...... densities were 9.4 × 10(5), 5 × 10(5) and 0.9-3.1 × 10(3) cells mL(-1) in freshwater, brine and snow, respectively. Highest cultivability was observed in snow (11.9%), followed by freshwater (0.3%) and brine (0.03%). In snow, the mercury-resistant bacteria accounted for up to 31% of the culturable bacteria, but...

  16. Final Report - Molecular Mechanisms of Bacterial Mercury Transformation - UCSF

    Miller, Susan M. [UCSF

    2014-04-24

    The bacterial mercury resistance (mer) operon functions in Hg biogeochemistry and bioremediation by converting reactive inorganic Hg(II) and organic [RHg(II)]1+ mercurials to relatively inert monoatomic mercury vapor, Hg(0). Its genes regulate operon expression (MerR, MerD, MerOP), import Hg(II) (MerT, MerP, and MerC), and demethylate (MerB) and reduce (MerA) mercurials. We focus on how these components interact with each other and with the host cell to allow cells to survive and detoxify Hg compounds. Understanding how this ubiquitous detoxification system fits into the biology and ecology of its bacterial host is essential to guide interventions that support and enhance Hg remediation. In the current overall project we focused on two aspects of this system: (1) investigations of the energetics of Hg(II)-ligand binding interactions, and (2) both experimental and computational approaches to investigating the molecular mechanisms of Hg(II) acquisition by MerA and intramolecular transfer of Hg(II) prior to reduction within the MerA enzyme active site. Computational work was led by Prof. Jeremy Smith and took place at the University of Tennessee, while experimental work on MerA was led by Prof. Susan Miller and took place at the University of California San Francisco.

  17. Diversity and characterization of mercury-resistant bacteria in snow, freshwater and sea-ice brine from the High Arctic.

    Møller, Annette K; Barkay, Tamar; Abu Al-Soud, Waleed; Sørensen, Søren J; Skov, Henrik; Kroer, Niels

    2011-03-01

    It is well-established that atmospheric deposition transports mercury from lower latitudes to the Arctic. The role of bacteria in the dynamics of the deposited mercury, however, is unknown. We characterized mercury-resistant bacteria from High Arctic snow, freshwater and sea-ice brine. Bacterial densities were 9.4 × 10(5), 5 × 10(5) and 0.9-3.1 × 10(3) cells mL(-1) in freshwater, brine and snow, respectively. Highest cultivability was observed in snow (11.9%), followed by freshwater (0.3%) and brine (0.03%). In snow, the mercury-resistant bacteria accounted for up to 31% of the culturable bacteria, but levels of most isolates were not temperature dependent. Of the resistant isolates, 25% reduced Hg(II) to Hg(0). No relation between resistance level, ability to reduce Hg(II) and phylogenetic group was observed. An estimation of the potential bacterial reduction of Hg(II) in snow suggested that it was important in the deeper snow layers where light attenuation inhibited photoreduction. Thus, by reducing Hg(II) to Hg(0), mercury-resistant bacteria may limit the supply of substrate for methylation processes and, hence, contribute to lowering the risk that methylmercury is being incorporated into the Arctic food chains. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  18. Isolation and Cloning of mercuric reductase gene (merA from mercury-resistant bacteria

    Parisa Khoshniyat

    2018-03-01

    Full Text Available Introduction: Some of the bacteria having merA gene coding mineral mercury reducing enzyme, has genetic potential of Hg removing via reduction of mineral mercury and transformation of that to gas form and finally bioremediation of polluted area. The aim of this study is the isolation of merA gene from resistance bacteria and cloning of that into suitable expression vector and then the environmental bioremediation by the transformation of bacteria with this vector. Materials and methods: A number of bacteria were collected in contaminated areas with mercury in order to isolate merA genes. Polymerase chain reaction had done on the four bacterial genomes including Klebsiella pneumoniae, Pseudomonas aeruginosa, Serratia marcescens and Escherichia coli using the specific primers in order to detect merA gene. For cloning, the primers containing restriction enzyme sites are used, merA gene was isolated and amplified. The amplified fragments were cloned in the expression vector pET21a+ and via heat shock method were transformed into E. coli TOP10 competent cell. For clustering of genes, Mega software version 4 was used and bioanformatic studies were achieved for predicted enzyme. Results: merA gene with 1686 bp in length was isolated from K pneumoniae and E. coli. Recombinant vectors in transgenic bacteria were confirmed by various methods and finally were confirmed by sequencing. The result of clustering these genes with existence genes in NCBI showed high similarity. Discussion and conclusion: The existence of merA gene in bacteria that adapted to Hg pollution area is because of resistance, so with cloning this gene into suitable expression vector and transformation of susceptible bacteria with this vector ability of resistance to Hg in bacteria for bioremediation could be given.

  19. The fruRBA Operon Is Necessary for Group A Streptococcal Growth in Fructose and for Resistance to Neutrophil Killing during Growth in Whole Human Blood

    Valdes, Kayla M.; Sundar, Ganesh S.; Vega, Luis A.; Belew, Ashton T.; Islam, Emrul; Binet, Rachel; El-Sayed, Najib M.

    2016-01-01

    Bacterial pathogens rely on the availability of nutrients for survival in the host environment. The phosphoenolpyruvate-phosphotransferase system (PTS) is a global regulatory network connecting sugar uptake with signal transduction. Since the fructose PTS has been shown to impact virulence in several streptococci, including the human pathogen Streptococcus pyogenes (the group A Streptococcus [GAS]), we characterized its role in carbon metabolism and pathogenesis in the M1T1 strain 5448. Growth in fructose as a sole carbon source resulted in 103 genes affected transcriptionally, where the fru locus (fruRBA) was the most induced. Reverse transcriptase PCR showed that fruRBA formed an operon which was repressed by FruR in the absence of fructose, in addition to being under carbon catabolic repression. Growth assays and carbon utilization profiles revealed that although the entire fru operon was required for growth in fructose, FruA was the main transporter for fructose and also was involved in the utilization of three additional PTS sugars: cellobiose, mannitol, and N-acetyl-d-galactosamine. The inactivation of sloR, a fruA homolog that also was upregulated in the presence of fructose, failed to reveal a role as a secondary fructose transporter. Whereas the ability of both ΔfruR and ΔfruB mutants to survive in the presence of whole human blood or neutrophils was impaired, the phenotype was not reproduced in murine whole blood, and those mutants were not attenuated in a mouse intraperitoneal infection. Since the ΔfruA mutant exhibited no phenotype in the human or mouse assays, we propose that FruR and FruB are important for GAS survival in a human-specific environment. PMID:26787724

  20. Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358

    Griffin, H.G.; Foster, T.J.; Silver, S.; Misra, T.K.

    1987-01-01

    The broad-spectrum mercurial-resistance plasmid pDU1358 was analyzed by cloning the resistance determinants and preparing a physical and genetic map of a 45-kilobase (kb) region of the plasmid that contains two separate mercurial-resistance operons that mapped about 20 kb apart. One encoded narrow-spectrum mercurial resistance to Hg 2+ and a few organomercurials; the other specified broad-spectrum resistance to phenylmercury and additional organomercurials. Each determinant governed mercurial transport functions. Southern DNA x DNA hybridization experiments using gene-specific probes from the plasmid R100 mer operon indicated close homology with the R100 deteminant. The 2153 base pairs of the promoter-distal part of the broad-spectrum Hg 2+ -resistance operon of pDU1358 were sequenced. This region included the 3'-terminal part of the merA gene, merD, unidentified reading frame URF1, and a part of URF2 homologous to previously sequenced determinants of plasmid R100. Between the merA and merD genes, an open reading frame encoding a 212 amino acid polypeptide was identified as the merB gene that determines the enzyme organomercurial lyase that cleaves the C-Hg bond of phenylmercury

  1. Influence of Heat Treatment on Mercury Cavitation Resistance of Surface Hardened 316LN Stainless Steel

    Pawel, Steven J [ORNL; Hsu, Julia [Massachusetts Institute of Technology (MIT)

    2010-11-01

    The cavitation-erosion resistance of carburized 316LN stainless steel was significantly degraded but not destroyed by heat treatment in the temperature range 500-800 C. The heat treatments caused rejection of some carbon from the carburized layer into an amorphous film that formed on each specimen surface. Further, the heat treatments encouraged carbide precipitation and reduced hardness within the carburized layer, but the overall change did not reduce surface hardness fully to the level of untreated material. Heat treatments as short as 10 min at 650 C substantially reduced cavitation-erosion resistance in mercury, while heat treatments at 500 and 800 C were found to be somewhat less detrimental. Overall, the results suggest that modest thermal excursions perhaps the result of a weld made at some distance to the carburized material or a brief stress relief treatment will not render the hardened layer completely ineffective but should be avoided to the greatest extent possible.

  2. The Life-cycle of Operons

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2005-11-18

    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  3. Evidence against the selfish operon theory.

    Pál, Csaba; Hurst, Laurence D

    2004-06-01

    According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

  4. Superconducting Mercury-Based Cuprate Films with a Zero-Resistance Transition Temperature of 124 Kelvin

    Tsuei, C. C.; Gupta, A.; Trafas, G.; Mitzi, D.

    1994-03-01

    The synthesis of high-quality films of the recently discovered mercury-based cuprate films with high transition temperatures has been plagued by problems such as the air sensitivity of the cuprate precursor and the volatility of Hg and HgO. These processing difficulties have been circumvented by a technique of atomic-scale mixing of the HgO and cuprate precursors, use of a protective cap layer, and annealing in an appropriate Hg and O_2 environment. With this procedure, a zero-resistance transition temperature as high as 124 kelvin in c axis-oriented epitaxial HgBa_2CaCu_2O6+δ films has been achieved.

  5. Superconducting mercury-based cuprate films with a zero-resistance transition temperature of 124 Kelvin.

    Tsuei, C C; Gupta, A; Trafas, G; Mitzi, D

    1994-03-04

    The synthesis of high-quality films of the recently discovered mercury-based cuprate films with high transition temperatures has been plagued by problems such as the air sensitivity of the cuprate precursor and the volatility of Hg and HgO. These processing difficulties have been circumvented by a technique of atomic-scale mixing of the HgO and cuprate precursors, use of a protective cap layer, and annealing in an appropriate Hg and O(2) environment. With this procedure, a zero-resistance transition temperature as high as 124 kelvin in c axis-oriented epitaxial HgBa(2)CaCu(2)O(6+delta) films has been achieved.

  6. Characterization of the Metabolically Modified Heavy Metal-Resistant Cupriavidus metallidurans Strain MSR33 Generated for Mercury Bioremediation

    Rojas, Luis A.; Yáñez, Carolina; González, Myriam; Lobos, Soledad; Smalla, Kornelia; Seeger, Michael

    2011-01-01

    Background Mercury-polluted environments are often contaminated with other heavy metals. Therefore, bacteria with resistance to several heavy metals may be useful for bioremediation. Cupriavidus metallidurans CH34 is a model heavy metal-resistant bacterium, but possesses a low resistance to mercury compounds. Methodology/Principal Findings To improve inorganic and organic mercury resistance of strain CH34, the IncP-1β plasmid pTP6 that provides novel merB, merG genes and additional other mer genes was introduced into the bacterium by biparental mating. The transconjugant Cupriavidus metallidurans strain MSR33 was genetically and biochemically characterized. Strain MSR33 maintained stably the plasmid pTP6 over 70 generations under non-selective conditions. The organomercurial lyase protein MerB and the mercuric reductase MerA of strain MSR33 were synthesized in presence of Hg2+. The minimum inhibitory concentrations (mM) for strain MSR33 were: Hg2+, 0.12 and CH3Hg+, 0.08. The addition of Hg2+ (0.04 mM) at exponential phase had not an effect on the growth rate of strain MSR33. In contrast, after Hg2+ addition at exponential phase the parental strain CH34 showed an immediate cessation of cell growth. During exposure to Hg2+ no effects in the morphology of MSR33 cells were observed, whereas CH34 cells exposed to Hg2+ showed a fuzzy outer membrane. Bioremediation with strain MSR33 of two mercury-contaminated aqueous solutions was evaluated. Hg2+ (0.10 and 0.15 mM) was completely volatilized by strain MSR33 from the polluted waters in presence of thioglycolate (5 mM) after 2 h. Conclusions/Significance A broad-spectrum mercury-resistant strain MSR33 was generated by incorporation of plasmid pTP6 that was directly isolated from the environment into C. metallidurans CH34. Strain MSR33 is capable to remove mercury from polluted waters. This is the first study to use an IncP-1β plasmid directly isolated from the environment, to generate a novel and stable bacterial strain

  7. Characterization of the metabolically modified heavy metal-resistant Cupriavidus metallidurans strain MSR33 generated for mercury bioremediation.

    Luis A Rojas

    Full Text Available BACKGROUND: Mercury-polluted environments are often contaminated with other heavy metals. Therefore, bacteria with resistance to several heavy metals may be useful for bioremediation. Cupriavidus metallidurans CH34 is a model heavy metal-resistant bacterium, but possesses a low resistance to mercury compounds. METHODOLOGY/PRINCIPAL FINDINGS: To improve inorganic and organic mercury resistance of strain CH34, the IncP-1β plasmid pTP6 that provides novel merB, merG genes and additional other mer genes was introduced into the bacterium by biparental mating. The transconjugant Cupriavidus metallidurans strain MSR33 was genetically and biochemically characterized. Strain MSR33 maintained stably the plasmid pTP6 over 70 generations under non-selective conditions. The organomercurial lyase protein MerB and the mercuric reductase MerA of strain MSR33 were synthesized in presence of Hg(2+. The minimum inhibitory concentrations (mM for strain MSR33 were: Hg(2+, 0.12 and CH(3Hg(+, 0.08. The addition of Hg(2+ (0.04 mM at exponential phase had not an effect on the growth rate of strain MSR33. In contrast, after Hg(2+ addition at exponential phase the parental strain CH34 showed an immediate cessation of cell growth. During exposure to Hg(2+ no effects in the morphology of MSR33 cells were observed, whereas CH34 cells exposed to Hg(2+ showed a fuzzy outer membrane. Bioremediation with strain MSR33 of two mercury-contaminated aqueous solutions was evaluated. Hg(2+ (0.10 and 0.15 mM was completely volatilized by strain MSR33 from the polluted waters in presence of thioglycolate (5 mM after 2 h. CONCLUSIONS/SIGNIFICANCE: A broad-spectrum mercury-resistant strain MSR33 was generated by incorporation of plasmid pTP6 that was directly isolated from the environment into C. metallidurans CH34. Strain MSR33 is capable to remove mercury from polluted waters. This is the first study to use an IncP-1β plasmid directly isolated from the environment, to generate a novel

  8. A Study on Mercury-Resistant Bacteria Isolated from a Gold Mine in Pongkor Village, Bogor, Indonesia

    WAHYU IRAWATI

    2012-12-01

    Full Text Available Mercury is one of the major pollutant in the environment which is highly toxic. Bioremediation strategies using bacteria have been proposed as an attractive alternative because this is effective, less expensive and more efficient to remove mercury. Brevundimonas sp. HgP1 and Brevundimonas sp. HgP2 were two highly mercury resistant bacteria isolated from a gold mine in Pongkor village with MIC of 575 ppm. The purposes of the research were to study the effect of mercury on bacterial growth and morphological changes of bacterial colony and to measure the ability of bacterial isolates to accumulate Hg2+. The growth was monitored by measuring optical density at 600 nm, whereas accumulation of Hg2+ was measured by mercury vaporation unit. This present studies revealed that the addition of 50 and 100 ppm HgCl2 in Brevundimonas sp. HgP1 resulted in the decreasing of growth rate and the elongation of lag phase in 8 and 16 hours, respectively. The addition of HgCl2 also affected morphological appearance of the bacterial colony to black. Brevundimonas sp. HgP1 accumulated Hg2+ up to 1.09 and 2.7 mg/g dry weight of cells and removed 64.38 and 57.10% Hg2+ from the medium containing 50 and 100 ppm HgCl2, respectively.

  9. The Life-cycle of Operons

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2007-03-15

    Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

  10. Problem-Solving Test: Tryptophan Operon Mutants

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  11. The relative value of operon predictions

    Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

    For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

  12. Method and apparatus for monitoring mercury emissions

    Durham, Michael D.; Schlager, Richard J.; Sappey, Andrew D.; Sagan, Francis J.; Marmaro, Roger W.; Wilson, Kevin G.

    1997-01-01

    A mercury monitoring device that continuously monitors the total mercury concentration in a gas. The device uses the same chamber for converting speciated mercury into elemental mercury and for measurement of the mercury in the chamber by radiation absorption techniques. The interior of the chamber is resistant to the absorption of speciated and elemental mercury at the operating temperature of the chamber.

  13. Antibiotic-resistant fecal bacteria, antibiotics, and mercury in surface waters of Oakland County, Michigan, 2005-2006

    Fogarty, Lisa R.; Duris, Joseph W.; Crowley, Suzanne L.; Hardigan, Nicole

    2007-01-01

    Water samples collected from 20 stream sites in Oakland and Macomb Counties, Mich., were analyzed to learn more about the occurrence of cephalosporin-resistant Escherichia coli (E. coli) and vancomycin-resistant enterococci (VRE) and the co-occurrence of antibiotics and mercury in area streams. Fecal indicator bacteria concentrations exceeded the Michigan recreational water-quality standard of 300 E. coli colony forming units (CFU) per 100 milliliters of water in 19 of 35 stream-water samples collected in Oakland County. A gene commonly associated with enterococci from humans was detected in samples from Paint Creek at Rochester and Evans Ditch at Southfield, indicating that human fecal waste is a possible source of fecal contamination at these sites. E. coli resistant to the cephalosporin antibiotics (cefoxitin and/ or ceftriaxone) were found at all sites on at least one occasion. The highest percentages of E. coli isolates resistant to cefoxitin and ceftriaxone were 71 percent (Clinton River at Auburn Hills) and 19 percent (Sashabaw Creek near Drayton Plains), respectively. Cephalosporin-resistant E. coli was detected more frequently in samples from intensively urbanized or industrialized areas than in samples from less urbanized areas. VRE were not detected in any sample collected in this study. Multiple antibiotics (azithromycin, erythromycin, ofloxacin, sulfamethoxazole, and trimethoprim) were detected in water samples from the Clinton River at Auburn Hills, and tylosin (an antibiotic used in veterinary medicine and livestock production that belongs to the macrolide group, along with erythromycin) was detected in one water sample from Paint Creek at Rochester. Concentrations of total mercury were as high as 19.8 nanograms per liter (Evans Ditch at Southfield). There was no relation among percentage of antibiotic-resistant bacteria and measured concentrations of antibiotics or mercury in the water. Genetic elements capable of exchanging multiple antibiotic-resistance

  14. Tributyltin-resistant Methanothermobacter thermautotrophicus mutant with mutational substitutions in the A.sub.1./sub.A.sub.0./sub.-ATP synthase operon

    Nováková, Z.; Bobálová, Janette; Vidová, M.; Hapala, I.; Šmigáň, P.

    2009-01-01

    Roč. 298, č. 2 (2009), s. 255-259 ISSN 0378-1097 Institutional research plan: CEZ:AV0Z40310501 Keywords : methanoarchaea * bioenergetics * tributyltin resistance Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.199, year: 2009

  15. Detecting uber-operons in prokaryotic genomes.

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

  16. The post-transcriptional operon

    Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

    2011-01-01

    model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

  17. Occurrence of large fractions of mercury-resistant bacteria in the Bay of Bengal

    De, J.; Ramaiah, N.

    , 1991 , pp. 1 ? 29. 21. Smith, T., Pitts, K., McGarvey, J. A. and Summers, A. O., Bact e- rial oxidation of mercury metal vapor, Hg(0). Appl. Environ. M i cr o biol ., 1998, 64 , 1328 ? 1332. 22. http://in.rediff.com /money/2003/nov/04mercury...

  18. The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

    Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

    2011-11-01

    HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

  19. Low molecular weight thiols and thioredoxins are important players in Hg(II) resistance in Thermus thermophilus HB27.

    Norambuena, J; Wang, Y; Hanson, T; Boyd, J M; Barkay, T

    2017-11-17

    Mercury (Hg), one of the most toxic and widely distributed heavy metals, has a high affinity for thiol groups. Thiol groups reduce and sequester Hg. Therefore, low molecular weight and protein thiols may be important cell components used in Hg resistance. To date, the role of low molecular weight thiols in Hg-detoxification remains understudied. The mercury resistance ( mer ) operon of Thermus thermophilus suggests an evolutionary link between Hg(II) resistance and low molecular weight thiol metabolism. This mer operon encodes for an enzyme involved in methionine biosynthesis, Oah. Challenge with Hg(II) resulted in increased expression of genes involved in the biosynthesis of multiple low molecular weight thiols (cysteine, homocysteine, and bacillithiol), as well as the thioredoxin system. Phenotypic analysis of gene replacement mutants indicated that Oah contributes to Hg resistance under sulfur limiting conditions, and strains lacking bacillithiol and/or thioredoxins are more sensitive to Hg(II) than the wild type. Growth in presence of either a thiol oxidizing agent or a thiol alkylating agent increased sensitivity to Hg(II). Furthermore, exposure to 3 μM Hg(II) consumed all intracellular reduced bacillithiol and cysteine. Database searches indicate that oah2 is present in all Thermus spp. mer operons. The presence of a thiol related gene was also detected in some alphaprotobacterial mer operons, in which a glutathione reductase gene was present, supporting the role of thiols in Hg(II) detoxification. These results have led to a working model in which LMW thiols act as Hg(II) buffering agents while Hg is reduced by MerA. Importance The survival of microorganisms in presence of toxic metals is central to life's sustainability. The affinity of thiol groups to toxic heavy metals drives microbe-metal interactions and modulate metal toxicity. Mercury detoxification ( mer ) genes likely originated early in microbial evolution among geothermal environments. Little is

  20. Mercury-Resistant Marine Bacteria and their Role in Bioremediation of Certain Toxicants

    De, J.

    of heavy metals (mercury, cadmium, lead to name a few). Without efficient retention technologies, toxic chemicals including Hg are let into the environment, endangering ecosystems and public health. The main focus in this section is on literature review... toxicity. For the most sensitive species, Daphnia magna, the NOTEL for reproductive impairment is 3 ppb for inorganic mercury and lesser than 0.04 ppb for methylmercury (Canstein, 2000). Hence it is of great importance for both environment and public health...

  1. Mechanism of mercuric chloride resistance in microorganisms. I. Vaporization of a mercury compound from mercuric chloride by multiple drug resistant strains of Escherichia coli

    Komura, I; Izaki, K

    1971-01-01

    Three strains of Escherichia coli possessing the multiple drug resistance were found to be resistant also to HgCl/sub 2/, though they were sensitive to other heavy metal ions such as nickel, cobalt, cadmium and zinc ions. Like the resistance to drugs such as chloramphenicol and tetracycline, the HgCl/sub 2/ resistance could be transferred from a resistant strain of E. coli to sensitive strains of E. coli and Aerobacter aerogenes. The resistant strains could grow in the presence of 0.02 mM HgCl/sub 2/, whereas a sensitive strain failed to grow in the presence of 0.01 mM HgCl/sub 2/. During cultivation in the presence of HgCl/sub 2/, the cells of resistant strain vaporized a form of radioactive mercury when incubated with /sup 203/HgCl/sub 2/, glucose and NaCl in phosphate buffer while the cells of sensitive strain showed no such activity. This phenomenon seemed to explain the HgCl/sub 2/ resistance of the resistant strains.

  2. REMap: Operon Map of M. tuberculosis

    Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

    2016-01-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

  3. Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

    Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

    2003-09-01

    features that can be distinguished. As additional genomes are thoroughly analyzed, an increasingly refined resolution of the sequential evolutionary steps is clearly possible. These comparisons suggest that present-day trp operons that possess finely tuned regulatory features are under strong positive selection and are able to resist the disruptive evolutionary events that may be experienced by simpler, poorly regulated operons.

  4. Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

    Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

    2003-01-01

    features that can be distinguished. As additional genomes are thoroughly analyzed, an increasingly refined resolution of the sequential evolutionary steps is clearly possible. These comparisons suggest that present-day trp operons that possess finely tuned regulatory features are under strong positive selection and are able to resist the disruptive evolutionary events that may be experienced by simpler, poorly regulated operons. PMID:12966138

  5. Mercury (II) removal by resistant bacterial isolates and mercuric (II) reductase activity in a new strain of Pseudomonas sp. B50A.

    Giovanella, Patricia; Cabral, Lucélia; Bento, Fátima Menezes; Gianello, Clesio; Camargo, Flávio Anastácio Oliveira

    2016-01-25

    This study aimed to isolate mercury resistant bacteria, determine the minimum inhibitory concentration for Hg, estimate mercury removal by selected isolates, explore the mer genes, and detect and characterize the activity of the enzyme mercuric (II) reductase produced by a new strain of Pseudomonas sp. B50A. The Hg removal capacity of the isolates was determined by incubating the isolates in Luria Bertani broth and the remaining mercury quantified by atomic absorption spectrophotometry. A PCR reaction was carried out to detect the merA gene and the mercury (II) reductase activity was determined in a spectrophotometer at 340 nm. Eight Gram-negative bacterial isolates were resistant to high mercury concentrations and capable of removing mercury, and of these, five were positive for the gene merA. The isolate Pseudomonas sp. B50A removed 86% of the mercury present in the culture medium and was chosen for further analysis of its enzyme activity. Mercuric (II) reductase activity was detected in the crude extract of this strain. This enzyme showed optimal activity at pH 8 and at temperatures between 37 °C and 45 °C. The ions NH4(+), Ba(2+), Sn(2+), Ni(2+) and Cd(2+) neither inhibited nor stimulated the enzyme activity but it decreased in the presence of the ions Ca(2+), Cu(+) and K(+). The isolate and the enzyme detected were effective in reducing Hg(II) to Hg(0), showing the potential to develop bioremediation technologies and processes to clean-up the environment and waste contaminated with mercury. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Final report - Microbial pathways for the reduction of mercury in saturated subsurface sediments

    Tamar barkay; Lily Young; Gerben Zylstra

    2009-08-25

    Mercury is a component of mixed wastes that have contaminated vast areas of the deep subsurface as a result of nuclear weapon and energy production. While this mercury is mostly bound to soil constituents episodes of groundwater contamination are known in some cases resulting in potable water super saturated with Hg(0). Microbial processes that reduce Hg(II) to the elemental form Hg(0) in the saturated subsurface sediments may contribute to this problem. When we started the project, only one microbial pathway for the reduction of Hg(II), the one mediated by the mer operon in mercury resistant bacteria was known. As we had previously demonstrated that the mer mediated process occurred in highly contaminated environments (Schaefer et al., 2004), and mercury concentrations in the subsurface were reported to be low (Krabbenhoft and Babiarz, 1992), we hypothesized that other microbial processes might be active in reducing Hg(II) to Hg(0) in saturated subsurface environments. The specific goals of our projects were: (1) Investigating the potential for Hg(II) reduction under varying electron accepting conditions in subsurface sediments and relating these potential to mer gene distribution; and (2) Examining the physiological and biochemical characteristics of the interactions of anaerobic bacteria with mercury. The results are briefly summarized with references to published papers and manuscripts in preparation where details about our research can be found. Additional information may be found in copies of our published manuscripts and conference proceedings, and our yearly reports that were submitted through the RIMS system.

  7. Removal of mercury in fixed-bed continuous upflow reactors by mercury-resistant bacteria and effect of sodium chloride on their performance

    De; Leonhauser, J.; Vardanyan, L.

    Urgent need to reduce the amount of toxic mercury compounds in the wastewater of industries and subsequent reuse of metal ions, has led to an increasing interest in microbial bioremediation. Two Pseudomonas aeruginosa strains, namely, isolate CH07...

  8. Teaching the Big Ideas of Biology with Operon Models

    Cooper, Robert A.

    2015-01-01

    This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

  9. Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

    Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

    2014-12-01

    Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

  10. Single and combined effects of microplastics and mercury on juveniles of the European seabass (Dicentrarchus labrax): Changes in behavioural responses and reduction of swimming velocity and resistance time.

    Barboza, Luís Gabriel Antão; Vieira, Luís Russo; Guilhermino, Lúcia

    2018-05-01

    Microplastics and mercury are environmental pollutants of great concern. The main goal of the present study was to investigate the effects of these pollutants, both individually and in binary mixtures, on the swimming performance of juvenile European seabass, Dicentrarchus labrax. Microplastics alone, mercury alone and all the mixtures caused significant reduction of the swimming velocity and resistance time of fish. Moreover, changes in behavioural responses including lethargic and erratic swimming behaviour were observed. These results highlight that fish behavioural responses can be used as sensitive endpoint to establish the effects of contamination by microplastics and also emphasizes the need to assess the combined effects of microplastics and other environmental contaminants, with special attention to the effects on behavioural responses in fish and other aquatic species. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Potential of mercury-resistant marine bacteria for detoxification of chemicals of environmental concern

    De, J.; Ramaiah, N.; Bhosle, N.B.; Garg, A.; Vardanyan, L.; Nagle, V.L.; Fukami, K.

    -resistant Pseudomonas putida strain. Appl. Environ. Microbiol. 65: 5279-5284. 11) Champ, M.A. 2000. A review of organotin regulatory strategies: pending actions, related costs and benefits. Sci. Total Environ. 258: 21-71. 12) Chang, J.S., R. Law, and C.C. Chang. 1997... indicating that TBT were degraded by bacterial action. With organic enrichment, the amounts of TBT degraded were similar by both strains but the degradation rate was faster. Discussion Lower costs and higher efficiency at low metal concentrations...

  12. Transcriptome dynamics-based operon prediction in prokaryotes.

    Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

    2014-05-16

    Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

  13. ProOpDB: Prokaryotic Operon DataBase.

    Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

    2012-01-01

    The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

  14. msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

    Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

    2015-02-01

    Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Metazoan operons accelerate recovery from growth arrested states

    Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

    2011-01-01

    Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

  16. Mercury and Your Health

    ... the Risk of Exposure to Mercury Learn About Mercury What is Mercury What is Metallic mercury? Toxicological Profile ToxFAQs Mercury Resources CDC’s National Biomonitoring Program Factsheet on Mercury ...

  17. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  18. Planet Mercury

    1974-01-01

    Mariner 10's first image of Mercury acquired on March 24, 1974. During its flight, Mariner 10's trajectory brought it behind the lighted hemisphere of Mercury, where this image was taken, in order to acquire important measurements with other instruments.This picture was acquired from a distance of 3,340,000 miles (5,380,000 km) from the surface of Mercury. The diameter of Mercury (3,031 miles; 4,878 km) is about 1/3 that of Earth.Images of Mercury were acquired in two steps, an inbound leg (images acquired before passing into Mercury's shadow) and an outbound leg (after exiting from Mercury's shadow). More than 2300 useful images of Mercury were taken, both moderate resolution (3-20 km/pixel) color and high resolution (better than 1 km/pixel) black and white coverage.

  19. Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents.

    Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon

    2014-01-01

    Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.

  20. Mercurial poisoning

    Gorton, B

    1924-01-01

    Cats which had been kept in a thermometer factory to catch rats were afflicted with mercury poisoning. So were the rats they were supposed to eat. The symptoms of mercury poisoning were the same in both species. The source of mercury for these animals is a fine film of the metal which coats floors, a result of accidental spills during the manufacturing process.

  1. Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

    Narang, Atul; Oehler, Stefan

    2017-05-01

    The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

  2. Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

    Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

    2015-05-25

    Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

  3. Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

    Crawford, I P; Han, C Y; Silverman, M

    1991-01-01

    The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

  4. Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus.

    Sahukhal, Gyan S; Elasri, Mohamed O

    2014-06-11

    Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

  5. Got Mercury?

    Meyers, Valerie E.; McCoy, J. Torin; Garcia, Hector D.; James, John T.

    2009-01-01

    Many of the operational and payload lighting units used in various spacecraft contain elemental mercury. If these devices were damaged on-orbit, elemental mercury could be released into the cabin. Although there are plans to replace operational units with alternate light sources, such as LEDs, that do not contain mercury, mercury-containing lamps efficiently produce high quality illumination and may never be completely replaced on orbit. Therefore, exposure to elemental mercury during spaceflight will remain possible and represents a toxicological hazard. Elemental mercury is a liquid metal that vaporizes slowly at room temperature. However, it may be completely vaporized at the elevated operating temperatures of lamps. Although liquid mercury is not readily absorbed through the skin or digestive tract, mercury vapors are efficiently absorbed through the respiratory tract. Therefore, the amount of mercury in the vapor form must be estimated. For mercury releases from lamps that are not being operated, we utilized a study conducted by the New Jersey Department of Environmental Quality to calculate the amount of mercury vapor expected to form over a 2-week period. For longer missions and for mercury releases occurring when lamps are operating, we conservatively assumed complete volatilization of the available mercury. Because current spacecraft environmental control systems are unable to remove mercury vapors, both short-term and long-term exposures to mercury vapors are possible. Acute exposure to high concentrations of mercury vapors can cause irritation of the respiratory tract and behavioral symptoms, such as irritability and hyperactivity. Chronic exposure can result in damage to the nervous system (tremors, memory loss, insomnia, etc.) and kidneys (proteinurea). Therefore, the JSC Toxicology Group recommends that stringent safety controls and verifications (vibrational testing, etc.) be applied to any hardware that contains elemental mercury that could yield

  6. Phytoremediation of Ionic and Methyl Mercury Pollution

    Meagher, Richard B.

    2005-06-01

    Phytoremediation is defined as the use of plants to extract, resist, detoxify, and/or sequester toxic environmental pollutants. The long-term goal of the proposed research is to develop and test highly productive, field-adapted plant species that have been engineered for the phytoremediation of mercury. A variety of different genes, which should enable plants to clean mercury polluted sites are being tested as tools for mercury phytoremediation, first in model laboratory plants and then in potential field species. Several of these genes have already been shown to enhance mercury phytoremediation. Mercury pollution is a serious, world-wide problem affecting the health of human and wildlife populations. Environmentally, the most serious mercury threat is the production of methylmercury (CH3Hg+) by native bacteria at mercury contaminated wetland sites. Methylmercury is inherently more toxic than metallic (Hg(0)) or ionic (Hg(II)) mercury, and because methylmercury is prolifically biomagnified up the food chain, it poses the most immediate danger to animal populations. We have successfully engineered two model plants, Arabidopsis and tobacco, to use the bacterial merB gene to convert methylmercury to less toxic ionic mercury and to use the bacterial merA gene to further detoxify ionic mercury to the least toxic form of mercury, metallic mercury. Plants expressing both MerA and MerB proteins detoxify methylmercury in two steps to the metallic form. These plants germinate, grow, and set seed at normal growth rates on levels of methylmercury or ionic mercury that are lethal to normal plants. Our newest efforts involve engineering plants with several additional bacterial and plant genes that allow for higher levels of mercury resistance and mercury hyperaccumulation. The potential for these plants to hyperaccumulate mercury was further advanced by developing constitutive, aboveground, and root-specific gene expression systems. Our current strategy is to engineer plants to

  7. Mercury accumulation plant Cyrtomium macrophyllum and its potential for phytoremediation of mercury polluted sites.

    Xun, Yu; Feng, Liu; Li, Youdan; Dong, Haochen

    2017-12-01

    Cyrtomium macrophyllum naturally grown in 225.73 mg kg -1 of soil mercury in mining area was found to be a potential mercury accumulator plant with the translocation factor of 2.62 and the high mercury concentration of 36.44 mg kg -1 accumulated in its aerial parts. Pot experiments indicated that Cyrtomium macrophyllum could even grow in 500 mg kg -1 of soil mercury with observed inhibition on growth but no obvious toxic effects, and showed excellent mercury accumulation and translocation abilities with both translocation and bioconcentration factors greater than 1 when exposed to 200 mg kg -1 and lower soil mercury, indicating that it could be considered as a great mercury accumulating species. Furthermore, the leaf tissue of Cyrtomium macrophyllum showed high resistance to mercury stress because of both the increased superoxide dismutase activity and the accumulation of glutathione and proline induced by mercury stress, which favorited mercury translocation from the roots to the aerial parts, revealing the possible reason for Cyrtomium macrophyllum to tolerate high concentration of soil mercury. In sum, due to its excellent mercury accumulation and translocation abilities as well as its high resistance to mercury stress, the use of Cyrtomium macrophyllum should be a promising approach to remediating mercury polluted soils. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. A conservative region of the mercuric reductase gene (merA) as a molecular marker of bacterial mercury resistance Região conservada do gene da mercúrio redutase (merA) como marcador molecular da resistência bacteriana ao mercúrio

    Adriana Sotero-Martins; Michele Silva de Jesus; Michele Lacerda; Josino Costa Moreira; Ana Luzia Lauria Filgueiras; Paulo Rubens Guimarães Barrocas

    2008-01-01

    The most common bacterial mercury resistance mechanism is based on the reduction of Hg(II) to Hg0, which is dependent of the mercuric reductase enzyme (MerA) activity. The use of a 431 bp fragment of a conservative region of the mercuric reductase (merA) gene was applied as a molecular marker of this mechanism, allowing the identification of mercury resistant bacterial strains.O mecanismo de resistência bacteriana ao mercúrio mais comum é baseada na redução do Hg(II) a Hg0, através da ativida...

  9. Phytoremediation of Ionic and Methyl Mercury Pollution

    Meagher, Richard B.

    2004-12-01

    Phytoremediation is defined as the use of plants to extract, resist, detoxify, and/or sequester toxic environmental pollutants. The long-term goal of the proposed research is to develop and test highly productive, field-adapted plant species that have been engineered for the phytoremediation of mercury. A variety of different genes, which should enable plants to clean mercury polluted sites are being tested as tools for mercury phytoremediation, first in model laboratory plants and then in potential field species. Several of these genes have already been shown to enhance mercury phytoremediation. Mercury pollution is a serious, world-wide problem affecting the health of human and wildlife populations. Environmentally, the most serious mercury threat is the production of methylmercury (CH3Hg+) by native bacteria at mercury contaminated wetland sites. Methylmercury is inherently more toxic than metallic (Hg(0)) or ionic (Hg(II)) mercury, and because methylmercury is prolifically biomagnified up the food chain, it poses the most immediate danger to animal populations. We have successfully engineered two model plants, Arabidopsis and tobacco, to use the bacterial merB gene to convert methylmercury to less toxic ionic mercury and to use the bacterial merA gene to further detoxify ionic mercury to the least toxic form of mercury, metallic mercury. Plants expressing both MerA and MerB proteins detoxify methylmercury in two steps to the metallic form. These plants germinate, grow, and set seed at normal growth rates on levels of methylmercury or ionic mercury that are lethal to normal plants. Our newest efforts involve engineering plants with several additional bacterial and plant genes that allow for higher levels of mercury resistance and mercury hyperaccumulation. The potential for these plants to hyperaccumulate mercury was further advanced by developing constitutive, aboveground, and root-specific gene expression systems.

  10. Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

    Lawrence, J

    1999-12-01

    The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

  11. Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli.

    Kim, Moonjeong; Kim, Kwang-Sun

    2017-07-06

    The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Evolution and Biophysics of the Escherichia coli lac Operon

    Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

    2011-03-01

    To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

  13. Induction of the mar operon by miscellaneous groceries.

    Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P

    2004-01-01

    To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.

  14. Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli.

    Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E

    2016-01-01

    An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

  15. Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

    Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

    2017-01-01

    The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

  16. Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

    Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

    2018-01-01

    Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

  17. CONDOP: an R package for CONdition-Dependent Operon Predictions.

    Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

    2016-10-15

    The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

    Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

    2016-01-01

    Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

  19. Characterization of a Mycobacterium avium subsp. avium Operon Associated with Virulence and Drug Detoxification

    Mariana Noelia Viale

    2014-01-01

    Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.

  20. HosA, a MarR Family Transcriptional Regulator, Represses Nonoxidative Hydroxyarylic Acid Decarboxylase Operon and Is Modulated by 4-Hydroxybenzoic Acid.

    Roy, Ajit; Ranjan, Akash

    2016-02-23

    Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.

  1. Dynamic model of gene regulation for the lac operon

    Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  2. Dynamic model of gene regulation for the lac operon

    Angelova, Maia; Ben-Halim, Asma

    2011-01-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  3. Acclimation of subsurface microbial communities to mercury

    de Lipthay, Julia R; Rasmussen, Lasse D; Øregaard, Gunnar

    2008-01-01

    of mercury tolerance and functional versatility of bacterial communities in contaminated soils initially were higher for surface soil, compared with the deeper soils. However, following new mercury exposure, no differences between bacterial communities were observed, which indicates a high adaptive potential......We studied the acclimation to mercury of bacterial communities of different depths from contaminated and noncontaminated floodplain soils. The level of mercury tolerance of the bacterial communities from the contaminated site was higher than those of the reference site. Furthermore, the level...... of the subsurface communities, possibly due to differences in the availability of mercury. IncP-1 trfA genes were detected in extracted community DNA from all soil depths of the contaminated site, and this finding was correlated to the isolation of four different mercury-resistance plasmids, all belonging...

  4. Daptomycin Tolerance in the Staphylococcus aureus pitA6 Mutant Is Due to Upregulation of the dlt Operon.

    Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich

    2016-05-01

    Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  5. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

    2005-04-12

    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  6. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

  7. Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

    Stewart, V; Yanofsky, C

    1986-01-01

    We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

  8. Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

    Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

    2013-01-01

    Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

  9. SHORT COMMUNICATION: Correlation between the Resistance Ratios of Platinum Resistance Thermometers at the Melting Point of Gallium and the Triple Point of Mercury

    Singh, Y. P.; Maas, H.; Edler, F.; Zaidi, Z. H.

    1994-01-01

    A set of resistance ratios (W) for platinum resistance thermometers was obtained at the triple point of Hg and the melting point of Ga in order to study their relationship. It was found that using measured values for one of the fixed points, a linear equation will predict the value of the other. These measurements also indicate that the fixed points of Hg and of Ga are inconsistent by about 1,5 mK in the sense that either the melting point of Ga or the triple point of Hg was assigned too high a value on the ITS-90.

  10. Sequence analysis of the Legionella micdadei groELS operon

    Hindersson, P; Høiby, N; Bangsborg, Jette Marie

    1991-01-01

    shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

  11. Rapid customised operon assembly by yeast recombinational cloning.

    Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

    2017-06-01

    We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

  12. Eucaryotic operon genes can define highly conserved syntenies

    Trachtulec, Zdeněk

    2004-01-01

    Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

  13. Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

    Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

    2016-04-01

    Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

  14. Deregulation of the arginine deiminase (arc) operon in penicillin-tolerant mutants of Streptococcus gordonii.

    Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P

    2000-10-01

    Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.

  15. Mercury's Messenger

    Chapman, Clark R.

    2004-01-01

    Forty years after Mariner 2, planetary exploration has still only just begun, and many more missions are on drawing boards, nearing the launch pad, or even en route across interplanetary space to their targets. One of the most challenging missions that will be conducted this decade is sending the MESSENGER spacecraft to orbit the planet Mercury.…

  16. Mercury Report-Children's exposure to elemental mercury

    ... gov . Mercury Background Mercury Report Additional Resources Mercury Report - Children's Exposure to Elemental Mercury Recommend on Facebook ... I limit exposure to mercury? Why was the report written? Children attending a daycare in New Jersey ...

  17. Phytoremediation of Ionic and Methyl Mercury Pollution

    Meagher, Richard B.

    2005-06-01

    Phytoremediation is defined as the use of plants to extract, resist, detoxify, and/or sequester toxic environmental pollutants. The long-term goal of the proposed research is to develop and test highly productive, field-adapted plant species that have been engineered for the phytoremediation of mercury. A variety of different genes, which should enable plants to clean mercury polluted sites are being tested as tools for mercury phytoremediation, first in model laboratory plants and then in potential field species. Several of these genes have already been shown to enhance mercury phytoremediation. Mercury pollution is a serious, world-wide problem affecting the health of human and wildlife populations. Environmentally, the most serious mercury threat is the production of methylmercury (CH3Hg+) by native bacteria at mercury contaminated wetland sites. Methylmercury is inherently more toxic than metallic (Hg(0)) or ionic (Hg(II)) mercury, and because methylmercury is prolifically biomagnified up the food chain, it poses the most immediate danger to animal populations. We have successfully engineered two model plants, Arabidopsis and tobacco, to use the bacterial merB gene to convert methylmercury to less toxic ionic mercury and to use the bacterial merA gene to further detoxify ionic mercury to the least toxic form of mercury, metallic mercury. Plants expressing both MerA and MerB proteins detoxify methylmercury in two steps to the metallic form. These plants germinate, grow, and set seed at normal growth rates on levels of methylmercury or ionic mercury that are lethal to normal plants. Our newest efforts involve engineering plants with several additional bacterial and plant genes that allow for higher levels of mercury resistance and mercury hyperaccumulation. The potential for these plants to hyperaccumulate mercury was further advanced by developing constitutive, aboveground, and root-specific gene expression systems. Our current strategy is to engineer plants to

  18. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel

    2015-01-01

    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

  19. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis.

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent

    2015-09-01

    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

  1. Multidrug Resistance Proteins and the Renal Elimination of Inorganic Mercury Mediated by 2,3-Dimercaptopropane-1-Sulfonic Acid and Meso-2,3-dimercaptosuccinic Acid

    Bridges, Christy C.; Joshee, Lucy; Zalups, Rudolfs K.

    2008-01-01

    Current therapies for inorganic mercury (Hg2+) intoxication include administration of a metal chelator, either 2,3-dimercaptopropane-1-sulfonic acid (DMPS) or meso-2,3-dimercaptosuccinic acid (DMSA). After exposure to either chelator, Hg2+ is rapidly eliminated from the kidneys and excreted in the urine, presumably as an S-conjugate of DMPS or DMSA. The multidrug resistance protein 2 (Mrp2) has been implicated in this process. We hypothesize that Mrp2 mediates the secretion of DMPS- or DMSA-S-conjugates of Hg2+ from proximal tubular cells. To test this hypothesis, the disposition of Hg2+ was examined in control and Mrp2-deficient TR− rats. Rats were injected i.v. with 0.5 μmol/kg HgCl2 containing 203Hg2+. Twenty-four and 28 h later, rats were injected with saline, DMPS, or DMSA. Tissues were harvested 48 h after HgCl2 exposure. The renal and hepatic burden of Hg2+ in the saline-injected TR− rats was greater than that of controls. In contrast, the amount of Hg2+ excreted in urine and feces of TR− rats was less than that of controls. DMPS, but not DMSA, significantly reduced the renal and hepatic content of Hg2+ in both groups of rats, with the greatest reduction in controls. A significant increase in urinary and fecal excretion of Hg2+, which was greater in the controls, was also observed following DMPS treatment. Experiments utilizing inside-out membrane vesicles expressing MRP2 support these observations by demonstrating that DMPS- and DMSA-S-conjugates of Hg2+ are transportable substrates of MRP2. Collectively, these data support a role for Mrp2 in the DMPS- and DMSA-mediated elimination of Hg2+ from the kidney. PMID:17940195

  2. Contribution of the nos-pdt operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.

    April M Sapp

    Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and

  3. A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.

    Kim, Dae Hun; Ko, Kwan Soo

    2015-07-01

    To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Structural characterization of the Salmonella typhimurium LT2 umu operon

    Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

    1990-01-01

    The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

  5. Elucidation of Operon Structures across Closely Related Bacterial Genomes

    Li, Guojun

    2014-01-01

    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

  6. Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

    Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

    2016-01-01

    The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

  7. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  8. Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression

    Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet

    2015-01-01

    Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450

  9. Bench-scale studies with mercury contaminated SRS soil

    Cicero, C.A.

    1995-01-01

    Bench-scale studies with mercury contaminated soil were performed at the SRTC to determine the optimum waste loading obtainable in the glass product without sacrificing durability, leach resistance, and processability. Vitrifying this waste stream also required offgas treatment for the capture of the vaporized mercury. Four soil glasses with slight variations in composition were produced, which were capable of passing the Product Consistency Test (PCT) and the Toxicity Characteristic Leaching Procedure (TCLP). The optimum glass feed composition contained 60 weight percent soil and produced a soda-lime-silica glass when melted at 1,350 C. The glass additives used to produce this glass were 24 weight percent Na 2 CO 3 and 16 weight percent CaCO 3 . Volatilized mercury released during the vitrification process was released to the proposed mercury collection system. The proposed mercury collection system consisted of quartz and silica tubing with a Na 2 S wash bottle followed by a NaOH wash bottle. Once in the system, the volatile mercury would pass through the wash bottle containing Na 2 S, where it would be converted to Hg 2 S, which is a stable form of mercury. However, attempts to capture the volatilized mercury in a Na 2 S solution wash bottle were not as successful as anticipated. Maximum mercury captured was only about 3.24% of the mercury contained in the feed. Mercury capture efforts then shifted to condensing and capturing the volatilized mercury. These attempts were much more successful at capturing the volatile mercury, with a capture efficiency of 34.24% when dry ice was used to pack the condenser. This captured mercury was treated on a mercury specific resin after digestion of the volatilized mercury

  10. The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

    Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

    1993-01-01

    Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

  11. A Synthetic Circuit for Mercury Bioremediation Using Self-Assembling Functional Amyloids.

    Tay, Pei Kun R; Nguyen, Peter Q; Joshi, Neel S

    2017-10-20

    Synthetic biology approaches to bioremediation are a key sustainable strategy to leverage the self-replicating and programmable aspects of biology for environmental stewardship. The increasing spread of anthropogenic mercury pollution into our habitats and food chains is a pressing concern. Here, we explore the use of programmed bacterial biofilms to aid in the sequestration of mercury. We demonstrate that by integrating a mercury-responsive promoter and an operon encoding a mercury-absorbing self-assembling extracellular protein nanofiber, we can engineer bacteria that can detect and sequester toxic Hg 2+ ions from the environment. This work paves the way for the development of on-demand biofilm living materials that can operate autonomously as heavy-metal absorbents.

  12. Mercury contamination extraction

    Fuhrmann, Mark [Silver Spring, MD; Heiser, John [Bayport, NY; Kalb, Paul [Wading River, NY

    2009-09-15

    Mercury is removed from contaminated waste by firstly applying a sulfur reagent to the waste. Mercury in the waste is then permitted to migrate to the reagent and is stabilized in a mercury sulfide compound. The stable compound may then be removed from the waste which itself remains in situ following mercury removal therefrom.

  13. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

    Igoshin, Oleg

    2011-03-01

    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  14. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  15. Genome Sequences of Two Copper-Resistant Escherichia coli Strains Isolated from Copper-Fed Pigs

    Lüthje, Freja L.; Hasman, Henrik; Aarestrup, Frank Møller

    2014-01-01

    The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances.......The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances....

  16. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  17. Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

    Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

    2017-01-01

    Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

  18. REMap: Operon map of M. tuberculosis based on RNA sequence data.

    Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

    2016-07-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

    Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

    2012-01-01

    Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

  20. Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

    Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

    2012-01-01

    During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

  1. Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

    Danielsen, S; Kilstrup, M; Barilla, K

    1992-01-01

    . A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

  2. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

  3. The pyrimidine operon pyrRPB-carA from Lactococcus lactis

    Martinussen, Jan; Schallert, J.; Andersen, Birgit

    2001-01-01

    The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

  4. Global Trends in Mercury Management

    Choi, Kyunghee

    2012-01-01

    The United Nations Environmental Program Governing Council has regulated mercury as a global pollutant since 2001 and has been preparing the mercury convention, which will have a strongly binding force through Global Mercury Assessment, Global Mercury Partnership Activities, and establishment of the Open-Ended Working Group on Mercury. The European Union maintains an inclusive strategy on risks and contamination of mercury, and has executed the Mercury Export Ban Act since December in 2010. The US Environmental Protection Agency established the Mercury Action Plan (1998) and the Mercury Roadmap (2006) and has proposed systematic mercury management methods to reduce the health risks posed by mercury exposure. Japan, which experienced Minamata disease, aims vigorously at perfection in mercury management in several ways. In Korea, the Ministry of Environment established the Comprehensive Plan and Countermeasures for Mercury Management to prepare for the mercury convention and to reduce risks of mercury to protect public health. PMID:23230466

  5. Basic Information about Mercury

    ... or metallic mercury is a shiny, silver-white metal and is liquid at room temperature. It is ... releases can happen naturally. Both volcanoes and forest fires send mercury into the atmosphere. Human activities, however, ...

  6. Minamata Convention on Mercury

    On November 6, 2013 the United States signed the Minamata Convention on Mercury, a new multilateral environmental agreement that addresses specific human activities which are contributing to widespread mercury pollution

  7. The Legionella pneumophila kai operon is implicated in stress response and confers fitness in competitive environments

    Loza-Correa, Maria; Sahr, Tobias; Rolando, Monica; Daniels, Craig; Petit, Pierre; Skarina, Tania; Valero, Laura Gomez; Dervins-Ravault, Delphine; Honoré, Nadine; Savchenko, Aleksey; Buchrieser, Carmen

    2014-01-01

    Summary Legionella pneumophila uses aquatic protozoa as replication niche and protection from harsh environments. Although L. pneumophila is not known to have a circadian clock, it encodes homologues of the KaiBC proteins of Cyanobacteria that regulate circadian gene expression. We show that L. pneumophila kaiB, kaiC and the downstream gene lpp1114, are transcribed as a unit under the control of the stress sigma factor RpoS. KaiC and KaiB of L. pneumophila do not interact as evidenced by yeast and bacterial two-hybrid analyses. Fusion of the C-terminal residues of cyanobacterial KaiB to Legionella KaiB restores their interaction. In contrast, KaiC of L. pneumophila conserved autophosphorylation activity, but KaiB does not trigger the dephosphorylation of KaiC like in Cyanobacteria. The crystal structure of L. pneumophila KaiB suggests that it is an oxidoreductase-like protein with a typical thioredoxin fold. Indeed, mutant analyses revealed that the kai operon-encoded proteins increase fitness of L. pneumophila in competitive environments, and confer higher resistance to oxidative and sodium stress. The phylogenetic analysis indicates that L. pneumophila KaiBC resemble Synechosystis KaiC2B2 and not circadian KaiB1C1. Thus, the L. pneumophila Kai proteins do not encode a circadian clock, but enhance stress resistance and adaption to changes in the environments. PMID:23957615

  8. A conservative region of the mercuric reductase gene (merA as a molecular marker of bacterial mercury resistance Região conservada do gene da mercúrio redutase (merA como marcador molecular da resistência bacteriana ao mercúrio

    Adriana Sotero-Martins

    2008-06-01

    Full Text Available The most common bacterial mercury resistance mechanism is based on the reduction of Hg(II to Hg0, which is dependent of the mercuric reductase enzyme (MerA activity. The use of a 431 bp fragment of a conservative region of the mercuric reductase (merA gene was applied as a molecular marker of this mechanism, allowing the identification of mercury resistant bacterial strains.O mecanismo de resistência bacteriana ao mercúrio mais comum é baseada na redução do Hg(II a Hg0, através da atividade da enzima mercúrio redutase (MerA. O uso do fragmento de 431 pb amplificado de uma região conservada do gene merA, que codifica a enzima MerA,foi utilizado como marcador molecular deste mecanismo, permitindo a identificação de bactérias resistentes ao mercúrio.

  9. Salmonella enterica Typhimurium fljBA operon stability: implications regarding the origin of Salmonella enterica I 4,[5],12:i:.

    Tomiyama, M P O; Werle, C H; Milanez, G P; Nóbrega, D B; Pereira, J P; Calarga, A P; Flores, F; Brocchi, M

    2015-12-29

    Salmonella enterica subsp enterica serovar 4,5,12:i:- has been responsible for many recent Salmonella outbreaks worldwide. Several studies indicate that this serovar originated from S. enterica subsp enterica serovar Typhimurium, by the loss of the flagellar phase II gene (fljB) and adjacent sequences. However, at least two different clones of S. enterica 4,5,12:i:- exist that differs in the molecular events responsible for fljB deletion. The aim of this study was to test the stability of the fljBA operon responsible for the flagellar phase variation under different growth conditions in order to verify if its deletion is a frequent event that could explain the origin and dissemination of this serovar. In fact, coding sequences for transposons are present near this operon and in some strains, such as S. enterica Typhimurium LT2, the Fels-2 prophage gene is inserted near this operon. The presence of mobile DNA could confer instability to this region. In order to examine this, the cat (chloramphenicol acetyltransferase) gene was inserted adjacent to the fljBA operon so that deletions involving this genomic region could be identified. After growing S. enterica chloramphenicol-resistant strains under different conditions, more than 104 colonies were tested for the loss of chloramphenicol resistance. However, none of the colonies were sensitive to chloramphenicol. These data suggest that the origin of S. enterica serovar 4,5,12:i:- from Typhimurium by fljBA deletion is not a frequent event. The origin and dissemination of 4,5,12:i:- raise several questions about the role of flagellar phase variation in virulence.

  10. Mercury in Your Environment

    Basic information about mercury, how it gets in the air, how people are exposed to it and health effects associated with exposure; what EPA and other organizations are doing to limit exposures; what citizens should know to minimize exposures and to reduce mercury in the environment; and information about products that contain mercury.

  11. Intoxication with metallic mercury

    Fichte, B.; Assmann, H.; Ritzau, F.

    1984-01-01

    Intoxications by metallic mercury are extremely rare. Report of a patient, who tried to commit suicide by subcutaneous injection of 500 g of metallic mercury. He died 16 months later in the course of the intoxication. A short review is given of effects and reactions of metallic mercury in the human organism. (orig.) [de

  12. Intoxication with metallic mercury

    Fichte, B.; Ritzau, F.; Assmann, H.

    1984-02-01

    Intoxications by metallic mercury are extremely rare. Report is given of a patient who tried to commit suicide by subcutaneous injection of 500 g of metallic mercury. He died 16 months later in the course of the intoxication. A short review is given of effects and reactions of metallic mercury in the human organism.

  13. Intoxication with metallic mercury

    Fichte, B.; Assmann, H.; Ritzau, F.

    1984-02-01

    Intoxications by metallic mercury are extremely rare. Report is given of a patient, who tried to commit suicide by subcutaneous injection of 500 g of metallic mercury. He died 16 months later in the course of the intoxication. A short review is given of effects and reactions of metallic mercury in the human organism.

  14. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    Gogarten J Peter

    2008-01-01

    Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

  15. Uptake of mercury vapor by wheat. An assimilation model

    Browne, C.L.; Fang, S.C.

    1978-01-01

    Using a whole-plant chamber and 203 Hg-labeled mercury, a quantitative study was made of the effect of environmental parameters on the uptake, by wheat (Triticum aestivum), of metallic mercury vapor, an atmospheric pollutant. Factors were examined in relation to their influence on components of the gas-assimilation model, U(Hg) = (C/sub A' -- C/sub L')/(r/sub L.Hg/ + r/sub M.Hg/) where U(Hg) is the rate of mercury uptake per unit leaf surface, C/sub A'/ is the ambient mercury vapor concentration, C/sub L'/ is the mercury concentration at immobilization sites within the plant (assumed to be zero), r/sub L.Hg/ is the total leaf resistance to mercury vapor exchange, and r/sub M.Hg/ is a residual term to account for unexplained physical and biochemical resistances to mercury vapor uptake. Essentially all mercury vapor uptake was confined to the leaves. r/sub L.Hg/ was particularly influenced by illumination (0 to 12.8 klux), but unaffected by ambient temperature (17 to 33 0 C) and mercury vapor concentration (0 to 40 μg m -3 ). The principal limitation to mercury vapor uptake was r/sub M.Hg/, which was linearly related to leaf temperature, but unaffected by mercury vapor concentration and illumination, except for apparent high values in darkness. Knowing C/sub A'/ and estimating r/sub L.Hg/ and r/sub M.Hg/ from experimental data, mercury vapor uptake by wheat in light was accurately predicted for several durations of exposure using the above model

  16. Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

    Dharmesh Harwani

    2014-12-01

    Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

  17. An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

    Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

    2013-07-01

    The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

    García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

    2017-09-01

    Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  19. Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

    Harwani, Dharmesh

    2014-01-01

    Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

  20. Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

    Ray, J. Christian J; Igoshin, Oleg A.

    2012-01-01

    Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

  1. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  2. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  3. The Genomic Pattern of tDNA Operon Expression in E. coli.

    2005-06-01

    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  4. Mercury balance analysis

    Maag, J.; Lassen, C.; Hansen, E.

    1996-01-01

    A detailed assessment of the consumption of mercury, divided into use areas, was carried out. Disposal and emissions to the environment were also qualified. The assessment is mainly based on data from 1992 - 1993. The most important source of emission of mercury to air is solid waste incineration which is assessed in particular to be due to the supply of mercury in batteries (most likely mercury oxide batteries from photo equipment) and to dental fillings. The second most important source of mercury emission to air is coal-fired power plants which are estimated to account for 200-500 kg of mercury emission p.a. Other mercury emissions are mainly related to waste treatment and disposal. The consumption of mercury is generally decreasing. During the period from 1982/83 - 1992-93, the total consumption of mercury in Denmark was about halved. This development is related to the fact that consumption with regard to several important use areas (batteries, dental fillings, thermometers etc.) has been significantly reduced, while for other purposes the use of mercury has completely, or almost disappeared, i.e. (fungicides for seed, tubes etc.). (EG)

  5. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Unknown

    [Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

  6. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  7. Characterization of mercury bioremediation by transgenic bacteria expressing metallothionein and polyphosphate kinase

    Gonzalez-Ruiz Gloriene

    2011-08-01

    Full Text Available Abstract Background The use of transgenic bacteria has been proposed as a suitable alternative for mercury remediation. Ideally, mercury would be sequestered by metal-scavenging agents inside transgenic bacteria for subsequent retrieval. So far, this approach has produced limited protection and accumulation. We report here the development of a transgenic system that effectively expresses metallothionein (mt-1 and polyphosphate kinase (ppk genes in bacteria in order to provide high mercury resistance and accumulation. Results In this study, bacterial transformation with transcriptional and translational enhanced vectors designed for the expression of metallothionein and polyphosphate kinase provided high transgene transcript levels independent of the gene being expressed. Expression of polyphosphate kinase and metallothionein in transgenic bacteria provided high resistance to mercury, up to 80 μM and 120 μM, respectively. Here we show for the first time that metallothionein can be efficiently expressed in bacteria without being fused to a carrier protein to enhance mercury bioremediation. Cold vapor atomic absorption spectrometry analyzes revealed that the mt-1 transgenic bacteria accumulated up to 100.2 ± 17.6 μM of mercury from media containing 120 μM Hg. The extent of mercury remediation was such that the contaminated media remediated by the mt-1 transgenic bacteria supported the growth of untransformed bacteria. Cell aggregation, precipitation and color changes were visually observed in mt-1 and ppk transgenic bacteria when these cells were grown in high mercury concentrations. Conclusion The transgenic bacterial system described in this study presents a viable technology for mercury bioremediation from liquid matrices because it provides high mercury resistance and accumulation while inhibiting elemental mercury volatilization. This is the first report that shows that metallothionein expression provides mercury resistance and

  8. Process for low mercury coal

    Merriam, Norman W.; Grimes, R. William; Tweed, Robert E.

    1995-01-01

    A process for producing low mercury coal during precombustion procedures by releasing mercury through discriminating mild heating that minimizes other burdensome constituents. Said mercury is recovered from the overhead gases by selective removal.

  9. Mercury (Environmental Health Student Portal)

    ... in contact with) to mercury is by eating fish or shellfish that have high levels of mercury. You can also get sick from: Touching it Breathing it in Drinking contaminated water How can mercury ...

  10. Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

    Riyanti, Eny Ida; Rogers, Peter L

    2009-01-01

    Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

  11. Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.

    Chung, T; Resnik, E; Stueland, C; LaPorte, D C

    1993-01-01

    Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

  12. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  13. Mercury is Moon's brother

    Ksanfomalifi, L.V.

    1976-01-01

    The latest information on Mercury planet is presented obtained by studying the planet with the aid of radar and space vehicles. Rotation of Mercury about its axis has been discovered; within 2/3 of its year it executes a complete revolution about its axis. In images obtained by the ''Mariner-10'' Mercurys surface differs little from that of the Moon. The ''Mariner-10'' has also discovered the Mercurys atmosphere, which consists of extremely rarefied helium. The helium is continuously supplied to the planet by the solar wind. The Mercury's magnetic field has been discovered, whose strength is 35 x 10 -4 at the Equator and 70 x 10 -4 E at the poles. The inclination of the dipole axis to the Mercury's rotation axis is 7 deg

  14. Solving a discrete model of the lac operon using Z3

    Gutierrez, Natalia A.

    2014-05-01

    A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

  15. Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

    Römling, Ute; Galperin, Michael Y.

    2015-01-01

    Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

  16. Detecting Airborne Mercury by Use of Palladium Chloride

    Ryan, Margaret; Shevade, Abhijit; Kisor, Adam; Homer, Margie; Jewell, April; Manatt, Kenneth; Torres, Julia; Soler, Jessica; Taylor, Charles

    2009-01-01

    Palladium chloride films have been found to be useful as alternatives to the gold films heretofore used to detect airborne elemental mercury at concentrations of the order of parts per billion (ppb). Somewhat more specifically, when suitably prepared palladium chloride films are exposed to parts-per-billion or larger concentrations of airborne mercury, their electrical resistances change by amounts large enough to be easily measurable. Because airborne mercury adversely affects health, it is desirable to be able to detect it with high sensitivity, especially in enclosed environments in which there is a risk of leakage of mercury from lamps or other equipment. The detection of mercury by use of gold films involves the formation of gold/mercury amalgam. Gold films offer adequate sensitivity for detection of airborne mercury and could easily be integrated into an electronic-nose system designed to operate in the temperature range of 23 to 28 C. Unfortunately, in order to regenerate a gold-film mercury sensor, one must heat it to a temperature of 200 C for several minutes in clean flowing air. In preparation for an experiment to demonstrate the present sensor concept, palladium chloride was deposited from an aqueous solution onto sets of gold electrodes and sintered in air to form a film. Then while using the gold electrodes to measure the electrical resistance of the films, the films were exposed, at a temperature of 25 C, to humidified air containing mercury at various concentrations from 0 to 35 ppb (see figure). The results of this and other experiments have been interpreted as signifying that sensors of this type can detect mercury in room-temperature air at concentrations of at least 2.5 ppb and can readily be regenerated at temperatures <40 C.

  17. The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis

    Kessler, Peter S.; Blank, Carrine; Leigh, John A.

    1998-01-01

    Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920

  18. Intentional intravenous mercury injection

    In this case report, intravenous complications, treatment strategies and possible ... Mercury toxicity is commonly associated with vapour inhalation or oral ingestion, for which there exist definite treatment options. Intravenous mercury ... personality, anxiousness, irritability, insomnia, depression and drowsi- ness.[1] However ...

  19. Mercury's shifting, rolling past

    Trulove, Susan

    2008-01-01

    Patterns of scalloped-edged cliffs or lobate scarps on Mercury's surface are thrust faults that are consistent with the planet shrinking and cooling with time. However, compression occurred in the planet's early history and Mariner 10 images revealed decades ago that lobate scarps are among the youngest features on Mercury. Why don't we find more evidence of older compressive features?

  20. Global Mercury Assessment 2013

    mercury pollution. This summary report and the accompanying. Technical Background Report for the Global. Mercury Assessment 2013 are developed in response to Decision 25/5, paragraph ... The use of different pollution control technologies in different ...... vegetation, snow, freshwater, and seawater. One of the largest ...

  1. MESSENGER: Exploring Mercury's Magnetosphere

    Slavin, James A.

    2008-01-01

    The MESSENGER mission to Mercury offers our first opportunity to explore this planet's miniature magnetosphere since Mariner 10's brief fly-bys in 1974-5. Mercury's magnetosphere is unique in many respects. The magnetosphere of Mercury is the smallest in the solar system with its magnetic field typically standing off the solar wind only - 1000 to 2000 km above the surface. For this reason there are no closed dri-fi paths for energetic particles and, hence, no radiation belts; the characteristic time scales for wave propagation and convective transport are short possibly coupling kinetic and fluid modes; magnetic reconnection at the dayside magnetopause may erode the subsolar magnetosphere allowing solar wind ions to directly impact the dayside regolith; inductive currents in Mercury's interior should act to modify the solar In addition, Mercury's magnetosphere is the only one with its defining magnetic flux tubes rooted in a planetary regolith as opposed to an atmosphere with a conductive ionosphere. This lack of an ionosphere is thought to be the underlying reason for the brevity of the very intense, but short lived, approx. 1-2 min, substorm-like energetic particle events observed by Mariner 10 in Mercury's magnetic tail. In this seminar, we review what we think we know about Mercury's magnetosphere and describe the MESSENGER science team's strategy for obtaining answers to the outstanding science questions surrounding the interaction of the solar wind with Mercury and its small, but dynamic magnetosphere.

  2. Mercury in Nordic ecosystems

    Munthe, John; Waengberg, Ingvar (IVL Swedish Environmental Research Inst., Stockholm (SE)); Rognerud, Sigurd; Fjeld, Eirik (Norwegian Inst. for Water Research (NIVA), Oslo (Norway)); Verta, Matti; Porvari, Petri (Finnish Environment Inst. (SYKE), Helsinki (Finland)); Meili, Markus (Inst. of Applied Environmental Research (ITM), Stockholm (Sweden))

    2007-12-15

    This report provides a first comprehensive compilation and assessment of available data on mercury in air, precipitation, sediments and fish in the Nordic countries. The main conclusion is that mercury levels in Nordic ecosystems continue to be affected by long-range atmospheric transport. The geographical patterns of mercury concentrations in both sediments and fish are also strongly affected by ecosystem characteristics and in some regions possibly by historical pollution. An evaluation of geographical variations in mercury concentrations in precipitation indicates that the influence from anthropogenic sources from Central European areas is still significant. The annual variability of deposition is large and dependant of precipitation amounts. An evaluation of data from stations around the North Sea has indicated a significant decrease in mercury concentrations in precipitation indicating a continuous decrease of emissions in Europe (Waengberg et al., 2007). For mercury in air (TGM), the geographical pattern is less pronounced indicating the influence of mercury emissions and distribution over a larger geographical area (i.e. hemispherical transport). Comparison of recent (surficial) and historical lake sediments show significantly elevated concentrations of mercury most likely caused by anthropogenic atmospheric deposition over the past century. The highest pollution impact was observed in the coastal areas of southern Norway, in south western Finland and in Sweden from the coastal areas in the southwest across the central parts to the north-east. The general increase in recent versus old sediments was 2-5 fold. Data on mercury in Nordic freshwater fish was assembled and evaluated with respect to geographical variations. The fish data were further compared with temporal and spatial trends in mercury deposition and mercury contamination of lake sediments in order to investigate the coupling between atmospheric transport and deposition of mercury and local mercury

  3. Olive-pomace harbors bacteria with the potential for hydrocarbon-biodegradation, nitrogen-fixation and mercury-resistance: promising material for waste-oil-bioremediation.

    Dashti, Narjes; Ali, Nedaa; Khanafer, Majida; Al-Awadhi, Husain; Sorkhoh, Naser; Radwan, Samir

    2015-05-15

    Olive-pomace, a waste by-product of olive oil industry, took up >40% of its weight crude oil. Meanwhile, this material harbored a rich and diverse hydrocarbonoclastic bacterial population in the magnitude of 10(6) to 10(7) cells g(-1). Using this material for bioaugmentation of batch cultures in crude oil-containing mineral medium, resulted in the consumption of 12.9, 21.5, 28.3, and 43% oil after 2, 4, 6 and 8 months, respectively. Similar oil-consumption values, namely 11.0, 29.3, 34.7 and 43.9%, respectively, were recorded when a NaNO3-free medium was used instead of the complete medium. Hydrocarbonoclastic bacteria involved in those bioremediation processes, as characterized by their 16S rRNA-gene sequences, belonged to the genera Agrococcus, Pseudomonas, Cellulosimicrobium, Streptococcus, Sinorhizobium, Olivibacter, Ochrobactrum, Rhizobium, Pleomorphomonas, Azoarcus, Starkeya and others. Many of the bacterial species belonging to those genera were diazotrophic; they proved to contain the nifH-genes in their genomes. Still other bacterial species could tolerate the heavy metal mercury. The dynamic changes of the proportions of various species during 8 months of incubation were recorded. The culture-independent, phylogenetic analysis of the bacterioflora gave lists different from those recorded by the culture-dependent method. Nevertheless, those lists comprised among others, several genera known for their hydrocarbonoclastic potential, e.g. Pseudomonas, Mycobacterium, Sphingobium, and Citrobacter. It was concluded that olive-pomace could be applied in oil-remediation, not only as a physical sorbent, but also for bioaugmentation purposes as a biological source of hydrocarbonoclastic bacteria. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Getting Mercury out of Schools.

    1999

    This guide was prepared while working with many Massachusetts schools to remove items that contain mercury and to find suitable alternatives. It contains fact sheets on: mercury in science laboratories and classrooms, mercury in school buildings and maintenance areas, mercury in the medical office and in medical technology classrooms in vocational…

  5. A rhizosphere-associated symbiont, Photobacterium spp. strain MELD1, and its targeted synergistic activity for phytoprotection against mercury.

    Dony Chacko Mathew

    Full Text Available Though heavy metal such as mercury is toxic to plants and microorganisms, the synergistic activity between them may offer benefit for surviving. In this study, a mercury-reducing bacterium, Photobacterium spp. strain MELD1, with an MIC of 33 mg x kg(-1 mercury was isolated from a severely mercury and dioxin contaminated rhizosphere soil of reed (Phragmites australis. While the whole genome sequencing of MELD1 confirmed the presence of a mer operon, the mercury reductase MerA gene showed 99% sequence identity to Vibrio shilloni AK1 and implicates its route resulted from the event of horizontal gene transfer. The efficiency of MELD1 to vaporize mercury (25 mg x kg(-1, 24 h and its tolerance to toxic metals and xenobiotics such as lead, cadmium, pentachlorophenol, pentachloroethylene, 3-chlorobenzoic acid, 2,3,7,8-tetrachlorodibenzo-p-dioxin and 1,2,3,7,8,9-hexachlorodibenzo-p-dioxin is promising. Combination of a long yard bean (Vigna unguiculata ssp. Sesquipedalis and strain MELD1 proved beneficial in the phytoprotection of mercury in vivo. The effect of mercury (Hg on growth, distribution and tolerance was examined in root, shoot, leaves and pod of yard long bean with and without the inoculation of strain MELD1. The model plant inoculated with MELD1 had significant increases in biomass, root length, seed number, and increased mercury uptake limited to roots. Biolog plate assay were used to assess the sole-carbon source utilization pattern of the isolate and Indole-3-acetic acid (IAA productivity was analyzed to examine if the strain could contribute to plant growth. The results of this study suggest that, as a rhizosphere-associated symbiont, the synergistic activity between the plant and MELD1 can improve the efficiency for phytoprotection, phytostabilization and phytoremediation of mercury.

  6. A rhizosphere-associated symbiont, Photobacterium spp. strain MELD1, and its targeted synergistic activity for phytoprotection against mercury.

    Mathew, Dony Chacko; Ho, Ying-Ning; Gicana, Ronnie Gicaraya; Mathew, Gincy Marina; Chien, Mei-Chieh; Huang, Chieh-Chen

    2015-01-01

    Though heavy metal such as mercury is toxic to plants and microorganisms, the synergistic activity between them may offer benefit for surviving. In this study, a mercury-reducing bacterium, Photobacterium spp. strain MELD1, with an MIC of 33 mg x kg(-1) mercury was isolated from a severely mercury and dioxin contaminated rhizosphere soil of reed (Phragmites australis). While the whole genome sequencing of MELD1 confirmed the presence of a mer operon, the mercury reductase MerA gene showed 99% sequence identity to Vibrio shilloni AK1 and implicates its route resulted from the event of horizontal gene transfer. The efficiency of MELD1 to vaporize mercury (25 mg x kg(-1), 24 h) and its tolerance to toxic metals and xenobiotics such as lead, cadmium, pentachlorophenol, pentachloroethylene, 3-chlorobenzoic acid, 2,3,7,8-tetrachlorodibenzo-p-dioxin and 1,2,3,7,8,9-hexachlorodibenzo-p-dioxin is promising. Combination of a long yard bean (Vigna unguiculata ssp. Sesquipedalis) and strain MELD1 proved beneficial in the phytoprotection of mercury in vivo. The effect of mercury (Hg) on growth, distribution and tolerance was examined in root, shoot, leaves and pod of yard long bean with and without the inoculation of strain MELD1. The model plant inoculated with MELD1 had significant increases in biomass, root length, seed number, and increased mercury uptake limited to roots. Biolog plate assay were used to assess the sole-carbon source utilization pattern of the isolate and Indole-3-acetic acid (IAA) productivity was analyzed to examine if the strain could contribute to plant growth. The results of this study suggest that, as a rhizosphere-associated symbiont, the synergistic activity between the plant and MELD1 can improve the efficiency for phytoprotection, phytostabilization and phytoremediation of mercury.

  7. A Rhizosphere-Associated Symbiont, Photobacterium spp. Strain MELD1, and Its Targeted Synergistic Activity for Phytoprotection against Mercury

    Mathew, Dony Chacko; Ho, Ying-Ning; Gicana, Ronnie Gicaraya; Mathew, Gincy Marina; Chien, Mei-Chieh; Huang, Chieh-Chen

    2015-01-01

    Though heavy metal such as mercury is toxic to plants and microorganisms, the synergistic activity between them may offer benefit for surviving. In this study, a mercury-reducing bacterium, Photobacterium spp. strain MELD1, with an MIC of 33 mg . kg-1 mercury was isolated from a severely mercury and dioxin contaminated rhizosphere soil of reed (Phragmites australis). While the whole genome sequencing of MELD1 confirmed the presence of a mer operon, the mercury reductase MerA gene showed 99% sequence identity to Vibrio shilloni AK1 and implicates its route resulted from the event of horizontal gene transfer. The efficiency of MELD1 to vaporize mercury (25 mg . kg-1, 24 h) and its tolerance to toxic metals and xenobiotics such as lead, cadmium, pentachlorophenol, pentachloroethylene, 3-chlorobenzoic acid, 2,3,7,8-tetrachlorodibenzo-p-dioxin and 1,2,3,7,8,9-hexachlorodibenzo-p-dioxin is promising. Combination of a long yard bean (Vigna unguiculata ssp. Sesquipedalis) and strain MELD1 proved beneficial in the phytoprotection of mercury in vivo. The effect of mercury (Hg) on growth, distribution and tolerance was examined in root, shoot, leaves and pod of yard long bean with and without the inoculation of strain MELD1. The model plant inoculated with MELD1 had significant increases in biomass, root length, seed number, and increased mercury uptake limited to roots. Biolog plate assay were used to assess the sole-carbon source utilization pattern of the isolate and Indole-3-acetic acid (IAA) productivity was analyzed to examine if the strain could contribute to plant growth. The results of this study suggest that, as a rhizosphere-associated symbiont, the synergistic activity between the plant and MELD1 can improve the efficiency for phytoprotection, phytostabilization and phytoremediation of mercury. PMID:25816328

  8. Cop-like operon: Structure and organization in species of the Lactobacillale order

    ANGÉLICA REYES

    2006-01-01

    Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

  9. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

    2011-10-01

    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  10. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

    Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

    2016-01-01

    Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  11. Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

    Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

    2014-10-01

    Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

  12. A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars.

    Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

    2017-05-05

    Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Mercury's Dynamic Magnetic Tail

    Slavin, James A.

    2010-01-01

    The Mariner 10 and MESSENGER flybys of Mercury have revealed a magnetosphere that is likely the most responsive to upstream interplanetary conditions of any in the solar system. The source of the great dynamic variability observed during these brief passages is due to Mercury's proximity to the Sun and the inverse proportionality between reconnection rate and solar wind Alfven Mach number. However, this planet's lack of an ionosphere and its small physical dimensions also contribute to Mercury's very brief Dungey cycle, approx. 2 min, which governs the time scale for internal plasma circulation. Current observations and understanding of the structure and dynamics of Mercury's magnetotail are summarized and discussed. Special emphasis will be placed upon such questions as: 1) How much access does the solar wind have to this small magnetosphere as a function of upstream conditions? 2) What roles do heavy planetary ions play? 3) Do Earth-like substorms take place at Mercury? 4) How does Mercury's tail respond to extreme solar wind events such coronal mass ejections? Prospects for progress due to advances in the global magnetohydrodynamic and hybrid simulation modeling and the measurements to be taken by MESSENGER after it enters Mercury orbit on March 18, 2011 will be discussed.

  14. Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

    Jan Ewald

    2015-04-01

    Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

  15. Total Mercury content of skin toning creams

    Administrator

    2008-04-01

    Apr 1, 2008 ... used it for cosmetics (Silberberg, 1995). Mercury- ... Cosmetic preparations containing mercury com- pounds are .... mercury determination by a modified version of an open .... level mercury exposure, which could lead to a.

  16. The potential for Probiotic Bacteria from milkfish intestine in reducing mercury metals in skimmed milk media

    Dwyana, Zaraswati; Priosambodo, D.; Haedar, N.; Erviani, A. E.; Djabura, A. K.; Sukma, R.

    2018-03-01

    Mercury (Hg) is one of the heavy metals that is harmful to humans. The accumulation of mercury in the body is generally derived from food. Several types of bacteria from intestine of milkfish are known to reduce mercury concentration. People can take advantage of this bacterial ability by eating it through probiotic foods. This research conducted to figure out the potential for probiotic bacteria from milkfish intestine in reducing mercury. Isolation from probiotic bacteria from milkfish intestine conducted with grown the isolates in MRSA medium with addition of 1% CaCO3. Twelve isolate were obtained from milkfish intestine. Mercury resistance tested was performed by measuring cell density using a spectrophotometer at concentrations of 10, 15 and 20 ppm respectively in skim milk media. Probiotic tests (gastric acid, bile salts and antimicrobial activity) for MRSB media was also conducted. Results showed that seven isolate were resistant to mercury in all concentrations and potential as probiotics. All resistant isolate then tested for skim milk media with addition of 5, 10, 20 ppm mercury acetate respectively. Result showed that only one isolated was able to reduce the concentration of mercury (Hg) in all variations on concentration and potential as mercury reducer probiotic bacteria.

  17. Recovery of mercury from mercury compounds via electrolytic methods

    Grossman, Mark W.; George, William A.

    1988-01-01

    A process for electrolytically recovering mercury from mercury compounds is provided. In one embodiment, Hg is recovered from Hg.sub.2 Cl.sub.2 employing as the electrolyte solution a mixture of HCl and H.sub.2 O. In another embodiment, Hg is electrolytically recovered from HgO wherein the electrolyte solution is comprised of glacial acetic acid and H.sub.2 O. Also provided is an apparatus for producing isotopically enriched mercury compounds in a reactor and then transporting the dissolved compounds into an electrolytic cell where mercury ions are electrolytically reduced and elemental mercury recovered from the mercury compounds.

  18. Metallic mercury recycling. Final report

    Beck, M.A.

    1994-07-01

    Metallic mercury is known to be a hazardous material and is regulated as such. The disposal of mercury, usually by landfill, is expensive and does not remove mercury from the environment. Results from the Metallic Mercury Recycling Project have demonstrated that metallic mercury is a good candidate for reclamation and recycling. Most of the potential contamination of mercury resides in the scum floating on the surface of the mercury. Pinhole filtration was demonstrated to be an inexpensive and easy way of removing residues from mercury. The analysis method is shown to be sufficient for present release practices, and should be sufficient for future release requirements. Data from tests are presented. The consistently higher level of activity of the filter residue versus the bulk mercury is discussed. Recommendations for the recycling procedure are made.

  19. Metallic mercury recycling. Final report

    Beck, M.A.

    1994-01-01

    Metallic mercury is known to be a hazardous material and is regulated as such. The disposal of mercury, usually by landfill, is expensive and does not remove mercury from the environment. Results from the Metallic Mercury Recycling Project have demonstrated that metallic mercury is a good candidate for reclamation and recycling. Most of the potential contamination of mercury resides in the scum floating on the surface of the mercury. Pinhole filtration was demonstrated to be an inexpensive and easy way of removing residues from mercury. The analysis method is shown to be sufficient for present release practices, and should be sufficient for future release requirements. Data from tests are presented. The consistently higher level of activity of the filter residue versus the bulk mercury is discussed. Recommendations for the recycling procedure are made

  20. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  1. The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

    Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

    2013-02-01

    Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

  2. GLYCOGEN IN BACILLUS-SUBTILIS - MOLECULAR CHARACTERIZATION OF AN OPERON ENCODING ENZYMES INVOLVED IN GLYCOGEN BIOSYNTHESIS AND DEGRADATION

    KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G

    Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

  3. The tectonics of Mercury

    Melosh, H.J.; Mckinnon, W.B.

    1988-01-01

    The probable tectonic history of Mercury and the relative sequence of events are discussed on the basis of data collected by the Mariner-10 spacecraft. Results indicate that Mercury's tectonic activity was confined to its early history; its endogenic activity was principally due to a small change in the shape of its lithosphere, caused by tidal despinning, and a small change in area caused by shrinkage due to cooling. Exogenic processes, in particular the impact activity, have produced more abundant tectonic features. Many features associated with the Caloris basin are due to loading of Mercury's thick lithosphere by extrusive lavas or subsidence due to magma withdrawal. It is emphasized that tectonic features observed on Mercury yield insight into the earliest tectonic events on planets like Mars and, perhaps, the earth, where subsequent events obscured or erased the most ancient tectonic records

  4. Intentional intravenous mercury injection

    Elemental mercury is the well-known silver liquid and usually causes pulmonary, neurological and ... suicidal ideation or features of major depression. Clinically the patient was .... medically at this stage and consider surgical intervention later.

  5. Mercury's Dynamic Magnetosphere

    Imber, S. M.

    2018-05-01

    The global dynamics of Mercury's magnetosphere will be discussed, focussing on observed asymmetries in the magnetotail and on the precipitation of particles of magnetospheric origin onto the nightside planetary surface.

  6. Mercury analysis in hair

    Esteban, Marta; Schindler, Birgit K; Jiménez-Guerrero, José A

    2015-01-01

    Human biomonitoring (HBM) is an effective tool for assessing actual exposure to chemicals that takes into account all routes of intake. Although hair analysis is considered to be an optimal biomarker for assessing mercury exposure, the lack of harmonization as regards sampling and analytical...... assurance program (QAP) for assessing mercury levels in hair samples from more than 1800 mother-child pairs recruited in 17 European countries. To ensure the comparability of the results, standard operating procedures (SOPs) for sampling and for mercury analysis were drafted and distributed to participating...... laboratories. Training sessions were organized for field workers and four external quality-assessment exercises (ICI/EQUAS), followed by the corresponding web conferences, were organized between March 2011 and February 2012. ICI/EQUAS used native hair samples at two mercury concentration ranges (0...

  7. Mercury's Early Geologic History

    Denevi, B. W.; Ernst, C. M.; Klima, R. L.; Robinson, M. S.

    2018-05-01

    A combination of geologic mapping, compositional information, and geochemical models are providing a better understanding of Mercury's early geologic history, and allow us to place it in the context of the Moon and the terrestrial planets.

  8. Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

    Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin

    2013-01-01

    The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

  9. Mercury CEM Calibration

    John F. Schabron; Joseph F. Rovani; Susan S. Sorini

    2007-03-31

    The Clean Air Mercury Rule (CAMR) which was published in the Federal Register on May 18, 2005, requires that calibration of mercury continuous emissions monitors (CEMs) be performed with NIST-traceable standards. Western Research Institute (WRI) is working closely with the Electric Power Research Institute (EPRI), the National Institute of Standards and Technology (NIST), and the Environmental Protection Agency (EPA) to facilitate the development of the experimental criteria for a NIST traceability protocol for dynamic elemental mercury vapor generators. The traceability protocol will be written by EPA. Traceability will be based on the actual analysis of the output of each calibration unit at several concentration levels ranging from about 2-40 ug/m{sup 3}, and this analysis will be directly traceable to analyses by NIST using isotope dilution inductively coupled plasma/mass spectrometry (ID ICP/MS) through a chain of analyses linking the calibration unit in the power plant to the NIST ID ICP/MS. Prior to this project, NIST did not provide a recommended mercury vapor pressure equation or list mercury vapor pressure in its vapor pressure database. The NIST Physical and Chemical Properties Division in Boulder, Colorado was subcontracted under this project to study the issue in detail and to recommend a mercury vapor pressure equation that the vendors of mercury vapor pressure calibration units can use to calculate the elemental mercury vapor concentration in an equilibrium chamber at a particular temperature. As part of this study, a preliminary evaluation of calibration units from five vendors was made. The work was performed by NIST in Gaithersburg, MD and Joe Rovani from WRI who traveled to NIST as a Visiting Scientist.

  10. Cutaneous mercury granuloma

    Kalpana A Bothale; Sadhana D Mahore; Sushil Pande; Trupti Dongre

    2013-01-01

    Cutaneous mercury granuloma is rarely encountered. Clinically it may pose difficulty in diagnosis. Here, we report a 23-year-old male presented with erythematous, nodular lesions over the forearm and anterior aspect of chest wall. Metallic mercury in tissue sections appear as dark black, opaque, spherical globules of varying size and number. They are surrounded by granulomatous foreign-body reaction. It is composed of foreign body giant cells and mixed inflammatory infiltrate composed of hist...

  11. Mercury in human hair

    Kapauan, P.A.; Cruz, C.C.; Verceluz, F.P.

    1980-10-01

    The analysis of mercury (Hg) in scalp hair obtained from individuals residing in five different localities in the Philippines - Metro Manila, Naga City in Bicol, Bataan, Oriental Mindoro, and Palawan is presented. An overall mean of 1.46 ug/g of hair was obtained for all samples excluding those from Palawan and represents a baseline value.'' In terms of the mercury levels found in hair, the Honda Bay area in Palawan is, relatively, a ''contaminated area.'' (author)

  12. Association between Blood Mercury Level and Visceral Adiposity in Adults

    Jong Suk Park

    2017-01-01

    Full Text Available BackgroundFew studies have examined the association between mercury exposure and obesity. The aim of this study is to investigate the association between blood mercury concentrations and indices of obesity in adults.MethodsA total of 200 healthy subjects, aged 30 to 64 years, who had no history of cardiovascular or malignant disease, were examined. Anthropometric and various biochemical profiles were measured. Visceral adipose tissue (VAT was measured using dual-energy X-ray absorptiometry (DXA.ResultsAll subjects were divided into three groups according to blood mercury concentrations. Compared with the subjects in the lowest tertile of mercury, those in the highest tertile were more likely to be male; were current alcohol drinkers and smokers; had a higher body mass index (BMI, waist circumference (WC, and VAT; had higher levels of blood pressure, fasting glucose, and insulin resistance; and consumed more fish. The blood mercury concentration was significantly associated with anthropometric parameters, showing relationships with BMI, WC, and VAT. After adjusting for multiple risk factors, the odds ratios (ORs for high mercury concentration was significantly higher in the highest VAT tertile than in the lowest VAT tertile (OR, 2.66; 95% confidence interval, 1.05 to 6.62; P<0.05.ConclusionThe blood mercury concentration was significantly associated with VAT in healthy adults. Further studies are warranted to confirm our findings.

  13. Cloning and identification of Group 1 mrp operon encoding a novel monovalent cation/proton antiporter system from the moderate halophile Halomonas zhaodongensis.

    Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan

    2014-11-01

    The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.

  14. Mercury pollution in Malaysia.

    Hajeb, Parvaneh; Jinap, S; Ismail, Ahmad; Mahyudin, Nor Ainy

    2012-01-01

    Although several studies have been published on levels of mercury contamination of the environment, and of food and human tissues in Peninsular Malaysia, there is a serious dearth of research that has been performed in East Malaysia (Sabah and Sarawak). Industry is rapidly developing in East Malaysia, and, hence, there is a need for establishing baseline levels of mercury contamination in environmental media in that part of the country by performing monitoring studies. Residues of total mercury and inorganic in food samples have been determined in nearly all previous studies that have been conducted; however, few researchers have analyzed samples for the presence of methlymercury residues. Because methylmercury is the most toxic form of mercury, and because there is a growing public awareness of the risk posed by methylmercury exposure that is associated with fish and seafood consumption, further monitoring studies on methylmercury in food are also essential. From the results of previous studies, it is obvious that the economic development in Malaysia, in recent years, has affected the aquatic environment of the country. Primary areas of environmental concern are centered on the rivers of the west Peninsular Malaysian coast, and the coastal waters of the Straits of Malacca, wherein industrial activities are rapidly expanding. The sources of existing mercury input to both of these areas of Malaysia should be studied and identified. Considering the high levels of mercury that now exists in human tissues, efforts should be continued, and accelerated in the future, if possible, to monitor mercury contamination levels in the coastal states, and particularly along the west Peninsular Malaysian coast. Most studies that have been carried out on mercury residues in environmental samples are dated, having been conducted 20-30 years ago; therefore, the need to collect much more and more current data is urgent. Furthermore, establishing baseline levels of mercury exposure to

  15. Characterization of the Leptospira interrogans S10-spc-alpha operon

    Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

    2000-01-01

    A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

  16. The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

    Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.

    2006-01-01

    The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

  17. clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

    Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

    2015-03-01

    The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  18. Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

    Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav

    2007-01-01

    Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

  19. Decreases in average bacterial community rRNA operon copy number during succession.

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  20. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  1. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  2. Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

    Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

    2005-01-01

    Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

  3. Mercury Quick Facts: Health Effects of Mercury Exposure

    ... 2012 What are the Health Effects of Mercury Exposure? The health effects that can be caused by breathing mercury depend ... they breathe faster and have smaller lungs. Health effects caused by long-term exposure to mercury vapors • • Anxiety • • Excessive shyness • • Anorexia • • Sleeping ...

  4. Mercury pOIsonIng

    A case of mercury poisoning is reported and clinical observations of 6 .... fish ingested and occupational exposure. .... exposed to mercury as a result of inadequate industrial safety standards, and ... WHO Tech Rep Ser 1980; No. 674: 102-115.

  5. Mercury Study Report to Congress

    EPA's Report to Congress on Mercury provides an assessment of the magnitude of U.S. mercury emissions by source, the health and environmental implications of those emissions, and the availability and cost of control technologies.

  6. True Polar Wander of Mercury

    Keane, J. T.; Matsuyama, I.

    2018-05-01

    We use new MESSENGER gravity data to investigate how impact basins and volcanic provinces alter Mercury's moments of inertia. We find that Mercury has reoriented tens of degrees over its history, affecting tectonics, volatiles, and more.

  7. Mercury Emissions: The Global Context

    Mercury emissions are a global problem that knows no national or continental boundaries. Mercury that is emitted to the air can travel thousands of miles in the atmosphere before it is eventually deposited back to the earth.

  8. Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

    Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

    2016-09-01

    The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

  9. Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

    Sun Yuan

    2006-02-01

    Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

  10. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  11. Mercury's magnetic field and interior

    Connerney, J.E.P.; Ness, N.F.

    1988-01-01

    The magnetic-field data collected on Mercury by the Mariner-10 spacecraft present substantial evidence for an intrinsic global magnetic field. However, studies of Mercury's thermal evolution show that it is most likely that the inner core region of Mercury solidified or froze early in the planet's history. Thus, the explanation of Mercury's magnetic field in the framework of the traditional planetary dynamo is less than certain

  12. MERCURY IN MARINE LIFE DATABASE

    The purpose of the Mercury in Marine Life Project is to organize information on estuarine and marine species so that EPA can better understand both the extent of monitoring for mercury and level of mercury contamination in the biota of coastal environments. This report follows a ...

  13. Reference Atmosphere for Mercury

    Killen, Rosemary M.

    2002-01-01

    We propose that Ar-40 measured in the lunar atmosphere and that in Mercury's atmosphere is due to current diffusion into connected pore space within the crust. Higher temperatures at Mercury, along with more rapid loss from the atmosphere will lead to a smaller column abundance of argon at Mercury than at the Moon, given the same crustal abundance of potassium. Because the noble gas abundance in the Hermean atmosphere represents current effusion, it is a direct measure of the crustal potassium abundance. Ar-40 in the atmospheres of the planets is a measure of potassium abundance in the interiors, since Ar-40 is a product of radiogenic decay of K-40 by electron capture with the subsequent emission of a 1.46 eV gamma-ray. Although the Ar-40 in the Earth's atmosphere is expected to have accumulated since the late bombardment, Ar-40 in the atmospheres of Mercury and the Moon is eroded quickly by photoionization and electron impact ionization. Thus, the argon content in the exospheres of the Moon and Mercury is representative of current effusion rather than accumulation over the lifetime of the planet.

  14. High Levels of Bioplastic Are Produced in Fertile Transplastomic Tobacco Plants Engineered with a Synthetic Operon for the Production of Polyhydroxybutyrate1[C][OA

    Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P.; Snell, Kristi D.

    2011-01-01

    An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5′ end by the host plant’s psbA coding sequence and at the 3′ end by the host plant’s 3′ psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated. PMID:21325565

  15. High levels of bioplastic are produced in fertile transplastomic tobacco plants engineered with a synthetic operon for the production of polyhydroxybutyrate.

    Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P; Snell, Kristi D

    2011-04-01

    An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5' end by the host plant's psbA coding sequence and at the 3' end by the host plant's 3' psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated.

  16. Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

    Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

    2012-10-01

    To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

  17. Identification of VanN-type vancomycin resistance in an Enterococcus faecium isolate from chicken meat in Japan.

    Nomura, Takahiro; Tanimoto, Koichi; Shibayama, Keigo; Arakawa, Yoshichika; Fujimoto, Shuhei; Ike, Yasuyoshi; Tomita, Haruyoshi

    2012-12-01

    Five VanN-type vancomycin-resistant Enterococcus faecium strains were isolated from a sample of domestic chicken meat in Japan. All isolates showed low-level resistance to vancomycin (MIC, 12 mg/liter) and had the same pulsed-field gel electrophoresis profile. The vancomycin resistance was encoded on a large plasmid (160 kbp) and was expressed constitutively. The VanN-type resistance operon was identical to the first resistance operon to be reported, with the exception of a 1-bp deletion in vanT(N) and a 1-bp substitution in vanS(N).

  18. Mechanism of mercuric chloride resistance in microorganisms. II. NADPH-dependent reduction of mercuric chloride and vaporization of mercury from mercuric chloride by a multiple drug resistant strain of Escherichia coli

    Komura, I; Funaba, T; Izaki, K

    1971-01-01

    The activity to vaporize a /sup 203/Hg compound from /sup 203/HgCl/sub 2/ was demonstrated in crude cell-free extracts of a strain of Escherichia coli W2252, which had acquired the multiple drug resistance. NADPH was essential for the vaporization, while NADH had only a slight stimulating effect and NADP/sup +/ had no effect. The oxidation of NADPH dependent on HgCl/sub 2/ was also demonstrated in the crude extracts, but the HgCl/sub 2/-dependent NADH oxidation could be demonstrated only when a partially purified enzyme preparation was used. The rate of NADH oxidation was much slower than that of NADPH oxidation. It was concluded that NADPH, and to a lesser extent NADH, act as electron donors for the enzymatic reduction of HgCl/sub 2/ and the vaporization occurs after this reduction. This reduction and subsequent vaporization seem to provide a mechanism of resistance to HgCl/sub 2/ in E. coli strains having the multiple drug resistance. 15 references, 4 figures, 4 tables.

  19. Water displacement mercury pump

    Nielsen, M.G.

    1984-04-20

    A water displacement mercury pump has a fluid inlet conduit and diffuser, a valve, a pressure cannister, and a fluid outlet conduit. The valve has a valve head which seats in an opening in the cannister. The entire assembly is readily insertable into a process vessel which produces mercury as a product. As the mercury settles, it flows into the opening in the cannister displacing lighter material. When the valve is in a closed position, the pressure cannister is sealed except for the fluid inlet conduit and the fluid outlet conduit. Introduction of a lighter fluid into the cannister will act to displace a heavier fluid from the cannister via the fluid outlet conduit. The entire pump assembly penetrates only a top wall of the process vessel, and not the sides or the bottom wall of the process vessel. This insures a leak-proof environment and is especially suitable for processing of hazardous materials.

  20. UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

    Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

    1994-01-01

    UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

  1. Mercury exposure in Ireland

    Cullen, Elizabeth; Evans, David S; Davidson, Fred

    2014-01-01

    of a study to Coordinate and Perform Human Biomonitoring on a European Scale (DEMOCOPHES) pilot biomonitoring study. METHODS: Hair mercury concentrations were determined from a convenience sample of 120 mother/child pairs. Mothers also completed a questionnaire. Rigorous quality assurance within DEMOCOPHES...... guaranteed the accuracy and international comparability of results. RESULTS: Mercury was detected in 79.2% of the samples from mothers, and 62.5% of children's samples. Arithmetic mean levels in mothers (0.262 µg/g hair) and children (0.149 µg /g hair) did not exceed the US EPA guidance value. Levels were...

  2. Mercury CEM Calibration

    John Schabron; Joseph Rovani; Mark Sanderson

    2008-02-29

    Mercury continuous emissions monitoring systems (CEMS) are being implemented in over 800 coal-fired power plant stacks. The power industry desires to conduct at least a full year of monitoring before the formal monitoring and reporting requirement begins on January 1, 2009. It is important for the industry to have available reliable, turnkey equipment from CEM vendors. Western Research Institute (WRI) is working closely with the Electric Power Research Institute (EPRI), the National Institute of Standards and Technology (NIST), and the Environmental Protection Agency (EPA) to facilitate the development of the experimental criteria for a NIST traceability protocol for dynamic elemental mercury vapor generators. The generators are used to calibrate mercury CEMs at power plant sites. The Clean Air Mercury Rule (CAMR) which was published in the Federal Register on May 18, 2005 requires that calibration be performed with NIST-traceable standards (Federal Register 2007). Traceability procedures will be defined by EPA. An initial draft traceability protocol was issued by EPA in May 2007 for comment. In August 2007, EPA issued an interim traceability protocol for elemental mercury generators (EPA 2007). The protocol is based on the actual analysis of the output of each calibration unit at several concentration levels ranging initially from about 2-40 {micro}g/m{sup 3} elemental mercury, and in the future down to 0.2 {micro}g/m{sup 3}, and this analysis will be directly traceable to analyses by NIST. The document is divided into two separate sections. The first deals with the qualification of generators by the vendors for use in mercury CEM calibration. The second describes the procedure that the vendors must use to certify the generator models that meet the qualification specifications. The NIST traceable certification is performance based, traceable to analysis using isotope dilution inductively coupled plasma/mass spectrometry performed by NIST in Gaithersburg, MD. The

  3. Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

    Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

    2017-10-01

    One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

  4. Method and apparatus for sampling atmospheric mercury

    Trujillo, Patricio E.; Campbell, Evan E.; Eutsler, Bernard C.

    1976-01-20

    A method of simultaneously sampling particulate mercury, organic mercurial vapors, and metallic mercury vapor in the working and occupational environment and determining the amount of mercury derived from each such source in the sampled air. A known volume of air is passed through a sampling tube containing a filter for particulate mercury collection, a first adsorber for the selective adsorption of organic mercurial vapors, and a second adsorber for the adsorption of metallic mercury vapor. Carbon black molecular sieves are particularly useful as the selective adsorber for organic mercurial vapors. The amount of mercury adsorbed or collected in each section of the sampling tube is readily quantitatively determined by flameless atomic absorption spectrophotometry.

  5. Metallothionein expression in chloroplasts enhances mercury accumulation and phytoremediation capability.

    Ruiz, Oscar N; Alvarez, Derry; Torres, Cesar; Roman, Laura; Daniell, Henry

    2011-06-01

    Genetic engineering to enhance mercury phytoremediation has been accomplished by expression of the merAB genes that protects the cell by converting Hg[II] into Hg[0] which volatilizes from the cell. A drawback of this approach is that toxic Hg is released back into the environment. A better phytoremediation strategy would be to accumulate mercury inside plants for subsequent retrieval. We report here the development of a transplastomic approach to express the mouse metallothionein gene (mt1) and accumulate mercury in high concentrations within plant cells. Real-time PCR analysis showed that up to 1284 copies of the mt1 gene were found per cell when compared with 1326 copies of the 16S rrn gene, thereby attaining homoplasmy. Past studies in chloroplast transformation used qualitative Southern blots to evaluate indirectly transgene copy number, whereas we used real-time PCR for the first time to establish homoplasmy and estimate transgene copy number and transcript levels. The mt1 transcript levels were very high with 183,000 copies per ng of RNA or 41% the abundance of the 16S rrn transcripts. The transplastomic lines were resistant up to 20 μm mercury and maintained high chlorophyll content and biomass. Although the transgenic plants accumulated high concentrations of mercury in all tissues, leaves accumulated up to 106 ng, indicating active phytoremediation and translocation of mercury. Such accumulation of mercury in plant tissues facilitates proper disposal or recycling. This study reports, for the first time, the use of metallothioneins in plants for mercury phytoremediation. Chloroplast genetic engineering approach is useful to express metal-scavenging proteins for phytoremediation. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  6. Mercury Information Clearinghouse

    Chad A. Wocken; Michael J. Holmes; Dennis L. Laudal; Debra F. Pflughoeft-Hassett; Greg F. Weber; Nicholas V. C. Ralston; Stanley J. Miller; Grant E. Dunham; Edwin S. Olson; Laura J. Raymond; John H. Pavlish; Everett A. Sondreal; Steven A. Benson

    2006-03-31

    The Canadian Electricity Association (CEA) identified a need and contracted the Energy & Environmental Research Center (EERC) to create and maintain an information clearinghouse on global research and development activities related to mercury emissions from coal-fired electric utilities. With the support of CEA, the Center for Air Toxic Metals{reg_sign} (CATM{reg_sign}) Affiliates, and the U.S. Department of Energy (DOE), the EERC developed comprehensive quarterly information updates that provide a detailed assessment of developments in the various areas of mercury monitoring, control, policy, and research. A total of eight topical reports were completed and are summarized and updated in this final CEA quarterly report. The original quarterly reports can be viewed at the CEA Web site (www.ceamercuryprogram.ca). In addition to a comprehensive update of previous mercury-related topics, a review of results from the CEA Mercury Program is provided. Members of Canada's coal-fired electricity generation sector (ATCO Power, EPCOR, Manitoba Hydro, New Brunswick Power, Nova Scotia Power Inc., Ontario Power Generation, SaskPower, and TransAlta) and CEA, have compiled an extensive database of information from stack-, coal-, and ash-sampling activities. Data from this effort are also available at the CEA Web site and have provided critical information for establishing and reviewing a mercury standard for Canada that is protective of environment and public health and is cost-effective. Specific goals outlined for the CEA mercury program included the following: (1) Improve emission inventories and develop management options through an intensive 2-year coal-, ash-, and stack-sampling program; (2) Promote effective stack testing through the development of guidance material and the support of on-site training on the Ontario Hydro method for employees, government representatives, and contractors on an as-needed basis; (3) Strengthen laboratory analytical capabilities through

  7. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

    2015-03-17

    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  8. Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

    2007-01-01

    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

  9. Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression

    Ziqing eDeng

    2013-07-01

    Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

  10. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

    Burbank, Lindsey P.; Van Horn, Christopher R.

    2017-01-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...

  11. Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade

    Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav

    2015-01-01

    Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015

  12. Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

    Chowdhury, Nilkanta; Bagchi, Angshuman

    2017-07-01

    Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

  13. Mercury Phase II Study - Mercury Behavior in Salt Processing Flowsheet

    Jain, V.; Shah, H.; Wilmarth, W. R.

    2016-01-01

    Mercury (Hg) in the Savannah River Site Liquid Waste System (LWS) originated from decades of canyon processing where it was used as a catalyst for dissolving the aluminum cladding of reactor fuel. Approximately 60 metric tons of mercury is currently present throughout the LWS. Mercury has long been a consideration in the LWS, from both hazard and processing perspectives. In February 2015, a Mercury Program Team was established at the request of the Department of Energy to develop a comprehensive action plan for long-term management and removal of mercury. Evaluation was focused in two Phases. Phase I activities assessed the Liquid Waste inventory and chemical processing behavior using a system-by-system review methodology, and determined the speciation of the different mercury forms (Hg+, Hg++, elemental Hg, organomercury, and soluble versus insoluble mercury) within the LWS. Phase II activities are building on the Phase I activities, and results of the LWS flowsheet evaluations will be summarized in three reports: Mercury Behavior in the Salt Processing Flowsheet (i.e. this report); Mercury Behavior in the Defense Waste Processing Facility (DWPF) Flowsheet; and Mercury behavior in the Tank Farm Flowsheet (Evaporator Operations). The evaluation of the mercury behavior in the salt processing flowsheet indicates, inter alia, the following: (1) In the assembled Salt Batches 7, 8 and 9 in Tank 21, the total mercury is mostly soluble with methylmercury (MHg) contributing over 50% of the total mercury. Based on the analyses of samples from 2H Evaporator feed and drop tanks (Tanks 38/43), the source of MHg in Salt Batches 7, 8 and 9 can be attributed to the 2H evaporator concentrate used in assembling the salt batches. The 2H Evaporator is used to evaporate DWPF recycle water. (2) Comparison of data between Tank 21/49, Salt Solution Feed Tank (SSFT), Decontaminated Salt Solution Hold Tank (DSSHT), and Tank 50 samples suggests that the total mercury as well as speciated

  14. A mercury transport and fate model (LM2-mercury) for mass budget assessment of mercury cycling in Lake Michigan

    LM2-Mercury, a mercury mass balance model, was developed to simulate and evaluate the transport, fate, and biogeochemical transformations of mercury in Lake Michigan. The model simulates total suspended solids (TSS), disolved organic carbon (DOC), and total, elemental, divalent, ...

  15. Resistance to the Peptidyl Transferase Inhibitor Tiamulin Caused by Mutation of Ribosomal Protein L3

    Bøsling, Jacob; Poulsen, Susan M.; Vester, Birte; Long, Katherine S.

    2003-01-01

    The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ri...

  16. Some like it cold: microbial transformations of mercury in polar regions

    Niels Kroer

    2011-12-01

    Full Text Available The contamination of polar regions with mercury that is transported from lower latitudes as inorganic mercury has resulted in the accumulation of methylmercury (MeHg in food chains, risking the health of humans and wildlife. While production of MeHg has been documented in polar marine and terrestrial environments, little is known about the responsible transformations and transport pathways and the processes that control them. We posit that as in temperate environments, microbial transformations play a key role in mercury geochemical cycling in polar regions by: (1 methylating mercury by one of four proposed pathways, some not previously described; (2 degrading MeHg by activities of mercury resistant and other bacteria; and (3 carrying out redox transformations that control the supply of the mercuric ion, the substrate of methylation reactions. Recent analyses have identified a high potential for mercury-resistant microbes that express the enzyme mercuric reductase to affect the production of gaseous elemental mercury when and where daylight is limited. The integration of microbially mediated processes in the paradigms that describe mercury geochemical cycling is therefore of high priority especially in light of concerns regarding the effect of global warming and permafrost thawing on input of MeHg to polar regions.

  17. Mercury Exposure and Heart Diseases

    Genchi, Giuseppe; Sinicropi, Maria Stefania; Carocci, Alessia; Lauria, Graziantonio; Catalano, Alessia

    2017-01-01

    Environmental contamination has exposed humans to various metal agents, including mercury. It has been determined that mercury is not only harmful to the health of vulnerable populations such as pregnant women and children, but is also toxic to ordinary adults in various ways. For many years, mercury was used in a wide variety of human activities. Nowadays, the exposure to this metal from both natural and artificial sources is significantly increasing. Recent studies suggest that chronic exposure, even to low concentration levels of mercury, can cause cardiovascular, reproductive, and developmental toxicity, neurotoxicity, nephrotoxicity, immunotoxicity, and carcinogenicity. Possible biological effects of mercury, including the relationship between mercury toxicity and diseases of the cardiovascular system, such as hypertension, coronary heart disease, and myocardial infarction, are being studied. As heart rhythm and function are under autonomic nervous system control, it has been hypothesized that the neurotoxic effects of mercury might also impact cardiac autonomic function. Mercury exposure could have a long-lasting effect on cardiac parasympathetic activity and some evidence has shown that mercury exposure might affect heart rate variability, particularly early exposures in children. The mechanism by which mercury produces toxic effects on the cardiovascular system is not fully elucidated, but this mechanism is believed to involve an increase in oxidative stress. The exposure to mercury increases the production of free radicals, potentially because of the role of mercury in the Fenton reaction and a reduction in the activity of antioxidant enzymes, such as glutathione peroxidase. In this review we report an overview on the toxicity of mercury and focus our attention on the toxic effects on the cardiovascular system. PMID:28085104

  18. Mercury Exposure and Heart Diseases.

    Genchi, Giuseppe; Sinicropi, Maria Stefania; Carocci, Alessia; Lauria, Graziantonio; Catalano, Alessia

    2017-01-12

    Environmental contamination has exposed humans to various metal agents, including mercury. It has been determined that mercury is not only harmful to the health of vulnerable populations such as pregnant women and children, but is also toxic to ordinary adults in various ways. For many years, mercury was used in a wide variety of human activities. Nowadays, the exposure to this metal from both natural and artificial sources is significantly increasing. Recent studies suggest that chronic exposure, even to low concentration levels of mercury, can cause cardiovascular, reproductive, and developmental toxicity, neurotoxicity, nephrotoxicity, immunotoxicity, and carcinogenicity. Possible biological effects of mercury, including the relationship between mercury toxicity and diseases of the cardiovascular system, such as hypertension, coronary heart disease, and myocardial infarction, are being studied. As heart rhythm and function are under autonomic nervous system control, it has been hypothesized that the neurotoxic effects of mercury might also impact cardiac autonomic function. Mercury exposure could have a long-lasting effect on cardiac parasympathetic activity and some evidence has shown that mercury exposure might affect heart rate variability, particularly early exposures in children. The mechanism by which mercury produces toxic effects on the cardiovascular system is not fully elucidated, but this mechanism is believed to involve an increase in oxidative stress. The exposure to mercury increases the production of free radicals, potentially because of the role of mercury in the Fenton reaction and a reduction in the activity of antioxidant enzymes, such as glutathione peroxidase. In this review we report an overview on the toxicity of mercury and focus our attention on the toxic effects on the cardiovascular system.

  19. Mercury Exposure and Heart Diseases

    Giuseppe Genchi

    2017-01-01

    Full Text Available Environmental contamination has exposed humans to various metal agents, including mercury. It has been determined that mercury is not only harmful to the health of vulnerable populations such as pregnant women and children, but is also toxic to ordinary adults in various ways. For many years, mercury was used in a wide variety of human activities. Nowadays, the exposure to this metal from both natural and artificial sources is significantly increasing. Recent studies suggest that chronic exposure, even to low concentration levels of mercury, can cause cardiovascular, reproductive, and developmental toxicity, neurotoxicity, nephrotoxicity, immunotoxicity, and carcinogenicity. Possible biological effects of mercury, including the relationship between mercury toxicity and diseases of the cardiovascular system, such as hypertension, coronary heart disease, and myocardial infarction, are being studied. As heart rhythm and function are under autonomic nervous system control, it has been hypothesized that the neurotoxic effects of mercury might also impact cardiac autonomic function. Mercury exposure could have a long-lasting effect on cardiac parasympathetic activity and some evidence has shown that mercury exposure might affect heart rate variability, particularly early exposures in children. The mechanism by which mercury produces toxic effects on the cardiovascular system is not fully elucidated, but this mechanism is believed to involve an increase in oxidative stress. The exposure to mercury increases the production of free radicals, potentially because of the role of mercury in the Fenton reaction and a reduction in the activity of antioxidant enzymes, such as glutathione peroxidase. In this review we report an overview on the toxicity of mercury and focus our attention on the toxic effects on the cardiovascular system.

  20. Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

    Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.

    1988-01-01

    The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

  1. OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

    Arkin Adam P

    2006-01-01

    Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

  2. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  3. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Kathleen Jwanoswki

    Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  4. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  5. Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

    Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

    2014-01-01

    Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

  6. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

    2017-01-01

    Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  7. Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

    Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

    2015-11-01

    Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

    Dixit, R; Trivedi, P K; Nath, P; Sane, P V

    1999-09-01

    Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

  9. Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

    Cortes, Teresa; Cox, Robert Ashley

    2015-04-01

    Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

  10. Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

    Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

    2013-10-01

    The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  11. MERCURY USAGE AND ALTERNATIVES IN THE ELECTRICAL AND ELECTRONICS INDUSTRIES

    Many industries have already found alternatives for mercury or have greatly decreased mercury use. However, the unique electromechanical and photoelectric properties of mercury and mercury compounds have made replacement of mercury difficult in some applications. This study was i...

  12. Mercury's exosphere: observations during MESSENGER's First Mercury flyby.

    McClintock, William E; Bradley, E Todd; Vervack, Ronald J; Killen, Rosemary M; Sprague, Ann L; Izenberg, Noam R; Solomon, Sean C

    2008-07-04

    During MESSENGER's first Mercury flyby, the Mercury Atmospheric and Surface Composition Spectrometer measured Mercury's exospheric emissions, including those from the antisunward sodium tail, calcium and sodium close to the planet, and hydrogen at high altitudes on the dayside. Spatial variations indicate that multiple source and loss processes generate and maintain the exosphere. Energetic processes connected to the solar wind and magnetospheric interaction with the planet likely played an important role in determining the distributions of exospheric species during the flyby.

  13. Effects of methyl mercury exposure on pancreatic beta cell development and function.

    Schumacher, Lauren; Abbott, Louise C

    2017-01-01

    Methyl mercury is an environmental contaminant of worldwide concern. Since the discovery of methyl mercury exposure due to eating contaminated fish as the underlying cause of the Minamata disaster, the scientific community has known about the sensitivity of the developing central nervous system to mercury toxicity. Warnings are given to pregnant women and young children to limit consumption of foods containing methyl mercury to protect the embryonic, fetal and postnatally developing central nervous system. However, evidence also suggests that exposure to methyl mercury or various forms of inorganic mercury may also affect development and function of other organs. Numerous reports indicate a worldwide increase in diabetes, particularly type 2 diabetes. Quite recently, methyl mercury has been shown to have adverse effects on pancreatic beta (β) cell development and function, resulting in insulin resistance and hyperglycemia and may even lead to the development of diabetes. This review discusses possible mechanisms by which methyl mercury exposure may adversely affect pancreatic β cell development and function, and the role that methyl mercury exposure may have in the reported worldwide increase in diabetes, particularly type 2 diabetes. While additional information is needed regarding associations between mercury exposure and specific mechanisms of the pathogenesis of diabetes in the human population, methyl mercury's adverse effects on the body's natural sources of antioxidants suggest that one possible therapeutic strategy could involve supplementation with antioxidants. Thus, it is important that additional investigation be undertaken into the role of methyl mercury exposure and reduced pancreatic β cell function. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  14. Recovery of mercury from acid waste residues

    Greenhalgh, Wilbur O.

    1989-12-05

    Mercury can be recovered from nitric acid-containing fluids by reacting the fluid with aluminum metal to produce mercury metal, and then quenching the reactivity of the nitric acid prior to nitration of the mercury metal.

  15. Health Effects of Exposures to Mercury

    ... IRIS database Top of Page Elemental (Metallic) Mercury Effects Exposures to metallic mercury most often occur when metallic ... poor performance on tests of mental function Higher exposures may also cause kidney effects, respiratory failure and death. Note that metallic mercury ...

  16. Mercury Poisoning Linked to Skin Products

    ... Products For Consumers Home For Consumers Consumer Updates Mercury Poisoning Linked to Skin Products Share Tweet Linkedin ... and, in some situations, criminal prosecution. Dangers of Mercury Exposure to mercury can have serious health consequences. ...

  17. Mercury content in Hot Springs

    Nakagawa, R

    1974-01-01

    A method of determination of mercury in hot spring waters by flameless atomic absorption spectrophotometry is described. Further, the mercury content and the chemical behavior of the elementary mercury in hot springs are described. Sulfide and iodide ions interfered with the determination of mercury by the reduction-vapor phase technique. These interferences could, however, be minimized by the addition of potassium permanganate. Waters collected from 55 hot springs were found to contain up to 26.0 ppb mercury. High concentrations of mercury have been found in waters from Shimoburo Springs, Aomori (10.0 ppb), Osorezan Springs, Aomori (1.3 approximately 18.8 ppb), Gosyogake Springs, Akita (26.0 ppb), Manza Springs, Gunma (0.30 approximately 19.5 ppb) and Kusatu Springs, Gunma (1.70 approximately 4.50 ppb). These hot springs were acid waters containing a relatively high quantity of chloride or sulfate.

  18. Non-carbon sorbents for mercury removal from flue gases

    Alptekin, G.O.; Dubovik, M.; Cesario, M. [TDA Research Inc., Wheat Ridge, CO (United States)

    2005-07-01

    TDA Research Inc. is developing a new sorbent that can effectively remove mercury from flue gases. It is made of non-carbon based materials and will therefore not alter the properties of the fly ash. The sorbent can be produced as an injectable powder. The paper summarises the initial testing results of the new sorbent. The sorbent exhibited 7.5 to 11.0 mg/g mercury absorption capacity under representative flue gas streams depending on the operating temperature and gas hourly space velocity. The sorbent also showed resistance to sulfur poisoning by sulfur dioxide. 6 refs., 3 figs., 1 tab.

  19. Interior Volatile Reservoirs in Mercury

    Anzures, B. A.; Parman, S. W.; Milliken, R. E.; Head, J. W.

    2018-05-01

    More measurements of 1) surface volatiles, and 2) pyroclastic deposits paired with experimental volatile analyses in silicate minerals can constrain conditions of melting and subsequent eruption on Mercury.

  20. Mercury in Canadian crude oil

    Hollebone, B.P.

    2005-01-01

    Estimates for average mercury concentrations in crude oil range widely from 10 ng/g of oil to 3,500 ng/g of oil. With such a broad range of estimates, it is difficult to determine the contributions of the petroleum sector to the total budget of mercury emissions. In response to concerns that the combustion of petroleum products may be a major source of air-borne mercury pollution, Environment Canada and the Canadian Petroleum Products Institute has undertaken a survey of the average total mercury concentration in crude oil processed in Canadian refineries. In order to calculate the potential upper limit of total mercury in all refined products, samples of more than 30 different types of crude oil collected from refineries were measured for their concentration of mercury as it enters into a refinery before processing. High temperature combustion, cold vapour atomic absorption and cold vapour atomic fluorescence were the techniques used to quantify mercury in the samples. The results of the study provide information on the total mass of mercury present in crude oil processed in Canada each year. Results can be used to determine the impact of vehicle exhaust emissions to the overall Canadian mercury emission budget. 17 refs., 2 tabs., 2 figs

  1. Mercury in bryophytes (moss)

    Yeaple, D S

    1972-01-28

    Recent reports in the literature, concerning the ability of certain mosses and lichens to concentrate heavy metals, have led to an investigation of the potential application of mosses as indicators of the transport of mercury through the atmosphere. A number of moss samples were collected to provide information regarding the level of mercury in moss around several types of populated areas. The results reported are from moss collected within an 80 mile radius of Boston, Massachusetts, along the Maine coast, near the tops of Mount Katahdin in Maine and Mount Washington in New Hampshire, and from Walden, New York, a small town located about 60 miles north of New York City. The data are admittedly limited, but provide sufficient insight into the usefulness of moss as an indicator to warrant the pursuit of a more detailed investigation. 6 references, 1 table.

  2. Integrated criteria document mercury

    Sloof, W.; Beelan, P. van; Annema, J.A.; Janus, J.A.

    1995-01-01

    The document contains a systematic review and a critical evaluation of the most relevant data on the priority substance mercury for the purpose of effect-oriented environmental policy. Chapter headings are: properties and existing standards; production, application, sources and emissions (natural sources, industry, energy, households, agriculture, dental use, waste); distribution and transformation (cinnabar; Hg 2+ , Hg 2 2+ , elemental mercury, methylmercury, behavior in soil, water, air, biota); concentrations and fluxes in the environment and exposure levels (sampling and measuring methods, occurrence in soil, water, air etc.); effects (toxicity to humans and aquatic and terrestrial systems); emissions reduction (from industrial sources, energy, waste processing etc.); and evaluation (risks, standards, emission reduction objectives, measuring strategies). 395 refs

  3. Method for mercury refinement

    Grossman, M.W.; Speer, R.; George, W.A.

    1991-04-09

    The effluent from mercury collected during the photochemical separation of the [sup 196]Hg isotope is often contaminated with particulate mercurous chloride, Hg[sub 2]Cl[sub 2]. The use of mechanical filtering via thin glass tubes, ultrasonic rinsing with acetone (dimethyl ketone) and a specially designed cold trap have been found effective in removing the particulate (i.e., solid) Hg[sub 2]Cl[sub 2] contaminant. The present invention is particularly directed to such filtering. 5 figures.

  4. Apparatus for mercury refinement

    Grossman, M.W.; Speer, R.; George, W.A.

    1991-07-16

    The effluent from mercury collected during the photochemical separation of the [sup 196]Hg isotope is often contaminated with particulate mercurous chloride, Hg[sub 2]Cl[sub 2]. The use of mechanical filtering via thin glass tubes, ultrasonic rinsing with acetone (dimethyl ketone) and a specially designed cold trap have been found effective in removing the particulate (i.e., solid) Hg[sub 2]Cl[sub 2] contaminant. The present invention is particularly directed to such filtering. 5 figures.

  5. The planet Mercury (1971)

    1972-01-01

    The physical properties of the planet Mercury, its surface, and atmosphere are presented for space vehicle design criteria. The mass, dimensions, mean density, and orbital and rotational motions are described. The gravity field, magnetic field, electromagnetic radiation, and charged particles in the planet's orbit are discussed. Atmospheric pressure, temperature, and composition data are given along with the surface composition, soil mechanical properties, and topography, and the surface electromagnetic and temperature properties.

  6. Magnetic field of Mercury

    Jackson, D.J.; Beard, D.B.

    1977-01-01

    The geomagnetic field, suitably scaled down and parameterized, is shown to give a very good fit to the magnetic field measurements taken on the first and third passes of the Mariner 10 space probe past Mercury. The excellence of the fit to a reliable planetary magnetospheric model is good evidence that the Mercury magnetosphere is formed by a simple, permanent, intrinsic planetary magnetic field distorted by the effects of the solar wind. The parameters used for a best fit to all the data are (depending slightly on the choice of data) 2.44--2.55 for the ratio of Mercury's magnetic field strength at the subsolar point to that of the earth's subsolar point field (this results in a dipole moment of 170 γR/sub M/ 3 (R/sub M/ is Mercury Radius), i.e., 2.41 x 10 22 G cm 3 in the same direction as the earth's dipole), approx.-113 γR/sub M/ 4 for the planetary quadrupole moment parallel to the dipole moment, 10degree--17degree for the tilt of the planet dipole toward the sun, 4.5degree for the tilt of the dipole toward dawn, and 2.5degree--7.6degree aberration angle for the shift in the tail axis from the planet-sun direction because of the planet's orbital velocity. The rms deviation overall for the entire data set compared with the theoretical fitted model for the magnetic field strength was 17 γ (approx.4% of the maximum field measured). If the data from the first pass that show presumed strong time variations are excluded, the overall rms deviation for the field magnitude is only 10 γ

  7. Method for scavenging mercury

    Chang, Shih-ger [El Cerrito, CA; Liu, Shou-heng [Kaohsiung, TW; Liu, Zhao-rong [Beijing, CN; Yan, Naiqiang [Berkeley, CA

    2009-01-20

    Disclosed herein is a method for removing mercury from a gas stream comprising contacting the gas stream with a getter composition comprising bromine, bromochloride, sulphur bromide, sulphur dichloride or sulphur monochloride and mixtures thereof. In one preferred embodiment the getter composition is adsorbed onto a sorbent. The sorbent may be selected from the group consisting of flyash, limestone, lime, calcium sulphate, calcium sulfite, activated carbon, charcoal, silicate, alumina and mixtures thereof. Preferred is flyash, activated carbon and silica.

  8. Apparatus for mercury refinement

    Grossman, M.W.; Speer, R.; George, W.A.

    1991-01-01

    The effluent from mercury collected during the photochemical separation of the 196 Hg isotope is often contaminated with particulate mercurous chloride, Hg 2 Cl 2 . The use of mechanical filtering via thin glass tubes, ultrasonic rinsing with acetone (dimethyl ketone) and a specially designed cold trap have been found effective in removing the particulate (i.e., solid) Hg 2 Cl 2 contaminant. The present invention is particularly directed to such filtering. 5 figures

  9. Method for mercury refinement

    Grossman, M.W.; Speer, R.; George, W.A.

    1991-01-01

    The effluent from mercury collected during the photochemical separation of the 196 Hg isotope is often contaminated with particulate mercurous chloride, Hg 2 Cl 2 . The use of mechanical filtering via thin glass tubes, ultrasonic rinsing with acetone (dimethyl ketone) and a specially designed cold trap have been found effective in removing the particulate (i.e., solid) Hg 2 Cl 2 contaminant. The present invention is particularly directed to such filtering. 5 figures

  10. Mercury's Densely Cratered Surface

    1974-01-01

    Mariner 10 took this picture (FDS 27465) of the densely cratered surface of Mercury when the spacecraft was 18,200 kilometers (8085 miles) from the planet on March 29. The dark line across top of picture is a 'dropout' of a few TV lines of data. At lower left, a portion of a 61 kilometer (38 mile) crater shows a flow front extending across the crater floor and filling more than half of the crater. The smaller, fresh crater at center is about 25 kilometers (15 miles) in diameter. Craters as small as one kilometer (about one-half mile) across are visible in the picture.The Mariner 10 mission, managed by the Jet Propulsion Laboratory for NASA's Office of Space Science, explored Venus in February 1974 on the way to three encounters with Mercury-in March and September 1974 and in March 1975. The spacecraft took more than 7,000 photos of Mercury, Venus, the Earth and the Moon.Image Credit: NASA/JPL/Northwestern University

  11. Mercury removal sorbents

    Alptekin, Gokhan

    2016-03-29

    Sorbents and methods of using them for removing mercury from flue gases over a wide range of temperatures are disclosed. Sorbent materials of this invention comprise oxy- or hydroxyl-halogen (chlorides and bromides) of manganese, copper and calcium as the active phase for Hg.sup.0 oxidation, and are dispersed on a high surface porous supports. In addition to the powder activated carbons (PACs), this support material can be comprised of commercial ceramic supports such as silica (SiO.sub.2), alumina (Al.sub.2O.sub.3), zeolites and clays. The support material may also comprise of oxides of various metals such as iron, manganese, and calcium. The non-carbon sorbents of the invention can be easily injected into the flue gas and recovered in the Particulate Control Device (PCD) along with the fly ash without altering the properties of the by-product fly ash enabling its use as a cement additive. Sorbent materials of this invention effectively remove both elemental and oxidized forms of mercury from flue gases and can be used at elevated temperatures. The sorbent combines an oxidation catalyst and a sorbent in the same particle to both oxidize the mercury and then immobilize it.

  12. Application of a mer-lux biosensor for estimating bioavailable mercury in soil

    Rasmussen, Lasse Dam; Sørensen, S. J.; Turner, R. R.

    2000-01-01

    A previously described bioassay using a mer-lux gene fusion for detection of bioavailable mercury was applied for the estimation of the bioavailable fraction of mercury in soil. The bioavailable fraction is defined here as being part of the water leachable fraction. Due to masking of light emission...... responses. The utility of the mer-lux biosensor assay was tested by relating measurements of bioavailable and total mercury to the response of the soil microbial community to mercury exposure. Two different soil types (an agricultural and a beech forest soil) were spiked with 2.5 µg Hg(II) g-1 in microcosms...... in resistance or diversity. This study showed that the bioassay using the mer-lux biosensor is a useful and sensitive tool for estimation of bioavailable mercury in soil....

  13. Catalysts for oxidation of mercury in flue gas

    Granite, Evan J [Wexford, PA; Pennline, Henry W [Bethel Park, PA

    2010-08-17

    Two new classes of catalysts for the removal of heavy metal contaminants, especially mercury (Hg) from effluent gases. Both of these classes of catalysts are excellent absorbers of HCl and Cl.sub.2 present in effluent gases. This adsorption of oxidizing agents aids in the oxidation of heavy metal contaminants. The catalysts remove mercury by oxidizing the Hg into mercury (II) moieties. For one class of catalysts, the active component is selected from the group consisting of iridium (Ir) and iridum-platinum (Ir/Pt) alloys. The Ir and Ir/Pt alloy catalysts are especially corrosion resistant. For the other class of catalyst, the active component is partially combusted coal or "Thief" carbon impregnated with Cl.sub.2. Untreated Thief carbon catalyst can be self-activating in the presence of effluent gas streams. The Thief carbon catalyst is disposable by means of capture from the effluent gas stream in a particulate collection device (PCD).

  14. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    Givskov, M; Eberl, L; Christiansen, Gunna

    1995-01-01

    . Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

  15. CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

    Marasco Rosangela

    2006-11-01

    Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

  16. Rotation of the planet mercury.

    Jefferys, W H

    1966-04-08

    The equations of motion for the rotation of Mercury are solved for the general case by an asymptotic expansion. The findings of Liu and O'Keefe, obtained by numerical integration of a special case, that it is possible for Mercury's rotation to be locked into a 2:3 resonance with its revolution, are confirmed in detail. The general solution has further applications.

  17. Mercury: Exploration of a Planet

    1976-01-01

    The flight of the Mariner 10 spacecraft to Venus and Mercury is detailed in animation and photography. Views of Mercury are featured. Also included is animation on the origin of the solar system. Dr. Bruce C. Murray, director of the Jet Propulsion Laboratory, comments on the mission.

  18. 49 CFR 173.164 - Mercury (metallic and articles containing mercury).

    2010-10-01

    ... ounces) of mercury per package; (iv) Tubes which are completely jacketed in sealed leakproof metal cases... 49 Transportation 2 2010-10-01 2010-10-01 false Mercury (metallic and articles containing mercury... Than Class 1 and Class 7 § 173.164 Mercury (metallic and articles containing mercury). (a) For...

  19. Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

    Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

    2013-07-01

    Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  20. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    2015-01-01

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

  1. The effect of stochasticity on the lac operon: an evolutionary perspective.

    Milan van Hoek

    2007-06-01

    Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel

  2. Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.

    T Sabari Sankar

    2009-03-01

    Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.

  3. A fluorescent bioreporter for acetophenone and 1-phenylethanol derived from a specifically induced catabolic operon

    Enrico eMuhr

    2016-01-01

    Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.

  4. A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

    Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

    2015-01-01

    The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

  5. Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

    Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

    2010-07-01

    Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

  6. Role of bacteria in bioaccumulation of mercury in the oyster Crassostrea virginica

    Sayler, G.S.; Nelson, J.D. Jr.; Colwell, R.R.

    1975-01-01

    An investigation of mercury-resistant bacteria was undertaken to determine their role in the accumulation of mercury in a simplified food chain. Oysters (Crassostrea virginica) were maintained in a closed system, sealed aquarium with stirred, aerated water containing 10 μg of 203 HgCl 2 per liter. Uptake of 203 Hg by oysters held under control conditions was compared with that of 203 Hg uptake by oysters under similar conditions except that mercury-accumulating and mercury-metabolizing species of Pseudomonsa, isolated from Chesapeake Bay, were added to the experimental oysters. After incubation for 4 days, the major portion of the 203 Hg in the water column was found to be associated with the microparticulate fraction, corresponding to a rise in total viable count. Mercury accumulation in the oysters was significantly higher in the gill and fisceral tissue than other tissues. Mercury concentrations were 200 times greater in tissue fractions of oysters dosed with mercury-metabolizing bacteria compared with the oysters held under control conditions without mercury-metabolizing bacteria. (U.S.)

  7. Methyl mercury in terrestrial compartments

    Stoeppler, M.; Burow, M.; Padberg, S.; May, K.

    1993-09-01

    On the basis of the analytical methodology available at present the state of the art for the determination of total mercury and of various organometallic compounds of mercury in air, precipitation, limnic systems, soils, plants and biota is reviewed. This is followed by the presentation and discussion of examples for the data obtained hitherto for trace and ultratrace levels of total mercury and mainly methyl mercury in terrestrial and limnic environments as well as in biota. The data discussed stem predominantly from the past decade in which, due to significant methodological progress, many new aspects were elucidated. They include the most important results in this area achieved by the Research Centre (KFA) Juelich within the project 'Origin and Fate of Methyl Mercury' (contracts EV4V-0138-D and STEP-CT90-0057) supported by the Commission of the European Communities, Brussels. (orig.) [de

  8. Human Exposure and Health Effects of Inorganic and Elemental Mercury

    Park, Jung-Duck; Zheng, Wei

    2012-01-01

    Mercury is a toxic and non-essential metal in the human body. Mercury is ubiquitously distributed in the environment, present in natural products, and exists extensively in items encountered in daily life. There are three forms of mercury, i.e., elemental (or metallic) mercury, inorganic mercury compounds, and organic mercury compounds. This review examines the toxicity of elemental mercury and inorganic mercury compounds. Inorganic mercury compounds are water soluble with a bioavailability o...

  9. fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

    Khun, H H; Deved, V; Wong, H; Lee, B C

    2000-12-01

    The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

  10. The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis

    Ahn, Sang-Joon; Burne, Robert A.

    2006-01-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...

  11. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Lindblad Peter

    2008-04-01

    Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

  12. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

  13. Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

    Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

    2016-11-08

    Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

  14. Purification and crystallization of Phd, the antitoxin of the phd/doc operon

    Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy

    2010-01-01

    The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein

  15. Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model

    Cao, Xin; Song, Yongli; Zhang, Tonghua

    In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.

  16. Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.

    da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A

    2017-07-01

    One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

  17. Methods for dispensing mercury into devices

    Grossman, Mark W.; George, William A.

    1987-04-28

    A process for dispensing mercury into devices which requires mercury. Mercury is first electrolytically separated from either HgO or Hg.sub.2 Cl.sub.2 and plated onto a cathode wire. The cathode wire is then placed into a device requiring mercury.

  18. Determination of mercury in plant material

    Pickard, J A; Martin, J T

    1960-07-01

    An analytical procedure used for the determination of traces of mercury in plant material is described. The conditions of combustion of organic matter are controlled to avoid loss of mercury and EDTA is used to reduce the values for apparent mercury on uncontaminated samples. Satisfactory recoveries of mercury added to apples, tomatoes and coffee are obtained. 10 references, 1 table.

  19. Mercury's Lithospheric Magnetization

    Johnson, C.; Phillips, R. J.; Philpott, L. C.; Al Asad, M.; Plattner, A.; Mast, S.; Kinczyk, M. J.; Prockter, L. M.

    2017-12-01

    Magnetic field data obtained by the MErcury Surface, Space ENvironment, GEochemistry, and Ranging (MESSENGER) spacecraft have been used to demonstrate the presence of lithospheric magnetization on Mercury. Larger amplitude fields resulting from the core dynamo and the strongly time-varying magnetospheric current systems are first estimated and subtracted from the magnetic field data to isolate lithospheric signals with wavelengths less than 500 km. These signals (hereafter referred to as data) are only observed at spacecraft altitudes less than 120 km, and are typically a few to 10 nT in amplitude. We present and compare equivalent source dipole magnetization models for latitudes 35°N to 75°N obtained from two distinct approaches to constrain the distribution and origin of lithospheric magnetization. First, models that fit either the data or the surface field predicted from a regional spherical harmonic representation of the data (see Plattner & Johnson abstract) and that minimize the root mean square (RMS) value of the magnetization are derived. Second, models in which the spatial distribution of magnetization required to fit the data is minimized are derived using the approach of Parker (1991). As seen previously, the largest amplitudes of lithospheric magnetization are concentrated around the Caloris basin. With this exception, across the northern hemisphere there are no overall correlations of magnetization with surface geology, although higher magnetizations are found in regions with darker surfaces. Similarly, there is no systematic correlation of magnetization signatures with crater materials, although there are specific instances of craters with interiors or ejecta that have magnetizations distinct from the surrounding region. For the latter case, we observe no correlation of the occurrence of these signatures with crater degradation state (a proxy for age). At the lowest spacecraft altitudes (source depths less than O(10 km) are unlikely in most regions

  20. Radar observations of Mercury

    Harmon, J.K.; Campbell, D.B.

    1988-01-01

    Some of the radar altimetry profiles of Mercury obtained on the basis of data from the Arecibo Observatory are presented. In these measurements, the delay-Doppler method was used to measure altitudes along the Doppler equator, rather than to map radar reflectivity. The profiles, derived from observations made over a 6-yr period, provide extensive coverage over a restricted equatorial band and permit the identification of radar signatures for features as small as 50-km diameter craters and 1-km-high arcuate scarps. The data allowed identification of large-scale topographic features such as smooth plains subsidence zones and major highland regions

  1. Fluorescent sensor for mercury

    Wang, Zidong [Urbana, IL; Lee, Jung Heon [Evanston, IL; Lu, Yi [Champaign, IL

    2011-11-22

    The present invention provides a sensor for detecting mercury, comprising: a first polynucleotide, comprising a first region, and a second region, a second polynucleotide, a third polynucleotide, a fluorophore, and a quencher, wherein the third polynucleotide is optionally linked to the second region; the fluorophore is linked to the first polynucleotide and the quencher is linked to the second polynucleotide, or the fluorophore is linked to the second polynucleotide and the quencher is linked to the first polynucleotide; the first region and the second region hybridize to the second polynucleotide; and the second region binds to the third polynucleotide in the presence of Hg.sup.2+ ions.

  2. Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

    Juliana Teixeira de Magalhães

    2005-06-01

    Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

  3. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  4. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  5. Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

    Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

    2016-08-01

    To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

  6. JV Task 96 - Phase 2 - Investigating the Importance of the Mercury-Selenium Interaction

    Nicholas Ralston; Laura Raymond

    2008-03-01

    In order to improve the understanding of the mercury issue, it is vital to study mercury's effects on selenium physiology. While mercury present in the environment or food sources may pose health risks, the protective effects of selenium have not been adequately considered in establishing regulatory policy. Numerous studies report that vulnerability to mercury toxicity is inversely proportional to selenium status or level. However, selenium status has not been considered in the development of the reference dosage levels for mercury exposure. Experimental animals fed low-selenium diets are far more vulnerable to mercury toxicity than animals fed normal selenium, and animals fed selenium-rich diets are even more resistant. Selenium-dependent enzymes in brain and endocrine tissues can be impaired by excessive mercury exposure, apparently because mercury has an extremely high binding affinity for selenium. When selenium becomes bound to mercury, it is unable to participate in the metabolic cycling of selenoprotein synthesis. Because of mercury-dependent impairments of selenoprotein synthesis, various antioxidant and regulatory functions in brain biochemistry are compromised. This report details a 2-year multiclient-funded research program designed to examine the interactions between mercury and selenium in animal models. The studies explored the effects of dietary intakes of toxic amounts of methylmercury and the protective effects of the normal dietary range of selenium in counteracting mercury toxicity. This study finds that the amounts of selenium present in ocean fish are sufficient to protect against far larger quantities of methylmercury than those present in typical seafoods. Toxic effects of methylmercury exposure were not directly proportional to mercury concentrations in blood, brain, or any other tissues. Instead, mercury toxicity was proportional to molar ratios of mercury relative to selenium. In order to accurately assess risk associated with

  7. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

  8. The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces.

    Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo

    2014-12-01

    The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

  9. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

  10. Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci

    Astha Agarwal

    2013-01-01

    Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

  11. Expression, purification and functional characterization of AmiA of acetamidase operon of Mycobacterium smegmatis.

    Sundararaman, Balaji; Palaniyandi, Kannan; Venkatesan, Arunkumar; Narayanan, Sujatha

    2014-11-01

    Regulation of gene expression is one of the mechanisms of virulence in pathogenic organisms. In this context, we would like to understand the gene regulation of acetamidase enzyme of Mycobacterium smegmatis, which is the first reported inducible enzyme in mycobacteria. The acetamidase is highly inducible and the expression of this enzyme is increased 100-fold when the substrate acetamide is added. The acetamidase structural gene (amiE) is found immediately downstream of three predicted open reading frames (ORFs). Three of these genes along with a divergently expressed ORF are predicted to form an operon and involved in the regulation of acetamidase enzyme. Here we report expression, purification and functional characterization of AmiA which is one of these predicted ORFs. Electrophoretic mobility shift assays showed that AmiA binds to the region between the amiA and amiD near the predicted promoter (P2). Over-expression of AmiA significantly lowered the expression of acetamidase compared to the wild type as demonstrated by qRT-PCR and SDS-PAGE. We conclude that AmiA binds near P2 promoter and acts as a repressor in the regulation of acetamidase operon. The described work is a further step forward toward broadening the knowledge on understanding of the complex gene regulatory mechanism of Mycobacterium sp. Copyright © 2014 Elsevier GmbH. All rights reserved.

  12. The Cry Toxin Operon of Clostridium bifermentans subsp. malaysia Is Highly Toxic to Aedes Larval Mosquitoes

    Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim

    2014-01-01

    The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432

  13. Dynamics and bistability in a reduced model of the lac operon

    Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

    2004-06-01

    It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

  14. Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.

    Marincola, Gabriella; Wolz, Christiane

    2017-06-02

    In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia.

    Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène

    2018-01-22

    Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.

  16. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  17. Removal of mercury (II), elemental mercury and arsenic from simulated flue gas by ammonium sulphide.

    Ning, Ping; Guo, Xiaolong; Wang, Xueqian; Wang, Ping; Ma, Yixing; Lan, Yi

    2015-01-01

    A tubular resistance furnace was used as a reactor to simulate mercury and arsenic in smelter flue gases by heating mercury and arsenic compounds. The flue gas containing Hg(2+), Hg(0) and As was treated with ammonium sulphide. The experiment was conducted to investigate the effects of varying the concentration of ammonium sulphide, the pH value of ammonium sulphide, the temperature of ammonium sulphide, the presence of SO2 and the presence of sulphite ion on removal efficiency. The prepared adsorption products were characterized by Fourier transform infrared spectroscopy, X-ray diffraction, X-ray photoelectron spectroscopy and scanning electron microscopy. The results showed that the optimal concentration of ammonium sulphide was 0.8 mol/L. The optimal pH value of ammonium sulphide was 10, and the optimal temperature of ammonium sulphide was 20°C.Under the optimum conditions, the removal efficiency of Hg(2+), Hg(0) and As could reach 99%, 88.8%, 98%, respectively. In addition, SO2 and sulphite ion could reduce the removal efficiency of mercury and arsenic from simulated flue gas.

  18. Mercury kinetics in marine zooplankton

    Fowler, S.W.; Heyraud, M.; LaRosa, J.

    1976-01-01

    Mercury, like many other heavy metals, is potentially available to marine animals by uptake directly from water and/or through the organisms food. Furthermore, bioavailability, assimilation and subsequent retention in biota may be affected by the chemical species of the element in sea water. While mercury is known to exist in the inorganic form in sea water, recent work has indicated that, in certain coastal areas, a good portion of the total mercury appears to be organically bound; however, the exact chemical nature of the organic fraction has yet to be determined. Methyl mercury may be one constituent of the natural organically bound fraction since microbial mechanisms for in situ methylation of mercury have been demonstrated in the aquatic environment. Despite the fact that naturally produced methyl mercury probably comprises only a small fraction of an aquatic ecosystem, the well-documented toxic effects of this organo-mercurial, caused by man-made introductions into marine food chains, make it an important compound to study

  19. Volcanic mercury in Pinus canariensis

    Rodríguez Martín, José Antonio; Nanos, Nikos; Miranda, José Carlos; Carbonell, Gregoria; Gil, Luis

    2013-08-01

    Mercury (Hg) is a toxic element that is emitted to the atmosphere by both human activities and natural processes. Volcanic emissions are considered a natural source of mercury in the environment. In some cases, tree ring records taken close to volcanoes and their relation to volcanic activity over time are contradictory. In 1949, the Hoyo Negro volcano (La Palma-Canary Islands) produced significant pyroclastic flows that damaged the nearby stand of Pinus canariensis. Recently, 60 years after the eruption, we assessed mercury concentrations in the stem of a pine which survived volcano formation, located at a distance of 50 m from the crater. We show that Hg content in a wound caused by pyroclastic impacts (22.3 μg kg-1) is an order of magnitude higher than the Hg concentrations measured in the xylem before and after the eruption (2.3 μg kg-1). Thus, mercury emissions originating from the eruption remained only as a mark—in pyroclastic wounds—and can be considered a sporadic and very high mercury input that did not affect the overall Hg input in the xylem. In addition, mercury contents recorded in the phloem (9.5 μg kg-1) and bark (6.0 μg kg-1) suggest that mercury shifts towards non-living tissues of the pine, an aspect that can be related to detoxification in volcanism-adapted species.

  20. Atmospheric mercury footprints of nations.

    Liang, Sai; Wang, Yafei; Cinnirella, Sergio; Pirrone, Nicola

    2015-03-17

    The Minamata Convention was established to protect humans and the natural environment from the adverse effects of mercury emissions. A cogent assessment of mercury emissions is required to help implement the Minamata Convention. Here, we use an environmentally extended multi-regional input-output model to calculate atmospheric mercury footprints of nations based on upstream production (meaning direct emissions from the production activities of a nation), downstream production (meaning both direct and indirect emissions caused by the production activities of a nation), and consumption (meaning both direct and indirect emissions caused by final consumption of goods and services in a nation). Results show that nations function differently within global supply chains. Developed nations usually have larger consumption-based emissions than up- and downstream production-based emissions. India, South Korea, and Taiwan have larger downstream production-based emissions than their upstream production- and consumption-based emissions. Developed nations (e.g., United States, Japan, and Germany) are in part responsible for mercury emissions of developing nations (e.g., China, India, and Indonesia). Our findings indicate that global mercury abatement should focus on multiple stages of global supply chains. We propose three initiatives for global mercury abatement, comprising the establishment of mercury control technologies of upstream producers, productivity improvement of downstream producers, and behavior optimization of final consumers.

  1. Volcanic mercury in Pinus canariensis.

    Rodríguez Martín, José Antonio; Nanos, Nikos; Miranda, José Carlos; Carbonell, Gregoria; Gil, Luis

    2013-08-01

    Mercury (Hg) is a toxic element that is emitted to the atmosphere by both human activities and natural processes. Volcanic emissions are considered a natural source of mercury in the environment. In some cases, tree ring records taken close to volcanoes and their relation to volcanic activity over time are contradictory. In 1949, the Hoyo Negro volcano (La Palma-Canary Islands) produced significant pyroclastic flows that damaged the nearby stand of Pinus canariensis. Recently, 60 years after the eruption, we assessed mercury concentrations in the stem of a pine which survived volcano formation, located at a distance of 50 m from the crater. We show that Hg content in a wound caused by pyroclastic impacts (22.3 μg kg(-1)) is an order of magnitude higher than the Hg concentrations measured in the xylem before and after the eruption (2.3 μg kg(-1)). Thus, mercury emissions originating from the eruption remained only as a mark-in pyroclastic wounds-and can be considered a sporadic and very high mercury input that did not affect the overall Hg input in the xylem. In addition, mercury contents recorded in the phloem (9.5 μg kg(-1)) and bark (6.0 μg kg(-1)) suggest that mercury shifts towards non-living tissues of the pine, an aspect that can be related to detoxification in volcanism-adapted species.

  2. Method for removal and stabilization of mercury in mercury-containing gas streams

    Broderick, Thomas E.

    2005-09-13

    The present invention is directed to a process and apparatus for removing and stabilizing mercury from mercury-containing gas streams. A gas stream containing vapor phase elemental and/or speciated mercury is contacted with reagent, such as an oxygen-containing oxidant, in a liquid environment to form a mercury-containing precipitate. The mercury-containing precipitate is kept or placed in solution and reacts with one or more additional reagents to form a solid, stable mercury-containing compound.

  3. Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

    Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

    1993-01-01

    CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

  4. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  5. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    Eberl, L; Christiansen, Gunna; Molin, S

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

  6. Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

    Douthwaite, S; Prince, J B; Noller, H F

    1985-01-01

    A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

  7. Exploring Mercury: The Iron Planet

    Stevenson, David J.

    2004-01-01

    Planet Mercury is both difficult to observe and difficult to reach by spacecraft. Just one spacecraft, Mariner 10, flew by the planet 30 years ago. An upcoming NASA mission, MESSENGER, will be launched this year and will go into orbit around Mercury at the end of this decade. A European mission is planned for the following decade. It's worth going there because Mercury is a strange body and the history of planetary exploration has taught us that strangeness gives us insight into planetary ori...

  8. Chelation Therapy for Mercury Poisoning

    Rong Guan

    2009-01-01

    Full Text Available Chelation therapy has been the major treatment for heavy metal poisoning. Various chelating agents have been developed and tested for treatment of heavy metal intoxications, including mercury poisoning. It has been clearly shown that chelating agents could rescue the toxicity caused by heavy metal intoxication, but the potential preventive role of chelating agents against heavy metal poisoning has not been explored much. Recent paper by Siddiqi and colleagues has suggested a protective role of chelating agents against mercury poisoning, which provides a promising research direction for broader application of chelation therapy in prevention and treatment of mercury poisoning.

  9. MESSENGER'S First Flyby of Mercury

    Slavin, James A.

    2008-01-01

    The MESSENGER mission to Mercury offers our first opportunity to explore this planet's miniature magnetosphere since Mariner 10's brief fly-bys in 1974-5. The magnetosphere of Mercury is the smallest in the solar system with its magnetic field typically standing off the solar wind only - 1000 to 2000 km above the surface. An overview of the MESSENGER mission and its January 14th close flyby of Mercury will be provided. Primary science objectives and the science instrumentation will be described. Initial results from MESSENGER'S first flyby on January 14th, 2008 will be discussed with an emphasis on the magnetic field and charged particle measurements.

  10. Distribution and retention of organic and inorganic mercury in methyl mercury-treated neonatal rats

    Thomas, D.J.; Fisher, H.L.; Sumler, M.R.; Hall, L.L.; Mushak, P.

    1988-01-01

    Seven-day-old Long Evans rats received one mumol of 203 Hg-labeled methyl mercury/kg sc and whole body retention and tissue distribution of organic and inorganic mercury were examined for 32 days postdosing. Neonates cleared mercury slowly until 10 days postdosing when the clearance rate abruptly increased. During the interval when whole body clearance of mercury was extremely slow, methyl mercury was metabolized to inorganic mercury. Peak concentration of mercury in kidney occurred at 2 days postdosing. At 32 days postdosing, 8% of mercury in kidney was in an organic from. Liver mercury concentration peaked at 2 days postdosing and organic mercury accounted for 38% at 32 days postdosing. Brain concentrations of mercury peaked at 2 days postdosing. At 10 days postdosing, organic mercury accounted for 86% of the brain mercury burden, and, at 32 days postdosing, for 60%. The percentage of mercury body burden in pelt rose from 30 to 70% between 1 and 10 days postdosing. At 32 days postdosing pelt contained 85% of the body burden of mercury. At all time points, about 95% of mercury in pelt was in an organic form. Compartmental analysis of these data permitted development of a model to describe the distribution and excretion of organic and inorganic mercury in methyl mercury-treated neonatal rats

  11. The Use of Bacteria for Remediation of Mercury Contaminated Groundwater

    Many processes of mercury transformation in the environment are bacteria mediated. Mercury properties cause some difficulties of remediation of mercury contaminated environment. Despite the significance of the problem of mercury pollution, methods of large scale bioremediation ...

  12. Occurrence of adhesin-encoding operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis Ocorrência de operons codificadores de adesinas em Escherichia coli isolada de aves reprodutoras com salpingite e de pintinhos com onfalite

    Terezinha Knöbl

    2006-06-01

    Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.

  13. Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

    Qinna Cui

    Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

  14. Elimination of mercury in health care facilities.

    2000-03-01

    Mercury is a persistent, bioaccumulative toxin that has been linked to numerous health effects in humans and wildlife. It is a potent neurotoxin that may also harm the brain, kidneys, and lungs. Unborn children and young infants are at particular risk for brain damage from mercury exposure. Hospitals' use of mercury in chemical solutions, thermometers, blood pressure gauges, batteries, and fluorescent lamps makes these facilities large contributors to the overall emission of mercury into the environment. Most hospitals recognize the dangers of mercury. In a recent survey, four out of five hospitals stated that they have policies in place to eliminate the use of mercury-containing products. Sixty-two percent of them require vendors to disclose the presence of mercury in chemicals that the hospitals purchase. Only 12 percent distribute mercury-containing thermometers to new parents. Ninety-two percent teach their employees about the health and environmental effects of mercury, and 46 percent teach all employees how to clean up mercury spills. However, the same study showed that many hospitals have not implemented their policies. Forty-two percent were not aware whether they still purchased items containing mercury. In addition, 49 percent still purchase mercury thermometers, 44 percent purchase mercury gastrointestinal diagnostic equipment, and 64 percent still purchase mercury lab thermometers.

  15. Mercury pollution: a transdisciplinary treatment

    Zuber, Sharon L; Newman, Michael C

    2012-01-01

    .... Also included are smaller case studies, such as the Minamata tragedy, fish consumption, and international treaties"-- "Mercury is the gravest chemical pollutant problem of our time, and this is...

  16. Mercury contamination in the Amazon

    Nancy Minogue

    contamination is mainly caused by deforestation upstream. ... The team expected to find that the mercury levels in the water, sediment, and soil decreased as they ... Methylmercury poisoning — known as Minamata Disease after the Japanese ...

  17. Mercury absorption in aqueous hypochlorite

    Zhao, L.L.; Rochelle, G.T.

    1999-01-01

    The absorption of elemental Hg vapor into aqueous hypochlorite was measured in a stirred tank reactor at 25 and 55C. NaOCl strongly absorbs Hg even at high pH. Low pH, high Cl - and high-temperature favor mercury absorption. Aqueous free Cl 2 was the active species that reacted with mercury. However, chlorine desorption was evident at high Cl - and pH 15 M -1 s -1 at 25C and 1.4x10 17 M -1 s -1 at 55C. Gas-phase reaction was observed between Hg and Cl 2 on apparatus surfaces. Strong mercury absorption in water was also detected with Cl 2 present. Results indicate that the chlorine concentration, moisture, and surface area contribute positively to mercury removal. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  18. Origin and composition of Mercury

    Lewis, J.S.

    1988-01-01

    The predictions of the expected range of composition of Mercury at the time of its formation made on the basis of a suite of condensation-accretion models of Mercury spanning a range of condensation temperature and accretion sampling functions appropriate to Mercury are examined. It is concluded that these compositonal models can, if modified to take into account the nonselective loss of most of the silicate component of the planet during accretion, provide compositional predictions for the Weidenschilling (1978, 1980) mechanism for the accretion of a metal-rich Mercury. The silicate portion would, in this case, contain 3.6 to 4.5 percent alumina, roughly 1 percent of alkali oxides, and between 0.5 and 6 percent FeO

  19. Localized surface plasmon resonance mercury detection system and methods

    James, Jay; Lucas, Donald; Crosby, Jeffrey Scott; Koshland, Catherine P.

    2016-03-22

    A mercury detection system that includes a flow cell having a mercury sensor, a light source and a light detector is provided. The mercury sensor includes a transparent substrate and a submonolayer of mercury absorbing nanoparticles, e.g., gold nanoparticles, on a surface of the substrate. Methods of determining whether mercury is present in a sample using the mercury sensors are also provided. The subject mercury detection systems and methods find use in a variety of different applications, including mercury detecting applications.

  20. Mercury Toolset for Spatiotemporal Metadata

    Devarakonda, Ranjeet; Palanisamy, Giri; Green, James; Wilson, Bruce; Rhyne, B. Timothy; Lindsley, Chris

    2010-06-01

    Mercury (http://mercury.ornl.gov) is a set of tools for federated harvesting, searching, and retrieving metadata, particularly spatiotemporal metadata. Version 3.0 of the Mercury toolset provides orders of magnitude improvements in search speed, support for additional metadata formats, integration with Google Maps for spatial queries, facetted type search, support for RSS (Really Simple Syndication) delivery of search results, and enhanced customization to meet the needs of the multiple projects that use Mercury. It provides a single portal to very quickly search for data and information contained in disparate data management systems, each of which may use different metadata formats. Mercury harvests metadata and key data from contributing project servers distributed around the world and builds a centralized index. The search interfaces then allow the users to perform a variety of fielded, spatial, and temporal searches across these metadata sources. This centralized repository of metadata with distributed data sources provides extremely fast search results to the user, while allowing data providers to advertise the availability of their data and maintain complete control and ownership of that data. Mercury periodically (typically daily)harvests metadata sources through a collection of interfaces and re-indexes these metadata to provide extremely rapid search capabilities, even over collections with tens of millions of metadata records. A number of both graphical and application interfaces have been constructed within Mercury, to enable both human users and other computer programs to perform queries. Mercury was also designed to support multiple different projects, so that the particular fields that can be queried and used with search filters are easy to configure for each different project.

  1. Mercury Toolset for Spatiotemporal Metadata

    Wilson, Bruce E.; Palanisamy, Giri; Devarakonda, Ranjeet; Rhyne, B. Timothy; Lindsley, Chris; Green, James

    2010-01-01

    Mercury (http://mercury.ornl.gov) is a set of tools for federated harvesting, searching, and retrieving metadata, particularly spatiotemporal metadata. Version 3.0 of the Mercury toolset provides orders of magnitude improvements in search speed, support for additional metadata formats, integration with Google Maps for spatial queries, facetted type search, support for RSS (Really Simple Syndication) delivery of search results, and enhanced customization to meet the needs of the multiple projects that use Mercury. It provides a single portal to very quickly search for data and information contained in disparate data management systems, each of which may use different metadata formats. Mercury harvests metadata and key data from contributing project servers distributed around the world and builds a centralized index. The search interfaces then allow the users to perform a variety of fielded, spatial, and temporal searches across these metadata sources. This centralized repository of metadata with distributed data sources provides extremely fast search results to the user, while allowing data providers to advertise the availability of their data and maintain complete control and ownership of that data. Mercury periodically (typically daily) harvests metadata sources through a collection of interfaces and re-indexes these metadata to provide extremely rapid search capabilities, even over collections with tens of millions of metadata records. A number of both graphical and application interfaces have been constructed within Mercury, to enable both human users and other computer programs to perform queries. Mercury was also designed to support multiple different projects, so that the particular fields that can be queried and used with search filters are easy to configure for each different project.

  2. The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.

    Rajagopalan, Ramya; Kroos, Lee

    2017-05-15

    Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

  3. Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

    Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

    2016-10-15

    Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is

  4. RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus.

    Lei, Mei G; Lee, Chia Y

    2015-12-01

    Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation

  5. Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

    Altenbuchner Josef

    2011-10-01

    Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

  6. Antibiotic combination therapy can select for broad-spectrum multidrug resistance in Pseudomonas aeruginosa

    Vestergaard, Martin; Paulander, Wilhelm; Marvig, Rasmus L.

    2016-01-01

    with the resistance evolved after single-drug exposure. Combination therapy selected for mutants that displayed broad-spectrum resistance, and a major resistance mechanism was mutational inactivation of the repressor gene mexR that regulates the multidrug efflux operon mexAB–oprM. Deregulation of this operon led...... to a broad-spectrum resistance phenotype that decreased susceptibility to the combination of drugs applied during selection as well as to unrelated antibiotic classes. Mutants isolated after single-drug exposure displayed narrow-spectrum resistance and carried mutations in the MexCD–OprJ efflux pump...... regulator gene nfxB conferring ciprofloxacin resistance, or in the gene encoding the non-essential penicillin-binding protein DacB conferring ceftazidime resistance. Reconstruction of resistance mutations by allelic replacement and in vitro fitness assays revealed that in contrast to single antibiotic use...

  7. Characterization of the binding capacity of mercurial species in Lactobacillus strains.

    Alcántara, Cristina; Jadán-Piedra, Carlos; Vélez, Dinoraz; Devesa, Vicenta; Zúñiga, Manuel; Monedero, Vicente

    2017-12-01

    Metal sequestration by bacteria has been proposed as a strategy to counteract metal contamination in foodstuffs. Lactobacilli can interact with metals, although studies with important foodborne metals such as inorganic [Hg(II)] or organic (CH 3 Hg) mercury are lacking. Lactobacilli were evaluated for their potential to bind these contaminants and the nature of the interaction was assessed by the use of metal competitors, chemical and enzymatical treatments, and mutants affected in the cell wall structure. Lactobacillus strains efficiently bound Hg(II) and CH 3 Hg. Mercury binding by Lactobacillus casei BL23 was independent of cell viability. In BL23, both forms of mercury were cell wall bound. Their interaction was not inhibited by cations and it was resistant to chelating agents and protein digestion. Lactobacillus casei mutants affected in genes involved in the modulation of the negative charge of the cell wall anionic polymer lipoteichoic acid showed increased mercury biosorption. In these mutants, mercury toxicity was enhanced compared to wild-type bacteria. These data suggest that lipoteichoic acid itself or the physicochemical characteristics that it confers to the cell wall play a major role in mercury complexation. This is the first example of the biosorption of Hg(II) and CH 3 Hg in lactobacilli and it represents a first step towards their possible use as agents for diminishing mercury bioaccessibility from food at the gastrointestinal tract. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  8. Cyanobacterial flv4-2 Operon-Encoded Proteins Optimize Light Harvesting and Charge Separation in Photosystem II.

    Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert

    2015-05-01

    Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  9. A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

    Chopra, Paras; Bender, Andreas

    The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

  10. Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

    Nouwen, N; Driessen, AJM

    2005-01-01

    Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

  11. Five phosphonate operon gene products as components of a multi-subunit complex of the carbon-phosphorus lyase pathway

    Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.

    2011-01-01

    Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...

  12. Microbiological stimulation of phytoremediation process using Salvinia natans to mercury contamined water

    Filyarovskaya, Viktoriya; Sitarska, Magdalena; Traczewska, Teodora; Wolf, Mirela

    2017-11-01

    An alternative to traditional cleaning methods of heavy metals in the water environment is phytoremediation. They efficiency depends on used technological process conditions as well as plant species. One of the most dangerous metallic elements mercury plays a particular role, which is a trace element and a physiologically foreign in living organisms. Mercury has a high degree of toxicity with strong affinity to thiol groups. This may cause an adverse effect on the enzymatic processes and consequently inhibiting the physiological functions. Because of high risk for human health, water environment treatment from mercury is essential proecological action. Mercury removal studies were conducted using Salvinia natans pleustofit, sampled from its natural water environment. In the first step, epiphytic bacteria, which was resistant to high concentrations of mercury (0,6 mgHg/l), was isolated from the plant and than selected by the tiles gradient mthod. In the next step, the identification using molecular biology methods was made. In the following step plant Salvinia natans was exposure to high levels of mercury in the presence of the three isolated Pseudomonas strains with exceptional resistance characteristics to environmental factors. Has been found a positive bacteria effect on the plant condition because the selected strains belong to Pseudomonas species producing materials supporting plant growth. The use of microbial stimulation to phytoremediation by hyperaccumulator Salvinia natans can multiply the effectiveness of the process.

  13. Microbiological stimulation of phytoremediation process using Salvinia natans to mercury contamined water

    Filyarovskaya Viktoriya

    2017-01-01

    Full Text Available An alternative to traditional cleaning methods of heavy metals in the water environment is phytoremediation. They efficiency depends on used technological process conditions as well as plant species. One of the most dangerous metallic elements mercury plays a particular role, which is a trace element and a physiologically foreign in living organisms. Mercury has a high degree of toxicity with strong affinity to thiol groups. This may cause an adverse effect on the enzymatic processes and consequently inhibiting the physiological functions. Because of high risk for human health, water environment treatment from mercury is essential proecological action. Mercury removal studies were conducted using Salvinia natans pleustofit, sampled from its natural water environment. In the first step, epiphytic bacteria, which was resistant to high concentrations of mercury (0,6 mgHg/l, was isolated from the plant and than selected by the tiles gradient mthod. In the next step, the identification using molecular biology methods was made. In the following step plant Salvinia natans was exposure to high levels of mercury in the presence of the three isolated Pseudomonas strains with exceptional resistance characteristics to environmental factors. Has been found a positive bacteria effect on the plant condition because the selected strains belong to Pseudomonas species producing materials supporting plant growth. The use of microbial stimulation to phytoremediation by hyperaccumulator Salvinia natans can multiply the effectiveness of the process.

  14. Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis

    Købmann, Brian Jensen; Solem, Christian; Jensen, Peter Ruhdal

    2005-01-01

    control on glycolysis and growth rate but high negative control on formate production. We find that PFK and PK have zero control on glycolysis and growth rate at the wildtype enzyme level but both enzymes exert strong positive control on the glycolytic flux at reduced activities. PK has high positive...... coefficient increased towards 3. Increased las expression resulted in a slight decrease in the glycolytic flux. At the wildtype level the control was close to zero on both glycolysis and the pyruvate branches. The sum of control coefficients for the three enzymes individually was comparable to the control...... coefficient found for the entire operon; the strong positive control by PK almost cancels out the negative control by LDH on formate production. The analysis suggests that co-regulation of PFK and PK provides a very efficient way to regulate glycolysis, and co-regulating PK and LDH allows the cells...

  15. Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.

    Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S

    2006-03-01

    Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.

  16. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

  17. Performance of Mercury Triple-Point Cells Made in Brazil

    Petkovic, S. G.; Santiago, J. F. N.; Filho, R. R.; Teixeira, R. N.; Santos, P. R. F.

    2003-09-01

    Fixed-points cells are primary standards in ITS-90. They contain reference material with a purity of 99.999 % or more. The gallium in a melting-point cell, for example, can reach a purity of 99.99999 %. This level of purity is not easy to obtain. However, substances like water and mercury can be purified by means of distillation and chemical procedures. This paper presents the results of mercury triple-point cells made in Brazil that were directly compared to a mercury triple-point cell of 99.999% purity. This reference cell, made by Isotech (England), was previously compared to cells from CENAM (Mexico) and NRC (Canada) and the maximum deviation found was approximately 0.4 mK. The purification stage started with a sample of mercury 99.3 % pure, and the repeated use of both mechanical and chemical processes led to a purification grade considered good enough for calibration of standard platinum resistance thermometers. The purification procedures, the method of construction of the cell, the laboratory facilities, the comparison results and the budget of uncertainties are described in this paper. All of the cells tested have a triple-point temperature within 0.25 mK of the triple-point temperature of the Inmetro reference cell.

  18. Autometallographic tracing of mercury in frog liver

    Loumbourdis, N.S.; Danscher, G.

    2004-01-01

    The distribution of mercury in the liver of the frog Rana ridibunda with the autometallographic method was investigated. The mercury specific autometallographic (HgS/Se AMG ) technique is a sensitive histochemical approach for tracing mercury in tissues from mercury-exposed organisms. Mercury accumulates in vivo as mercury sulphur/mercury selenium nanocrystals that can be silver-enhanced. Thus, only a fraction of the Hg can be visualized. Six animals were exposed for one day and another group of six animals for 6 days in 1 ppm mercury (as HgCI 2 ) dissolved in fresh water. A third group of six animals, served as controls, were sacrificed the day of arrival at the laboratory. First, mercury appears in the blood plasma and erythrocytes. Next, mercury moves to hepatocytes and in the apical part of the cells, that facing bile canaliculi. In a next step, mercury appears in the endothelial and Kupffer cells. It seems likely that, the mercury of hepatocytes moves through bile canaliculi to the gut, most probably bound to glutathione and/or other similar ligands. Most probably, the endothelial and Kupffer cells comprise the first line of defense against metal toxicity. - Frogs can be good bioindicators of mercury

  19. Comparative analysis of the mechanisms of sulfur anion oxidation and reduction by dsr operon to maintain environmental sulfur balance.

    Ghosh, Semanti; Bagchi, Angshuman

    2015-12-01

    Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio

  20. RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.

    Pérez-Oseguera, Angeles; Cevallos, Miguel A

    2013-11-01

    Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli.

    Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito

    2014-09-01

    Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  2. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.

    Burbank, Lindsey P; Van Horn, Christopher R

    2017-11-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

  3. The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.

    Ahn, Sang-Joon; Burne, Robert A

    2006-10-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.

  4. Role of the Escherichia coli glnALG operon in regulation of ammonium transport

    Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.

    1986-01-01

    Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt

  5. HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.

    Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong

    2016-01-01

    Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

    Zhu, Y; Lin, E C

    1988-05-01

    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

  7. Vaporization of elemental mercury from pools of molten lead at low concentrations

    Greene, G.A.; Finfrock, C.C.

    2000-01-01

    investigate its effect upon the mercury vaporization rate in simulation of the aluminum structure in the APT blanket. No effect at all was observed for a case with an argon atmosphere. This suggests that there are no chemical effects of the aluminum on the vaporization kinetics. With an air atmosphere, the presence of aluminum in the melt reduced the mercury vaporization by a factor of six in comparison to the identical test but without aluminum present. This suggests that aluminum in the lead/mercury .melt retards the vaporization of mercury by creating a surface oxide layer in addition to the lead-oxide layer which increases the mass transfer resistance

  8. Mercury: Aspects of its ecology and environmental toxicity. [physiological effects of mercury compound contamination of environment

    Siegel, S. M.

    1973-01-01

    A study was conducted to determine the effects of mercury pollution on the environment. The possible sources of mercury contamination in sea water are identified. The effects of mercury on food sources, as represented by swordfish, are analyzed. The physiological effects of varying concentrations of mercury are reported. Emphasis is placed on the situation existing in the Hawaiian Islands.

  9. 76 FR 13851 - National Emission Standards for Hazardous Air Pollutants: Mercury Emissions From Mercury Cell...

    2011-03-14

    ... National Emission Standards for Hazardous Air Pollutants: Mercury Emissions From Mercury Cell Chlor-Alkali...-5] RIN 2060-AN99 National Emission Standards for Hazardous Air Pollutants: Mercury Emissions From Mercury Cell Chlor-Alkali Plants AGENCY: Environmental Protection Agency (EPA). ACTION: Supplemental...

  10. Groundwater Modeling Of Mercury Pollution At A Former Mercury Cell Chlor Alkali Facility In Pavoldar, Kazakhstan

    In Kazakhstan, there is a serious case of mercury pollution near the city of Pavlodar from an old mercury cell chlor-alkali plant. The soil, sediment, and water is severly contaminated with mercury and mercury compounds as a result of the industrial activity of this chemical pla...

  11. Mercury - the hollow planet

    Rothery, D. A.

    2012-04-01

    Mercury is turning out to be a planet characterized by various kinds of endogenous hole (discounting impact craters), which are compared here. These include volcanic vents and collapse features on horizontal scales of tens of km, and smaller scale depressions ('hollows') associated with bright crater-floor deposits (BCFD). The BCFD hollows are tens of metres deep and kilometres or less across and are characteristically flat-floored, with steep, scalloped walls. Their form suggests that they most likely result from removal of surface material by some kind of mass-wasting process, probably associated with volume-loss caused by removal (via sublimation?) of a volatile component. These do not appear to be primarily a result of undermining. Determining the composition of the high-albedo bluish surface coating in BCFDs will be a key goal for BepiColombo instruments such as MIXS (Mercury Imaging Xray Spectrometer). In contrast, collapse features are non-circular rimless pits, typically on crater floors (pit-floor craters), whose morphology suggests collapse into void spaces left by magma withdrawal. This could be by drainage of either erupted lava (or impact melt) or of shallowly-intruded magma. Unlike the much smaller-scale BCFD hollows, these 'collapse pit' features tend to lack extensive flat floors and instead tend to be close to triangular in cross-section with inward slopes near to the critical angle of repose. The different scale and morphology of BCFD hollows and collapse pits argues for quite different modes of origin. However, BCFD hollows adjacent to and within the collapse pit inside Scarlatti crater suggest that the volatile material whose loss was responsible for the growth of the hollows may have been emplaced in association with the magma whose drainage caused the main collapse. Another kind of volcanic collapse can be seen within a 25 km-wide volcanic vent outside the southern rim of the Caloris basin (22.5° N, 146.1° E), on a 28 m/pixel MDIS NAC image

  12. Mercury in dated Greenland marine sediments

    Asmund, G.; Nielsen, S.P.

    2000-01-01

    Twenty marine sediment cores from Greenland were analysed for mercury, and dated by the lead-210 method. In general the cores exhibit a mercury profile with higher mercury concentrations in the upper centimetres of the core. The cores were studied by linear regression of In Hg vs, age of the sedi......Twenty marine sediment cores from Greenland were analysed for mercury, and dated by the lead-210 method. In general the cores exhibit a mercury profile with higher mercury concentrations in the upper centimetres of the core. The cores were studied by linear regression of In Hg vs, age...... indicating that the mercury mainly originates from atmospheric washout. But the large variability indicates that other processes also influence the mercury flux to Arctic marine sediments. (C) 2000 Elsevier Science B.V. All rights reserved....

  13. Sorption of mercury on chemically synthesized polyaniline

    Remya Devi, P.S.; Verma, R.; Sudersanan, M.

    2006-01-01

    Sorption of inorganic mercury (Hg 2+ ) and methyl mercury, on chemically synthesized polyaniline, in 0.1-10N HCl solutions has been studied. Hg 2+ is strongly sorbed at low acidities and the extent of sorption decreases with increase in acidity. The sorption of methyl mercury is very low in the HCl concentration range studied. Sorption of Hg 2+ on polyaniline in 0.1-10N LiCl and H 2 SO 4 solutions has also been studied. The analysis of the data indicates that the sorption of Hg 2+ depends on the degree of protonation of polyaniline and the nature of mercury(II) chloride complexes in solution. X-ray photoelectron spectroscopy analysis (XPS) of polyaniline sorbed with mercury show that mercury is bound as Hg 2+ . Sorbed mercury is quantitatively eluted from polyaniline with 0.5N HNO 3 . Polyaniline can be used for separation and pre-concentration of inorganic mercury from aqueous samples. (author)

  14. Genetic effects of organic mercury compounds

    Ramel, C

    1967-01-01

    Studies on the genetic and developmental effects of organic mercury compounds on lilies, drosophila, and ice were carried out. It was found that chromosomal and developmental abnormalities were correlated with the administration of mercury compounds.

  15. Mercury-Containing Devices and Demolition

    Some items inside residential buildings contain mercury, which poses a persistent and toxic human health and environmental threat. These materials should be carefully salvaged for proper recycling to prevent mercury contamination prior to demolition.

  16. EPA Leadership in the Global Mercury Partnership

    The Global Mercury Partnership is a voluntary multi-stakeholder partnership initiated in 2005 to take immediate actions to protect human health and the environment from the releases of mercury and its compounds to the environment.

  17. Mercury in Thana creek, Bombay harbour

    Zingde, M.D.; Desai, B.N.

    weight) with marked increased from harbour to the creek region suggests substantial mercury input in the head region. Chemical extraction by hydrogen peroxide indicated that more than 70% of mercury was leachable and probably organically bound...

  18. Mercury Lander Mission Concept Study Summary

    Eng, D. A.

    2018-05-01

    Provides a summary of the Mercury Lander Mission Concept Study performed as part of the last Planetary Decadal Survey. The presentation will focus on engineering trades and the challenges of developing a Mercury lander mission.

  19. Mercury Emission Measurement in Coal-Fired Boilers by Continuous Mercury Monitor and Ontario Hydro Method

    Zhu, Yanqun; Zhou, Jinsong; He, Sheng; Cai, Xiaoshu; Hu, Changxin; Zheng, Jianming; Zhang, Le; Luo, Zhongyang; Cen, Kefa

    2007-06-01

    The mercury emission control approach attaches more importance. The accurate measurement of mercury speciation is a first step. Because OH method (accepted method) can't provide the real-time data and 2-week time for results attained, it's high time to seek on line mercury continuous emission monitors(Hg-CEM). Firstly, the gaseous elemental and oxidized mercury were conducted to measure using OH and CEM method under normal operation conditions of PC boiler after ESP, the results between two methods show good consistency. Secondly, through ESP, gaseous oxidized mercury decrease a little and particulate mercury reduce a little bit, but the elemental mercury is just the opposite. Besides, the WFGD system achieved to gaseous oxidized mercury removal of 53.4%, gaseous overall mercury and elemental mercury are 37.1% and 22.1%, respectively.

  20. Cloning, expression, crystallization and preliminary X-ray analysis of a putative multiple antibiotic resistance repressor protein (MarR) from Xanthomonas campestris

    Tu, Zhi-Le; Li, Juo-Ning; Chin, Ko-Hsin; Chou, Chia-Cheng; Lee, Cheng-Chung; Shr, Hui-Lin; Lyu, Ping-Chiang; Gao, Fei Philip; Wang, Andrew H.-J.; Chou, Shan-Ho

    2005-01-01

    A putative repressor for the multiple antibiotic resistance operon from a plant pathogen X. campestris pv. campestris has been overexpressed in E. coli, purified and crystallized. The crystals diffracted to 2.3 Å with good quality. The multiple antibiotic resistance operon (marRAB) is a member of the multidrug-resistance system. When induced, this operon enhances resistance of bacteria to a variety of medically important antibiotics, causing a serious global health problem. MarR is a marR-encoded protein that represses the transcription of the marRAB operon. Through binding with salicylate and certain antibiotics, however, MarR can derepress and activate the marRAB operon. In this report, the cloning, expression, crystallization and preliminary X-ray analysis of XC1739, a putative MarR repressor protein present in the Xanthomonas campestris pv. campestris, a Gram-negative bacterium causing major worldwide disease of cruciferous crops, are described. The XC1739 crystals diffracted to a resolution of at least 1.8 Å. They are orthorhombic and belong to space group P2 1 2 1 2 1 , with unit-cell parameters a = 39.5, b = 54.2 and c = 139.5 Å, respectively. They contain two molecules in the asymmetric unit from calculation of the self-rotation function

  1. Method for the removal and recovery of mercury

    Easterly, Clay E.; Vass, Arpad A.; Tyndall, Richard L.

    1997-01-01

    The present invention is an enhanced method for the removal and recovery of mercury from mercury-contaminated matrices. The method involves contacting a mercury-contaminated matrix with an aqueous dispersant solution derived from specific intra-amoebic isolates to release the mercury from the mercury-contaminated matrix and emulsify the mercury; then, contacting the matrix with an amalgamating metal from a metal source to amalgamate the mercury to the amalgamating metal; removing the metallic source from the mercury-contaminated matrix; and heating the metallic source to vaporize the mercury in a closed system to capture the mercury vapors.

  2. Study of the environmental cycling of mercury

    Garcia Frades, J P; Hildebrand, S G; Huckabee, J W; Murias, B; Diaz, F S; Wilson, R H

    1977-01-01

    A study of mercury in the environment is under way near the mercury mine at Almaden, Spain. The main aspects of the project are: ecology; atmospheric monitoring; and human studies. The mercury deposit at Almaden is described. The liquid effluent from the mine and smelter contains high concentrations of mercury that pollute nearby rivers. Sample collection and analytical methods used in the ecological survey are reviewed. Ecological experiments are considered. Air monitoring studies and human studies currently being performed are assessed. (1 map)

  3. Mercury Continuous Emmission Monitor Calibration

    John Schabron; Eric Kalberer; Ryan Boysen; William Schuster; Joseph Rovani

    2009-03-12

    Mercury continuous emissions monitoring systems (CEMs) are being implemented in over 800 coal-fired power plant stacks throughput the U.S. Western Research Institute (WRI) is working closely with the Electric Power Research Institute (EPRI), the National Institute of Standards and Technology (NIST), and the Environmental Protection Agency (EPA) to facilitate the development of the experimental criteria for a NIST traceability protocol for dynamic elemental mercury vapor calibrators/generators. These devices are used to calibrate mercury CEMs at power plant sites. The Clean Air Mercury Rule (CAMR) which was published in the Federal Register on May 18, 2005 and vacated by a Federal appeals court in early 2008 required that calibration be performed with NIST-traceable standards. Despite the vacature, mercury emissions regulations in the future will require NIST traceable calibration standards, and EPA does not want to interrupt the effort towards developing NIST traceability protocols. The traceability procedures will be defined by EPA. An initial draft traceability protocol was issued by EPA in May 2007 for comment. In August 2007, EPA issued a conceptual interim traceability protocol for elemental mercury calibrators. The protocol is based on the actual analysis of the output of each calibration unit at several concentration levels ranging initially from about 2-40 {micro}g/m{sup 3} elemental mercury, and in the future down to 0.2 {micro}g/m{sup 3}, and this analysis will be directly traceable to analyses by NIST. The EPA traceability protocol document is divided into two separate sections. The first deals with the qualification of calibrator models by the vendors for use in mercury CEM calibration. The second describes the procedure that the vendors must use to certify the calibrators that meet the qualification specifications. The NIST traceable certification is performance based, traceable to analysis using isotope dilution inductively coupled plasma

  4. MODELING MERCURY CONTROL WITH POWDERED ACTIVATED CARBON

    The paper presents a mathematical model of total mercury removed from the flue gas at coal-fired plants equipped with powdered activated carbon (PAC) injection for Mercury control. The developed algorithms account for mercury removal by both existing equipment and an added PAC in...

  5. Plain formation on Mercury: tectonic implications

    Thomas, P.

    1980-01-01

    Four major plain units, plus intermediates, are distinguished on Mercury. The chronologic relationships between these plains indicate that plains formation was a permanent process on Mercury. Their location and morphology seem to indicate a possible volcanic origin for these plains. The relationships between tectonism and volcanism seems to indicate the global contraction is not the only tectonic process on Mercury. (Auth.)

  6. 21 CFR 872.3700 - Dental mercury.

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Dental mercury. 872.3700 Section 872.3700 Food and... DENTAL DEVICES Prosthetic Devices § 872.3700 Dental mercury. (a) Identification. Dental mercury is a... dental cavity or a broken tooth. (b) Classification. Class I. ...

  7. Quarter 9 Mercury information clearinghouse final report

    Laudal, D.L.; Miller, S.; Pflughoeft-Hassett, D.; Ralston, N.; Dunham, G.; Weber, G.

    2005-12-15

    The Canadian Electricity Association (CEA) identified a need and contracted the Energy & Environmental Research Center (EERC) to create and maintain an information clearinghouse on global research and development activities related to mercury emissions from coal-fired electric utilities. A total of eight reports were completed and are summarized and updated in this final CEA quarterly report. Selected topics were discussed in detail in each quarterly report. Issues related to mercury from coal-fired utilities include the general areas of measurement, control, policy, and transformations. Specific topics that have been addressed in previous quarterly reports include the following: Quarterly 1 - Sorbent Control Technologies for Mercury Control; Quarterly 2 - Mercury Measurement; Quarterly 3 - Advanced and Developmental Mercury Control Technologies; Quarterly 4 - Prerelease of Mercury from Coal Combustion By-Products; Quarterly 5 - Mercury Fundamentals; Quarterly 6 - Mercury Control Field Demonstrations; Quarterly 7 - Mercury Regulations in the United States: Federal and State; and Quarterly 8 - Commercialization Aspects of Sorbent Injection Technologies in Canada. In this last of nine quarterly reports, an update of these mercury issues is presented that includes a summary of each topic, with recent information pertinent to advances made since the quarterly reports were originally presented. In addition to a comprehensive update of previous mercury-related topics, a review of results from the CEA Mercury Program is provided. 86 refs., 11 figs., 8 tabs.

  8. 40 CFR 721.10068 - Elemental mercury.

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Elemental mercury. 721.10068 Section... Substances § 721.10068 Elemental mercury. (a) Definitions. The definitions in § 721.3 apply to this section... elemental mercury (CAS. No. 7439-97-6) is subject to reporting under this section for the significant new...

  9. Mercury bioaccumulation in the Mediterranean

    Cinnirella S.

    2013-04-01

    Full Text Available This study details mercury pollution within the food chain of the Mediterranean by analysing the most comprehensive mercury dataset available for biota and water measurements. In this study we computed a bioaccumulation factor (BAF for datasets in the existing mercury-related scientific literature, in on-going programs, and in past measurement campaigns. Preliminary results indicate a major lack of information, making the outcome of any assessment very uncertain. Importantly, not all marine eco-regions are (or have ever been covered by measurement campaigns. Most lacking is information associated with the South-Eastern part of the Mediterranean, and in several eco-regions it is still impossible to reconstruct a trophic net, as the required species were not accounted for when mercury measurements were taken. The datasets also have additional temporal sampling problems, as species were often not sampled systematically (but only sporadically during any given sampling period. Moreover, datasets composed of mercury concentrations in water also suffer from similar geographic limitations, as they are concentrated in the North-Western Mediterranean. Despite these concerns, we found a very clear bioaccumulation trend in 1999, the only year where comprehensive information on both methylmercury concentrations in water and biota was available.

  10. Study of the Behavior and Distribution of Mercury in Soil Samples Collected on the Banks of the Valdeazogues River

    Lominchar, M. A.; Sierra, M. J.; Rodiriguez, J.; Millam, R.

    2010-01-01

    The main objective of this study is to determine the behavior of mercury in the soil of the Valdeazogues river (Almaden, Ciudad Real, Spain) by using a six-step sequential extraction procedure (CIEMAT) and checking the relationship between the percentage of organic matter in soil and the percentage of mercury associated with the exchangeable and oxidizable fractions. The results show that total mercury concentrations in soil range from 116.7 ±24.3 to 245.5 ±59.6 mg kg - 1 of Hg even to concentrations of 350.9 ±68.6 mg kg -1 . However, the available mercury concentration is a smaller percentage of 0.15% of total mercury measured in the samples. Also, the soluble mercury is less than 0,037 mg kg - 1, so that, the leaching process and transport of mercury to surface water and groundwater are very slow. With regard to the distribution of mercury between the different fractions of soil, the metal is associated with more resistant soil fractions, these are: crystalline Fe-Mn oxyhydroxides, organic matter absorbed and the fi nal residue. (Author9) 50 refs.

  11. An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

    Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

    2017-01-15

    The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

  12. Control of mercury emissions: policies, technologies, and future trends

    Rhee, Seung-Whee

    2015-01-01

    Seung-Whee Rhee Department of Environmental Engineering, Kyonggi University, Suwon, Republic of Korea Abstract: Owing to the Minamata Convention on Mercury and the Global Mercury Partnership, policies and regulations on mercury management in advanced countries were intensified by a mercury phaseout program in the mercury control strategy. In developing countries, the legislative or regulatory frameworks on mercury emissions are not established specifically, but mercury management is designed...

  13. Sodium Velocity Maps on Mercury

    Potter, A. E.; Killen, R. M.

    2011-01-01

    The objective of the current work was to measure two-dimensional maps of sodium velocities on the Mercury surface and examine the maps for evidence of sources or sinks of sodium on the surface. The McMath-Pierce Solar Telescope and the Stellar Spectrograph were used to measure Mercury spectra that were sampled at 7 milliAngstrom intervals. Observations were made each day during the period October 5-9, 2010. The dawn terminator was in view during that time. The velocity shift of the centroid of the Mercury emission line was measured relative to the solar sodium Fraunhofer line corrected for radial velocity of the Earth. The difference between the observed and calculated velocity shift was taken to be the velocity vector of the sodium relative to Earth. For each position of the spectrograph slit, a line of velocities across the planet was measured. Then, the spectrograph slit was stepped over the surface of Mercury at 1 arc second intervals. The position of Mercury was stabilized by an adaptive optics system. The collection of lines were assembled into an images of surface reflection, sodium emission intensities, and Earthward velocities over the surface of Mercury. The velocity map shows patches of higher velocity in the southern hemisphere, suggesting the existence of sodium sources there. The peak earthward velocity occurs in the equatorial region, and extends to the terminator. Since this was a dawn terminator, this might be an indication of dawn evaporation of sodium. Leblanc et al. (2008) have published a velocity map that is similar.

  14. Modeling and Experimental Studies of Mercury Oxidation and Adsorption in a Fixed-Bed Reactor

    Buitrago, Paula A.; Morrill, Mike; Lighty, JoAnn S.; Silcox, Geoffrey D.

    2009-06-15

    This report presents experimental and modeling mercury oxidation and adsorption data. Fixed-bed and single-particle models of mercury adsorption were developed. The experimental data were obtained with two reactors: a 300-W, methane-fired, tubular, quartz-lined reactor for studying homogeneous oxidation reactions and a fixed-bed reactor, also of quartz, for studying heterogeneous reactions. The latter was attached to the exit of the former to provide realistic combustion gases. The fixed-bed reactor contained one gram of coconut-shell carbon and remained at a temperature of 150°C. All methane, air, SO2, and halogen species were introduced through the burner to produce a radical pool representative of real combustion systems. A Tekran 2537A Analyzer coupled with a wet conditioning system provided speciated mercury concentrations. At 150°C and in the absence of HCl or HBr, the mercury uptake was about 20%. The addition of 50 ppm HCl caused complete capture of all elemental and oxidized mercury species. In the absence of halogens, SO2 increased the mercury adsorption efficiency to up to 30 percent. The extent of adsorption decreased with increasing SO2 concentration when halogens were present. Increasing the HCl concentration to 100 ppm lessened the effect of SO2. The fixed-bed model incorporates Langmuir adsorption kinetics and was developed to predict adsorption of elemental mercury and the effect of multiple flue gas components. This model neglects intraparticle diffusional resistances and is only applicable to pulverized carbon sorbents. It roughly describes experimental data from the literature. The current version includes the ability to account for competitive adsorption between mercury, SO2, and NO2. The single particle model simulates in-flight sorbent capture of elemental mercury. This model was developed to include Langmuir and Freundlich isotherms, rate equations, sorbent feed rate, and

  15. The transport behaviour of elemental mercury DNAPL in saturated porous media: analysis of field observations and two-phase flow modelling.

    Sweijen, Thomas; Hartog, Niels; Marsman, Annemieke; Keijzer, Thomas J S

    2014-06-01

    Mercury is a contaminant of global concern. The use of elemental mercury in various (former) industrial processes, such as chlorine production at chlor-alkali plants, is known to have resulted in soil and groundwater contaminations worldwide. However, the subsurface transport behaviour of elemental mercury as an immiscible dense non-aqueous phase liquid (DNAPL) in porous media has received minimal attention to date. Even though, such insight would aid in the remediation effort of mercury contaminated sites. Therefore, in this study a detailed field characterization of elemental mercury DNAPL distribution with depth was performed together with two-phase flow modelling, using STOMP. This is to evaluate the dynamics of mercury DNAPL migration and the controls on its distribution in saturated porous media. Using a CPT-probe mounted with a digital camera, in-situ mercury DNAPL depth distribution was obtained at a former chlor-alkali-plant, down to 9 m below ground surface. Images revealing the presence of silvery mercury DNAPL droplets were used to quantify its distribution, characteristics and saturation, using an image analysis method. These field-observations with depth were compared with results from a one-dimensional two-phase flow model simulation for the same transect. Considering the limitations of this approach, simulations reasonably reflected the variability and range of the mercury DNAPL distribution. To further explore the impact of mercury's physical properties in comparison with more common DNAPLs, the migration of mercury and PCE DNAPL in several typical hydrological scenarios was simulated. Comparison of the simulations suggest that mercury's higher density is the overall controlling factor in controlling its penetration in saturated porous media, despite its higher resistance to flow due to its higher viscosity. Based on these results the hazard of spilled mercury DNAPL to cause deep contamination of groundwater systems seems larger than for any other

  16. Intake of mercury through fish consumption

    Sarmani, S.B.; Kiprawi, A.Z.; Ismail, R.B.; Hassan, R.B.; Wood, A.K.; Rahman, S.A.

    1995-01-01

    Fish has been known as a source of non-occupational mercury exposure to fish consuming population groups, and this is shown by the high hair mercury levels. In this study, hair samples collected from fishermen and their families, and commercial marine fishes were analyzed for mercury and methylmercury by neutron activation and gas chromatography. The results showed a correlation between hair mercury levels and fish consumption patterns. The levels of mercury found in this study were similar to those reported by other workers for fish consuming population groups worldwide. (author)

  17. Coal fired flue gas mercury emission controls

    Wu, Jiang; Pan, Weiguo; Pan, Weiping

    2015-01-01

    Mercury (Hg) is one of the most toxic heavy metals, harmful to both the environment and human health. Hg is released into the atmosphere from natural and anthropogenic sources and its emission control has caused much concern. This book introduces readers to Hg pollution from natural and anthropogenic sources and systematically describes coal-fired flue gas mercury emission control in industry, especially from coal-fired power stations. Mercury emission control theory and experimental research are demonstrated, including how elemental mercury is oxidized into oxidized mercury and the effect of

  18. Apparatus for control of mercury

    Downs, William; Bailey, Ralph T.

    2001-01-01

    A method and apparatus for reducing mercury in industrial gases such as the flue gas produced by the combustion of fossil fuels such as coal adds hydrogen sulfide to the flue gas in or just before a scrubber of the industrial process which contains the wet scrubber. The method and apparatus of the present invention is applicable to installations employing either wet or dry scrubber flue gas desulfurization systems. The present invention uses kraft green liquor as a source for hydrogen sulfide and/or the injection of mineral acids into the green liquor to release vaporous hydrogen sulfide in order to form mercury sulfide solids.

  19. The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

    Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

    2008-01-01

    The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

  20. Marine biogeochemistry of mercury

    Gill, G.A.

    1986-01-01

    Noncontaminating sample collection and handling procedures and accurate and sensitive analysis methods were developed to measure sub-picomolar Hg concentrations in seawater. Reliable and diagnostic oceanographic Hg distributions were obtained, permitting major processes governing the marine biogeochemistry of Hg to be identified. Mercury concentrations in the northwest Atlantic, central Pacific, southeast Pacific, and Tasman Sea ranged from 0.5 to 12 pM. Vertical Hg distributions often exhibited a maximum within or near the main thermocline. At similar depths, Hg concentrations in the northwest Atlantic Ocean were elevated compared to the N. Pacific Ocean. This pattern appears to result from a combination of enhanced supply of Hg to the northwest Atlantic by rainfall and scavenging removal along deep water circulation pathways. These observations are supported by geochemical steady-state box modelling which predicts a relatively short mean residence time for Hg in the oceans; demonstrating the reactive nature of Hg in seawater and precluding significant involvement in nutrient-type recyclic. Evidence for the rapid removal of Hg from seawater was obtained at two locations. Surface seawater Hg measurements along 160 0 W (20 0 N to 20 0 S) showed a depression in the equatorial upwelling area which correlated well with the transect region exhibiting low 234 Th/ 238 U activity ratios. This relationship implies that Hg will be scavenged and removed from surface seawater in biologically productive oceanic zones. Further, a broad minimum in the vertical distribution of Hg was observed to coincide with the intense oxygen minimum zone in the water column in coastal waters off Peru

  1. Global Mercury Pathways in the Arctic Ecosystem

    Lahoutifard, N.; Lean, D.

    2003-12-01

    The sudden depletions of atmospheric mercury which occur during the Arctic spring are believed to involve oxidation of gaseous elemental mercury, Hg(0), rendering it less volatile and more soluble. The Hg(II) oxidation product(s) are more susceptible to deposition, consistent with the observation of dramatic increases in snow mercury levels during depletion events. Temporal correlations with ozone depletion events and the proliferation of BrO radicals support the hypothesis that oxidation of Hg(0) occurs in the gas phase and results in its conversion to RGM (Reactive Gaseous Mercury). The mechanisms of Hg(0) oxidation and particularly Hg(II) reduction are as yet unproven. In order to evaluate the feasibility of proposed chemical processes involving mercury in the Arctic atmosphere and its pathway after deposition on the snow from the air, we investigated mercury speciation in air and snow pack at Resolute, Nunavut, Canada (latitude 75° N) prior to and during snow melt during spring 2003. Quantitative, real-time information on emission, air transport and deposition were combined with experimental studies of the distribution and concentrations of different mercury species, methyl mercury, anions, total organic carbon and total inorganic carbon in snow samples. The effect of solar radiation and photoreductants on mercury in snow samples was also investigated. In this work, we quantify mercury removed from the air, and deposited on the snow and the transformation to inorganic and methyl mercury.

  2. Repression of the pyr operon in Lactobacillus plantarum prevents its ability to grow at low carbon dioxide levels

    Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence

    2005-01-01

    Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...

  3. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG

    Orlando Díaz-Hernández

    2010-07-01

    Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  4. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.

    Díaz-Hernández, Orlando; Santillán, Moisés

    2010-01-01

    In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  5. Mercury emission monitoring on municipal waste combustion

    Braun, H.; Gerig, A.

    1991-01-01

    In waste incineration, mercury is the only heavy metal to be released as a gas, mostly as mercury(II) chloride, because of its high volatility. Continuous emission monitoring is possible only when mercury occurs in its elemental form. This paper reports on various possibilities of converting Hg(II) into Hg(0) that has been studied and tested on a laboratory scale and in the TAMARA refuse incineration pilot facility. Continuous mercury emission measurement appears to be possible, provided mercury is converted in the flue gas condensate precipitated. The measuring results obtained on two municipal solid waste and on one sewage treatment sludge incineration plants show that the mercury monitor is a highly sensitive and selective continuously working instrument for mercury emission monitoring

  6. Genetic effects of organic mercury compounds

    Ramel, C

    1967-01-01

    Organic mercury compounds have a c-mitotic effect on plant cells that cause polyploidi. Studies were performed on Allium root cells. These investigations involved methyl mercury dicyandiamide, methyl mercury hydroxide, and phenyl mercury hydroxide. The lowest concentration necessary for a cytologically observable effect was about 0.05 ppM Hg for the methyl compounds. For the phenyl compound, the value was lower. Experiments were performed on Drosophila melanogaster. The question was whether the mercury would reach the gonads. Experimental data with mercury treated larvae indicated a chromosome disjunction. Data indicated a preferential segregation at the meiotic division might be involved. Experiments are being performed on mice inbred (CBA) in order to investigate teratogenic effects and dominant lethality caused by organic mercury compounds. The mutagenic effects of these compounds are studied on Neurospora Drosophila. No conclusive data is now available.

  7. Mercury risk in poultry in the Wanshan Mercury Mine, China

    Yin, Runsheng; Zhang, Wei; Sun, Guangyi; Feng, Zhaohui; Hurley, James P.; Yang, Liyuan; Shang, Lihai; Feng, Xinbin

    2017-01-01

    In this study, total mercury (THg) and methylmercury (MeHg) concentrations in muscles (leg and breast), organs (intestine, heart, stomach, liver) and blood were investigated for backyard chickens, ducks and geese of the Wanshan Mercury Mine, China. THg in poultry meat products range from 7.9 to 3917.1 ng/g, most of which exceeded the Chinese national standard limit for THg in meat (50 ng/g). Elevated MeHg concentrations (0.4–62.8 ng/g) were also observed in meat products, suggesting that poultry meat can be an important human MeHg exposure source. Ducks and geese showed higher Hg levels than chickens. For all poultry species, the highest Hg concentrations were observed in liver (THg: 23.2–3917.1 ng/g; MeHg: 7.1–62.8 ng/g) and blood (THg: 12.3–338.0 ng/g; MeHg: 1.4–17.6 ng/g). We estimated the Hg burdens in chickens (THg: 15.3–238.1 μg; MeHg: 2.2–15.6 μg), ducks (THg: 15.3–238.1 μg; MeHg: 3.5–14.7 μg) and geese (THg: 83.8–93.4 μg; MeHg: 15.4–29.7 μg). To not exceed the daily intake limit for THg (34.2 μg/day) and MeHg (6 μg/day), we suggested that the maximum amount (g) for chicken leg, breast, heart, stomach, intestine, liver, and blood should be 1384, 1498, 2315, 1214, 1081, 257, and 717, respectively; the maximum amount (g) for duck leg, breast, heart, stomach, intestine, liver, and blood should be 750, 1041, 986, 858, 752, 134, and 573, respectively; and the maximum amount (g) for goose leg, breast, heart, stomach, intestine, liver, and blood should be 941, 1051, 1040, 1131, 964, 137, and 562, respectively. - Highlights: • Elevated mercury levels were observed in poultry from Wanshan Mercury Mine, China. • Ducks and geese showed higher mercury levels than chickens. • Liver and blood showed the highest mercury levels. • Poultry can be an important dietary Hg exposure source for local residents. - High levels of Hg associated with poultry surrounding the Wanshan Mercury Mine pose a great risk of Hg exposure to

  8. stg fimbrial operon from S. Typhi STH2370 contributes to association and cell disruption of epithelial and macrophage-like cells.

    Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C

    2015-07-07

    Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.

  9. Biochemical basis of mercury remediation and bioaccumulation by Enterobacter sp. EMB21.

    Sinha, Arvind; Kumar, Sumit; Khare, Sunil Kumar

    2013-01-01

    The aims of this study were to isolate metal bioaccumulating bacterial strains and to study their applications in removal of environmental problematic heavy metals like mercury. Five bacterial strains belonging to genera Enterobacter, Bacillus, and Pseudomonas were isolated from oil-spilled soil. Among these, one of the strains Enterobacter sp. EMB21 showed mercury bioaccumulation inside the cells simultaneous to its bioremediation. The bioaccumulation of remediated mercury was confirmed by transmission electron microscopy and energy dispersive X-ray. The mercury-resistant loci in the Enterobacter sp. EMB21 cells were plasmid-mediated as confirmed by transformation of mercury-sensitive Escherichia coli DH5α by Enterobacter sp. EMB21 plasmid. Effect of different culture parameters viz-a-viz inoculum size, pH, carbon, and nitrogen source revealed that alkaline pH and presence of dextrose and yeast extract favored better remediation. The results indicated the usefulness of Enterobacter sp. EMB21 for the effective remediation of mercury in bioaccumulated form. The Enterobacter sp. EMB21 seems promising for heavy metal remediation wherein the remediated metal can be trapped inside the cells. The process can further be developed for the synthesis of valuable high-end functional alloy, nanoparticles, or metal conjugates from the metal being remediated.

  10. Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity.

    Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T

    2017-11-01

    Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

  11. Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

    2012-01-01

    Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433

  12. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  13. Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

    Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

    2001-01-01

    Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

  14. Behaviour of mercury compounds in soil

    Booer, J R

    1944-01-01

    The uses of inorganic compounds of mercury for the control of plant pests is reviewed, and a summary of the relevant chemical and physical properties of the compounds concerned is given. On chemical evidence a working hypothesis is propounded showing that all compounds may be expected to decompose into metallic mercury. A pot technique is described by means of which a correlation can be obtained between the effective mercury content of a given soil sample and the rate of growth of wheat seedlings. The mathematical treatment of the results is described, and the validity of the pot technique is verified by statistical analysis of results. Using the pot technqiue it is shown that volatilization losses are insignificant but that mercury is slowly rendered ineffective by the formation of mercuric sulphide. The effect of sulphur-reducing bacteria is considered and the influence of Vibrio desulphuricans on mercury is studied in detail. Experimental evidence obtained by the pot technique is produced to show that mercurous chloride slowly decomposes in the soil giving mercury and mercuric chloride, mercuric chloride rapidly decomposes into mercury and mercurous chloride, and other inorganic compounds decompose directly into mercury. The working hypothesis is substantiated in all major aspects. The uses and properties of the organo-mercury compounds are then discussed. Type compounds selected are ethyl mercury phosphate, phenyl mercury acetate and methoxyethyl mercury acetate. Using the pot technique it is shown that the formation of organo-mercury clays takes place and that these clays decompose giving metallic mercury. A mechanism is suggested.

  15. Mercury in the environment : a review

    Goodarzi, F.

    2000-01-01

    Both geogenic and anthropogenic sources are responsible for the input of mercury into the environment. However, mercury comes mostly from geogenic sources and is found naturally in air, water and soil. Crustal degassing results in emission of mercury into the atmosphere. Mercury in water and soil is due mostly to input from sedimentary rocks. Mercury in lake sediments is related mainly to input by country rock and anthropogenic activities such as agriculture. The mercury content of coal is similar to or less than the amount found in the earths crust. Natural charcoal is also able to capture mercury at low temperature combustion. The amount of mercury emitted from the stack of coal-fired power plants is related to the nature of the milled coal and its mineralogical and elemental content. Mercury emissions originating from the combustion of coal from electric utility power plants are considered to be among the greatest contributors to global mercury air emissions. In order to quantify the impact the electric power industry has on the environment, information regarding mercury concentrations in coal and their speciation is needed. For this reason the author examined the behaviour of mercury in three coal samples ashed at increasing temperatures. Mercury removal from coal-fired power plants ranges from 10 to 50 per cent by fabric filters and 20 to 95 per cent by FGD systems. This data will help in regulating emissions of hazardous air pollutants from electric utility steam generating units and will potentially provide insight into the industry's contribution to the global mercury burden. 50 refs

  16. Dissolved gaseous mercury formation and mercury volatilization in intertidal sediments.

    Cesário, Rute; Poissant, Laurier; Pilote, Martin; O'Driscoll, Nelson J; Mota, Ana M; Canário, João

    2017-12-15

    Intertidal sediments of Tagus estuary regularly experiences complex redistribution due to tidal forcing, which affects the cycling of mercury (Hg) between sediments and the water column. This study quantifies total mercury (Hg) and methylmercury (MMHg) concentrations and fluxes in a flooded mudflat as well as the effects on water-level fluctuations on the air-surface exchange of mercury. A fast increase in dissolved Hg and MMHg concentrations was observed in overlying water in the first 10min of inundation and corresponded to a decrease in pore waters, suggesting a rapid export of Hg and MMHg from sediments to the water column. Estimations of daily advective transport exceeded the predicted diffusive fluxes by 5 orders of magnitude. A fast increase in dissolved gaseous mercury (DGM) concentration was also observed in the first 20-30min of inundation (maximum of 40pg L -1 ). Suspended particulate matter (SPM) concentrations were inversely correlated with DGM concentrations. Dissolved Hg variation suggested that biotic DGM production in pore waters is a significant factor in addition to the photochemical reduction of Hg. Mercury volatilization (ranged from 1.1 to 3.3ngm -2 h -1 ; average of 2.1ngm -2 h -1 ) and DGM production exhibited the same pattern with no significant time-lag suggesting a fast release of the produced DGM. These results indicate that Hg sediment/water exchanges in the physical dominated estuaries can be underestimated when the tidal effect is not considered. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Mercury erosion experiments for spallation target system

    Kinoshita, Hidetaka; Kaminaga, Masanori; Haga, Katsuhiro; Hino, Ryutaro

    2003-01-01

    The Japan Atomic Energy Research Institute (JAERI) and the High Energy Accelerator Research Organization (KEK) are promoting a plan to construct the spallation neutron source at the Tokai Research Establishment, JAERI, under the High-Intensity Proton Accelerator Project (J-PARC). A mercury circulation system has been designed so as to supply mercury to the target stably under the rated flow rate of 41 m 3 /hr. Then, it was necessary to confirm a mercury pump performance from the viewpoint of making the mercury circulation system feasible, and more, to investigate erosion rate under the mercury flow as well as an amount of mercury remained on the surface after drain from the viewpoints of mechanical strength relating to the lifetime and remote handling of mercury components. The mercury pump performance was tested under the mercury flow conditions by using an experimental gear pump, which had almost the same structure as a practical mercury pump to be expected in the mercury circulation system, and the erosion rates in a mercury pipeline as well as the amount of mercury remained on the surface were also investigated. The discharged flow rates of the experimental gear pump increased linearly with the rotation speed, so that the gear pump would work as the flow meter. Erosion rates obtained under the mercury velocity less than 1.6 m/s was found to be so small that decrease of pipeline wall thickness would be 390 μm after 30-year operation under the rated mercury velocity of 0.7 m/s. For the amount of remaining mercury on the pipeline, remaining rates of weight and volume were estimated at 50.7 g/m 2 and 3.74 Hg-cm 3 /m 2 , respectively. Applying these remaining rates of weight and volume to the mercury target, the remaining mercury was estimated at about 106.5 g and 7.9 cm 3 . Radioactivity of this remaining mercury volume was found to be three-order lower than that of the target casing. (author)

  18. Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.

    de Oliveira, Rafael R; Nicholson, Wayne L

    2016-01-01

    To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

  19. An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

    Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

    2017-05-01

    Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  20. Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri.

    Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong

    2015-10-23

    The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

  1. The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202.

    Boyd, D A; Mulvey, M R

    2013-02-01

    To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

  2. 76 FR 75446 - Amendment of Class E Airspace; Mercury, NV

    2011-12-02

    ...-0894; Airspace Docket No. 11-AWP-14] Amendment of Class E Airspace; Mercury, NV AGENCY: Federal... Mercury, Desert Rock Airport, Mercury, NV. Decommissioning of the Mercury Non-Directional Beacon (NDB) at Mercury, Desert Rock Airport has made this action necessary for the safety and management of Instrument...

  3. Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

    Galas, D J; Branscomb, E W

    1976-08-12

    The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

  4. Exploiting rRNA operon copy number to investigate bacterial reproductive strategies.

    Roller, Benjamin R K; Stoddard, Steven F; Schmidt, Thomas M

    2016-09-12

    The potential for rapid reproduction is a hallmark of microbial life, but microbes in nature must also survive and compete when growth is constrained by resource availability. Successful reproduction requires different strategies when resources are scarce and when they are abundant 1,2 , but a systematic framework for predicting these reproductive strategies in bacteria has not been available. Here, we show that the number of ribosomal RNA operons (rrn) in bacterial genomes predicts two important components of reproduction-growth rate and growth efficiency-which are favoured under contrasting regimes of resource availability 3,4 . We find that the maximum reproductive rate of bacteria doubles with a doubling of rrn copy number, and the efficiency of carbon use is inversely related to maximal growth rate and rrn copy number. We also identify a feasible explanation for these patterns: the rate and yield of protein synthesis mirror the overall pattern in maximum growth rate and growth efficiency. Furthermore, comparative analysis of genomes from 1,167 bacterial species reveals that rrn copy number predicts traits associated with resource availability, including chemotaxis and genome streamlining. Genome-wide patterns of orthologous gene content covary with rrn copy number, suggesting convergent evolution in response to resource availability. Our findings imply that basic cellular processes adapt in contrasting ways to long-term differences in resource availability. They also establish a basis for predicting changes in bacterial community composition in response to resource perturbations using rrn copy number measurements 5 or inferences 6,7 .

  5. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Løvdal Irene S

    2012-03-01

    Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.

  6. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    2012-01-01

    Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404

  7. Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii

    Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard

    2002-01-01

    Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052

  8. Fatigue properties of type 316LN stainless steel in air and mercury

    Strizak, J.P.; Tian, H.; Liaw, P.K.; Mansur, L.K.

    2005-01-01

    An extensive fatigue testing program on 316LN stainless steel was recently carried out to support the design of the mercury target container for the spallation neutron source (SNS) that is currently under construction at the Oak Ridge National Laboratory in the United States. The major objective was to determine the effects of mercury on fatigue behavior. The S-N fatigue behavior of 316LN stainless steel is characterized by a family of bilinear fatigue curves which are dependent on frequency, environment, mean stress and cold work. Generally, fatigue life increases with decreasing stress and levels off in the high cycle region to an endurance limit below which the material will not fail. For fully reversed loading as well as tensile mean stress loading conditions mercury had no effect on endurance limit. However, at higher stresses a synergistic relationship between mercury and cyclic loading frequency was observed at low frequencies. As expected, fatigue life decreased with decreasing frequency, but the response was more pronounced in mercury compared with air. As a result of liquid metal embrittlement (LME), fracture surfaces of specimens tested in mercury showed widespread brittle intergranular cracking as opposed to typical transgranular cracking for specimens tested in air. For fully reversed loading (zero mean stress) the effect of mercury disappeared as frequency increased to 10 Hz. For mean stress conditions with R-ratios of 0.1 and 0.3, LME was still evident at 10 Hz, but at 700 Hz the effect of mercury had disappeared (R 0.1). Further, for higher R-ratios (0.5 and 0.75) fatigue curves for 10 Hz showed no environmental effect. Finally, cold working (20%) increased tensile strength and hardness, and improved fatigue resistance. Fatigue behavior at 10 and 700 Hz was similar and no environmental effect was observed

  9. Fatigue properties of type 316LN stainless steel in air and mercury

    Strizak, J. P.; Tian, H.; Liaw, P. K.; Mansur, L. K.

    2005-08-01

    An extensive fatigue testing program on 316LN stainless steel was recently carried out to support the design of the mercury target container for the spallation neutron source (SNS) that is currently under construction at the Oak Ridge National Laboratory in the United States. The major objective was to determine the effects of mercury on fatigue behavior. The S- N fatigue behavior of 316LN stainless steel is characterized by a family of bilinear fatigue curves which are dependent on frequency, environment, mean stress and cold work. Generally, fatigue life increases with decreasing stress and levels off in the high cycle region to an endurance limit below which the material will not fail. For fully reversed loading as well as tensile mean stress loading conditions mercury had no effect on endurance limit. However, at higher stresses a synergistic relationship between mercury and cyclic loading frequency was observed at low frequencies. As expected, fatigue life decreased with decreasing frequency, but the response was more pronounced in mercury compared with air. As a result of liquid metal embrittlement (LME), fracture surfaces of specimens tested in mercury showed widespread brittle intergranular cracking as opposed to typical transgranular cracking for specimens tested in air. For fully reversed loading (zero mean stress) the effect of mercury disappeared as frequency increased to 10 Hz. For mean stress conditions with R-ratios of 0.1 and 0.3, LME was still evident at 10 Hz, but at 700 Hz the effect of mercury had disappeared ( R = 0.1). Further, for higher R-ratios (0.5 and 0.75) fatigue curves for 10 Hz showed no environmental effect. Finally, cold working (20%) increased tensile strength and hardness, and improved fatigue resistance. Fatigue behavior at 10 and 700 Hz was similar and no environmental effect was observed.

  10. Touchstones and mercury at Hedeby

    Ježek, Martin; Holub, M.

    2014-01-01

    Roč. 89, č. 1 (2014), s. 193-204 ISSN 0079-4848 Institutional support: RVO:67985912 Keywords : Hedeby * Viking Age * grave goods * touchstone * precious metal * mercury * chemical microanalysis * archaeometallurgy Subject RIV: AC - Archeology, Anthropology, Ethnology Impact factor: 0.278, year: 2014

  11. Venus and Mercury as Planets

    1974-01-01

    A general evolutionary history of the solar planetary system is given. The previously observed characteristics of Venus and Mercury (i.e. length of day, solar orbit, temperature) are discussed. The role of the Mariner 10 space probe in gathering scientific information on the two planets is briefly described.

  12. PERCEPTION OF MERCURY RISK INFORMATION

    Approximately 8% of American women have blood Mercury levels exceeding the EPA reference dose (a dose below which symptoms would be unlikely). The children of these women are at risk of neurological deficits (lower IQ scores) primarily because of the mother's consumption of conta...

  13. Venus and Mercury as planets

    1974-01-01

    A general evolutionary history of the solar planetary system is given. The previously observed characteristics of Venus and Mercury (i.e. length of day, solar orbit, temperature) are discussed. The role of the Mariner 10 space probe in gathering scientific information on the two planets is briefly described

  14. A downstream voyage with mercury

    Heinz, Gary

    2016-01-01

    Retrospective essay for the Bulletin of Environmental Contamination and Toxicology.As I look back on my paper, “Effects of Low Dietary Levels of Methyl Mercury on Mallard Reproduction,” published in 1974 in the Bulletin of Environmental Contamination and Toxicology, a thought sticks in my mind. I realize just how much my mercury research was not unlike a leaf in a stream, carried this way and that, sometimes stalled in an eddy, restarted, and carried downstream at a pace and path that was not completely under my control. I was hired in 1969 by the Patuxent Wildlife Research Center to study the effects of environmental pollutants on the behavior of wildlife. A colleague was conducting a study on the reproductive effects of methylmercury on mallards (Anas platyrhynchos), and he offered to give me some of the ducklings. I conducted a pilot study, testing how readily ducklings approached a tape-recorded maternal call. Sample sizes were small, but the results suggested that ducklings from mercury-treated parents behaved differently than controls. That’s how I got into mercury research—pretty much by chance.

  15. Chemical Form Matters: Differential Accumulation of Mercury Following Inorganic and Organic Mercury Exposures in Zebrafish Larvae

    Korbas, Malgorzata; MacDonald, Tracy C.; Pickering, Ingrid J.; George, Graham N.; Krone, Patrick H. (Saskatchewan)

    2013-04-08

    Mercury, one of the most toxic elements, exists in various chemical forms each with different toxicities and health implications. Some methylated mercury forms, one of which exists in fish and other seafood products, pose a potential threat, especially during embryonic and early postnatal development. Despite global concerns, little is known about the mechanisms underlying transport and toxicity of different mercury species. To investigate the impact of different mercury chemical forms on vertebrate development, we have successfully combined the zebrafish, a well-established developmental biology model system, with synchrotron-based X-ray fluorescence imaging. Our work revealed substantial differences in tissue-specific accumulation patterns of mercury in zebrafish larvae exposed to four different mercury formulations in water. Methylmercury species not only resulted in overall higher mercury burdens but also targeted different cells and tissues than their inorganic counterparts, thus revealing a significant role of speciation in cellular and molecular targeting and mercury sequestration. For methylmercury species, the highest mercury concentrations were in the eye lens epithelial cells, independent of the formulation ligand (chloride versus L-cysteine). For inorganic mercury species, in absence of L-cysteine, the olfactory epithelium and kidney accumulated the greatest amounts of mercury. However, with L-cysteine present in the treatment solution, mercuric bis-L-cysteineate species dominated the treatment, significantly decreasing uptake. Our results clearly demonstrate that the common differentiation between organic and inorganic mercury is not sufficient to determine the toxicity of various mercury species.

  16. The Plasma Environment at Mercury

    Raines, James M.; Gershman, Daniel J.; Zurbuchen, Thomas H.; Gloeckler, George; Slavin, James A.; Anderson, Brian J.; Korth, Haje; Krimigis, Stamatios M.; Killen, Rosemary M.; Sarantos, Menalos; hide

    2011-01-01

    Mercury is the least explored terrestrial planet, and the one subjected to the highest flux of solar radiation in the heliosphere. Its highly dynamic, miniature magnetosphere contains ions from the exosphere and solar wind, and at times may allow solar wind ions to directly impact the planet's surface. Together these features create a plasma environment that shares many features with, but is nonetheless very different from, that of Earth. The first in situ measurements of plasma ions in the Mercury space environment were made only recently, by the Fast Imaging Plasma Spectrometer (FIPS) during the MESSENGER spacecraft's three flybys of the planet in 2008-2009 as the probe was en route to insertion into orbit about Mercury earlier this year. Here. we present analysis of flyby and early orbital mission data with novel techniques that address the particular challenges inherent in these measurements. First. spacecraft structures and sensor orientation limit the FIPS field of view and allow only partial sampling of velocity distribution functions. We use a software model of FIPS sampling in velocity space to explore these effects and recover bulk parameters under certain assumptions. Second, the low densities found in the Mercury magnetosphere result in a relatively low signal-to-noise ratio for many ions. To address this issue, we apply a kernel density spread function to guide removal of background counts according to a background-signature probability map. We then assign individual counts to particular ion species with a time-of-flight forward model, taking into account energy losses in the carbon foil and other physical behavior of ions within the instrument. Using these methods, we have derived bulk plasma properties and heavy ion composition and evaluated them in the context of the Mercury magnetosphere.

  17. Mercury emission from crematories in Japan

    M. Takaoka

    2010-04-01

    Full Text Available Anthropogenic sources of mercury emissions have a significant impact on global pollution. Therefore, finding uncharacterised sources and assessing the emissions from these sources are important. However, limited data are available worldwide on mercury emissions from crematories. In Japan, 99.9% of dead bodies are cremated, which is the highest percentage in the world, and more than 1600 crematories are in operation. We thus focused on emissions from crematories in Japan. The number of targeted facilities was seven, and we used continuous emission monitoring to measure the mercury concentrations and investigate mercury behaviour. The total mercury concentrations in stack gases were a few μg/Nm3 (normal cubic meters. Considering the time profile of mercury and its species in cremations, the findings confirmed that the mercury in stack gas originated from dental amalgam. The amount of mercury emissions was calculated using the total concentration and gas flow rate. Furthermore, the annual amount of mercury emission from crematories in Japan was estimated by using the total number of corpses. The emission amount was considerably lower than that estimated in the United Kingdom. From statistical analyses on population demographics and measurements, future total emissions from crematories were also predicted. As a result, the amount of mercury emitted by crematories will likely increase by 2.6-fold from 2007 to 2037.

  18. Environmental Mercury and Its Toxic Effects

    Kevin M. Rice

    2014-03-01

    Full Text Available Mercury exists naturally and as a man-made contaminant. The release of processed mercury can lead to a progressive increase in the amount of atmospheric mercury, which enters the atmospheric-soil-water distribution cycles where it can remain in circulation for years. Mercury poisoning is the result of exposure to mercury or mercury compounds resulting in various toxic effects depend on its chemical form and route of exposure. The major route of human exposure to methylmercury (MeHg is largely through eating contaminated fish, seafood, and wildlife which have been exposed to mercury through ingestion of contaminated lower organisms. MeHg toxicity is associated with nervous system damage in adults and impaired neurological development in infants and children. Ingested mercury may undergo bioaccumulation leading to progressive increases in body burdens. This review addresses the systemic pathophysiology of individual organ systems associated with mercury poisoning. Mercury has profound cellular, cardiovascular, hematological, pulmonary, renal, immunological, neurological, endocrine, reproductive, and embryonic toxicological effects.

  19. New Mechanisms of Mercury Binding to Peat

    Nagy, K. L.; Manceau, A.; Gasper, J. D.; Ryan, J. N.; Aiken, G. R.

    2007-12-01

    Mercury can be immobilized in the aquatic environment by binding to peat, a solid form of natural organic matter. Binding mechanisms can vary in strength and reversibility, and therefore will control concentrations of bioreactive mercury, may explain rates of mercury methylation, and are important for designing approaches to improve water quality using natural wetlands or engineered phytoremediation schemes. In addition, strong binding between mercury and peat is likely to result in the fixation of mercury that ultimately resides in coal. The mechanisms by which aqueous mercury at low concentrations reacts with both dissolved and solid natural organic matter remain incompletely understood, despite recent efforts. We have identified three distinct binding mechanisms of divalent cationic mercury to solid peats from the Florida Everglades using EXAFS spectroscopic data (FAME beamline, European Synchrotron Radiation Facility (ESRF)) obtained on experimental samples as compared to relevant references including mercury-bearing solids and mercury bound to various organic molecules. The proportions of the three molecular configurations vary with Hg concentration, and two new configurations that involve sulfur ligands occur at Hg concentrations up to about 4000 ppm. The binding mechanism at the lowest experimental Hg concentration (60-80 ppm) elucidates published reports on the inhibition of metacinnabar formation in the presence of Hg-bearing solutions and dissolved natural organic matter, and also, the differences in extent of mercury methylation in distinct areas of the Florida Everglades.

  20. Mercury emissions from municipal solid waste combustors

    1993-05-01

    This report examines emissions of mercury (Hg) from municipal solid waste (MSW) combustion in the United States (US). It is projected that total annual nationwide MSW combustor emissions of mercury could decrease from about 97 tonnes (1989 baseline uncontrolled emissions) to less than about 4 tonnes in the year 2000. This represents approximately a 95 percent reduction in the amount of mercury emitted from combusted MSW compared to the 1989 mercury emissions baseline. The likelihood that routinely achievable mercury emissions removal efficiencies of about 80 percent or more can be assured; it is estimated that MSW combustors in the US could prove to be a comparatively minor source of mercury emissions after about 1995. This forecast assumes that diligent measures to control mercury emissions, such as via use of supplemental control technologies (e.g., carbon adsorption), are generally employed at that time. However, no present consensus was found that such emissions control measures can be implemented industry-wide in the US within this time frame. Although the availability of technology is apparently not a limiting factor, practical implementation of necessary control technology may be limited by administrative constraints and other considerations (e.g., planning, budgeting, regulatory compliance requirements, etc.). These projections assume that: (a) about 80 percent mercury emissions reduction control efficiency is achieved with air pollution control equipment likely to be employed by that time; (b) most cylinder-shaped mercury-zinc (CSMZ) batteries used in hospital applications can be prevented from being disposed into the MSW stream or are replaced with alternative batteries that do not contain mercury; and (c) either the amount of mercury used in fluorescent lamps is decreased to an industry-wide average of about 27 milligrams of mercury per lamp or extensive diversion from the MSW stream of fluorescent lamps that contain mercury is accomplished.

  1. Comparative Examination of Reconnection-Driven Magnetotail Dynamics at Mercury and Earth

    Slavin, J. A.

    2014-12-01

    becomes quasi-periodic. Unlike the Earth, solar wind dynamic pressure increases at Mercury couple directly to its large iron core. Magnetic fields due to induction currents in Mercury's interior strongly resist compression of the dayside magnetosphere. The effects of such inductive coupling on magnetotail dynamics at Mercury remains to be determined.

  2. Spore Heat Activation Requirements and Germination Responses Correlate with Sequences of Germinant Receptors and with the Presence of a Specific spoVA2mob Operon in Foodborne Strains of Bacillus subtilis.

    Krawczyk, Antonina O; de Jong, Anne; Omony, Jimmy; Holsappel, Siger; Wells-Bennik, Marjon H J; Kuipers, Oscar P; Eijlander, Robyn T

    2017-04-01

    Spore heat resistance, germination, and outgrowth are problematic bacterial properties compromising food safety and quality. Large interstrain variation in these properties makes prediction and control of spore behavior challenging. High-level heat resistance and slow germination of spores of some natural Bacillus subtilis isolates, encountered in foods, have been attributed to the occurrence of the spoVA 2mob operon carried on the Tn 1546 transposon. In this study, we further investigate the correlation between the presence of this operon in high-level-heat-resistant spores and their germination efficiencies before and after exposure to various sublethal heat treatments (heat activation, or HA), which are known to significantly improve spore responses to nutrient germinants. We show that high-level-heat-resistant spores harboring spoVA 2mob required higher HA temperatures for efficient germination than spores lacking spoVA 2mob The optimal spore HA requirements additionally depended on the nutrients used to trigger germination, l-alanine (l-Ala), or a mixture of l-asparagine, d-glucose, d-fructose, and K + (AGFK). The distinct HA requirements of these two spore germination pathways are likely related to differences in properties of specific germinant receptors. Moreover, spores that germinated inefficiently in AGFK contained specific changes in sequences of the GerB and GerK germinant receptors, which are involved in this germination response. In contrast, no relation was found between transcription levels of main germination genes and spore germination phenotypes. The findings presented in this study have great implications for practices in the food industry, where heat treatments are commonly used to inactivate pathogenic and spoilage microbes, including bacterial spore formers. IMPORTANCE This study describes a strong variation in spore germination capacities and requirements for a heat activation treatment, i.e., an exposure to sublethal heat that increases

  3. pIMP-PH114 carrying bla IMP-4 in a Klebsiella pneumoniae strain is closely related to other multidrug-resistant IncA/C2 plasmids.

    Ho, Pak-Leung; Lo, Wai-U; Chan, Jane; Cheung, Yuk-Yam; Chow, Kin-Hung; Yam, Wing-Cheong; Lin, Chi-Ho; Que, Tak-Lun

    2014-02-01

    The IncA/C plasmids are broad host-range vehicles which have been associated with wide dissemination of CMY-2 among Enterobacteriaceae of human and animal origins. Acquired metallo-β-lactamases (MBLs) such as the IMP-type enzymes are increasingly reported in multidrug-resistant Gram-negative bacteria worldwide, particularly in Enterobacteriaceae. We described the complete sequence of the first IMP-4-encoding IncA/C2 plasmid, pIMP-PH114 (151,885 bp), from a sequence type 1 Klebsiella pneumoniae strain that was recovered from a patient who was hospitalized in the Philippines. pIMP-PH114 consists of a backbone from the IncA/C2 plasmids, with the insertion of a novel Tn21-like class 1 integron composite structure (containing the cassette array bla IMP-4-qacG-aacA4-catB3, followed by a class C β-lactamase bla DHA-1 and the mercury resistance operon, merRTPCADE) and a sul2-floR encoding region. Phylogenetic analysis of the IncA/C repA sequences showed that pIMP-PH114 formed a subgroup with other IncA/C plasmids involved in the international spread of CMY-2, TEM-24 and NDM-1. Identical bla IMP-4 arrays have been described among different Enterobacteriaceae and Acinetobacter spp. in China, Singapore and Australia but the genetic context is different. The broad host range of IncA/C plasmids may have facilitated dissemination of the bla IMP-4 arrays among different diverse groups of bacteria.

  4. Overview of Mercury Magnetospheric Orbiter (MMO) for BepiColombo

    Murakami, G.; Hayakawa, H.; Fujimoto, M.; BepiColombo Project Team

    2018-05-01

    The next Mercury exploration mission BepiColombo will be launched in October 2018 and will arrive at Mercury in December 2025. We present the current status, science goals, and observation plans of JAXA's Mercury Magnetospheric Orbiter (MMO).

  5. Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

    Brøndsted, Lone; Atlung, Tove

    1996-01-01

    The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

  6. Spatial variation of mercury bioaccumulation in bats of Canada linked to atmospheric mercury deposition.

    Chételat, John; Hickey, M Brian C; Poulain, Alexandre J; Dastoor, Ashu; Ryjkov, Andrei; McAlpine, Donald; Vanderwolf, Karen; Jung, Thomas S; Hale, Lesley; Cooke, Emma L L; Hobson, Dave; Jonasson, Kristin; Kaupas, Laura; McCarthy, Sara; McClelland, Christine; Morningstar, Derek; Norquay, Kaleigh J O; Novy, Richard; Player, Delanie; Redford, Tony; Simard, Anouk; Stamler, Samantha; Webber, Quinn M R; Yumvihoze, Emmanuel; Zanuttig, Michelle

    2018-06-01

    Wildlife are exposed to neurotoxic mercury at locations distant from anthropogenic emission sources because of long-range atmospheric transport of this metal. In this study, mercury bioaccumulation in insectivorous bat species (Mammalia: Chiroptera) was investigated on a broad geographic scale in Canada. Fur was analyzed (n=1178) for total mercury from 43 locations spanning 20° latitude and 77° longitude. Total mercury and methylmercury concentrations in fur were positively correlated with concentrations in internal tissues (brain, liver, kidney) for a small subset (n=21) of little brown bats (Myotis lucifugus) and big brown bats (Eptesicus fuscus), validating the use of fur to indicate internal mercury exposure. Brain methylmercury concentrations were approximately 10% of total mercury concentrations in fur. Three bat species were mainly collected (little brown bats, big brown bats, and northern long-eared bats [M. septentrionalis]), with little brown bats having lower total mercury concentrations in their fur than the other two species at sites where both species were sampled. On average, juvenile bats had lower total mercury concentrations than adults but no differences were found between males and females of a species. Combining our dataset with previously published data for eastern Canada, median total mercury concentrations in fur of little brown bats ranged from 0.88-12.78μg/g among 11 provinces and territories. Highest concentrations were found in eastern Canada where bats are most endangered from introduced disease. Model estimates of atmospheric mercury deposition indicated that eastern Canada was exposed to greater mercury deposition than central and western sites. Further, mean total mercury concentrations in fur of adult little brown bats were positively correlated with site-specific estimates of atmospheric mercury deposition. This study provides the largest geographic coverage of mercury measurements in bats to date and indicates that atmospheric

  7. Mercury Flow Through the Mercury-Containing Lamp Sector of the Economy of the United States

    Goonan, Thomas G.

    2006-01-01

    Introduction: This Scientific Investigations Report examines the flow of mercury through the mercury-containing lamp sector of the U.S. economy in 2001 from lamp manufacture through disposal or recycling. Mercury-containing lamps illuminate commercial and industrial buildings, outdoor areas, and residences. Mercury is an essential component in fluorescent lamps and high-intensity discharge lamps (high-pressure sodium, mercury-vapor, and metal halide). A typical fluorescent lamp is composed of a phosphor-coated glass tube with electrodes located at either end. Only a very small amount of the mercury is in vapor form. The remainder of the mercury is in the form of either liquid mercury metal or solid mercury oxide (mercury oxidizes over the life of the lamp). When voltage is applied, the electrodes energize the mercury vapor and cause it to emit ultraviolet energy. The phosphor coating absorbs the ultraviolet energy, which causes the phosphor to fluoresce and emit visible light. Mercury-containing lamps provide more lumens per watt than incandescent lamps and, as a result, require from three to four times less energy to operate. Mercury is persistent and toxic within the environment. Mercury-containing lamps are of environmental concern because they are widely distributed throughout the environment and are easily broken in handling. The magnitude of lamp sector mercury emissions, estimated to be 2.9 metric tons per year (t/yr), is small compared with the estimated mercury losses of the U.S. coal-burning and chlor-alkali industries, which are about 70 t/yr and about 90 t/yr, respectively.

  8. Amended Silicated for Mercury Control

    James Butz; Thomas Broderick; Craig Turchi

    2006-12-31

    Amended Silicates{trademark}, a powdered, noncarbon mercury-control sorbent, was tested at Duke Energy's Miami Fort Station, Unit 6 during the first quarter of 2006. Unit 6 is a 175-MW boiler with a cold-side electrostatic precipitator (ESP). The plant burns run-of-the-river eastern bituminous coal with typical ash contents ranging from 8-15% and sulfur contents from 1.6-2.6% on an as-received basis. The performance of the Amended Silicates sorbent was compared with that for powdered activated carbon (PAC). The trial began with a period of baseline monitoring during which no sorbent was injected. Sampling during this and subsequent periods indicated mercury capture by the native fly ash was less than 10%. After the baseline period, Amended Silicates sorbent was injected at several different ratios, followed by a 30-day trial at a fixed injection ratio of 5-6 lb/MMACF. After this period, PAC was injected to provide a comparison. Approximately 40% mercury control was achieved for both the Amended Silicates sorbent and PAC at injection ratios of 5-6 lbs/MMACF. Higher injection ratios did not achieve significantly increased removal. Similar removal efficiencies have been reported for PAC injection trials at other plants with cold-side ESPs, most notably for plants using medium to high sulfur coal. Sorbent injection did not detrimentally impact plant operations and testing confirmed that the use of Amended Silicates sorbent does not degrade fly ash quality (unlike PAC). The cost for mercury control using either PAC or Amended Silicates sorbent was estimated to be equivalent if fly ash sales are not a consideration. However, if the plant did sell fly ash, the effective cost for mercury control could more than double if those sales were no longer possible, due to lost by-product sales and additional cost for waste disposal. Accordingly, the use of Amended Silicates sorbent could reduce the overall cost of mercury control by 50% or more versus PAC for locations where

  9. Human accumulation of mercury in Greenland

    Johansen, Poul; Mulvad, Gert; Pedersen, Henning Sloth

    2007-01-01

    In the Arctic, the traditional diet exposes its people to a high intake of mercury especially from marine mammals. To determine whether the mercury is accumulated in humans, we analyzed autopsy samples of liver, kidney and spleen from adult ethnic Greenlanders who died between 1990 and 1994 from...... a wide range of causes, natural and violent. Liver, kidney and spleen samples from between 33 and 71 case subjects were analyzed for total mercury and methylmercury, and liver samples also for selenium. Metal levels in men and women did not differ and were not related to age except in one case, i.......e. for total mercury in liver, where a significant declining concentration with age was observed. The highest total mercury levels were found in kidney followed by liver and spleen. Methylmercury followed the same pattern, but levels were much lower, constituting only 19% of the total mercury concentration...

  10. Action of mercury as a soil fungicide

    Booer, J R

    1951-01-01

    Metallic mercury and mercury compounds in the soil retard the growth of plants. The development of mosses and lichens is inhibited, and experimental evidence shows that the growth of toadstools on turf and the activity of ascomycetes is retarded by mercury. In vitro, mercury has no fungicidal action but the rate of growth of hyphae is reduced by mercury vapour. The lack of fungicial properties of mercury and its good performance in controlling certain soil-borne diseases are reconciled by assuming that a differential retardation disturbs the relationships necessary for infection. This assumption is supported by diagrams which treat the rates of growth of the parasite and the host as population characteristics normally distributed. 21 references, 10 figures, 5 tables.

  11. Human accumulation of mercury in Greenland

    Johansen, P.; Mulvad, G.; Pedersen, H. S.

    2007-01-01

    a wide range of causes, natural and violent. Liver, kidney and spleen samples from between 33 and 71 case subjects were analyzed for total mercury and methylmercury, and liver samples also for selenium. Metal levels in men and women did not differ and were not related to age except in one case, i......In the Arctic, the traditional diet exposes its people to a high intake of mercury especially from marine mammals. To determine whether the mercury is accumulated in humans, we analyzed autopsy samples of liver, kidney and spleen from adult ethnic Greenlanders who died between 1990 and 1994 from.......e. for total mercury in liver, where a significant declining concentration with age was observed. The highest total mercury levels were found in kidney followed by liver and spleen. Methylmercury followed the same pattern, but levels were much lower, constituting only 19% of the total mercury concentration...

  12. Design study on large-scale mercury loop for engineering test of target of high-intensity proton accelerator

    Hino, Ryutaro; Haga, Katsuhiro; Aita, Hideki; Sekita, Kenji; Sudo, Yukio; Koiso, Kohji; Kaminaga, Masanori; Takahashi, Hiromichi.

    1997-03-01

    A heavy liquid-metal target has been proposed as a representative target of a 5MW-scale neutron source for a neutron scattering facility coupled with a high-intensity proton accelerator. In the report, about mercury considered to be the best material of the heavy liquid-metal target, its properties needed for the design were formulated, and results of research on mercury treatment and of evaluation of heat removal performance on the basis of generating heat obtained by a numerical calculation of a spallation reaction were presented. From these results, a 1.5MW-scale mercury loop which equals to that for the first stage operation of the neutron science program of JAERI was designed conceptually for obtaining design data of the mercury target, and basic flow diagram of the loop and specifications of components were decided: diameter of pipelines flowing mercury at the velocity below 1m/s, power of an electro-magnet pump and structure of a cooler. Through the design, engineering problems were made clear such as selection and development of mercury-resistant materials and optimization of the loop and components for decreasing mercury inventory. (author)

  13. Metal resistance sequences and transgenic plants

    Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.

    1999-10-12

    The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.

  14. Thiosulphate assisted phytoextraction of mercury contaminated soils at the Wanshan Mercury Mining District, Southwest China

    J. Wang

    2013-10-01

    Full Text Available Wanshan, known as the “Mercury Capital” of China, is located in the Southwest of China. Due to the extensive mining and smelting works in the Wanshan area, the local ecosystem has been serious contaminated with mercury. In the present study, a number of soil samples were taken from the Wanshan mercury mining area and the mercury fractionations in soils were analyzed using sequential extraction procedure technique. The obtained results showed that the dominate mercury fractions (represent 95% of total mercury were residual and organic bound mercury. A field trial was conducted in a mercury polluted farmland at the Wanshan mercury mine. Four plant species Brassica juncea Czern. et Coss.var. ASKYC (ASKYC, Brassica juncea Czern. et Coss.var.DPDH (DPDH, Brassica juncea Czern. et Coss.var.CHBD(CHBD, Brassica juncea Czern. et Coss.var.LDZY (LDZY were tested their ability to extract mercury from soil with thiosulphate amendment. The results indicated that the mercury concentration in the roots and shoots of the four plants were significantly increased with thiosulphate treatment. The mercury phytoextraction yield of ASKYC, DPDH, CHBD and LDZY were 92, 526, 294 and 129 g/ha, respectively

  15. Thiosulphate assisted phytoextraction of mercury contaminated soils at the Wanshan Mercury Mining District, Southwest China

    J Wang

    2013-10-01

    Full Text Available Wanshan, known as the “Mercury Capital” of China, is located in the Southwest of China. Due to the extensive mining and smelting works in the Wanshan area, the local ecosystem has been serious contaminated with mercury. In the present study, a number of soil samples were taken from the Wanshan mercury mining area and the mercury fractionations in soils were analyzed using sequential extraction procedure technique. The obtained results showed that the dominate mercury fractions (represent 95% of total mercury were residual and organic bound mercury. A field trial was conducted in a mercury polluted farmland at the Wanshan mercury mine. Four plant species Brassica juncea Czern. et Coss.var. ASKYC (ASKYC, Brassica juncea Czern. et Coss.var.DPDH (DPDH, Brassica juncea Czern. et Coss.var.CHBD(CHBD, Brassica juncea Czern. et Coss.var.LDZY (LDZY were tested their ability to extract mercury from soil with thiosulphate amendment. The results indicated that the mercury concentration in the roots and shoots of the four plants were significantly increased with thiosulphate treatment. The mercury phytoextraction yield of ASKYC, DPDH, CHBD and LDZY were 92, 526, 294 and 129 g/ha, respectively.

  16. Radioactive mercury distribution in biological fluids and excretion in human subjects after inhalation of mercury vapor

    Cherian, M.G.; Hursh, J.B.; Clarkson, T.W.; Allen, J.

    1978-01-01

    The distribution of mercury in red blood cells (RBCs) and plasma, and its excretion in urine and feces are described in five human subjects during the first 7 days following inhalation of radioactive mercury vapor. A major portion (98%) of radioactive mercury in whole blood is initially accumulated in the RBCs and is transferred partly to the plasma compartment until the ratio of mercury in RBCs to plasma is about 2 within 20 h. The cumulative urinary and fecal excretion of mercury for 7 days is about 11.6% of the retained dose, and is closely related to the percent decline in body burden of mercury. There is little correlation between either the urinary excretion and plasma radioactivity of mercury, or the specific activities of urine and plasma mercury, suggesting a mechanism other than a direct glomerular filtration involved in the urinary excretion of recently exposed mercury. These studies suggest that blood mercury levels can be used as an index of recent exposure, while urinary levels may be an index of renal concentration of mercury. However, there is no reliable index for mercury concentration in the brain

  17. Molecular level biodegradation of phenol and its derivatives through dmp operon of Pseudomonas putida: A bio-molecular modeling and docking analysis.

    Ray, Sujay; Banerjee, Arundhati

    2015-10-01

    Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.

  18. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    Luke Czapla

    Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  19. Identification of the Staphylococcus aureus vfrAB operon, a novel virulence factor regulatory locus.

    Bose, Jeffrey L; Daly, Seth M; Hall, Pamela R; Bayles, Kenneth W

    2014-05-01

    During a screen of the Nebraska Transposon Mutant Library, we identified 71 mutations in the Staphylococcus aureus genome that altered hemolysis on blood agar medium. Although many of these mutations disrupted genes known to affect the production of alpha-hemolysin, two of them were associated with an apparent operon, designated vfrAB, that had not been characterized previously. Interestingly, a ΔvfrB mutant exhibited only minor effects on the transcription of the hla gene, encoding alpha-hemolysin, when grown in broth, as well as on RNAIII, a posttranscriptional regulatory RNA important for alpha-hemolysin translation, suggesting that VfrB may function at the posttranscriptional level. Indeed, a ΔvfrB mutant had increased aur and sspAB protease expression under these conditions. However, disruption of the known secreted proteases in the ΔvfrB mutant did not restore hemolytic activity in the ΔvfrB mutant on blood agar. Further analysis revealed that, in contrast to the minor effects of VfrB on hla transcription when strains were cultured in liquid media, the level of hla transcription was decreased 50-fold in the absence of VfrB on solid media. These results demonstrate that while VfrB represses protease expression when strains are grown in broth, hla regulation is highly responsive to factors associated with growth on solid media. Intriguingly, the ΔvfrB mutant displayed increased pathogenesis in a model of S. aureus dermonecrosis, further highlighting the complexity of VfrB-dependent virulence regulation. The results of this study describe a phenotype associated with a class of highly conserved yet uncharacterized proteins found in Gram-positive bacteria, and they shed new light on the regulation of virulence factors necessary for S. aureus pathogenesis.

  20. Untangling the transcription regulatory network of the bacitracin synthase operon in Bacillus licheniformis DW2.

    Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen

    The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.