Isolation of Mercury-Resistant Fungi from Mercury-Contaminated Agricultural Soil

Directory of Open Access Journals (Sweden)

Reginawanti Hindersah

2018-02-01

Full Text Available Illegal gold mining and the resulting gold mine tailing ponds on Buru Island in Maluku, Indonesia have increased Mercury (Hg levels in agricultural soil and caused massive environmental damage. High levels of Hg in soil lowers plant productivity and threatens the equilibrium of the food web. One possible method of handling Hg-contaminated soils is through bioremediation, which could eliminate Hg from the rhizosphere (root zone. In this study, indigenous fungi isolated from Hg-contaminated soil exhibited Hg-resistance in vitro. Soil samples were collected from the rhizosphere of pioneer plants which grew naturally in areas contaminated with gold mine tailing. The fungi’s capacity for Hg-resistance was confirmed by their better growth in chloramphenicol-boosted potato dextrose agar media which contained various HgCl2 concentrations. Four isolates exhibited resistance of up to 25 mg kg−1 of Hg, and in an experiment with young Chinese cabbage (Brassica rapa L. test plants, two fungi species (including Aspergillus were demonstrated to increase the soil’s availability of Hg. The results suggest that Hg-resistant indigenous fungi can mobilize mercury in the soil and serve as potential bioremediation agents for contaminated agricultural land.

Functional characterization of a cadmium resistance operon in Staphylococcus aureus ATCC12600: CadC does not function as a repressor.

Science.gov (United States)

Hoogewerf, Arlene J; Dyk, Lisa A Van; Buit, Tyler S; Roukema, David; Resseguie, Emily; Plaisier, Christina; Le, Nga; Heeringa, Lee; Griend, Douglas A Vander

2015-02-01

Sequencing of a cadmium resistance operon from a Staphylococcus aureus ATCC12600 plasmid revealed that it is identical to a cadCA operon found in MRSA strains. Compared to plasmid-cured and cadC-mutant strains, cadC-positive ATCC12600 cells had increased resistance to cadmium (1 mg ml(-1) cadmium sulfate) and zinc (4 mg ml(-1) zinc sulfate), but not to other metal ions. After growth in media containing 20 µg ml(-1) cadmium sulfate, cadC-mutant cells contained more intracellular cadmium than cadC-positive ATCC12600 cells, suggesting that cadC absence results in impaired cadmium efflux. Electrophoretic mobility shift assays were performed with CadC proteins encoded by the S. aureus ATCC12600 plasmid and by the cadC gene of pI258, which is known to act as a transcriptional repressor and shares only 47% protein sequence identity with ATCC12600 CadC. Mobility shifts occurred when pI258 CadC protein was incubated with the promoter DNA-regions from the pI258 and S. aureus ATCC12600 cadCA operons, but did not occur with S. aureus ATCC12600 CadC protein, indicating that the ATCC12600 CadC protein does not interact with promoter region DNA. This cadCA operon, found in MRSA strains and previously functionally uncharacterized, increases resistance to cadmium and zinc by an efflux mechanism, and CadC does not function as a transcriptional repressor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

Science.gov (United States)

Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

2011-11-01

HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

NARCIS (Netherlands)

Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.

2016-01-01

The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted

Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

Directory of Open Access Journals (Sweden)

Cataldi Angel A

2011-07-01

Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon

Science.gov (United States)

Berendsen, Erwin M.; Koning, Rosella A.; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P.; Wells-Bennik, Marjon H. J.

2016-01-01

Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA2mob, present on a Tn1546 transposon in Bacillus subtilis, leads to profoundly increased wet heat resistance of B. subtilis spores. Such Tn1546 transposon elements including the spoVA2mob operon were also found in several strains of Bacillus amyloliquefaciens and Bacillus licheniformis, and these strains were shown to produce spores with significantly higher resistances to wet heat than their counterparts lacking this transposon. In this study, the locations and compositions of Tn1546 transposons encompassing the spoVA2mob operons in B. amyloliquefaciens and B. licheniformis were analyzed. Introduction of these spoVA2mob operons into B. subtilis 168 (producing spores that are not highly heat resistant) rendered mutant 168 strains that produced high-level heat resistant spores, demonstrating that these elements in B. amyloliquefaciens and B. licheniformis are responsible for high level heat resistance of spores. Assessment of growth of the nine strains of each species between 5.2°C and 57.7°C showed some differences between strains, especially at lower temperatures, but all strains were able to grow at 57.7°C. Strains of B. amyloliquefaciens and B. licheniformis that contain the Tn1546 elements (and produce high-level heat resistant spores) grew at temperatures similar to those of their Tn1546-negative counterparts that produce low-level heat resistant spores. The findings presented in this study allow for detection of B. amyloliquefaciens and B. licheniformis strains that produce highly heat resistant spores in the food chain. PMID:27994575

Isolation, screening and identification of mercury resistant bacteria from mercury contaminated soil

Directory of Open Access Journals (Sweden)

Kowalczyk Anna

2016-01-01

Full Text Available New bacterial strains resistant to high concentration of mercury were obtained and character iz ed focusing on their potential application in bioremediation. The biological material was isolated from soil contaminated with mercury. The ability to removal of Hg from the liquid medium and the effect of the various pH and mercury concentrations in the environment on bacterial strains growth kinetics were tested. The selected strains were identified by analysis of the 16S ribosome subunit coding sequenc es as Pseudomonas syringae. The analysis of Hg concentration in liquid medium as effect of microbial metabolism demonstrated that P. syringae is able to remove almost entire metal from medium after 120 hours of incubation. Obtained results revealed new ability of the isolated strain P. syringae. Analyzed properties of this soil bacteria species able to reduce concentration of Hg ors immobi lize this metal are promising for industrial wastewater treatment and bioremediation of the soils polluted especially by mercury lamps scrapping, measuring instruments, dry batteries, detonators or burning fuels made from crude oil, which may also contain mercury. Selected bacteria strains provide efficient and relatively low-cost bioremediation of the areas and waters contaminated with Hg.

Class IIa bacteriocin resistance in Enterococcus faecalis V583: The mannose PTS operon mediates global transcriptional responses

Directory of Open Access Journals (Sweden)

Opsata Mona

2010-08-01

Full Text Available Abstract Background The class IIa bacteriocin, pediocin PA-1, has clear potential as food preservative and in the medical field to be used against Gram negative pathogen species as Enterococcus faecalis and Listeria monocytogenes. Resistance towards class IIa bacteriocins appear in laboratory and characterization of these phenotypes is important for their application. To gain insight into bacteriocin resistance we studied mutants of E. faecalis V583 resistant to pediocin PA-1 by use of transcriptomic analyses. Results Mutants of E. faecalis V583 resistant to pediocin PA-1 were isolated, and their gene expression profiles were analyzed and compared to the wild type using whole-genome microarray. Significantly altered transcription was detected from about 200 genes; most of them encoding proteins involved in energy metabolism and transport. Glycolytic genes were down-regulated in the mutants, but most of the genes showing differential expression were up-regulated. The data indicate that the mutants were relieved from glucose repression and putative catabolic responsive elements (cre could be identified in the upstream regions of 70% of the differentially expressed genes. Bacteriocin resistance was caused by reduced expression of the mpt operon encoding the mannose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS, and the same transcriptional changes were seen in a mptD-inactivated mutant. This mutant also had decreased transcription of the whole mpt operon, showing that the PTS is involved in its own transcriptional regulation. Conclusion Our data confirm the important role of mannose PTS in class IIa bacteriocin sensitivity and we demonstrate its importance involving global carbon catabolite control.

Tolerance to various toxicants by marine bacteria highly resistant to mercury

Digital Repository Service at National Institute of Oceanography (India)

De, J.; Ramaiah, N.; Mesquita, A.; Verlecar, X.N.

of growth in media containing 5 ppm mercury. Plasmid-curing assays done in this study ascertained that resistance to mercury antibiotics, and toxic xenobiotics is mediated by chromosomally borne genes and/or transposable elements rather than by plasmids...

The Life-cycle of Operons

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

2005-11-18

Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

Mercury resistance and mercuric reductase activities and expression among chemotrophic thermophilic Aquificae.

Science.gov (United States)

Freedman, Zachary; Zhu, Chengsheng; Barkay, Tamar

2012-09-01

Mercury (Hg) resistance (mer) by the reduction of mercuric to elemental Hg is broadly distributed among the Bacteria and Archaea and plays an important role in Hg detoxification and biogeochemical cycling. MerA is the protein subunit of the homodimeric mercuric reductase (MR) enzyme, the central function of the mer system. MerA sequences in the phylum Aquificae form the deepest-branching lineage in Bayesian phylogenetic reconstructions of all known MerA homologs. We therefore hypothesized that the merA homologs in two thermophilic Aquificae, Hydrogenobaculum sp. strain Y04AAS1 (AAS1) and Hydrogenivirga sp. strain 128-5-R1-1 (R1-1), specified Hg resistance. Results supported this hypothesis, because strains AAS1 and R1-1 (i) were resistant to >10 μM Hg(II), (ii) transformed Hg(II) to Hg(0) during cellular growth, and (iii) possessed Hg-dependent NAD(P)H oxidation activities in crude cell extracts that were optimal at temperatures corresponding with the strains' optimal growth temperatures, 55°C for AAS1 and 70°C for R1-1. While these characteristics all conformed with the mer system paradigm, expression of the Aquificae mer operons was not induced by exposure to Hg(II) as indicated by unity ratios of merA transcripts, normalized to gyrA transcripts for hydrogen-grown AAS1 cultures, and by similar MR specific activities in thiosulfate-grown cultures with and without Hg(II). The Hg(II)-independent expression of mer in the deepest-branching lineage of MerA from bacteria whose natural habitats are Hg-rich geothermal environments suggests that regulated expression of mer was a later innovation likely in environments where microorganisms were intermittently exposed to toxic concentrations of Hg.

The Life-cycle of Operons

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

2007-03-15

Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

The Cut-off Value of Blood Mercury Concentration in Relation to Insulin Resistance

Directory of Open Access Journals (Sweden)

Seok-Hoon Lee

2017-09-01

Full Text Available Background : Increased blood mercury concentration is associated with inflammation, and chronic inflammation can cause insulin resistance. We examined the cut-off value of blood mercury in relation to an increased score on the homeostasis model assessment for insulin resistance (HOMA-IR. Methods : We used data from the Korean National Health and Nutrition Examination Survey (2008–2010. Relevant data from 5,184 subjects (2,523 men and 2,661 women were analyzed cross-sectionally. General linear analysis was performed to evaluate the relationship between HOMA-IR score and blood mercury concentration. In addition, we determined the cut-off value of blood mercury concentration in relation to increased HOMA-IR score (> 2.34 using an ROC curve. Results : The mean value of blood mercury concentration in men and women was 5.88 μg/L and 4.11 μg/L, respectively. In men, comparing to the first quartile, HOMA-IR score increased significantly in the third and fourth blood mercury quartiles. In women, however, the increase in HOMA-IR score was not significant. The cut-off value that best represented the association between increased HOMA-IR score and blood mercury concentration in men was found to be 4.71 μg/L. Conclusion : Blood mercury concentration was associated with increased HOMA-IR score in men, and the cut-off value of blood mercury concentration that was correlated with increased HOMA-IR score was around 4.71 μg/L.

Detecting uber-operons in prokaryotic genomes.

Science.gov (United States)

Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

2006-01-01

We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

Unusual rise in mercury-resistant bacteria in coastal environs

Digital Repository Service at National Institute of Oceanography (India)

Ramaiah, N.; De, J.

A sharp rise in mercury-resistant bacteria (MRB) capable of tolerating very high concentration of Hg was observed over the last 3-4 years in the coastal environs of India. While none or negligible colony-forming units (CFU) of bacteria were counted...

Evidence against the selfish operon theory.

Science.gov (United States)

Pál, Csaba; Hurst, Laurence D

2004-06-01

According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

A Synthetic Circuit for Mercury Bioremediation Using Self-Assembling Functional Amyloids.

Science.gov (United States)

Tay, Pei Kun R; Nguyen, Peter Q; Joshi, Neel S

2017-10-20

Synthetic biology approaches to bioremediation are a key sustainable strategy to leverage the self-replicating and programmable aspects of biology for environmental stewardship. The increasing spread of anthropogenic mercury pollution into our habitats and food chains is a pressing concern. Here, we explore the use of programmed bacterial biofilms to aid in the sequestration of mercury. We demonstrate that by integrating a mercury-responsive promoter and an operon encoding a mercury-absorbing self-assembling extracellular protein nanofiber, we can engineer bacteria that can detect and sequester toxic Hg 2+ ions from the environment. This work paves the way for the development of on-demand biofilm living materials that can operate autonomously as heavy-metal absorbents.

Characterization of marine bacteria highly resistant to mercury exhibiting multiple resistances to toxic chemicals

Digital Repository Service at National Institute of Oceanography (India)

De, J.; Ramaiah, N.

, GP15 and GP16) and one Pseudomonas aeruginosa (CH07) which showed comparatively higher resistance to toxic heavy metals and xenobiotics and were used in more detailed experiments. Antibiotic sensitivity of all three isolates after plasmid curing... using Nucleospin Plasmid isolation kit (Macherey Nagel, Germany) and agarose gel electrophoresis. To further confirm the presence/absence of plasmid, two different plasmid curing assays were performed to note the loss, if any, of mercury resistance...

Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

2003-01-01

features that can be distinguished. As additional genomes are thoroughly analyzed, an increasingly refined resolution of the sequential evolutionary steps is clearly possible. These comparisons suggest that present-day trp operons that possess finely tuned regulatory features are under strong positive selection and are able to resist the disruptive evolutionary events that may be experienced by simpler, poorly regulated operons. PMID:12966138

Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

2003-09-01

features that can be distinguished. As additional genomes are thoroughly analyzed, an increasingly refined resolution of the sequential evolutionary steps is clearly possible. These comparisons suggest that present-day trp operons that possess finely tuned regulatory features are under strong positive selection and are able to resist the disruptive evolutionary events that may be experienced by simpler, poorly regulated operons.

REMap: Operon Map of M. tuberculosis

Science.gov (United States)

Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

2016-01-01

A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

ProOpDB: Prokaryotic Operon DataBase.

Science.gov (United States)

Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

2012-01-01

The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

Science.gov (United States)

Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

2014-12-01

Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

The relative value of operon predictions

NARCIS (Netherlands)

Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

Transcriptome dynamics-based operon prediction in prokaryotes.

Science.gov (United States)

Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

2014-05-16

Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

International Nuclear Information System (INIS)

Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

1993-01-01

Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

Diversity and characterization of mercury-resistant bacteria in snow, freshwater and sea-ice brine from the High Arctic

DEFF Research Database (Denmark)

Møller, Annette; Barkay, Tamar; Abu Al-Soud, Waleed

2011-01-01

It is well-established that atmospheric deposition transports mercury from lower latitudes to the Arctic. The role of bacteria in the dynamics of the deposited mercury, however, is unknown. We characterized mercury-resistant bacteria from High Arctic snow, freshwater and sea-ice brine. Bacterial...... densities were 9.4 × 10(5), 5 × 10(5) and 0.9-3.1 × 10(3) cells mL(-1) in freshwater, brine and snow, respectively. Highest cultivability was observed in snow (11.9%), followed by freshwater (0.3%) and brine (0.03%). In snow, the mercury-resistant bacteria accounted for up to 31% of the culturable bacteria, but...

Diversity and characterization of mercury-resistant bacteria in snow, freshwater and sea-ice brine from the High Arctic.

Science.gov (United States)

Møller, Annette K; Barkay, Tamar; Abu Al-Soud, Waleed; Sørensen, Søren J; Skov, Henrik; Kroer, Niels

2011-03-01

It is well-established that atmospheric deposition transports mercury from lower latitudes to the Arctic. The role of bacteria in the dynamics of the deposited mercury, however, is unknown. We characterized mercury-resistant bacteria from High Arctic snow, freshwater and sea-ice brine. Bacterial densities were 9.4 × 10(5), 5 × 10(5) and 0.9-3.1 × 10(3) cells mL(-1) in freshwater, brine and snow, respectively. Highest cultivability was observed in snow (11.9%), followed by freshwater (0.3%) and brine (0.03%). In snow, the mercury-resistant bacteria accounted for up to 31% of the culturable bacteria, but levels of most isolates were not temperature dependent. Of the resistant isolates, 25% reduced Hg(II) to Hg(0). No relation between resistance level, ability to reduce Hg(II) and phylogenetic group was observed. An estimation of the potential bacterial reduction of Hg(II) in snow suggested that it was important in the deeper snow layers where light attenuation inhibited photoreduction. Thus, by reducing Hg(II) to Hg(0), mercury-resistant bacteria may limit the supply of substrate for methylation processes and, hence, contribute to lowering the risk that methylmercury is being incorporated into the Arctic food chains. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon

NARCIS (Netherlands)

Berendsen, Erwin M; Koning, Rosella A; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P; Wells-Bennik, Marjon H J

2016-01-01

Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA(2mob), present on a Tn1546

Final report - Microbial pathways for the reduction of mercury in saturated subsurface sediments

Energy Technology Data Exchange (ETDEWEB)

Tamar barkay; Lily Young; Gerben Zylstra

2009-08-25

Mercury is a component of mixed wastes that have contaminated vast areas of the deep subsurface as a result of nuclear weapon and energy production. While this mercury is mostly bound to soil constituents episodes of groundwater contamination are known in some cases resulting in potable water super saturated with Hg(0). Microbial processes that reduce Hg(II) to the elemental form Hg(0) in the saturated subsurface sediments may contribute to this problem. When we started the project, only one microbial pathway for the reduction of Hg(II), the one mediated by the mer operon in mercury resistant bacteria was known. As we had previously demonstrated that the mer mediated process occurred in highly contaminated environments (Schaefer et al., 2004), and mercury concentrations in the subsurface were reported to be low (Krabbenhoft and Babiarz, 1992), we hypothesized that other microbial processes might be active in reducing Hg(II) to Hg(0) in saturated subsurface environments. The specific goals of our projects were: (1) Investigating the potential for Hg(II) reduction under varying electron accepting conditions in subsurface sediments and relating these potential to mer gene distribution; and (2) Examining the physiological and biochemical characteristics of the interactions of anaerobic bacteria with mercury. The results are briefly summarized with references to published papers and manuscripts in preparation where details about our research can be found. Additional information may be found in copies of our published manuscripts and conference proceedings, and our yearly reports that were submitted through the RIMS system.

Problem-Solving Test: Tryptophan Operon Mutants

Science.gov (United States)

Szeberenyi, Jozsef

2010-01-01

This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

Science.gov (United States)

Narang, Atul; Oehler, Stefan

2017-05-01

The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

Molecular characterization of mercury resistant bacteria inhabiting polluted water bodies of different geographical locations in India

NARCIS (Netherlands)

Jan, A.T.; Azam, M.; Ali, A.; Haq, Q.M.

2012-01-01

Mercury pollution is a major environmental problem that arises as a result of natural processes as well as from anthropogenic sources. In response to toxic mercury compounds, microbes have developed astonishing array of resistance systems to detoxify them. To address this challenge, this study was

Isolation and characterization of chromium, mercury and cadmium resistant bacteria

International Nuclear Information System (INIS)

Bhatti, K.P.; Noor, A.R.

2009-01-01

Ten heavy metal resistant strains were isolated from samples of soil, water and rhizosphere of plant Cynadon Dectylon of Kasur sector. Among these bacteria, four strains Cr-l, Cr- 2, Cr-3 and Cr-4 were showed the resistant to chromium up to 300 mg/L, two strains Cd-1 and Cd-2 resisted cadmium up to 100 mg/L, two strains Cd-3 and Cd-4 resisted cadmium up to 50 mg/L and two strains (Hg-l, Hg-2) were observed resistant to mercury up to 100 mg/L. Their morphological and colonial characteristics were investigated. The families of isolated bacteria are reported i.e. Azotobacteriaceae(C r-l), Enterobacteriacea(eC r-2, Cr-3, Cr-4, Hg-2) and Neisseriaceae(Cd-I, Cd-2, Cd-3, Cd-4, Hg-2). (author)

Isolation, identification and PCR amplification of merA gene from ...

African Journals Online (AJOL)

Mercury resistant Escherichia coli strains have been isolated from different mercury polluted sites of India and their minimum inhibitory concentration (MIC) levels were determined. The zone of inhibition was measured to find the antibiotic sensitivity level. The location of mer operon was determined by transforming the ...

Detoxification of toxic heavy metals by marine bacteria highly resistant to mercury

Digital Repository Service at National Institute of Oceanography (India)

De; Ramaiah, N.; Vardanyan, L.

Pollution in industrial areas is a serious environmental concern, and interest in bacterial resistance to heavy metals is of practical significance. Mercury (Hg), Cadmium (Cd), and lead (Pb) are known to cause damage to living organisms, including...

Characterization of the Metabolically Modified Heavy Metal-Resistant Cupriavidus metallidurans Strain MSR33 Generated for Mercury Bioremediation

Science.gov (United States)

Rojas, Luis A.; Yáñez, Carolina; González, Myriam; Lobos, Soledad; Smalla, Kornelia; Seeger, Michael

2011-01-01

Background Mercury-polluted environments are often contaminated with other heavy metals. Therefore, bacteria with resistance to several heavy metals may be useful for bioremediation. Cupriavidus metallidurans CH34 is a model heavy metal-resistant bacterium, but possesses a low resistance to mercury compounds. Methodology/Principal Findings To improve inorganic and organic mercury resistance of strain CH34, the IncP-1β plasmid pTP6 that provides novel merB, merG genes and additional other mer genes was introduced into the bacterium by biparental mating. The transconjugant Cupriavidus metallidurans strain MSR33 was genetically and biochemically characterized. Strain MSR33 maintained stably the plasmid pTP6 over 70 generations under non-selective conditions. The organomercurial lyase protein MerB and the mercuric reductase MerA of strain MSR33 were synthesized in presence of Hg2+. The minimum inhibitory concentrations (mM) for strain MSR33 were: Hg2+, 0.12 and CH3Hg+, 0.08. The addition of Hg2+ (0.04 mM) at exponential phase had not an effect on the growth rate of strain MSR33. In contrast, after Hg2+ addition at exponential phase the parental strain CH34 showed an immediate cessation of cell growth. During exposure to Hg2+ no effects in the morphology of MSR33 cells were observed, whereas CH34 cells exposed to Hg2+ showed a fuzzy outer membrane. Bioremediation with strain MSR33 of two mercury-contaminated aqueous solutions was evaluated. Hg2+ (0.10 and 0.15 mM) was completely volatilized by strain MSR33 from the polluted waters in presence of thioglycolate (5 mM) after 2 h. Conclusions/Significance A broad-spectrum mercury-resistant strain MSR33 was generated by incorporation of plasmid pTP6 that was directly isolated from the environment into C. metallidurans CH34. Strain MSR33 is capable to remove mercury from polluted waters. This is the first study to use an IncP-1β plasmid directly isolated from the environment, to generate a novel and stable bacterial strain

Characterization of the metabolically modified heavy metal-resistant Cupriavidus metallidurans strain MSR33 generated for mercury bioremediation.

Directory of Open Access Journals (Sweden)

Luis A Rojas

Full Text Available BACKGROUND: Mercury-polluted environments are often contaminated with other heavy metals. Therefore, bacteria with resistance to several heavy metals may be useful for bioremediation. Cupriavidus metallidurans CH34 is a model heavy metal-resistant bacterium, but possesses a low resistance to mercury compounds. METHODOLOGY/PRINCIPAL FINDINGS: To improve inorganic and organic mercury resistance of strain CH34, the IncP-1β plasmid pTP6 that provides novel merB, merG genes and additional other mer genes was introduced into the bacterium by biparental mating. The transconjugant Cupriavidus metallidurans strain MSR33 was genetically and biochemically characterized. Strain MSR33 maintained stably the plasmid pTP6 over 70 generations under non-selective conditions. The organomercurial lyase protein MerB and the mercuric reductase MerA of strain MSR33 were synthesized in presence of Hg(2+. The minimum inhibitory concentrations (mM for strain MSR33 were: Hg(2+, 0.12 and CH(3Hg(+, 0.08. The addition of Hg(2+ (0.04 mM at exponential phase had not an effect on the growth rate of strain MSR33. In contrast, after Hg(2+ addition at exponential phase the parental strain CH34 showed an immediate cessation of cell growth. During exposure to Hg(2+ no effects in the morphology of MSR33 cells were observed, whereas CH34 cells exposed to Hg(2+ showed a fuzzy outer membrane. Bioremediation with strain MSR33 of two mercury-contaminated aqueous solutions was evaluated. Hg(2+ (0.10 and 0.15 mM was completely volatilized by strain MSR33 from the polluted waters in presence of thioglycolate (5 mM after 2 h. CONCLUSIONS/SIGNIFICANCE: A broad-spectrum mercury-resistant strain MSR33 was generated by incorporation of plasmid pTP6 that was directly isolated from the environment into C. metallidurans CH34. Strain MSR33 is capable to remove mercury from polluted waters. This is the first study to use an IncP-1β plasmid directly isolated from the environment, to generate a novel

Molecular Cloning and Expression of Bacterial Mercuric Reductase ...

African Journals Online (AJOL)

In order to characterize the bacterial mercuric reductase (merA) gene, mercury resistant (Hgr) Escherichia coli strains have been isolated from various mercury contaminated sites of India. Their minimum inhibitory concentration (MIC) for Hg and zone of inhibition for different antibiotics were measured, and finally mer operon ...

SEVERAL MECHANISMS OF MERCURY RESISTANCE FOUND IN SOIL ISOLATES FROM PAVLODAR, KAZAKHSTAN

Science.gov (United States)

Abdrashitova, Svetlava A., M.A. Ilyushchenko, A. Yu Kalmykv, S.A. Aitkeldieva, Wendy J. Davis-Hoover and Richard Devereux. In press. Several Mechanisms of Mercury Resistance Found in Soil Isolates from Pavlodar, Kazakhstan (Abstract). To be presented at the Battelle Conference on...

Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus.

Science.gov (United States)

Sahukhal, Gyan S; Elasri, Mohamed O

2014-06-11

Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

Science.gov (United States)

Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

2015-01-01

Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

Metazoan operons accelerate recovery from growth arrested states

Science.gov (United States)

Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

2011-01-01

Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

Science.gov (United States)

Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

2015-05-25

Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

Mercury resistant bacteria from effluents of paint factory : characterisation and mercury uptake ability

International Nuclear Information System (INIS)

Yasmin, A.; Afrasayab, S.; Hasnain, S.

1998-01-01

Twelve Hg-resistant strains [SHg-13,SHg-14, SHg-15, SHg-16, SHg-17, SHg-18, SHg-19, SHg-20, SHg-21, SHg-22, SHg-23, SHg-24] were isolated from the polluted water sample taken from the outlets of ICI paint factory. They could tolerate 350-500 mu g ml/sup -1/ of HgCl/sub 2/ in the solid medium and 25-125 mu g mg/sup -1/ of HgCl/sub 2/ in the liquid medium. All strains had off-white, convex [except SHg-20 which had orange flat colonies] and circular colonies. SHg-13, SHg-15 and SHg-17 were Gram variable rods, while rest of strains had Gram -ve rods. They were strictly aerobic bacteria except SHg-16, SHg-18, SHg-22 and SHg-24 which were facilitative anaerobes. On the basis of morphological and biochemical characters strains SHg-13, Shg-14, SHg-15, SHg-17, SHg-19, SHg-20, SHg-21, SHg-23 were affiliated with family Pseudomonadaceae, whereas strains SHg-16, SHg-18, SHg-22 and SHg-24 could be grouped with family Vibranoaceae. All strains could grow in pH range from 6-9 with different optimum, SHg-14 and SHg-16 yielded maximum growth at 28 deg. C while SHg-17, SHg-18, SHg-20, SHg-22 and SHg-23 showed optimum growth at 32 deg. C, whereas rest of the strains yielded maximum growth at 37 deg. C. They conferred resistance to ampicillin and chloramphenicol, but were sensitive to streptomycin [except SHg-20, SHg-23], kanamycin [except SHg-24] and tetracycline [excluding SHg-13, SHg-18]. These isolates could tolerate a number of other metallic salts. Excluding Shg-19 all strains harbor single plasmid. These strains had the ability to uptake/transform mercury. Maximum mercury uptake was observed by SHg-14 and SHg-15. (author)

Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

Science.gov (United States)

Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

2016-04-01

Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

Mercury accumulation plant Cyrtomium macrophyllum and its potential for phytoremediation of mercury polluted sites.

Science.gov (United States)

Xun, Yu; Feng, Liu; Li, Youdan; Dong, Haochen

2017-12-01

Cyrtomium macrophyllum naturally grown in 225.73 mg kg -1 of soil mercury in mining area was found to be a potential mercury accumulator plant with the translocation factor of 2.62 and the high mercury concentration of 36.44 mg kg -1 accumulated in its aerial parts. Pot experiments indicated that Cyrtomium macrophyllum could even grow in 500 mg kg -1 of soil mercury with observed inhibition on growth but no obvious toxic effects, and showed excellent mercury accumulation and translocation abilities with both translocation and bioconcentration factors greater than 1 when exposed to 200 mg kg -1 and lower soil mercury, indicating that it could be considered as a great mercury accumulating species. Furthermore, the leaf tissue of Cyrtomium macrophyllum showed high resistance to mercury stress because of both the increased superoxide dismutase activity and the accumulation of glutathione and proline induced by mercury stress, which favorited mercury translocation from the roots to the aerial parts, revealing the possible reason for Cyrtomium macrophyllum to tolerate high concentration of soil mercury. In sum, due to its excellent mercury accumulation and translocation abilities as well as its high resistance to mercury stress, the use of Cyrtomium macrophyllum should be a promising approach to remediating mercury polluted soils. Copyright © 2017 Elsevier Ltd. All rights reserved.

msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

Science.gov (United States)

Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

2015-02-01

Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli.

Science.gov (United States)

Kim, Moonjeong; Kim, Kwang-Sun

2017-07-06

The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

Science.gov (United States)

Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

2016-01-01

The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

Multidrug-Resistant CTX-M-(15, 9, 2)- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance).

Science.gov (United States)

Andrade, Leonardo N; Siqueira, Thiago E S; Martinez, Roberto; Darini, Ana Lucia C

2018-01-01

Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes ( sil operon: silE, silS, silR, silC, silF, silB, silA , and silP ) and acquired extended-spectrum cephalosporin and carbapenem resistance genes ( bla CTX-M and bla KPC ) in Enterobacter cloacae Complex (EcC) ( n = 27) and Enterobacter aerogenes ( n = 8) isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump) and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump), arsB (arsenite-efflux pump), terF (tellurite resistance protein), and merA (mercuric reductase) were also investigated. Outstandingly, 21/27 (78%) EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA -positive EcC isolates. Interestingly, 8/20 (40%) E. hormaechei and 5/6 (83%) E. asburiae co-harbored silA/pcoD genes and bla CTX-M-(15,2,or9) and/or bla KPC-2 genes. Frequent occurrences of arsB, terF , and merA genes were detected, especially in silA/pcoD -positive, multidrug-resistant (MDR) and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

Multidrug-Resistant CTX-M-(15, 9, 2- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance

Directory of Open Access Journals (Sweden)

Leonardo N. Andrade

2018-03-01

Full Text Available Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes (sil operon: silE, silS, silR, silC, silF, silB, silA, and silP and acquired extended-spectrum cephalosporin and carbapenem resistance genes (blaCTX−M and blaKPC in Enterobacter cloacae Complex (EcC (n = 27 and Enterobacter aerogenes (n = 8 isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump, arsB (arsenite-efflux pump, terF (tellurite resistance protein, and merA (mercuric reductase were also investigated. Outstandingly, 21/27 (78% EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA-positive EcC isolates. Interestingly, 8/20 (40% E. hormaechei and 5/6 (83% E. asburiae co-harbored silA/pcoD genes and blaCTX−M−(15,2,or9 and/or blaKPC−2 genes. Frequent occurrences of arsB, terF, and merA genes were detected, especially in silA/pcoD-positive, multidrug-resistant (MDR and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

Teaching the Big Ideas of Biology with Operon Models

Science.gov (United States)

Cooper, Robert A.

2015-01-01

This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

Antibiotic-resistant fecal bacteria, antibiotics, and mercury in surface waters of Oakland County, Michigan, 2005-2006

Science.gov (United States)

Fogarty, Lisa R.; Duris, Joseph W.; Crowley, Suzanne L.; Hardigan, Nicole

2007-01-01

Water samples collected from 20 stream sites in Oakland and Macomb Counties, Mich., were analyzed to learn more about the occurrence of cephalosporin-resistant Escherichia coli (E. coli) and vancomycin-resistant enterococci (VRE) and the co-occurrence of antibiotics and mercury in area streams. Fecal indicator bacteria concentrations exceeded the Michigan recreational water-quality standard of 300 E. coli colony forming units (CFU) per 100 milliliters of water in 19 of 35 stream-water samples collected in Oakland County. A gene commonly associated with enterococci from humans was detected in samples from Paint Creek at Rochester and Evans Ditch at Southfield, indicating that human fecal waste is a possible source of fecal contamination at these sites. E. coli resistant to the cephalosporin antibiotics (cefoxitin and/ or ceftriaxone) were found at all sites on at least one occasion. The highest percentages of E. coli isolates resistant to cefoxitin and ceftriaxone were 71 percent (Clinton River at Auburn Hills) and 19 percent (Sashabaw Creek near Drayton Plains), respectively. Cephalosporin-resistant E. coli was detected more frequently in samples from intensively urbanized or industrialized areas than in samples from less urbanized areas. VRE were not detected in any sample collected in this study. Multiple antibiotics (azithromycin, erythromycin, ofloxacin, sulfamethoxazole, and trimethoprim) were detected in water samples from the Clinton River at Auburn Hills, and tylosin (an antibiotic used in veterinary medicine and livestock production that belongs to the macrolide group, along with erythromycin) was detected in one water sample from Paint Creek at Rochester. Concentrations of total mercury were as high as 19.8 nanograms per liter (Evans Ditch at Southfield). There was no relation among percentage of antibiotic-resistant bacteria and measured concentrations of antibiotics or mercury in the water. Genetic elements capable of exchanging multiple antibiotic-resistance

Isolation and Cloning of mercuric reductase gene (merA from mercury-resistant bacteria

Directory of Open Access Journals (Sweden)

Parisa Khoshniyat

2018-03-01

Full Text Available Introduction: Some of the bacteria having merA gene coding mineral mercury reducing enzyme, has genetic potential of Hg removing via reduction of mineral mercury and transformation of that to gas form and finally bioremediation of polluted area. The aim of this study is the isolation of merA gene from resistance bacteria and cloning of that into suitable expression vector and then the environmental bioremediation by the transformation of bacteria with this vector. Materials and methods: A number of bacteria were collected in contaminated areas with mercury in order to isolate merA genes. Polymerase chain reaction had done on the four bacterial genomes including Klebsiella pneumoniae, Pseudomonas aeruginosa, Serratia marcescens and Escherichia coli using the specific primers in order to detect merA gene. For cloning, the primers containing restriction enzyme sites are used, merA gene was isolated and amplified. The amplified fragments were cloned in the expression vector pET21a+ and via heat shock method were transformed into E. coli TOP10 competent cell. For clustering of genes, Mega software version 4 was used and bioanformatic studies were achieved for predicted enzyme. Results: merA gene with 1686 bp in length was isolated from K pneumoniae and E. coli. Recombinant vectors in transgenic bacteria were confirmed by various methods and finally were confirmed by sequencing. The result of clustering these genes with existence genes in NCBI showed high similarity. Discussion and conclusion: The existence of merA gene in bacteria that adapted to Hg pollution area is because of resistance, so with cloning this gene into suitable expression vector and transformation of susceptible bacteria with this vector ability of resistance to Hg in bacteria for bioremediation could be given.

Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

2005-04-12

Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli.

Science.gov (United States)

Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E

2016-01-01

An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

Method and apparatus for monitoring mercury emissions

Science.gov (United States)

Durham, Michael D.; Schlager, Richard J.; Sappey, Andrew D.; Sagan, Francis J.; Marmaro, Roger W.; Wilson, Kevin G.

1997-01-01

A mercury monitoring device that continuously monitors the total mercury concentration in a gas. The device uses the same chamber for converting speciated mercury into elemental mercury and for measurement of the mercury in the chamber by radiation absorption techniques. The interior of the chamber is resistant to the absorption of speciated and elemental mercury at the operating temperature of the chamber.

Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

Science.gov (United States)

Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

2017-01-01

Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

Science.gov (United States)

Crawford, I P; Han, C Y; Silverman, M

1991-01-01

The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

Science.gov (United States)

Lawrence, J

1999-12-01

The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

Evolution and Biophysics of the Escherichia coli lac Operon

Science.gov (United States)

Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

2011-03-01

To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

Bilateral Comparison of Mercury and Gallium Fixed-Point Cells Using Standard Platinum Resistance Thermometer

Science.gov (United States)

Bojkovski, J.; Veliki, T.; Zvizdić, D.; Drnovšek, J.

2011-08-01

The objective of project EURAMET 1127 (Bilateral comparison of triple point of mercury and melting point of gallium) in the field of thermometry is to compare realization of a triple point of mercury (-38.8344 °C) and melting point of gallium (29.7646 °C) between the Slovenian national laboratory MIRS/UL-FE/LMK and the Croatian national laboratory HMI/FSB-LPM using a long-stem 25 Ω standard platinum resistance thermometer (SPRT). MIRS/UL/FE-LMK participated in a number of intercomparisons on the level of EURAMET. On the other hand, the HMI/LPM-FSB laboratory recently acquired new fixed-point cells which had to be evaluated in the process of intercomparisons. A quartz-sheathed SPRT has been selected and calibrated at HMI/LPM-FSB at the triple point of mercury, the melting point of gallium, and the water triple point. A second set of measurements was made at MIRS/UL/FE-LMK. After its return, the SPRT was again recalibrated at HMI/LPM-FSB. In the comparison, the W value of the SPRT has been used. Results of the bilateral intercomparison confirmed that the new gallium cell of the HMI/LPM-FSB has a value that is within uncertainty limits of both laboratories that participated in the exercise, while the mercury cell experienced problems. After further research, a small leakage in the mercury fixed-point cell has been found.

PSYCHROPHILIC PSEUDOMONAS SP. RESISTANT TO MERCURY FROM PAVLODAR, KAZAKHSTAN

Science.gov (United States)

As mercury circulates and deposits globally, the remediation of extensive mercury contamination surrounding a chloralkali plant in Pavlodar, Kazakhstan is critical. High-levels of mercury contamination exist within the confines of the plant, at nearby off-site waste storage and e...

Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

NARCIS (Netherlands)

Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

2013-01-01

Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

Science.gov (United States)

Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

2014-07-08

We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

A Tn5051-like mer-containing transposon identified in a heavy metal tolerant strain Achromobacter sp. AO22

Directory of Open Access Journals (Sweden)

Bhave Mrinal

2009-03-01

Full Text Available Abstract Background Achromobacter sp. AO22 (formerly Alcaligenes sp. AO22, a bacterial strain isolated from a lead-contaminated industrial site in Australia, was previously found to be resistant to moderate to high levels of mercury, copper and other heavy metals. However, the nature and location of the genetic basis for mercuric ion resistance in this strain, had not been previously identified. Findings Achromobacter sp. AO22 contains a functional mer operon with all four essential genes (merRTPA and shows >99% DNA sequence identity to that of Tn501. The mer operon was present on a transposon, designated TnAO22, captured by introducing a broad-host-range IncP plasmid into Achromobacter sp. AO22 and subsequently transferring it to E. coli recipients. The transposition frequency of TnAO22 was 10-2 to 10-3 per target plasmid transferred. Analysis of TnAO22 sequence revealed it belonged to the Tn21 subgroup of the Tn3 superfamily of transposons, with the transposition module having >99% identity with Tn5051 of a Pseudomonas putida strain isolated from a water sample in New York. Conclusion TnAO22 is thus a new variant of Tn5051 of the Tn3 superfamily and the transposon and its associated mercury resistance system are among the few such systems reported in a soil bacterium. Achromobacter sp. AO22 can thus be exploited for applications such as in situ mercury bioremediation of contaminated sites, or the mobile unit and mer operon could be mobilized to other bacteria for similar purposes.

Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

Directory of Open Access Journals (Sweden)

Gogarten J Peter

2008-01-01

Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

Science.gov (United States)

Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

2017-01-01

The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents.

Science.gov (United States)

Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon

2014-01-01

Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.

HosA, a MarR Family Transcriptional Regulator, Represses Nonoxidative Hydroxyarylic Acid Decarboxylase Operon and Is Modulated by 4-Hydroxybenzoic Acid.

Science.gov (United States)

Roy, Ajit; Ranjan, Akash

2016-02-23

Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.

REMap: Operon map of M. tuberculosis based on RNA sequence data.

Science.gov (United States)

Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

2016-07-01

A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

Science.gov (United States)

Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

2012-01-01

During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

Science.gov (United States)

Ray, J. Christian J; Igoshin, Oleg A.

2012-01-01

Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

Functions, Evolution, and Application of the Supramolecular Machines of Hg Detoxification

Energy Technology Data Exchange (ETDEWEB)

Miller, Susan M.

2009-11-27

The bacterial mercury resistance (mer) operon functions in Hg biogeochemistry and bioremediation by converting reactive inorganic [Hg(II)] and organic [RHg(I)] mercurials to relatively inert monoatomic mercury vapor, Hg(0). Its genes regulate expression (MerR, MerD, MerOP), import Hg(II) (MerT, MerP, and MerC), and demethylate (MerB) and reduce (MerA) mercurials. We focus on how these components interact with each other and with the host cell to allow cells to survive and detoxify Hg compounds. Understanding how this ubiquitous detoxification system fits into the biology and ecology of its bacterial host is essential to guide interventions that support and enhance Hg remediation. At a more basic level, studies of interactions between the metal ion trafficking proteins in this pathway provide insights into general mechanisms used by proteins in pathways involved in trafficking of other metal ions in cells of all types of organisms, including pathways for essential metal ions such as Cu and Zn and other toxic metal ions such as Cd. In this project we focused on investigations of proteins from mer operons found in gamma-proteobacteria with specific objectives to use biophysical and biochemical approaches to detect and define (1) interactions between the structural components of the key detoxifying mer operon enzyme, mercuric ion reductase (MerA), (2) interactions between the components of MerA and the other mer operon enzyme, organomercurial lyase (MerB), and (3) to investigate the structure and interactions of integral membrane transport proteins, MerT and MerC, with MerA.

The Genomic Pattern of tDNA Operon Expression in E. coli.

Directory of Open Access Journals (Sweden)

2005-06-01

Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

Solving a discrete model of the lac operon using Z3

Science.gov (United States)

Gutierrez, Natalia A.

2014-05-01

A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

OCCURRENCE OF MERCURY-RESISTANT MICROORGANISMS IN MERCURY-CONTAMINATED SOILS AND SEDIMENTS IN PAVLODAR, KAZAKHSTAN

Science.gov (United States)

There is extensive mercury contamination of soil surrounding a chloralkali plant in Pavlodar, Kazakhstan that operated from 1970 to 1990. High-level mercury contamination exists within the confines of the plant, at nearby off-site waste storage and evaporation ponds, and in Balky...

Mercury (II) removal by resistant bacterial isolates and mercuric (II) reductase activity in a new strain of Pseudomonas sp. B50A.

Science.gov (United States)

Giovanella, Patricia; Cabral, Lucélia; Bento, Fátima Menezes; Gianello, Clesio; Camargo, Flávio Anastácio Oliveira

2016-01-25

This study aimed to isolate mercury resistant bacteria, determine the minimum inhibitory concentration for Hg, estimate mercury removal by selected isolates, explore the mer genes, and detect and characterize the activity of the enzyme mercuric (II) reductase produced by a new strain of Pseudomonas sp. B50A. The Hg removal capacity of the isolates was determined by incubating the isolates in Luria Bertani broth and the remaining mercury quantified by atomic absorption spectrophotometry. A PCR reaction was carried out to detect the merA gene and the mercury (II) reductase activity was determined in a spectrophotometer at 340 nm. Eight Gram-negative bacterial isolates were resistant to high mercury concentrations and capable of removing mercury, and of these, five were positive for the gene merA. The isolate Pseudomonas sp. B50A removed 86% of the mercury present in the culture medium and was chosen for further analysis of its enzyme activity. Mercuric (II) reductase activity was detected in the crude extract of this strain. This enzyme showed optimal activity at pH 8 and at temperatures between 37 °C and 45 °C. The ions NH4(+), Ba(2+), Sn(2+), Ni(2+) and Cd(2+) neither inhibited nor stimulated the enzyme activity but it decreased in the presence of the ions Ca(2+), Cu(+) and K(+). The isolate and the enzyme detected were effective in reducing Hg(II) to Hg(0), showing the potential to develop bioremediation technologies and processes to clean-up the environment and waste contaminated with mercury. Copyright © 2015 Elsevier B.V. All rights reserved.

A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.

Science.gov (United States)

Kim, Dae Hun; Ko, Kwan Soo

2015-07-01

To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

Salmonella enterica Typhimurium fljBA operon stability: implications regarding the origin of Salmonella enterica I 4,[5],12:i:.

Science.gov (United States)

Tomiyama, M P O; Werle, C H; Milanez, G P; Nóbrega, D B; Pereira, J P; Calarga, A P; Flores, F; Brocchi, M

2015-12-29

Salmonella enterica subsp enterica serovar 4,5,12:i:- has been responsible for many recent Salmonella outbreaks worldwide. Several studies indicate that this serovar originated from S. enterica subsp enterica serovar Typhimurium, by the loss of the flagellar phase II gene (fljB) and adjacent sequences. However, at least two different clones of S. enterica 4,5,12:i:- exist that differs in the molecular events responsible for fljB deletion. The aim of this study was to test the stability of the fljBA operon responsible for the flagellar phase variation under different growth conditions in order to verify if its deletion is a frequent event that could explain the origin and dissemination of this serovar. In fact, coding sequences for transposons are present near this operon and in some strains, such as S. enterica Typhimurium LT2, the Fels-2 prophage gene is inserted near this operon. The presence of mobile DNA could confer instability to this region. In order to examine this, the cat (chloramphenicol acetyltransferase) gene was inserted adjacent to the fljBA operon so that deletions involving this genomic region could be identified. After growing S. enterica chloramphenicol-resistant strains under different conditions, more than 104 colonies were tested for the loss of chloramphenicol resistance. However, none of the colonies were sensitive to chloramphenicol. These data suggest that the origin of S. enterica serovar 4,5,12:i:- from Typhimurium by fljBA deletion is not a frequent event. The origin and dissemination of 4,5,12:i:- raise several questions about the role of flagellar phase variation in virulence.

A Study on Mercury-Resistant Bacteria Isolated from a Gold Mine in Pongkor Village, Bogor, Indonesia

Directory of Open Access Journals (Sweden)

WAHYU IRAWATI

2012-12-01

Full Text Available Mercury is one of the major pollutant in the environment which is highly toxic. Bioremediation strategies using bacteria have been proposed as an attractive alternative because this is effective, less expensive and more efficient to remove mercury. Brevundimonas sp. HgP1 and Brevundimonas sp. HgP2 were two highly mercury resistant bacteria isolated from a gold mine in Pongkor village with MIC of 575 ppm. The purposes of the research were to study the effect of mercury on bacterial growth and morphological changes of bacterial colony and to measure the ability of bacterial isolates to accumulate Hg2+. The growth was monitored by measuring optical density at 600 nm, whereas accumulation of Hg2+ was measured by mercury vaporation unit. This present studies revealed that the addition of 50 and 100 ppm HgCl2 in Brevundimonas sp. HgP1 resulted in the decreasing of growth rate and the elongation of lag phase in 8 and 16 hours, respectively. The addition of HgCl2 also affected morphological appearance of the bacterial colony to black. Brevundimonas sp. HgP1 accumulated Hg2+ up to 1.09 and 2.7 mg/g dry weight of cells and removed 64.38 and 57.10% Hg2+ from the medium containing 50 and 100 ppm HgCl2, respectively.

Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

Science.gov (United States)

García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

2017-09-01

Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

Science.gov (United States)

Igoshin, Oleg

2011-03-01

Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

Rapid customised operon assembly by yeast recombinational cloning.

Science.gov (United States)

Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

2017-06-01

We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

Science.gov (United States)

Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

2018-01-01

Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

Genome Sequences of Two Copper-Resistant Escherichia coli Strains Isolated from Copper-Fed Pigs

DEFF Research Database (Denmark)

Lüthje, Freja L.; Hasman, Henrik; Aarestrup, Frank Møller

2014-01-01

The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances.......The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances....

Phytoremediation of Ionic and Methyl Mercury Pollution

Energy Technology Data Exchange (ETDEWEB)

Meagher, Richard B.

2004-12-01

Phytoremediation is defined as the use of plants to extract, resist, detoxify, and/or sequester toxic environmental pollutants. The long-term goal of the proposed research is to develop and test highly productive, field-adapted plant species that have been engineered for the phytoremediation of mercury. A variety of different genes, which should enable plants to clean mercury polluted sites are being tested as tools for mercury phytoremediation, first in model laboratory plants and then in potential field species. Several of these genes have already been shown to enhance mercury phytoremediation. Mercury pollution is a serious, world-wide problem affecting the health of human and wildlife populations. Environmentally, the most serious mercury threat is the production of methylmercury (CH3Hg+) by native bacteria at mercury contaminated wetland sites. Methylmercury is inherently more toxic than metallic (Hg(0)) or ionic (Hg(II)) mercury, and because methylmercury is prolifically biomagnified up the food chain, it poses the most immediate danger to animal populations. We have successfully engineered two model plants, Arabidopsis and tobacco, to use the bacterial merB gene to convert methylmercury to less toxic ionic mercury and to use the bacterial merA gene to further detoxify ionic mercury to the least toxic form of mercury, metallic mercury. Plants expressing both MerA and MerB proteins detoxify methylmercury in two steps to the metallic form. These plants germinate, grow, and set seed at normal growth rates on levels of methylmercury or ionic mercury that are lethal to normal plants. Our newest efforts involve engineering plants with several additional bacterial and plant genes that allow for higher levels of mercury resistance and mercury hyperaccumulation. The potential for these plants to hyperaccumulate mercury was further advanced by developing constitutive, aboveground, and root-specific gene expression systems.

Characterization of a Mycobacterium avium subsp. avium Operon Associated with Virulence and Drug Detoxification

Directory of Open Access Journals (Sweden)

Mariana Noelia Viale

2014-01-01

Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

Science.gov (United States)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

Daptomycin Tolerance in the Staphylococcus aureus pitA6 Mutant Is Due to Upregulation of the dlt Operon.

Science.gov (United States)

Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich

2016-05-01

Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

OCCURRENCE OF MICROORGANISMS RESISTANT TO MERCURY IN MERCURY CONTAMINATED SOILS AND SEDIMENTS IN PAVLODAR, KAZAKHSTAN

Science.gov (United States)

There is extensive mercury contamination of soil surrounding a chloralkali plant in Pavlodar, Kazakhstan that operated from 1970 to 1990. High-level mercury contamination exists within the confines of the plant, at nearby off-site waste storage and evaporation ponds, and in Balky...

Phytoremediation of Ionic and Methyl Mercury Pollution

Energy Technology Data Exchange (ETDEWEB)

Meagher, Richard B.

2005-06-01

Phytoremediation is defined as the use of plants to extract, resist, detoxify, and/or sequester toxic environmental pollutants. The long-term goal of the proposed research is to develop and test highly productive, field-adapted plant species that have been engineered for the phytoremediation of mercury. A variety of different genes, which should enable plants to clean mercury polluted sites are being tested as tools for mercury phytoremediation, first in model laboratory plants and then in potential field species. Several of these genes have already been shown to enhance mercury phytoremediation. Mercury pollution is a serious, world-wide problem affecting the health of human and wildlife populations. Environmentally, the most serious mercury threat is the production of methylmercury (CH3Hg+) by native bacteria at mercury contaminated wetland sites. Methylmercury is inherently more toxic than metallic (Hg(0)) or ionic (Hg(II)) mercury, and because methylmercury is prolifically biomagnified up the food chain, it poses the most immediate danger to animal populations. We have successfully engineered two model plants, Arabidopsis and tobacco, to use the bacterial merB gene to convert methylmercury to less toxic ionic mercury and to use the bacterial merA gene to further detoxify ionic mercury to the least toxic form of mercury, metallic mercury. Plants expressing both MerA and MerB proteins detoxify methylmercury in two steps to the metallic form. These plants germinate, grow, and set seed at normal growth rates on levels of methylmercury or ionic mercury that are lethal to normal plants. Our newest efforts involve engineering plants with several additional bacterial and plant genes that allow for higher levels of mercury resistance and mercury hyperaccumulation. The potential for these plants to hyperaccumulate mercury was further advanced by developing constitutive, aboveground, and root-specific gene expression systems. Our current strategy is to engineer plants to

An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

Science.gov (United States)

Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

2013-07-01

The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Phytoremediation of Ionic and Methyl Mercury Pollution

Energy Technology Data Exchange (ETDEWEB)

Meagher, Richard B.

2005-06-01

Phytoremediation is defined as the use of plants to extract, resist, detoxify, and/or sequester toxic environmental pollutants. The long-term goal of the proposed research is to develop and test highly productive, field-adapted plant species that have been engineered for the phytoremediation of mercury. A variety of different genes, which should enable plants to clean mercury polluted sites are being tested as tools for mercury phytoremediation, first in model laboratory plants and then in potential field species. Several of these genes have already been shown to enhance mercury phytoremediation. Mercury pollution is a serious, world-wide problem affecting the health of human and wildlife populations. Environmentally, the most serious mercury threat is the production of methylmercury (CH3Hg+) by native bacteria at mercury contaminated wetland sites. Methylmercury is inherently more toxic than metallic (Hg(0)) or ionic (Hg(II)) mercury, and because methylmercury is prolifically biomagnified up the food chain, it poses the most immediate danger to animal populations. We have successfully engineered two model plants, Arabidopsis and tobacco, to use the bacterial merB gene to convert methylmercury to less toxic ionic mercury and to use the bacterial merA gene to further detoxify ionic mercury to the least toxic form of mercury, metallic mercury. Plants expressing both MerA and MerB proteins detoxify methylmercury in two steps to the metallic form. These plants germinate, grow, and set seed at normal growth rates on levels of methylmercury or ionic mercury that are lethal to normal plants. Our newest efforts involve engineering plants with several additional bacterial and plant genes that allow for higher levels of mercury resistance and mercury hyperaccumulation. The potential for these plants to hyperaccumulate mercury was further advanced by developing constitutive, aboveground, and root-specific gene expression systems. Our current strategy is to engineer plants to

Characterization of mercury bioremediation by transgenic bacteria expressing metallothionein and polyphosphate kinase

Directory of Open Access Journals (Sweden)

Gonzalez-Ruiz Gloriene

2011-08-01

Full Text Available Abstract Background The use of transgenic bacteria has been proposed as a suitable alternative for mercury remediation. Ideally, mercury would be sequestered by metal-scavenging agents inside transgenic bacteria for subsequent retrieval. So far, this approach has produced limited protection and accumulation. We report here the development of a transgenic system that effectively expresses metallothionein (mt-1 and polyphosphate kinase (ppk genes in bacteria in order to provide high mercury resistance and accumulation. Results In this study, bacterial transformation with transcriptional and translational enhanced vectors designed for the expression of metallothionein and polyphosphate kinase provided high transgene transcript levels independent of the gene being expressed. Expression of polyphosphate kinase and metallothionein in transgenic bacteria provided high resistance to mercury, up to 80 μM and 120 μM, respectively. Here we show for the first time that metallothionein can be efficiently expressed in bacteria without being fused to a carrier protein to enhance mercury bioremediation. Cold vapor atomic absorption spectrometry analyzes revealed that the mt-1 transgenic bacteria accumulated up to 100.2 ± 17.6 μM of mercury from media containing 120 μM Hg. The extent of mercury remediation was such that the contaminated media remediated by the mt-1 transgenic bacteria supported the growth of untransformed bacteria. Cell aggregation, precipitation and color changes were visually observed in mt-1 and ppk transgenic bacteria when these cells were grown in high mercury concentrations. Conclusion The transgenic bacterial system described in this study presents a viable technology for mercury bioremediation from liquid matrices because it provides high mercury resistance and accumulation while inhibiting elemental mercury volatilization. This is the first report that shows that metallothionein expression provides mercury resistance and

Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis

Science.gov (United States)

Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel

2015-01-01

The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis.

Science.gov (United States)

Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent

2015-09-01

The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

CONDOP: an R package for CONdition-Dependent Operon Predictions.

Science.gov (United States)

Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

2016-10-15

The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Science.gov (United States)

Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin

2013-01-01

The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

Science.gov (United States)

Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

2012-01-01

Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

A conservative region of the mercuric reductase gene (merA) as a molecular marker of bacterial mercury resistance Região conservada do gene da mercúrio redutase (merA) como marcador molecular da resistência bacteriana ao mercúrio

OpenAIRE

Adriana Sotero-Martins; Michele Silva de Jesus; Michele Lacerda; Josino Costa Moreira; Ana Luzia Lauria Filgueiras; Paulo Rubens Guimarães Barrocas

2008-01-01

The most common bacterial mercury resistance mechanism is based on the reduction of Hg(II) to Hg0, which is dependent of the mercuric reductase enzyme (MerA) activity. The use of a 431 bp fragment of a conservative region of the mercuric reductase (merA) gene was applied as a molecular marker of this mechanism, allowing the identification of mercury resistant bacterial strains.O mecanismo de resistência bacteriana ao mercúrio mais comum é baseada na redução do Hg(II) a Hg0, através da ativida...

The pyrimidine operon pyrRPB-carA from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Schallert, J.; Andersen, Birgit

2001-01-01

The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

DEFF Research Database (Denmark)

Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

1994-01-01

Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Muhammad Afzal

2016-09-01

Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

Science.gov (United States)

Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

2016-01-01

Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

Mechanism of mercuric chloride resistance in microorganisms. I. Vaporization of a mercury compound from mercuric chloride by multiple drug resistant strains of Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Komura, I; Izaki, K

1971-01-01

Three strains of Escherichia coli possessing the multiple drug resistance were found to be resistant also to HgCl/sub 2/, though they were sensitive to other heavy metal ions such as nickel, cobalt, cadmium and zinc ions. Like the resistance to drugs such as chloramphenicol and tetracycline, the HgCl/sub 2/ resistance could be transferred from a resistant strain of E. coli to sensitive strains of E. coli and Aerobacter aerogenes. The resistant strains could grow in the presence of 0.02 mM HgCl/sub 2/, whereas a sensitive strain failed to grow in the presence of 0.01 mM HgCl/sub 2/. During cultivation in the presence of HgCl/sub 2/, the cells of resistant strain vaporized a form of radioactive mercury when incubated with /sup 203/HgCl/sub 2/, glucose and NaCl in phosphate buffer while the cells of sensitive strain showed no such activity. This phenomenon seemed to explain the HgCl/sub 2/ resistance of the resistant strains.

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

NARCIS (Netherlands)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

The post-transcriptional operon

DEFF Research Database (Denmark)

Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

2011-01-01

model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

Uptake of mercury vapor by wheat. An assimilation model

International Nuclear Information System (INIS)

Browne, C.L.; Fang, S.C.

1978-01-01

Using a whole-plant chamber and 203 Hg-labeled mercury, a quantitative study was made of the effect of environmental parameters on the uptake, by wheat (Triticum aestivum), of metallic mercury vapor, an atmospheric pollutant. Factors were examined in relation to their influence on components of the gas-assimilation model, U(Hg) = (C/sub A' -- C/sub L')/(r/sub L.Hg/ + r/sub M.Hg/) where U(Hg) is the rate of mercury uptake per unit leaf surface, C/sub A'/ is the ambient mercury vapor concentration, C/sub L'/ is the mercury concentration at immobilization sites within the plant (assumed to be zero), r/sub L.Hg/ is the total leaf resistance to mercury vapor exchange, and r/sub M.Hg/ is a residual term to account for unexplained physical and biochemical resistances to mercury vapor uptake. Essentially all mercury vapor uptake was confined to the leaves. r/sub L.Hg/ was particularly influenced by illumination (0 to 12.8 klux), but unaffected by ambient temperature (17 to 33 0 C) and mercury vapor concentration (0 to 40 μg m -3 ). The principal limitation to mercury vapor uptake was r/sub M.Hg/, which was linearly related to leaf temperature, but unaffected by mercury vapor concentration and illumination, except for apparent high values in darkness. Knowing C/sub A'/ and estimating r/sub L.Hg/ and r/sub M.Hg/ from experimental data, mercury vapor uptake by wheat in light was accurately predicted for several durations of exposure using the above model

Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

OpenAIRE

Stewart, V; Yanofsky, C

1986-01-01

We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

Directory of Open Access Journals (Sweden)

Juliana Teixeira de Magalhães

2005-06-01

Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

Acclimation of subsurface microbial communities to mercury

DEFF Research Database (Denmark)

de Lipthay, Julia R; Rasmussen, Lasse D; Øregaard, Gunnar

2008-01-01

of mercury tolerance and functional versatility of bacterial communities in contaminated soils initially were higher for surface soil, compared with the deeper soils. However, following new mercury exposure, no differences between bacterial communities were observed, which indicates a high adaptive potential......We studied the acclimation to mercury of bacterial communities of different depths from contaminated and noncontaminated floodplain soils. The level of mercury tolerance of the bacterial communities from the contaminated site was higher than those of the reference site. Furthermore, the level...... of the subsurface communities, possibly due to differences in the availability of mercury. IncP-1 trfA genes were detected in extracted community DNA from all soil depths of the contaminated site, and this finding was correlated to the isolation of four different mercury-resistance plasmids, all belonging...

Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

Directory of Open Access Journals (Sweden)

Dharmesh Harwani

2014-12-01

Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

Science.gov (United States)

Harwani, Dharmesh

2014-01-01

Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

THE BEHAVIOR OF MICROORGANISMS RESISTANT TO MERCURY FROM PAVLODAR, KAZAKHSTAN

Science.gov (United States)

There is extensive mercury contamination surrounding a chloralkali plant in Pavlodar, Kazakhstan that operated from 1970 to 1990. High-level mercury contamination exists within the confines of the plant, at nearby off-site waste storage and evaporation ponds, in Balkyldak Lake w...

Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

Science.gov (United States)

Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

2016-01-01

Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

Identification of VanN-type vancomycin resistance in an Enterococcus faecium isolate from chicken meat in Japan.

Science.gov (United States)

Nomura, Takahiro; Tanimoto, Koichi; Shibayama, Keigo; Arakawa, Yoshichika; Fujimoto, Shuhei; Ike, Yasuyoshi; Tomita, Haruyoshi

2012-12-01

Five VanN-type vancomycin-resistant Enterococcus faecium strains were isolated from a sample of domestic chicken meat in Japan. All isolates showed low-level resistance to vancomycin (MIC, 12 mg/liter) and had the same pulsed-field gel electrophoresis profile. The vancomycin resistance was encoded on a large plasmid (160 kbp) and was expressed constitutively. The VanN-type resistance operon was identical to the first resistance operon to be reported, with the exception of a 1-bp deletion in vanT(N) and a 1-bp substitution in vanS(N).

Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

Directory of Open Access Journals (Sweden)

Catherine E Dana

Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

Structural organization of the transfer RNA operon I of Vibrio cholerae

Indian Academy of Sciences (India)

Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression

Directory of Open Access Journals (Sweden)

Ziqing eDeng

2013-07-01

Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

Directory of Open Access Journals (Sweden)

Jeffrey R Johansen

Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

Detecting Airborne Mercury by Use of Palladium Chloride

Science.gov (United States)

Ryan, Margaret; Shevade, Abhijit; Kisor, Adam; Homer, Margie; Jewell, April; Manatt, Kenneth; Torres, Julia; Soler, Jessica; Taylor, Charles

2009-01-01

Palladium chloride films have been found to be useful as alternatives to the gold films heretofore used to detect airborne elemental mercury at concentrations of the order of parts per billion (ppb). Somewhat more specifically, when suitably prepared palladium chloride films are exposed to parts-per-billion or larger concentrations of airborne mercury, their electrical resistances change by amounts large enough to be easily measurable. Because airborne mercury adversely affects health, it is desirable to be able to detect it with high sensitivity, especially in enclosed environments in which there is a risk of leakage of mercury from lamps or other equipment. The detection of mercury by use of gold films involves the formation of gold/mercury amalgam. Gold films offer adequate sensitivity for detection of airborne mercury and could easily be integrated into an electronic-nose system designed to operate in the temperature range of 23 to 28 C. Unfortunately, in order to regenerate a gold-film mercury sensor, one must heat it to a temperature of 200 C for several minutes in clean flowing air. In preparation for an experiment to demonstrate the present sensor concept, palladium chloride was deposited from an aqueous solution onto sets of gold electrodes and sintered in air to form a film. Then while using the gold electrodes to measure the electrical resistance of the films, the films were exposed, at a temperature of 25 C, to humidified air containing mercury at various concentrations from 0 to 35 ppb (see figure). The results of this and other experiments have been interpreted as signifying that sensors of this type can detect mercury in room-temperature air at concentrations of at least 2.5 ppb and can readily be regenerated at temperatures <40 C.

Resistance to the Peptidyl Transferase Inhibitor Tiamulin Caused by Mutation of Ribosomal Protein L3

OpenAIRE

Bøsling, Jacob; Poulsen, Susan M.; Vester, Birte; Long, Katherine S.

2003-01-01

The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ri...

A rhizosphere-associated symbiont, Photobacterium spp. strain MELD1, and its targeted synergistic activity for phytoprotection against mercury.

Directory of Open Access Journals (Sweden)

Dony Chacko Mathew

Full Text Available Though heavy metal such as mercury is toxic to plants and microorganisms, the synergistic activity between them may offer benefit for surviving. In this study, a mercury-reducing bacterium, Photobacterium spp. strain MELD1, with an MIC of 33 mg x kg(-1 mercury was isolated from a severely mercury and dioxin contaminated rhizosphere soil of reed (Phragmites australis. While the whole genome sequencing of MELD1 confirmed the presence of a mer operon, the mercury reductase MerA gene showed 99% sequence identity to Vibrio shilloni AK1 and implicates its route resulted from the event of horizontal gene transfer. The efficiency of MELD1 to vaporize mercury (25 mg x kg(-1, 24 h and its tolerance to toxic metals and xenobiotics such as lead, cadmium, pentachlorophenol, pentachloroethylene, 3-chlorobenzoic acid, 2,3,7,8-tetrachlorodibenzo-p-dioxin and 1,2,3,7,8,9-hexachlorodibenzo-p-dioxin is promising. Combination of a long yard bean (Vigna unguiculata ssp. Sesquipedalis and strain MELD1 proved beneficial in the phytoprotection of mercury in vivo. The effect of mercury (Hg on growth, distribution and tolerance was examined in root, shoot, leaves and pod of yard long bean with and without the inoculation of strain MELD1. The model plant inoculated with MELD1 had significant increases in biomass, root length, seed number, and increased mercury uptake limited to roots. Biolog plate assay were used to assess the sole-carbon source utilization pattern of the isolate and Indole-3-acetic acid (IAA productivity was analyzed to examine if the strain could contribute to plant growth. The results of this study suggest that, as a rhizosphere-associated symbiont, the synergistic activity between the plant and MELD1 can improve the efficiency for phytoprotection, phytostabilization and phytoremediation of mercury.

A rhizosphere-associated symbiont, Photobacterium spp. strain MELD1, and its targeted synergistic activity for phytoprotection against mercury.

Science.gov (United States)

Mathew, Dony Chacko; Ho, Ying-Ning; Gicana, Ronnie Gicaraya; Mathew, Gincy Marina; Chien, Mei-Chieh; Huang, Chieh-Chen

2015-01-01

Though heavy metal such as mercury is toxic to plants and microorganisms, the synergistic activity between them may offer benefit for surviving. In this study, a mercury-reducing bacterium, Photobacterium spp. strain MELD1, with an MIC of 33 mg x kg(-1) mercury was isolated from a severely mercury and dioxin contaminated rhizosphere soil of reed (Phragmites australis). While the whole genome sequencing of MELD1 confirmed the presence of a mer operon, the mercury reductase MerA gene showed 99% sequence identity to Vibrio shilloni AK1 and implicates its route resulted from the event of horizontal gene transfer. The efficiency of MELD1 to vaporize mercury (25 mg x kg(-1), 24 h) and its tolerance to toxic metals and xenobiotics such as lead, cadmium, pentachlorophenol, pentachloroethylene, 3-chlorobenzoic acid, 2,3,7,8-tetrachlorodibenzo-p-dioxin and 1,2,3,7,8,9-hexachlorodibenzo-p-dioxin is promising. Combination of a long yard bean (Vigna unguiculata ssp. Sesquipedalis) and strain MELD1 proved beneficial in the phytoprotection of mercury in vivo. The effect of mercury (Hg) on growth, distribution and tolerance was examined in root, shoot, leaves and pod of yard long bean with and without the inoculation of strain MELD1. The model plant inoculated with MELD1 had significant increases in biomass, root length, seed number, and increased mercury uptake limited to roots. Biolog plate assay were used to assess the sole-carbon source utilization pattern of the isolate and Indole-3-acetic acid (IAA) productivity was analyzed to examine if the strain could contribute to plant growth. The results of this study suggest that, as a rhizosphere-associated symbiont, the synergistic activity between the plant and MELD1 can improve the efficiency for phytoprotection, phytostabilization and phytoremediation of mercury.

A Rhizosphere-Associated Symbiont, Photobacterium spp. Strain MELD1, and Its Targeted Synergistic Activity for Phytoprotection against Mercury

Science.gov (United States)

Mathew, Dony Chacko; Ho, Ying-Ning; Gicana, Ronnie Gicaraya; Mathew, Gincy Marina; Chien, Mei-Chieh; Huang, Chieh-Chen

2015-01-01

Though heavy metal such as mercury is toxic to plants and microorganisms, the synergistic activity between them may offer benefit for surviving. In this study, a mercury-reducing bacterium, Photobacterium spp. strain MELD1, with an MIC of 33 mg . kg-1 mercury was isolated from a severely mercury and dioxin contaminated rhizosphere soil of reed (Phragmites australis). While the whole genome sequencing of MELD1 confirmed the presence of a mer operon, the mercury reductase MerA gene showed 99% sequence identity to Vibrio shilloni AK1 and implicates its route resulted from the event of horizontal gene transfer. The efficiency of MELD1 to vaporize mercury (25 mg . kg-1, 24 h) and its tolerance to toxic metals and xenobiotics such as lead, cadmium, pentachlorophenol, pentachloroethylene, 3-chlorobenzoic acid, 2,3,7,8-tetrachlorodibenzo-p-dioxin and 1,2,3,7,8,9-hexachlorodibenzo-p-dioxin is promising. Combination of a long yard bean (Vigna unguiculata ssp. Sesquipedalis) and strain MELD1 proved beneficial in the phytoprotection of mercury in vivo. The effect of mercury (Hg) on growth, distribution and tolerance was examined in root, shoot, leaves and pod of yard long bean with and without the inoculation of strain MELD1. The model plant inoculated with MELD1 had significant increases in biomass, root length, seed number, and increased mercury uptake limited to roots. Biolog plate assay were used to assess the sole-carbon source utilization pattern of the isolate and Indole-3-acetic acid (IAA) productivity was analyzed to examine if the strain could contribute to plant growth. The results of this study suggest that, as a rhizosphere-associated symbiont, the synergistic activity between the plant and MELD1 can improve the efficiency for phytoprotection, phytostabilization and phytoremediation of mercury. PMID:25816328

UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

International Nuclear Information System (INIS)

Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

1994-01-01

UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

Cloning, expression, crystallization and preliminary X-ray analysis of a putative multiple antibiotic resistance repressor protein (MarR) from Xanthomonas campestris

International Nuclear Information System (INIS)

Tu, Zhi-Le; Li, Juo-Ning; Chin, Ko-Hsin; Chou, Chia-Cheng; Lee, Cheng-Chung; Shr, Hui-Lin; Lyu, Ping-Chiang; Gao, Fei Philip; Wang, Andrew H.-J.; Chou, Shan-Ho

2005-01-01

A putative repressor for the multiple antibiotic resistance operon from a plant pathogen X. campestris pv. campestris has been overexpressed in E. coli, purified and crystallized. The crystals diffracted to 2.3 Å with good quality. The multiple antibiotic resistance operon (marRAB) is a member of the multidrug-resistance system. When induced, this operon enhances resistance of bacteria to a variety of medically important antibiotics, causing a serious global health problem. MarR is a marR-encoded protein that represses the transcription of the marRAB operon. Through binding with salicylate and certain antibiotics, however, MarR can derepress and activate the marRAB operon. In this report, the cloning, expression, crystallization and preliminary X-ray analysis of XC1739, a putative MarR repressor protein present in the Xanthomonas campestris pv. campestris, a Gram-negative bacterium causing major worldwide disease of cruciferous crops, are described. The XC1739 crystals diffracted to a resolution of at least 1.8 Å. They are orthorhombic and belong to space group P2 1 2 1 2 1 , with unit-cell parameters a = 39.5, b = 54.2 and c = 139.5 Å, respectively. They contain two molecules in the asymmetric unit from calculation of the self-rotation function

Cop-like operon: Structure and organization in species of the Lactobacillale order

Directory of Open Access Journals (Sweden)

ANGÉLICA REYES

2006-01-01

Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

Elucidation of Operon Structures across Closely Related Bacterial Genomes

Science.gov (United States)

Li, Guojun

2014-01-01

About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

Some like it cold: microbial transformations of mercury in polar regions

Directory of Open Access Journals (Sweden)

Niels Kroer

2011-12-01

Full Text Available The contamination of polar regions with mercury that is transported from lower latitudes as inorganic mercury has resulted in the accumulation of methylmercury (MeHg in food chains, risking the health of humans and wildlife. While production of MeHg has been documented in polar marine and terrestrial environments, little is known about the responsible transformations and transport pathways and the processes that control them. We posit that as in temperate environments, microbial transformations play a key role in mercury geochemical cycling in polar regions by: (1 methylating mercury by one of four proposed pathways, some not previously described; (2 degrading MeHg by activities of mercury resistant and other bacteria; and (3 carrying out redox transformations that control the supply of the mercuric ion, the substrate of methylation reactions. Recent analyses have identified a high potential for mercury-resistant microbes that express the enzyme mercuric reductase to affect the production of gaseous elemental mercury when and where daylight is limited. The integration of microbially mediated processes in the paradigms that describe mercury geochemical cycling is therefore of high priority especially in light of concerns regarding the effect of global warming and permafrost thawing on input of MeHg to polar regions.

The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

Science.gov (United States)

Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

2015-03-17

Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

Antibiotic combination therapy can select for broad-spectrum multidrug resistance in Pseudomonas aeruginosa

DEFF Research Database (Denmark)

Vestergaard, Martin; Paulander, Wilhelm; Marvig, Rasmus L.

2016-01-01

with the resistance evolved after single-drug exposure. Combination therapy selected for mutants that displayed broad-spectrum resistance, and a major resistance mechanism was mutational inactivation of the repressor gene mexR that regulates the multidrug efflux operon mexAB–oprM. Deregulation of this operon led...... to a broad-spectrum resistance phenotype that decreased susceptibility to the combination of drugs applied during selection as well as to unrelated antibiotic classes. Mutants isolated after single-drug exposure displayed narrow-spectrum resistance and carried mutations in the MexCD–OprJ efflux pump...... regulator gene nfxB conferring ciprofloxacin resistance, or in the gene encoding the non-essential penicillin-binding protein DacB conferring ceftazidime resistance. Reconstruction of resistance mutations by allelic replacement and in vitro fitness assays revealed that in contrast to single antibiotic use...

Mercury

International Nuclear Information System (INIS)

Vilas, F.; Chapman, C.R.; Matthews, M.S.

1988-01-01

Papers are presented on future observations of and missions to Mercury, the photometry and polarimetry of Mercury, the surface composition of Mercury from reflectance spectrophotometry, the Goldstone radar observations of Mercury, the radar observations of Mercury, the stratigraphy and geologic history of Mercury, the geomorphology of impact craters on Mercury, and the cratering record on Mercury and the origin of impacting objects. Consideration is also given to the tectonics of Mercury, the tectonic history of Mercury, Mercury's thermal history and the generation of its magnetic field, the rotational dynamics of Mercury and the state of its core, Mercury's magnetic field and interior, the magnetosphere of Mercury, and the Mercury atmosphere. Other papers are on the present bounds on the bulk composition of Mercury and the implications for planetary formation processes, the building stones of the planets, the origin and composition of Mercury, the formation of Mercury from planetesimals, and theoretical considerations on the strange density of Mercury

Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

Science.gov (United States)

Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

2011-10-01

Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

The potential for Probiotic Bacteria from milkfish intestine in reducing mercury metals in skimmed milk media

Science.gov (United States)

Dwyana, Zaraswati; Priosambodo, D.; Haedar, N.; Erviani, A. E.; Djabura, A. K.; Sukma, R.

2018-03-01

Mercury (Hg) is one of the heavy metals that is harmful to humans. The accumulation of mercury in the body is generally derived from food. Several types of bacteria from intestine of milkfish are known to reduce mercury concentration. People can take advantage of this bacterial ability by eating it through probiotic foods. This research conducted to figure out the potential for probiotic bacteria from milkfish intestine in reducing mercury. Isolation from probiotic bacteria from milkfish intestine conducted with grown the isolates in MRSA medium with addition of 1% CaCO3. Twelve isolate were obtained from milkfish intestine. Mercury resistance tested was performed by measuring cell density using a spectrophotometer at concentrations of 10, 15 and 20 ppm respectively in skim milk media. Probiotic tests (gastric acid, bile salts and antimicrobial activity) for MRSB media was also conducted. Results showed that seven isolate were resistant to mercury in all concentrations and potential as probiotics. All resistant isolate then tested for skim milk media with addition of 5, 10, 20 ppm mercury acetate respectively. Result showed that only one isolated was able to reduce the concentration of mercury (Hg) in all variations on concentration and potential as mercury reducer probiotic bacteria.

Dynamic model of gene regulation for the lac operon

International Nuclear Information System (INIS)

Angelova, Maia; Ben-Halim, Asma

2011-01-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

Dynamic model of gene regulation for the lac operon

Energy Technology Data Exchange (ETDEWEB)

Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

2011-03-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

Superconducting Mercury-Based Cuprate Films with a Zero-Resistance Transition Temperature of 124 Kelvin

Science.gov (United States)

Tsuei, C. C.; Gupta, A.; Trafas, G.; Mitzi, D.

1994-03-01

The synthesis of high-quality films of the recently discovered mercury-based cuprate films with high transition temperatures has been plagued by problems such as the air sensitivity of the cuprate precursor and the volatility of Hg and HgO. These processing difficulties have been circumvented by a technique of atomic-scale mixing of the HgO and cuprate precursors, use of a protective cap layer, and annealing in an appropriate Hg and O_2 environment. With this procedure, a zero-resistance transition temperature as high as 124 kelvin in c axis-oriented epitaxial HgBa_2CaCu_2O6+δ films has been achieved.

Superconducting mercury-based cuprate films with a zero-resistance transition temperature of 124 Kelvin.

Science.gov (United States)

Tsuei, C C; Gupta, A; Trafas, G; Mitzi, D

1994-03-04

The synthesis of high-quality films of the recently discovered mercury-based cuprate films with high transition temperatures has been plagued by problems such as the air sensitivity of the cuprate precursor and the volatility of Hg and HgO. These processing difficulties have been circumvented by a technique of atomic-scale mixing of the HgO and cuprate precursors, use of a protective cap layer, and annealing in an appropriate Hg and O(2) environment. With this procedure, a zero-resistance transition temperature as high as 124 kelvin in c axis-oriented epitaxial HgBa(2)CaCu(2)O(6+delta) films has been achieved.

Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

Science.gov (United States)

Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

2017-10-01

One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

Science.gov (United States)

Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

2016-09-01

The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

Prevalence of transcription promoters within archaeal operons and coding sequences.

Science.gov (United States)

Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

2009-01-01

Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

Science.gov (United States)

Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

2015-03-01

The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Contribution of the nos-pdt operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.

Directory of Open Access Journals (Sweden)

April M Sapp

Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and

CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

Directory of Open Access Journals (Sweden)

Marasco Rosangela

2006-11-01

Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

Bench-scale studies with mercury contaminated SRS soil

International Nuclear Information System (INIS)

Cicero, C.A.

1995-01-01

Bench-scale studies with mercury contaminated soil were performed at the SRTC to determine the optimum waste loading obtainable in the glass product without sacrificing durability, leach resistance, and processability. Vitrifying this waste stream also required offgas treatment for the capture of the vaporized mercury. Four soil glasses with slight variations in composition were produced, which were capable of passing the Product Consistency Test (PCT) and the Toxicity Characteristic Leaching Procedure (TCLP). The optimum glass feed composition contained 60 weight percent soil and produced a soda-lime-silica glass when melted at 1,350 C. The glass additives used to produce this glass were 24 weight percent Na 2 CO 3 and 16 weight percent CaCO 3 . Volatilized mercury released during the vitrification process was released to the proposed mercury collection system. The proposed mercury collection system consisted of quartz and silica tubing with a Na 2 S wash bottle followed by a NaOH wash bottle. Once in the system, the volatile mercury would pass through the wash bottle containing Na 2 S, where it would be converted to Hg 2 S, which is a stable form of mercury. However, attempts to capture the volatilized mercury in a Na 2 S solution wash bottle were not as successful as anticipated. Maximum mercury captured was only about 3.24% of the mercury contained in the feed. Mercury capture efforts then shifted to condensing and capturing the volatilized mercury. These attempts were much more successful at capturing the volatile mercury, with a capture efficiency of 34.24% when dry ice was used to pack the condenser. This captured mercury was treated on a mercury specific resin after digestion of the volatilized mercury

Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

Science.gov (United States)

Cortes, Teresa; Cox, Robert Ashley

2015-04-01

Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

DEFF Research Database (Denmark)

Danielsen, S; Kilstrup, M; Barilla, K

1992-01-01

. A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

Science.gov (United States)

Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

2013-10-01

The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Influence of Heat Treatment on Mercury Cavitation Resistance of Surface Hardened 316LN Stainless Steel

Energy Technology Data Exchange (ETDEWEB)

Pawel, Steven J [ORNL; Hsu, Julia [Massachusetts Institute of Technology (MIT)

2010-11-01

The cavitation-erosion resistance of carburized 316LN stainless steel was significantly degraded but not destroyed by heat treatment in the temperature range 500-800 C. The heat treatments caused rejection of some carbon from the carburized layer into an amorphous film that formed on each specimen surface. Further, the heat treatments encouraged carbide precipitation and reduced hardness within the carburized layer, but the overall change did not reduce surface hardness fully to the level of untreated material. Heat treatments as short as 10 min at 650 C substantially reduced cavitation-erosion resistance in mercury, while heat treatments at 500 and 800 C were found to be somewhat less detrimental. Overall, the results suggest that modest thermal excursions perhaps the result of a weld made at some distance to the carburized material or a brief stress relief treatment will not render the hardened layer completely ineffective but should be avoided to the greatest extent possible.

A conservative region of the mercuric reductase gene (merA as a molecular marker of bacterial mercury resistance Região conservada do gene da mercúrio redutase (merA como marcador molecular da resistência bacteriana ao mercúrio

Directory of Open Access Journals (Sweden)

Adriana Sotero-Martins

2008-06-01

Full Text Available The most common bacterial mercury resistance mechanism is based on the reduction of Hg(II to Hg0, which is dependent of the mercuric reductase enzyme (MerA activity. The use of a 431 bp fragment of a conservative region of the mercuric reductase (merA gene was applied as a molecular marker of this mechanism, allowing the identification of mercury resistant bacterial strains.O mecanismo de resistência bacteriana ao mercúrio mais comum é baseada na redução do Hg(II a Hg0, através da atividade da enzima mercúrio redutase (MerA. O uso do fragmento de 431 pb amplificado de uma região conservada do gene merA, que codifica a enzima MerA,foi utilizado como marcador molecular deste mecanismo, permitindo a identificação de bactérias resistentes ao mercúrio.

Mercury Report-Children's exposure to elemental mercury

Science.gov (United States)

... gov . Mercury Background Mercury Report Additional Resources Mercury Report - Children's Exposure to Elemental Mercury Recommend on Facebook ... I limit exposure to mercury? Why was the report written? Children attending a daycare in New Jersey ...

Metal resistance sequences and transgenic plants

Science.gov (United States)

Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.

1999-10-12

The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.

Structural characterization of the Salmonella typhimurium LT2 umu operon

International Nuclear Information System (INIS)

Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

1990-01-01

The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

Directory of Open Access Journals (Sweden)

Jan Ewald

2015-04-01

Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

Directory of Open Access Journals (Sweden)

Sun Yuan

2006-02-01

Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

Science.gov (United States)

Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

2015-01-01

In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

Decreases in average bacterial community rRNA operon copy number during succession.

Science.gov (United States)

Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

2016-05-01

Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

OpenAIRE

Riyanti, Eny Ida; Rogers, Peter L

2009-01-01

Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

Mercury

Science.gov (United States)

Mercury is an element that is found in air, water and soil. It has several forms. Metallic mercury is a shiny, silver-white, odorless liquid. If ... with other elements to form powders or crystals. Mercury is in many products. Metallic mercury is used ...

Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

Science.gov (United States)

Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

2014-10-01

Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

Resistance to the peptidyl transferase inhibitor tiamulin caused by mutation of ribosomal protein l3.

Science.gov (United States)

Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S

2003-09-01

The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.

Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

DEFF Research Database (Denmark)

Givskov, M; Eberl, L; Christiansen, Gunna

1995-01-01

. Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

Deregulation of the arginine deiminase (arc) operon in penicillin-tolerant mutants of Streptococcus gordonii.

Science.gov (United States)

Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P

2000-10-01

Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.

Occurrence of large fractions of mercury-resistant bacteria in the Bay of Bengal

Digital Repository Service at National Institute of Oceanography (India)

De, J.; Ramaiah, N.

, 1991 , pp. 1 ? 29. 21. Smith, T., Pitts, K., McGarvey, J. A. and Summers, A. O., Bact e- rial oxidation of mercury metal vapor, Hg(0). Appl. Environ. M i cr o biol ., 1998, 64 , 1328 ? 1332. 22. http://in.rediff.com /money/2003/nov/04mercury...

Eucaryotic operon genes can define highly conserved syntenies

Czech Academy of Sciences Publication Activity Database

Trachtulec, Zdeněk

2004-01-01

Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

Microbiological stimulation of phytoremediation process using Salvinia natans to mercury contamined water

Science.gov (United States)

Filyarovskaya, Viktoriya; Sitarska, Magdalena; Traczewska, Teodora; Wolf, Mirela

2017-11-01

An alternative to traditional cleaning methods of heavy metals in the water environment is phytoremediation. They efficiency depends on used technological process conditions as well as plant species. One of the most dangerous metallic elements mercury plays a particular role, which is a trace element and a physiologically foreign in living organisms. Mercury has a high degree of toxicity with strong affinity to thiol groups. This may cause an adverse effect on the enzymatic processes and consequently inhibiting the physiological functions. Because of high risk for human health, water environment treatment from mercury is essential proecological action. Mercury removal studies were conducted using Salvinia natans pleustofit, sampled from its natural water environment. In the first step, epiphytic bacteria, which was resistant to high concentrations of mercury (0,6 mgHg/l), was isolated from the plant and than selected by the tiles gradient mthod. In the next step, the identification using molecular biology methods was made. In the following step plant Salvinia natans was exposure to high levels of mercury in the presence of the three isolated Pseudomonas strains with exceptional resistance characteristics to environmental factors. Has been found a positive bacteria effect on the plant condition because the selected strains belong to Pseudomonas species producing materials supporting plant growth. The use of microbial stimulation to phytoremediation by hyperaccumulator Salvinia natans can multiply the effectiveness of the process.

Microbiological stimulation of phytoremediation process using Salvinia natans to mercury contamined water

Directory of Open Access Journals (Sweden)

Filyarovskaya Viktoriya

2017-01-01

Full Text Available An alternative to traditional cleaning methods of heavy metals in the water environment is phytoremediation. They efficiency depends on used technological process conditions as well as plant species. One of the most dangerous metallic elements mercury plays a particular role, which is a trace element and a physiologically foreign in living organisms. Mercury has a high degree of toxicity with strong affinity to thiol groups. This may cause an adverse effect on the enzymatic processes and consequently inhibiting the physiological functions. Because of high risk for human health, water environment treatment from mercury is essential proecological action. Mercury removal studies were conducted using Salvinia natans pleustofit, sampled from its natural water environment. In the first step, epiphytic bacteria, which was resistant to high concentrations of mercury (0,6 mgHg/l, was isolated from the plant and than selected by the tiles gradient mthod. In the next step, the identification using molecular biology methods was made. In the following step plant Salvinia natans was exposure to high levels of mercury in the presence of the three isolated Pseudomonas strains with exceptional resistance characteristics to environmental factors. Has been found a positive bacteria effect on the plant condition because the selected strains belong to Pseudomonas species producing materials supporting plant growth. The use of microbial stimulation to phytoremediation by hyperaccumulator Salvinia natans can multiply the effectiveness of the process.

Got Mercury?

Science.gov (United States)

Meyers, Valerie E.; McCoy, J. Torin; Garcia, Hector D.; James, John T.

2009-01-01

Many of the operational and payload lighting units used in various spacecraft contain elemental mercury. If these devices were damaged on-orbit, elemental mercury could be released into the cabin. Although there are plans to replace operational units with alternate light sources, such as LEDs, that do not contain mercury, mercury-containing lamps efficiently produce high quality illumination and may never be completely replaced on orbit. Therefore, exposure to elemental mercury during spaceflight will remain possible and represents a toxicological hazard. Elemental mercury is a liquid metal that vaporizes slowly at room temperature. However, it may be completely vaporized at the elevated operating temperatures of lamps. Although liquid mercury is not readily absorbed through the skin or digestive tract, mercury vapors are efficiently absorbed through the respiratory tract. Therefore, the amount of mercury in the vapor form must be estimated. For mercury releases from lamps that are not being operated, we utilized a study conducted by the New Jersey Department of Environmental Quality to calculate the amount of mercury vapor expected to form over a 2-week period. For longer missions and for mercury releases occurring when lamps are operating, we conservatively assumed complete volatilization of the available mercury. Because current spacecraft environmental control systems are unable to remove mercury vapors, both short-term and long-term exposures to mercury vapors are possible. Acute exposure to high concentrations of mercury vapors can cause irritation of the respiratory tract and behavioral symptoms, such as irritability and hyperactivity. Chronic exposure can result in damage to the nervous system (tremors, memory loss, insomnia, etc.) and kidneys (proteinurea). Therefore, the JSC Toxicology Group recommends that stringent safety controls and verifications (vibrational testing, etc.) be applied to any hardware that contains elemental mercury that could yield

The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

Science.gov (United States)

Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

2013-02-01

Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

Cloning and identification of Group 1 mrp operon encoding a novel monovalent cation/proton antiporter system from the moderate halophile Halomonas zhaodongensis.

Science.gov (United States)

Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan

2014-11-01

The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.

Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

Directory of Open Access Journals (Sweden)

Qinna Cui

Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

NARCIS (Netherlands)

Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

Role of bacteria in bioaccumulation of mercury in the oyster Crassostrea virginica

International Nuclear Information System (INIS)

Sayler, G.S.; Nelson, J.D. Jr.; Colwell, R.R.

1975-01-01

An investigation of mercury-resistant bacteria was undertaken to determine their role in the accumulation of mercury in a simplified food chain. Oysters (Crassostrea virginica) were maintained in a closed system, sealed aquarium with stirred, aerated water containing 10 μg of 203 HgCl 2 per liter. Uptake of 203 Hg by oysters held under control conditions was compared with that of 203 Hg uptake by oysters under similar conditions except that mercury-accumulating and mercury-metabolizing species of Pseudomonsa, isolated from Chesapeake Bay, were added to the experimental oysters. After incubation for 4 days, the major portion of the 203 Hg in the water column was found to be associated with the microparticulate fraction, corresponding to a rise in total viable count. Mercury accumulation in the oysters was significantly higher in the gill and fisceral tissue than other tissues. Mercury concentrations were 200 times greater in tissue fractions of oysters dosed with mercury-metabolizing bacteria compared with the oysters held under control conditions without mercury-metabolizing bacteria. (U.S.)

stg fimbrial operon from S. Typhi STH2370 contributes to association and cell disruption of epithelial and macrophage-like cells.

Science.gov (United States)

Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C

2015-07-07

Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.

Mercury-Resistant Marine Bacteria and their Role in Bioremediation of Certain Toxicants

Digital Repository Service at National Institute of Oceanography (India)

De, J.

of heavy metals (mercury, cadmium, lead to name a few). Without efficient retention technologies, toxic chemicals including Hg are let into the environment, endangering ecosystems and public health. The main focus in this section is on literature review... toxicity. For the most sensitive species, Daphnia magna, the NOTEL for reproductive impairment is 3 ppb for inorganic mercury and lesser than 0.04 ppb for methylmercury (Canstein, 2000). Hence it is of great importance for both environment and public health...

Induction of the mar operon by miscellaneous groceries.

Science.gov (United States)

Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P

2004-01-01

To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.

Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.

OpenAIRE

Chung, T; Resnik, E; Stueland, C; LaPorte, D C

1993-01-01

Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem

Science.gov (United States)

Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria

2016-01-01

The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the

Application of a mer-lux biosensor for estimating bioavailable mercury in soil

DEFF Research Database (Denmark)

Rasmussen, Lasse Dam; Sørensen, S. J.; Turner, R. R.

2000-01-01

A previously described bioassay using a mer-lux gene fusion for detection of bioavailable mercury was applied for the estimation of the bioavailable fraction of mercury in soil. The bioavailable fraction is defined here as being part of the water leachable fraction. Due to masking of light emission...... responses. The utility of the mer-lux biosensor assay was tested by relating measurements of bioavailable and total mercury to the response of the soil microbial community to mercury exposure. Two different soil types (an agricultural and a beech forest soil) were spiked with 2.5 µg Hg(II) g-1 in microcosms...... in resistance or diversity. This study showed that the bioassay using the mer-lux biosensor is a useful and sensitive tool for estimation of bioavailable mercury in soil....

Removal of mercury (II), elemental mercury and arsenic from simulated flue gas by ammonium sulphide.

Science.gov (United States)

Ning, Ping; Guo, Xiaolong; Wang, Xueqian; Wang, Ping; Ma, Yixing; Lan, Yi

2015-01-01

A tubular resistance furnace was used as a reactor to simulate mercury and arsenic in smelter flue gases by heating mercury and arsenic compounds. The flue gas containing Hg(2+), Hg(0) and As was treated with ammonium sulphide. The experiment was conducted to investigate the effects of varying the concentration of ammonium sulphide, the pH value of ammonium sulphide, the temperature of ammonium sulphide, the presence of SO2 and the presence of sulphite ion on removal efficiency. The prepared adsorption products were characterized by Fourier transform infrared spectroscopy, X-ray diffraction, X-ray photoelectron spectroscopy and scanning electron microscopy. The results showed that the optimal concentration of ammonium sulphide was 0.8 mol/L. The optimal pH value of ammonium sulphide was 10, and the optimal temperature of ammonium sulphide was 20°C.Under the optimum conditions, the removal efficiency of Hg(2+), Hg(0) and As could reach 99%, 88.8%, 98%, respectively. In addition, SO2 and sulphite ion could reduce the removal efficiency of mercury and arsenic from simulated flue gas.

GLYCOGEN IN BACILLUS-SUBTILIS - MOLECULAR CHARACTERIZATION OF AN OPERON ENCODING ENZYMES INVOLVED IN GLYCOGEN BIOSYNTHESIS AND DEGRADATION

NARCIS (Netherlands)

KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G

Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

OpenAIRE

Goh, Yong Jun; Klaenhammer, Todd R

2013-01-01

Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

Identification and molecular analysis of mercury resistant bacteria in ...

African Journals Online (AJOL)

Mercury (Hg) is one of the most important toxic pollutants widespread in the environment. It is being extensively used in industrial applications (chlor-alkali electrolysis, fungicides, disinfectants, dental products, etc), resulting in local hot spots of pollution and serious effects on biota and humans. The aim of this study was to ...

Co-spread of metal and antibiotic resistance within ST3-IncHI2 plasmids from E. coli isolates of food-producing animals.

Science.gov (United States)

Fang, Liangxing; Li, Xingping; Li, Liang; Li, Shumin; Liao, Xiaoping; Sun, Jian; Liu, Yahong

2016-05-04

Concerns have been raised in recent years regarding co-selection for antibiotic resistance among bacteria exposed to heavy metals, particularly copper and zinc, used as growth promoters for some livestock species. In this study, 25 IncHI2 plasmids harboring oqxAB (20/25)/blaCTX-M (18/25) were found with sizes ranging from ∼260 to ∼350 kb and 22 belonged to the ST3-IncHI2 group. In addition to blaCTX-M and oqxAB, pcoA-E (5/25) and silE-P (5/25), as well as aac(6')-Ib-cr (18/25), floR (16/25), rmtB (6/25), qnrS1(3/25) and fosA3 (2/25), were also identified on these IncHI2 plasmids. The plasmids carried pco and sil contributed to increasing in the MICs of CuSO4 and AgNO3. The genetic context surrounding the two operons was well conserved except some variations within the pco operon. The ~32 kb region containing the two operons identified in the IncHI2 plasmids was also found in chromosomes of different Enterobacteriaceae species. Further, phylogenetic analysis of this structure showed that Tn7-like transposon might play an important role in cross-genus transfer of the sil and pco operons among Enterobacteriaceae. In conclusion, co-existence of the pco and sil operons, and oqxAB/blaCTX-M as well as other antibiotic resistance genes on IncHI2 plasmids may promote the development of multidrug-resistant bacteria.

Planet Mercury

Science.gov (United States)

1974-01-01

Mariner 10's first image of Mercury acquired on March 24, 1974. During its flight, Mariner 10's trajectory brought it behind the lighted hemisphere of Mercury, where this image was taken, in order to acquire important measurements with other instruments.This picture was acquired from a distance of 3,340,000 miles (5,380,000 km) from the surface of Mercury. The diameter of Mercury (3,031 miles; 4,878 km) is about 1/3 that of Earth.Images of Mercury were acquired in two steps, an inbound leg (images acquired before passing into Mercury's shadow) and an outbound leg (after exiting from Mercury's shadow). More than 2300 useful images of Mercury were taken, both moderate resolution (3-20 km/pixel) color and high resolution (better than 1 km/pixel) black and white coverage.

Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

Science.gov (United States)

Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

2012-10-01

To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

Science.gov (United States)

Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

2003-01-01

Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

Science.gov (United States)

Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

2013-07-01

Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202.

Science.gov (United States)

Boyd, D A; Mulvey, M R

2013-02-01

To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

Mercury

NARCIS (Netherlands)

de Vries, Irma

2017-01-01

Mercury is a naturally occurring metal that exists in several physical and chemical forms. Inorganic mercury refers to compounds formed after the combining of mercury with elements such as chlorine, sulfur, or oxygen. After combining with carbon by covalent linkage, the compounds formed are called

Sequence analysis of the Legionella micdadei groELS operon

DEFF Research Database (Denmark)

Hindersson, P; Høiby, N; Bangsborg, Jette Marie

1991-01-01

shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

Antimicrobial resistance, heavy metal resistance and integron content in bacteria isolated from a South African tilapia aquaculture system.

Science.gov (United States)

Chenia, Hafizah Y; Jacobs, Anelet

2017-11-21

Antibacterial compounds and metals co-select for antimicrobial resistance when bacteria harbour resistance genes towards both types of compounds, facilitating the proliferation and evolution of antimicrobial and heavy metal resistance. Antimicrobial and heavy metal resistance indices of 42 Gram-negative bacteria from a tilapia aquaculture system were determined to identify possible correlations between these phenotypes. Agar dilution assays were carried out to determine susceptibility to cadmium, copper, lead, mercury, chromate and zinc, while susceptibility to 21 antimicrobial agents was investigated by disk diffusion assays. Presence of merA, the mercury resistance gene, was determined by dot-blot hybridizations and PCR. Association of mercury resistance with integrons and transposon Tn21 was also investigated by PCR. Isolates displayed a high frequency of antimicrobial (erythromycin: 100%; ampicillin: 85%; trimethoprim: 78%) and heavy metal (Zn2+: 95%; Cd2+: 91%) resistance. No correlation was established between heavy metal and multiple antibiotic resistance indices. Significant positive correlations were observed between heavy metal resistance profiles, indices, Cu2+ and Cr3+ resistance with erythromycin resistance. Significant positive correlations were observed between merA (24%)/Tn21 (24%) presence and heavy metal resistance profiles and indices; however, significant negative correlations were obtained between integron-associated qacE∆1 (43%) and sulI (26%) gene presence and heavy metal resistance indices. Heavy metal and antimicrobial agents co-select for resistance, with fish-associated, resistant bacteria demonstrating simultaneous heavy metal resistance. Thus, care should be taken when using anti-fouling heavy metals as feed additives in aquaculture facilities.

A microencapsulation process of liquid mercury by sulfur polymer stabilization/solidification technology. Part II: Durability of materials

Energy Technology Data Exchange (ETDEWEB)

Lopez-Delgado, A.; Guerrero, A.; Lopez, F. A.; Perez, C.; Alguacil, F. J.

2012-11-01

Under the European LIFE Program a microencapsulation process was developed for liquid mercury using Sulfur Polymer Stabilization/Solidification (SPSS) technology, obtaining a stable concrete-like sulfur matrix that allows the immobilization of mercury for long-term storage. The process description and characterization of the materials obtained were detailed in Part I. The present document, Part II, reports the results of different tests carried out to determine the durability of Hg-S concrete samples with very high mercury content (up to 30 % w/w). Different UNE and RILEM standard test methods were applied, such as capillary water absorption, low pressure water permeability, alkali/acid resistance, salt mist aging, freeze-thaw resistance and fire performance. The samples exhibited no capillarity and their resistance in both alkaline and acid media was very high. They also showed good resistance to very aggressive environments such as spray salt mist, freeze-thaw and dry-wet. The fire hazard of samples at low heat output was negligible. (Author)

Structural organization of the transfer RNA operon I of Vibrio cholerae

Indian Academy of Sciences (India)

Unknown

[Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

49 CFR 173.164 - Mercury (metallic and articles containing mercury).

Science.gov (United States)

2010-10-01

... ounces) of mercury per package; (iv) Tubes which are completely jacketed in sealed leakproof metal cases... 49 Transportation 2 2010-10-01 2010-10-01 false Mercury (metallic and articles containing mercury... Than Class 1 and Class 7 § 173.164 Mercury (metallic and articles containing mercury). (a) For...

Recovery of mercury from mercury compounds via electrolytic methods

Science.gov (United States)

Grossman, Mark W.; George, William A.

1988-01-01

A process for electrolytically recovering mercury from mercury compounds is provided. In one embodiment, Hg is recovered from Hg.sub.2 Cl.sub.2 employing as the electrolyte solution a mixture of HCl and H.sub.2 O. In another embodiment, Hg is electrolytically recovered from HgO wherein the electrolyte solution is comprised of glacial acetic acid and H.sub.2 O. Also provided is an apparatus for producing isotopically enriched mercury compounds in a reactor and then transporting the dissolved compounds into an electrolytic cell where mercury ions are electrolytically reduced and elemental mercury recovered from the mercury compounds.

Heavy metals in liquid pig manure in light of bacterial antimicrobial resistance

Energy Technology Data Exchange (ETDEWEB)

Hoelzel, Christina S., E-mail: Christina.Hoelzel@wzw.tum.de [Chair of Animal Hygiene, Technische Universitaet Muenchen, Weihenstephaner Berg 3, 85354 Freising (Germany); Mueller, Christa [Institute for Agroecology, Organic Farming and Soil Protection, Bavarian State Research Center for Agriculture (LfL), Lange Point 12, 85354 Freising (Germany); Harms, Katrin S. [Chair of Animal Hygiene, Technische Universitaet Muenchen, Weihenstephaner Berg 3, 85354 Freising (Germany); Mikolajewski, Sabine [Department for Quality Assurance and Analytics, Bavarian State Research Center for Agriculture (LfL), Lange Point 4, 85354 Freising (Germany); Schaefer, Stefanie; Schwaiger, Karin; Bauer, Johann [Chair of Animal Hygiene, Technische Universitaet Muenchen, Weihenstephaner Berg 3, 85354 Freising (Germany)

2012-02-15

Heavy metals are regularly found in liquid pig manure, and might interact with bacterial antimicrobial resistance. Concentrations of heavy metals were determined by atomic spectroscopic methods in 305 pig manure samples and were connected to the phenotypic resistance of Escherichia coli (n=613) against 29 antimicrobial drugs. Concentrations of heavy metals (/kg dry matter) were 0.08-5.30 mg cadmium, 1.1-32.0 mg chrome, 22.4-3387.6 mg copper, <2.0-26.7 mg lead, <0.01-0.11 mg mercury, 3.1-97.3 mg nickel and 93.0-8239.0 mg zinc. Associated with the detection of copper and zinc, resistance rates against {beta}-lactams were significantly elevated. By contrast, the presence of mercury was significantly associated with low antimicrobial resistance rates of Escherichia coli against {beta}-lactams, aminoglycosides and other antibiotics. Effects of subinhibitory concentrations of mercury on bacterial resistance against penicillins, cephalosporins, aminoglycosides and doxycycline were also demonstrated in a laboratory trial. Antimicrobial resistance in the porcine microflora might be increased by copper and zinc. By contrast, the occurrence of mercury in the environment might, due to co-toxicity, act counter-selective against antimicrobial resistant strains.

Characterization of the Leptospira interrogans S10-spc-alpha operon

NARCIS (Netherlands)

Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

2000-01-01

A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

Science.gov (United States)

Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

2017-01-01

The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

Science.gov (United States)

Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

2017-01-01

The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

Association between Blood Mercury Level and Visceral Adiposity in Adults

Directory of Open Access Journals (Sweden)

Jong Suk Park

2017-01-01

Full Text Available BackgroundFew studies have examined the association between mercury exposure and obesity. The aim of this study is to investigate the association between blood mercury concentrations and indices of obesity in adults.MethodsA total of 200 healthy subjects, aged 30 to 64 years, who had no history of cardiovascular or malignant disease, were examined. Anthropometric and various biochemical profiles were measured. Visceral adipose tissue (VAT was measured using dual-energy X-ray absorptiometry (DXA.ResultsAll subjects were divided into three groups according to blood mercury concentrations. Compared with the subjects in the lowest tertile of mercury, those in the highest tertile were more likely to be male; were current alcohol drinkers and smokers; had a higher body mass index (BMI, waist circumference (WC, and VAT; had higher levels of blood pressure, fasting glucose, and insulin resistance; and consumed more fish. The blood mercury concentration was significantly associated with anthropometric parameters, showing relationships with BMI, WC, and VAT. After adjusting for multiple risk factors, the odds ratios (ORs for high mercury concentration was significantly higher in the highest VAT tertile than in the lowest VAT tertile (OR, 2.66; 95% confidence interval, 1.05 to 6.62; P<0.05.ConclusionThe blood mercury concentration was significantly associated with VAT in healthy adults. Further studies are warranted to confirm our findings.

Effects of methyl mercury exposure on pancreatic beta cell development and function.

Science.gov (United States)

Schumacher, Lauren; Abbott, Louise C

2017-01-01

Methyl mercury is an environmental contaminant of worldwide concern. Since the discovery of methyl mercury exposure due to eating contaminated fish as the underlying cause of the Minamata disaster, the scientific community has known about the sensitivity of the developing central nervous system to mercury toxicity. Warnings are given to pregnant women and young children to limit consumption of foods containing methyl mercury to protect the embryonic, fetal and postnatally developing central nervous system. However, evidence also suggests that exposure to methyl mercury or various forms of inorganic mercury may also affect development and function of other organs. Numerous reports indicate a worldwide increase in diabetes, particularly type 2 diabetes. Quite recently, methyl mercury has been shown to have adverse effects on pancreatic beta (β) cell development and function, resulting in insulin resistance and hyperglycemia and may even lead to the development of diabetes. This review discusses possible mechanisms by which methyl mercury exposure may adversely affect pancreatic β cell development and function, and the role that methyl mercury exposure may have in the reported worldwide increase in diabetes, particularly type 2 diabetes. While additional information is needed regarding associations between mercury exposure and specific mechanisms of the pathogenesis of diabetes in the human population, methyl mercury's adverse effects on the body's natural sources of antioxidants suggest that one possible therapeutic strategy could involve supplementation with antioxidants. Thus, it is important that additional investigation be undertaken into the role of methyl mercury exposure and reduced pancreatic β cell function. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

Directory of Open Access Journals (Sweden)

Arkin Adam P

2006-01-01

Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

Science.gov (United States)

Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

2015-11-17

rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

Science.gov (United States)

Dixit, R; Trivedi, P K; Nath, P; Sane, P V

1999-09-01

Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression

Science.gov (United States)

Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet

2015-01-01

Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450

Mercury and Your Health

Science.gov (United States)

... the Risk of Exposure to Mercury Learn About Mercury What is Mercury What is Metallic mercury? Toxicological Profile ToxFAQs Mercury Resources CDC’s National Biomonitoring Program Factsheet on Mercury ...

Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

Science.gov (United States)

Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

2014-01-01

Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

Experimental Infection and Clearance of Coccidian Parasites in Mercury-Exposed Zebra Finches.

Science.gov (United States)

Ebers Smith, Jessica H; Cristol, Daniel A; Swaddle, John P

2018-01-01

Mercury is a globally distributed, persistent environmental contaminant that affects the health of many taxa. It can suppress the immune system, which often plays a role in defense against parasites. However, there have been few investigations of whether mercury affects the abilities of animals to resist parasitic infection. Here, we exposed zebra finches to a lifetime dietary exposure of methylmercury (1.2 μg/g wet weight) and experimentally infected them with coccidian parasites to examine the effect of methylmercury exposure on parasitic infection. The mercury-exposed birds did not have an altered immune response (heterophil:lymphocyte ratio) nor a reduced ability to clear the infection. However, mercury-exposed birds tended to have higher parasite loads at the time when we expected the greatest immune response (2-3 weeks post-infection). Although mercury did not greatly influence the infection-course of this parasite in captivity, responses may be more accentuated in the wild where birds face additional immune challenges.

Molecular level biodegradation of phenol and its derivatives through dmp operon of Pseudomonas putida: A bio-molecular modeling and docking analysis.

Science.gov (United States)

Ray, Sujay; Banerjee, Arundhati

2015-10-01

Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.

Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

Science.gov (United States)

Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

2008-01-01

Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

Heavy metals in liquid pig manure in light of bacterial antimicrobial resistance

International Nuclear Information System (INIS)

Hölzel, Christina S.; Müller, Christa; Harms, Katrin S.; Mikolajewski, Sabine; Schäfer, Stefanie; Schwaiger, Karin; Bauer, Johann

2012-01-01

Heavy metals are regularly found in liquid pig manure, and might interact with bacterial antimicrobial resistance. Concentrations of heavy metals were determined by atomic spectroscopic methods in 305 pig manure samples and were connected to the phenotypic resistance of Escherichia coli (n=613) against 29 antimicrobial drugs. Concentrations of heavy metals (/kg dry matter) were 0.08–5.30 mg cadmium, 1.1–32.0 mg chrome, 22.4–3387.6 mg copper, <2.0–26.7 mg lead, <0.01–0.11 mg mercury, 3.1–97.3 mg nickel and 93.0–8239.0 mg zinc. Associated with the detection of copper and zinc, resistance rates against β-lactams were significantly elevated. By contrast, the presence of mercury was significantly associated with low antimicrobial resistance rates of Escherichia coli against β-lactams, aminoglycosides and other antibiotics. Effects of subinhibitory concentrations of mercury on bacterial resistance against penicillins, cephalosporins, aminoglycosides and doxycycline were also demonstrated in a laboratory trial. Antimicrobial resistance in the porcine microflora might be increased by copper and zinc. By contrast, the occurrence of mercury in the environment might, due to co-toxicity, act counter-selective against antimicrobial resistant strains.

RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.

Science.gov (United States)

Pérez-Oseguera, Angeles; Cevallos, Miguel A

2013-11-01

Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

Occurrence of adhesin-encoding operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis Ocorrência de operons codificadores de adesinas em Escherichia coli isolada de aves reprodutoras com salpingite e de pintinhos com onfalite

Directory of Open Access Journals (Sweden)

Terezinha Knöbl

2006-06-01

Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.

Non-carbon sorbents for mercury removal from flue gases

Energy Technology Data Exchange (ETDEWEB)

Alptekin, G.O.; Dubovik, M.; Cesario, M. [TDA Research Inc., Wheat Ridge, CO (United States)

2005-07-01

TDA Research Inc. is developing a new sorbent that can effectively remove mercury from flue gases. It is made of non-carbon based materials and will therefore not alter the properties of the fly ash. The sorbent can be produced as an injectable powder. The paper summarises the initial testing results of the new sorbent. The sorbent exhibited 7.5 to 11.0 mg/g mercury absorption capacity under representative flue gas streams depending on the operating temperature and gas hourly space velocity. The sorbent also showed resistance to sulfur poisoning by sulfur dioxide. 6 refs., 3 figs., 1 tab.

Rethinking mercury: the role of selenium in the pathophysiology of mercury toxicity.

Science.gov (United States)

Spiller, Henry A

2018-05-01

There is increasing evidence that the pathophysiological target of mercury is in fact selenium, rather than the covalent binding of mercury to sulfur in the body's ubiquitous sulfhydryl groups. The role of selenium in mercury poisoning is multifaceted, bidirectional, and central to understanding the target organ toxicity of mercury. An initial search was performed using Medline/PubMed, Toxline, Google Scholar, and Google for published work on mercury and selenium. These searches yielded 2018 citations. Publications that did not evaluate selenium status or evaluated environmental status (e.g., lake or ocean sediment) were excluded, leaving approximately 500 citations. This initial selection was scrutinized carefully and 117 of the most relevant and representative references were selected for use in this review. Binding of mercury to thiol/sulfhydryl groups: Mercury has a lower affinity for thiol groups and higher affinity for selenium containing groups by several orders of magnitude, allowing for binding in a multifaceted way. The established binding of mercury to thiol moieties appears to primarily involve the transport across membranes, tissue distribution, and enhanced excretion, but does not explain the oxidative stress, calcium dyshomeostasis, or specific organ injury seen with mercury. Effects of mercury on selenium and the role this plays in the pathophysiology of mercury toxicity: Mercury impairs control of intracellular redox homeostasis with subsequent increased intracellular oxidative stress. Recent work has provided convincing evidence that the primary cellular targets are the selenoproteins of the thioredoxin system (thioredoxin reductase 1 and thioredoxin reductase 2) and the glutathione-glutaredoxin system (glutathione peroxidase). Mercury binds to the selenium site on these proteins and permanently inhibits their function, disrupting the intracellular redox environment. A number of other important possible target selenoproteins have been identified

Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

International Nuclear Information System (INIS)

Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.

1988-01-01

The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

Evidence for functional interaction between domains II and V of 23S ribosomal RNA from an erythromycin-resistant mutant

DEFF Research Database (Denmark)

Douthwaite, S; Prince, J B; Noller, H F

1985-01-01

A mutation affording low levels of erythromycin resistance has been obtained by in vitro hydroxylamine mutagenesis of a cloned ribosomal RNA operon from Escherichia coli. The site of the mutational event responsible for antibiotic resistance was localized to the gene region encoding domain II of ...

A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

Science.gov (United States)

Chopra, Paras; Bender, Andreas

The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

Mercury Quick Facts: Health Effects of Mercury Exposure

Science.gov (United States)

... 2012 What are the Health Effects of Mercury Exposure? The health effects that can be caused by breathing mercury depend ... they breathe faster and have smaller lungs. Health effects caused by long-term exposure to mercury vapors • • Anxiety • • Excessive shyness • • Anorexia • • Sleeping ...

Mercury balance analysis

International Nuclear Information System (INIS)

Maag, J.; Lassen, C.; Hansen, E.

1996-01-01

A detailed assessment of the consumption of mercury, divided into use areas, was carried out. Disposal and emissions to the environment were also qualified. The assessment is mainly based on data from 1992 - 1993. The most important source of emission of mercury to air is solid waste incineration which is assessed in particular to be due to the supply of mercury in batteries (most likely mercury oxide batteries from photo equipment) and to dental fillings. The second most important source of mercury emission to air is coal-fired power plants which are estimated to account for 200-500 kg of mercury emission p.a. Other mercury emissions are mainly related to waste treatment and disposal. The consumption of mercury is generally decreasing. During the period from 1982/83 - 1992-93, the total consumption of mercury in Denmark was about halved. This development is related to the fact that consumption with regard to several important use areas (batteries, dental fillings, thermometers etc.) has been significantly reduced, while for other purposes the use of mercury has completely, or almost disappeared, i.e. (fungicides for seed, tubes etc.). (EG)

Mercury Phase II Study - Mercury Behavior in Salt Processing Flowsheet

International Nuclear Information System (INIS)

Jain, V.; Shah, H.; Wilmarth, W. R.

2016-01-01

Mercury (Hg) in the Savannah River Site Liquid Waste System (LWS) originated from decades of canyon processing where it was used as a catalyst for dissolving the aluminum cladding of reactor fuel. Approximately 60 metric tons of mercury is currently present throughout the LWS. Mercury has long been a consideration in the LWS, from both hazard and processing perspectives. In February 2015, a Mercury Program Team was established at the request of the Department of Energy to develop a comprehensive action plan for long-term management and removal of mercury. Evaluation was focused in two Phases. Phase I activities assessed the Liquid Waste inventory and chemical processing behavior using a system-by-system review methodology, and determined the speciation of the different mercury forms (Hg+, Hg++, elemental Hg, organomercury, and soluble versus insoluble mercury) within the LWS. Phase II activities are building on the Phase I activities, and results of the LWS flowsheet evaluations will be summarized in three reports: Mercury Behavior in the Salt Processing Flowsheet (i.e. this report); Mercury Behavior in the Defense Waste Processing Facility (DWPF) Flowsheet; and Mercury behavior in the Tank Farm Flowsheet (Evaporator Operations). The evaluation of the mercury behavior in the salt processing flowsheet indicates, inter alia, the following: (1) In the assembled Salt Batches 7, 8 and 9 in Tank 21, the total mercury is mostly soluble with methylmercury (MHg) contributing over 50% of the total mercury. Based on the analyses of samples from 2H Evaporator feed and drop tanks (Tanks 38/43), the source of MHg in Salt Batches 7, 8 and 9 can be attributed to the 2H evaporator concentrate used in assembling the salt batches. The 2H Evaporator is used to evaporate DWPF recycle water. (2) Comparison of data between Tank 21/49, Salt Solution Feed Tank (SSFT), Decontaminated Salt Solution Hold Tank (DSSHT), and Tank 50 samples suggests that the total mercury as well as speciated

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Winson, MK; Sternberg, C

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

Science.gov (United States)

Chowdhury, Nilkanta; Bagchi, Angshuman

2017-07-01

Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

Catalysts for oxidation of mercury in flue gas

Science.gov (United States)

Granite, Evan J [Wexford, PA; Pennline, Henry W [Bethel Park, PA

2010-08-17

Two new classes of catalysts for the removal of heavy metal contaminants, especially mercury (Hg) from effluent gases. Both of these classes of catalysts are excellent absorbers of HCl and Cl.sub.2 present in effluent gases. This adsorption of oxidizing agents aids in the oxidation of heavy metal contaminants. The catalysts remove mercury by oxidizing the Hg into mercury (II) moieties. For one class of catalysts, the active component is selected from the group consisting of iridium (Ir) and iridum-platinum (Ir/Pt) alloys. The Ir and Ir/Pt alloy catalysts are especially corrosion resistant. For the other class of catalyst, the active component is partially combusted coal or "Thief" carbon impregnated with Cl.sub.2. Untreated Thief carbon catalyst can be self-activating in the presence of effluent gas streams. The Thief carbon catalyst is disposable by means of capture from the effluent gas stream in a particulate collection device (PCD).

The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces.

Science.gov (United States)

Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo

2014-12-01

The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

Science.gov (United States)

Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

2012-07-15

Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

Distribution and retention of organic and inorganic mercury in methyl mercury-treated neonatal rats

International Nuclear Information System (INIS)

Thomas, D.J.; Fisher, H.L.; Sumler, M.R.; Hall, L.L.; Mushak, P.

1988-01-01

Seven-day-old Long Evans rats received one mumol of 203 Hg-labeled methyl mercury/kg sc and whole body retention and tissue distribution of organic and inorganic mercury were examined for 32 days postdosing. Neonates cleared mercury slowly until 10 days postdosing when the clearance rate abruptly increased. During the interval when whole body clearance of mercury was extremely slow, methyl mercury was metabolized to inorganic mercury. Peak concentration of mercury in kidney occurred at 2 days postdosing. At 32 days postdosing, 8% of mercury in kidney was in an organic from. Liver mercury concentration peaked at 2 days postdosing and organic mercury accounted for 38% at 32 days postdosing. Brain concentrations of mercury peaked at 2 days postdosing. At 10 days postdosing, organic mercury accounted for 86% of the brain mercury burden, and, at 32 days postdosing, for 60%. The percentage of mercury body burden in pelt rose from 30 to 70% between 1 and 10 days postdosing. At 32 days postdosing pelt contained 85% of the body burden of mercury. At all time points, about 95% of mercury in pelt was in an organic form. Compartmental analysis of these data permitted development of a model to describe the distribution and excretion of organic and inorganic mercury in methyl mercury-treated neonatal rats

Dynamics and bistability in a reduced model of the lac operon

Science.gov (United States)

Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

2004-06-01

It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli.

Science.gov (United States)

Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito

2014-09-01

Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Method for removal and stabilization of mercury in mercury-containing gas streams

Science.gov (United States)

Broderick, Thomas E.

2005-09-13

The present invention is directed to a process and apparatus for removing and stabilizing mercury from mercury-containing gas streams. A gas stream containing vapor phase elemental and/or speciated mercury is contacted with reagent, such as an oxygen-containing oxidant, in a liquid environment to form a mercury-containing precipitate. The mercury-containing precipitate is kept or placed in solution and reacts with one or more additional reagents to form a solid, stable mercury-containing compound.

Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

DEFF Research Database (Denmark)

Brøndsted, Lone; Atlung, Tove

1996-01-01

The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

Cyanobacterial flv4-2 Operon-Encoded Proteins Optimize Light Harvesting and Charge Separation in Photosystem II.

Science.gov (United States)

Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert

2015-05-01

Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

DEFF Research Database (Denmark)

Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

2015-01-01

encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

Dry deposition of gaseous oxidized mercury in Western Maryland.

Science.gov (United States)

Castro, Mark S; Moore, Chris; Sherwell, John; Brooks, Steve B

2012-02-15

The purpose of this study was to directly measure the dry deposition of gaseous oxidized mercury (GOM) in western Maryland. Annual estimates were made using passive ion-exchange surrogate surfaces and a resistance model. Surrogate surfaces were deployed for seventeen weekly sampling periods between September 2009 and October 2010. Dry deposition rates from surrogate surfaces ranged from 80 to 1512 pgm(-2)h(-1). GOM dry deposition rates were strongly correlated (r(2)=0.75) with the weekly average atmospheric GOM concentrations, which ranged from 2.3 to 34.1 pgm(-3). Dry deposition of GOM could be predicted from the ambient air concentrations of GOM using this equation: GOM dry deposition (pgm(-2)h(-1))=43.2 × GOM concentration-80.3. Dry deposition velocities computed using GOM concentrations and surrogate surface GOM dry deposition rates, ranged from 0.2 to 1.7 cms(-1). Modeled dry deposition rates were highly correlated (r(2)=0.80) with surrogate surface dry deposition rates. Using the overall weekly average surrogate surface dry deposition rate (369 ± 340 pg m(-2)h(-1)), we estimated an annual GOM dry deposition rate of 3.2 μg m(-2)year(-1). Using the resistance model, we estimated an annual GOM dry deposition rate of 3.5 μg m(-2)year(-1). Our annual GOM dry deposition rates were similar to the dry deposition (3.3 μg m(-2)h(-1)) of gaseous elemental mercury (GEM) at our site. In addition, annual GOM dry deposition was approximately 1/2 of the average annual wet deposition of total mercury (7.7 ± 1.9 μg m(-2)year(-1)) at our site. Total annual mercury deposition from dry deposition of GOM and GEM and wet deposition was approximately 14.4 μg m(-2)year(-1), which was similar to the average annual litterfall deposition (15 ± 2.1 μg m(-2)year(-1)) of mercury, which was also measured at our site. Copyright © 2012 Elsevier B.V. All rights reserved.

Mercury-impacted scrap metal: Source and nature of the mercury.

Science.gov (United States)

Finster, Molly E; Raymond, Michelle R; Scofield, Marcienne A; Smith, Karen P

2015-09-15

The reuse and recycling of industrial solid wastes such as scrap metal is supported and encouraged both internationally and domestically, especially when such wastes can be used as substitutes for raw material. However, scrap metal processing facilities, such as mini-mills, have been identified as a source of mercury (Hg) emissions in the United States. This research aims to better define some of the key issues related to the source and nature of mercury in the scrap metal waste stream. Overall, it is difficult to pinpoint the key mercury sources feeding into scrap metal recycling facilities, quantify their associated mercury concentrations, or determine which chemical forms are most significant. Potential sources of mercury in scrap metal include mercury switches from discarded vehicles, electronic-based scrap from household appliances and related industrial systems, and Hg-impacted scrap metal from the oil and gas industry. The form of mercury associated with scrap metal varies and depends on the source type. The specific amount of mercury that can be adsorbed and retained by steel appears to be a function of both metallurgical and environmental factors. In general, the longer the steel is in contact with a fluid or condensate that contains measurable concentrations of elemental mercury, the greater the potential for mercury accumulation in that steel. Most mercury compounds are thermally unstable at elevated temperatures (i.e., above 350 °C). As such, the mercury associated with impacted scrap is expected to be volatilized out of the metal when it is heated during processing (e.g., shredding or torch cutting) or melted in a furnace. This release of fugitive gas (Hg vapor) and particulates, as well as Hg-impacted bag-house dust and control filters, could potentially pose an occupational exposure risk to workers at a scrap metal processing facility. Thus, identifying and characterizing the key sources of Hg-impacted scrap, and understanding the nature and extent

Mercury contamination extraction

Science.gov (United States)

Fuhrmann, Mark [Silver Spring, MD; Heiser, John [Bayport, NY; Kalb, Paul [Wading River, NY

2009-09-15

Mercury is removed from contaminated waste by firstly applying a sulfur reagent to the waste. Mercury in the waste is then permitted to migrate to the reagent and is stabilized in a mercury sulfide compound. The stable compound may then be removed from the waste which itself remains in situ following mercury removal therefrom.

Global Trends in Mercury Management

Science.gov (United States)

Choi, Kyunghee

2012-01-01

The United Nations Environmental Program Governing Council has regulated mercury as a global pollutant since 2001 and has been preparing the mercury convention, which will have a strongly binding force through Global Mercury Assessment, Global Mercury Partnership Activities, and establishment of the Open-Ended Working Group on Mercury. The European Union maintains an inclusive strategy on risks and contamination of mercury, and has executed the Mercury Export Ban Act since December in 2010. The US Environmental Protection Agency established the Mercury Action Plan (1998) and the Mercury Roadmap (2006) and has proposed systematic mercury management methods to reduce the health risks posed by mercury exposure. Japan, which experienced Minamata disease, aims vigorously at perfection in mercury management in several ways. In Korea, the Ministry of Environment established the Comprehensive Plan and Countermeasures for Mercury Management to prepare for the mercury convention and to reduce risks of mercury to protect public health. PMID:23230466

Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

International Nuclear Information System (INIS)

Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

2007-01-01

The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

Subcellular Targeting of Methylmercury Lyase Enhances Its Specific Activity for Organic Mercury Detoxification in Plants1

Science.gov (United States)

Bizily, Scott P.; Kim, Tehryung; Kandasamy, Muthugapatti K.; Meagher, Richard B.

2003-01-01

Methylmercury is an environmental pollutant that biomagnifies in the aquatic food chain with severe consequences for humans and other animals. In an effort to remove this toxin in situ, we have been engineering plants that express the bacterial mercury resistance enzymes organomercurial lyase MerB and mercuric ion reductase MerA. In vivo kinetics experiments suggest that the diffusion of hydrophobic organic mercury to MerB limits the rate of the coupled reaction with MerA (Bizily et al., 2000). To optimize reaction kinetics for organic mercury compounds, the merB gene was engineered to target MerB for accumulation in the endoplasmic reticulum and for secretion to the cell wall. Plants expressing the targeted MerB proteins and cytoplasmic MerA are highly resistant to organic mercury and degrade organic mercury at 10 to 70 times higher specific activity than plants with the cytoplasmically distributed wild-type MerB enzyme. MerB protein in endoplasmic reticulum-targeted plants appears to accumulate in large vesicular structures that can be visualized in immunolabeled plant cells. These results suggest that the toxic effects of organic mercury are focused in microenvironments of the secretory pathway, that these hydrophobic compartments provide more favorable reaction conditions for MerB activity, and that moderate increases in targeted MerB expression will lead to significant gains in detoxification. In summary, to maximize phytoremediation efficiency of hydrophobic pollutants in plants, it may be beneficial to target enzymes to specific subcellular environments. PMID:12586871

Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

Directory of Open Access Journals (Sweden)

Lindblad Peter

2008-04-01

Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

Characterization of the binding capacity of mercurial species in Lactobacillus strains.

Science.gov (United States)

Alcántara, Cristina; Jadán-Piedra, Carlos; Vélez, Dinoraz; Devesa, Vicenta; Zúñiga, Manuel; Monedero, Vicente

2017-12-01

Metal sequestration by bacteria has been proposed as a strategy to counteract metal contamination in foodstuffs. Lactobacilli can interact with metals, although studies with important foodborne metals such as inorganic [Hg(II)] or organic (CH 3 Hg) mercury are lacking. Lactobacilli were evaluated for their potential to bind these contaminants and the nature of the interaction was assessed by the use of metal competitors, chemical and enzymatical treatments, and mutants affected in the cell wall structure. Lactobacillus strains efficiently bound Hg(II) and CH 3 Hg. Mercury binding by Lactobacillus casei BL23 was independent of cell viability. In BL23, both forms of mercury were cell wall bound. Their interaction was not inhibited by cations and it was resistant to chelating agents and protein digestion. Lactobacillus casei mutants affected in genes involved in the modulation of the negative charge of the cell wall anionic polymer lipoteichoic acid showed increased mercury biosorption. In these mutants, mercury toxicity was enhanced compared to wild-type bacteria. These data suggest that lipoteichoic acid itself or the physicochemical characteristics that it confers to the cell wall play a major role in mercury complexation. This is the first example of the biosorption of Hg(II) and CH 3 Hg in lactobacilli and it represents a first step towards their possible use as agents for diminishing mercury bioaccessibility from food at the gastrointestinal tract. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Resistance of the Extreme Halophile Halobacterium sp. NRC-1 to Multiple Stresses

International Nuclear Information System (INIS)

Gygli, Patrick E.; Prajapati, Surendra; DeVeaux, Linda C.; DasSarma, Shiladitya; DasSarma, Priya; Mestari, Mohammed Amine; Wells, Douglas P.

2009-01-01

The model Archaeon Halobacterium sp. NRC-1 is an extreme halophile known for its resistance to multiple stressors, including electron-beam and ultraviolet radiation. It is a well-developed system with a completely sequenced genome and extensive post-genomic tools for the study of a variety of biological processes. To further understand the mechanisms of Halobacterium's, radiation resistance, we previously reported the selection for multiple independent highly resistant mutants using repeated exposure to high doses of 18-20 MeV electrons using a medical S-band Linac. Molecular analysis of the transcriptional profile of several of these mutants revealed a single common change: upregulation of the rfa3 operon. These genes encode proteins homologous to the subunits of eukaryotic Replication Protein A (RPA), a DNA binding protein with major roles in DNA replication, recombination, and repair. This operon has also been implicated in a somewhat lesser role in resistance of wild type Halobacterium to ultraviolet radiation, suggesting common mechanisms for resistance. To further understand the mechanism of radiation resistance in the mutant strains, we measured the survival after exposure to both electron-beam and ultraviolet radiation, UV-A, B, and C All mutant strains showed increased resistance to electrons when compared with the parent. However, the mutant strains do not display increased UV resistance, and in one case is more sensitive than the parent strain. Thus, the protective role of increased RPA expression within a cell may be specific to the DNA damage caused by the different physical effects induced by high energy electron-beam radiation.

Metallothionein expression in chloroplasts enhances mercury accumulation and phytoremediation capability.

Science.gov (United States)

Ruiz, Oscar N; Alvarez, Derry; Torres, Cesar; Roman, Laura; Daniell, Henry

2011-06-01

Genetic engineering to enhance mercury phytoremediation has been accomplished by expression of the merAB genes that protects the cell by converting Hg[II] into Hg[0] which volatilizes from the cell. A drawback of this approach is that toxic Hg is released back into the environment. A better phytoremediation strategy would be to accumulate mercury inside plants for subsequent retrieval. We report here the development of a transplastomic approach to express the mouse metallothionein gene (mt1) and accumulate mercury in high concentrations within plant cells. Real-time PCR analysis showed that up to 1284 copies of the mt1 gene were found per cell when compared with 1326 copies of the 16S rrn gene, thereby attaining homoplasmy. Past studies in chloroplast transformation used qualitative Southern blots to evaluate indirectly transgene copy number, whereas we used real-time PCR for the first time to establish homoplasmy and estimate transgene copy number and transcript levels. The mt1 transcript levels were very high with 183,000 copies per ng of RNA or 41% the abundance of the 16S rrn transcripts. The transplastomic lines were resistant up to 20 μm mercury and maintained high chlorophyll content and biomass. Although the transgenic plants accumulated high concentrations of mercury in all tissues, leaves accumulated up to 106 ng, indicating active phytoremediation and translocation of mercury. Such accumulation of mercury in plant tissues facilitates proper disposal or recycling. This study reports, for the first time, the use of metallothioneins in plants for mercury phytoremediation. Chloroplast genetic engineering approach is useful to express metal-scavenging proteins for phytoremediation. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Mercurial poisoning

Energy Technology Data Exchange (ETDEWEB)

Gorton, B

1924-01-01

Cats which had been kept in a thermometer factory to catch rats were afflicted with mercury poisoning. So were the rats they were supposed to eat. The symptoms of mercury poisoning were the same in both species. The source of mercury for these animals is a fine film of the metal which coats floors, a result of accidental spills during the manufacturing process.

Biochemical basis of mercury remediation and bioaccumulation by Enterobacter sp. EMB21.

Science.gov (United States)

Sinha, Arvind; Kumar, Sumit; Khare, Sunil Kumar

2013-01-01

The aims of this study were to isolate metal bioaccumulating bacterial strains and to study their applications in removal of environmental problematic heavy metals like mercury. Five bacterial strains belonging to genera Enterobacter, Bacillus, and Pseudomonas were isolated from oil-spilled soil. Among these, one of the strains Enterobacter sp. EMB21 showed mercury bioaccumulation inside the cells simultaneous to its bioremediation. The bioaccumulation of remediated mercury was confirmed by transmission electron microscopy and energy dispersive X-ray. The mercury-resistant loci in the Enterobacter sp. EMB21 cells were plasmid-mediated as confirmed by transformation of mercury-sensitive Escherichia coli DH5α by Enterobacter sp. EMB21 plasmid. Effect of different culture parameters viz-a-viz inoculum size, pH, carbon, and nitrogen source revealed that alkaline pH and presence of dextrose and yeast extract favored better remediation. The results indicated the usefulness of Enterobacter sp. EMB21 for the effective remediation of mercury in bioaccumulated form. The Enterobacter sp. EMB21 seems promising for heavy metal remediation wherein the remediated metal can be trapped inside the cells. The process can further be developed for the synthesis of valuable high-end functional alloy, nanoparticles, or metal conjugates from the metal being remediated.

The effect of stochasticity on the lac operon: an evolutionary perspective.

Directory of Open Access Journals (Sweden)

Milan van Hoek

2007-06-01

Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel

Atmospheric mercury in Changbai Mountain area, northeastern China II. The distribution of reactive gaseous mercury and particulate mercury and mercury deposition fluxes.

Science.gov (United States)

Wan, Qi; Feng, Xinbin; Lu, Julia; Zheng, Wei; Song, Xinjie; Li, Ping; Han, Shijie; Xu, Hao

2009-08-01

Reactive gaseous mercury (RGM) and particulate mercury (Hgp) concentrations in ambient air from a remote site at Changbai Mountain area in northeastern China were intermittently monitored from August 2005 to July 2006 totaling 93 days representing fall, winter-spring and summer season, respectively. Rainwater and snow samples were collected during a whole year, and total mercury (THg) in rain samples were used to calculate wet depositional flux. A throughfall method and a model method were used to estimate dry depositional flux. Results showed mean concentrations of RGM and Hgp are 65 and 77 pg m(-3). Compared to background concentrations of atmospheric mercury species in Northern Hemisphere, RGM and Hgp are significantly elevated in Changbai area. Large values for standard deviation indicated fast reactivity and a low residence time for these mercury species. Seasonal variability is also important, with lower mercury levels in summer compared to other seasons, which is attributed to scavenging by rainfall and low local mercury emissions in summer. THg concentrations ranged from 11.5 to 15.9 ng L(-1) in rainwater samples and 14.9-18.6 ng L(-1) in throughfall samples. Wet depositional flux in Changbai area is calculated to be 8.4 microg m(-2) a(-1), and dry deposition flux is estimated to be 16.5 microg m(-2) a(-1) according to a throughfall method and 20.2 microg m(-2) a(-1) using a model method.

Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

OpenAIRE

Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

1993-01-01

CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

Toward a Unified Understanding of Mercury and Methylated Mercury from the World's Oceans

Science.gov (United States)

McNutt, M. K.; Krabbenhoft, D. P.; Landing, W. M.; Sunderland, E. M.

2012-12-01

Marine fish and shellfish are the main source of toxic methylmercury exposure for humans. As recently as decade ago, very limited aqueous methylated mercury data were available from marine settings, resulting in a generally poor understanding of the processes controlling mercury in pelagic marine food webs. Recent oceanographic cruises have significantly improved availability of reliable measurements of methylated mercury and total mercury in seawater. This presentation will focus on vertical seawater profiles collected to depths 1000 m from three recent sampling efforts in collaboration with the CLIVAR Repeat Hydrography Program sponsored by NOAA including: 1) the northeastern Pacific (P16N cruise from Honolulu, Hawaii to Kodiak, Alaska); (2) the southern Indian Ocean (I5 cruise from Cape Town, South Africa, to Fremantle, Australia); and, (3) the Southern Ocean cruise (S4P from McMurdo, Antarctica, to Punta Arenas, Chile). Analytical results presented were all derived from the USGS Mercury Research Lab (http://wi.water.usgs.gov/mercury-lab). Supporting data derived from these cruises on water mass ages, nutrients, carbon and dissolved oxygen provide an opportunity to develop a stronger understanding of the biogeochemical factors controlling oceanic distributions of mercury and methylated mercury. Whole-water, median total mercury, and methylated mercury concentrations for the northern Pacific, southern Indian, and Southern Ocean were 1.10, 0.80, and 1.65 pM, , and 0.11, 0.08, and 0.32 pM, respectively. For all three oceans, vertical profiles of total mercury generally show the lowest concentrations in the surface mixed layer, and concentration maxima at the 700-1000 m depths. Surface depletion of total mercury is attributed to photo-chemical reduction and evasion of gaseous elemental mercury as well as scavenging by settling particulate matter, the main vector of transport to the subsurface ocean. Methylated mercury in all the ocean profiles reveal distinct mid

Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri.

Science.gov (United States)

Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong

2015-10-23

The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

Science.gov (United States)

Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

2017-05-01

Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Excretion and distribution of mercury in rats, antidotes for mercury and effects of egg production and fertility of hens after mercury administration

Energy Technology Data Exchange (ETDEWEB)

Ulfvarson, U

1973-01-01

The results of investigations of the distribution and excretion of organic and inorganic mercury compounds in albino rats and white leghorn hens conducted over a period of ten years are surveyed. The storage of mercury in eggs as well as its effects on the egg-lay-frequency and hatchability of the eggs have also been studied. All investigated mercury compounds were labelled with the radioactive mercury isotope /sup 203/Hg and the mercury level was measured with a scintillation technique. Since antidotes used in the treatment of mercury poisoning influence not only the excretion of mercury, but also its distribution in the body, the effects of nine antidotes on the metabolism of different mercury compounds were also investigated. The results of the survey are presented graphically. 6 references, 15 figures, 1 table.

Identification of an operon involved in fluoride resistance in Enterobacter cloacae FRM

OpenAIRE

Liu, Xiaoqing; Tian, Jian; Liu, Lihui; Zhu, Tao; Yu, Xiaoxia; Chu, Xiaoyu; Yao, Bin; Wu, Ningfeng; Fan, Yunliu

2017-01-01

Fluorine is ubiquitous and the most active non-metal element in nature. While many microorganisms have developed fluoride resistance as a result of the widespread and prolonged application of oral hygiene products, the mechanisms used by these organisms to overcome fluoride toxicity are incompletely understood. In this study, a fluoride-resistant strain, Enterobacter cloacae FRM, was identified which could grow well at a fluoride concentration of 4,000?mg/L. According to comparative genomics,...

Mercury's exosphere: observations during MESSENGER's First Mercury flyby.

Science.gov (United States)

McClintock, William E; Bradley, E Todd; Vervack, Ronald J; Killen, Rosemary M; Sprague, Ann L; Izenberg, Noam R; Solomon, Sean C

2008-07-04

During MESSENGER's first Mercury flyby, the Mercury Atmospheric and Surface Composition Spectrometer measured Mercury's exospheric emissions, including those from the antisunward sodium tail, calcium and sodium close to the planet, and hydrogen at high altitudes on the dayside. Spatial variations indicate that multiple source and loss processes generate and maintain the exosphere. Energetic processes connected to the solar wind and magnetospheric interaction with the planet likely played an important role in determining the distributions of exospheric species during the flyby.

Mercury-Supported Biomimetic Membranes for the Investigation of Antimicrobial Peptides

Directory of Open Access Journals (Sweden)

Lucia Becucci

2014-01-01

Full Text Available Tethered bilayer lipid membranes (tBLMs consist of a lipid bilayer interposed between an aqueous solution and a hydrophilic “spacer” anchored to a gold or mercury electrode. There is great potential for application of these biomimetic membranes for the elucidation of structure-function relationships of membrane peptides and proteins. A drawback in the use of mercury-supported tBLMs with respect to gold-supported ones is represented by the difficulty in applying surface sensitive, spectroscopic and scanning probe microscopic techniques to gather information on the architecture of these biomimetic membranes. Nonetheless, mercury-supported tBLMs are definitely superior to gold-supported biomimetic membranes for the investigation of the function of membrane peptides and proteins, thanks to a fluidity and lipid lateral mobility comparable with those of bilayer lipid membranes interposed between two aqueous phases (BLMs, but with a much higher robustness and resistance to electric fields. The different features of mercury-supported tBLMs reconstituted with functionally active membrane proteins and peptides of bacteriological or pharmacological interest may be disclosed by a judicious choice of the most appropriate electrochemical techniques. We will describe the way in which electrochemical impedance spectroscopy, potential-step chronocoulometry, cyclic voltammetry and phase-sensitive AC voltammetry are conveniently employed to investigate the structure of mercury-supported tBLMs and the mode of interaction of antimicrobial peptides reconstituted into them.

Spectroscopy of Cu(II)-PcoC and the multicopper oxidase function of PcoA, two essential components of Escherichia coli pco copper resistance operon.

Science.gov (United States)

Huffman, David L; Huyett, Jennifer; Outten, F Wayne; Doan, Peter E; Finney, Lydia A; Hoffman, Brian M; O'Halloran, Thomas V

2002-08-06

The plasmid-encoded pco copper resistance operon in Escherichia coli consists of seven genes that are expressed from two pco promoters in response to elevated copper; however, little is known about how they mediate resistance to excess environmental copper. Two of the genes encode the soluble periplasmic proteins PcoA and PcoC. We show here that inactivation of PcoC, and PcoA to a lesser extent, causes cells to become more sensitive to copper than wild-type nonresistant strains, consistent with a tightly coupled detoxification pathway. Periplasmic extracts show copper-inducible oxidase activity, attributed to the multicopper oxidase function of PcoA. PcoC, a much smaller protein than PcoA, binds one Cu(II) and exhibits a weak electronic transition characteristic of a type II copper center. ENDOR and ESEEM spectroscopy of Cu(II)-PcoC and the (15)N- and Met-CD(3)-labeled samples are consistent with a tetragonal ligand environment of three nitrogens and one aqua ligand "in the plane". A weakly associated S-Met and aqua are likely axial ligands. At least one N is a histidine and is likely trans to the in-plane aqua ligand. The copper chemistry of PcoC and the oxidase function of PcoA are consistent with the emerging picture of the chromosomally encoded copper homeostasis apparatus in the E. coli cell envelope [Outten, F. W., Huffman, D. L., Hale, J. A., and O'Halloran, T. V. (2001) J. Biol. Chem. 276, 30670-30677]. We propose a model for the plasmid system in which Cu(I)-PcoC functions in this copper efflux pathway as a periplasmic copper binding protein that docks with the multiple repeats of Met-rich domains in PcoA to effect oxidation of Cu(I) to the less toxic Cu(II) form. The solvent accessibility of the Cu(II) in PcoC may allow for metal transfer to other plasmid and chromosomal factors and thus facilitate removal of Cu(II) from the cell envelope.

Performance of Mercury Triple-Point Cells Made in Brazil

Science.gov (United States)

Petkovic, S. G.; Santiago, J. F. N.; Filho, R. R.; Teixeira, R. N.; Santos, P. R. F.

2003-09-01

Fixed-points cells are primary standards in ITS-90. They contain reference material with a purity of 99.999 % or more. The gallium in a melting-point cell, for example, can reach a purity of 99.99999 %. This level of purity is not easy to obtain. However, substances like water and mercury can be purified by means of distillation and chemical procedures. This paper presents the results of mercury triple-point cells made in Brazil that were directly compared to a mercury triple-point cell of 99.999% purity. This reference cell, made by Isotech (England), was previously compared to cells from CENAM (Mexico) and NRC (Canada) and the maximum deviation found was approximately 0.4 mK. The purification stage started with a sample of mercury 99.3 % pure, and the repeated use of both mechanical and chemical processes led to a purification grade considered good enough for calibration of standard platinum resistance thermometers. The purification procedures, the method of construction of the cell, the laboratory facilities, the comparison results and the budget of uncertainties are described in this paper. All of the cells tested have a triple-point temperature within 0.25 mK of the triple-point temperature of the Inmetro reference cell.

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Winson, MK; Sternberg, C

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

A mercury transport and fate model (LM2-mercury) for mass budget assessment of mercury cycling in Lake Michigan

Science.gov (United States)

LM2-Mercury, a mercury mass balance model, was developed to simulate and evaluate the transport, fate, and biogeochemical transformations of mercury in Lake Michigan. The model simulates total suspended solids (TSS), disolved organic carbon (DOC), and total, elemental, divalent, ...

Mercury Emission Measurement in Coal-Fired Boilers by Continuous Mercury Monitor and Ontario Hydro Method

Science.gov (United States)

Zhu, Yanqun; Zhou, Jinsong; He, Sheng; Cai, Xiaoshu; Hu, Changxin; Zheng, Jianming; Zhang, Le; Luo, Zhongyang; Cen, Kefa

2007-06-01

The mercury emission control approach attaches more importance. The accurate measurement of mercury speciation is a first step. Because OH method (accepted method) can't provide the real-time data and 2-week time for results attained, it's high time to seek on line mercury continuous emission monitors(Hg-CEM). Firstly, the gaseous elemental and oxidized mercury were conducted to measure using OH and CEM method under normal operation conditions of PC boiler after ESP, the results between two methods show good consistency. Secondly, through ESP, gaseous oxidized mercury decrease a little and particulate mercury reduce a little bit, but the elemental mercury is just the opposite. Besides, the WFGD system achieved to gaseous oxidized mercury removal of 53.4%, gaseous overall mercury and elemental mercury are 37.1% and 22.1%, respectively.

Removal of mercury in fixed-bed continuous upflow reactors by mercury-resistant bacteria and effect of sodium chloride on their performance

Digital Repository Service at National Institute of Oceanography (India)

De; Leonhauser, J.; Vardanyan, L.

Urgent need to reduce the amount of toxic mercury compounds in the wastewater of industries and subsequent reuse of metal ions, has led to an increasing interest in microbial bioremediation. Two Pseudomonas aeruginosa strains, namely, isolate CH07...

Biomarkers of mercury exposure at a mercury recycling facility in Ukraine

Science.gov (United States)

Gibb, H.J.; Kozlov, K.; Buckley, J.P.; Centeno, J.; Jurgenson, V.; Kolker, A.; Conko, K.; Landa, E.; Panov, B.; Panov, Y.; Xu, H.

2008-01-01

This study evaluates biomarkers of occupational mercury exposure among workers at a mercury recycling operation in Gorlovka, Ukraine. The 29 study participants were divided into three occupational categories for analysis: (1) those who worked in the mercury recycling operation (Group A, n = 8), (2) those who worked at the facility but not in the yard where the recycling was done (Group B, n = 14), and (3) those who did not work at the facility (Group C, n = 7). Urine, blood, hair, and nail samples were collected from the participants, and a questionnaire was administered to obtain data on age, gender, occupational history, smoking, alcohol consumption, fish consumption, tattoos, dental amalgams, home heating system, education, source of drinking water, and family employment in the former mercury mine/smelter located on the site of the recycling facility. Each factor was tested in a univariate regression with total mercury in urine, blood, hair, and nails. Median biomarker concentrations were 4.04 ??g/g-Cr (urine), 2.58 ??g/L (blood), 3.95 ??g/g (hair), and 1.16 ??g/g (nails). Occupational category was significantly correlated (p < 0.001) with both blood and urinary mercury concentrations but not with hair or nail mercury. Four individuals had urinary mercury concentrations in a range previously found to be associated with subtle neurological and subjective symptoms (e.g., fatigue, loss of appetite, irritability), and one worker had a urinary mercury concentration in a range associated with a high probability of neurological effects and proteinuria. Comparison of results by occupational category found that workers directly involved with the recycling operation had the highest blood and urinary mercury levels. Those who worked at the facility but were not directly involved with the recycling operation had higher levels than those who did not work at the facility. Copyright ?? 2008 JOEH, LLC.

Concentration of mercury in wheat samples stored with mercury tablets as preservative

International Nuclear Information System (INIS)

Lalit, B.Y.; Ramachandran, T.V.

1977-01-01

Tablets consisting of mercury in the form of a dull grey powder made by triturating mercury with chalk and sugar are used in Indian household for storing food-grains. The contamination of wheat samples by mercury, when stored with mercury tablets for period of upto four years has been assessed by using non-destructive neutron activation analysis. The details of the analytical procedure used have also been briefly described. The concentration of mercury in wheat increases with storage period. Loss of weight of mercury tablet is proportional to the storage period to a first approximation. In the present experiment, the average weight loss at the and end of first year was 0.009716 g corresponding to 6 ppm in wheat. (T.G.)

Mercury Flow Through the Mercury-Containing Lamp Sector of the Economy of the United States

Science.gov (United States)

Goonan, Thomas G.

2006-01-01

Introduction: This Scientific Investigations Report examines the flow of mercury through the mercury-containing lamp sector of the U.S. economy in 2001 from lamp manufacture through disposal or recycling. Mercury-containing lamps illuminate commercial and industrial buildings, outdoor areas, and residences. Mercury is an essential component in fluorescent lamps and high-intensity discharge lamps (high-pressure sodium, mercury-vapor, and metal halide). A typical fluorescent lamp is composed of a phosphor-coated glass tube with electrodes located at either end. Only a very small amount of the mercury is in vapor form. The remainder of the mercury is in the form of either liquid mercury metal or solid mercury oxide (mercury oxidizes over the life of the lamp). When voltage is applied, the electrodes energize the mercury vapor and cause it to emit ultraviolet energy. The phosphor coating absorbs the ultraviolet energy, which causes the phosphor to fluoresce and emit visible light. Mercury-containing lamps provide more lumens per watt than incandescent lamps and, as a result, require from three to four times less energy to operate. Mercury is persistent and toxic within the environment. Mercury-containing lamps are of environmental concern because they are widely distributed throughout the environment and are easily broken in handling. The magnitude of lamp sector mercury emissions, estimated to be 2.9 metric tons per year (t/yr), is small compared with the estimated mercury losses of the U.S. coal-burning and chlor-alkali industries, which are about 70 t/yr and about 90 t/yr, respectively.

Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

Directory of Open Access Journals (Sweden)

Hiraku Takada

Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

Estimating mercury emissions from a zinc smelter in relation to China's mercury control policies

International Nuclear Information System (INIS)

Wang, S.X.; Song, J.X.; Li, G.H.; Wu, Y.; Zhang, L.; Wan, Q.; Streets, D.G.; Chin, Conrad K.; Hao, J.M.

2010-01-01

Mercury concentrations of flue gas at inlet/outlet of the flue gas cleaning, electrostatic demister, reclaiming tower, acid plant, and mercury contents in zinc concentrate and by-products were measured in a hydrometallurgical zinc smelter. The removal efficiency of flue gas cleaning, electrostatic demister, mercury reclaiming and acid plant was about 17.4%, 30.3%, 87.9% and 97.4% respectively. Flue gas cleaning and electrostatic demister captured 11.7% and 25.3% of the mercury in the zinc concentrate, respectively. The mercury reclaiming tower captured 58.3% of the mercury in the zinc concentrate. About 4.2% of the mercury in the zinc concentrate was captured by the acid plant. Consequently, only 0.8% of the mercury in the zinc concentrate was emitted to the atmosphere. The atmospheric mercury emission factor was 0.5 g t -1 of zinc produced for the tested smelter, indicating that this process offers the potential to effectively reduce mercury emissions from zinc smelting. - Modern scale production equipped with acid plant and Hg reclaiming tower will significantly reduce Hg emissions from zinc smelters in China.

Quantification of Gaseous Elemental Mercury Dry Deposition to Environmental Surfaces using Mercury Stable Isotopes in a Controlled Environment

Science.gov (United States)

Rutter, A. P.; Schauer, J. J.; Shafer, M. M.; Olson, M.; Robinson, M.; Vanderveer, P.; Creswell, J. E.; Parman, A.; Mallek, J.; Gorski, P.

2009-12-01

atmospheric turbulence and wind speed. GEM enriched in stable isotope 198 (GEM-198) was released into the room from source at elevated but environmentally relevant concentrations of GEM-198 for several days. Uptake of GEM-198 from deciduous and conifer trees, grass turf, 3 types of soil, sand, concrete, asphalt, and adsorbent coated deposition coupons were quantified over several days. Exposures were conducted between 10oC and 30oC, in dark and light conditions. Mercury was recovered from the samples using acidic digestions and surface leaches, and then analyzed for the content of GEM-198 by high resolution ICPMS. Experimental results demonstrated that uptake by White Ash, White Spruce, and Kentucky bluegrass were significantly higher than uptakes measured for two Wisconsin soils, peat, sand, concrete and asphalt at all of the conditions studied. Deposition resistances for surface transfer processes for were calculated for each of the substrates across the conditions studied for use in atmospheric model simulations.

Spatial variation of mercury bioaccumulation in bats of Canada linked to atmospheric mercury deposition.

Science.gov (United States)

Chételat, John; Hickey, M Brian C; Poulain, Alexandre J; Dastoor, Ashu; Ryjkov, Andrei; McAlpine, Donald; Vanderwolf, Karen; Jung, Thomas S; Hale, Lesley; Cooke, Emma L L; Hobson, Dave; Jonasson, Kristin; Kaupas, Laura; McCarthy, Sara; McClelland, Christine; Morningstar, Derek; Norquay, Kaleigh J O; Novy, Richard; Player, Delanie; Redford, Tony; Simard, Anouk; Stamler, Samantha; Webber, Quinn M R; Yumvihoze, Emmanuel; Zanuttig, Michelle

2018-06-01

Wildlife are exposed to neurotoxic mercury at locations distant from anthropogenic emission sources because of long-range atmospheric transport of this metal. In this study, mercury bioaccumulation in insectivorous bat species (Mammalia: Chiroptera) was investigated on a broad geographic scale in Canada. Fur was analyzed (n=1178) for total mercury from 43 locations spanning 20° latitude and 77° longitude. Total mercury and methylmercury concentrations in fur were positively correlated with concentrations in internal tissues (brain, liver, kidney) for a small subset (n=21) of little brown bats (Myotis lucifugus) and big brown bats (Eptesicus fuscus), validating the use of fur to indicate internal mercury exposure. Brain methylmercury concentrations were approximately 10% of total mercury concentrations in fur. Three bat species were mainly collected (little brown bats, big brown bats, and northern long-eared bats [M. septentrionalis]), with little brown bats having lower total mercury concentrations in their fur than the other two species at sites where both species were sampled. On average, juvenile bats had lower total mercury concentrations than adults but no differences were found between males and females of a species. Combining our dataset with previously published data for eastern Canada, median total mercury concentrations in fur of little brown bats ranged from 0.88-12.78μg/g among 11 provinces and territories. Highest concentrations were found in eastern Canada where bats are most endangered from introduced disease. Model estimates of atmospheric mercury deposition indicated that eastern Canada was exposed to greater mercury deposition than central and western sites. Further, mean total mercury concentrations in fur of adult little brown bats were positively correlated with site-specific estimates of atmospheric mercury deposition. This study provides the largest geographic coverage of mercury measurements in bats to date and indicates that atmospheric

The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

DEFF Research Database (Denmark)

Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

2008-01-01

The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

Metallic mercury recycling. Final report

Energy Technology Data Exchange (ETDEWEB)

Beck, M.A.

1994-07-01

Metallic mercury is known to be a hazardous material and is regulated as such. The disposal of mercury, usually by landfill, is expensive and does not remove mercury from the environment. Results from the Metallic Mercury Recycling Project have demonstrated that metallic mercury is a good candidate for reclamation and recycling. Most of the potential contamination of mercury resides in the scum floating on the surface of the mercury. Pinhole filtration was demonstrated to be an inexpensive and easy way of removing residues from mercury. The analysis method is shown to be sufficient for present release practices, and should be sufficient for future release requirements. Data from tests are presented. The consistently higher level of activity of the filter residue versus the bulk mercury is discussed. Recommendations for the recycling procedure are made.

Metallic mercury recycling. Final report

International Nuclear Information System (INIS)

Beck, M.A.

1994-01-01

Metallic mercury is known to be a hazardous material and is regulated as such. The disposal of mercury, usually by landfill, is expensive and does not remove mercury from the environment. Results from the Metallic Mercury Recycling Project have demonstrated that metallic mercury is a good candidate for reclamation and recycling. Most of the potential contamination of mercury resides in the scum floating on the surface of the mercury. Pinhole filtration was demonstrated to be an inexpensive and easy way of removing residues from mercury. The analysis method is shown to be sufficient for present release practices, and should be sufficient for future release requirements. Data from tests are presented. The consistently higher level of activity of the filter residue versus the bulk mercury is discussed. Recommendations for the recycling procedure are made

Single and combined effects of microplastics and mercury on juveniles of the European seabass (Dicentrarchus labrax): Changes in behavioural responses and reduction of swimming velocity and resistance time.

Science.gov (United States)

Barboza, Luís Gabriel Antão; Vieira, Luís Russo; Guilhermino, Lúcia

2018-05-01

Microplastics and mercury are environmental pollutants of great concern. The main goal of the present study was to investigate the effects of these pollutants, both individually and in binary mixtures, on the swimming performance of juvenile European seabass, Dicentrarchus labrax. Microplastics alone, mercury alone and all the mixtures caused significant reduction of the swimming velocity and resistance time of fish. Moreover, changes in behavioural responses including lethargic and erratic swimming behaviour were observed. These results highlight that fish behavioural responses can be used as sensitive endpoint to establish the effects of contamination by microplastics and also emphasizes the need to assess the combined effects of microplastics and other environmental contaminants, with special attention to the effects on behavioural responses in fish and other aquatic species. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Comparative Examination of Reconnection-Driven Magnetotail Dynamics at Mercury and Earth

Science.gov (United States)

Slavin, J. A.

2014-12-01

becomes quasi-periodic. Unlike the Earth, solar wind dynamic pressure increases at Mercury couple directly to its large iron core. Magnetic fields due to induction currents in Mercury's interior strongly resist compression of the dayside magnetosphere. The effects of such inductive coupling on magnetotail dynamics at Mercury remains to be determined.

Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.

Directory of Open Access Journals (Sweden)

T Sabari Sankar

2009-03-01

Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.

Mercury(II) and methyl mercury speciation on Streptococcus pyogenes loaded Dowex Optipore SD-2

International Nuclear Information System (INIS)

Tuzen, Mustafa; Uluozlu, Ozgur Dogan; Karaman, Isa; Soylak, Mustafa

2009-01-01

A solid phase extraction procedure based on speciation of mercury(II) and methyl mercury on Streptococcus pyogenes immobilized on Dowex Optipore SD-2 has been established. Selective and sequential elution with 0.1 mol L -1 HCl for methyl mercury and 2 mol L -1 HCl for mercury(II) were performed at pH 8. The determination of mercury levels was performed by cold vapour atomic absorption spectrometry (CVAAS). Optimal analytical conditions including pH, amounts of biosorbent, sample volumes, etc., were investigated. The influences of the some alkaline and earth alkaline ions and some transition metals on the recoveries were also investigated. The capacity of biosorbent for mercury(II) and methyl mercury was 4.8 and 3.4 mg g -1 . The detection limit (3 sigma) of the reagent blank for mercury(II) and methyl mercury was 2.1 and 1.5 ng L -1 . Preconcentration factor was calculated as 25. The relative standard deviations of the procedure were below 7%. The validation of the presented procedure is performed by the analysis of standard reference material (NRCC-DORM 2 Dogfish Muscle). The procedure was successfully applied to the speciation of mercury(II) and methyl mercury in natural water and environmental samples.

Mercury(II) and methyl mercury speciation on Streptococcus pyogenes loaded Dowex Optipore SD-2

Energy Technology Data Exchange (ETDEWEB)

Tuzen, Mustafa, E-mail: m.tuzen@gmail.com [Gaziosmanpasa University, Faculty of Science and Arts, Chemistry Department, 60250 Tokat (Turkey); Uluozlu, Ozgur Dogan [Gaziosmanpasa University, Faculty of Science and Arts, Chemistry Department, 60250 Tokat (Turkey); Karaman, Isa [Gaziosmanpasa University, Faculty of Science and Arts, Biology Department, 60250 Tokat (Turkey); Soylak, Mustafa [Erciyes University, Faculty of Science and Arts, Chemistry Department, 38039 Kayseri (Turkey)

2009-09-30

A solid phase extraction procedure based on speciation of mercury(II) and methyl mercury on Streptococcus pyogenes immobilized on Dowex Optipore SD-2 has been established. Selective and sequential elution with 0.1 mol L{sup -1} HCl for methyl mercury and 2 mol L{sup -1} HCl for mercury(II) were performed at pH 8. The determination of mercury levels was performed by cold vapour atomic absorption spectrometry (CVAAS). Optimal analytical conditions including pH, amounts of biosorbent, sample volumes, etc., were investigated. The influences of the some alkaline and earth alkaline ions and some transition metals on the recoveries were also investigated. The capacity of biosorbent for mercury(II) and methyl mercury was 4.8 and 3.4 mg g{sup -1}. The detection limit (3 sigma) of the reagent blank for mercury(II) and methyl mercury was 2.1 and 1.5 ng L{sup -1}. Preconcentration factor was calculated as 25. The relative standard deviations of the procedure were below 7%. The validation of the presented procedure is performed by the analysis of standard reference material (NRCC-DORM 2 Dogfish Muscle). The procedure was successfully applied to the speciation of mercury(II) and methyl mercury in natural water and environmental samples.

Thiosulphate assisted phytoextraction of mercury contaminated soils at the Wanshan Mercury Mining District, Southwest China

Directory of Open Access Journals (Sweden)

J. Wang

2013-10-01

Full Text Available Wanshan, known as the “Mercury Capital” of China, is located in the Southwest of China. Due to the extensive mining and smelting works in the Wanshan area, the local ecosystem has been serious contaminated with mercury. In the present study, a number of soil samples were taken from the Wanshan mercury mining area and the mercury fractionations in soils were analyzed using sequential extraction procedure technique. The obtained results showed that the dominate mercury fractions (represent 95% of total mercury were residual and organic bound mercury. A field trial was conducted in a mercury polluted farmland at the Wanshan mercury mine. Four plant species Brassica juncea Czern. et Coss.var. ASKYC (ASKYC, Brassica juncea Czern. et Coss.var.DPDH (DPDH, Brassica juncea Czern. et Coss.var.CHBD(CHBD, Brassica juncea Czern. et Coss.var.LDZY (LDZY were tested their ability to extract mercury from soil with thiosulphate amendment. The results indicated that the mercury concentration in the roots and shoots of the four plants were significantly increased with thiosulphate treatment. The mercury phytoextraction yield of ASKYC, DPDH, CHBD and LDZY were 92, 526, 294 and 129 g/ha, respectively

Thiosulphate assisted phytoextraction of mercury contaminated soils at the Wanshan Mercury Mining District, Southwest China

Directory of Open Access Journals (Sweden)

J Wang

2013-10-01

Full Text Available Wanshan, known as the “Mercury Capital” of China, is located in the Southwest of China. Due to the extensive mining and smelting works in the Wanshan area, the local ecosystem has been serious contaminated with mercury. In the present study, a number of soil samples were taken from the Wanshan mercury mining area and the mercury fractionations in soils were analyzed using sequential extraction procedure technique. The obtained results showed that the dominate mercury fractions (represent 95% of total mercury were residual and organic bound mercury. A field trial was conducted in a mercury polluted farmland at the Wanshan mercury mine. Four plant species Brassica juncea Czern. et Coss.var. ASKYC (ASKYC, Brassica juncea Czern. et Coss.var.DPDH (DPDH, Brassica juncea Czern. et Coss.var.CHBD(CHBD, Brassica juncea Czern. et Coss.var.LDZY (LDZY were tested their ability to extract mercury from soil with thiosulphate amendment. The results indicated that the mercury concentration in the roots and shoots of the four plants were significantly increased with thiosulphate treatment. The mercury phytoextraction yield of ASKYC, DPDH, CHBD and LDZY were 92, 526, 294 and 129 g/ha, respectively.

Mercury CEM Calibration

Energy Technology Data Exchange (ETDEWEB)

John Schabron; Joseph Rovani; Mark Sanderson

2008-02-29

Mercury continuous emissions monitoring systems (CEMS) are being implemented in over 800 coal-fired power plant stacks. The power industry desires to conduct at least a full year of monitoring before the formal monitoring and reporting requirement begins on January 1, 2009. It is important for the industry to have available reliable, turnkey equipment from CEM vendors. Western Research Institute (WRI) is working closely with the Electric Power Research Institute (EPRI), the National Institute of Standards and Technology (NIST), and the Environmental Protection Agency (EPA) to facilitate the development of the experimental criteria for a NIST traceability protocol for dynamic elemental mercury vapor generators. The generators are used to calibrate mercury CEMs at power plant sites. The Clean Air Mercury Rule (CAMR) which was published in the Federal Register on May 18, 2005 requires that calibration be performed with NIST-traceable standards (Federal Register 2007). Traceability procedures will be defined by EPA. An initial draft traceability protocol was issued by EPA in May 2007 for comment. In August 2007, EPA issued an interim traceability protocol for elemental mercury generators (EPA 2007). The protocol is based on the actual analysis of the output of each calibration unit at several concentration levels ranging initially from about 2-40 {micro}g/m{sup 3} elemental mercury, and in the future down to 0.2 {micro}g/m{sup 3}, and this analysis will be directly traceable to analyses by NIST. The document is divided into two separate sections. The first deals with the qualification of generators by the vendors for use in mercury CEM calibration. The second describes the procedure that the vendors must use to certify the generator models that meet the qualification specifications. The NIST traceable certification is performance based, traceable to analysis using isotope dilution inductively coupled plasma/mass spectrometry performed by NIST in Gaithersburg, MD. The

Accumulation of mercury in selected plant species grown in soils contaminated with different mercury compounds

International Nuclear Information System (INIS)

Su, Yi; Han, Fengxiang; Shiyab, Safwan; Chen, Jian; Monts, David L.

2007-01-01

The objective of our research is to screen and search for suitable plant species for phyto-remediation of mercury-contaminated soil. Currently our effort is specifically focused on mercury removal from the U.S. Department of Energy (DOE) sites, where mercury contamination is a major concern. In order to cost effectively implement mercury remediation efforts, it is necessary now to obtain an improved understanding of biological means of removing mercury and mercury compounds.. Phyto-remediation is a technology that uses various plants to degrade, extract, contain, or immobilize contaminants from soil and water. In particular, phyto-extraction is the uptake of contaminants by plant roots and translocation within the plants to shoots or leaves. Contaminants are generally removed by harvesting the plants. We have investigated phyto-extraction of mercury from contaminated soil by using some of the known metal-accumulating plants since no natural plant species with mercury hyper-accumulating properties has yet been identified. Different natural plant species have been studied for mercury uptake, accumulation, toxicity and overall mercury removal efficiency. Various mercury compounds, such as HgS, HgCl 2 , and Hg(NO 3 ) 2 , were used as contaminant sources. Different types of soil were examined and chosen for phyto-remediation experiments. We have applied microscopy and diffuse reflectance spectrometry as well as conventional analytical chemistry to monitor the phyto-remediation processes of mercury uptake, translocation and accumulation, and the physiological impact of mercury contaminants on selected plant species. Our results indicate that certain plant species, such as beard grass (Polypogon monospeliensis), accumulated a very limited amount of mercury in the shoots ( 2 powder, respectively; no visual stress symptoms were observed. We also studied mercury phyto-remediation using aged soils that contained HgS, HgCl 2 , or Hg(NO 3 ) 2 . We have found that up to hundreds

Sequence analysis and identification of the pyrKDbF operon from Lactococcus lactis including a novel gene, pyrK, involved in pyrimidine biosynthesis

DEFF Research Database (Denmark)

Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin

1996-01-01

Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...

Methyl mercury, but not inorganic mercury, associated with higher blood pressure during pregnancy.

Science.gov (United States)

Wells, Ellen M; Herbstman, Julie B; Lin, Yu Hong; Hibbeln, Joseph R; Halden, Rolf U; Witter, Frank R; Goldman, Lynn R

2017-04-01

Prior studies addressing associations between mercury and blood pressure have produced inconsistent findings; some of this may result from measuring total instead of speciated mercury. This cross-sectional study of 263 pregnant women assessed total mercury, speciated mercury, selenium, and n-3 polyunsaturated fatty acids in umbilical cord blood and blood pressure during labor and delivery. Models with a) total mercury or b) methyl and inorganic mercury were evaluated. Regression models adjusted for maternal age, race/ethnicity, prepregnancy body mass index, neighborhood income, parity, smoking, n-3 fatty acids and selenium. Geometric mean total, methyl, and inorganic mercury concentrations were 1.40µg/L (95% confidence interval: 1.29, 1.52); 0.95µg/L (0.84, 1.07); and 0.13µg/L (0.10, 0.17), respectively. Elevated systolic BP, diastolic BP, and pulse pressure were found, respectively, in 11.4%, 6.8%, and 19.8% of mothers. In adjusted multivariable models, a one-tertile increase of methyl mercury was associated with 2.83mmHg (0.17, 5.50) higher systolic blood pressure and 2.99mmHg (0.91, 5.08) higher pulse pressure. In the same models, an increase of one tertile of inorganic mercury was associated with -1.18mmHg (-3.72, 1.35) lower systolic blood pressure and -2.51mmHg (-4.49, -0.53) lower pulse pressure. No associations were observed with diastolic pressure. There was a non-significant trend of higher total mercury with higher systolic blood pressure. We observed a significant association of higher methyl mercury with higher systolic and pulse pressure, yet higher inorganic mercury was significantly associated with lower pulse pressure. These results should be confirmed with larger, longitudinal studies. Copyright © 2017 Elsevier Inc. All rights reserved.

Mercury and halogens in coal--Their role in determining mercury emissions from coal combustion

Science.gov (United States)

Kolker, Allan; Quick, Jeffrey C.; Senior, Connie L.; Belkin, Harvey E.

2012-01-01

Mercury is a toxic pollutant. In its elemental form, gaseous mercury has a long residence time in the atmosphere, up to a year, allowing it to be transported long distances from emission sources. Mercury can be emitted from natural sources such as volcanoes, or from anthropogenic sources, such as coal-fired powerplants. In addition, all sources of mercury on the Earth's surface can re-emit it from land and sea back to the atmosphere, from which it is then redeposited. Mercury in the atmosphere is present in such low concentrations that it is not considered harmful. Once mercury enters the aquatic environment, however, it can undergo a series of biochemical transformations that convert a portion of the mercury originally present to methylmercury, a highly toxic organic form of mercury that accumulates in fish and birds. Many factors contribute to creation of methylmercury in aquatic ecosystems, including mercury availability, sediment and nutrient load, bacterial influence, and chemical conditions. In the United States, consumption of fish with high levels of methylmercury is the most common pathway for human exposure to mercury, leading the U.S. Environmental Protection Agency (EPA) to issue fish consumption advisories in every State. The EPA estimates that 50 percent of the mercury entering the atmosphere in the United States is emitted from coal-burning utility powerplants. An EPA rule, known as MATS (for Mercury and Air Toxics Standards), to reduce emissions of mercury and other toxic pollutants from powerplants, was signed in December 2011. The rule, which is currently under review, specifies limits for mercury and other toxic elements, such as arsenic, chromium, and nickel. MATS also places limits on emission of harmful acid gases, such as hydrochloric acid and hydrofluoric acid. These standards are the result of a 2010 detailed nationwide program by the EPA to sample stack emissions and thousands of shipments of coal to coal-burning powerplants. The United

Multidrug resistance in enteric and other gram-negative bacteria.

Science.gov (United States)

George, A M

1996-05-15

In Gram-negative bacteria, multidrug resistance is a term that is used to describe mechanisms of resistance by chromosomal genes that are activated by induction or mutation caused by the stress of exposure to antibiotics in natural and clinical environments. Unlike plasmid-borne resistance genes, there is no alteration or degradation of drugs or need for genetic transfer. Exposure to a single drug leads to cross-resistance to many other structurally and functionally unrelated drugs. The only mechanism identified for multidrug resistance in bacteria is drug efflux by membrane transporters, even though many of these transporters remain to be identified. The enteric bacteria exhibit mostly complex multidrug resistance systems which are often regulated by operons or regulons. The purpose of this review is to survey molecular mechanisms of multidrug resistance in enteric and other Gram-negative bacteria, and to speculate on the origins and natural physiological functions of the genes involved.

Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

Science.gov (United States)

Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

2015-11-01

Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Christiansen, Gunna; Molin, S

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

Directory of Open Access Journals (Sweden)

Potrich D.P.

2001-01-01

Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

Modular Ligation Extension of Guide RNA Operons (LEGO) for Multiplexed dCas9 Regulation of Metabolic Pathways in Saccharomyces cerevisiae.

Science.gov (United States)

Deaner, Matthew; Holzman, Allison; Alper, Hal S

2018-04-16

Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Mercury is Moon's brother

International Nuclear Information System (INIS)

Ksanfomalifi, L.V.

1976-01-01

The latest information on Mercury planet is presented obtained by studying the planet with the aid of radar and space vehicles. Rotation of Mercury about its axis has been discovered; within 2/3 of its year it executes a complete revolution about its axis. In images obtained by the ''Mariner-10'' Mercurys surface differs little from that of the Moon. The ''Mariner-10'' has also discovered the Mercurys atmosphere, which consists of extremely rarefied helium. The helium is continuously supplied to the planet by the solar wind. The Mercury's magnetic field has been discovered, whose strength is 35 x 10 -4 at the Equator and 70 x 10 -4 E at the poles. The inclination of the dipole axis to the Mercury's rotation axis is 7 deg

Mercury nano-trap for effective and efficient removal of mercury(II) from aqueous solution

Science.gov (United States)

Li, Baiyan; Zhang, Yiming; Ma, Dingxuan; Shi, Zhan; Ma, Shengqian

2014-11-01

Highly effective and highly efficient decontamination of mercury from aqueous media remains a serious task for public health and ecosystem protection. Here we report that this task can be addressed by creating a mercury ‘nano-trap’ as illustrated by functionalizing a high surface area and robust porous organic polymer with a high density of strong mercury chelating groups. The resultant porous organic polymer-based mercury ‘nano-trap’ exhibits a record-high saturation mercury uptake capacity of over 1,000 mg g-1, and can effectively reduce the mercury(II) concentration from 10 p.p.m. to the extremely low level of smaller than 0.4 p.p.b. well below the acceptable limits in drinking water standards (2 p.p.b.), and can also efficiently remove >99.9% mercury(II) within a few minutes. Our work therefore presents a new benchmark for mercury adsorbent materials and provides a new perspective for removing mercury(II) and also other heavy metal ions from contaminated water for environmental remediation.

Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

Czech Academy of Sciences Publication Activity Database

Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav

2007-01-01

Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

Plasmid Mediated Antibiotic and Heavy Metal Resistance in Bacillus Strains Isolated From Soils in Rize, Turkey

Directory of Open Access Journals (Sweden)

Elif SEVİM

2015-09-01

Full Text Available Fifteen Bacillus strains which were isolated from soil samples were examined for resistance to 17 different antibiotics (ampicillin, methicillin, erythromycin, norfloxacin, cephalotine, gentamycin, ciprofloxacin, streptomycin, tobramycin, chloramphenicol, trimethoprim-sulfamethoxazole, tetracycline, vancomycin, oxacilin, neomycin, kanamycin and, novabiocin and to 10 different heavy metals (copper, lead, cobalt, chrome, iron, mercury, zinc, nickel, manganese and, cadmium and for the presence of plasmid DNA. A total of eleven strains (67% were resistant to at least one antibiotic. The most common resistance was observed against methicillin and oxacillin. The most resistance strains were found as Bacillus sp. B3 and Bacillus sp. B11. High heavy metal resistance against copper, chromium, zinc, iron and nickel was detected, but mercury and cobalt resistance was not detected, except for 3 strains (B3, B11, and B12 which showed mercury resistance. It has been determined that seven Bacillus strains have plasmids. The isolated plasmids were transformed into the Bacillus subtilis W168 and it was shown that heavy metal and antibiotic resistance determinants were carried on these plasmids. These results showed that there was a correlation between plasmid content and resistance for both antibiotic and heavy metal resistance

Mercury flow experiments. 4th report: Measurements of erosion rate caused by mercury flow

International Nuclear Information System (INIS)

Kinoshita, Hidetaka; Kaminaga, Masanori; Haga, Katsuhiro; Hino, Ryutaro

2002-06-01

The Japan Atomic Energy Research Institute (JAERI) and the High Energy Accelerator Research Organization (KEK) are promoting a construction plan of the Material-Life Science Facility, which is consisted of a Muon Science Facility and a Neutron Scattering Facility, in order to open up the new science fields. The Neutron Scattering Facility will be utilized for advanced fields of Material and Life science using high intensity neutron generated by the spallation reaction of a 1 MW pulsed proton beam and mercury target. Design of the spallation mercury target system aims to obtain high neutron performance with high reliability and safety. Since the target system is using mercury as the target material and contains large amount of radioactive spallation products, it is necessary to estimate reliability for strength of instruments in a mercury flow system during lifetime of the facility. Piping and components in the mercury flow system would be damaged by erosion with mercury flow, since these components will be weak by thickness decreasing. This report presents experimental results of wall thickness change by erosion using a mercury experimental loop. In the experiments, an erosion test section and coupons were installed in the mercury experimental loop, and their wall thickness was measured with an ultra sonic thickness gage after every 1000 hours. As a result, under 0.7 m/s of mercury velocity condition which is slightly higher than the practical velocity in mercury pipelines, the erosion is about 3 μm in 1000 hours. The wall thickness decrease during facility lifetime of 30 years is estimated to be less than 0.5 mm. According to the experimental result, it is confirmed that the effect of erosion on component strength is extremely small. Moreover, a measurement of residual mercury on the piping surface was carried out. As a result, 19 g/m 2 was obtained as the residual mercury for the piping surface. According to this result, estimated amount of residual mercury for

Study of high levels indoor air mercury contamination from mercury amalgam use in dentistry

International Nuclear Information System (INIS)

Khwaja, M.A.; Abbasi, M.S.; Mehmood, F.; Jahangir, S.

2014-01-01

In 2005, United Nations Environment Programme (UNEP) estimated that 362 tonnes of dental mercury are consumed annually worldwide. Dental mercury amalgams also called silver fillings and amalgam fillings are widely done. These fillings gave off mercury vapours. Estimated average absorbed concentrations of mercury vapours from dental fillings vary from 3,000 to 17,000 ng Hg. Mercury (Hg) also known as quick silver is an essential constituent of dental amalgam. It is a toxic substance of global concern. A persistent pollutant, mercury is not limited to its source but it travels, on time thousands of kilometers away from the source. Scientific evidence, including, UNEP Global Mercury report, establishes mercury as an extremely toxic substance, which is a major threat to wildlife, ecosystem and human health, at a global scale. Children are more at risk from mercury poisoning which affects their neurological development and brain. Mercury poisoning diminishes memory, attention, thinking and sight. In the past, a number of studies at dental sites in many countries have been carried out and reported which have been reviewed and briefly described. This paper describes and discusses the recent investigations, regarding mercury vapours level in air, carried out at 18 dental sites in Pakistan and other countries. It is evident from the data of 42 dental sites in 17 countries, including, selected dental sites in five main cities of Pakistan, described and discussed in this paper that at most dental sites in many countries including Pakistan, the indoor mercury vapours levels exceed far above the permissible limit, recommended for safe physical and mental health. At these sites, public, in general, and the medical, paramedical staff and vulnerable population, in particular, are at most serious risk to health resulting from exposure to toxic and hazardous mercury. (author)

Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

Science.gov (United States)

Osipiuk, J; Joachimiak, A

1997-09-12

We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.

Science.gov (United States)

de Oliveira, Rafael R; Nicholson, Wayne L

2016-01-01

To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

Concentration of mercury in wheat samples stored with mercury tablets as preservative. [Neutrons

Energy Technology Data Exchange (ETDEWEB)

Lalit, B Y; Ramachandran, T V [Bhabha Atomic Research Centre, Bombay (India). Air Monitoring Section

1977-01-01

Tablets consisting of mercury in the form of a dull grey powder made by triturating mercury with chalk and sugar are used in Indian household for storing food-grains. The contamination of wheat samples by mercury, when stored with mercury tablets for period of upto four years has been assessed by using non-destructive neutron activation analysis. The details of the analytical procedure used have also been briefly described. The concentration of mercury in wheat increases with storage period. Loss of weight of mercury tablet is proportional to the storage period to a first approximation. In the present experiment, the average weight loss at the and end of first year was 0.009716 g corresponding to 6 ppm in wheat.

The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

Science.gov (United States)

Stefanski, Katherine M.

A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

Science.gov (United States)

Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

2016-08-01

To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

Czech Academy of Sciences Publication Activity Database

Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

2017-01-01

Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

Design study on large-scale mercury loop for engineering test of target of high-intensity proton accelerator

International Nuclear Information System (INIS)

Hino, Ryutaro; Haga, Katsuhiro; Aita, Hideki; Sekita, Kenji; Sudo, Yukio; Koiso, Kohji; Kaminaga, Masanori; Takahashi, Hiromichi.

1997-03-01

A heavy liquid-metal target has been proposed as a representative target of a 5MW-scale neutron source for a neutron scattering facility coupled with a high-intensity proton accelerator. In the report, about mercury considered to be the best material of the heavy liquid-metal target, its properties needed for the design were formulated, and results of research on mercury treatment and of evaluation of heat removal performance on the basis of generating heat obtained by a numerical calculation of a spallation reaction were presented. From these results, a 1.5MW-scale mercury loop which equals to that for the first stage operation of the neutron science program of JAERI was designed conceptually for obtaining design data of the mercury target, and basic flow diagram of the loop and specifications of components were decided: diameter of pipelines flowing mercury at the velocity below 1m/s, power of an electro-magnet pump and structure of a cooler. Through the design, engineering problems were made clear such as selection and development of mercury-resistant materials and optimization of the loop and components for decreasing mercury inventory. (author)

Radioactive mercury distribution in biological fluids and excretion in human subjects after inhalation of mercury vapor

International Nuclear Information System (INIS)

Cherian, M.G.; Hursh, J.B.; Clarkson, T.W.; Allen, J.

1978-01-01

The distribution of mercury in red blood cells (RBCs) and plasma, and its excretion in urine and feces are described in five human subjects during the first 7 days following inhalation of radioactive mercury vapor. A major portion (98%) of radioactive mercury in whole blood is initially accumulated in the RBCs and is transferred partly to the plasma compartment until the ratio of mercury in RBCs to plasma is about 2 within 20 h. The cumulative urinary and fecal excretion of mercury for 7 days is about 11.6% of the retained dose, and is closely related to the percent decline in body burden of mercury. There is little correlation between either the urinary excretion and plasma radioactivity of mercury, or the specific activities of urine and plasma mercury, suggesting a mechanism other than a direct glomerular filtration involved in the urinary excretion of recently exposed mercury. These studies suggest that blood mercury levels can be used as an index of recent exposure, while urinary levels may be an index of renal concentration of mercury. However, there is no reliable index for mercury concentration in the brain

High levels of bioplastic are produced in fertile transplastomic tobacco plants engineered with a synthetic operon for the production of polyhydroxybutyrate.

Science.gov (United States)

Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P; Snell, Kristi D

2011-04-01

An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5' end by the host plant's psbA coding sequence and at the 3' end by the host plant's 3' psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated.

Solubility of helium in mercury for bubbling technology of the spallation neutron mercury target

International Nuclear Information System (INIS)

Hasegawa, S.; Naoe, T.; Futakawa, M.

2010-01-01

The pitting damage of mercury target container that originates in the pressure wave excited by the proton beam incidence becomes a large problem to reach the high-power neutron source in JSNS and SNS. The lifetime of mercury container is decreased remarkably by the pitting damage. As one of solutions, the pressure wave is mitigated by injecting the helium micro bubbles in mercury. In order to inject the helium micro bubbles into mercury, it is important to understand the characteristic of micro bubbles in mercury. The solubility of mercury-helium system is a key factor to decide bubbling conditions, because the disappearance behavior, i.e. the lifetime of micro bubbles, depends on the solubility. In addition, the bubble generation method is affected by it. Moreover, the experimental data related to the solubility of helium in mercury hardly exist. In this work, the solubility was obtained experimentally by measuring precisely the pressure drop of the gas that is facing to mercury surface. The pressure drop was attributed to the helium dissolution into mercury. Based on the measured solubility, the lifetime of micro bubbles and the method of the bubble generation is estimated using the solubility data.

Fatigue properties of type 316LN stainless steel in air and mercury

International Nuclear Information System (INIS)

Strizak, J.P.; Tian, H.; Liaw, P.K.; Mansur, L.K.

2005-01-01

An extensive fatigue testing program on 316LN stainless steel was recently carried out to support the design of the mercury target container for the spallation neutron source (SNS) that is currently under construction at the Oak Ridge National Laboratory in the United States. The major objective was to determine the effects of mercury on fatigue behavior. The S-N fatigue behavior of 316LN stainless steel is characterized by a family of bilinear fatigue curves which are dependent on frequency, environment, mean stress and cold work. Generally, fatigue life increases with decreasing stress and levels off in the high cycle region to an endurance limit below which the material will not fail. For fully reversed loading as well as tensile mean stress loading conditions mercury had no effect on endurance limit. However, at higher stresses a synergistic relationship between mercury and cyclic loading frequency was observed at low frequencies. As expected, fatigue life decreased with decreasing frequency, but the response was more pronounced in mercury compared with air. As a result of liquid metal embrittlement (LME), fracture surfaces of specimens tested in mercury showed widespread brittle intergranular cracking as opposed to typical transgranular cracking for specimens tested in air. For fully reversed loading (zero mean stress) the effect of mercury disappeared as frequency increased to 10 Hz. For mean stress conditions with R-ratios of 0.1 and 0.3, LME was still evident at 10 Hz, but at 700 Hz the effect of mercury had disappeared (R 0.1). Further, for higher R-ratios (0.5 and 0.75) fatigue curves for 10 Hz showed no environmental effect. Finally, cold working (20%) increased tensile strength and hardness, and improved fatigue resistance. Fatigue behavior at 10 and 700 Hz was similar and no environmental effect was observed

Fatigue properties of type 316LN stainless steel in air and mercury

Science.gov (United States)

Strizak, J. P.; Tian, H.; Liaw, P. K.; Mansur, L. K.

2005-08-01

An extensive fatigue testing program on 316LN stainless steel was recently carried out to support the design of the mercury target container for the spallation neutron source (SNS) that is currently under construction at the Oak Ridge National Laboratory in the United States. The major objective was to determine the effects of mercury on fatigue behavior. The S- N fatigue behavior of 316LN stainless steel is characterized by a family of bilinear fatigue curves which are dependent on frequency, environment, mean stress and cold work. Generally, fatigue life increases with decreasing stress and levels off in the high cycle region to an endurance limit below which the material will not fail. For fully reversed loading as well as tensile mean stress loading conditions mercury had no effect on endurance limit. However, at higher stresses a synergistic relationship between mercury and cyclic loading frequency was observed at low frequencies. As expected, fatigue life decreased with decreasing frequency, but the response was more pronounced in mercury compared with air. As a result of liquid metal embrittlement (LME), fracture surfaces of specimens tested in mercury showed widespread brittle intergranular cracking as opposed to typical transgranular cracking for specimens tested in air. For fully reversed loading (zero mean stress) the effect of mercury disappeared as frequency increased to 10 Hz. For mean stress conditions with R-ratios of 0.1 and 0.3, LME was still evident at 10 Hz, but at 700 Hz the effect of mercury had disappeared ( R = 0.1). Further, for higher R-ratios (0.5 and 0.75) fatigue curves for 10 Hz showed no environmental effect. Finally, cold working (20%) increased tensile strength and hardness, and improved fatigue resistance. Fatigue behavior at 10 and 700 Hz was similar and no environmental effect was observed.

Mercury CEM Calibration

Energy Technology Data Exchange (ETDEWEB)

John F. Schabron; Joseph F. Rovani; Susan S. Sorini

2007-03-31

The Clean Air Mercury Rule (CAMR) which was published in the Federal Register on May 18, 2005, requires that calibration of mercury continuous emissions monitors (CEMs) be performed with NIST-traceable standards. Western Research Institute (WRI) is working closely with the Electric Power Research Institute (EPRI), the National Institute of Standards and Technology (NIST), and the Environmental Protection Agency (EPA) to facilitate the development of the experimental criteria for a NIST traceability protocol for dynamic elemental mercury vapor generators. The traceability protocol will be written by EPA. Traceability will be based on the actual analysis of the output of each calibration unit at several concentration levels ranging from about 2-40 ug/m{sup 3}, and this analysis will be directly traceable to analyses by NIST using isotope dilution inductively coupled plasma/mass spectrometry (ID ICP/MS) through a chain of analyses linking the calibration unit in the power plant to the NIST ID ICP/MS. Prior to this project, NIST did not provide a recommended mercury vapor pressure equation or list mercury vapor pressure in its vapor pressure database. The NIST Physical and Chemical Properties Division in Boulder, Colorado was subcontracted under this project to study the issue in detail and to recommend a mercury vapor pressure equation that the vendors of mercury vapor pressure calibration units can use to calculate the elemental mercury vapor concentration in an equilibrium chamber at a particular temperature. As part of this study, a preliminary evaluation of calibration units from five vendors was made. The work was performed by NIST in Gaithersburg, MD and Joe Rovani from WRI who traveled to NIST as a Visiting Scientist.

Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

Science.gov (United States)

Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

2013-11-01

Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

Mercury Exposure and Heart Diseases

Science.gov (United States)

Genchi, Giuseppe; Sinicropi, Maria Stefania; Carocci, Alessia; Lauria, Graziantonio; Catalano, Alessia

2017-01-01

Environmental contamination has exposed humans to various metal agents, including mercury. It has been determined that mercury is not only harmful to the health of vulnerable populations such as pregnant women and children, but is also toxic to ordinary adults in various ways. For many years, mercury was used in a wide variety of human activities. Nowadays, the exposure to this metal from both natural and artificial sources is significantly increasing. Recent studies suggest that chronic exposure, even to low concentration levels of mercury, can cause cardiovascular, reproductive, and developmental toxicity, neurotoxicity, nephrotoxicity, immunotoxicity, and carcinogenicity. Possible biological effects of mercury, including the relationship between mercury toxicity and diseases of the cardiovascular system, such as hypertension, coronary heart disease, and myocardial infarction, are being studied. As heart rhythm and function are under autonomic nervous system control, it has been hypothesized that the neurotoxic effects of mercury might also impact cardiac autonomic function. Mercury exposure could have a long-lasting effect on cardiac parasympathetic activity and some evidence has shown that mercury exposure might affect heart rate variability, particularly early exposures in children. The mechanism by which mercury produces toxic effects on the cardiovascular system is not fully elucidated, but this mechanism is believed to involve an increase in oxidative stress. The exposure to mercury increases the production of free radicals, potentially because of the role of mercury in the Fenton reaction and a reduction in the activity of antioxidant enzymes, such as glutathione peroxidase. In this review we report an overview on the toxicity of mercury and focus our attention on the toxic effects on the cardiovascular system. PMID:28085104

Mercury Exposure and Heart Diseases.

Science.gov (United States)

Genchi, Giuseppe; Sinicropi, Maria Stefania; Carocci, Alessia; Lauria, Graziantonio; Catalano, Alessia

2017-01-12

Environmental contamination has exposed humans to various metal agents, including mercury. It has been determined that mercury is not only harmful to the health of vulnerable populations such as pregnant women and children, but is also toxic to ordinary adults in various ways. For many years, mercury was used in a wide variety of human activities. Nowadays, the exposure to this metal from both natural and artificial sources is significantly increasing. Recent studies suggest that chronic exposure, even to low concentration levels of mercury, can cause cardiovascular, reproductive, and developmental toxicity, neurotoxicity, nephrotoxicity, immunotoxicity, and carcinogenicity. Possible biological effects of mercury, including the relationship between mercury toxicity and diseases of the cardiovascular system, such as hypertension, coronary heart disease, and myocardial infarction, are being studied. As heart rhythm and function are under autonomic nervous system control, it has been hypothesized that the neurotoxic effects of mercury might also impact cardiac autonomic function. Mercury exposure could have a long-lasting effect on cardiac parasympathetic activity and some evidence has shown that mercury exposure might affect heart rate variability, particularly early exposures in children. The mechanism by which mercury produces toxic effects on the cardiovascular system is not fully elucidated, but this mechanism is believed to involve an increase in oxidative stress. The exposure to mercury increases the production of free radicals, potentially because of the role of mercury in the Fenton reaction and a reduction in the activity of antioxidant enzymes, such as glutathione peroxidase. In this review we report an overview on the toxicity of mercury and focus our attention on the toxic effects on the cardiovascular system.

Mercury Exposure and Heart Diseases

Directory of Open Access Journals (Sweden)

Giuseppe Genchi

2017-01-01

Full Text Available Environmental contamination has exposed humans to various metal agents, including mercury. It has been determined that mercury is not only harmful to the health of vulnerable populations such as pregnant women and children, but is also toxic to ordinary adults in various ways. For many years, mercury was used in a wide variety of human activities. Nowadays, the exposure to this metal from both natural and artificial sources is significantly increasing. Recent studies suggest that chronic exposure, even to low concentration levels of mercury, can cause cardiovascular, reproductive, and developmental toxicity, neurotoxicity, nephrotoxicity, immunotoxicity, and carcinogenicity. Possible biological effects of mercury, including the relationship between mercury toxicity and diseases of the cardiovascular system, such as hypertension, coronary heart disease, and myocardial infarction, are being studied. As heart rhythm and function are under autonomic nervous system control, it has been hypothesized that the neurotoxic effects of mercury might also impact cardiac autonomic function. Mercury exposure could have a long-lasting effect on cardiac parasympathetic activity and some evidence has shown that mercury exposure might affect heart rate variability, particularly early exposures in children. The mechanism by which mercury produces toxic effects on the cardiovascular system is not fully elucidated, but this mechanism is believed to involve an increase in oxidative stress. The exposure to mercury increases the production of free radicals, potentially because of the role of mercury in the Fenton reaction and a reduction in the activity of antioxidant enzymes, such as glutathione peroxidase. In this review we report an overview on the toxicity of mercury and focus our attention on the toxic effects on the cardiovascular system.

Sexual differences in the excretion of organic and inorganic mercury by methyl mercury-treated rats

International Nuclear Information System (INIS)

Thomas, D.J.; Fisher, H.L.; Sumler, M.R.; Mushak, P.; Hall, L.L.

1987-01-01

Adult male and female Long Evans rats received 1 mumole of methyl ( 203 Hg) mercuric chloride per kilogram sc. Whole-body retention of mercury and excretion of organic and inorganic mercury in urine and feces were monitored for 98 days after dosing. Females cleared mercury from the body more rapidly than did males. The major route of mercury excretion was feces. By 98 days after dosing, cumulative mercury excretion in feces accounted for about 51% of the dose in males and about 54% of the dose in females. For both sexes, about 33% of the dose was excreted in feces as inorganic mercury. Cumulative excretion of organic mercury in feces accounted for about 18 and 21% of the dose in males and females, respectively. Urinary excretion of mercury was quantitatively a smaller route for mercury clearance but important sexual differences in loss by this route were found. Over the 98-day experimental period, males excreted in urine about 3.2% of the dose and females excreted 7.5%. Cumulative organic Hg excretion in urine accounted for 1.8% of the dose in males and 5.3% of the dose in females. These sexual differences in urinary and fecal excretion of organic and inorganic mercury following methyl mercury treatment were consistent with previous reports of sexual differences in mercury distribution and retention in methyl mercury-treated rats, particularly sexual differences in organic mercury uptake and retention in the kidney. Relationships between body burdens of organic or inorganic Hg and output of these forms of Hg in urine and feces were also found to be influenced by the interval after MeHg treatment and by sex. Relationship between concentration of Hg in liver and feces and in kidney and urine differed for organic and inorganic Hg and depended upon sexual status and interval after MeHg treatment

Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

Science.gov (United States)

Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

2001-01-01

Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

Proteomic differences between tellurite-sensitive and tellurite-resistant E.coli.

Directory of Open Access Journals (Sweden)

Jana Aradská

Full Text Available Tellurite containing compounds are in use for industrial processes and increasing delivery into the environment generates specific pollution that may well result in contamination and subsequent potential adverse effects on public health. It was the aim of the current study to reveal mechanism of toxicity in tellurite-sensitive and tellurite-resistant E. coli at the protein level. In this work an approach using gel-based mass spectrometrical analysis to identify a differential protein profile related to tellurite toxicity was used and the mechanism of ter operon-mediated tellurite resistance was addressed. E. coli BL21 was genetically manipulated for tellurite-resistance by the introduction of the resistance-conferring ter genes on the pLK18 plasmid. Potassium tellurite was added to cultures in order to obtain a final 3.9 micromolar concentration. Proteins from tellurite-sensitive and tellurite-resistant E. coli were run on 2-D gel electrophoresis, spots of interest were picked, in-gel digested and subsequently analysed by nano-LC-MS/MS (ion trap. In addition, Western blotting and measurement of enzymatic activity were performed to verify the expression of certain candidate proteins. Following exposure to tellurite, in contrast to tellurite-resistant bacteria, sensitive cells exhibited increased levels of antioxidant enzymes superoxide dismutases, catalase and oxidoreductase YqhD. Cysteine desulfurase, known to be related to tellurite toxicity as well as proteins involved in protein folding: GroEL, DnaK and EF-Tu were upregulated in sensitive cells. In resistant bacteria, several isoforms of four essential Ter proteins were observed and following tellurite treatment the abovementioned protein levels did not show any significant proteome changes as compared to the sensitive control. The absence of general defense mechanisms against tellurite toxicity in resistant bacteria thus provides further evidence that the four proteins of the ter operon

Induction of the Nitrate Assimilation nirA Operon and Protein-Protein Interactions in the Maturation of Nitrate and Nitrite Reductases in the Cyanobacterium Anabaena sp. Strain PCC 7120.

Science.gov (United States)

Frías, José E; Flores, Enrique

2015-07-01

Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria

A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

Science.gov (United States)

Tadmor, Arbel

2009-03-01

In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.

CysB-dependent upregulation of the Salmonella Typhimurium cysJIH operon in response to antimicrobial compounds that induce oxidative stress.

Science.gov (United States)

Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando

2015-02-27

It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.

76 FR 13851 - National Emission Standards for Hazardous Air Pollutants: Mercury Emissions From Mercury Cell...

Science.gov (United States)

2011-03-14

... National Emission Standards for Hazardous Air Pollutants: Mercury Emissions From Mercury Cell Chlor-Alkali...-5] RIN 2060-AN99 National Emission Standards for Hazardous Air Pollutants: Mercury Emissions From Mercury Cell Chlor-Alkali Plants AGENCY: Environmental Protection Agency (EPA). ACTION: Supplemental...

The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

NARCIS (Netherlands)

Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.

2006-01-01

The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

Mercury in Nordic ecosystems

Energy Technology Data Exchange (ETDEWEB)

Munthe, John; Waengberg, Ingvar (IVL Swedish Environmental Research Inst., Stockholm (SE)); Rognerud, Sigurd; Fjeld, Eirik (Norwegian Inst. for Water Research (NIVA), Oslo (Norway)); Verta, Matti; Porvari, Petri (Finnish Environment Inst. (SYKE), Helsinki (Finland)); Meili, Markus (Inst. of Applied Environmental Research (ITM), Stockholm (Sweden))

2007-12-15

This report provides a first comprehensive compilation and assessment of available data on mercury in air, precipitation, sediments and fish in the Nordic countries. The main conclusion is that mercury levels in Nordic ecosystems continue to be affected by long-range atmospheric transport. The geographical patterns of mercury concentrations in both sediments and fish are also strongly affected by ecosystem characteristics and in some regions possibly by historical pollution. An evaluation of geographical variations in mercury concentrations in precipitation indicates that the influence from anthropogenic sources from Central European areas is still significant. The annual variability of deposition is large and dependant of precipitation amounts. An evaluation of data from stations around the North Sea has indicated a significant decrease in mercury concentrations in precipitation indicating a continuous decrease of emissions in Europe (Waengberg et al., 2007). For mercury in air (TGM), the geographical pattern is less pronounced indicating the influence of mercury emissions and distribution over a larger geographical area (i.e. hemispherical transport). Comparison of recent (surficial) and historical lake sediments show significantly elevated concentrations of mercury most likely caused by anthropogenic atmospheric deposition over the past century. The highest pollution impact was observed in the coastal areas of southern Norway, in south western Finland and in Sweden from the coastal areas in the southwest across the central parts to the north-east. The general increase in recent versus old sediments was 2-5 fold. Data on mercury in Nordic freshwater fish was assembled and evaluated with respect to geographical variations. The fish data were further compared with temporal and spatial trends in mercury deposition and mercury contamination of lake sediments in order to investigate the coupling between atmospheric transport and deposition of mercury and local mercury

Study of the Behavior and Distribution of Mercury in Soil Samples Collected on the Banks of the Valdeazogues River

International Nuclear Information System (INIS)

Lominchar, M. A.; Sierra, M. J.; Rodiriguez, J.; Millam, R.

2010-01-01

The main objective of this study is to determine the behavior of mercury in the soil of the Valdeazogues river (Almaden, Ciudad Real, Spain) by using a six-step sequential extraction procedure (CIEMAT) and checking the relationship between the percentage of organic matter in soil and the percentage of mercury associated with the exchangeable and oxidizable fractions. The results show that total mercury concentrations in soil range from 116.7 ±24.3 to 245.5 ±59.6 mg kg - 1 of Hg even to concentrations of 350.9 ±68.6 mg kg -1 . However, the available mercury concentration is a smaller percentage of 0.15% of total mercury measured in the samples. Also, the soluble mercury is less than 0,037 mg kg - 1, so that, the leaching process and transport of mercury to surface water and groundwater are very slow. With regard to the distribution of mercury between the different fractions of soil, the metal is associated with more resistant soil fractions, these are: crystalline Fe-Mn oxyhydroxides, organic matter absorbed and the fi nal residue. (Author9) 50 refs.

An ArsR/SmtB family member is involved in the regulation by arsenic of the arsenite oxidase operon in Thiomonas arsenitoxydans.

Science.gov (United States)

Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine

2014-10-01

The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Understanding the mercury reduction issue: the impact of mercury on the environment and human health.

Science.gov (United States)

Kao, Richard T; Dault, Scott; Pichay, Teresa

2004-07-01

Mercury has been used in both medicine and dentistry for centuries. Recent media attention regarding the increased levels of mercury in dietary fish, high levels of mercury in air emissions, and conjecture that certain diseases may be caused by mercury exposure has increased public awareness of the potential adverse health effects of high doses of mercury. Dentistry has been criticized for its continued use of mercury in dental amalgam for both public health and environmental reasons. To address these concerns, dental professionals should understand the impact of the various levels and types of mercury on the environment and human health. Mercury is unique in its ability to form amalgams with other metals. Dental amalgam--consisting of silver, copper, tin, and mercury--has been used as a safe, stable, and cost-effective restorative material for more than 150 years. As a result of this use, the dental profession has been confronted by the public on two separate health issues concerning the mercury content in amalgam. The first issue is whether the mercury amalgamated with the various metals to create dental restorations poses a health issue for patients. The second is whether the scraps associated with amalgam placement and the removal of amalgam restorations poses environmental hazards which may eventually have an impact on human health. Despite the lack of scientific evidence for such hazards, there is growing pressure for the dental profession to address these health issues. In this article, the toxicology of mercury will be reviewed and the impact of amalgam on health and the environment will be examined.

Chemical Form Matters: Differential Accumulation of Mercury Following Inorganic and Organic Mercury Exposures in Zebrafish Larvae

Energy Technology Data Exchange (ETDEWEB)

Korbas, Malgorzata; MacDonald, Tracy C.; Pickering, Ingrid J.; George, Graham N.; Krone, Patrick H. (Saskatchewan)

2013-04-08

Mercury, one of the most toxic elements, exists in various chemical forms each with different toxicities and health implications. Some methylated mercury forms, one of which exists in fish and other seafood products, pose a potential threat, especially during embryonic and early postnatal development. Despite global concerns, little is known about the mechanisms underlying transport and toxicity of different mercury species. To investigate the impact of different mercury chemical forms on vertebrate development, we have successfully combined the zebrafish, a well-established developmental biology model system, with synchrotron-based X-ray fluorescence imaging. Our work revealed substantial differences in tissue-specific accumulation patterns of mercury in zebrafish larvae exposed to four different mercury formulations in water. Methylmercury species not only resulted in overall higher mercury burdens but also targeted different cells and tissues than their inorganic counterparts, thus revealing a significant role of speciation in cellular and molecular targeting and mercury sequestration. For methylmercury species, the highest mercury concentrations were in the eye lens epithelial cells, independent of the formulation ligand (chloride versus L-cysteine). For inorganic mercury species, in absence of L-cysteine, the olfactory epithelium and kidney accumulated the greatest amounts of mercury. However, with L-cysteine present in the treatment solution, mercuric bis-L-cysteineate species dominated the treatment, significantly decreasing uptake. Our results clearly demonstrate that the common differentiation between organic and inorganic mercury is not sufficient to determine the toxicity of various mercury species.

Antimicrobial drug resistance in Staphylococcus aureus isolated from cattle in Brazil.

Science.gov (United States)

Pereira, M S; Siqueira-Júnior, J P

1995-06-01

Isolates of Staphylococcus aureus obtained from apparently healthy cattle in the State of Paraiba, Brazil were characterized in relation to resistance to 21 antimicrobial agents. Among the 46 isolates obtained, resistance to penicillin was most frequent, followed by resistance to cadmium, streptomycin, arsenate, tetracycline, mercury, erythromycin and kanamycin/neomycin. All isolates were susceptible to fusidic acid, ethidium bromide, cetrimide, chloramphenicol, benzalkonium chloride, doxycycline, gentamicin, methicillin, minocycline, novobiocin, rifamycin, tylosin and vancomycin. Only six isolates were susceptible to all the drugs tested. With respect to the antibiotics, multi-resistant isolates were uncommon. These results are probably a consequence of the peculiarities of local drug usage pressures. In relation to metal ions, resistance to mercury was rare while resistance to arsenate was relatively frequent, which contrasts with the situation for human Staph. aureus strains. After treatment with ethidium bromide, elimination of resistance to penicillin, tetracycline, streptomycin, erythromycin and cadmium was observed, which was consistent with the genetic determinants being plasmid-borne.

Comparative analysis of the mechanisms of sulfur anion oxidation and reduction by dsr operon to maintain environmental sulfur balance.

Science.gov (United States)

Ghosh, Semanti; Bagchi, Angshuman

2015-12-01

Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio

Getting Mercury out of Schools.

Science.gov (United States)

1999

This guide was prepared while working with many Massachusetts schools to remove items that contain mercury and to find suitable alternatives. It contains fact sheets on: mercury in science laboratories and classrooms, mercury in school buildings and maintenance areas, mercury in the medical office and in medical technology classrooms in vocational…

Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity.

Science.gov (United States)

Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T

2017-11-01

Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

Science.gov (United States)

Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

2017-01-01

Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

Directory of Open Access Journals (Sweden)

Kathleen Jwanoswki

Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

Environmental Mercury and Its Toxic Effects

Directory of Open Access Journals (Sweden)

Kevin M. Rice

2014-03-01

Full Text Available Mercury exists naturally and as a man-made contaminant. The release of processed mercury can lead to a progressive increase in the amount of atmospheric mercury, which enters the atmospheric-soil-water distribution cycles where it can remain in circulation for years. Mercury poisoning is the result of exposure to mercury or mercury compounds resulting in various toxic effects depend on its chemical form and route of exposure. The major route of human exposure to methylmercury (MeHg is largely through eating contaminated fish, seafood, and wildlife which have been exposed to mercury through ingestion of contaminated lower organisms. MeHg toxicity is associated with nervous system damage in adults and impaired neurological development in infants and children. Ingested mercury may undergo bioaccumulation leading to progressive increases in body burdens. This review addresses the systemic pathophysiology of individual organ systems associated with mercury poisoning. Mercury has profound cellular, cardiovascular, hematological, pulmonary, renal, immunological, neurological, endocrine, reproductive, and embryonic toxicological effects.

The Legionella pneumophila kai operon is implicated in stress response and confers fitness in competitive environments

Science.gov (United States)

Loza-Correa, Maria; Sahr, Tobias; Rolando, Monica; Daniels, Craig; Petit, Pierre; Skarina, Tania; Valero, Laura Gomez; Dervins-Ravault, Delphine; Honoré, Nadine; Savchenko, Aleksey; Buchrieser, Carmen

2014-01-01

Summary Legionella pneumophila uses aquatic protozoa as replication niche and protection from harsh environments. Although L. pneumophila is not known to have a circadian clock, it encodes homologues of the KaiBC proteins of Cyanobacteria that regulate circadian gene expression. We show that L. pneumophila kaiB, kaiC and the downstream gene lpp1114, are transcribed as a unit under the control of the stress sigma factor RpoS. KaiC and KaiB of L. pneumophila do not interact as evidenced by yeast and bacterial two-hybrid analyses. Fusion of the C-terminal residues of cyanobacterial KaiB to Legionella KaiB restores their interaction. In contrast, KaiC of L. pneumophila conserved autophosphorylation activity, but KaiB does not trigger the dephosphorylation of KaiC like in Cyanobacteria. The crystal structure of L. pneumophila KaiB suggests that it is an oxidoreductase-like protein with a typical thioredoxin fold. Indeed, mutant analyses revealed that the kai operon-encoded proteins increase fitness of L. pneumophila in competitive environments, and confer higher resistance to oxidative and sodium stress. The phylogenetic analysis indicates that L. pneumophila KaiBC resemble Synechosystis KaiC2B2 and not circadian KaiB1C1. Thus, the L. pneumophila Kai proteins do not encode a circadian clock, but enhance stress resistance and adaption to changes in the environments. PMID:23957615

Histochemical demonstration of two mercury pools in trout tissues: mercury in kidney and liver after mercuric chloride exposure

International Nuclear Information System (INIS)

Baatrup, E.; Nielsen, M.G.; Danscher, G.

1986-01-01

Juvenile rainbow trout (Salmo gairdneri) were exposed to 100 ppb mercury (as HgCl 2 ) in the water for 14 days. Concentrations of mercury in water and fish organs were monitored using radiolabeled mercury. Tissues from kidney and liver were fixed, and sections were developed by autometallography, a method whereby accumulations of mercury sulfides and/or mercury selenides are silver amplified. In the kidney, mercury was found within lysosomes and extracellularly in the basal lamina of proximal tubules. In the liver, mercury was found within lysosomes of the hepatocytes. Additional groups of mercury-exposed trout were subjected to selenium (as Na 2 SeO 3 ), administered intraperitoneally 2 hr before fixation. Following this treatment, additional mercury could be visualized in the kidney circulatory system, including glomeruli, and in the nucleus and endoplasmic reticulum of liver cells. It is suggested that the mercury visualized prior to selenium treatment represents inorganic mercury, while additional mercury visualized after selenium administration represents an organic form

Distribution of mercury in guinea pig offspring after in utero exposure to mercury vapor during late gestation

Energy Technology Data Exchange (ETDEWEB)

Yoshida, Minoru; Yamamura, Yukio; Sataoh, Hiroshi

1986-04-01

Organ distribution of mercury after in utero mercury vapor exposure was investigated in neonatal guinea pigs. Mother guinea pigs in late gestation were exposed to 0.2-0.3 mg/m/sup 3/ mercury vapor 2 h per day until giving birth. Mercury concentrations in neonatal brain, lungs, heart, kidneys, plasma and erythrocytes were much lower than those of maternal organs and tissues. Neonatal liver, however, showed a mercury concentration twice as high as maternal liver. Mercury concentration ratios of erythrocytes to plasma in offspring were quite different from those of mothers, being 0.2-0.4 for offspring, and 1.3-3.0 for mothers. These results suggested that mercury vapor metabolism in fetuses was quite different from that in their mothers. This may be due to the different blood circulation, as mercury vapor transferred through the placental barrier would be rapidly oxidized into ionic mercury in fetal liver and accumulated in the organ. The different mercury vapor metabolism may prevent fetal brain, which is rapidly developing, and thus vulnerable, from being exposed to excessive mercury vapor.

Mercury in mercury(II)-spiked soils is highly susceptible to plant bioaccumulation.

Science.gov (United States)

Hlodák, Michal; Urík, Martin; Matúš, Peter; Kořenková, Lucia

2016-01-01

Heavy metal phytotoxicity assessments usually use soluble metal compounds in spiked soils to evaluate metal bioaccumulation, growth inhibition and adverse effects on physiological parameters. However, exampling mercury phytotoxicity for barley (Hordeum vulgare) this paper highlights unsuitability of this experimental approach. Mercury(II) in spiked soils is extremely bioavailable, and there experimentally determined bioaccumulation is significantly higher compared to reported mercury bioaccumulation efficiency from soils collected from mercury-polluted areas. Our results indicate this is not affected by soil sorption capacity, thus soil ageing and formation of more stable mercuric complexes with soil fractions is necessary for reasonable metal phytotoxicity assessments.

Below a Historic Mercury Mine: Non-linear Patterns of Mercury Bioaccumulation in Aquatic Organisms

Science.gov (United States)

Haas, J.; Ichikawa, G.; Ode, P.; Salsbery, D.; Abel, J.

2001-12-01

Unlike most heavy metals, mercury is capable of bioaccumulating in aquatic food-chains, primarily because it is methylated by bacteria in sediment to the more toxic methylmercury form. Mercury concentrations in a number of riparian systems in California are highly elevated as a result of historic mining activities. These activities included both the mining of cinnabar in the coastal ranges to recover elemental mercury and the use of elemental mercury in the gold fields of the Sierra Nevada Mountains. The most productive mercury mining area was the New Almaden District, now a county park, located in the Guadalupe River drainage of Santa Clara County, where cinnabar was mined and retorted for over 100 years. As a consequence, riparian systems in several subwatersheds of the Guadalupe River drainage are contaminated with total mercury concentrations that exceed state hazardous waste criteria. Mercury concentrations in fish tissue frequently exceed human health guidelines. However, the potential ecological effects of these elevated mercury concentrations have not been thoroughly evaluated. One difficulty is in extrapolating sediment concentrations to fish tissue concentrations without accounting for physical and biological processes that determine bioaccumulation patterns. Many processes, such as methylation and demethylation of mercury by bacteria, assimilation efficiency in invertebrates, and metabolic rates in fish, are nonlinear, a factor that often confounds attempts to evaluate the effects of mercury contamination on aquatic food webs. Sediment, benthic macroinvertebrate, and fish tissue samples were collected in 1998 from the Guadalupe River drainage in Santa Clara County at 13 sites upstream and downstream from the historic mining district. Sediment and macroinvertebrate samples were analyzed for total mercury and methylmercury. Fish samples were analyzed for total mercury as whole bodies, composited by species and size. While linear correlations of sediment

Mercury pollution in Wuchuan mercury mining area, Guizhou, Southwestern China: the impacts from large scale and artisanal mercury mining.

Science.gov (United States)

Li, Ping; Feng, Xinbin; Qiu, Guangle; Shang, Lihai; Wang, Shaofeng

2012-07-01

To evaluate the environmental impacts from large scale mercury mining (LSMM) and artisanal mercury mining (AMM), total mercury (THg) and methyl mercury (MeHg) were determined in mine waste, ambient air, stream water and soil samples collected from Wuchuan mercury (Hg) mining area, Guizhou, Southwestern China. Mine wastes from both LSMM and AMM contained high THg concentrations, which are important Hg contamination sources to the local environment. Total gaseous mercury (TGM) concentrations in the ambient air near AMM furnaces were highly elevated, which indicated that AMM retorting is a major source of Hg emission. THg concentrations in the stream water varied from 43 to 2100 ng/L, where the elevated values were mainly found in the vicinity of AMM and mine waste heaps of LSMM. Surface soils were seriously contaminated with Hg, and land using types and organic matter played an important role in accumulation and transportation of Hg in soil. The results indicated heavy Hg contaminations in the study area, which were resulted from both LSMM and AMM. The areas impacted by LSMM were concentrated in the historical mining and smelting facilities, while Hg pollution resulted from AMM can be distributed anywhere in the Hg mining area. Copyright © 2011 Elsevier Ltd. All rights reserved.

Behaviour of mercury compounds in soil

Energy Technology Data Exchange (ETDEWEB)

Booer, J R

1944-01-01

The uses of inorganic compounds of mercury for the control of plant pests is reviewed, and a summary of the relevant chemical and physical properties of the compounds concerned is given. On chemical evidence a working hypothesis is propounded showing that all compounds may be expected to decompose into metallic mercury. A pot technique is described by means of which a correlation can be obtained between the effective mercury content of a given soil sample and the rate of growth of wheat seedlings. The mathematical treatment of the results is described, and the validity of the pot technique is verified by statistical analysis of results. Using the pot technqiue it is shown that volatilization losses are insignificant but that mercury is slowly rendered ineffective by the formation of mercuric sulphide. The effect of sulphur-reducing bacteria is considered and the influence of Vibrio desulphuricans on mercury is studied in detail. Experimental evidence obtained by the pot technique is produced to show that mercurous chloride slowly decomposes in the soil giving mercury and mercuric chloride, mercuric chloride rapidly decomposes into mercury and mercurous chloride, and other inorganic compounds decompose directly into mercury. The working hypothesis is substantiated in all major aspects. The uses and properties of the organo-mercury compounds are then discussed. Type compounds selected are ethyl mercury phosphate, phenyl mercury acetate and methoxyethyl mercury acetate. Using the pot technique it is shown that the formation of organo-mercury clays takes place and that these clays decompose giving metallic mercury. A mechanism is suggested.

Mercury in the environment : a review

International Nuclear Information System (INIS)

Goodarzi, F.

2000-01-01

Both geogenic and anthropogenic sources are responsible for the input of mercury into the environment. However, mercury comes mostly from geogenic sources and is found naturally in air, water and soil. Crustal degassing results in emission of mercury into the atmosphere. Mercury in water and soil is due mostly to input from sedimentary rocks. Mercury in lake sediments is related mainly to input by country rock and anthropogenic activities such as agriculture. The mercury content of coal is similar to or less than the amount found in the earths crust. Natural charcoal is also able to capture mercury at low temperature combustion. The amount of mercury emitted from the stack of coal-fired power plants is related to the nature of the milled coal and its mineralogical and elemental content. Mercury emissions originating from the combustion of coal from electric utility power plants are considered to be among the greatest contributors to global mercury air emissions. In order to quantify the impact the electric power industry has on the environment, information regarding mercury concentrations in coal and their speciation is needed. For this reason the author examined the behaviour of mercury in three coal samples ashed at increasing temperatures. Mercury removal from coal-fired power plants ranges from 10 to 50 per cent by fabric filters and 20 to 95 per cent by FGD systems. This data will help in regulating emissions of hazardous air pollutants from electric utility steam generating units and will potentially provide insight into the industry's contribution to the global mercury burden. 50 refs

Axial mercury segregation in direct current operated low-pressure argon-mercury gas discharge: Part II. Model

International Nuclear Information System (INIS)

Gielen, John W A M; Groot, Simon de; Dijk, Jan van; Mullen, Joost J A M van der

2004-01-01

In a previous paper we had presented experimental results on mercury segregation due to cataphoresis in direct current operated low-pressure argon-mercury gas discharges. In this paper, we present our model to describe cataphoretic segregation in argon (or another noble gas)-mercury discharges. The model is based on the balance equations for mass and momentum and includes electrophoresis effects of electrons on mercury. Good agreement is found between the experimental results and model calculations. The model confirms our experimental observation that the mercury vapour pressure gradient depends on the local mercury vapour pressure. Furthermore, the model predicts the reversal of the direction of the transport of mercury under certain conditions (the phenomenon known as retrograde cataphoresis)

Mercury in Canadian crude oil

International Nuclear Information System (INIS)

Hollebone, B.P.

2005-01-01

Estimates for average mercury concentrations in crude oil range widely from 10 ng/g of oil to 3,500 ng/g of oil. With such a broad range of estimates, it is difficult to determine the contributions of the petroleum sector to the total budget of mercury emissions. In response to concerns that the combustion of petroleum products may be a major source of air-borne mercury pollution, Environment Canada and the Canadian Petroleum Products Institute has undertaken a survey of the average total mercury concentration in crude oil processed in Canadian refineries. In order to calculate the potential upper limit of total mercury in all refined products, samples of more than 30 different types of crude oil collected from refineries were measured for their concentration of mercury as it enters into a refinery before processing. High temperature combustion, cold vapour atomic absorption and cold vapour atomic fluorescence were the techniques used to quantify mercury in the samples. The results of the study provide information on the total mass of mercury present in crude oil processed in Canada each year. Results can be used to determine the impact of vehicle exhaust emissions to the overall Canadian mercury emission budget. 17 refs., 2 tabs., 2 figs

MESSENGER: Exploring Mercury's Magnetosphere

Science.gov (United States)

Slavin, James A.

2008-01-01

The MESSENGER mission to Mercury offers our first opportunity to explore this planet's miniature magnetosphere since Mariner 10's brief fly-bys in 1974-5. Mercury's magnetosphere is unique in many respects. The magnetosphere of Mercury is the smallest in the solar system with its magnetic field typically standing off the solar wind only - 1000 to 2000 km above the surface. For this reason there are no closed dri-fi paths for energetic particles and, hence, no radiation belts; the characteristic time scales for wave propagation and convective transport are short possibly coupling kinetic and fluid modes; magnetic reconnection at the dayside magnetopause may erode the subsolar magnetosphere allowing solar wind ions to directly impact the dayside regolith; inductive currents in Mercury's interior should act to modify the solar In addition, Mercury's magnetosphere is the only one with its defining magnetic flux tubes rooted in a planetary regolith as opposed to an atmosphere with a conductive ionosphere. This lack of an ionosphere is thought to be the underlying reason for the brevity of the very intense, but short lived, approx. 1-2 min, substorm-like energetic particle events observed by Mariner 10 in Mercury's magnetic tail. In this seminar, we review what we think we know about Mercury's magnetosphere and describe the MESSENGER science team's strategy for obtaining answers to the outstanding science questions surrounding the interaction of the solar wind with Mercury and its small, but dynamic magnetosphere.

JV Task 96 - Phase 2 - Investigating the Importance of the Mercury-Selenium Interaction

Energy Technology Data Exchange (ETDEWEB)

Nicholas Ralston; Laura Raymond

2008-03-01

In order to improve the understanding of the mercury issue, it is vital to study mercury's effects on selenium physiology. While mercury present in the environment or food sources may pose health risks, the protective effects of selenium have not been adequately considered in establishing regulatory policy. Numerous studies report that vulnerability to mercury toxicity is inversely proportional to selenium status or level. However, selenium status has not been considered in the development of the reference dosage levels for mercury exposure. Experimental animals fed low-selenium diets are far more vulnerable to mercury toxicity than animals fed normal selenium, and animals fed selenium-rich diets are even more resistant. Selenium-dependent enzymes in brain and endocrine tissues can be impaired by excessive mercury exposure, apparently because mercury has an extremely high binding affinity for selenium. When selenium becomes bound to mercury, it is unable to participate in the metabolic cycling of selenoprotein synthesis. Because of mercury-dependent impairments of selenoprotein synthesis, various antioxidant and regulatory functions in brain biochemistry are compromised. This report details a 2-year multiclient-funded research program designed to examine the interactions between mercury and selenium in animal models. The studies explored the effects of dietary intakes of toxic amounts of methylmercury and the protective effects of the normal dietary range of selenium in counteracting mercury toxicity. This study finds that the amounts of selenium present in ocean fish are sufficient to protect against far larger quantities of methylmercury than those present in typical seafoods. Toxic effects of methylmercury exposure were not directly proportional to mercury concentrations in blood, brain, or any other tissues. Instead, mercury toxicity was proportional to molar ratios of mercury relative to selenium. In order to accurately assess risk associated with

Mercury's Dynamic Magnetic Tail

Science.gov (United States)

Slavin, James A.

2010-01-01

The Mariner 10 and MESSENGER flybys of Mercury have revealed a magnetosphere that is likely the most responsive to upstream interplanetary conditions of any in the solar system. The source of the great dynamic variability observed during these brief passages is due to Mercury's proximity to the Sun and the inverse proportionality between reconnection rate and solar wind Alfven Mach number. However, this planet's lack of an ionosphere and its small physical dimensions also contribute to Mercury's very brief Dungey cycle, approx. 2 min, which governs the time scale for internal plasma circulation. Current observations and understanding of the structure and dynamics of Mercury's magnetotail are summarized and discussed. Special emphasis will be placed upon such questions as: 1) How much access does the solar wind have to this small magnetosphere as a function of upstream conditions? 2) What roles do heavy planetary ions play? 3) Do Earth-like substorms take place at Mercury? 4) How does Mercury's tail respond to extreme solar wind events such coronal mass ejections? Prospects for progress due to advances in the global magnetohydrodynamic and hybrid simulation modeling and the measurements to be taken by MESSENGER after it enters Mercury orbit on March 18, 2011 will be discussed.

Mercury in Your Environment

Science.gov (United States)

Basic information about mercury, how it gets in the air, how people are exposed to it and health effects associated with exposure; what EPA and other organizations are doing to limit exposures; what citizens should know to minimize exposures and to reduce mercury in the environment; and information about products that contain mercury.

Rapid Monitoring of Mercury in Air from an Organic Chemical Factory in China Using a Portable Mercury Analyzer

Directory of Open Access Journals (Sweden)

Akira Yasutake

2011-01-01

Full Text Available A chemical factory, using a production technology of acetaldehyde with mercury catalysis, was located southeast of Qingzhen City in Guizhou Province, China. Previous research showed heavy mercury pollution through an extensive downstream area. A current investigation of the mercury distribution in ambient air, soils, and plants suggests that mobile mercury species in soils created elevated mercury concentrations in ambient air and vegetation. Mercury concentrations of up to 600 ng/m3 in air over the contaminated area provided evidence of the mercury transformation to volatile Hg(0. Mercury analysis of soil and plant samples demonstrated that the mercury concentrations in soil with vaporized and plant-absorbable forms were higher in the southern area, which was closer to the factory. Our results suggest that air monitoring using a portable mercury analyzer can be a convenient and useful method for the rapid detection and mapping of mercury pollution in advanced field surveys.

EDITORIAL: Mercury-free discharges for lighting

Science.gov (United States)

Haverlag, M.

2007-07-01

This special Cluster of articles in Journal of Physics D: Applied Physics covers the subject of mercury-free discharges that are being investigated by different light source researchers, as an alternative to existing mercury-containing lamps. The main driving force to move away from mercury-containing discharge light sources is connected to the environmentally unfriendly nature of mercury. After inhalation or direct contact, severe mercury exposure can lead to damage to human brain cells, the kidneys, the liver and the nervous system. For this reason, the use of mercury in products is becoming more and more restricted by different governmental bodies. In the lighting industry, however, many products still make use of mercury, for different reasons. The main reason is that mercury-containing products are, in most cases, more efficient than mercury-free products. For a realistic comparison of the environmental impact, the mercury-contamination due to electricity production must be taken into account, which depends on the type of fuel being used. For an average European fuel-mix, the amount of mercury that is released into the environment is around 29 μg kWh-1. This means that a typical 30 W TL lamp during a lifetime of 20,000 hours will release a total of about 20 mg mercury due to electricity production, which exceeds the total mercury dose in the lamp (more and more of which is being recycled) by a factor of 5-10 for a modern TL lamp. This illustrates that, quite apart from other environmental arguments like increased CO2 production, mercury-free alternatives that use more energy can in fact be detrimental for the total mercury pollution over the lifetime of the lamp. For this reason, the lighting industry has concentrated on lowering the mercury content in lamps as long as no efficient alternatives exist. Nevertheless, new initiatives for HID lamps and fluorescent lamps with more or less equal efficiency are underway, and a number of them are described in this

Intoxication with metallic mercury

International Nuclear Information System (INIS)

Fichte, B.; Assmann, H.; Ritzau, F.

1984-01-01

Intoxications by metallic mercury are extremely rare. Report of a patient, who tried to commit suicide by subcutaneous injection of 500 g of metallic mercury. He died 16 months later in the course of the intoxication. A short review is given of effects and reactions of metallic mercury in the human organism. (orig.) [de

Intoxication with metallic mercury

Energy Technology Data Exchange (ETDEWEB)

Fichte, B.; Ritzau, F.; Assmann, H.

1984-02-01

Intoxications by metallic mercury are extremely rare. Report is given of a patient who tried to commit suicide by subcutaneous injection of 500 g of metallic mercury. He died 16 months later in the course of the intoxication. A short review is given of effects and reactions of metallic mercury in the human organism.

Intoxication with metallic mercury

Energy Technology Data Exchange (ETDEWEB)

Fichte, B.; Assmann, H.; Ritzau, F.

1984-02-01

Intoxications by metallic mercury are extremely rare. Report is given of a patient, who tried to commit suicide by subcutaneous injection of 500 g of metallic mercury. He died 16 months later in the course of the intoxication. A short review is given of effects and reactions of metallic mercury in the human organism.

Mercury in dated Greenland marine sediments

DEFF Research Database (Denmark)

Asmund, G.; Nielsen, S.P.

2000-01-01

Twenty marine sediment cores from Greenland were analysed for mercury, and dated by the lead-210 method. In general the cores exhibit a mercury profile with higher mercury concentrations in the upper centimetres of the core. The cores were studied by linear regression of In Hg vs, age of the sedi......Twenty marine sediment cores from Greenland were analysed for mercury, and dated by the lead-210 method. In general the cores exhibit a mercury profile with higher mercury concentrations in the upper centimetres of the core. The cores were studied by linear regression of In Hg vs, age...... indicating that the mercury mainly originates from atmospheric washout. But the large variability indicates that other processes also influence the mercury flux to Arctic marine sediments. (C) 2000 Elsevier Science B.V. All rights reserved....

Mercury kinetics in marine zooplankton

International Nuclear Information System (INIS)

Fowler, S.W.; Heyraud, M.; LaRosa, J.

1976-01-01

Mercury, like many other heavy metals, is potentially available to marine animals by uptake directly from water and/or through the organisms food. Furthermore, bioavailability, assimilation and subsequent retention in biota may be affected by the chemical species of the element in sea water. While mercury is known to exist in the inorganic form in sea water, recent work has indicated that, in certain coastal areas, a good portion of the total mercury appears to be organically bound; however, the exact chemical nature of the organic fraction has yet to be determined. Methyl mercury may be one constituent of the natural organically bound fraction since microbial mechanisms for in situ methylation of mercury have been demonstrated in the aquatic environment. Despite the fact that naturally produced methyl mercury probably comprises only a small fraction of an aquatic ecosystem, the well-documented toxic effects of this organo-mercurial, caused by man-made introductions into marine food chains, make it an important compound to study

The secondary release of mercury in coal fly ash-based flue-gas mercury removal technology.

Science.gov (United States)

He, Jingfeng; Duan, Chenlong; Lei, Mingzhe; Zhu, Xuemei

2016-01-01

The secondary release of mercury from coal fly ash is a negative by-product from coal-fired power plants, and requires effective control to reduce environmental pollution. Analysing particle size distribution and composition of the coal fly ash produced by different mercury removing technologies indicates that the particles are generally less than 0.5 mm in size and are composed mainly of SiO2, Al2O3, and Fe2O3. The relationships between mercury concentration in the coal fly ash, its particle size, and loss of ignition were studied using different mercury removing approaches. The research indicates that the coal fly ash's mercury levels are significantly higher after injecting activated carbon or brominating activated carbon when compared to regular cooperating-pollution control technology. This is particularly true for particle size ranges of >0.125, 0.075-0.125, and 0.05-0.075 mm. Leaching experiments revealed the secondary release of mercury in discarded coal fly ash. The concentration of mercury in the coal fly ash increases as the quantity of injecting activated carbon or brominating activated carbon increases. The leached concentrations of mercury increase as the particle size of the coal fly ash increases. Therefore, the secondary release of mercury can be controlled by adding suitable activated carbon or brominating activated carbon when disposing of coal fly ash. Adding CaBr2 before coal combustion in the boiler also helps control the secondary release of mercury, by increasing the Hg(2+) concentration in the leachate. This work provides a theoretical foundation for controlling and removing mercury in coal fly ash disposal.

Biomarkers of mercury exposure at a mercury recycling facility in Ukraine.

Science.gov (United States)

Gibb, Herman Jones; Kozlov, Kostj; Buckley, Jessie Poulin; Centeno, Jose; Jurgenson, Vera; Kolker, Allan; Conko, Kathryn; Landa, Edward; Panov, Boris; Panov, Yuri; Xu, Hanna

2008-08-01

This study evaluates biomarkers of occupational mercury exposure among workers at a mercury recycling operation in Gorlovka, Ukraine. The 29 study participants were divided into three occupational categories for analysis: (1) those who worked in the mercury recycling operation (Group A, n = 8), (2) those who worked at the facility but not in the yard where the recycling was done (Group B, n = 14), and (3) those who did not work at the facility (Group C, n = 7). Urine, blood, hair, and nail samples were collected from the participants, and a questionnaire was administered to obtain data on age, gender, occupational history, smoking, alcohol consumption, fish consumption, tattoos, dental amalgams, home heating system, education, source of drinking water, and family employment in the former mercury mine/smelter located on the site of the recycling facility. Each factor was tested in a univariate regression with total mercury in urine, blood, hair, and nails. Median biomarker concentrations were 4.04 microg/g-Cr (urine), 2.58 microg/L (blood), 3.95 microg/g (hair), and 1.16 microg/g (nails). Occupational category was significantly correlated (p recycling operation had the highest blood and urinary mercury levels. Those who worked at the facility but were not directly involved with the recycling operation had higher levels than those who did not work at the facility.

Effects of mercury on survival and development of the larval grass shrimp Palaemonetes vulgaris

Energy Technology Data Exchange (ETDEWEB)

Shealy, M.H. Jr.; Sandifer, P.A.

1975-11-10

Effects of 7 concentrations of mercury from 0.0 (control) to 0.056 ppM on survival and development of the larval grass shrimp Palaemonetes vulgaris (Say) were investigated. A concentration of 0.056 ppM Hg was toxic to all larvae within 24 h, but below a threshold level (less than or equal to 0.0056 ppM) no lethal effect occurred within 48 h. Feeding appeared to increase slightly the resistance of P. vulgaris larvae to mercury, and 48-h median tolerance limits for fed and unfed larvae were 0.0156 and 0.0100 ppM, respectively. Delayed effects of 48-h exposure to sublethal mercury concentrations which appeared in later post-exposure rearing of the larvae included reduced survival to the postlarval stage, delayed molting, extended development time, increased numbers of larval instars, and morphological deformities.

Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.

Science.gov (United States)

da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A

2017-07-01

One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

Groundwater Modeling Of Mercury Pollution At A Former Mercury Cell Chlor Alkali Facility In Pavoldar, Kazakhstan

Science.gov (United States)

In Kazakhstan, there is a serious case of mercury pollution near the city of Pavlodar from an old mercury cell chlor-alkali plant. The soil, sediment, and water is severly contaminated with mercury and mercury compounds as a result of the industrial activity of this chemical pla...

Process for low mercury coal

Science.gov (United States)

Merriam, Norman W.; Grimes, R. William; Tweed, Robert E.

1995-01-01

A process for producing low mercury coal during precombustion procedures by releasing mercury through discriminating mild heating that minimizes other burdensome constituents. Said mercury is recovered from the overhead gases by selective removal.

Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

NARCIS (Netherlands)

Nouwen, N; Driessen, AJM

2005-01-01

Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

Mercury's magnetic field and interior

International Nuclear Information System (INIS)

Connerney, J.E.P.; Ness, N.F.

1988-01-01

The magnetic-field data collected on Mercury by the Mariner-10 spacecraft present substantial evidence for an intrinsic global magnetic field. However, studies of Mercury's thermal evolution show that it is most likely that the inner core region of Mercury solidified or froze early in the planet's history. Thus, the explanation of Mercury's magnetic field in the framework of the traditional planetary dynamo is less than certain

Multi-model study of mercury dispersion in the atmosphere: vertical and interhemispheric distribution of mercury species

Directory of Open Access Journals (Sweden)

J. Bieser

2017-06-01

Full Text Available Atmospheric chemistry and transport of mercury play a key role in the global mercury cycle. However, there are still considerable knowledge gaps concerning the fate of mercury in the atmosphere. This is the second part of a model intercomparison study investigating the impact of atmospheric chemistry and emissions on mercury in the atmosphere. While the first study focused on ground-based observations of mercury concentration and deposition, here we investigate the vertical and interhemispheric distribution and speciation of mercury from the planetary boundary layer to the lower stratosphere. So far, there have been few model studies investigating the vertical distribution of mercury, mostly focusing on single aircraft campaigns. Here, we present a first comprehensive analysis based on various aircraft observations in Europe, North America, and on intercontinental flights. The investigated models proved to be able to reproduce the distribution of total and elemental mercury concentrations in the troposphere including interhemispheric trends. One key aspect of the study is the investigation of mercury oxidation in the troposphere. We found that different chemistry schemes were better at reproducing observed oxidized mercury patterns depending on altitude. High concentrations of oxidized mercury in the upper troposphere could be reproduced with oxidation by bromine while elevated concentrations in the lower troposphere were better reproduced by OH and ozone chemistry. However, the results were not always conclusive as the physical and chemical parameterizations in the chemistry transport models also proved to have a substantial impact on model results.

Vertical Distribution of Total Mercury and Mercury Methylation in a Landfill Site in Japan

Directory of Open Access Journals (Sweden)

Jing Yang

2018-06-01

Full Text Available Mercury is a neurotoxin, with certain organic forms of the element being particularly harmful to humans. The Minamata Convention was adopted to reduce the intentional use and emission of mercury. Because mercury is an element, it cannot be decomposed. Mercury-containing products and mercury used for various processes will eventually enter the waste stream, and landfill sites will become a mercury sink. While landfill sites can be a source of mercury pollution, the behavior of mercury in solid waste within a landfill site is still not fully understood. The purpose of this study was to determine the depth profile of mercury, the levels of methyl mercury (MeHg, and the factors controlling methylation in an old landfill site that received waste for over 30 years. Three sampling cores were selected, and boring sampling was conducted to a maximum depth of 18 m, which reached the bottom layer of the landfill. Total mercury (THg and MeHg were measured in the samples to determine the characteristics of mercury at different depths. Bacterial species were identified by 16S rRNA amplification and sequencing, because the methylation process is promoted by a series of genes. It was found that the THg concentration was 19–975 ng/g, with a geometric mean of 298 ng/g, which was slightly less than the 400 ng/g concentration recorded 30 years previously. In some samples, MeHg accounted for up to 15–20% of THg, which is far greater than the general level in soils and sediments, although the source of MeHg was unclear. The genetic data indicated that hgcA was present mostly in the upper and lower layers of the three cores, merA was almost as much as hgcA, while the level of merB was hundreds of times less than those of the other two genes. A significant correlation was found between THg and MeHg, as well as between MeHg and MeHg/THg. In addition, a negative correlation was found between THg and merA. The coexistence of the three genes indicated that both

Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Galas, D J; Branscomb, E W

1976-08-12

The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

Mercury (Environmental Health Student Portal)

Science.gov (United States)

... in contact with) to mercury is by eating fish or shellfish that have high levels of mercury. You can also get sick from: Touching it Breathing it in Drinking contaminated water How can mercury ...

Elimination of mercury in health care facilities.

Science.gov (United States)

2000-03-01

Mercury is a persistent, bioaccumulative toxin that has been linked to numerous health effects in humans and wildlife. It is a potent neurotoxin that may also harm the brain, kidneys, and lungs. Unborn children and young infants are at particular risk for brain damage from mercury exposure. Hospitals' use of mercury in chemical solutions, thermometers, blood pressure gauges, batteries, and fluorescent lamps makes these facilities large contributors to the overall emission of mercury into the environment. Most hospitals recognize the dangers of mercury. In a recent survey, four out of five hospitals stated that they have policies in place to eliminate the use of mercury-containing products. Sixty-two percent of them require vendors to disclose the presence of mercury in chemicals that the hospitals purchase. Only 12 percent distribute mercury-containing thermometers to new parents. Ninety-two percent teach their employees about the health and environmental effects of mercury, and 46 percent teach all employees how to clean up mercury spills. However, the same study showed that many hospitals have not implemented their policies. Forty-two percent were not aware whether they still purchased items containing mercury. In addition, 49 percent still purchase mercury thermometers, 44 percent purchase mercury gastrointestinal diagnostic equipment, and 64 percent still purchase mercury lab thermometers.

Phytoremediation of mercury in pristine and crude oil contaminated soils: Contributions of rhizobacteria and their host plants to mercury removal.

Science.gov (United States)

Sorkhoh, N A; Ali, N; Al-Awadhi, H; Dashti, N; Al-Mailem, D M; Eliyas, M; Radwan, S S

2010-11-01

The rhizospheric soils of three tested legume crops: broad beans (Vicia faba), beans (Phaseolus vulgaris) and pea (Pisum sativum), and two nonlegume crops: cucumber (Cucumis sativus) and tomato, (Lycopersicon esculentum) contained considerable numbers (the magnitude of 10(5)g(-1) soil) of bacteria with the combined potential for hydrocarbon-utilization and mercury-resistance. Sequencing of the 16S rRNA coding genes of rhizobacteria associated with broad beans revealed that they were affiliated to Citrobacter freundii, Enterobacter aerogenes, Exiquobacterium aurantiacum, Pseudomonas veronii, Micrococcus luteus, Brevibacillus brevis, Arthrobacter sp. and Flavobacterium psychrophilum. These rhizobacteria were also diazotrophic, i.e. capable of N(2) fixation, which makes them self-sufficient regarding their nitrogen nutrition and thus suitable remediation agents in nitrogen-poor soils, such as the oily desert soil. The crude oil attenuation potential of the individual rhizobacteria was inhibited by HgCl(2), but about 50% or more of this potential was still maintained in the presence of up to 40 mgl(-1) HgCl(2). Rhizobacteria-free plants removed amounts of mercury from the surrounding media almost equivalent to those removed by the rhizospheric bacterial consortia in the absence of the plants. It was concluded that both the collector plants and their rhizospheric bacterial consortia contributed equivalently to mercury removal from soil. Copyright © 2010 Elsevier Inc. All rights reserved.

Mercury

CERN Document Server

Balogh, André; Steiger, Rudolf

2008-01-01

Mercury, the planet closest to the Sun, is different in several respects from the other three terrestrial planets. In appearance, it resembles the heavily cratered surface of the Moon, but its density is high, it has a magnetic field and magnetosphere, but no atmosphere or ionosphere. This book reviews the progress made in Mercury studies since the flybys by Mariner 10 in 1974-75, based on the continued research using the Mariner 10 archive, on observations from Earth, and on increasingly realistic models of its interior evolution.

Autometallographic tracing of mercury in frog liver

International Nuclear Information System (INIS)

Loumbourdis, N.S.; Danscher, G.

2004-01-01

The distribution of mercury in the liver of the frog Rana ridibunda with the autometallographic method was investigated. The mercury specific autometallographic (HgS/Se AMG ) technique is a sensitive histochemical approach for tracing mercury in tissues from mercury-exposed organisms. Mercury accumulates in vivo as mercury sulphur/mercury selenium nanocrystals that can be silver-enhanced. Thus, only a fraction of the Hg can be visualized. Six animals were exposed for one day and another group of six animals for 6 days in 1 ppm mercury (as HgCI 2 ) dissolved in fresh water. A third group of six animals, served as controls, were sacrificed the day of arrival at the laboratory. First, mercury appears in the blood plasma and erythrocytes. Next, mercury moves to hepatocytes and in the apical part of the cells, that facing bile canaliculi. In a next step, mercury appears in the endothelial and Kupffer cells. It seems likely that, the mercury of hepatocytes moves through bile canaliculi to the gut, most probably bound to glutathione and/or other similar ligands. Most probably, the endothelial and Kupffer cells comprise the first line of defense against metal toxicity. - Frogs can be good bioindicators of mercury

A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

Science.gov (United States)

Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

2015-01-01

The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

Science.gov (United States)

Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

2010-07-01

Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

Reduced susceptibility to vancomycin and biofilm formation in methicillin-resistant Staphylococcus epidermidis isolated from blood cultures

Directory of Open Access Journals (Sweden)

Luiza Pinheiro

2014-11-01

Full Text Available This study aimed to correlate the presence of ica genes, biofilm formation and antimicrobial resistance in 107 strains of Staphylococcus epidermidis isolated from blood cultures. The isolates were analysed to determine their methicillin resistance, staphylococcal cassette chromosome mec (SCCmec type, ica genes and biofilm formation and the vancomycin minimum inhibitory concentration (MIC was measured for isolates and subpopulations growing on vancomycin screen agar. The mecA gene was detected in 81.3% of the S. epidermidis isolated and 48.2% carried SCCmec type III. The complete icaADBC operon was observed in 38.3% of the isolates; of these, 58.5% produced a biofilm. Furthermore, 47.7% of the isolates grew on vancomycin screen agar, with an increase in the MIC in 75.9% of the isolates. Determination of the MIC of subpopulations revealed that 64.7% had an MIC ≥ 4 μg mL-1, including 15.7% with an MIC of 8 μg mL-1 and 2% with an MIC of 16 μg mL-1. The presence of the icaADBC operon, biofilm production and reduced susceptibility to vancomycin were associated with methicillin resistance. This study reveals a high level of methicillin resistance, biofilm formation and reduced susceptibility to vancomycin in subpopulations of S. epidermidis. These findings may explain the selection of multidrug-resistant isolates in hospital settings and the consequent failure of antimicrobial treatment.

Method and apparatus for sampling atmospheric mercury

Science.gov (United States)

Trujillo, Patricio E.; Campbell, Evan E.; Eutsler, Bernard C.

1976-01-20

A method of simultaneously sampling particulate mercury, organic mercurial vapors, and metallic mercury vapor in the working and occupational environment and determining the amount of mercury derived from each such source in the sampled air. A known volume of air is passed through a sampling tube containing a filter for particulate mercury collection, a first adsorber for the selective adsorption of organic mercurial vapors, and a second adsorber for the adsorption of metallic mercury vapor. Carbon black molecular sieves are particularly useful as the selective adsorber for organic mercurial vapors. The amount of mercury adsorbed or collected in each section of the sampling tube is readily quantitatively determined by flameless atomic absorption spectrophotometry.

Methods for dispensing mercury into devices

Science.gov (United States)

Grossman, Mark W.; George, William A.

1987-04-28

A process for dispensing mercury into devices which requires mercury. Mercury is first electrolytically separated from either HgO or Hg.sub.2 Cl.sub.2 and plated onto a cathode wire. The cathode wire is then placed into a device requiring mercury.

Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

Science.gov (United States)

2012-01-01

Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433

Mercury erosion experiments for spallation target system

International Nuclear Information System (INIS)

Kinoshita, Hidetaka; Kaminaga, Masanori; Haga, Katsuhiro; Hino, Ryutaro

2003-01-01

The Japan Atomic Energy Research Institute (JAERI) and the High Energy Accelerator Research Organization (KEK) are promoting a plan to construct the spallation neutron source at the Tokai Research Establishment, JAERI, under the High-Intensity Proton Accelerator Project (J-PARC). A mercury circulation system has been designed so as to supply mercury to the target stably under the rated flow rate of 41 m 3 /hr. Then, it was necessary to confirm a mercury pump performance from the viewpoint of making the mercury circulation system feasible, and more, to investigate erosion rate under the mercury flow as well as an amount of mercury remained on the surface after drain from the viewpoints of mechanical strength relating to the lifetime and remote handling of mercury components. The mercury pump performance was tested under the mercury flow conditions by using an experimental gear pump, which had almost the same structure as a practical mercury pump to be expected in the mercury circulation system, and the erosion rates in a mercury pipeline as well as the amount of mercury remained on the surface were also investigated. The discharged flow rates of the experimental gear pump increased linearly with the rotation speed, so that the gear pump would work as the flow meter. Erosion rates obtained under the mercury velocity less than 1.6 m/s was found to be so small that decrease of pipeline wall thickness would be 390 μm after 30-year operation under the rated mercury velocity of 0.7 m/s. For the amount of remaining mercury on the pipeline, remaining rates of weight and volume were estimated at 50.7 g/m 2 and 3.74 Hg-cm 3 /m 2 , respectively. Applying these remaining rates of weight and volume to the mercury target, the remaining mercury was estimated at about 106.5 g and 7.9 cm 3 . Radioactivity of this remaining mercury volume was found to be three-order lower than that of the target casing. (author)

Histochemical demonstration of two mercury pools in trout tissues: mercury in kidney and liver after mercuric chloride exposure

DEFF Research Database (Denmark)

Baatrup, E; Nielsen, M G; Danscher, G

1987-01-01

Juvenile rainbow trout (Salmo gairdneri) were exposed to 100 ppb mercury (as HgCl2) in the water for 14 days. Concentrations of mercury in water and fish organs were monitored using radiolabeled mercury. Tissues from kidney and liver were fixed, and sections were developed by autometallography......, a method whereby accumulations of mercury sulfides and/or mercury selenides are silver amplified. In the kidney, mercury was found within lysosomes and extracellularly in the basal lamina of proximal tubules. In the liver, mercury was found within lysosomes of the hepatocytes. Additional groups of mercury......-exposed trout were subjected to selenium (as Na2SeO3), administered intraperitoneally 2 hr before fixation. Following this treatment, additional mercury could be visualized in the kidney circulatory system, including glomeruli, and in the nucleus and endoplasmic reticulum of liver cells. It is suggested...

Mercury flow experiments. 4th report Measurements of erosion rate caused by mercury flow

CERN Document Server

Kinoshita, H; Hino, R; Kaminaga, M

2002-01-01

The Japan Atomic Energy Research Institute (JAERI) and the High Energy Accelerator Research Organization (KEK) are promoting a construction plan of the Material-Life Science Facility, which is consisted of a Muon Science Facility and a Neutron Scattering Facility, in order to open up the new science fields. The Neutron Scattering Facility will be utilized for advanced fields of Material and Life science using high intensity neutron generated by the spallation reaction of a 1 MW pulsed proton beam and mercury target. Design of the spallation mercury target system aims to obtain high neutron performance with high reliability and safety. Since the target system is using mercury as the target material and contains large amount of radioactive spallation products, it is necessary to estimate reliability for strength of instruments in a mercury flow system during lifetime of the facility. Piping and components in the mercury flow system would be damaged by erosion with mercury flow, since these components will be we...

Mercury uptake in vivo by normal and acatalasemic mice exposed to metallic mercury vapor (203Hg degrees) and injected with metallic mercury or mercuric chloride (203HgCl2)

International Nuclear Information System (INIS)

Ogata, M.; Kenmotsu, K.; Hirota, N.; Meguro, T.; Aikoh, H.

1985-01-01

Levels of mercury in the brain and liver of acatalasemic mice immediately following exposure to metallic mercury vapor or injection of metallic mercury were higher than those found in normal mice. Acatalasemic mice had decreased levels of mercury in the blood and kidneys when the levels were compared with those of normal mice, which indicated that catalase plays a role in oxidizing and taking up mercury. Thus, the brain/blood or liver/blood ratio of mercury concentration in acatalasemic mice was significantly higher than that of normal mice. These results suggest that metallic mercury in the blood easily passed through the blood-brain or blood-liver barrier. The levels of mercury distribution to the kidneys of normal and acatalasemic mice, 1 hr after injection of mercuric chloride solution, were higher than that of normal and acatalasemic mice, respectively, 1 hr after injection of metallic mercury

Mercury content in Hot Springs

Energy Technology Data Exchange (ETDEWEB)

Nakagawa, R

1974-01-01

A method of determination of mercury in hot spring waters by flameless atomic absorption spectrophotometry is described. Further, the mercury content and the chemical behavior of the elementary mercury in hot springs are described. Sulfide and iodide ions interfered with the determination of mercury by the reduction-vapor phase technique. These interferences could, however, be minimized by the addition of potassium permanganate. Waters collected from 55 hot springs were found to contain up to 26.0 ppb mercury. High concentrations of mercury have been found in waters from Shimoburo Springs, Aomori (10.0 ppb), Osorezan Springs, Aomori (1.3 approximately 18.8 ppb), Gosyogake Springs, Akita (26.0 ppb), Manza Springs, Gunma (0.30 approximately 19.5 ppb) and Kusatu Springs, Gunma (1.70 approximately 4.50 ppb). These hot springs were acid waters containing a relatively high quantity of chloride or sulfate.

Arsenic- and mercury-induced phytotoxicity in the Mediterranean shrubs Pistacia lentiscus and Tamarix gallica grown in hydroponic culture.

Science.gov (United States)

Moreno-Jiménez, E; Esteban, E; Carpena-Ruiz, R O; Peñalosa, J M

2009-09-01

Hg and As resistance and bioaccumulation were studied in hydroponically grown Pistacia lentiscus and Tamarix gallica plants. Both elements caused growth inhibition in roots and shoots, with mercury showing greater phytotoxicity than arsenic. Accumulation of both elements by plants increased in response to element supply, with the greatest uptake found in T. gallica. Both elements affected P and Mn status in plants, reduced chlorophyll a concentration and increased MDA and thiol levels. These stress indices showed good correlations with As and Hg concentration in plant tissues, especially in the roots. Toxic responses to mercury were more evident than for arsenic, especially in shoot tissues. T. gallica showed higher resistance to both Hg and As than P. lentiscus, as well accumulating more As and Hg.

Functional analysis of the pediocin operon of Pediococcus acidilactici PAC1.0 : PedB is the immunity protein and PedD is the precursor processing enzyme

NARCIS (Netherlands)

Venema, Konraad; Kok, Jan; Marugg, Joey D.; Toonen, Marjolein Y.; Ledeboer, Aat M.; Venema, Gerhardus; Chikindas, Michael L.

The bacteriocin pediocin PA-1 operon of Pediococcus acidilactici PAC1.0 encompasses four genes: pedA, pedB, pedC and pedD. Transcription of the operon results in the formation of two overlapping transcripts, probably originating from a single promoter upstream of pedA. The major transcript comprises

Return to Mercury: a global perspective on MESSENGER's first Mercury flyby.

Science.gov (United States)

Solomon, Sean C; McNutt, Ralph L; Watters, Thomas R; Lawrence, David J; Feldman, William C; Head, James W; Krimigis, Stamatios M; Murchie, Scott L; Phillips, Roger J; Slavin, James A; Zuber, Maria T

2008-07-04

In January 2008, the MErcury Surface, Space ENvironment, GEochemistry, and Ranging (MESSENGER) spacecraft became the first probe to fly past the planet Mercury in 33 years. The encounter revealed that Mercury is a dynamic system; its liquid iron-rich outer core is coupled through a dominantly dipolar magnetic field to the surface, exosphere, and magnetosphere, all of which interact with the solar wind. MESSENGER images confirm that lobate scarps are the dominant tectonic landform and record global contraction associated with cooling of the planet. The history of contraction can be related to the history of volcanism and cratering, and the total contractional strain is at least one-third greater than inferred from Mariner 10 images. On the basis of measurements of thermal neutrons made during the flyby, the average abundance of iron in Mercury's surface material is less than 6% by weight.

Molecular evidence for the coordination of nitrogen and carbon metabolisms, revealed by a study on the transcriptional regulation of the agl3EFG operon that encodes a putative carbohydrate transporter in Streptomyces coelicolor.

Science.gov (United States)

Cen, Xu-Feng; Wang, Jing-Zhi; Zhao, Guo-Ping; Wang, Ying; Wang, Jin

2016-03-18

In the agl3EFGXYZ operon (SCO7167-SCO7162, abbreviated as agl3 operon) of Streptomyces coelicolor M145, agl3EFG genes encode a putative ABC-type carbohydrate transporter. The transcription of this operon has been proved to be repressed by Agl3R (SCO7168), a neighboring GntR-family regulator, and this repression can be released by growth on poor carbon sources. Here in this study, we prove that the transcription of agl3 operon is also directly repressed by GlnR, a central regulator governing the nitrogen metabolism in S. coelicolor. The electrophoretic mobility shift assay (EMSA) employing the agl3 promoter and mixtures of purified recombinant GlnR and Agl3R indicates that GlnR and Agl3R bind to different DNA sequences within the promoter region of agl3 operon, which is further confirmed by the DNase I footprinting assay. As Agl3R and GlnR have been demonstrated to sense the extracellular carbon and nitrogen supplies, respectively, it is hypothesized that the transcription of agl3 operon is stringently governed by the availabilities of extracellular carbon and nitrogen sources. Consistent with the hypothesis, the agl3 operon is further found to be derepressed only under the condition of poor carbon and rich nitrogen supplies, when both regulators are inactivated. It is believed that activation of the expression of agl3 operon may facilitate the absorption of extracellular carbohydrates to balance the ratio of intracellular carbon to nitrogen. Copyright © 2016 Elsevier Inc. All rights reserved.

Mercury: Aspects of its ecology and environmental toxicity. [physiological effects of mercury compound contamination of environment

Science.gov (United States)

Siegel, S. M.

1973-01-01

A study was conducted to determine the effects of mercury pollution on the environment. The possible sources of mercury contamination in sea water are identified. The effects of mercury on food sources, as represented by swordfish, are analyzed. The physiological effects of varying concentrations of mercury are reported. Emphasis is placed on the situation existing in the Hawaiian Islands.

Axial mercury segregation in direct current operated low-pressure argon-mercury gas discharges: Part I. Experimental

International Nuclear Information System (INIS)

Gielen, John W A M; Groot, Simon de; Mullen, Joost J A M van der

2004-01-01

Due to cataphoresis, axial segregation of mercury will occur when the gas discharge of a fluorescent lamp is operated by means of a direct current. A consequence of this is a non-uniform axial luminance distribution along the lamp. To determine the degree of axial mercury segregation experimentally, axial luminance distributions have been measured which are converted into axial mercury vapour pressure distributions by an appropriate calibration method. The mercury segregation has been investigated for variations in lamp tube radius (3.6-4.8 mm), argon buffer gas pressure (200-600 Pa) and lamp current (100-250 mA) at mercury vapour pressures set at the anode in the range from 0.2 to 9.0 Pa. From the experiments it has been concluded that the mercury vapour pressure gradient at any axial position for a certain lamp tube diameter, argon pressure and lamp current depends on the local mercury vapour pressure. This observation is in contrast to assumptions made in earlier modelling publications in which one mercury vapour pressure gradient is used for all axial positions. By applying a full factorial design, an empirical relation of the mercury segregation is found for any set of parameters inside the investigated parameter ranges

Deletion of the budBAC operon in Klebsiella pneumoniae to understand the physiological role of 2,3-butanediol biosynthesis.

Science.gov (United States)

Jeong, Daun; Yang, Jeongmo; Lee, Soojin; Kim, Borim; Um, Youngsoon; Kim, Youngrok; Ha, Kyoung-Su; Lee, Jinwon

2016-05-18

Klebsiella pneumoniae is known to produce 2,3-butanediol (2,3-BDO), a valuable chemical. In K. pneumoniae, the 2,3-BDO operon (budBAC) is involved in the production of 2,3-BDO. To observe the physiological role of the 2,3-BDO operon in a mixed acid fermentation, we constructed a budBAC-deleted strain (SGSB109). The production of extracellular metabolites, CO2 emission, carbon distribution, and NADH/NAD(+) balance of SGSB109 were compared with the parent strain (SGSB100). When comparing the carbon distribution at 15 hr, four significant differences were observed: in 2,3-BDO biosynthesis, lactate and acetate production (lactate and acetate production increased 2.3-fold and 4.1-fold in SGSB109 compared to SGSB100), CO2 emission (higher in SGSB100), and carbon substrate uptake (higher in SGSB100). Previous studies on the inactivation of the 2,3-BDO operon were focused on the increase of 1,3-propanediol production. Few studies have been done observing the role of 2,3-BDO biosynthesis. This study provides a prime insight into the role of 2,3-BDO biosynthesis of K. pneumoniae.

Mercury Sorption onto Malt Spent Rootlets

Science.gov (United States)

Manariotis, I. D.; Anagnostopoulos, V.; Karapanagioti, H. K.; Chrysikopoulos, C.

2011-12-01

Mercury is a metal of particular concern due to its toxicity even at relatively low concentrations. The maximum permissible level for mercury in drinking water set by the European Union is 0.001 mg/L. Mercury is released into the environment via four principal pathways: (1) natural processes; i.e. a volcanic eruption, (2) incidental to some other activity; i.e. coal burning power plants, (3) accidentally during the manufacture, breakage or disposal of products that have mercury put into them deliberately, and (4) direct use in industrial settings. The present study focuses on the removal of mercury (II) from aqueous solutions via sorption onto Malt Spent Rootlets (MSR). Batch experiments were conducted employing MSR with size ranging from 0.18 to 1 mm. The effects of pH, mercury concentration, contact time, and solid to liquid ratio on mercury sorption onto MSR were investigated. The highest mercury removal from the aqueous phase, of 41%, was observed at pH of 5.

Mercury Exposure: Protein Biomarkers of Mercury Exposure in Jaraqui Fish from the Amazon Region.

Science.gov (United States)

Vieira, José Cavalcante Souza; Braga, Camila Pereira; de Oliveira, Grasieli; Padilha, Cilene do Carmo Federici; de Moraes, Paula Martin; Zara, Luiz Fabricio; Leite, Aline de Lima; Buzalaf, Marília Afonso Rabelo; Padilha, Pedro de Magalhães

2018-05-01

This study presents data on the extraction and characterization of proteins associated with mercury in the muscle and liver tissues of jaraqui (Semaprochilodus spp.) from the Madeira River in the Brazilian Amazon. Protein fractionation was carried out by two-dimensional electrophoresis (2D-PAGE). Mercury determination in tissues, pellets, and protein spots was performed by graphite furnace atomic absorption spectrometry (GFAAS). Proteins in the spots that showed mercury were characterized by electrospray ionization tandem mass spectrometry (ESI-MS/MS). The highest mercury concentrations were found in liver tissues and pellets (426 ± 6 and 277 ± 4 μg kg -1 ), followed by muscle tissues and pellets (132 ± 4 and 86 ± 1 μg kg -1 , respectively). Mercury quantification in the protein spots allowed us to propose stoichiometric ratios in the range of 1-4 mercury atoms per molecule of protein in the protein spots. The proteins characterized in the analysis by ESI-MS/MS were keratin, type II cytoskeletal 8, parvalbumin beta, parvalbumin-2, ubiquitin-40S ribosomal S27a, 39S ribosomal protein L36 mitochondrial, hemoglobin subunit beta, and hemoglobin subunit beta-A/B. The results suggest that proteins such as ubiquitin-40S ribosomal protein S27a, which have specific domains, possibly zinc finger, can be used as biomarkers of mercury, whereas mercury and zinc present characteristics of soft acids.

Vaporization of elemental mercury from pools of molten lead at low concentrations

International Nuclear Information System (INIS)

Greene, G.A.; Finfrock, C.C.

2000-01-01

investigate its effect upon the mercury vaporization rate in simulation of the aluminum structure in the APT blanket. No effect at all was observed for a case with an argon atmosphere. This suggests that there are no chemical effects of the aluminum on the vaporization kinetics. With an air atmosphere, the presence of aluminum in the melt reduced the mercury vaporization by a factor of six in comparison to the identical test but without aluminum present. This suggests that aluminum in the lead/mercury .melt retards the vaporization of mercury by creating a surface oxide layer in addition to the lead-oxide layer which increases the mass transfer resistance

Method for the removal and recovery of mercury

Science.gov (United States)

Easterly, Clay E.; Vass, Arpad A.; Tyndall, Richard L.

1997-01-01

The present invention is an enhanced method for the removal and recovery of mercury from mercury-contaminated matrices. The method involves contacting a mercury-contaminated matrix with an aqueous dispersant solution derived from specific intra-amoebic isolates to release the mercury from the mercury-contaminated matrix and emulsify the mercury; then, contacting the matrix with an amalgamating metal from a metal source to amalgamate the mercury to the amalgamating metal; removing the metallic source from the mercury-contaminated matrix; and heating the metallic source to vaporize the mercury in a closed system to capture the mercury vapors.

The fruRBA Operon Is Necessary for Group A Streptococcal Growth in Fructose and for Resistance to Neutrophil Killing during Growth in Whole Human Blood

Science.gov (United States)

Valdes, Kayla M.; Sundar, Ganesh S.; Vega, Luis A.; Belew, Ashton T.; Islam, Emrul; Binet, Rachel; El-Sayed, Najib M.

2016-01-01

Bacterial pathogens rely on the availability of nutrients for survival in the host environment. The phosphoenolpyruvate-phosphotransferase system (PTS) is a global regulatory network connecting sugar uptake with signal transduction. Since the fructose PTS has been shown to impact virulence in several streptococci, including the human pathogen Streptococcus pyogenes (the group A Streptococcus [GAS]), we characterized its role in carbon metabolism and pathogenesis in the M1T1 strain 5448. Growth in fructose as a sole carbon source resulted in 103 genes affected transcriptionally, where the fru locus (fruRBA) was the most induced. Reverse transcriptase PCR showed that fruRBA formed an operon which was repressed by FruR in the absence of fructose, in addition to being under carbon catabolic repression. Growth assays and carbon utilization profiles revealed that although the entire fru operon was required for growth in fructose, FruA was the main transporter for fructose and also was involved in the utilization of three additional PTS sugars: cellobiose, mannitol, and N-acetyl-d-galactosamine. The inactivation of sloR, a fruA homolog that also was upregulated in the presence of fructose, failed to reveal a role as a secondary fructose transporter. Whereas the ability of both ΔfruR and ΔfruB mutants to survive in the presence of whole human blood or neutrophils was impaired, the phenotype was not reproduced in murine whole blood, and those mutants were not attenuated in a mouse intraperitoneal infection. Since the ΔfruA mutant exhibited no phenotype in the human or mouse assays, we propose that FruR and FruB are important for GAS survival in a human-specific environment. PMID:26787724

Groundwater Modeling of Mercury Pollution at a Former Mercury Cell Chlor Alkali Facility in Pavlodar City, Kazakhstan

Science.gov (United States)

In northern Kazakhstan, there is a serious case of mercury pollution near the city of Pavlodar from an old mercury cell chlor-alkali plant. The soil, sediment, and water is severely contaminated with mercury and mercury compounds as a result of the industrial activity of this ch...

Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia.

Science.gov (United States)

Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène

2018-01-22

Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.

Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

Directory of Open Access Journals (Sweden)

Johanna Rintahaka

Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we

Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

Science.gov (United States)

Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

2014-01-01

A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

Czech Academy of Sciences Publication Activity Database

Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

2017-01-01

Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016