
Sample records for mendelevium 247

  1. Symposium commemorating the 25th anniversary of the discovery of mendelevium

    Energy Technology Data Exchange (ETDEWEB)

    Seaborg, G.T. (ed.)


    The Symposium honoring the 25th Anniversary of the discovery of mendelevium was held at the Lawrence Berkeley Laboratory on March 28, 1980. The following three papers were presented: Chemical Properties of Mendelevium; Nuclear Properties of Mendelevium; and Radioactive Decay of Md Isotopes. Besides these papers there were introductory remarks, reminiscences, and concluding remarks.

  2. Studies on some physico-chemical properties of the monovalent mendelevium

    International Nuclear Information System (INIS)

    Kamenskaya, A.N.; Mikheev, N.B.; Novichenko, V.L.


    It was established that Md 3+ reduced by Yb 2+ or Eu 2+ co-crystallizes with NaCl in water-ethanol solutions. The co-crystallization coefficient is independent of the relative quantities of the solid and liquid phase, of the concentration of the reducing agent in the concentration range from 1 to 8 mg/ml, and of the concentration of the chloride ion in the solution. Basing on the knowledge of anomalous mixed crystals and on the thermodynamical analysis of the formation of truly isomorphical solid solutions and anomalous mixed crystals, it was shown that mendelevium co-crystallizing with NaCl is in its monovalent state. Besides, it was concluded that up to 1.5 M chloride concentration the monovalent mendelevium does not form stable chloride complexes in water-ethanol solutions. (author)

  3. Chemical properties of mendelevium

    Energy Technology Data Exchange (ETDEWEB)

    Hulet, E.K.


    Even with the most intense ion beams and the largest available quantities of target isotope, about 10/sup 6/ atoms at a time is all the Md that can be produced for chemical studies. This lack of sufficient sample size coupled with the very short lifetimes of the few atoms produced has severely restricted the gathering and the broadness of our knowledge concerning the properties of Md and the heavier elements. To illustrate, the literature contains a mere eleven references to the chemical studies of Md, and none of these deal with bulk properties associated with the element bound in solid phases. Some of these findings are: Md was found to be more volatile than other actinide metals which lead to the belief that it is divalent in the metallic state; separation of Md from the other actinides can be accomplished either by reduction of Md/sup 3 +/ to the divalent state or by chromatographic separations with Md remaining in the tripositive state; extraction of Md/sup 2 +/ with bis(2-ethylhexyl)phosphoric acid is much poorer than the extraction of the neighboring tripositive actinides; attempts to oxidize Md/sup 3 +/ with sodium bismuthate failed to show any evidence for Md/sup 4 +/; reduction potential of Md/sup 3 +/ was found to be close to -0.1 volt; Md/sup 3 +/ can be reduced to Md(Hg) by sodium amalgams and by electrolysis; the electrochemical behavior of Md is very similar to that of Fm and can be summarized in the equation, Md/sup 2 +/ + 2e/sup -/ = Md(Hg) and E/sup 0/ = -1.50 V.; and Md cannot be reduced to a monovalent ion with Sm/sup 2 +/.

  4. Chemical properties of mendelevium

    International Nuclear Information System (INIS)

    Hulet, E.K.


    The isotope 256 Md is nearly always employed for chemical studies of this element. This nuclide can be made by bombardment of fractions of a microgram of 254 Es with intense alpha-particle beams which will produce about 10 6 atoms of 256 Md with a half-life of 77 minutes. Even with the most intense ion beams and the largest available quantities of target isotope, about 10 6 atoms at a time is all the Md that can be produced for chemical studies. This lack of sufficient sample size coupled with the very short lifetimes of the few atoms produced has severly restricted the gathering and broadening of our knowledge concerning the properties of Md and the heavier elements. To illustrate, the literature contains a mere eleven references to the chemical studies of Md, and none of these deal with bulk properties associated with element found in solid phases. Some of these findings are: Md was found to be more volatile than other actinide metals which lead to the belief that it is divalent in the metallic state; separation of Md from the other actinides can be accomplished either by reduction of Md to the divalent state or by chromatographic separations with Md remaining in the tripositive state; extraction of Md with bis(2-ethylhexyl)phosphoric acid is much poorer than the extraction of the neighboring tripositive actinides; attempts to oxidize Md wih sodium bismuthate failed to show any evidence of Md 4+ ; standard reduction potential of Md 3+ was found to be close to -0.1 volt; Md 3+ can be reduced to Md(Hg) by sodium amalgams and by electrolysis; the electrochemical behavior of Md is very similar to that of Fm and can be summarized in the equation, Md 2+ + 2e - = Md(Hg), and E 0 = 1.5 V

  5. Chemical properties of mendelevium

    International Nuclear Information System (INIS)

    Hulet, E.K.


    Even with the most intense ion beams and the largest available quantities of target isotope, about 10 6 atoms at a time is all the Md that can be produced for chemical studies. This lack of sufficient sample size coupled with the very short lifetimes of the few atoms produced has severely restricted the gathering and the broadness of our knowledge concerning the properties of Md and the heavier elements. To illustrate, the literature contains a mere eleven references to the chemical studies of Md, and none of these deal with bulk properties associated with the element bound in solid phases. Some of these findings are: Md was found to be more volatile than other actinide metals which lead to the belief that it is divalent in the metallic state; separation of Md from the other actinides can be accomplished either by reduction of Md 3+ to the divalent state or by chromatographic separations with Md remaining in the tripositive state; extraction of Md 2+ with bis(2-ethylhexyl)phosphoric acid is much poorer than the extraction of the neighboring tripositive actinides; attempts to oxidize Md 3+ with sodium bismuthate failed to show any evidence for Md 4+ ; reduction potential of Md 3+ was found to be close to -0.1 volt; Md 3+ can be reduced to Md(Hg) by sodium amalgams and by electrolysis; the electrochemical behavior of Md is very similar to that of Fm and can be summarized in the equation, Md 2+ + 2e - = Md(Hg) and E 0 = -1.50 V.; and Md cannot be reduced to a monovalent ion with Sm 2+

  6. Exploring 24/7 environments

    NARCIS (Netherlands)

    Tan, Wendy; Klaasen, Ina


    24/7 environments – those areas where one can shop, eat out, find entertainment, etc., 24 hours a day and seven days a week – can be seen as underpinning urban vitality. But the question arises why they exist in some cities and seemingly not in comparable others. Finding that directly relevant

  7. 7 CFR 247.19 - Dual participation. (United States)


    ... CHILD NUTRITION PROGRAMS COMMODITY SUPPLEMENTAL FOOD PROGRAM § 247.19 Dual participation. (a) What must State and local agencies do to prevent and detect dual participation? The State agency must work with... 7 Agriculture 4 2010-01-01 2010-01-01 false Dual participation. 247.19 Section 247.19 Agriculture...

  8. 7 CFR 247.27 - Financial management. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Financial management. 247.27 Section 247.27... AGRICULTURE CHILD NUTRITION PROGRAMS COMMODITY SUPPLEMENTAL FOOD PROGRAM § 247.27 Financial management. (a) What are the Federal requirements for State and local agencies with regard to financial management...

  9. 43 CFR 24.7 - Exemptions. (United States)


    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Exemptions. 24.7 Section 24.7 Public Lands...-FEDERAL RELATIONSHIPS § 24.7 Exemptions. (a) Exempted from this policy are the following: (1) The control and regulation by the United States, in the area in which an international convention or treaty...

  10. 7 CFR 247.6 - State Plan. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false State Plan. 247.6 Section 247.6 Agriculture... CHILD NUTRITION PROGRAMS COMMODITY SUPPLEMENTAL FOOD PROGRAM § 247.6 State Plan. (a) What is the State Plan? The State Plan is a document that describes how the State agency will operate CSFP and the...

  11. 24/7 SM slavery. (United States)

    Dancer, Peter L; Kleinplatz, Peggy J; Moser, Charles


    This study describes the nature of 24/7 SM slavery as practiced within the SM (sadomasochistic) community. These SM participants, who attempt to live full-time in owner-slave roles, represent a small proportion of those with SM interests. SM slaves have not been studied systematically to determine if and how they differ from other SM practitioners. An online questionnaire was used to obtain responses from individuals who self-identified as slaves. A total of 146 respondents participated, 53% female and 47% male, ranging in age from 18 to 72. We explored the depth of their relationships, how well they approximated "slavery," and how their relationships were structured to maintain distinct roles. Data showed that in long-term SM slave relationships, a power differential exists which extends beyond time-limited SM or sexual interactions. Owners and slaves often use common, daily life experiences or situations, such as the completion of household chores, money management, and morning or evening routines, to distinguish and maintain their respective roles. In addition, contrary to the perception of total submission, results revealed that slaves exercise free will when it is in their best interests to do so. These relationships were long-lasting and satisfying to the respondents.

  12. Erythroderma: analysis of 247 cases

    Directory of Open Access Journals (Sweden)

    Cidia Vasconcellos


    Full Text Available The profile of 247 patients with erythroderma during a 23 year period from January, 1962 through March, 1985, with a follow-up period ranging from 1 to 26 years were analysed. The patients presented with diffuse erythema, scaling and pruritus of more than 2 months' duration, and the age ranged from 16 to 60 years. Psoriasis was the most frequent underlying disease with an estimated frequency of 44.9%, the reaction to the use of drugs appeared in 7.3% of total cases and association with reticulosis showed a frequency of 4.1%. The cause of the erythroderma could not be determined in 29.2% of the cases. Sex differences in terms of underlying diseases were not observed. One or more skin biopsies along with the clinical findings were diagnostic or suggestive of the underlying disease in 63.6% of the cases. Repeated skin biopsies are recommended as the best method for etiologic diagnosis of erythroderma. At P=0.05 significance level, masculine/feminine ratio of 2 : 1 was found. The question arises wether causal agent of erythroderma may not be somehow related to different exposure by sex to environmental antigens.

  13. Erythroderma: analysis of 247 cases

    Directory of Open Access Journals (Sweden)

    Cidia Vasconcellos


    Full Text Available The profile of 247 patients with erythroderma during a 23 year period from January, 1962 through March, 1985, with a follow-up period ranging from 1 to 26 years were analysed. The patients presented with diffuse erythema, scaling and pruritus of more than 2 months' duration, and the age ranged from 16 to 60 years. Psoriasis was the most frequent underlying disease with an estimated frequency of 44.9%, the reaction to the use of drugs appeared in 7.3% of total cases and association with reticulosis showed a frequency of 4.1%. The cause of the erythroderma could not be determined in 29.2% of the cases. Sex differences in terms of underlying diseases were not observed. One or more skin biopsies along with the clinical findings were diagnostic or suggestive of the underlying disease in 63.6% of the cases. Repeated skin biopsies are recommended as the best method for etiologic diagnosis of erythroderma. At P=0.05 significance level, masculine/feminine ratio of 2 : 1 was found. The question arises wether causal agent of erythroderma may not be somehow related to different exposure by sex to environmental antigens.Foi analisado o perfil de 247 doentes com eritrodermia em um período de 23 anos, de Janeiro de 1962 a março de 1985, com o período de seguimento variando de 1 a 26 anos. Os doentes se apresentavam com eritema universal, descamação e prurido com mais de 2 meses de duração e a idade variava de 16 a 60 anos. A psoríase foi a doença associada mais freqüente, com uma proporção estimada de 44,9%, as reações cutâneas ao uso de drogas contribuíram com 7,3% do total de casos e a associação com reticuloses mostrou uma proporção de 4,1%. A eritrodermia permaneceu como de causa desconhecida em 29,2% dos casos. Não foram observadas diferenças entre os sexos no que diz respeito à doença associada. Um ou mais resultados anátomo patológicos das biópsias de pele, em conjunto com o quadro clínico, foi diagnóstico ou sugestivo do

  14. 48 CFR 52.247-17 - Charges. (United States)


    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Charges. 52.247-17 Section... Charges. As prescribed in 47.207-6(a)(2), insert the following clause in solicitations and contracts for transportation or for transportation-related services: Charges (APR 1984) In no event shall charges under this...

  15. 7 CFR 247.20 - Program violations. (United States)


    ...) Selling commodities obtained in the program, or exchanging them for non-food items; (4) Physical abuse, or threat of physical abuse, of program staff; or (5) Committing dual participation. (b) What are the... CHILD NUTRITION PROGRAMS COMMODITY SUPPLEMENTAL FOOD PROGRAM § 247.20 Program violations. (a) What are...

  16. 7 CFR 247.16 - Certification period. (United States)


    ... Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS COMMODITY SUPPLEMENTAL FOOD PROGRAM § 247.16 Certification period. (a..., color, national origin, age, sex, or disability. (Approved by the Office of Management and Budget under...

  17. 7 CFR 247.17 - Notification of discontinuance of participant. (United States)


    ... Section 247.17 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS COMMODITY SUPPLEMENTAL FOOD PROGRAM § 247.17... discrimination by race, color, national origin, age, sex, or disability. ...

  18. 48 CFR 52.247-2 - Permits, Authorities, or Franchises. (United States)


    ... Franchises. 52.247-2 Section 52.247-2 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION....247-2 Permits, Authorities, or Franchises. As prescribed in 47.207-1(a), insert the following clause: Permits, Authorities, or Franchises (JAN 1997) (a) The offeror does □, does not □, hold authorization from...

  19. 43 CFR 2.47 - Records subject to Privacy Act. (United States)


    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Records subject to Privacy Act. 2.47 Section 2.47 Public Lands: Interior Office of the Secretary of the Interior RECORDS AND TESTIMONY; FREEDOM OF INFORMATION ACT Privacy Act § 2.47 Records subject to Privacy Act. The Privacy Act applies to all...

  20. 25 CFR 247.18 - What are the sanitation prohibitions? (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false What are the sanitation prohibitions? 247.18 Section 247.18 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE USE OF COLUMBIA RIVER TREATY FISHING ACCESS SITES § 247.18 What are the sanitation prohibitions? (a) You cannot deposit...

  1. 48 CFR 52.247-60 - Guaranteed Shipping Characteristics. (United States)


    ... Characteristics. 52.247-60 Section 52.247-60 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION....247-60 Guaranteed Shipping Characteristics. As prescribed in 47.305-16(b)(1), insert the following clause: Guaranteed Shipping Characteristics (DEC 1989) (a) The offeror is requested to complete...

  2. The Dusty Disc of NGC 247 (United States)


    This image of NGC 247, taken by the Wide Field Imager on the MPG/ESO 2.2-metre telescope at ESO's La Silla Observatory in Chile, reveals the fine details of this highly inclined spiral galaxy and its rich backdrop. Astronomers say this highly tilted orientation, when viewed from Earth, explains why the distance to this prominent galaxy was previously overestimated. The spiral galaxy NGC 247 is one of the closest spiral galaxies of the southern sky. In this new view from the Wide Field Imager on the MPG/ESO 2.2-metre telescope in Chile large numbers of the galaxy's component stars are clearly resolved and many glowing pink clouds of hydrogen, marking regions of active star formation, can be made out in the loose and ragged spiral arms. NGC 247 is part of the Sculptor Group, a collection of galaxies associated with the Sculptor Galaxy (NGC 253, also shown in eso0902 and eso1025). This is the nearest group of galaxies to our Local Group, which includes the Milky Way, but putting a precise value on such celestial distances is inherently difficult. To measure the distance from the Earth to a nearby galaxy, astronomers have to rely on a type of variable star called a Cepheid to act as a distance marker. Cepheids are very luminous stars, whose brightness varies at regular intervals. The time taken for the star to brighten and fade can be plugged into a simple mathematical relation that gives its intrinsic brightness. When compared with the measured brightness this gives the distance. However, this method isn't foolproof, as astronomers think this period-luminosity relationship depends on the composition of the Cepheid. Another problem arises from the fact that some of the light from a Cepheid may be absorbed by dust en route to Earth, making it appear fainter, and therefore further away than it really is. This is a particular problem for NGC 247 with its highly inclined orientation, as the line of sight to the Cepheids passes through the galaxy's dusty disc. However, a

  3. 48 CFR 3452.247-70 - Foreign travel. (United States)


    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Foreign travel. 3452.247... 3452.247-70 Foreign travel. As prescribed in 3447.7000, insert the following clause in all solicitations and resultant cost-reimbursement contracts: Foreign Travel (AUG 1987) Foreign travel shall not be...

  4. 48 CFR 952.247-70 - Foreign travel. (United States)


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Foreign travel. 952.247-70... SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 952.247-70 Foreign travel. As prescribed in 947.7002, insert the following clause: Foreign Travel (JUN 2010) Contractor foreign travel...

  5. 7 CFR 2.47 - Administrator, Rural Utilities Service. (United States)


    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Administrator, Rural Utilities Service. 2.47 Section 2... Development § 2.47 Administrator, Rural Utilities Service. (a) Delegations. Pursuant to §§ 2.17 (a)(14) and (a... for Rural Economic and Community Development to the Administrator, Rural Utilities Service: (1...

  6. 48 CFR 452.247-70 - Delivery Location. (United States)


    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Delivery Location. 452.247-70 Section 452.247-70 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE CLAUSES AND... Location. As prescribed in 447.302, insert a clause substantially as follows: Delivery Location (FEB 1988...

  7. 40 CFR 247.10 - Paper and paper products. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Paper and paper products. 247.10... COMPREHENSIVE PROCUREMENT GUIDELINE FOR PRODUCTS CONTAINING RECOVERED MATERIALS Item Designations § 247.10 Paper and paper products. Paper and paper products, excluding building and construction paper grades. ...

  8. 7 CFR 58.247 - Insect and rodent control program. (United States)


    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Insect and rodent control program. 58.247 Section 58... Service 1 Operations and Operating Procedures § 58.247 Insect and rodent control program. In addition to... made responsible for the performance of a regularly scheduled insect and rodent control program as...

  9. Formation and characterization of Y:247 film through spray pyrolysis ...

    Indian Academy of Sciences (India)

    The synthesis of high temperature superconducting films of Y:247 (c ∼ K) have been successfully achieved. The difficulty in synthesis owing to narrow range of stability of Y:247 has been taken care of through several quenching modes, e.g. quenching of the films synthesized at ∼ 850°C, in air or in liquid nitrogen.

  10. 48 CFR 52.247-7 - Freight Excluded. (United States)


    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Freight Excluded. 52.247-7... AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 52.247-7 Freight... contracts for transportation or for transportation-related services when any commodities or types of...

  11. 7 CFR 247.28 - Storage and inventory of commodities. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Storage and inventory of commodities. 247.28 Section..., DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS COMMODITY SUPPLEMENTAL FOOD PROGRAM § 247.28 Storage and inventory of commodities. (a) What are the requirements for storage of commodities? State and local agencies...

  12. Formation and characterization of Y: 247 film through spray pyrolysis ...

    Indian Academy of Sciences (India)

    The difficulty in synthesis owing to narrow range of stability of Y:247 has been taken care of through several quenching modes, e.g. quenching of the films ... Representative estimates of transport critical current density (c) for Y:247 films is ∼ 103 A/cm2, and with silver corresponding to Y2Ba4Cu7O14+ (Ag0.1) is found to ...

  13. Formation and characterization of Y : 247 film through spray ...

    Indian Academy of Sciences (India)


    The difficulty in synthesis owing to narrow range of stability of Y : 247 has been taken care of through several quenching modes, e.g. quenching of the ... critical current density (Jc) for Y : 247 films is ~ 103 A/cm2, and with silver corresponding to Y2Ba4Cu7O14+x. (Ag0⋅1) is found to be ~ 104 A/cm2. Keywords. Thin film ...

  14. 8 CFR 247.12 - Disposition of case. (United States)


    ... CERTAIN RESIDENT ALIENS § 247.12 Disposition of case. (a) Allegations admitted or no answer filed. If the waiver Form I-508 and, if applicable, Form I-508F is not filed by the alien within the time prescribed... unless the alien, within 10 days of receipt of notification of such decision, requests permission to...

  15. CDC 24/7: Saving Lives, Protecting People

    Centers for Disease Control (CDC) Podcasts


    24/7, CDC provides health information, responds to public health emergencies and natural disasters, and monitors disease.  Created: 6/4/2012 by Office of the Associate Director of Communciation (OADC).   Date Released: 6/4/2012.

  16. 14 CFR 135.247 - Pilot qualifications: Recent experience. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Pilot qualifications: Recent experience... Flight Crewmember Requirements § 135.247 Pilot qualifications: Recent experience. (a) No certificate... least 1,500 hours of aeronautical experience as a pilot; (B) In each airplane that is type certificated...

  17. 48 CFR 52.247-51 - Evaluation of Export Offers. (United States)


    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Evaluation of Export....247-51 Evaluation of Export Offers. As prescribed in 47.305-6(e), insert the following provision: Evaluation of Export Offers (JAN 2001) (a) Port handling and ocean charges—other than DOD water terminals...

  18. 48 CFR 52.247-12 - Supervision, Labor, or Materials. (United States)


    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Supervision, Labor, or....247-12 Supervision, Labor, or Materials. As prescribed in 47.207-5(b), insert a clause substantially... when the contractor is required to furnish supervision, labor, or materials: Supervision, Labor, or...

  19. 48 CFR 252.247-7022 - Representation of extent of transportation by sea. (United States)


    ... contract. The term supplies is defined in the Transportation of Supplies by Sea clause of this solicitation... of transportation by sea. 252.247-7022 Section 252.247-7022 Federal Acquisition Regulations System... transportation by sea. As prescribed in 247.574(a), use the following provision: Representation of Extent of...

  20. 48 CFR 52.247-11 - Net Weight-Household Goods or Office Furniture. (United States)


    ... or Office Furniture. 52.247-11 Section 52.247-11 Federal Acquisition Regulations System FEDERAL... Provisions and Clauses 52.247-11 Net Weight—Household Goods or Office Furniture. As prescribed in 47.207-4(b... Weight—Household Goods or Office Furniture (APR 1984) (a) Net weight—full loads. The net weight of the...

  1. 26 CFR 1.247-1 - Deduction for dividends paid on preferred stock of public utilities. (United States)


    ... of public utilities. 1.247-1 Section 1.247-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF....247-1 Deduction for dividends paid on preferred stock of public utilities. (a) Amount of deduction. (1... lesser of (i) the amount of the dividends paid during the taxable year by a public utility on its...

  2. 48 CFR 52.247-40 - Ex Dock, Pier, or Warehouse, Port of Importation. (United States)


    ... Warehouse, Port of Importation. 52.247-40 Section 52.247-40 Federal Acquisition Regulations System FEDERAL... Provisions and Clauses 52.247-40 Ex Dock, Pier, or Warehouse, Port of Importation. As prescribed in 47.303-12..., pier, or warehouse, port of importation: Ex Dock, Pier, or Warehouse, Port of Importation (APR 1984) (a...

  3. 24/7 pediatric radiology attending coverage: times are changing

    Energy Technology Data Exchange (ETDEWEB)

    Donaldson, James S. [Feinberg School of Medicine at Northwestern University, Department of Medical Imaging, Ann and Robert H. Lurie Children' s Hospital of Chicago, IL (United States); Thakrar, Kiran H. [University of Chicago Pritzker School of Medicine, Body Imaging, NorthShore University HealthSystem, Chicago, IL (United States)


    The job of the pediatric radiologist long ago ceased to be an 8-to-5 role. Many practices have adopted evening shifts of in-house attending radiologists to cover the busy evening activity. With the ever-increasing role of imaging in clinical decisions and patient management, there is a need - if not a demand - to further extend attending pediatric radiology coverage. In this article, we discuss the needs and justification for extending pediatric radiology coverage at a tertiary-care children's hospital. We also describe the approach we took toward implementing 24/7 attending in-house coverage of pediatric radiology. (orig.)

  4. 32 CFR Appendix E to Part 247 - DoD Command Newspaper and Magazine Review System (United States)


    ... 32 National Defense 2 2010-07-01 2010-07-01 false DoD Command Newspaper and Magazine Review System... ENTERPRISE PUBLICATIONS Pt. 247, App. E Appendix E to Part 247—DoD Command Newspaper and Magazine Review System A. Purpose. The purpose of the DoD command newspaper and magazine review system is to assist...

  5. 7 CFR 247.8 - Individuals applying to participate in CSFP. (United States)


    ... Section 247.8 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS COMMODITY SUPPLEMENTAL FOOD PROGRAM § 247.8..., color, national origin, age, sex, or disability. After informing the applicant (or adult parent or...

  6. 7 CFR 247.10 - Distribution and use of CSFP commodities. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Distribution and use of CSFP commodities. 247.10... SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS COMMODITY SUPPLEMENTAL FOOD PROGRAM § 247.10 Distribution and use of CSFP commodities. (a) What are the requirements for distributing CSFP commodities to...

  7. Complications of laparoscopic cholecystectomy: an experience of 247 cases

    International Nuclear Information System (INIS)

    Farooq, U.; Rashid, T.; Barkat, N.


    Laparoscopic cholecystectomy needs lot of training and experience in developing countries like Pakistan. After the introduction of laparoscopic cholecystectomy several studies have been conducted to evaluate the complications of laparoscopic cholecystectomy and to establish the efficacy and safety of the procedure. The aim of this study was to determine the complications of laparoscopic cholecystectomy in a teaching hospital during the learning process. Methods: This descriptive case series was conducted in the department of General Surgery at Social Security Teaching Hospital, Islamabad, from October 2012 to February 2015. Patients of more than 15 years of age having symptomatic gallstones were included. Patients with dilated common bile duct (>8 mm in diameter), jaundice, acute cholecystitis, mass at porta hepatis and positive hepatitis B or C virology were excluded. Results: A sample of 247 consecutive patients was studied. Of them, 218 (88.26%) were females and 29 (11.74 %) were males. Their age ranged from 15 to 73 years (mean 43.37). Six (2.43%) patients developed epigastric port site wound infection. Four patients (1.62%) had bleeding. There was bile leakage in 2 (0.82 %) patients postoperatively. Two patients (0.82%) had collection (haematoma) in pouch of Morrison. One patient (0.41%) had duodenal injury. Eighteen (7.29 %) laparoscopic procedures were converted to open cholecystectomy. The mean postoperative hospital stay was 1.8 days. Conclusion: Complication rate is high in early learning phase of laparoscopic surgery which can be reduced with proper training of surgeons and they should perform these procedures under supervision of experienced laparoscopic surgeons during their learning phase. (author)

  8. Switching Investigations on a SiC MOSFET in a TO-247 Package

    DEFF Research Database (Denmark)

    Anthon, Alexander; Hernandez Botella, Juan Carlos; Zhang, Zhe


    package, has a major influence on the switching energy. Crucial design guidelines for an improved double pulse test circuit are introduced which are used for practical investigations on the switching behavior. Switching energies of a SiC MOSFET in a TO-247 package is measured depending on varying gate......This paper deals with the switching behavior of a SiC MOSFET in a TO-247 package. Based on simulations, critical parasitic inductances in the circuit layout are analyzed and their effect on the switching losses highlighted. Especially the common source inductance, a critical parameter in a TO-247...

  9. 25 CFR 247.19 - Can a site be used for commercial enterprises other than fishing enterprises by the tribes? (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Can a site be used for commercial enterprises other than fishing enterprises by the tribes? 247.19 Section 247.19 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE USE OF COLUMBIA RIVER TREATY FISHING ACCESS SITES § 247.19 Can a site...

  10. Field testing of hand-held infrared thermography, phase II TPF-5(247) : final report. (United States)


    This report is the second of two volumes that document results from the pooled fund study TPF-5 (247), Development of : Handheld Infrared Thermography, Phase II. The interim report (volume I) studied the implementation of handheld thermography : by p...

  11. Radiology 24/7 In-House Attending Coverage: Do Benefits Outweigh Cost? (United States)

    Coleman, Stephanie; Holalkere, Nagaraj Setty; O׳Malley, Julie; Doherty, Gemma; Norbash, Alexander; Kadom, Nadja


    Many radiology practices, including academic centers, are moving to in-house 24/7 attending coverage. This could be costly and may not be easily accepted by radiology trainees and attending radiologists. In this article, we evaluated the effects of 24/7 in-house attending coverage on patient care, costs, and qualitative aspects such as trainee education. We retrospectively collected report turnaround times (TAT) and work relative value units (wRVU). We compared these parameters between the years before and after the implementation of 24/7 in-house attending coverage. The cost to provide additional attending coverage was estimated from departmental financial reports. A qualitative survey of radiology residents and faculty was performed to study perceived effects on trainee education. There were decreases in report TAT following 24/7 attending implementation: 69% reduction in computed tomography, 43% reduction in diagnostic radiography, 7% reduction in magnetic resonance imaging, and 43% reduction in ultrasound. There was an average daytime wRVU decrease of 9%, although this was compounded by a decrease in total RVUs of the 2013 calendar year. The financial investment by the institution was estimated at $850,000. Qualitative data demonstrated overall positive feedback from trainees and faculty in radiology, although loss of independence was reported as a negative effect. TAT and wRVU metrics changed with implementation of 24/7 attending coverage, although these metrics do not directly relate to patient outcomes. Additional clinical benefits may include fewer discrepancies between preliminary and final reports that may improve emergency and inpatient department workflows and liability exposure. Radiologists reported the impression that clinicians appreciated 24/7 in-house attending coverage, particularly surgical specialists. Loss of trainee independence on call was a perceived disadvantage of 24/7 attending coverage and raised a concern that residency education

  12. Rotational emission-line spectrum of Orion A between 247 and 263 GHZ

    International Nuclear Information System (INIS)

    Blake, G.A.; Sutton, E.C.; Masson, C.R.; Phillips, T.G.


    Results are presented from a molecular line survey of the core of the Orion molecular cloud between 247 and 263 GHz. The spectrum contains a total of 243 resolvable lines from 23 different chemical species. When combined with the earlier survey of Orion from 215 to 247 GHz by Sutton et al (1985), the complete data set includes over 780 emission features from 29 distinct molecules. Of the 23 molecules detected in this survey, only NO, CCH, and HCO + were identified not in the lower frequency data

  13. [Danish emergency departments are not staffed by consultants 24/7]. (United States)

    Mackenhauer, Julie; Møller, Cecilie; Fjældstad, Alexander; Østervig, Rebecca; Kole, Ayhan Al; Folkestad, Lars; Hallas, Peter; Brabrand, Mikkel; Møllekær, Anders; Kirkegaard, Hans


    The Danish health care system is undergoing a major reorganisation, resulting in fewer emergency departments (ED) with consultants in attendance 24/7. This questionnaire-based study evaluates the status of the reorganisation with emphasis on physician attendance and recruitment. 76% of the EDs are not staffed by consultants 24/7, 51% report difficulties in recruiting qualified personnel and 33% report problems connected to retaining them. 71% believe that a specialty in emergency medicine could help solve these problems. Danish EDs do not comply with the visions of the reorganisation plan.

  14. 48 CFR 52.247-32 - F.o.b. Origin, Freight Prepaid. (United States)


    ... a port area having water transportation service) or the carrier's freight station; (iii) To a U.S... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false F.o.b. Origin, Freight....247-32 F.o.b. Origin, Freight Prepaid. As prescribed in 47.303-4(c), insert the following clause: F.o...

  15. 48 CFR 52.247-31 - F.o.b. Origin, Freight Allowed. (United States)


    ... port area having water transportation service) or the carrier's freight station; (iii) To a U.S. Postal... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false F.o.b. Origin, Freight....247-31 F.o.b. Origin, Freight Allowed. As prescribed in 47.303-3(c), insert the following clause: F.o...

  16. 48 CFR 52.247-29 - F.o.b. Origin. (United States)


    ... the shipping point is within a port area having water transportation service) or the carrier's freight... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false F.o.b. Origin. 52.247-29....o.b. Origin. As prescribed in 47.303-1(c), insert the following clause: F.o.b. Origin (FEB 2006) (a...

  17. 48 CFR 52.247-33 - F.o.b. Origin, With Differentials. (United States)


    ... shipping point is within a port area having water transportation service) or the carrier's freight station... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false F.o.b. Origin, With....247-33 F.o.b. Origin, With Differentials. As prescribed in 47.303-5(c), insert the following clause: F...

  18. Serving culturally diverse learners in the 24/7 management classroom

    NARCIS (Netherlands)

    van de Bunt-Kokhuis, S.G.M.; Weir, D.


    Purpose: The purpose of this paper is to highlight how future teaching in business schools will probably take place in an online (here called 24/7) classroom, where culturally diverse e-learners around the globe meet. Technologies such as iPhone, iPad and a variety of social media, to mention but a

  19. 7 CFR 247.13 - Provisions for non-English or limited-English speakers. (United States)


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Provisions for non-English or limited-English speakers... § 247.13 Provisions for non-English or limited-English speakers. (a) What must State and local agencies do to ensure that non-English or limited-English speaking persons are aware of their rights and...

  20. Agarwal Vijay K see Varma AK 247 see Varma AK 257 Banse Karl ...

    Indian Academy of Sciences (India)

    R.Narasimhan(krishtel emaging) 1461 1996 Oct 15 13:05:22

    Agarwal Vijay K see Varma A K. 247 see Varma A K. 257. Banse Karl see Lierheimer Lisa Jade. 163. Basu Sujit see Sarkar Abhijit. 297. Bawiskar S M. Momentum transport of wave zero during March: A possible predictor for the Indian summer monsoon. 153. Bhatla R see Mohanty U C. 365. Bhattacharya S. Grenvillian ...

  1. 48 CFR 252.247-7026 - Evaluation Preference for Use of Domestic Shipyards-Applicable to Acquisition of Carriage by... (United States)


    ... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.247-7026 Evaluation Preference for Use of... Noncontiguous Trade. As prescribed in 247.574(e), use the following provision: Evaluation Preference For Use of... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Evaluation Preference for...

  2. Microstructural studies of carbides in MAR-M247 nickel-based superalloy (United States)

    Szczotok, A.; Rodak, K.


    Carbides play an important role in the strengthening of microstructures of nickel-based superalloys. Grain boundary carbides prevent or retard grain-boundary sliding and make the grain boundary stronger. Carbides can also tie up certain elements that would otherwise promote phase instability during service. Various types of carbides are possible in the microstructure of nickel-based superalloys, depending on the superalloy composition and processing. In this paper, scanning electron and scanning transmission electron microscopy studies of carbides occurring in the microstructure of polycrystalline MAR-M247 nickel-based superalloy were carried out. In the present work, MC and M23C6 carbides in the MAR-M247 microstructure were examined.

  3. Evaluation of Cm-247 neutron cross sections in the resonance region

    International Nuclear Information System (INIS)

    Martinelli, T.; Menapace, E.; Motta, M.; Vaccari, M.


    The neutron cross sections of Cm-247 are evaluated in the resonance (resolved and unresolved) region up to 10 keV. Average resonance parameters (i.e. spacing D, fission and radiative widths, neutron strength functions) are determined for unresolved region calculations. Moreover for a better comparison with the experimental data, fission cross section is calculated up to 10 MeV. In addition, the average number of neutrons emitted per fission as a function of energy is estimated

  4. 24/7 Registered Nurse Staffing Coverage in Saskatchewan Nursing Homes and Acute Hospital Use. (United States)

    McGregor, Margaret J; Murphy, Janice M; Poss, Jeffrey W; McGrail, Kimberlyn M; Kuramoto, Lisa; Huang, Huei-Chung; Bryan, Stirling


    RÉSUMÉ La législation, dans de nombreuses juridictions, nécessite les établissements des soins de longue durée (SLD) d'avoir une infirmière en service 24 heures par jour, 7 jours par semaine. Bien que la recherche considérable existe sur l'intensité SLD de la dotation en personnel infirmier, il n'existe pas de la recherche empirique relative à cette exigence. Notre étude rétrospectif d'observation a comparé des installations en Saskatchewan avec 24/7 RN couverture aux établissements offrant moins de couverture, complétées par divers modèles de dotation des postes de nuit. Les ratios de risque associés à moins de 24/7 couverture RN complété de la dotation infirmière autorisé de nuit, ajusté pour l'intensité de dotation en personnel infirmier et d'autres facteurs de confusion potentiels, étaient de 1,17, IC 95% [0,91, 1,50] et 1.00, IC à 95% [0,72, 1,39], et avec moins de couverture 24/7 RN complété avec soin par aides personnels de nuit, les ratios de risque étaient de 1,46, IC 95% [1,11, 1,91] et 1,11, IC 95% [0,78, 1,58], pour les patients hospitalisés et de visites aux services d'urgence, respectivement. Ces résultats suggèrent que l'utilisation des soins de courte durée peut être influencée négativement par l'absence de la couverture 24/7 RN.

  5. A novel thymoma-associated immunodeficiency with increased naive T cells and reduced CD247 expression. (United States)

    Christopoulos, Petros; Dopfer, Elaine P; Malkovsky, Miroslav; Esser, Philipp R; Schaefer, Hans-Eckart; Marx, Alexander; Kock, Sylvia; Rupp, Nicole; Lorenz, Myriam R; Schwarz, Klaus; Harder, Jan; Martin, Stefan F; Werner, Martin; Bogdan, Christian; Schamel, Wolfgang W A; Fisch, Paul


    The mechanisms underlying thymoma-associated immunodeficiency are largely unknown, and the significance of increased blood γδ Τ cells often remains elusive. In this study we address these questions based on an index patient with thymoma, chronic visceral leishmaniasis, myasthenia gravis, and a marked increase of rare γδ T cell subsets in the peripheral blood. This patient showed cutaneous anergy, even though he had normal numbers of peripheral blood total lymphocytes as well as CD4(+) and CD8(+) T cells. Despite his chronic infection, analyses of immunophenotypes and spectratyping of his lymphocytes revealed an unusual accumulation of naive γδ and αβ T cells, suggesting a generalized T cell activation defect. Functional studies in vitro demonstrated substantially diminished IL-2 and IFN-γ production following TCR stimulation of his "untouched" naive CD4(+) T cells. Biochemical analysis revealed that his γδ and αβ T cells carried an altered TCR complex with reduced amounts of the ζ-chain (CD247). No mutations were found in the CD247 gene that encodes the homodimeric ζ protein. The diminished presence of CD247 and increased numbers of γδ T cells were also observed in thymocyte populations obtained from three other thymoma patients. Thus, our findings describe a novel type of a clinically relevant acquired T cell immunodeficiency in thymoma patients that is distinct from Good's syndrome. Its characteristics are an accumulation of CD247-deficient, hyporresponsive naive γδ and αβ T cells and an increased susceptibility to infections. Copyright © 2015 by The American Association of Immunologists, Inc.

  6. The energy and monetary implications of the '24/7 'always on' society

    International Nuclear Information System (INIS)

    Loveday, Dennis L.; Bhamra, T.; Tang, T.; Haines, V.J.A.; Holmes, M.J.; Green, R.J.


    This paper reviews the trends in society, technology and energy demand of the past 30 years, together with the growth of the 'on-demand' culture. The '24/7' or 'always on' society can be defined as one where people demand - and generally receive - what they want 'now'. It has grown up in parallel with developments in information technology, which have produced the services needed to meet that demand. Larger numbers of appliances, resulting from greater affluence and disposable income, have increased energy use, despite energy efficiencies in other areas. While monetary factors suggest that changes brought about by the 24/7 society will generally be self-correcting at the macro-economic level, there will nevertheless be effects for individuals, such as potentially severe impacts on the fuel poor as electricity prices rise. We conclude with a view of future directions. As the 24/7 culture continues to grow, there is scope for designers and for information technology to manage and reduce energy consumption. This includes buildings, their services systems, and the mix of new technologies that will be deployed over the next 20 years or so, including the possibilities for data exchange and control at the interface between energy suppliers and consumers, coupled with greater understanding of the behaviour of the consumers themselves. (author)

  7. Extending Pickering Fuel Channel Life to 247,000 EFPH (2020)

    International Nuclear Information System (INIS)

    Malek, I.


    This presentation is about extending the life of PNGS Pressure tubes from 210,000 EFPH (Effective Full Power Hours) to 247,000 EFPH. The l license renewal is in 2013 (R & D defined in 2009). The unknowns are the extent of degradation in some key areas. There are regulatory requirements for fuel channel extended life. It is necessary to integrate inspection capability and do-ability in outages. This would result in safe operation and demonstrated margin to extend life with operation to 2020.

  8. Pro/Con debate: should 24/7 in-house intensivist coverage be implemented? (United States)

    Arabi, Yaseen


    You are appointed director of a new large multi-discipline intensive care unit in an academic center. The hospital is affiliated with a medical school and as such there will be an adequate number of medical students, residents, and fellows (specializing in critical care) rotating through the unit. The unit will be a 'closed' (intensivist-led) model. In setting up the call schedule for the intensivists, you need to decide whether the mandate will be for the intensivists to provide 24/7 in-house coverage as opposed to off-hour coverage from home. You wonder about the sustainability of each model.

  9. The Influence of Cobalt on the Microstructure of the Nickel-Base Superalloy MAR-M247 (United States)

    Nathal, M. V.; Maier, R. D.; Ebert, L. J.


    The influence of cobalt on the microstructure of MAR-M247, a cast nickel-base superalloy, was investigated. Nickel was substituted for Co to produce 0, 5, and the standard 10 pct Co versions of MAR-M247. The microstructures of the alloys were examined using optical and electron microscopy, X-ray diffraction, phase extraction, and differential thermal analysis. Samples were examined in as-cast, heat treated, long-time aged, and stress-rupture tested conditions. As Co was removed from MAR-M247, the γ' volume fraction decreased, the mean γ' particle size increased, the W and Ti concentrations in the γ' increased, the Cr and Al concentrations in the γ phase decreased, and the amount of carbides increased. This increase in carbide precipitation caused a change from discrete grain boundary carbides to a grain boundary film as Co level decreased.

  10. Safe2Tell® : an anonymous, 24/7 reporting system for preventing school violence. (United States)

    Payne, Susan R T; Elliott, Delbert S


    There is widespread agreement that many school shootings could be prevented if authorities were informed that a student was planning or preparing to carry out an attack. A universal problem is that young people are highly reluctant to report on their peers. This code of silence represents a major barrier to prevention efforts. In response to the Columbine shooting, the state of Colorado established the Safe2Tell® anonymous, 24/7 reporting system for receiving and forwarding threats of violence, bullying, and other concerns. This article describes how the program has grown to the point that it now receives more than 100 calls per month. A series of case examples illustrates its success in responding to threatening situations, including twenty-eight potential school attacks. Copyright © 2011 Wiley Periodicals, Inc., A Wiley Company.

  11. Monte-Carlo Geant4 numerical simulation of experiments at 247-MeV proton microscope (United States)

    Kantsyrev, A. V.; Skoblyakov, A. V.; Bogdanov, A. V.; Golubev, A. A.; Shilkin, N. S.; Yuriev, D. S.; Mintsev, V. B.


    A radiographic facility for an investigation of fast dynamic processes with areal density of targets up to 5 g/cm2 is under development on the basis of high-current proton linear accelerator at the Institute for Nuclear Research (Troitsk, Russia). A virtual model of the proton microscope developed in a software toolkit Geant4 is presented in the article. Fullscale Monte-Carlo numerical simulation of static radiographic experiments at energy of a proton beam 247 MeV was performed. The results of simulation of proton radiography experiments with static model of shock-compressed xenon are presented. The results of visualization of copper and polymethyl methacrylate step wedges static targets also described.

  12. [Clinical analysis of 247 children with whooping cough and the risk factors of severe cases]. (United States)

    Hu, Yunge; Liu, Quanbo


    To summarize the clinical characteristics of whooping cough in children and analyze the risk factors for severe whooping cough. A retrospective analysis was made on the clinical data of 247 children with whooping cough in Children's Hospital of Chongqing Medical University between Jan 2013 and Dec 2014. Of these patients, 126 were male, 121 were female, the median age was 3.1 months (23 days-4 years and eight months old). The patients were divided into two groups, group 1 had infants less than 3 months of age (n=120) and group 2 had infants and young children older than 3 months (n=127) according to their age. On the other hand, the patients were also divided into two groups according to vaccination status: vaccinated group (received diphtheria toxoid, tetanus toxoid, and acellular pertussis, DTP) (n=31) and unvaccinated group (n=188). Pure Bordetella pertussis infection was seen in 106 cases, and 141 cases had mixed infection. Severe disease was seen in 13 cases, and the other 234 cases had the modest disease. Clinical data were retrospectively analyzed and compared. (1) Bordetella pertussis was identified in 57/680 cases (8.4%) in 2013, and 190/1 856 cases (10.2%) in 2014. The disease could be seen throughout the year, but 182 cases (73.7%) occurred in summer or autumn; 202 cases (81.8%) were less than 6 months. (2) Paroxysmal cough was seen in 238 cases (96.4%) , 61 cases (24.7%) had inspiratory whoop. Infants in group 1 often had episodes of cyanosis, apnea and suffocation (χ² = 19.999, 12.081, 6.508, Pfall. Infants less than 3 months old, unvaccinated with DTP had high susceptibility to pertussis, often had a severe clinical presentation and severe complications, had a high mortality rate.

  13. Help at 3:00 AM! Providing 24/7 Timely Support to Online Students via a Virtual Assistant (United States)

    Vu, Phu; Fredrickson, Scott; Meyer, Richard


    With a dearth of research on human-robot interaction in education and relatively high non-completion rates of online students, this study was conducted to determine the feasibility of using a virtual assistant (VA) to respond to questions and concerns of students and provide 24/7 online course content support. During a 16 week-long academic…

  14. 17 CFR 247.771 - Exemption from the definition of “broker” for banks effecting transactions in securities issued... (United States)


    ... of âbrokerâ for banks effecting transactions in securities issued pursuant to Regulation S. 247.771...) REGULATION R-EXEMPTIONS AND DEFINITIONS RELATED TO THE EXCEPTIONS FOR BANKS FROM THE DEFINITION OF BROKER... issued pursuant to Regulation S. (a) A bank is exempt from the definition of the term “broker” under...

  15. 17 CFR 247.700 - Defined terms relating to the networking exception from the definition of “broker.” (United States)


    ... overall profitability or revenue of: (i) The bank, either on a stand-alone or consolidated basis; (ii) Any... THE EXCEPTIONS FOR BANKS FROM THE DEFINITION OF BROKER § 247.700 Defined terms relating to the... by the bank or broker or dealer for customer referrals, including such criteria as minimum assets...

  16. 40 CFR 174.524 - Glyphosate Oxidoreductase GOX or GOXv247 in all plants; exemption from the requirement of a... (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Glyphosate Oxidoreductase GOX or... REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.524 Glyphosate... Glyphosate Oxidoreductase GOX or GOXv247 enzyme in all plants are exempt from the requirement of a tolerance...

  17. Phosphorylation of HOX11/TLX1 on Threonine-247 during mitosis modulates expression of cyclin B1

    Directory of Open Access Journals (Sweden)

    Chesney Alden


    Full Text Available Abstract Background The HOX11/TLX1 (hereafter referred to as HOX11 homeobox gene was originally identified at a t(10;14(q24;q11 translocation breakpoint, a chromosomal abnormality observed in 5-7% of T cell acute lymphoblastic leukemias (T-ALLs. We previously reported a predisposition to aberrant spindle assembly checkpoint arrest and heightened incidences of chromosome missegregation in HOX11-overexpressing B lymphocytes following exposure to spindle poisons. The purpose of the current study was to evaluate cell cycle specific expression of HOX11. Results Cell cycle specific expression studies revealed a phosphorylated form of HOX11 detectable only in the mitotic fraction of cells after treatment with inhibitors to arrest cells at different stages of the cell cycle. Mutational analyses revealed phosphorylation on threonine-247 (Thr247, a conserved amino acid that defines the HOX11 gene family and is integral for the association with DNA binding elements. The effect of HOX11 phosphorylation on its ability to modulate expression of the downstream target, cyclin B1, was tested. A HOX11 mutant in which Thr247 was substituted with glutamic acid (HOX11 T247E, thereby mimicking a constitutively phosphorylated HOX11 isoform, was unable to bind the cyclin B1 promoter or enhance levels of the cyclin B1 protein. Expression of the wildtype HOX11 was associated with accelerated progression through the G2/M phase of the cell cycle, impaired synchronization in prometaphase and reduced apoptosis whereas expression of the HOX11 T247E mutant restored cell cycle kinetics, the spindle checkpoint and apoptosis. Conclusions Our results demonstrate that the transcriptional activity of HOX11 is regulated by phosphorylation of Thr247 in a cell cycle-specific manner and that this phosphorylation modulates the expression of the target gene, cyclin B1. Since it is likely that Thr247 phosphorylation regulates DNA binding activity to multiple HOX11 target sequences, it is

  18. 32 CFR Appendix C to Part 247 - Mailing of DoD Newspapers, Magazines, CE Guides, and Installation Maps; Sales and Distribution of... (United States)


    ..., and Installation Maps; Sales and Distribution of Non-DoD Publications C Appendix C to Part 247... Appendix C to Part 247—Mailing of DoD Newspapers, Magazines, CE Guides, and Installation Maps; Sales and.... Government Agencies, Members of Congress, libraries, hospitals, schools, and depositories. f. Mailing of an...

  19. Creep-Fatigue Cracking Near the Welded Interface in Friction Welding Dissimilar Superalloys INCONEL 718 and MAR-M247 (United States)

    Tra, Tran Hung; Okazaki, Masakazu


    A forged INCONEL 718 and a cast MAR-M247 alloy were joined by a friction welding process. The creep-fatigue strength of this joint was investigated. The life of the joint was significantly shorter than that of the base alloys. The joint failed near the interface of the INCONEL 718 side, although the life of INCONEL 718 was longer than that of MAR-M247. To understand this behavior, the stress field in the welding was numerically analyzed using a visco-elastic model. The results suggested that triaxiality in the stress state could be promoted near the welded interface and lead to an acceleration of creep-fatigue crack nucleation.

  20. LCF- and LCF/HCF-behaviour of the superalloy MAR-M247LC

    Energy Technology Data Exchange (ETDEWEB)

    Gelmedin, Domnin; Lang, Karl-Heinz [Karlsruhe Institute of Technology (KIT), Karlsruhe (Germany). Inst. fuer Werkstoffkunde I


    The fatigue behaviour of the Nickel-base superalloy Mar-M247LC was investigated at 650 C in air environment under total strain control. Pure low cycle fatigue (LCF) loading, pure high cycle fatigue (HCF) loading and superimposed LCF/HCF loading were realised. In LCF tests with a strain ratio of zero and a hold time of 60 seconds the cyclic deformation and the lifetime behaviour was investigated. The dependence of the fatigue limit on the mean strain was estimated in HCF tests at a frequency of 60 Hz using an ultimate number of cycles of ten million. Finally the influence of superimposed HCF and LCF loadings was examined. At high total strain ranges of the HCF loading the lifetime of the superalloy as reduced about more than one magnitude compared to the lifetime under pure LCF loading. With decreasing HCF loadings the reduction of the lifetime decreases. This life time reduction can be explained by the interaction of the LCF and the superimposed HCF loading. Crack initiation and first crack propagation is predominantly induced by the LCF loading. After reaching an adequate long fatigue crack length the superimposed HCF loading contributes considerably to the crack growth. This contribution can be determined evaluating the distance between the LCF marking lines which form on the fracture surface. The higher the superimposed HCF loading was the longer the distance between the LCF marking lines and the lower the crack length were when first LCF marking lines could be recognized. On the basis of this cognition the life time under superimposed LCF/HCF loading was modelled using a model basing on fracture mechanics. (orig.)

  1. Prediction of maximum casting defect size in MAR-M-247 alloy processed by hot isostatic pressing

    Czech Academy of Sciences Publication Activity Database

    Šmíd, Miroslav; Fintová, Stanislava; Kunz, Ludvík; Hutař, Pavel; Hrbáček, K.


    Roč. 22, č. 1 (2015), s. 25-32 ISSN 1335-0803 R&D Projects: GA MPO FR-TI4/030; GA MŠk(CZ) EE2.3.20.0214 Institutional support: RVO:68081723 Keywords : MAR-M 247 * Superalloys * Fatigue * Casting defects * Elevated temperatures Subject RIV: JL - Materials Fatigue, Friction Mechanics

  2. P247 and p523: two in vivo-expressed megalocytivirus proteins that induce protective immunity and are essential to viral infection.

    Directory of Open Access Journals (Sweden)

    Jian Zhang

    Full Text Available Megalocytivirus is a DNA virus with a broad host range among teleost fish. Although the complete genome sequences of a number of megalocytivirus isolates have been reported, the functions of most of the genes of this virus are unknown. In this study, we selected two megalocytivirus immunogens, P247 and P523, which were expressed during host infection and, when in the form of DNA vaccines (pCN247 and pCN523 respectively, elicited strong protectivity against lethal megalocytivirus challenge in a turbot (Scophthalmus maximus model. Compared to control fish, fish vaccinated with pCN247 and pCN523 exhibited drastically reduced viral loads in tissues and high levels of survival rates. Immune response analysis showed that pCN247 and pCN523 (i induced production of specific serum antibodies, (ii caused generation of cytotoxic immune cells and specific memory immune cells that responded to secondary antigen stimulation, and (iii upregulated the expression of genes involved in innate and adaptive immunity. To examine the potential role of P247 and P523 in viral infection, the expression of P247 and P523 was knocked down by siRNA. Subsequent in vivo infection study showed that P247 and P523 knockdown significantly impaired viral replication. Furthermore, whole-genome transcriptome analysis revealed that P247 and P523 knockdown altered the expression profiles of 26 and 41 viral genes, respectively, putatively participating in diverse aspects of viral infection. Taken together, these results indicate that P247 and P523 induce protective immunity in teleost and play fundamental roles essential to viral replication. These observations provide the first evidence that suggests a likely link between the protectivity of viral immunogens and their biological significance in viral replication.

  3. P247 and p523: two in vivo-expressed megalocytivirus proteins that induce protective immunity and are essential to viral infection. (United States)

    Zhang, Jian; Zhang, Bao Cun; Sun, Li


    Megalocytivirus is a DNA virus with a broad host range among teleost fish. Although the complete genome sequences of a number of megalocytivirus isolates have been reported, the functions of most of the genes of this virus are unknown. In this study, we selected two megalocytivirus immunogens, P247 and P523, which were expressed during host infection and, when in the form of DNA vaccines (pCN247 and pCN523 respectively), elicited strong protectivity against lethal megalocytivirus challenge in a turbot (Scophthalmus maximus) model. Compared to control fish, fish vaccinated with pCN247 and pCN523 exhibited drastically reduced viral loads in tissues and high levels of survival rates. Immune response analysis showed that pCN247 and pCN523 (i) induced production of specific serum antibodies, (ii) caused generation of cytotoxic immune cells and specific memory immune cells that responded to secondary antigen stimulation, and (iii) upregulated the expression of genes involved in innate and adaptive immunity. To examine the potential role of P247 and P523 in viral infection, the expression of P247 and P523 was knocked down by siRNA. Subsequent in vivo infection study showed that P247 and P523 knockdown significantly impaired viral replication. Furthermore, whole-genome transcriptome analysis revealed that P247 and P523 knockdown altered the expression profiles of 26 and 41 viral genes, respectively, putatively participating in diverse aspects of viral infection. Taken together, these results indicate that P247 and P523 induce protective immunity in teleost and play fundamental roles essential to viral replication. These observations provide the first evidence that suggests a likely link between the protectivity of viral immunogens and their biological significance in viral replication.

  4. Impact of Surface and Volume Modification of Nickel Superalloys IN-713C and MAR-247 on High Temperature Creep Resistance

    Directory of Open Access Journals (Sweden)

    Cieśla M.


    Full Text Available Impact of surface and volume modification and double filtration during pouring the moulds on basic mechanical properties and creep resistance of nickel superalloys IN-713C and MAR-247 in conditions of accelerated creep of castings made of post-production scrap of these alloys is evaluated in this paper. The conditions of initiation and propagation of cracks in the specimens were analysed with consideration of stereological properties of material macro- and microstructure. It has been proven that in the conditions of hightemperature creep at 980°C and at stress σ = 150 MPa, creep resistance of superalloy MAR-247 is more than 10 times higher than the creep resistance of IN-713C alloy. In case of IN-713C alloy, the creep resistance negligibly depends on macrograin sizes. But, the macrograin size considerably affects the time to failure of specimens made of alloy MAR-247. Creep resistance of specimens made of coarse grain material was 20% higher than the resistance of fine grain materials.

  5. 24/7 Solar Minimum Polar Cap and Auroral Ion Temperature Observations (United States)

    Sojka, Jan J.; Nicolls, Michael; van Eyken, Anthony; Heinselman, Craig; Bilitza, Dieter


    During the International Polar Year (IPY) two Incoherent Scatter Radars (ISRs) achieved close to 24/7 continuous observations. This presentation describes their data sets and specifically how they can provide the International Reference Ionosphere (IRI) a fiduciary E- and F-region ionosphere description for solar minimum conditions in both the auroral and polar cap regions. The ionospheric description being electron density, ion temperature and electron temperature profiles from as low as 90 km extending to several scale heights above the F-layer peak. The auroral location is Poker Flat in Alaska at 65.1 N latitude, 212.5 E longitude where the NSF s new Poker Flat Incoherent Scatter Radar (PFISR) is located. This location during solar minimum conditions is in the auroral region for most of the day but is at midlatitudes, equator ward of the cusp, for about 4-8 h per day dependent upon geomagnetic activity. In contrast the polar location is Svalbard, at 78.2 N latitude, 16.0 E longitude where the EISCAT Svalbard Radar (ESR) is located. For most of the day the ESR is in the Northern Polar Cap with a noon sector passage often through the dayside cusp. Of unique relevance to IRI is that these extended observations have enabled the ionospheric morphology to be distinguished between quiet and disturbed geomagnetic conditions. During the IPY year, 1 March 2007 - 29 February 2008, about 50 solar wind Corotating Interaction Regions (CIRs) impacted geospace. Each CIR has a two to five day geomagnetic disturbance that is observed in the ESR and PFISR observations. Hence, this data set also enables the quiet-background ionospheric climatology to be established as a function of season and local time. These two separate climatologies for the ion temperature at an altitude of 300 km are presented and compared with IRI ion temperatures. The IRI ion temperatures are about 200-300 K hotter than the observed values. However, the MSIS neutral temperature at 300 km compares favorably

  6. Performance Characteristics of Automotive Engines in the United States : First Series - Report No. 12 - 1975 Perkins Diesel 247 CID (4.0 Liters) (United States)


    Experimental data were obtained in dynamometer tests of a 1975 Perkins 247-CID diesel engine to determine fuel consumption and emissions (hydrocarbon, carbon monoxide, oxides of nitrogen) at steady-state engine-operating modes. The objective of the p...

  7. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner


    . In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites......The Cd247 gene encodes for a transmembrane protein important for the expression and assembly of TCR/CD3 complex on the surface of T lymphocytes. Down-regulation of CD247 has functional consequences in systemic autoimmunity and has been shown to be associated with Type 1 Diabetes in NOD mouse......, supported by histone marks and ChIP-seq data, that specifically have features of an enhancer and a promoter, respectively. We also identified a putative long non-coding RNA from the characteristically long first intron of the Cd247 gene. The long non-coding RNA annotation is supported by manual annotations...

  8. 17 CFR 247.781 - Exemption from the definition of “broker” for banks for a limited period of time. (United States)


    ... “broker” for banks for a limited period of time. A bank is exempt from the definition of the term “broker... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Exemption from the definition of âbrokerâ for banks for a limited period of time. 247.781 Section 247.781 Commodity and Securities...

  9. Development and Evaluation of an Enzyme-Linked Immunosorbent Assay for Plasmodium vivax-VK247 Sporozoites (United States)


    phosphate-buffered saline (PBS), pH initial evaluation of an ELISA for the P. vivax- 7.4. Glands were ground gently with a pestle VK247 CS protein in...Department of Entomology. U.S. Army Medical Compo- land were diluted to 1.600 sporozoites per 50 Al nent. 315-16 Raiavithi Rd., Bangkok. Thailand . o0.5...Absorbance from mosquitoes fed on patients in Kanchanaburi (405 nm) values were recorded after 1 h with anl or Ratchaburi provinces, in western Thailand ELISA

  10. Development of a Plasmodium berghei transgenic parasite expressing the full-length Plasmodium vivax circumsporozoite VK247 protein for testing vaccine efficacy in a murine model. (United States)

    Mizutani, Masanori; Fukumoto, Shinya; Soubeiga, Adam Patrice; Soga, Akira; Iyori, Mitsuhiro; Yoshida, Shigeto


    The approach of using transgenic rodent malaria parasites to assess the immune system's response to antigenic targets from a human malaria parasite has been shown to be useful for preclinical evaluation of new vaccine formulations. The transgenic Plasmodium berghei parasite line [PvCSP(VK210)/Pb] generated previously expresses the full-length circumsporozoite protein (CSP) VK210 from Plasmodium vivax. The transgenic parasite expresses one of the two most common alleles of CSP, defined by nine amino acids at the central repeat region of this protein. In the present study, a transgenic P. berghei parasite line [PvCSP(VK247)/Pb] expressing the full-length PvCSP(VK247), which is the alternative common allele, was generated and characterized. The P. berghei expressing full-length PvCSP(VK247) was generated and examined its applicability to CSP-based vaccine research by examining its biological characteristics in mosquitoes and mice. Similar to PvCSP(VK210)/Pb, PvCSP(VK247)/Pb developed normally in mosquitoes and produced infectious sporozoites equipped to generate patent infections in mice. Invasion of HepG2 cells by PvCSP(VK247)/Pb sporozoites was inhibited by an anti-PvCSP(VK247) repeat monoclonal antibody (mAb), but not by an anti-PvCSP(VK210) repeat mAb. These two transgenic parasites thus far can be used to evaluate the potential efficacy of PvCSP-based vaccine candidates encompassing the two major genetic variants in preclinical trials.

  11. The influence of cobalt on the microstructure of the nickel-base superalloy MAR-M247 (United States)

    Nathal, M. V.; Maier, R. D.; Ebert, L. J.


    Nickel was substituted for Co to produce 0, 5, and the standard 10% versions of MAR-M247, a cast nickel-base superalloy. The microstructures of the alloys were examined in as-cast, heat treated, aged, and stress-rupture tested conditions using a variety of metallographic techniques and differential thermal analysis. As cobalt concentration was reduced from 10 to 0 wt %, the gamma-prime weight fraction decreased from 59 to 41%; W and Ti concentrations in the gamma-prime phase increased from 5 to 8 and 2 to 3 at.%, respectively; the mean gamma-prime particle size increased from 0.6 to 0.8 micron; Cr and Al concentrations in the gamma matrix decreased from 17 to 13 and 15 to 12 at.%, respectively; and the weight fraction of carbides increased by approximately 1%.

  12. Failure behaviour of the superalloy MAR-M247 LC under LCF, HCF and combined LCF/HCF loading

    Energy Technology Data Exchange (ETDEWEB)

    Gelmedin, Domnin; Lang, Karl-Heinz [Karlsruher Institut fuer Technologie (KIT), Karlsruhe (DE). Inst. fuer Angewandte Materialien (IAM-WK)


    Materials for turbine blades experience in service a combined loading of low and high cycle fatigue at high temperatures. In order to understand the failure behaviour under these loading conditions, systematic investigations were carried out. Low cycle fatigue, high cycle fatigue and combined low and high cycle fatigue tests were realised on MAR-M247 LC at 650 C in an air environment under total strain control. Surface damage and fracture surfaces were analysed. Under combined low and high cycle fatigue, the lifetime is reduced if the low cycle fatigue leads to a degradation of the high cycle fatigue strength caused by crack initiation and crack growth. By analysing the fracture surface, the crack growth rate under combined cycle fatigue loading could be determined and it was significantly higher than under pure low cycle fatigue loading. The accelerated crack growth mainly causes the lifetime reduction. (orig.)

  13. Effect of Process Variables on the Inertia Friction Welding of Superalloys LSHR and Mar-M247 (United States)

    Mahaffey, D. W.; Senkov, O. N.; Shivpuri, R.; Semiatin, S. L.


    The effect of inertia friction welding process parameters on microstructure evolution, weld plane quality, and the tensile behavior of welds between dissimilar nickel-base superalloys was established. For this purpose, the fine-grain, powder metallurgy alloy LSHR was joined to coarse-grain cast Mar-M247 using a fixed level of initial kinetic energy, but different combinations of the flywheel moment of inertia and initial rotation speed. It was found that welds made with the largest moment of inertia resulted in a sound bond with the best microstructure and room-temperature tensile strength equal to or greater than that of the parent materials. A relationship between the moment of inertia and weld process efficiency was established. The post-weld tensile behavior was interpreted in the context of observed microstructure gradients and weld-line defects.

  14. Development of a logic model to support a network approach in delivering 24/7 children's palliative care: part two. (United States)

    Maynard, Linda; Lynn, Deborah


    This is the second of a two-part article that discusses a research project that aimed to develop and evaluate a 24/7 symptom-management service for children with palliative care needs and a nursing logic model to enable a novel service approach to be generalised and replicated. Findings demonstrated that the service standards were met and exceeded expectations. Families valued the role, which enabled choice in location of care and perceived the service as a 'lifeline'. Team composition with the right level of specialist and advanced nursing skills, anticipating symptom-management planning, clinical supervision and funded on-call processes were key success criteria. The nursing logic model demonstrated relationships between context investments into the service and outcomes for children and families.

  15. SlamZ: Slide activity on the Hikurangi margin, New Zealand - First results of the RV Sonne expedition SO247 (United States)

    Huhn, Katrin; Kukowski, Nina; Freudenthal, Tim; Crutchley, Gareth; Goepel, Andreas; Henrys, Stuart; Kasten, Sabine; Kaul, Norbert; Kuhlmann, Jannis; Mountjoy, Joshu; Orpin, Alan; Pape, Thomas; Schwarze, Cornelius; Totsche, Kai-Uwe; Torres, Marta; Villinger, Heiner


    Submarine landslides are important geologic hazards. Although they have been the focus of research for decades, there is still a clear lack in knowledge with respect to the interplay between tectonic movements, slope architecture and sediment physical properties of slope strata, as well as gas hydrate dissociation as controlling factors of slope stability or respectively slope failure processes. The main scientific goal of the Sonne expedition SO247 undertaken in spring 2016 was to gain a better understanding of the factors controlling slope destabilization, especially the interaction of tectonic steepening and gas hydrate transformation, at different tectonic settings along the Hikurangi subduction zone east of New Zealand's North Island. This active continental margin is characterized by various potential triggers for slope failure, e.g. (I) a wide range of tectonic movements which are associated with high seismicity, numerous active faults, sediment uplift and slope over-steepening, and (II) large gas hydrate deposits whose current upper stability limit in some places correlates with the breakoff points of slides. The target areas of SO247 were the frontal accretionary ridge at Rock Garden and the Tuaheni landslide complex (TLC) further north offshore Gisborne. Bathymetric as well as high-resolution seismic reflection and Parasound data were used to select suitable position for 53 gravity cores with a total length of 150 m which were recovered along systematic transects from the undisturbed slope sections to the slid masses in both working areas. In addition, six long sediment cores (three in both working areas) with a total length of approx. 470 m were drilled utilizing the MARUM Bremen drill rig MeBo200. These include a 105 m long continuous sediment core (core recovery > 95%) from an undisturbed slope section in the vicinity of the Tuaheni slide complex. This core represented the first long (i.e. longer than 50 m) sediment record from the Hikurangi margin

  16. Expression of the benign HEXA mutations, Arg247Trp and Arg249Trp, associated with beta-hexosaminidase A pseudodeficiency

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Z.; Petroulakis, E.; Salo, T. [Univ. of Manitoba (Canada)] [and others


    {beta}-Hexosaminidase (Hex A) is a heterodimer of {alpha} and {beta} subunits encoded by the HEXA and HEXB genes, respectively. Mutations in the HEXA gene typically cause Tay-Sachs disease or less severe forms of G{sub M2} gangliosidosis. However, two benign mutations (Arg247Trp and Arg249Trp) in the {alpha}-subunit of Hex A account for Hex A deficiency in {approximately}36% of non-Jewish enzyme-defined Tay-Sachs disease carriers. These mutations do not result in any apparent clinical phenotype in individuals who are genetic compounds with a second disease-causing mutation. We expressed the {alpha}-subunit harboring each of the benign mutations separately to study activity toward the synthetic substrate, 4-MUGS, for comparison to activity from enzymes containing mutations associated with other forms of G{sub M2} gangliosidosis. The C739T (Arg247Trp;benign), C745T (Arg 249Trp; benign), G805A (Gly269Ser; adult-onset), G749A (Gly250Asp; juvenile), and C508T (Arg170Trp; infantile) mutations were introduced into the {alpha}-subunit cDNA. These were transfected alone, or with the {beta}-subunit cDNA, to generate Hex S ({alpha}{alpha}) or Hex A ({alpha}{beta}), respectively. The activities were monitored using 4-MUGS, and the levels of {alpha}-subunit protein were assessed by Western blotting. Repeated experiments show that the benign mutations produce approximately 35% of normal Hex S and 40% of normal Hex A activity. This level is much higher than that of Hex A harbouring the Gly169Ser adult-onset mutation (12%). A sequential decrease in expressed Hex A activity is observed as mutations associated with more severe phenotypes are expressed. The benign mutations also result in lower levels of mature {alpha}-subunit protein compared to normal, and slightly reduced levels of {alpha}-subunit precursor protein. The Hex A deficiency resulting from benign mutations is not as great as that associated with disease-causing mutations.

  17. Grainex Mar-M 247 Turbine Disk Life Study for NASA's High Temperature High Speed Turbine Seal Test Facility (United States)

    Delgado, Irebert R.


    An experimental and analytical fatigue life study was performed on the Grainex Mar-M 247 disk used in NASA s Turbine Seal Test Facility. To preclude fatigue cracks from growing to critical size in the NASA disk bolt holes due to cyclic loading at severe test conditions, a retirement-for-cause methodology was adopted to detect and monitor cracks within the bolt holes using eddy-current inspection. For the NASA disk material that was tested, the fatigue strain-life to crack initiation at a total strain of 0.5 percent, a minimum to maximum strain ratio of 0, and a bolt hole temperature of 649 C was calculated to be 665 cycles using -99.95 percent prediction intervals. The fatigue crack propagation life was calculated to be 367 cycles after implementing a safety factor of 2 on life. Thus, the NASA disk bolt hole total life or retirement life was determined to be 1032 cycles at a crack depth of 0.501 mm. An initial NASA disk bolt hole inspection at 665 cycles is suggested with 50 cycle inspection intervals thereafter to monitor fatigue crack growth.

  18. Radiometallurgical examination of 1.47 enriched I&E fuel elements for PT-IP-247-A

    Energy Technology Data Exchange (ETDEWEB)

    Teats, R.


    Under the conditions of PT-IP-247-A, four columns of self-supported and four columns of rib-supported I&E 1.47% enriched fuel elements were irradiated to determine their relative performance under severe operating conditions. Four of the self-supported and two of the rib-supported control elements were received for nation. The two rib-supported control pieces, which were classified as ``near failures`` had received average exposures of 353 and 359 MWD/T at average specific power levels of 91 and 108 KW/ft before they were discharged because of other ruptured pieces in the tubes. The nominal specified canned fuel dimensions of the rib supported elements was 1.445 in. OD, .310 in bore, and 7.640 in. long. The first two self-supported elements were selected for examination on the basis of high weight losses sustained during irradiation, and the second two were selected to determine the effect of specific power levels on the AlSi bonding. The average specific power levels of the four self-supported elements varied from 79 to 110 KW/ft and the exposure varied from 845 MWD/T to 949 MWD/T. The nominal canned dimensions of the self-supported elements, which were made oversize to attain high annular coolant temperatures with respect to the interior coolant channel, were 1.460 in. OD, .375 in. bore, and 7.640 in. long. The eight bridge rail supports were spot welded on and gave an effective rib outside diameter of 1.600 in. All of the components were X-8001 aluminum alloy.

  19. HPLC MS/MS method for quantification of meprobamate in human plasma: application to 24/7 clinical toxicology. (United States)

    Delavenne, Xavier; Gay-Montchamp, Jean Pierre; Basset, Thierry


    We described the development and full validation of rapid and accurate liquid chromatography method, coupled with tandem mass spectrometry detection, for quantification of meprobamate in human plasma with [(13)C-(2)H(3)]-meprobamate as internal standard. Plasma pretreatment involved a one-step protein precipitation with acetonitrile. Separation was performed by reversed-phase chromatography on a Luna MercuryMS C18 (20 mm×4 mm×3 μm) column using a gradient elution mode. The mobile phase was a mix of distilled water containing 0.1% formic acid and acetonitrile containing 0.1% formic acid. The selected reaction monitoring transitions, in electrospray positive ionization, used for quantification were 219.2→158.2 m/z and 223.1→161.1m/z for meprobamate and internal standard, respectively. Qualification transitions were 219.2→97.0 and 223.1→101.1 m/z for meprobamate and internal standard, respectively. The method was linear over the concentration range of 1-300 mg/L. The intra- and inter-day precision values were below 6.4% and accuracy was within 95.3% and 103.6% for all QC levels (5, 75 and 200 mg/L). The lower limit of quantification was 1 mg/L. Total analysis time was reduced to 6 min including sample preparation. The present method is successfully applied to 24/7 clinical toxicology and demonstrated its usefulness to detect meprobamate poisoning. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. The influence of cobalt on the tensile and stress-rupture properties of the nickel-base superalloy mar-m247 (United States)

    Nathal, M. V.; Maier, R. D.; Ebert, L. J.


    The influence of cobalt on the mechanical properties of MAR-M247, a cast nickel-base superalloy, was investigated. Nickel was substituted for cobalt to produce 0, 5, and the standard 10 pct cobalt versions of MAR-M247. Tensile tests were performed between 649 and 982 dgC; stress-rupture tests were conducted at temperatures ranging from 760 to 982 dgC. The tensile properties were not significantly affected by cobalt level, but a slight peak in strength at 5 pct Co was apparent. A -80 °C shift in the peak yield strength temperature as Co level was reduced from 10 to 0 pct was also evident. This behavior was related to a reduction in the γ' volume fraction, an increase in γ' particle size, an increase in W and Ti concentrations in the γ', and a decrease in Cr and Al concentrations in the γ as Co level in MAR-M247 was reduced. Stress-rupture properties, however, were more significantly affected by Co level. The 10 pct Co alloy exhibited rupture lives typically 1.2 times greater than that of the 5 pct Co alloy and 3 times greater than that of the 0 pct Co alloy. The steady state creep rate of the 10 pct Co alloy was generally equal to that of the 5 pct Co alloy, but was only one third as large as the creep rate of the 0 pct Co alloy. This behavior was associated with a decrease in γ' volume fraction and the formation of a grain boundary carbide film as cobalt level was reduced.

  1. Methyl-3,4-dihydroxybenzoate and 9-10-dihydrophenanthrene-2,4,7-triol two phenolic compounds from Dioscorea alata L. and their antioxidant activity (United States)

    Aminah, N. S.; Yulvia, A.; Tanjung, M.


    Two phenolic compounds namely: methyl-3,4-dihydroxybenzoate (1) and 9,10-dihydrophenanthrene-2,4,7-triol (2) had been isolated for the first time from the tuber of Dioscorea alata L. The extraction of two compounds were done by maceration method using methanol as solvent, followed by partition with n-hexane and ethyl acetate. The ethyl acetate extract was separated and purified using various chromatographic techniques yielded pure compounds. The structure of isolated compounds were determined based on spectroscopic data, including UV-Vis, 1D and 2D NMR spectra. Compounds (1), (2) and ascorbic acid as a comparator were evaluated for their antioxidant properties against DPPH, showing their IC50 were 9,41 ± 0,08; 23,52 ± 0,05; and 10,95 ± 0,08 ppm, respectively.

  2. Val/Leu247 and Trp/Ser316 polymorphisms in beta 2 glycoprotein I and their association with thrombosis in unselected Chilean patients. (United States)

    Palomo, Iván; Pereira, Jaime; Alarcón, Marcelo; Vásquez, Marcela; Pinochet, Carmen; Poblete, Fernando; Mendez, Evelyn; Sandoval, Jeannette; Vidal, Rolando; Pierangeli, Silvia


    It is known that polymorphisms of beta (2)-glycoprotein I (beta (2)GPI) in exon 7 affect interaction between the phospholipid binding site and the antibodies, and that other polymorphisms in exon 8 increase the generation of antibodies. In this study, we analyzed genetic polymorphisms of beta (2)GPI in unselected Chilean patients to determine the prevalence of beta (2)GPI polymorphisms in the phospholipid domain in patients with venous and arterial thrombosis and the clinical correlation with thromboembolic complications. This study comprised 149 patients with venous and arterial thrombosis (62 with venous thrombosis and 87 with arterial thrombosis) and 160 healthy controls with no previous history of thrombosis. Polymorphisms of exons 7 and 8 of beta (2)GPI, which encode for its fifth domain, were determined by PCR-RFLP. The presence of aPL or anti-beta (2)GPI in the patients was detected by ELISA. Anti-beta (2)GPI were present in 8/149 patients (5.4%); of these, five had aCL antibodies of low titer. The allele containing Val/Leu(247) and Trp/Ser(316) was significantly more frequent in patients with thrombosis than in the control group (OR=3.1, CI 1.6-6.0, p=0.0003; OR=2.9, CI 1.1-8.6, p=0.027, respectively). These polymorphisms did not correlate with aPL or anti-beta (2)GPI but significant differences were observed with venous thrombosis (p=<0.0001) and arterial thrombosis (p=0.026). In conclusion, the beta (2)GPI polymorphisms Val/Leu(247) and Trp/Ser(316) are not related to the presence of anti-beta (2)GPI antibodies in unselected Chilean patients with venous and arterial thrombosis, but they are significantly associated with venous and arterial thrombosis.

  3. The effects of tantalum on the microstructure of two polycrystalline nickel-base superalloys: B-1900 + Hf and MAR-M247 (United States)

    Janowski, G. M.; Heckel, R. W.; Pletka, B. J.


    Changes in the γ/γ'/carbide microstructure as a function of Ta content were studied in conventionally cast B-1900 + Hf and both conventionally cast and directionally solidified MAR-M247.* The effects of tantalum on the microstructure were found to be similar in both nickel-base superalloys. In particular, the γ' and carbide volume fractions increased approximately linearly with tantalum additions in both alloys. The γ' phase compositions did not change as tantalum additions were made with the exception of an increase in the tantalum level. Bulk tantalum additions increased the tantalum, chromium, and cobalt levels of the γ phase in both alloy series. The increase in the concentrations of the latter two elements was attributed to a decrease in the γ phase fraction with increasing bulk tantalum level and nearly constant γ' /γ partitioning ratios. It was demonstrated that the large increase in the γ ' volume fraction was a result of tantalum not affecting the partitioning ratios of the other alloying elements. The addition of tantalum led to a partial replacement of the hafnium in the MC carbides, although the degree of replacement was reduced by the solutionizing and aging heat treat-ment. In addition, chromium-rich M23C6 carbides formed as a result of MC carbide decomposition during heat treatment.

  4. Structural Benchmark Creep Testing for Microcast MarM-247 Advanced Stirling Convertor E2 Heater Head Test Article SN18 (United States)

    Krause, David L.; Brewer, Ethan J.; Pawlik, Ralph


    This report provides test methodology details and qualitative results for the first structural benchmark creep test of an Advanced Stirling Convertor (ASC) heater head of ASC-E2 design heritage. The test article was recovered from a flight-like Microcast MarM-247 heater head specimen previously used in helium permeability testing. The test article was utilized for benchmark creep test rig preparation, wall thickness and diametral laser scan hardware metrological developments, and induction heater custom coil experiments. In addition, a benchmark creep test was performed, terminated after one week when through-thickness cracks propagated at thermocouple weld locations. Following this, it was used to develop a unique temperature measurement methodology using contact thermocouples, thereby enabling future benchmark testing to be performed without the use of conventional welded thermocouples, proven problematic for the alloy. This report includes an overview of heater head structural benchmark creep testing, the origin of this particular test article, test configuration developments accomplished using the test article, creep predictions for its benchmark creep test, qualitative structural benchmark creep test results, and a short summary.

  5. Hydra—The National Earthquake Information Center’s 24/7 seismic monitoring, analysis, catalog production, quality analysis, and special studies tool suite (United States)

    Patton, John M.; Guy, Michelle R.; Benz, Harley M.; Buland, Raymond P.; Erickson, Brian K.; Kragness, David S.


    This report provides an overview of the capabilities and design of Hydra, the global seismic monitoring and analysis system used for earthquake response and catalog production at the U.S. Geological Survey National Earthquake Information Center (NEIC). Hydra supports the NEIC’s worldwide earthquake monitoring mission in areas such as seismic event detection, seismic data insertion and storage, seismic data processing and analysis, and seismic data output.The Hydra system automatically identifies seismic phase arrival times and detects the occurrence of earthquakes in near-real time. The system integrates and inserts parametric and waveform seismic data into discrete events in a database for analysis. Hydra computes seismic event parameters, including locations, multiple magnitudes, moment tensors, and depth estimates. Hydra supports the NEIC’s 24/7 analyst staff with a suite of seismic analysis graphical user interfaces.In addition to the NEIC’s monitoring needs, the system supports the processing of aftershock and temporary deployment data, and supports the NEIC’s quality assurance procedures. The Hydra system continues to be developed to expand its seismic analysis and monitoring capabilities.

  6. Survey of in-house coverage by pediatric intensivists: characterization of 24/7 in-hospital pediatric critical care faculty coverage*. (United States)

    Rehder, Kyle J; Cheifetz, Ira M; Markovitz, Barry P; Turner, David A


    To characterize the current state of 24/7 in-hospital pediatric intensivist coverage in academic PICUs, including perceptions of faculty and trainees regarding the advantages and disadvantages of in-hospital coverage. Cross-sectional observational study via web-based survey. PICUs at North American academic institutions. Pediatric intensivists, pediatric critical care fellows, and pediatric residents. None. A total of 1,323 responses were received representing a center response rate of 74% (147 of 200). Ninety percent of respondents stated that in-hospital coverage is good for patient care, and 85% stated that in-hospital coverage provides safer care. Sixty-three percent of intensivists stated that working in in-hospital models limits academic productivity, and 65% stated that in-hospital models interfere with nonclinical responsibilities. When compared with intensivists in home coverage models, intensivists working in in-hospital models generally had more favorable perceptions of the effects of in-hospital on patient care (p working in in-hospital models increases burnout risk, burnout scores were not different between coverage models. Seventy-nine percent of intensivists currently working at institutions with in-hospital coverage stated that they would prefer to work in an in-hospital coverage model, compared with 31% of those working in a home coverage model (p work at an institution with in-hospital coverage. Further research is needed to objectively delineate the effects of in-hospital coverage on both patients and faculty.

  7. Did CDM particles of mass 2.47 x 10(-3) eV interact with precursor biopolymers and nucleic acids to initiate and boost lifeforms on Earth? (United States)

    Rosen, Gerald


    Recent observations and theoretical studies have shown that non-baryonic Cold Dark Matter (CDM), which constitutes about 84% of all matter in the Universe, may feature a complex-scalar-field that carries particles of mass ≅ 2.47 x 10(-3)eV with the associated Compton range m(-1) ≅8.02 x 10(-3) cm, a distance on the scale of extended bionucleic acids and living cells. Such a complex-scalar-field can enter a weak-isospin Lorentz-invariant interaction that generates the flow of right-handed electrons and induces a chirality-imbued quantum chemistry on the m (-1) scale. A phenomenological Volterra-type equation is proposed for the CDM-impacted time development of N, the number of base pairs in the most advanced organism at Earth-age t. The solution to this equation suggests that the boosts in N at t ≅ 1.1 Gyr (advent of the first living prokaryotic cells), at t ≅ 2.9 Gyr (advent of eukaryotic single-celled organisms) and finally at t ≅ 4.0 Gyr (the Cambrian explosion) may be associated with three multi-Myr-duration cosmic showers of the complex-scalar-field CDM particles. If so, the signature of the particles may be detectible in Cambrian rocks.

  8. Did CDM Particles of Mass 2.47 × 10-3 eV Interact with Precursor Biopolymers and Nucleic Acids to Initiate and Boost Lifeforms on Earth? (United States)

    Rosen, Gerald


    Recent observations and theoretical studies have shown that non-baryonic Cold Dark Matter (CDM), which constitutes about 84% of all matter in the Universe, may feature a complex-scalar-field that carries particles of mass m ≅ 2.47 × {10^{{ - 3}}}eV with the associated Compton range {m^{{ - 1}}} ≅ 8.02 × {10^{{ - 3}}}cm, a distance on the scale of extended bionucleic acids and living cells. Such a complex-scalar-field can enter a weak-isospin Lorentz-invariant interaction that generates the flow of right-handed electrons and induces a chirality-imbued quantum chemistry on the m -1 scale. A phenomenological Volterra-type equation is proposed for the CDM-impacted time development of N, the number of base pairs in the most advanced organism at Earth-age t. The solution to this equation suggests that the boosts in N at t ≅ 1.1 Gyr (advent of the first living prokaryotic cells), at t ≅ 2.9 Gyr (advent of eukaryotic single-celled organisms) and finally at t ≅ 4.0 Gyr (the Cambrian explosion) may be associated with three multi-Myr-duration cosmic showers of the complex-scalar-field CDM particles. If so, the signature of the particles may be detectible in Cambrian rocks.

  9. 7 CFR 247.18 - Nutrition education. (United States)


    ... participant input and must be directed by a nutritionist or other qualified professional. The evaluation may... children, where appropriate. (d) May CSFP foods be used in cooking demonstrations? Yes. The State or local agency, or another agency with which it has signed an agreement, may use CSFP foods to conduct cooking...

  10. 40 CFR 247.12 - Construction products. (United States)


    ... limited to structural fiberboard and laminated paperboard products, perlite composite board, polyurethane... limited to foam-in-place polyurethane and polyisocyanurate, and spray-on cellulose. (b) Structural..., stucco, masonry, wood, and metal surfaces. (h) Carpet cushion made from bonded polyurethane, jute...

  11. 40 CFR 247.15 - Landscaping products. (United States)


    ... hydroseeding and as an over-spray for straw mulch in landscaping, erosion control, and soil reclamation. (b) Compost made from recovered organic materials. (c) Garden and soaker hoses containing recovered plastic or rubber. (d) Lawn and garden edging containing recovered plastic or rubber. (e) Plastic lumber landscaping...

  12. 32 CFR 247.3 - Definitions. (United States)


    ... communicate with the intended DoD readership: command, military department, and DoD news and features... for Public Affairs (OASD(PA)), AFIS, the Military Departments, their subordinate levels of command... level of command when no daily English language newspapers are readily available. Inserts. A flier...

  13. 40 CFR 247.3 - Definitions. (United States)


    ... naturally-occurring waste component of coal fly ash, are very small, inert, lightweight, hollow, “glass... lubricating oils means petroleum-based oils used for reducing friction in engine parts; Federal agency means... means insulation which is composed principally of glass fibers, with or without binders; Flexible...

  14. Publications | Page 247 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the results of our funded ...

  15. 32 CFR 247.5 - Responsibilities. (United States)


    ... the implementation of policies and procedures pertaining to the management, content, and publication... Department's publications. (2) Encourage the use of CE publications when they are the most cost-effective... that the newspaper is prepared to support U.S. forces in the command area during contingencies and...

  16. Reference: 247 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ssociated with suppression of FHL expression in fhy1-3 cannot be accounted for by a critical role for FHY1-F... abundances of FHY1 and FHL in WT plants account for the differences in the severity of fhy1 and fhl mutatio

  17. 40 CFR 247.17 - Miscellaneous products. (United States)


    ... Miscellaneous products. (a) Pallets containing recovered wood, plastic, or paperboard. (b) Sorbents containing... containing recovered steel, plastic, or paper. (d) Awards and plaques containing recovered glass, wood, paper, or plastic. (e) Mats containing recovered rubber and/or plastic. (f)(1) Non-road signs containing...

  18. 48 CFR 247.572 - Policy. (United States)


    ... a vessel for which the contractor submitted an offer in response to the solicitation for the contract; and (ii) Prior to the acceptance of the vessel by the Government. (2) The Secretary of Defense... Act for Fiscal Year 2007 (Public Law 109-364)— (1) When obtaining carriage requiring a covered vessel...

  19. 27 CFR 19.247 - General. (United States)


    ... impairing the efficiency of such bond. Executors, administrators, assignees, receivers, trustees, or other persons acting in a fiduciary capacity, continuing or liquidating the business of the principal, shall... business of operations to which such bond relates, he shall file a valid superseding bond to be effective...

  20. 32 CFR 247.4 - Policy. (United States)


    ... sources. A balanced selection of commercial news or opinion shall appear in the same issue and same page.... Presentation of such political campaign news shall be made on a balanced, impartial, and nonpartisan basis. (i... officially authorized fund-raising campaigns (e.g., Combined Federal Campaign (CFC)) within the Department of...

  1. 24/7: the SANE approach. (United States)

    Mycek, Shari


    The Sexual Assault Nurse Examiners (SANE) program has proven itself to be an exemplary collaboration of hospitals, police and prosecutors for handling the complex and devastating aftermath of rape and sexual assault.

  2. No. 247-Antibiotic Prophylaxis in Obstetric Procedures. (United States)

    van Schalkwyk, Julie; Van Eyk, Nancy


    To review the evidence and provide recommendations on antibiotic prophylaxis for obstetrical procedures. Outcomes evaluated include need and effectiveness of antibiotics to prevent infections in obstetrical procedures. Published literature was retrieved through searches of Medline and The Cochrane Library on the topic of antibiotic prophylaxis in obstetrical procedures. Results were restricted to systematic reviews, randomized controlled trials/controlled clinical trials, and observational studies. Searches were updated on a regular basis and articles published from January 1978 to June2009 were incorporated in the guideline. Current guidelines published by the American College of Obstetrics and Gynecology were also incorporated. Grey (unpublished) literature was identified through searching the websites of health technology assessment and health technology assessment-related agencies, clinical practice guideline collections, clinical trial registries, and national and international medical specialty societies. The evidence obtained was reviewed and evaluated by the Infectious Diseases Committee of the Society of Obstetricians and Gynaecologists of Canada under the leadership of the principal authors, and recommendations were made according to guidelines developed by the Canadian Task Force on Preventive Health Care (Table 1). Implementation of this guideline should reduce the cost and harm resulting from the administration of antibiotics when they are not required and the harm resulting from failure to administer antibiotics when they would be beneficial. RECOMMENDATIONS. Copyright © 2017. Published by Elsevier Inc.

  3. 8 CFR 247.11 - Notice. (United States)


    ... (Waiver of Rights, Privileges, Exemptions and Immunities) and, if a French national receiving salary from the French Republic, Form I-508F (election as to tax exemption under the Convention between the United States and the French Republic), within 10 days after service of the notice, or the alien, within such 10...

  4. 32 CFR 247.6 - Procedures. (United States)


    ... cohesiveness and effectiveness by providing a visual representation of the essence of the command itself. (G... this part. (vii) AFIS print media directorate. See appendix D to this part. (viii) DoD command...

  5. 40 CFR 247.13 - Transportation products. (United States)


    ... traffic. (b) Parking stops made from concrete or containing recovered plastic or rubber. (c) Channelizers...) Flexible delineators containing recovered plastic. [60 FR 21381, May 1, 1995, as amended at 62 FR 60974...

  6. Web Based Prognostics and 24/7 Monitoring (United States)

    Strautkalns, Miryam; Robinson, Peter


    We created a general framework for analysts to store and view data in a way that removes the boundaries created by operating systems, programming languages, and proximity. With the advent of HTML5 and CSS3 with JavaScript the distribution of information is limited to only those who lack a browser. We created a framework based on the methodology: one server, one web based application. Additional benefits are increased opportunities for collaboration. Today the idea of a group in a single room is antiquated. Groups will communicate and collaborate with others from other universities, organizations, as well as other continents across times zones. There are many varieties of data gathering and condition-monitoring software available as well as companies who specialize in customizing software to individual applications. One single group will depend on multiple languages, environments, and computers to oversee recording and collaborating with one another in a single lab. The heterogeneous nature of the system creates challenges for seamless exchange of data and ideas between members. To address these limitations we designed a framework to allow users seamless accessibility to their data. Our framework was deployed using the data feed on the NASA Ames' planetary rover testbed. Our paper demonstrates the process and implementation we followed on the rover.

  7. 48 CFR 247.270-2 - Technical provisions. (United States)


    ..., DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT TRANSPORTATION Contracts for Transportation or for Transportation... sometimes within the same port, it is not practical to develop standard technical provisions covering all...

  8. 247-IJBCS-Article-Chukwunjindu M A Iwegbue

    African Journals Online (AJOL)


    basic cellular processes and brain function. (USEPA 1984, Dahiya et al., 2005). A provisional tolerable weekly intake has been established at 25 µg/g body weight ..... chocolates and candies from suburban area of Mumbai, India. J. Food Comp. Anal., 18: 517-522. De Pasquale A, Paino E, De Pasquale R,. Germano MP.

  9. 48 CFR 52.247-57 - Transportation Transit Privilege Credits. (United States)


    ... equipment and acceptance by the carrier, these shipments under paid commercial bills of lading will move for... the offered f.o.b. origin price unless a lower rate is applicable on the date of bid opening (or...

  10. 29 CFR 779.247 - “Goods” defined. (United States)


    ... OR SERVICES Employment to Which the Act May Apply; Enterprise Coverage Interstate Inflow Test Under... Act is defined in section 3(i) of the Act. The statutory definition is quoted in § 779.14, and is...

  11. 32 CFR Appendix B to Part 247 - CE Publications (United States)


    ... DoD and Service regulations and request exclusion of only those advertisements that are clearly in... legal coordination of the proposed exclusion. After coordination, the public affairs office shall...), the FAR contains many clauses that are useful in protecting the interests of the Government. The...

  12. 48 CFR 52.247-68 - Report of Shipment (REPSHIP). (United States)


    ..., or private) for transportation to a domestic destination (other than a port for export); (2..., MEMPHIS, TN. SHIPPED YOUR DEPOT 1981 JUN 1 540 CTNS MENS COTTON TROUSERS, 30,240 LB, 1782 CUBE, VIA XX-YY...

  13. All projects related to | Page 247 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)


    A grant to improve a new generation of Latin American leaders' understanding of how to better manage natural resources will contribute to the region's economic and social development. Start Date: January 1, 2012. End Date: July 1, 2015. Topic: ENVIRONMENTAL DEGRADATION, ENVIRONMENTAL POLICY, ...

  14. Scheduling Aircrews 1: Intra-Theater 24/7 Operations (United States)


    wider red portions on the cognitive effectiveness prediction. Sleep periods are shown as blue bands across the horizontal axis. The cognitive...during at least one month to multiple periods of prolonged wakefulness, excessive work hours, disturbed or shortened major sleep periods , unresolved...persisted or recurred for at least one month. [It is not eliminated by any number of sleep periods without first removing the cause.] 5 Number of Crews

  15. Waves and Oscillations in the Solar Atmosphere (IAU S247) (United States)

    Erdélyi, Robert; Mendoza-Briceno, César A.


    Preface; Organizing committee; Conference participants; Address by the Scientific Organizing Committee R. Erdélyi; Progress in coronal seismology B. Roberts; Session 1. Waves and oscillations in solar and stellar interior Robert Erdélyi; Session 2. Coupling of global solar and stellar motions into the lower atmosphere Bernard Roberts; Session 3. Seismology of the lower solar atmosphere and stellar chromospheres Siraj S. Hasan; Session 4. Seismology of open versus closed magnetic structures Marcel Goossens; Session 5. Prominence seismology Jose Luis Ballester; Session 6. Dynamical processes and coupling in the magnetic atmosphere of Sun and stars Miguel Ibañez; Session 7. Wave-particle interactions in magnetized plasmas Cesar A. Mendoza-Briceño; Session 8. Solar and stellar global coronal seismology Viggo Hansteen; Session 9. Fundamental physical processes in coronae: waves, turbulence, reconnection Saku Tsuneta; Session 10. Waves and instabilities in atmospheric plasmas Arnold O. Benz; Summary of meeting Cesar A. Mendoza-Briceño; Concluding remarks A. O. Benz; Late papers; Author index.


    African Journals Online (AJOL)

    The author first examined the impact of the cognitive aspect of culture, that is, the impact of a given message on what is generally and commonly known as community. The symbolic aspects of the message, matters concerning image, clichés and their interpretation were also examined in this chapter. Details of these can be.

  17. 48 CFR 252.247-7008 - Evaluation of bids. (United States)


    ... other factors, the Contracting Officer will evaluate bids on the basis of advantages or disadvantages to... evaluation, the Contracting Officer will assume that the administrative cost to the Government for issuing... Government, including the administrative costs in paragraph (b)(1). (c) When drayage is necessary for the...

  18. Dicty_cDB: SFJ247 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AAAGCCAAGATCCAAGATAAAGAA GGTATTCCACCAGATCAACAAAGATTAATCT sequence update 2001. 6. 1 Translated Amino Acid sequence ---m*xqxpxxxrf...kinxcr*tir rwsysf*lqyskrihspfsfkikrwyanlc*nshw*nnhfrs*rf**h*kc*sqdpr*rr ystrstkin Frame B: ---m*xqxpxxxrfppd

  19. Dicty_cDB: VHM247 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ryza sativa Japonica Group genomic DNA, chromoso... 48 0.76 1 ( EE263958 ) D07_D07gf4n14_pDNRf_505927 Myzu...s persicae, line G... 48 0.76 1 ( DW014216 ) w7k20_M13F Myzus persicae, tobacco lin...eage, whole... 48 0.76 1 ( DW014077 ) w7d4_M13F Myzus persicae, tobacco lineage, whole ... 48 0.76 1 ( DT970

  20. 40 CFR 247.16 - Non-paper office products. (United States)


    ... furniture containing recovered steel, aluminum, wood, agricultural fiber, or plastic. [60 FR 21381, May 1...-paper office products. (a) Office recycling containers and office waste receptacles. (b) Plastic desktop accessories. (c) Toner cartridges. (d) Plastic-covered binders containing recovered plastic; chipboard and...

  1. Formation and characterization of Y : 247 film through spray ...

    Indian Academy of Sciences (India)


    Thin film; quenching; superconducting. 1. Introduction. Three high-temperature superconductors are found to exist in the Y–Ba–Cu–O HTSC family. Their chemical formulae may be written as Y2Ba4Cu6+nO14+n, where n is the average number of CuO 'chains' separating two CuO2. 'planes' in each basic building block.

  2. 247 Educational Policy and Technological Development in Africa ...

    African Journals Online (AJOL)


    Abstract. Technological development is a basic artery through which nations strive to attain true independence. However, the level of technological development is dependent on the system, policy and philosophy of education that is dominant or prevalent in such a country. Any nation that lacks a sound system or policy of ...

  3. Dicty_cDB: AFH247 [Dicty_cDB

    Lifescience Database Archive (English)


  4. Maintaining Mission Critical Systems in a 247 Environment

    CERN Document Server

    Curtis, Peter M


    "This book is meant to offer Architects, Property Mangers, Facility Managers, Building Engineers, Information Technology Professionals, Data Center Personnel, Electrical & Mechanical Technicians and students in undergraduate, graduate, or continuing education programs relevant insight into the Mission Critical Environment with an emphasis on business resiliency, data center efficiency, and green power technology. Industry improvements, standards, and techniques have been incorporated into the text and address the latest issues prevalent in the Mission Critical Industry. An emphasis on green technologies and certifications is presented throughout the book. In addition, a description of the United States energy infrastructure's dependency on oil, in relation to energy security in the mission critical industry, is discussed. In conjunction with this, either a new chapter will be created on updated policies and regulations specifically related to the mission critical industry or updates to policies and regula...

  5. 48 CFR 252.247-7010 - Scope of contract. (United States)


    ... containers (Federal Specification PPP-B-580), all equipment, plant and labor; and (2) Perform all work in accomplishing containerization of personal property for overseas or domestic movement or storage, including— (i... property (including servicing of appliances) for movement or storage, drayage and related services. Unless...

  6. 48 CFR 252.247-7017 - Erroneous shipments. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Erroneous shipments. 252... SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of..., articles of personal property inadvertently packed with goods of other than the rightful owner. (2) Ensure...

  7. Exon 3-deleted/full-length growth hormone receptor polymorphism genotype frequencies in Spanish short small-for-gestational-age (SGA) children and adolescents (n = 247) and in an adult control population (n = 289) show increased fl/fl in short SGA. (United States)

    Audí, Laura; Esteban, Cristina; Carrascosa, Antonio; Espadero, Rosa; Pérez-Arroyo, Annalisa; Arjona, Rosa; Clemente, María; Wollmann, Hartmut; Fryklund, Linda; Parodi, Luis A


    A polymorphism in the human GH receptor gene (d3/fl-GHR) resulting in genomic deletion of exon 3 has been associated with the degree of height increase in response to GH therapy. The objective of the study was to evaluate the frequencies of d3/fl-GHR polymorphism genotypes in control and short small-for-gestational-age (SGA) populations. An adult control population with heights normally distributed (ACPNH) between -2 and +2 sd score (SDS) and a short non-GH-deficient SGA child population were selected. Thirty Spanish hospitals participated in the selection of the short non-GH-deficient SGA children in the setting of a controlled, randomized trial, and one of these hospitals selected the ACPNH. CONTROLS AND PATIENTS: Two hundred eighty-nine adult subjects of both sexes constituted the ACPNH and 247 children and adolescents of both sexes the short SGA patients. Heights and weights were recorded in the ACPNH, and auxologic and biochemical data were recorded at each hospital for the SGA patients; d3/fl-GHR genotypes were determined and data analyzed in a single hospital. In short SGA patients, d3/fl-GHR genotype frequencies were significantly different from those in ACPNH, with a higher frequency of fl/fl genotype (P or=-2 SDS, n = 60). Our data showed significant differences in the frequency distribution of the d3/fl-GHR genotypes between a normally distributed adult height population and short SGA children, with the biologically less active fl/fl genotype being almost twice as frequent in SGA patients. These data suggest that the d3/fl-GHR polymorphism might be considered among the factors that contribute to the phenotypic expression of growth.

  8. S. Aft. J. Anim. Sci., 4, 247-258 (1974) INTENSIFICATION

    African Journals Online (AJOL)

    optimal age for replacement is influenced more by declining productivity after 9 years of age than by existing cattle prices or interest rates. This study suggests that although many variables must be considered, the retention of cows beyond 10 years of age is likely to result in reduced long- term productivity and profits in most ...

  9. 32 CFR Appendix A to Part 247 - Funded Newspapers and Magazines (United States)


    ... funds and manpower may be used for distribution of Funded publications, as required. I. Advertising. Funded publications shall not carry commercial advertising. As a service, the Funded newspaper may carry... Ethics Regulation. In addition, DoD personnel whose spouse or children (or other relatives as described...

  10. Phonological Representations in Visual Word Recognition: The Adjunct Access Model. Technical Report. No. 247. (United States)

    Kleiman, Glenn M.; Humphrey, Mary M.

    While studies of college-level readers have yielded evidence both for and against the use of phonological or speech recoding in the recognition of written words, no consistent picture of when recoding occurs has yet emerged. However, one model, the adjunct access model, can account for the previous research findings. According to this model,…

  11. S. Afr. J. Anim. Sci. II , 247- 254 ( I 981 ) PRACTICAL IMPLICATIONS ...

    African Journals Online (AJOL)

    J. agric. Sci. Camb.,93,607. CRONJE, K.G., l9l3.Ondersoek na die invloed van verskillende drogingstegnieke op die samestelling van gedroogde groenvoer en kuilvoer. M.Sc. Tesis Universiteit van Stellenbosch-. DANLEY, M.M. & VETTER, R.L., l9l l. Changes in carbohydrate and nitrogen fractionsand digestibilityof orages:.

  12. Field testing of hand-held infrared thermography, phase II TPF-5(247) interim report. (United States)


    This report describes research completed to develop and implement infrared thermography, a nondestructive evaluation (NDE) : technology for the condition assessment of concrete bridge components. The overall goal of this research was to develop new :...

  13. : tous les projets | Page 247 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)


  14. Flame Retardant: Cyberbullies Torment Their Victims 24/7: Here's How to Stop the Abuse (United States)

    Willard, Nancy


    Cyberbullying is the use of electronic information such as e-mail and other digital age tools to bully or harass individuals. Cyberbullies post angry and vulgar messages in online "flaming" wars or hack into a peer's e-mail account to wreak havoc, assaulting the reputations and already fragile egos of their young victims. The devastating effects…

  15. Safe2Tell[R]: An Anonymous, 24/7 Reporting System for Preventing School Violence (United States)

    Payne, Susan R. T.; Elliott, Delbert S.


    There is widespread agreement that many school shootings could be prevented if authorities were informed that a student was planning or preparing to carry out an attack. A universal problem is that young people are highly reluctant to report on their peers. This code of silence represents a major barrier to prevention efforts. In response to the…

  16. 17 CFR 247.741 - Exemption for banks effecting transactions in money market funds. (United States)


    ... no-load; or (ii) If the class or series of securities is not no-load (A) The bank or, if applicable... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Exemption for banks effecting... EXCHANGE COMMISSION (CONTINUED) REGULATION R-EXEMPTIONS AND DEFINITIONS RELATED TO THE EXCEPTIONS FOR BANKS...

  17. 27 CFR 24.247 - Materials authorized for the treatment of distilling material. (United States)


    ... oryzae, Bacillus subtilis, or barley malt per FDA advisory opinion of 8/18/83 or from Rhizopus oryzae per 21 CFR 173.130 or from Bacillus licheniformis per 21 CFR 184.1027. Carbohydrase (beta- Amylase) To...

  18. Episode: Phaedrus (247c6-8 by Yorgos Kentrotis, translated and introduced by Paschalis Nikolaou

    Directory of Open Access Journals (Sweden)

    Yorgos Kentrotis


    Full Text Available Yorgos Kentrotis was born in 1958 in Laconia, the Peloponnese. Following studies in Law at Greek and German universities, he was eventually won over by literature and translation. He is currently Professor in Translation Theory at the Ionian University in Corfu. Since the early 1980s he has steadily produced translations from ancient Greek, Latin, German and Russian–of works by, among others, Plato, Cicero, Robert Musil, Pablo Neruda, Vladimir Mayakovsky and Bertolt Brecht. His essays and monographs on comparative literature, poetics and translation are widely recognized. A first collection of his poems appeared in 2006; Kentrotis has published five collections since. In 2014, he put out a collection of no less than 500 of Brecht’s poems in Greek translation, as well as a selection of epigrams from the Palatine Anthology. A similar edition of Paz’s poetry is forthcoming. Most recently in 2015, he published the long-awaited Greek translation of Giambattista Vico’s (1668–1744 La Scienza Nuova (1725.

  19. 247. Complicaciones durante la experiencia inicial en cirugía robótica

    Directory of Open Access Journals (Sweden)

    J.F. Valderrama Marcos


    Conclusiones: a El número de pacientes intervenidos es muy escaso para los recursos empleados; b en nuestro medio, no obtuvimos los resultados esperados en los pacientes intervenidos de válvula mitral; c en pacientes coronarios, hemos conseguido un abordaje realmente miniinvasivo, sin complicaciones observadas durante el postoperatorio; d en otra enfermedad como los mixomas y la pericardiectomía, se ha mostrado como una herramienta eficaz, aunque el escaso volumen no permita sacar conclusiones, y e el tiempo transcurrido entre las intervenciones influye negativamente en los resultados.

  20. 24 CFR 247.3 - Entitlement of tenants to occu- pancy. (United States)


    ... a covered person in accordance with sections 5.858 and 5.859, or alcohol abuse by a covered person... violations of the rental agreement that: (i) Disrupt the livability of the project, (ii) Adversely affect the health or safety of any person or the right of any tenant to the quiet enjoyment of the leased premises...

  1. The Lived Experiences of 24/7 Connectivity on Secondary Educators (United States)

    Heiden, James P.


    Student access to the Internet has dramatically increased during the first decade of 2000. A recent study indicated that over 85% of US teens have regular access to a cell phone (Rideout et al., 2010). The cell phone coupled with an Internet plan has created the smart phone. This technology allows students to decide when and where they want to…

  2. 48 CFR 252.247-7016 - Contractor liability for loss or damage. (United States)


    ... the Contractor's negligence, indemnification shall be at a rate not to exceed sixty cents per pound per article. (ii) Negligent damage. When loss or damage is caused by the negligence of the Contractor...

  3. 32 CFR Appendix D to Part 247 - AFIS Print Media Directorate (United States)


    .... Products include the following: 1. American Forces Press Service, news and feature articles, photographs... featuring articles authored by senior military and civilian officials on DoD programs and policies. An...

  4. Sud du Sahara | Page 247 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Sud du Sahara. Sud du Sahara. Read more about Publishing and Alternative Licensing Model of Africa (PALM Africa). Langue English. Read more about Strategic Action Plan for ERNWACA - 2007-2011. Langue English. Read more about Plan d'action stratégique du ROCARE - 2007-2011. Langue French. Read more ...

  5. High Cycle Fatigue Damage Mechanisms of MAR-M 247 Superalloy at High Temperatures

    Czech Academy of Sciences Publication Activity Database

    Šmíd, Miroslav; Horník, Vít; Hutař, Pavel; Hrbáček, K.; Kunz, Ludvík


    Roč. 69, č. 2 (2016), s. 393-397 ISSN 0972-2815 R&D Projects: GA TA ČR(CZ) TA04011525; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081723 Keywords : High cycle fatigue * S-N curves * Fractography * High temperature * EBSD analysis Subject RIV: JL - Materials Fatigue, Friction Mechanics Impact factor: 0.533, year: 2016

  6. 49 CFR 173.247 - Bulk packaging for certain elevated temperature materials. (United States)


    ... reference to the axes of the transport vehicle. Each accelerative or decelerative load may be considered... packagings used for transportation of molten metals and molten glass by rail when movement is restricted to...

  7. Entropy 2008, 10, 240-247: Ferri et al. Deformed Generalization of the Semiclassical Entropy (United States)

    Harremoës, Peter


    It has come to our attention that names of authors have been misspelled in a paper recently published in Entropy [1]. The correct names are: Gustavo Ferri, Felipe Olivares, Flavia Pennini, Angelo Plastino, Angel R. Plastino and Montserrat Casas. We apologize for this mistake and any inconvenience caused.

  8. 75 FR 62333 - Airworthiness Directives; Hamilton Sundstrand Propellers Model 247F Propellers (United States)


    ... reports of blades with corrosion pits in the tulip area of the blades. This supplemental NPRM revises the... this AD to prevent cracks from developing in the tulip area of the blade, which could result in... damage to the corrosion protection on the blade tulips. Those blades also require complying with Service...

  9. 76 FR 7101 - Airworthiness Directives; Hamilton Sundstrand Propellers Model 247F Propellers (United States)


    ... was prompted by reports of blades with corrosion pits in the tulip area of the blades. We are issuing this AD to prevent cracks from developing in the tulip area of the blade, which could result in...) This AD results from reports of blades with corrosion pits in the tulip area of the blades. We are...

  10. Buli. Mater. Sci., Vol. 20, No. 2, April 1997, pp. 247-257. (C

    Indian Academy of Sciences (India)

    material for commercial applications. It has been known to exhibit ultra-low thermal expansion, good thermal shock resistance, high-thermal stability and high-chemical durability (Yang et al 1991). It is largely used as refractory materials in industrial furnaces and as heat exchangers in gas turbines. Its other applications are ...

  11. Beverage consumption habits "24/7" among British adults: association with total water intake and energy intake. (United States)

    Gibson, Sigrid; Shirreffs, Susan M


    Various recommendations exist for total water intake (TWI), yet it is seldom reported in dietary surveys. Few studies have examined how real-life consumption patterns, including beverage type, variety and timing relate to TWI and energy intake (EI). We analysed weighed dietary records from the National Diet and Nutrition Survey of 1724 British adults aged 19-64 years (2000/2001) to investigate beverage consumption patterns over 24 hrs and 7 days and associations with TWI and EI. TWI was calculated from the nutrient composition of each item of food and drink and compared with reference values. Mean TWI was 2.53 L (SD 0.86) for men and 2.03 L (SD 0.71) for women, close to the European Food Safety Authority "adequate Intake" (AI) of 2.5 L and 2 L, respectively. However, for 33% of men and 23% of women TWI was below AI and TWI:EI ratio was juice 1%.In multi-variable regression (adjusted for sex, age, body weight, smoking, dieting, activity level and mis-reporting), replacing 100 g of caloric beverages (milk, fruit juice, caloric soft drinks and alcohol) with 100 g non-caloric drinks (diet soft drinks, hot beverages and water) was associated with a reduction in EI of 15 kcal, or 34 kcal if food energy were unchanged. Using within-person data (deviations from 7-day mean) each 100 g change in caloric beverages was associated with 29 kcal change in EI or 35 kcal if food energy were constant. By comparison the calculated energy content of caloric drinks consumed was 47 kcal/100 g. TWI and beverage consumption are closely related, and some individuals appeared to have low TWI. Compensation for energy from beverages may occur but is partial. A better understanding of interactions between drinking and eating habits and their impact on water and energy balance would give a firmer basis to dietary recommendations.

  12. Retrospective analysis of hepatitis B virus chronic infection in 247 patients: clinical stages, response to treatment and poor prognostic factors

    Directory of Open Access Journals (Sweden)

    Marlone Cunha-Silva


    Conclusions: Elevations of viral load and serum alanine aminotransferase may select patients with worse prognosis, especially progression to cirrhosis and hepatocellular carcinoma, which were strongly association with death.

  13. 48 CFR 52.247-55 - F.o.b. Point for Delivery of Government-Furnished Property. (United States)


    ... specified destination. (b) If the destination of the Government-furnished property is a Contractor's plant... equipment, supplies, and property, including all property not returned in the form of acceptable end items... plant, the Contracting Officer may direct the Contractor to deliver the Government property being...

  14. Unprecedented cobalt-catalyzed isomerization reactions to single skipped 2,4,7-trienes applied in the synthesis of urushiol. (United States)

    Schmidt, Anastasia; Hilt, Gerhard


    The cobalt-catalyzed isomerization of 1,3-dienes to 2Z,4E-dienes was realized for the very challenging substrates with an additional double bond in the side chain. An isomerization to the conjugated 3,5,7-triene derivative was not observed, which is in stark contrast to observations with many other isomerization catalysts. Accordingly, the synthesis of the natural product urushiol, which has a sensitive 2Z,4E,7Z-triene subunit in the side chain, was investigated. The O-protected urushiol derivative was generated selectively without isomerization to the conjugated 3,5,7-triene or Z/E-isomerization of the double bond at position 7. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Beverage consumption habits “24/7” among British adults: association with total water intake and energy intake

    Directory of Open Access Journals (Sweden)

    Gibson Sigrid


    Full Text Available Abstract Background Various recommendations exist for total water intake (TWI, yet it is seldom reported in dietary surveys. Few studies have examined how real-life consumption patterns, including beverage type, variety and timing relate to TWI and energy intake (EI. Methods We analysed weighed dietary records from the National Diet and Nutrition Survey of 1724 British adults aged 19–64 years (2000/2001 to investigate beverage consumption patterns over 24 hrs and 7 days and associations with TWI and EI. TWI was calculated from the nutrient composition of each item of food and drink and compared with reference values. Results Mean TWI was 2.53 L (SD 0.86 for men and 2.03 L (SD 0.71 for women, close to the European Food Safety Authority “adequate Intake” (AI of 2.5 L and 2 L, respectively. However, for 33% of men and 23% of women TWI was below AI and TWI:EI ratio was In multi-variable regression (adjusted for sex, age, body weight, smoking, dieting, activity level and mis-reporting, replacing 100 g of caloric beverages (milk, fruit juice, caloric soft drinks and alcohol with 100 g non-caloric drinks (diet soft drinks, hot beverages and water was associated with a reduction in EI of 15 kcal, or 34 kcal if food energy were unchanged. Using within-person data (deviations from 7-day mean each 100 g change in caloric beverages was associated with 29 kcal change in EI or 35 kcal if food energy were constant. By comparison the calculated energy content of caloric drinks consumed was 47 kcal/100 g. Conclusions TWI and beverage consumption are closely related, and some individuals appeared to have low TWI. Compensation for energy from beverages may occur but is partial. A better understanding of interactions between drinking and eating habits and their impact on water and energy balance would give a firmer basis to dietary recommendations.

  16. Testing oral proficiency: what does pronunciation tell us?DOI:10.5007/2175-8026.2011n60p247

    Directory of Open Access Journals (Sweden)

    Vanessa Borges-Almeida


    Full Text Available In this study we discuss the role of pronunciation in languagetesting and investigate two features of pronunciation of eightcandidates of the Test of Oral Proficiency in English (TEPOLIalong four bands of the test scale. Deviations in vowel segmentsand in syllable structure are analyzed. The results point to theneed for a global assessment of the candidates’ phonologicalsystems.

  17. Social media: a teaching & learning experience with facebook : 24/7 Education in the 21st century

    NARCIS (Netherlands)

    Wim Oostindiër


    Presentatie in het kader van het project Opening Up. Opening Up is bedoeld om een betere dienstverlening aan burgers en bedrijven te zoeken door de inzet van social media en open data. Het Opening Up-project startte in oktober 2011 en duurt drie jaar. De Hanzehogeschool Groningen is een belangrijke

  18. 78 FR 19413 - Listing of Color Additives Exempt From Certification; Reactive Blue 246 and Reactive Blue 247... (United States)


    ... the dockets to read background documents or objections received, go to and insert the docket numbers, found in brackets in the heading of this document, into the ``Search'' box and... petitioner. This study demonstrated that there was no detectable migration of C.I. Reactive Blue 246 at the...

  19. 78 FR 46315 - Foreign-Trade Zone (FTZ) 247-Erie, Pennsylvania, Notification of Proposed Production Activity, GE... (United States)


    ...; refrigerators; fuel heaters; heat exchangers; exhaust gas coolers; warming ovens; baffles; bonnet lube oil...; motorized wheels; AC drills; alternators; armatures; bus rings; armature coils; coils; commutators; dynamic... assemblies; weldments; barrier assemblies; coil assemblies; door assemblies; duct assemblies; dynamic brake...

  20. Adolescents living the 24/7 lifestyle: effects of caffeine and technology on sleep duration and daytime functioning. (United States)

    Calamaro, Christina J; Mason, Thornton B A; Ratcliffe, Sarah J


    Adolescents may not receive the sleep they need. New media technology and new, popular energy drinks may be implicated in sleep deficits. In this pilot study we quantified nighttime technology use and caffeine consumption to determine effects on sleep duration and daytime behaviors in adolescents. We hypothesized that with increased technology use, adolescents increase caffeine consumption, resulting in insufficient sleep duration. Subjects were recruited from a pediatric office in a proximal suburb of Philadelphia, Pennsylvania. Inclusion criteria for this study were middle and high school subjects aged 12 to 18 years old. The questionnaire, Adolescent Sleep, Caffeine Intake, and Technology Use, was developed by the investigators to measure adolescents' intake of caffeinated drinks, use of nighttime media-related technology, and sleep behaviors. Descriptive statistics characterized the subjects, their caffeine and technology use, and sleep variables. Regression models assessed the relationships between caffeine, technology use, and sleep variables, having adjusted for age, race, gender, and BMI. Sleep was significantly related to the multitasking index. Teenagers getting 8 to 10 hours of sleep on school nights tended to have 1.5- to 2-fold lower multitasking indices compared with those getting less sleep. Thirty-three percent of the teenagers reported falling asleep during school. Caffeine consumption tended to be 76% higher by those who fell asleep. The log-transformed multitasking index was significantly related to falling asleep during school and with difficulties falling asleep on weeknights. Many adolescents used multiple forms of technology late into the night and concurrently consumed caffeinated beverages. Subsequently, their ability to stay alert and fully functional throughout the day was impaired by excessive daytime sleepiness. Future studies should measure more than television hours when evaluating the impact of nighttime activities on sleep patterns in adolescents.

  1. 17 CFR 247.701 - Exemption from the definition of “broker” for certain institutional referrals. (United States)


    ... value of the Personal Consumption Expenditures Chain-Type Price Index (or any successor index thereto..., perform a suitability analysis of the securities transaction in accordance with the rules of the broker or... analysis of all securities transactions requested by the customer contemporaneously with the referral in...

  2. The approach and treatment of a unicystic Ameloblastoma in the jaw - doi:10.5020/18061230.2006.p247

    Directory of Open Access Journals (Sweden)

    Antônio Francisco Durighetto Júnior


    Full Text Available Among the complex group of odontogenic tumors, the ameloblastoma points out as the most important and common odontogenic tumor of epithelial origin. It consists mainly of a benign tumor, slow in progress and locally invasive, although it can present high rates of reincidence. The unicystic ameloblastoma is one of the tumor variants and deserves singular consideration for its peculiar characteristics. This study aimed at showing the peculiarities of this ameloblastoma variant through a case report on the care assistance of a young man committed by a jaw tumor, approaching the diagnostic methods used and the applied treatment. Based on present, we conclud that the prognostic for patients with unicystic ameloblastoma is very favorable, since the propaedeutic proceedings are well conducted by the professionals involved.

  3. 49 CFR 40.247 - What procedures does the BAT or STT follow after a screening test result? (United States)


    ... 49 Transportation 1 2010-10-01 2010-10-01 false What procedures does the BAT or STT follow after a... What procedures does the BAT or STT follow after a screening test result? (a) If the test result is an alcohol concentration of less than 0.02, as the BAT or STT, you must do the following: (1) Sign and date...

  4. 48 CFR 247.573-1 - Ocean transportation incidental to a contract for supplies, services, or construction. (United States)


    ... is clearly identifiable for eventual use by DoD. (b) DD Form 1653, Transportation Data for... Business Management Directorate, MSC; or (ii) The Commander, Military Surface Deployment and Distribution (SDDC), through the SDDC global e-mailbox [email protected] and the Principal Assistant...

  5. Teaching and Learning 24/7 Using Twitter in a University Classroom: Experiences from a Developing Country (United States)

    Chawinga, Winner Dominic


    It is understood that microblogging (tweeting) which is a form of Web 2.0, has been a centre of attraction in some institutions of higher education. However, despite its hype and pomp as reported by some scholars in developed countries, integration of Twitter in a classroom environment in developing countries is just beginning to flourish. In…

  6. 17 CFR 247.721 - Defined terms relating to the trust and fiduciary activities exception from the definition of... (United States)


    ..., including, without limitation, a fee paid— (A) For personal services, tax preparation, or real estate...— (1) Providing transfer agent or sub-transfer agent services for beneficial owners of investment... shares; (3) Providing beneficial owners with account statements showing their purchases, sales, and...

  7. Beverage consumption habits “24/7” among British adults: association with total water intake and energy intake (United States)


    Background Various recommendations exist for total water intake (TWI), yet it is seldom reported in dietary surveys. Few studies have examined how real-life consumption patterns, including beverage type, variety and timing relate to TWI and energy intake (EI). Methods We analysed weighed dietary records from the National Diet and Nutrition Survey of 1724 British adults aged 19–64 years (2000/2001) to investigate beverage consumption patterns over 24 hrs and 7 days and associations with TWI and EI. TWI was calculated from the nutrient composition of each item of food and drink and compared with reference values. Results Mean TWI was 2.53 L (SD 0.86) for men and 2.03 L (SD 0.71) for women, close to the European Food Safety Authority “adequate Intake” (AI) of 2.5 L and 2 L, respectively. However, for 33% of men and 23% of women TWI was below AI and TWI:EI ratio was Beverages accounted for 75% of TWI. Beverage variety was correlated with TWI (r 0.34) and more weakly with EI (r 0.16). Beverage consumption peaked at 0800 hrs (mainly hot beverages/ milk) and 2100 hrs (mainly alcohol). Total beverage consumption was higher at weekends, especially among men. Overall, beverages supplied 16% of EI (men 17%, women 14%), alcoholic drinks contributed 9% (men) and 5% (women), milk 5-6%, caloric soft drinks 2%, and fruit juice 1%. In multi-variable regression (adjusted for sex, age, body weight, smoking, dieting, activity level and mis-reporting), replacing 100 g of caloric beverages (milk, fruit juice, caloric soft drinks and alcohol) with 100 g non-caloric drinks (diet soft drinks, hot beverages and water) was associated with a reduction in EI of 15 kcal, or 34 kcal if food energy were unchanged. Using within-person data (deviations from 7-day mean) each 100 g change in caloric beverages was associated with 29 kcal change in EI or 35 kcal if food energy were constant. By comparison the calculated energy content of caloric drinks consumed was 47 kcal/100 g. Conclusions TWI and beverage consumption are closely related, and some individuals appeared to have low TWI. Energy from beverages may be partly compensated. A better understanding of interactions between drinking and eating habits and their impact on water and energy balance would give a firmer basis to dietary recommendations. PMID:23305461

  8. SU-E-J-247: Time Evolution of Radiation-Induced Lung Injury After Stereotactic Proton Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Grassberger, C; Sharp, G; Fintelmann, F; Paganetti, H; Willers, H [Massachusetts General Hospital, Boston, MA (United States)


    Purpose: Quantitative metrics to assess patient-specific radiation-induced lung injury have the potential to guide individualization of therapy and be early indicators of recurrence. Here we investigate computed tomography (CT) density changes in normal lung after stereotactic Proton Therapy. Methods: Participants in a phase-I clinical trial for stereotactic body radiation therapy (SBRT) with protons are analyzed on a rolling basis. The dataset includes 9 patients with 34 CT images to date. Follow-up images are registered to the planning CT using deformable image registration and the change in CT density is correlated to the dose to examine the time-evolution of Hounsfield Unit (HU) changes after large doses of proton radiation. Results: The lung density observed on the follow-up images increases significantly with dose for all dose levels above 5 Gy(RBE) (p<0.001) for 8/9 patients. The change per unit dose [HU/Gy] varies significantly among the patients, from 0.1 (for the one patient without significant correlation) to 5.7 ΔHU/Gy(RBE). The current population average of ΔHU/Gy(RBE) is 2.1, i.e. a 1 Gy(RBE) increase in dose leads on average to a 2.1 HU increase in CT density. The slope of the dose-response curve is constant for all timepoints investigated (from 3–24+ months). Additionally a pronounced non-linearity in the dose response curve is noted for long follow-up times (>18 months). Conclusion: CT density changes have a robust correlation with proton dose, quantitatively similar to photon dose, and may allow estimation of a patient’s intrinsic radiosensitivity after proton therapy. The stability of the correlation with time however diverges from what is known about CT response after photon irradiation. This could have important implications for clinical decision-making during proton therapy for lung cancer, especially for scheduling of follow-up CT/PET imaging and diagnosis of recurrence.

  9. High-temperature low-cycle fatigue behaviour of HIP treated and untreated superalloy MAR-M247

    Czech Academy of Sciences Publication Activity Database

    Šulák, Ivo; Obrtlík, Karel; Čelko, L.


    Roč. 54, č. 6 (2016), s. 471-481 ISSN 0023-432X R&D Projects: GA TA ČR(CZ) TA04011525; GA ČR(CZ) GA15-20991S Institutional support: RVO:68081723 Keywords : hot isostatic pressing * high-temperature low cycle fatigue * fatigue life curves * Ni-based superalloy * dislocation structures * planar bands Subject RIV: JL - Materials Fatigue, Friction Mechanics Impact factor: 0.366, year: 2016

  10. 17 CFR 247.760 - Exemption from definition of “broker” for banks accepting orders to effect transactions in... (United States)


    ... brokerage accounts or that the bank's safekeeping and custody services substitute for a securities brokerage... custodian bank that contracted with the administrator or recordkeeper bank for services. (f) Subcustodians...

  11. "I'm on it 24/7 at the moment": A qualitative examination of multi-screen viewing behaviours among UK 10-11 year olds

    Directory of Open Access Journals (Sweden)

    Cillero Itziar


    Full Text Available Abstract Background Screen-viewing has been associated with increased body mass, increased risk of metabolic syndrome and lower psychological well-being among children and adolescents. There is a shortage of information about the nature of contemporary screen-viewing amongst children especially given the rapid advances in screen-viewing equipment technology and their widespread availability. Anecdotal evidence suggests that large numbers of children embrace the multi-functionality of current devices to engage in multiple forms of screen-viewing at the same time. In this paper we used qualitative methods to assess the nature and extent of multiple forms of screen-viewing in UK children. Methods Focus groups were conducted with 10-11 year old children (n = 63 who were recruited from five primary schools in Bristol, UK. Topics included the types of screen-viewing in which the participants engaged; whether the participants ever engaged in more than one form of screen-viewing at any time and if so the nature of this multiple viewing; reasons for engaging in multi-screen-viewing; the room within the house where multi-screen-viewing took place and the reasons for selecting that room. All focus groups were transcribed verbatim, anonymised and thematically analysed. Results Multi-screen viewing was a common behaviour. Although multi-screen viewing often involved watching TV, TV viewing was often the background behaviour with attention focussed towards a laptop, handheld device or smart-phone. There were three main reasons for engaging in multi-screen viewing: 1 tempering impatience that was associated with a programme loading; 2 multi-screen facilitated filtering out unwanted content such as advertisements; and 3 multi-screen viewing was perceived to be enjoyable. Multi-screen viewing occurred either in the child's bedroom or in the main living area of the home. There was considerable variability in the level and timing of viewing and this appeared to be a function of whether the participants attended after-school clubs. Conclusions UK children regularly engage in two or more forms of screen-viewing at the same time. There are currently no means of assessing multi-screen viewing nor any interventions that specifically focus on reducing multi-screen viewing. To reduce children's overall screen-viewing we need to understand and then develop approaches to reduce multi-screen viewing among children.

  12. Correction: Correction to 'Clinical Policy: Procedural Sedation and Analgesia in the Emergency Department' [Annals of Emergency Medicine 63 (2014) 247-258.e18]. (United States)

    Godwin, Steven A; Burton, John H; Gerardo, Charles J; Hatten, Benjamin W; Mace, Sharon E; Silvers, Scott M; Fesmire, Francis M


    Due to a miscommunication during the process of transferring this manuscript from our editorial team to Production, the Members of the American College of Emergency Physicians Clinical Policies Committee (Oversight Committee) were not properly indexed in PubMed. This has now been corrected online. This has now been corrected online. The publisher would like to apologize for any inconvenience caused. Copyright © 2017 American College of Emergency Physicians. Published by Elsevier Inc. All rights reserved.

  13. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel


    The grass family (Poaceae), the fourth largest family of flowering plants, encompasses the most economically important cereal, forage, and energy crops, and exhibits a unique gametophytic self-incompatibility (SI) mechanism that is controlled by at least two multiallelic and independent loci, S a...

  14. Non-destructive examinations of D247.01 SiC-ball. Gamma scan wires 1 and 2 and SiC-ball 1 through 7

    Energy Technology Data Exchange (ETDEWEB)

    Dassel, G.; Buurveld, H.A.; Plakman, J.C.


    In the frame of the KFA programme on Innovative Nuclear Technology SiC-coated graphite spheres have been irradiated in the HFR Petten. With this irradiation two stainless steel gamma scan wires have been irradiated to be able to reconstruct the neutron flux profile during the irradiation and to calculate the absorption of neutrons in the spheres. This report presents the results from the gamma scanning of the two gamma scan wires. Appended are the results from dose rate measurements and weighing of the spheres and gamma spectrometric results from balls 5 and 6. (orig.).

  15. Non-destructive examinations of D247.01 SiC-ball. Gamma scan wires 1 and 2 and SiC-ball 1 through 7

    International Nuclear Information System (INIS)

    Dassel, G.; Buurveld, H.A.; Plakman, J.C.


    In the frame of the KFA programme on Innovative Nuclear Technology SiC-coated graphite spheres have been irradiated in the HFR Petten. With this irradiation two stainless steel gamma scan wires have been irradiated to be able to reconstruct the neutron flux profile during the irradiation and to calculate the absorption of neutrons in the spheres. This report presents the results from the gamma scanning of the two gamma scan wires. Appended are the results from dose rate measurements and weighing of the spheres and gamma spectrometric results from balls 5 and 6. (orig.)

  16. PS2-47: Systematic Stakeholder Assessment to Determine Facilitators of and Barriers to SBIRT Implementation in Multiple Integrated Health Systems (United States)

    Rahm, Alanna Kulchak; Boggs, Jennifer; Martin, Carmen; Beck, Arne; Pearson, Marilyn; Backer, Thomas; Ahmedani, Brian


    Background/Aims The US Preventive Services Task Force has identified alcohol and drug use screening as a high priority in primary care. SBIRT is a framework for population based screening and brief intervention with the goal of reducing substance use before it progresses to dependence. There has been limited uptake of SBIRT in any large health system, thus SAMHSA has supported a series of studies, led by Kaiser Permanente Colorado (KPCO), to determine strategies to promote large scale SBIRT implementation. Methods A qualitative examination of SBIRT feasibility and subsequent pilot testing within KPCO primary care guided a series of additional stakeholder interviews at Henry Ford Health System (HFHS) to assess feasibility of SBIRT implementation in additional organizations. Qualitative interviews were conducted with a broad spectrum of HFHS stakeholders using snowball sampling. A total of 28 HFHS stakeholders were interviewed. Interviews were conducted telephonically by trained interviewers from KPCO and lasted approximately 30 minutes. Interviews were digitally recorded and transcribed. After each interview, a detailed summary was generated and used to create the initial code book for analysis of interview transcripts. Results While current screening, brief intervention, and referral to treatment processes for substance use were noted in HFHS, they were inconsistent and no systematic policies exist. Many facilitators for SBIRT implementation within HFHS were noted including: population, recent implementation of depression screening in primary care, and EMR tools to facilitate documentation. Barriers to SBIRT implementation included time and competing demands for primary care providers, access to treatment, and follow-up processes for positive screens. All stakeholders were supportive of pilot implementation of SBIRT within HFHS with adequate attention to barriers and facilitators. Conclusions This project successfully demonstrated the value of gaining stakeholder perspectives in order to facilitate successful implementation of SBIRT in large integrated health systems and provides a systematic protocol for gathering this data.

  17. SU-F-T-247: Collision Risks in a Modern Radiation Oncology Department: An Efficient Approach to Failure Modes and Effects Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, L; Westerly, D; Vinogradskiy, Y; Fisher, C; Liu, A [University of Colorado Denver, Aurora, CO (United States); Aldridge, J [University of Colorado Hospital, Aurora, CO (United States)


    Purpose: Collisions between treatment equipment and patients are potentially catastrophic. Modern technology now commonly involves automated remote motion during imaging and treatment, yet a systematic assessment to identify and mitigate collision risks has yet to be performed. Failure modes and effects analysis (FMEA) is a method of risk assessment that has been increasingly used in healthcare, yet can be resource intensive. This work presents an efficient approach to FMEA to identify collision risks and implement practical interventions within a modern radiation therapy department. Methods: Potential collisions (e.g. failure modes) were assessed for all treatment and simulation rooms by teams consisting of physicists, therapists, and radiation oncologists. Failure modes were grouped into classes according to similar characteristics. A single group meeting was held to identify implementable interventions for the highest priority classes of failure modes. Results: A total of 60 unique failure modes were identified by 6 different teams of physicists, therapists, and radiation oncologists. Failure modes were grouped into four main classes: specific patient setups, automated equipment motion, manual equipment motion, and actions in QA or service mode. Two of these classes, unusual patient setups and automated machine motion, were identified as being high priority in terms severity of consequence and addressability by interventions. The two highest risk classes consisted of 33 failure modes (55% of the total). In a single one hour group meeting, 6 interventions were identified. Those interventions addressed 100% of the high risk classes of failure modes (55% of all failure modes identified). Conclusion: A class-based approach to FMEA was developed to efficiently identify collision risks and implement interventions in a modern radiation oncology department. Failure modes and interventions will be listed, and a comparison of this approach against traditional FMEA methods will be presented.

  18. 47 CFR 15.247 - Operation within the bands 902-928 MHz, 2400-2483.5 MHz, and 5725-5850 MHz. (United States)


    ... to ISM equipment operated under the provisions of part 18 of this chapter. Many of these Government... or arrays that comprise the device, i.e., the sum of the power supplied to all antennas, antenna elements, staves, etc. and summed across all carriers or frequency channels, shall not exceed the limit...

  19. Erratum: International Journal of Global Energy Issues, Vol. 13, Nos. 1-3, 2000, p.247. Bent Soerensen and Peter Meibom 'A global renewable energy scenario'

    International Nuclear Information System (INIS)


    5.1 ecentralised renewable energy 2050 scenario. The demand categories have already, as shown in Table 6, been simplified under the assumption of an abundant fraction of the supply being in the form of electric energy. We now determine the sources of supply for each demand type. For the vegetable food-fraction, the results of comparing local supply and demand are shown in Figures 38 and 39, where Figure 38 shows the amount of surplus for those geographical grid cells, where supply exceeds demand, and Figure 39 shows the amount of deficit for those local cells where demand exceeds supply. Regional sums are given in Table 10, while the sums of individual contributions to demand and supply are given in Tables 6 and 8. It follows that on average, worldwide supply exceeds demand by 35%. This must be considered reasonable, as there has to be room for variations in crop harvests and thus food production from year to year, and further the transportation required for evening out supply and demand will entail some additional losses. Like today, there is surplus vegetable food production in the Americas and Western Europe (regions 1, 2 and 4), and by the year 2050 also in region 3 (including Russia), due to substantial improvements in agricultural practices assumed for this region. Region 5 (including China and India) will be just self-sufficient by the year 2050, whereas Africa (region 6) will have a deficit that must be covered by imports. In the scenario, Africa is the only region that by 2050 is in a development situation where it may offer labour at lower expense that the other regions, and thus there will be the possibility of paying for food imports by industrial revenues, provided that an education policy is pursued, that will give the workforce the necessary skills. In addition to inter-regional exchange, Figures 38 and 39 indicate scenario requirements for transport of vegetable food within regions, especially from farming areas into cities. The scenario assumptions for inter-regional trade in food is indicated in Figures 55-60, where the regional exports have been selected from the surpluses available. The substantial needs for both vegetable and animal foods in Africa are uniformly imported from regions 1-4. (author)

  20. Effect of tensile dwell on high-temperature low-cycle fatigue and fracture behaviour of cast superalloy MAR-M247

    Czech Academy of Sciences Publication Activity Database

    Šulák, Ivo; Obrtlík, Karel


    Roč. 185, NOV (2017), s. 92-100 ISSN 0013-7944. [ICMFM 2016 - International Colloquium on Mechanical Fatigue of Metals /18./. Gijón, 05.09.2016-07.09.2016] R&D Projects: GA ČR(CZ) GA15-20991S Institutional support: RVO:68081723 Keywords : Nickel-based superalloy * High-temperature low-cycle fatigue * Tensile dwell * Fatigue life * Damage mechanisms Subject RIV: JL - Materials Fatigue, Friction Mechanics OBOR OECD: Audio engineering, reliability analysis Impact factor: 2.151, year: 2016

  1. Improvement activities to soil stabilization near Bolivia-Brazil gas pipeline crossing through an embankment over a corrugated drainage pipe, at Km 247 in Mato Grosso do Sul, Brazil; Melhorias para estabilidade do gasoduto Bolivia-Brasil em cruzamento de aterro sobre tubo de drenagem tipo ARMCO, no km 247 em Mato Grosso do Sul

    Energy Technology Data Exchange (ETDEWEB)

    Jorge, Kemal Vieira [TBG - Transportadora Brasileira Gasoduto Bolivia Brasil S.A., Rio de Janeiro, RJ (Brazil); Costa, Cesar Augusto [TBG - Transportadora Brasileira Gasoduto Bolivia Brasil S.A., Campo Grande, MS (Brazil). Gerencia Regional Centro Oeste (CRGO)


    A hundred and seventy kilometers from Campo Grande city, on Mato Grosso do Sul State, the Brasil-Bolivia Gas Pipeline crosses a 8,5 meters high landfill, over a drainage systems made of a 2,8 meters of diameter corrugated pipe. This drainage pipe was installed to allow the drainage of the valley, and the landfill above it was built so the Gas pipeline could cross easier the 80 meters deep and 30 degree vertices valley. This paper illustrates the work tasks and solutions taken to monitor and guarantee the integrity of the drainage and landfill structures, as well as the integrity of the Gas Pipeline. Some of the work tasks illustrated are the investigation of the support conditions of the Gas Pipeline, the analysis of a drainage system under the pipeline, on a rocky soil, the analysis of the stability of the landfill, the construction of a gravity retaining walls and the monitoring of the deformations on the drainage pipe. (author)

  2. Work/Family Balancing and 24/7 Work Schedules: Network Analysis of Strategies in a Transport Company Cleaning Service: Concilier travail-famille et horaires 24/7: analyse réseau des stratégies au sein du service de nettoyage d'une compagnie de transport. (United States)

    Lefrançois, Mélanie; Saint-Charles, Johanne; Riel, Jessica


    Whether or not official work/family balance measures exist within an organization, scheduling accommodations often go through informal channels involving colleagues and superiors and are negotiated within interpersonal relationships. This study examines the relationship dimensions of the scheduling strategies of cleaners working atypical hours in the transport sector through the lenses of ergonomic activity, network, and gender analyses. Using semi-directed interviews, observation, and network analysis, we revealed the effect of gender on relationship dynamics and the influence of these dynamics on work/family balance strategies deployed by cleaners. One of the main contributions of this study is to demonstrate the decisive effect of relationships by revealing inequalities in access to organizational social networks. Creating spaces to discuss work/family balancing and a more equitable circulation of information could contribute to reducing inequalities associated with gender, social status, and family responsibilities and support the work/family strategies developed by workers dealing with restrictive work schedules. Résumé Les accommodements du temps de travail pour la conciliation travail-famille (CTF) passent souvent par des ententes informelles qui s'inscrivent dans les relations entre collègues ou avec des gestionnaires. Notre étude, intégrant l'ergonomie et la communication dans une perspective de genre, porte sur les dimensions relationnelles des stratégies de choix d'horaire d'agentes et agents de nettoyage devant composer avec des horaires atypiques dans le secteur des transports. À partir d'entretiens semi-dirigés, d'observations et d'analyse de réseaux, nous avons pu observer l'influence des dynamiques relationnelles, notamment de genre, sur les stratégies de CTF. Un apport central de cette étude est de montrer l'effet structurant des relations en révélant notamment des inégalités dans l'accès aux ressources facilitant le choix d'horaire, mais aussi dans l'inclusion au sein du réseau de relations. L'article conclut en proposant des pistes de solutions concrètes pour la réduction de ces inégalités.

  3. Chemistry of the heaviest elements--one atom at a time

    International Nuclear Information System (INIS)

    Hoffman, Darleane C.; Lee, Diana M.


    In keeping with the goal of the Viewpoint series of the Journal of Chemical Education, this article gives a 75-year perspective of the chemistry of the heaviest elements, including a 50-year retrospective view of past developments, a summary of current research achievements and applications, and some predictions about exciting, new developments that might be envisioned within the next 25 years. A historical perspective of the importance of chemical separations in the discoveries of the transuranium elements from neptunium (Z=93) through mendelevium (Z=101) is given. The development of techniques for studying the chemical properties of mendelevium and still heavier elements on the basis of measuring the radioactive decay of a single atom (''atom-at-a-time'' chemistry) and combining the results of many separate experiments is reviewed. The influence of relativistic effects (expected to increase as Z 2 ) on chemical properties is discussed. The results from recent atom-at-a-time studies of the chemistry of the heaviest elements through seaborgium (Z=106) are summarized and show that their properties cannot be readily predicted based on simple extrapolation from the properties of their lighter homologues in the periodic table. The prospects for extending chemical studies to still heavier elements than seaborgium are considered and appear promising

  4. Retraction: Kartelija G, Nedeljković M, Radenović L. Photosensitive neurons in mollusks, Arch Biol Sci. 2005; 57(4:247-58, DOI:10.2298/ABS0504247K

    Directory of Open Access Journals (Sweden)



    Full Text Available This is a notice of retraction of the article: Photosensitive neurons in mollusks, published in the Archives of Biological Sciences in 2005, Vol. 57, Issue 4. The editorial board has been informed that this paper plagiarizes an earlier paper: Kartelija G, Nedeljkovic M, Radenovic L. Photosensitive neurons in mollusks. Comp Biochem Physiol A Mol Integr Physiol. 2003, 134(3:483-495. This claim is correct and the entire paper is a verbatim copy of the earlier one. After confirmation of this fact, the editorial board of the Archives of Biological Sciences has decided to retract the paper immediately. We apologize to the readers of the journal that it took so many years to notice this error and to retract the paper. We request readers of the journal to directly get in touch with the editorial office and the editors of the journal for similar cases in the future, so that they can be handled promptly. Link to the retracted article 10.2298/ABS0504247K

  5. A Review of the Literature on Social and Emotional Learning for Students Ages 3-8: Teacher and Classroom Strategies that Contribute to Social and Emotional Learning (Part 3 of 4). REL 2017-247 (United States)

    O'Conner, Rosemarie; De Feyter, Jessica; Carr, Alyssa; Luo, Jia Lisa; Romm, Helen


    Social and emotional learning (SEL) is the process by which children and adults learn to understand and manage emotions, maintain positive relationships, and make responsible decisions. This is the third in a series of four related reports about what is known about SEL programs for students ages 3-8. The report series addresses four issues raised…

  6. Cultura corporal na pauta do jornal: notas de uma análise a partir do "Programa AN Escola"doi: 10.5007/2175-8042.2010v22n35p247

    Directory of Open Access Journals (Sweden)

    Daniel Minuzzi de Souza


    Full Text Available Este estudo objetivou apresentar elementos de uma análise de um programa de jornal escolar, em que identificamos matérias referentes aos conteúdos da cultura corporal. Para tanto, utilizamos procedimentos de análise de conteúdo para analisar o suplemento AN Escola, tendo o recorte temporal de 2004-2008. Nesse corpus identificamos a presença de conteúdos da cultura corporal em 1145 matérias que foram distribuídas em 11 categorias (Esporte, Temas transversais, Lazer, Corpo/identidade, Jogos/brincadeiras, Saúde, Estética, Circo, Dança, Lutas, e Outros. As conclusões apontam indícios de o Programa AN Escola tratar-se de mais uma estratégia de marketing institucional do que ser um programa que promove mídia-educação, apesar dessa possibilidade.

  7. Comments on the paper 'Phase diagram calculations of the U-Pu-N system with carbon and oxygen impurities', by D.D. Sood, R. Agarwal, V. Venugopal, ibid., vol.247, p.299, 1997

    International Nuclear Information System (INIS)

    Jain, G.C.


    We published a paper entitled 'Experimental evaluation of oxygen solubility in UN, PuN and (U,Pu)N' authored by G.C. Jain and C. Ganguly (1993). Oxygen solubility limits were experimentally determined from lattice parameter and composition of the phases. The lattice parameter was determined from X-ray diffraction measurement and the composition was evaluated from chemical analysis results. Sood et al. have m[e some comments on a part of our data on the UNCO and PuNCO systems in the last two paragraphs in the chapter of Results and discussion on p. 299 of their above cited paper. In this context, the following comments are offered. (orig.)

  8. The discovery of 260Md and the decay properties of 258Fm, 258m,gMd and 259Md

    International Nuclear Information System (INIS)

    Lougheed, R.W.; Hulet, E.K.; Dougan, R.J.; Wild, J.F.; Dupzyk, R.J.; Henderson, C.M.; Moody, K.J.; Hahn, R.L.; Suemmerer, K.; Bethune, G.


    We have discovered a new neutron-rich isotope, 260 Md, from 18 O and 22 Ne bombardments of 254 Es. We observed a spontaneous-fission (SF) activity with a half-life of 32 days in electromagnetically separated fractions with mass number 260 from these bombardments and we measured the mass and kinetic energy distributions of this SF activity. The mass distribution was symmetric with the principal energy peak at a total kinetic energy (TKE) of 234 MeV, similar to previous observations for heavy fermium isotopes. Surprisingly, we also observed a smaller symmetric component with a TKE of 195 MeV. We interpret these two peaks in the TKE distribution as arising from two types of fission in the same nucleus, or bimodal fission. The observed fission activity may be either from the SF decay of 260 Md or from 260 Fm which would arise from electron-capture (EC) decay of 260 Md. We have eliminated the possible β - decay of 260 Md by measuring β - -SF time correlations for the decay of 260 Md and we plan to determine whether 260 Md decays by EC by measuring time correlations between fermium X-rays and SF events. We also measured various properties of the heavy fermium and mendelevium isotopes and obtained 1. more accurate cross-sections for the neutron-rich mendelevium isotopes which we use to predict the production rates of yet undiscovered nuclides, 2. improved half-life measurements for 258m,g Md and 259 Md, 3. confirmation of the EC decay of 258m Md by measurement of the fermium X-rays preceding the SF decay of 258 Fm and 4. very substantially improved mass and TKE distributions for the SF decay of 258 Fm and 259 Md. (orig.)

  9. ORF Alignment: NC_002976 [GENIUS II[Archive

    Lifescience Database Archive (English)


  10. ORF Alignment: NC_002977 [GENIUS II[Archive

    Lifescience Database Archive (English)


  11. ORF Alignment: NC_006368 [GENIUS II[Archive

    Lifescience Database Archive (English)


  12. Learning by bidding: evidence from a large-scale natural experiment

    Czech Academy of Sciences Publication Activity Database

    Hanousek, Jan; Kočenda, Evžen

    -, č. 247 (2005), s. 1-33 ISSN 1211-3298 Institutional research plan: CEZ:AV0Z70850503 Keywords : learning * natural experiment * auction Subject RIV: AH - Economics

  13. 78 FR 15711 - Submission for OMB Review; Comment Request (United States)


    ... Documentation/Instructions; DFARS 247.207 and the related clause at 252.247-7028; OMB Control Number 0704-0250...-7004 is used by contracting officers use to determine if contractor material management and accounting...

  14. RIBEIRO, Nelson de Figueiredo. A questão geopolítica da Amazônia: da soberania difusa a soberania restrita. Belém: EDUFPA, 2006, 417 p. ISBN 85-247-0337-7 - DOI: 10.5801/ncn.v16i1.1202


    da Silva, Alberto Teixeira; de Sena Júnior, Paulo Roberto

    2013-01-01 No limiar do século XXI, a Amazônia como fronteira periférica do capitalismo contemporâneo, tornou-se espaço territorial estratégico pelos estoques de biodiversidade, abundância de recursos hídricos e serviços climáticos indispensáveis para a manutenção do equilíbrio planetário, colocando em pauta questões controversas sobre soberania, defesa, segurança, presença de múltiplos stakeholders e, sobretudo, o desafio de conciliar crescimento econômico, just...

  15. Sistemas de trabalho de alto envolvimento (STAE sobre a perspectiva da dimensão soft da gestão estratégica de pessoas: análise de conteúdo de 2000 a 2012

    Directory of Open Access Journals (Sweden)

    Denilson Aparecida Leite Freire


    Full Text Available Esse artigo teve por objetivo comparar as variáveis que compõe os Sistemas de Trabalho de Alto Envolvimento (CIAVARELLA, 2003 com as estratégias “Hard” e “Soft” (LEGGE, 1995 e de Controle e Comprometimento (WALTON, 1985, sugerindo um modelo de análise que favoreça futuras investigações desses sistemas. O trabalho demonstrou que se pode efetuar, teoricamente, uma comparação entre as variáveis investigadas, contudo, há a necessidade de pesquisas quantitativas, que mensurem as correlações necessárias para validação do modelo de Análise. A análise de conteúdo das publicações da ANPAD de 2000 a 2012 revelaram poucos estudos, indicando a necessidade de estudos sobre esses sistemas.

  16. Antonio Maria Baggio (ed.), Adriana Cossedu, Paolo Giusta, Rodrigo Mardones Z. y Antonio Márquez Prieto, Caino e i suoi fratelli. Il fondamento relazionale nella politica e nel diritto, Città Nuova, Roma, 2012, 247 págs.


    María Salas Porras


    Los estudios recogidos en este volumen intentan reinterpretar los fundamentos de la Política y del Derecho, enmarcados en el horizonte relacional que la fraternidad les abre. Desde esta perspectiva, la fraternidad asume una relevancia política y jurídica en la medida en que se la entienda sustancialmente ligada a la libertad y a la igualdad. Cada una de las tres categorías, en la medida en que sean consideradas conjuntamente, llegan a adquirir su propio significado a través de la relación con...

  17. Antonio Maria Baggio (ed., Adriana Cossedu, Paolo Giusta, Rodrigo Mardones Z. y Antonio Márquez Prieto, Caino e i suoi fratelli. Il fondamento relazionale nella politica e nel diritto, Città Nuova, Roma, 2012, 247 págs.

    Directory of Open Access Journals (Sweden)

    María Salas Porras


    Full Text Available Los estudios recogidos en este volumen intentan reinterpretar los fundamentos de la Política y del Derecho, enmarcados en el horizonte relacional que la fraternidad les abre. Desde esta perspectiva, la fraternidad asume una relevancia política y jurídica en la medida en que se la entienda sustancialmente ligada a la libertad y a la igualdad. Cada una de las tres categorías, en la medida en que sean consideradas conjuntamente, llegan a adquirir su propio significado a través de la relación con las otras. El redescubrimiento de la fraternidad significa por tanto volver a proponer el "tríptico" entero, para recuperar, a través del mismo, el proyecto humanísitico de la modernidad, y liberarnos del destino del conflicto radical al que nuestro tiempo parece condenado: Caín no sólo ha matado a su hermano, sino que también ha fundado la primera ciudad, es decir, el lugar donde la violencia se ve confinada por el gobierno y por las leyes. Abrir el Derecho al horizonte de la fraternidad significa, hoy, llevar la racionalidad jurídica más allá de la mera racionalidad técnica; permitir renovar la relación jurídica, volver a encontrar sus fundamentos humanísticos, redescubriendo una justicia que reconcilia y reconstruye, fortificando el vínculo social. Considerar la fraternidad una categoría política significa poder emitir juicios políticos, capaces de producir un pensamiento político a través de la óptica de la fraternidad; se abandonan así las lógicas de la ideología, para intentar construir una forma de pensamiento en disposición de pasar, de una idea intuitiva de fraternidad, a una definición que la haga operativa, "operacionalizable". Es una tarea que no corresponde hoy a una sola disciplina, sino que interesa a todo el conjunto de los ya numerosos estudiosos que se han enrolado en este frente, interactuando entre sí de manera interdisiciplinar y abriendo un camino en el cual resulte posible, a todos los que han abrazado un humanismo y un ideal político, encontrar las mejores razones de su esperanza.

  18. ‘A dialogue about the art of portraiture’ Originally published as ‘Gespräch von der Bildniskunst’, Österreichische Rundschau, Volume 6, 1906, 502—516, and republished: Julius Schlosser, Präludien Vorträge und Aufsätze, Berlin: Bard 1927, 227—247. Translated with an introduction by Karl Johns

    Directory of Open Access Journals (Sweden)

    Julius Schlosser


    Full Text Available In an unusually popular and readable dialogue form, Schlosser alludes to the classical education he takes for granted in any reader approaching his favourite ‘thorny’ questions from aesthetics and history. These involve the problems of naturalism, impressionism, portrait likeness, psychology of perception and numerous others being bandied around academic circles at the turn of the century. It is of further interest in directly referring critically to his recently deceased friend (Alois Riegl, and being written just at a moment in his career when Schlosser had been casting around the ideas of Ernst Brücke, Konrad Lange, even Henri Bergson, but had discovered the recent contribution of Benedetto Croce, which would colour his approach with an increasing intensity for the remainder of his life. He became what might be seen as the archetypical art historical theorist, but continues to distinguish himself from his successors by his greater consistency.

  19. Optical simulations for the S3 project - Super separator spectrometer - gamma-electron coincidence spectroscopy of a transfermium nucleus: the 251Md101

    International Nuclear Information System (INIS)

    Dechery, Fabien


    In analogy with the atomic closed shells giving rise to the stability and high ionisation energies of noble gases, nuclear physics also has its magic numbers of protons and neutrons which enhance nuclear structure stability. Knowledge of the structure of doubly-magic nuclei, both proton and neutron numbers, is crucial to parameterize theoretical models. The discovery of the next and ultimate magic numbers will provide a strong constraint on the many predictions. These two numbers are like the centre coordinates of an area of enhanced stability of the nuclear chart, well known as 'island of stability'. These superheavy nuclei only exist due to pure quantum shell effects. My thesis work deals with two distinct, but complementary, aspects of fundamental physics with the common goal of studying these extreme mass nuclei structure. The first part corresponds to the development of a next generation instrument for nuclear physics to allow synthesis and spectroscopy studies of superheavy nuclei: the Super Separator Spectrometer S 3 . This project will be installed at SPIRAL2 (GANIL) and has been approved by the French Research National Agency (ANR) within the EQUIPEX framework. It has been designed to take advantage of the high intensity heavy ion beam from the LINAC, giving access to a wide range of physical programs. The second part corresponds to the preparation, realisation and analysis of an experiment on 251-Mendelevium in which the very first prompt gamma-electron coincidence spectroscopy was performed for a transfermium nuclei. (author) [fr

  20. ORF Alignment: NC_003074 [GENIUS II[Archive

    Lifescience Database Archive (English)


  1. ORF Alignment: NC_002944 [GENIUS II[Archive

    Lifescience Database Archive (English)


  2. ORF Alignment: NC_003450 [GENIUS II[Archive

    Lifescience Database Archive (English)


  3. ORF Alignment: NC_006361 [GENIUS II[Archive

    Lifescience Database Archive (English)


  4. ORF Alignment: NC_004578 [GENIUS II[Archive

    Lifescience Database Archive (English)


  5. Epistemologia da educação física: análise da produção científica do programa de pós-graduação da faculdade de educação física da Unicamp (1991-2008 DOI:10.5007/2175-8042.2011v23n36p247

    Directory of Open Access Journals (Sweden)

    Julia Paula Motta de Souza


    Full Text Available Este artigo tem como objetivo apresentar uma síntese dos resultados de uma pesquisa sobre a produção científica do Programa de Pós-Graduação da Faculdade de Educação Física da UNICAMP de 1991 a 2008. O estudo tomou como referência a análise epistemológica, considerada como meta-análise, ou estudos de segunda ordem, que procuram a compreensão a respeito da investigação científica de um determinado campo do conhecimento - primeira ordem - e pretende estimular na ciência um processo de auto-reflexão e autocrítica sobre seus resultados e sobre os processos e condições da sua produção. A análise foi composta de duas dimensões: a lógica que articula os elementos da produção do conhecimento pretendida em cada pesquisa e a histórica que busca compreender as condições materiais e político-sociais que determinam essa produção. Algumas questões teórico-metodológicas emergiram com a análise destes resultados como: a a distinção entre fato e valor, ou entre conhecimento e interesse; b diferenças e aproximações entre as ciências naturais e as ciências humanas no campo científico da educação física; c a manifestação das novas epistemologias; d a alternativa crítica como opção para mudança do quadro que está posto, já que mais do que quantidade de pesquisas científicas é preciso se decidir sobre o tipo de ciência que é necessário produzir. A responsabilidade social do pesquisador pode vir da consciência crítica de que a ciência não é neutra e que esta não neutralidade começa na escolha do próprio problema de pesquisa e na forma de se aproximar dele.

  6. Application of alpha spectrometry to the discovery of new elements by heavy-ion-beam bombardment

    International Nuclear Information System (INIS)

    Nitschke, J.M.


    Starting with polonium in 1898, α-spectrometry has played a decisive role in the discovery of new, heavy elements. For even-even nuclei, α-spectra have proved simple to interpret and exhibit systematic trends that allow extrapolation to unknown isotopes. The early discovery of the natural α-decay series led to the very powerful method of genetically linking the decay of new elements to the well-established α-emission of daughter and granddaughter nuclei. This technique has been used for all recent discoveries of new elements including Z = 109. Up to mendelevium (Z = 101), thin samples suitable for α-spectrometry were prepared by chemical methods. With the advent of heavy-ion accelerators new sample preparation methods emerged. These were based on the large momentum transfer associated with heavy-ion reactions, which produced energetic target recoils that, when ejected from the target, could be thermalized in He gas. Subsequent electrical deposition or a He-jet technique yielded samples that were not only thin enough for α-spectroscopy, but also for α- and #betta#-recoil experiments. Many variations of these methods have been developed and are discussed. For the synthesis of element 106 an aerosol-based recoil transport technique was devised. In the most recent experiments, α-spectrometry has been coupled with the magnetic analysis of the recoils. The time from production to analysis of an isotope has thereby been reduced to 10 - 6 s; while it was 10 - 1 to 10 0 s for He-jets and 10 1 to 10 3 s for rapid chemical separations. Experiments are now in progress to synthesize super heavy elements (SHE) and to analyze them with these latest techniques. Again, α-spectrometry will play a major role since the expected signature for the decay of a SHE is a sequence of α-decays followed by spontaneous fission

  7. ORF Alignment: NC_002942 [GENIUS II[Archive

    Lifescience Database Archive (English)


  8. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. M R Meshram1 Nawal K Agrawal1 Bharoti Sinha1 P S Misra2. Department of Electronics and Computer Engineering, Indian Institute of Technology, Roorkee 247 667, India; Department of Metallurgical and Materials Engineering, Indian Institute of Technology, Roorkee 247 667, India ...

  9. 76 FR 61279 - Defense Federal Acquisition Regulation Supplement; Defense Cargo Riding Gang Member (DFARS Case... (United States)


    ... that the language of the proposed clause be amended to read as follows to reinforce DoD's role in the... Military Sealift Command), and specific procedural guidance for DoD personnel obtaining the background... 247.5. B. Language Inconsistency Comment: DFARS 252.247-7027(a) defines ``riding gang member'' as it...

  10. 75 FR 51416 - Defense Federal Acquisition Regulation Supplement; Transportation (DFARS Case 2003-D028) (United States)


    ... Returnable containers other than cylinders. Use the clause at 252.247-7021, Returnable Containers Other Than..., spools, or other returnable containers if the ] contractor is to retain title to the containers. 247.370... sea. (c) If the contractor notifies the contracting officer that the contractor or a subcontractor...

  11. Cultural Economy, Capitalism and the Logic of the Public Sphere

    DEFF Research Database (Denmark)

    Schwarzkopf, Stefan


    Review essay: Promotional Cultures: The Rise and Spread of Advertising, Public Relations, Marketing and Branding/ by Aeron Davis. (Polity, 2013, ISBN 978-0-7456-3983-3, 247 + xi pp.......Review essay: Promotional Cultures: The Rise and Spread of Advertising, Public Relations, Marketing and Branding/ by Aeron Davis. (Polity, 2013, ISBN 978-0-7456-3983-3, 247 + xi pp....

  12. Production of Aspergillus niger β-mannosidase in Pichia pastoris

    Czech Academy of Sciences Publication Activity Database

    Fliedrová, Barbora; Weignerová, Lenka; Křen, Vladimír


    Roč. 279, č. 1 (2012), s. 247-247 ISSN 1742-464X. [IUBMB Congress /22./ and FEBS Congress /37./. 04.09.2012-09.09.2012, Seville] R&D Projects: GA ČR GD305/09/H008; GA ČR GAP207/10/0321 Institutional support: RVO:61388971 Keywords : NAG-thiazoline

  13. Decline in snowfall in response to temperature in Satluj basin ...

    Indian Academy of Sciences (India)

    Riyaz Ahmad Mir1 2 Sanjay K Jain3 Arun K Saraf1 Ajanta Goswami4. Department of Earth Sciences, Indian Institute of Technology, Roorkee 247 667, India. Geological Survey of India, State Unit: J&K, Srinagar, 190 008, India. National Institute of Hydrology, Roorkee 247 667, India. Indian Institute of Remote Sensing, ...

  14. Život i djelo Dmitrija Ivanoviča Mendeljejeva - povodom 100. obljetnice smrti

    Directory of Open Access Journals (Sweden)

    Vaščić, V.


    Full Text Available The life and activities of D. I. Mendeleyev are presented primarily in view of his role in the progress of chemistry. Born in Tobolsk in 1834 to a numerous and poor family, burdened by the family's bad luck and his ill health, he graduated natural sciences in 1855 at St. Petersburg and was awarded a gold medal for exceptional success. In 1855/56 he was teacher at a secondary school in Odessa. He obtained his MSc degree in 1856 in St. Petersburg where he was appointed lecturer in 1857. He was guest scientist 1859-1861 at the University in Heidelberg where he investigated the behavior of gases under various pressures and temperatures and discovered the criticaltemperature of liquefaction. He achieved his PhD degree in 1865 in St. Petersburg with a thesis on ethanol/water mixtures. Therein he had proven the existence of alcohol hydrates. His work later enabled the elaboration of modern conceptions on solvate formation in solutions. In 1865 he was elected professor at the University in St. Petersburg where he worked until 1890 when he was forced to retire. Preparing his textbook "Fundamentals of Chemistry" in 1869, he discovered that properties of chemical elements depend periodically on atomic weights. This enabled the elaboration of a periodic system as the base for classification in chemistry, as well as for further research and development of chemical science and technology. The international scientific community accepted Mendeleyev's system with distrust and it was generally acknowledged not before three "prophecies" of Mendeleyev were realized by the discovery of gallium (1875, scandium (1879 and germanium (1886. Later, in verification of his predictions, other elements - including transuranics - were discovered. Hence, in honor of the creator of the periodic system, the element of atomic number 101 was named mendelevium (1955. Mendeleyev was reactivated in 1892 as director of the Central Bureau for Measures and Weights where he worked until

  15. Retinitis Pigmentosa Mutations in Bad Response to Refrigeration 2 (Brr2) Impair ATPase and Helicase Activity. (United States)

    Ledoux, Sarah; Guthrie, Christine


    Brr2 is an RNA-dependent ATPase required to unwind the U4/U6 snRNA duplex during spliceosome assembly. Mutations within the ratchet helix of the Brr2 RNA binding channel result in a form of degenerative human blindness known as retinitis pigmentosa (RP). The biochemical consequences of these mutations on Brr2's RNA binding, helicase, and ATPase activity have not yet been characterized. Therefore, we identified the largest construct of Brr2 that is soluble in vitro, which truncates the first 247 amino acids of the N terminus (Δ247-Brr2), to characterize the effects of the RP mutations on Brr2 activity. The Δ247-Brr2 RP mutants exhibit a gradient of severity of weakened RNA binding, reduced helicase activity, and reduced ATPase activity compared with wild type Δ247-Brr2. The globular C-terminal Jab1/Mpn1-like domain of Prp8 increases the ability of Δ247-Brr2 to bind the U4/U6 snRNA duplex at high pH and increases Δ247-Brr2's RNA-dependent ATPase activity and the extent of RNA unwinding. However, this domain of Prp8 does not differentially affect the Δ247-Brr2 RP mutants compared with the wild type Δ247-Brr2. When stimulated by Prp8, wild type Δ247-Brr2 is able to unwind long stable duplexes in vitro, and even the RP mutants capable of binding RNA with tight affinity are incapable of fully unwinding short duplex RNAs. Our data suggest that the RP mutations within the ratchet helix impair Brr2 translocation through RNA helices. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. RAVI KANT1 UJJWAL PRAKASH1 VIJAYA AGARWALA1 V V SATYA PRASAD2. Department of Metallurgical and Materials Engineering, IIT Roorkee, Roorkee 247 667, India; Defence Metallurgical Research Laboratory, Kanchanbagh, Hyderabad 500 058, India ...

  17. on the performance of Autoregressive Moving Average Polynomial

    African Journals Online (AJOL)

    Timothy Ademakinwa

    Using numerical example, DL, PDL, ARPDL and. ARMAPDL models were fitted. Autoregressive Moving Average Polynomial Distributed Lag Model. (ARMAPDL) model performed better than the other models. Keywords: Distributed Lag Model, Selection Criterion, Parameter Estimation, Residual Variance. ABSTRACT. 247.

  18. Alzheimer's Disease Facts and Figures

    Medline Plus

    Full Text Available | Find Your Chapter 24/7 Helpline: 1.800.272.3900 Find your chapter: search by state In My Area | Alzheimer's & Dementia | Life with ALZ | Research | Professionals |

  • Sigmodontinae, Rodentia

    Indian Academy of Sciences (India)

    Wagner) and O. mamorae (Thomas). Am. Mus. Novit. 3661, 1–32. Catzeflis F. and Tilak M. 2009 Molecular systematic of Neotropi- cal spiny mice (Neacomys: Sigmodontinae, Rodentia) from the. Guianan Region. Mammalia 73, 239–247.

  • Alzheimer's Disease Facts and Figures

    Medline Plus

    Full Text Available | Find Your Chapter 24/7 Helpline: 1.800.272.3900 Find your chapter: search by state In My Area | Alzheimer's & Dementia | Life with ALZ | Research | Professionals |

    1. Effect of carbon on corrosion resistance of powder-processed Fe–0 ...

      Indian Academy of Sciences (India)

      Metallurgical and Materials Engineering Department, National Institute of Technology Srinagar, Srinagar 190 006, India; Department of Mechanical Engineering, Indian Institute of Technology, New Delhi 110 016, India; Metallurgical and Materials Engineering Department, Indian Institute of Technology, Roorkee 247 667, ...

    2. 78 FR 23581 - Federal Property Suitable as Facilities To Assist the Homeless (United States)


      ... Directions: includes 2 Bldgs.; masonry 2,048 sf. +/-, frame 5,513 sf. +/- Comments: bldgs. sits on .83 acres...-NV-565 Comments: 81,247 sf.; current use: federal bldg.; extensive structural issues; needs major...

    3. Influence of fretting on the fatigue strength at the vise clamp ...

      Indian Academy of Sciences (India)

      Author Affiliations. Abdulhaqq A Hamid1 2 Rafi K Yahya1. Mechanical Engineering Department, College of Engineering, University of Mosul, Mosul, Iraq; Mechanical and Industrial Engineering Department, Indian Institute of Technology, Roorkee 247 667, India ...

    4. Trematodes of fishes of the Indo-west Pacific: told and untold richness

      Czech Academy of Sciences Publication Activity Database

      Cribb, T.H.; Bray, R. A.; Diaz, P.E.; Huston, D.C.; Kudlai, Olena; Martin, S.B.; Yong, R.Q.-Y.; Cutmore, S.C.


      Roč. 93, č. 3 (2016), s. 237-247 ISSN 0165-5752 Institutional support: RVO:60077344 Keywords : Great Barrier reef * French Polynesia * Cardicola forsteri Subject RIV: EH - Ecology, Behaviour Impact factor: 1.181, year: 2016

    5. 75 FR 57284 - Agency Information Collection Activities: Cost Submission (United States)


      ... Form 247, Cost Submission, is used by CBP to assist in correctly calculating the duty on imported... Respondent: 1. Estimated time per Response: 50 hours. Estimated Total Annual Burden Hours: 50,000. [[Page 57285

    6. Ilmus väärt artiklikogumik / Arvo Tering

      Index Scriptorium Estoniae

      Tering, Arvo, 1949-


      Arvustus: Ajalookirjutaja aeg = Aetas historicum / Eesti Rahvusraamatukogu ; koost. Piret Lotman. - Tallinn, 2008. - 247 lk. - (Eesti Rahvusraamatukogu toimetised. A, Raamat ja aeg, 1736-6984 ; nr. 1) ; (Eesti Rahvusraamatukogu toimetised ; 11)

    7. Communication, timing, and common learning

      Czech Academy of Sciences Publication Activity Database

      Steiner, Jakub; Stewart, C.


      Roč. 146, č. 1 (2011), s. 230-247 ISSN 0022-0531 Institutional research plan: CEZ:AV0Z70850503 Keywords : common knowledge * learning * communication Subject RIV: AH - Economics Impact factor: 1.235, year: 2011

    8. A new temperature-dependent equation of state of solids

      Indian Academy of Sciences (India)

      Author Affiliations. Kamal Kapoor1 Anuj Kumar2 Narsingh Dass1. Physics Department, College of Engineering Roorkee, Roorkee 247 667, India; Physics Department, Gurukul Kangri Vishwavidyalaya, Haridwar 249 404, India ...

    9. Electroless deposition, post annealing and characterization of nickel ...

      Indian Academy of Sciences (India)

      Department of Metallurgical & Materials Engineering, Indian Institute of Technology, Roorkee 247 667, India; Department of Physics, Columbia University, New York, USA; Spectroscopy Division, TPPED, Bhabha Atomic Research Centre, Mumbai 400 085, India; Crystal Technology Laboratory, TPPED, Bhabha Atomic ...

    10. Barokní opevnění Prahy v trase stavby tunelu Blanka

      Czech Academy of Sciences Publication Activity Database

      Bartošová, V.; Herichová, Iva; Kašička, F.; Tomková, Kateřina


      Roč. 70, č. 4 (2010), s. 239-247 ISSN 1210-5538 Institutional research plan: CEZ:AV0Z80020508 Keywords : Baroque fortification * Prague * preservation of monuments * archaeological excavation Subject RIV: AC - Archeology, Anthropology, Ethnology

    11. Bezradnost metodologie kosmologie?

      Czech Academy of Sciences Publication Activity Database

      Havlík, Vladimír


      Roč. 63, č. 2 (2015), s. 247-266 ISSN 0015-1831 Institutional support: RVO:67985955 Keywords : methodology of science * anomalies * dark energy * dark matter * I. Lakatos * T. Kuhn Subject RIV: AA - Philosophy ; Religion

    12. Disease: H01460 [KEGG MEDICUS

      Lifescience Database Archive (English)

      Full Text Available ourth D, Galanopoulou AS ... TITLE ... Modeling new therapies for infantile spasms. ... JOURNAL ... Epilepsia... by ST3Gal-III deficiency. ... JOURNAL ... Epilepsia 54:e24-7 (2013) DOI:10.1111/epi.12050

    13. Application of random amplified polymorphic DNA (RAPD) markers ...

      African Journals Online (AJOL)



      1998). DNA fingerprinting of strawberry (Fragaria X ananassa) cultivars using randomly amplified polymorphic DNA (RAPD) markers. Euphytica. 102:247-253. Doyle JJ, Doyle LJ (1990). Isolation of plant DNA from fresh tissue.

    14. Historie a současný stav urychlovačů částic v českých zemích. II. Kruhové urychlovače

      Czech Academy of Sciences Publication Activity Database

      Janovský, I.; Šimáně, Čestmír


      Roč. 62, č. 4 (2012), s. 239-247 ISSN 0009-0700 Institutional support: RVO:61389005 Keywords : accelerator history * cyclic accelerator s Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders

    15. 76 FR 55989 - Self-Regulatory Organizations; Municipal Securities Rulemaking Board; Notice of Filing of... (United States)


      ... public pension funds) must have a reasonable basis to believe that the special entity has an independent... Internal Revenue Service summarized the legislative history of Section 6700. See H. Conf. Rep. No. 101-247...

    16. Proceedings of the Second Environmental Physics Conference (EPC-2006)

      International Nuclear Information System (INIS)

      Comsan, M.N.H.


      The publication has been set up as proceedings of the environmental physics conference. the conference consistes of atmospere and climate; the ecosystem; radiation and radioactivity; activity review; environmental issues. This conference consistes of 247p., figs., tabs., refs

    17. Report on progress of researches by common utilization of JAERI nuclear facilities, for fiscal 1992

      International Nuclear Information System (INIS)


      The results of the joint researches by utilizing the facilities of JAERI in 1992 fiscal year were summarized. The number of research themes in 1992 was 247 cases. In this book, 166 reports are collected. (J.P.N.)

    18. delta-Thiolactones as Prodrugs of Thiol-Based Glutamate Carboxypeptidase II (GCPII) Inhibitors

      Czech Academy of Sciences Publication Activity Database

      Ferraris, D. V.; Majer, Pavel; Ni, C.; Slusher, C. E.; Rais, R.; Wu, Y.; Wozniak, K. M.; Alt, J.; Rojas, C.; Slusher, B. S.; Tsukamoto, T.


      Roč. 57, č. 1 (2014), s. 243-247 ISSN 0022-2623 Institutional support: RVO:61388963 Keywords : pharmacokinetics * discovery * disorders * diagnosis * pain Subject RIV: CC - Organic Chemistry Impact factor: 5.447, year: 2014

    19. Bulletin of Materials Science | Indian Academy of Sciences

      Indian Academy of Sciences (India)

      Author Affiliations. Abdulhaqq A Hamid1 2 Rafi K Yahya1. Mechanical Engineering Department, College of Engineering, University of Mosul, Mosul, Iraq; Mechanical and Industrial Engineering Department, Indian Institute of Technology, Roorkee 247 667, India ...

    20. 77 FR 28252 - Oral Dosage Form New Animal Drugs; Change of Sponsor; Griseofulvin Powder; Levamisole... (United States)


      ... Sponsor; Griseofulvin Powder; Levamisole Hydrochloride Powder; Oxytetracycline Powder AGENCY: Food and... applications (ANADAs) for griseofulvin powder, levamisole hydrochloride soluble powder, and oxytetracycline..., ANADA 200-391 for Griseofulvin Powder, ANADAs 200-146 and 200-247 for Oxytetracycline Hydrochloride...

    1. A note on the tangent bundle of G/P

      Indian Academy of Sciences (India)

      . 39–50. [3] Donaldson S K, Infinite determinants, stable bundles, and curvature, Duke Math. J. 54. (1987) 231–247. [4] Kobayashi S, Differential geometry of complex vector bundles (NJ: Princeton University. Press, Princeton; Tokyo: Iwanami ...

    2. Gclust Server: 154498 [Gclust Server

      Lifescience Database Archive (English)

      Full Text Available 154498 SCE_YMR247W-A Cluster Sequences - 47 Identified by expression profiling and mass spectrometry...annotation Identified by expression profiling and mass spectrometry Number of Seq

    3. 78 FR 34881 - Special Local Regulations; Marine Events, Wrightsville Channel; Wrightsville Beach, NC (United States)


      .... Edge, Coast Guard Sector North Carolina, Coast Guard; telephone (252) 247-4525, email Joseph.M.Edge..., Program Manager, Docket Operations, telephone (202) 366-9826. SUPPLEMENTARY INFORMATION: Table of Acronyms...

    4. 76 FR 55407 - Announcement of Funding Awards; Public and Indian Housing Family Self-Sufficiency Program Under... (United States)


      ... strategies to coordinate the use of assistance under the Public Housing program with public and private........... MN 55071 29,247 Redevelopment Authority. Housing Authority of Kansas City, 301 East Armour...

    5. Právnický elektronický slovník (PES)

      Czech Academy of Sciences Publication Activity Database

      Cvrček, František


      Roč. 154, č. 3 (2015), s. 247-260 ISSN 0231-6625 Institutional support: RVO:68378122 Keywords : legal language * legal dictionaries * linguistic analysis of legal texts Subject RIV: AG - Legal Sciences

    6. Microstructure and oxidation performance of a γ–γ′ Pt-aluminide ...

      Indian Academy of Sciences (India)

      247LC alloy for about 100 h, whereas the coating imparted oxidation resistance for significantly longer duration of about 1000 h. The nature of surface damage that occurred to the -' coating during oxidation has been compared with that ...

    7. Alzheimer's Disease Facts and Figures

      Medline Plus

      Full Text Available ... were diagnosed in the mild cognitive impairment (MCI) stage — before dementia — it would collectively save $7 trillion ... symptoms What is dementia What is Alzheimer's 7 stages of Alzheimer's Treatments Contact us 24/7 Helpline: ...

    8. 8 CFR 223.2 - Processing. (United States)


      ... I-508F (election as to tax exemption under the Convention between the United States and the French Republic) required by part 247 of this chapter. (d) Effect of travel before a decision is made. Departure...

    9. 10 CFR 110.23 - General license for the export of byproduct material. (United States)


      ...) Actinium-225 and -227, americium-241 and -242m, californium-248, -249, -250, -251, -252, -253, and -254, curium-240, -241, -242, -243, -244, -245, -246 and -247, einsteinium-252, -253, -254 and -255, fermium...

    10. Development of a specification for flexible base construction. (United States)


      The Texas Department of Transportation (TxDOT) currently uses Item 247 Flexible Base to specify a : pavement foundation course. The goal of this project was to evaluate the current method of base course : acceptance and investigate methods to r...

    11. 0-6621 : developing a mixture-based specification for flexible base. (United States)


      The Texas Department of Transportation : (TxDOT) currently utilizes Item 247, Flexible : Base, to specify a foundation course of flexible : base utilized in a pavement. Base materials are : not allowed to be used by the contractors until : the ...

    12. The Prevalence of Enterhaemorrhagic Escherichia Coli in children ...

      African Journals Online (AJOL)

      EHEC), the pathogenicity of other strains of Escherichia coli and other organisms in children presenting with and without diarrhoea in the hospital. Subjects and Methods: A total of 247 stool samples collected from children aged 1 month to 7 ...

    13. Český knižní trh 2012: kvalitní díla i honba za penězi

      Czech Academy of Sciences Publication Activity Database

      Janáček, Pavel; Palán, A.; Weiss, T.; Růžička, L.; Mandys, P; Matoušek, P.; Trávníček, Jiří; Kopáč, R.


      Roč. 56, č. 247 (2012), s. 12-13 ISSN 0862-9587 Institutional support: RVO:68378068 Keywords : Czech prose * Czech poetry * comics * e-books * book publishing Subject RIV: AJ - Letters, Mass-media, Audiovision

    14. 2D Stabilised analytic signal method in DC pole-pole potential data ...

      Indian Academy of Sciences (India)

      Author Affiliations. Paras R Pujari1 Rambhatla G Sastry2. Scientist, National Environmental Engineering Research Institute (NEERI), Nehru Marg, Nagpur 440 020, India; Associate Professor, Department of Earth Sciences, IIT, Roorkee 247 667, India ...

    15. Infusorial concentration in rumen fluid of red deer, fallow deer, roe deer and moufflon

      Czech Academy of Sciences Publication Activity Database

      Kamler, Jiří


      Roč. 68, č. 4 (1999), s. 247-252 ISSN 0001-7213 R&D Projects: GA ČR GA206/97/0172; GA AV ČR KSK2005601 Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.227, year: 1999

    16. Understanding the Foraging Ecology of Beaked and Short-Finned Pilot Whales in Hawaiian Waters (United States)


      and Hildebrand, J. (2008). “Temporal pattern in the acoustic signals of beaked whales at Cross Seamount .” Biol. Lett. 4, 208-211. Lammers, M.O...1 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. Understanding the Foraging Ecology of Beaked and Short... Biology phone: (808) 247-5026 fax: (808) 247-5831 email: 2 Department of Oceanography University of Hawaii Award

    17. Alpha1a-Adrenoceptor Genetic Variant Triggers Vascular Smooth Muscle Cell Hyperproliferation and Agonist Induced Hypertrophy via EGFR Transactivation Pathway.

      Directory of Open Access Journals (Sweden)

      Irina Gradinaru

      Full Text Available α1a Adrenergic receptors (α1aARs are the predominant AR subtype in human vascular smooth muscle cells (SMCs. α1aARs in resistance vessels are crucial in the control of blood pressure, yet the impact of naturally occurring human α1aAR genetic variants in cardiovascular disorders remains poorly understood. To this end, we present novel findings demonstrating that 3D cultures of vascular SMCs expressing human α1aAR-247R (247R genetic variant demonstrate significantly increased SMC contractility compared with cells expressing the α1aAR-WT (WT receptor. Stable expression of 247R genetic variant also triggers MMP/EGFR-transactivation dependent serum- and agonist-independent (constitutive hyperproliferation and agonist-dependent hypertrophy of SMCs. Agonist stimulation reduces contractility Using pathway-specific inhibitors we determined that the observed hyperproliferation of 247R-expressing cells is triggered via β-arrestin1/Src/MMP-2/EGFR/ERK-dependent mechanism. MMP-2-specific siRNA inhibited 247R-triggered hyperproliferation indicating MMP-2 involvement in 247R-triggered hyperproliferation in SMCs. β-arrestin1-specific shRNA also inhibited 247R-triggered hyperproliferation but did not affect hypertrophy in 247R-expressing SMCs, indicating that agonist-dependent hypertrophy is independent of β-arrestin1. Our data reveal that in different cardiovascular cells the same human receptor genetic variant can activate alternative modulators of the same signaling pathway. Thus, our findings in SMCs demonstrate that depending on the type of cells expressing the same receptor (or receptor variant, different target-specific inhibitors could be used to modulate aberrant hyperproliferative or hypertrophic pathways in order to restore normal phenotype.

    18. Study of the effect of moisture content and bending rate on the fracture toughness of rocks

      Czech Academy of Sciences Publication Activity Database

      Vavro, Leona; Souček, Kamil


      Roč. 10, č. 2 (2013), s. 247-253 ISSN 1214-9705 R&D Projects: GA MŠk ED2.1.00/03.0082 Institutional support: RVO:68145535 Keywords : fracture toughness * bending rate * tensile strength Subject RIV: DB - Geology ; Mineralogy Impact factor: 0.667, year: 2013

    19. Clinical study of p-aminobenzoic acid-N-xyloside Na in advanced cancer patients

      Energy Technology Data Exchange (ETDEWEB)

      Fukushima, M.; Ota, K. (Aichi Cancer Center, Nagoya (Japan))


      Therapeutic effect of p-aminobenzoic acid-N-xyloside Na (K-247) were studied. Eleven patients with a variety of solid tumors were treated with K-247 alone. K-247 was given orally 800 mg daily for 4 weeks. As for side effect of the drug, only mild gastritis was observed in a few patients. Partial response (over 25% reduction of tumor size) with a median duration of two months was observed in 3 patients. These cases were metastatic tumor of lung from the carcinoma of thyroid, metastatic tumors of lung from the carcinoma of kidney, and mediastinal tumor. In eight patients the response was classified as no change and in one patient there was progressive disease. Thus K-247 has some therapeutic activity in patients with solid tumor. Combination therapy of irradiation and administration of K-247 were also studied. In the twelve patients receiving the combination therapy, partial response was observed in 7 patients with complete response in 3 patients. In some patients it seems that the effect of irradiation was enhanced by K-247 administration. To confirm this observation, randomized controlled trial is required.

    20. Clinical study of p-aminobenzoic acid-N-xyloside Na in advanced cancer patients

      International Nuclear Information System (INIS)

      Fukushima, Masanori; Ota, Kazuo


      Therapeutic effect of p-aminobenzoic acid-N-xyloside Na (K-247) were studied. Eleven patients with a variety of solid tumors were treated with K-247 alone. K-247 was given orally 800 mg daily for 4 weeks. As for side effect of the drug, only mild gastritis was observed in a few patients. Partial response (over 25% reduction of tumor size) with a median duration of two months was observed in 3 patients. These cases were metastatic tumor of lung from the carcinoma of thyroid, metastatic tumors of lung from the carcinoma of kidney, and mediastinal tumor. In eight patients the response was classified as no change and in one patient there was progressive disease. Thus K-247 has some therapeutic activity in patients with solid tumor. Combination therapy of irradiation and administration of K-247 were also studied. In twelve patients received the conbination therapy, partial response was observed in 7 patients with complete response in 3 patients. In some patients it seems that the effect of irradiation was enhanced by K-247 administration. To confirm this observation, randomized controlled trial is required. (author)

    1. Bacillus zeae sp. nov., isolated from the rhizosphere of Zea mays. (United States)

      Kämpfer, Peter; Busse, Hans-Jürgen; McInroy, John A; Hu, Chia-Hui; Kloepper, Joseph W; Glaeser, Stefanie P


      A Gram-positive-staining, aerobic organism, isolated from the rhizosphere of Zea mays, was investigated in detail. Based on 16S rRNA gene sequence similarity comparisons, strain JJ-247T was grouped into the genus Bacillus, most closely related to Bacillus foraminis (98.4 %). The 16S rRNA gene sequence similarity to the sequences of the type strains of other species of the genus Bacillus was Bacillus. The polar lipid profile contained the major components diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine and an unidentified aminophospholipid. The major quinone was menaquinone MK-7, and the major polyamine was spermidine. The genomic DNA G+C content of strain JJ-247T was 44.5 mol%. DNA-DNA hybridizations with the type strain B. foraminis LMG 23147T resulted in values below 70 %. In addition, physiological and biochemical test results allowed a clear phenotypic differentiation of strain JJ-247T from B. foraminis. As a consequence, JJ-247T represents a novel species of the genus Bacillus, for which we propose the name Bacillus zeae sp. nov., with JJ-247T (=CCM 8726T=LMG 29876T) as the type strain.

    2. Evaluation of Heat Capacity and Resistance to Cyclic Oxidation of Nickel Superalloys

      Directory of Open Access Journals (Sweden)

      Przeliorz R.


      Full Text Available Paper presents the results of evaluation of heat resistance and specific heat capacity of MAR-M-200, MAR-M-247 and Rene 80 nickel superalloys. Heat resistance was evaluated using cyclic method. Every cycle included heating in 1100°C for 23 hours and cooling for 1 hour in air. Microstructure of the scale was observed using electron microscope. Specific heat capacity was measured using DSC calorimeter. It was found that under conditions of cyclically changing temperature alloy MAR-M-247 exhibits highest heat resistance. Formed oxide scale is heterophasic mixture of alloying elements, under which an internal oxidation zone was present. MAR-M-200 alloy has higher specific heat capacity compared to MAR-M-247. For tested alloys in the temperature range from 550°C to 800°C precipitation processes (γ′, γ″ are probably occurring, resulting in a sudden increase in the observed heat capacity.

    3. Tri-axial Grain Orientation of Y2Ba4Cu7Oy Achieved by the Magneto-science Method (United States)

      Fukushima, Takayuki; Horii, Shigeru; Ogino, Hiraku; Uchikoshi, Tetsuo; Suzuki, Tohru S.; Sakka, Yoshio; Ishihara, Atsushi; Shimoyama, Jun-ichi; Kishio, Kohji


      Tri-axial orientation of orthorhombic and twin-free Y2Ba4Cu7Oy (Y247) powders was attempted using a rotating magnetic field with modulated rate. Although magnetic anisotropy of paramagnetic Y247 originated only from the two-dimensional CuO2 and one-dimensional Cu-O chain structures are small, strong tri-axial grain orientation with misorientation angles below 1.5° was successfully achieved during the solidification process of epoxy resin. Our present results indicate the possibility of fabrication of tri- or bi-axial grain-oriented bulk and thick films without applying epitaxial methods, such as melt-solidification or thin film deposition, and that the modulated-rotation magnetic field is applicable not only to RE247 compounds but also to orthorhombic high critical temperature cuprate superconductors, including practical REBa2Cu3Oy, in principle.

    4. Comparative efficacy of different post-emergence herbicides in wheat (triticum aestivum l.)

      International Nuclear Information System (INIS)

      Shehzad, M.A.; Nadeem, M.A.; Sarwar, M.A.


      A field experiment was carried out to study the efficacy of different post-emergence herbicides for controlling weeds in wheat during a Rabi season 2008-09. Experiment comprised of six treatments, i.e. weed-infested control, pyroxasulfone at 50 g a.i ha/sup -1/, metribuzin at 250 g a.i ha/sup -1/, isoproturon at 1080 g a.i ha/sup -1/, clodinafop propargyl at 240 g a.i ha/sup -1/ and bromoxynil+MCPA at 247+247 g a.i ha/sup -1/ as post-emergence herbicides. Results revealed that Post-emergence application of isoproturon (1080 g a.i ha-1) proved to be best for obtaining maximum grain plus straw yield up to the level of weed-free control. Bromoxynil+MCPA (247+247 g a.i ha/sup -1/) and clodinafop propargyl (240 g a.i ha-1) also gave maximum spike bearing tillers, number of grains spike-1 and 1000-grain weight. Isoproturon (1080 g a.i ha/sup -1/) strictly reduced the weeds population as well as biomass as compared to weed-infested control. Poor weed control was achieved by using pyroxasulfone and metribuzin treatments. Hence, post-emergence Isoproturon (1080 g a.i ha/sup -1/) followed by bromoxynil + MCPA (247+247 g a.i ha/sup -1/) was provide to be the most effective herbicide against weeds and resulted in maximum wheat yield. (author)

    5. Comparative efficacy of different post-emergence herbicides in wheat (triticum aestivum L.)

      International Nuclear Information System (INIS)

      Shehzad, M.A.; Nadeem, M.A.; Sarwar, M.A.; Naseer-ud-Din, G.M.; Ilahi, F.


      A field experiment was carried out to study the efficacy of different post-emergence herbicides for controlling weeds in wheat during a Rabi season 2008-09. Experiment comprised of six treatments, i.e. weed-infested control, pyroxasulfone at 50 g a.i ha/sup -1/, metribuzin at 250 g a.i ha/sup -1/, isoproturon at 1080 g a.i ha/sup -1/, clodinafop propargyl at 240 g a.i ha/sup -1/ and as post-emergence herbicides. Results revealed that Post-emergence application of bromoxynil + MCPA at 247+247 g a.i ha/sup -1/ isoproturon (1080 g a.i ha) proved to be best for obtaining maximum grain plus straw yield up to the level of weed-free -1 -1 control. Bromoxynil + MCPA (247+247 g a.i ha) and clodinafop propargyl (240 g a.i ha/sup -1/) also gave maximum spike bearing tillers, number of grains spike and 1000-grain weight. Isoproturon (1080 g a.i ha/sup -1/) strictly reduced the weeds population as well as biomass as compared to weed-infested control. Poor weed control was achieved by using pyroxasulfone and metribuzin treatments. Hence, post-emergence Isoproturon (1080 g a.i ha/sup -1/) followed by bromoxynil + MCPA (247+247 g a.i ha/sup -1/ ) was provide to be the most effective herbicide against weeds and resulted in maximum wheat yield. (author)

    6. 12-core x 3-mode Dense Space Division Multiplexed Transmission over 40 km Employing Multi-carrier Signals with Parallel MIMO Equalization

      DEFF Research Database (Denmark)

      Mizuno, T.; Kobayashi, T.; Takara, H.


      We demonstrate dense SDM transmission of 20-WDM multi-carrier PDM-32QAM signals over a 40-km 12-core x 3-mode fiber with 247.9-b/s/Hz spectral efficiency. Parallel MIMO equalization enables 21-ns DMD compensation with 61 TDE taps per subcarrier.......We demonstrate dense SDM transmission of 20-WDM multi-carrier PDM-32QAM signals over a 40-km 12-core x 3-mode fiber with 247.9-b/s/Hz spectral efficiency. Parallel MIMO equalization enables 21-ns DMD compensation with 61 TDE taps per subcarrier....

    7. Characterizations of a loss-of-function mutation in the Kir3.4 channel subunit

      DEFF Research Database (Denmark)

      Calloe, Kirstine; Ravn, Lasse Steen; Schmitt, Nicole


      and two-electrode voltage-clamp revealed that Kir3.4-G247R basal current was reduced compared to wild-type Kir3.4 and co-expression with the muscarinic acetylcholine receptor type 2 showed that also the acetylcholine induced current was severely reduced in Kir3.4-G247R, indicating that the mutation...... the lack of clear clinical manifestations and further studies are necessary to elucidate if mutations in Kir3.4 are predisposing AF. Udgivelsesdato: 2007-Dec-28...

    8. Reversible optic neuropathy with OPA1 exon 5b mutation

      DEFF Research Database (Denmark)

      Cornille, K.; Milea, D.; Amati-Bonneau, P.


      A new c.740G>A (R247H) mutation in OPA1 alternate spliced exon 5b was found in a patient presenting with bilateral optic neuropathy followed by partial, spontaneous visual recovery. R247H fibroblasts from the patient and his unaffected father presented unusual highly tubular mitochondrial network......, significant increased susceptibility to apoptosis, oxidative phosphorylation uncoupling, and altered OPA1 protein profile, supporting the pathogenicity of this mutation. These results suggest that the clinical spectrum of the OPA1-associated optic neuropathies may be larger than previously described......, and that spontaneous recovery may occur in cases harboring an exon 5b mutation Udgivelsesdato: 2008/5...

    9. New Antioxidative Secondary Metabolites from the Fruits of a Beibu Gulf Mangrove, Avicennia marina

      Directory of Open Access Journals (Sweden)

      Cheng-Hai Gao


      Full Text Available Further chemical investigation of the fruits of the mangrove, Avicennia marina, afforded three new phenylethyl glycosides, marinoids J–L (1–3, and a new cinnamoyl glycoside, marinoid M (4. The structures of isolates were elucidated on the basis of extensive spectroscopic analysis and by comparison of the data with those of related secondary metabolites. The antioxidant activity of the isolates was evaluated using the cellular antioxidant assay (CAA, and compounds 1–4 showed antioxidant activities, with EC50 values ranging from 23.0 ± 0.71 μM to 247.8 ± 2.47 μM.

    10. Speciallægen er ikke i front på de danske akutafdelinger

      DEFF Research Database (Denmark)

      Mackenhauer, Julie; Møller, Cecilie; Fjældstad, Alexander


      are not staffed by consultants 24/7, 51% report difficulties in recruiting qualified personnel and 33% report problems connected to retaining them. 71% believe that a specialty in emergency medicine could help solve these problems. Danish EDs do not comply with the visions of the reorganisation plan.......The Danish health care system is undergoing a major reorganisation, resulting in fewer emergency departments (ED) with consultants in attendance 24/7. This questionnaire-based study evaluates the status of the reorganisation with emphasis on physician attendance and recruitment. 76% of the EDs...

    11. New antioxidative secondary metabolites from the fruits of a Beibu Gulf mangrove, Avicennia marina. (United States)

      Gao, Cheng-Hai; Yi, Xiang-Xi; Xie, Wen-Pei; Chen, Yin-Ning; Xu, Ming-Ben; Su, Zhi-Wei; Yu, Lian; Huang, Ri-Ming


      Further chemical investigation of the fruits of the mangrove, Avicennia marina, afforded three new phenylethyl glycosides, marinoids J-L (1-3), and a new cinnamoyl glycoside, marinoid M (4). The structures of isolates were elucidated on the basis of extensive spectroscopic analysis and by comparison of the data with those of related secondary metabolites. The antioxidant activity of the isolates was evaluated using the cellular antioxidant assay (CAA), and compounds 1-4 showed antioxidant activities, with EC50 values ranging from 23.0 ± 0.71 μM to 247.8 ± 2.47 μM.

    12. Alfred Lameli, Roland Kehrein, Stefan Rabanus (eds): Language and Space. An Internatuinal Handbook of Linguistic Variation. Volume 2. Language Mapping. Part , I, II. Berlin - New York 2010: De Gruyer Mouton, I, 668 s., II, 446 s. (ISBN 978-3-11-019609-2, e-ISBN 978-3-11-021916-6)

      Czech Academy of Sciences Publication Activity Database

      Šipková, Milena


      Roč. 7, - (2015), s. 247-256. ISBN 978-83-7654-182-2. ISSN 1898-9276 R&D Projects: GA ČR(CZ) GAP406/11/1786 Keywords : language/linguistic maps * language/linguistic atlases * computerization of language mapping Subject RIV: AI - Linguistics

    13. The mouse skull as a source of morphometric data for phylogeny inference

      Czech Academy of Sciences Publication Activity Database

      Macholán, Miloš


      Roč. 247, - (2008), s. 315-327 ISSN 0044-5231 R&D Projects: GA AV ČR IAA6045307 Institutional research plan: CEZ:AV0Z50450515 Keywords : ancestral states * brownian motion * comparative analysis Subject RIV: EG - Zoology Impact factor: 1.319, year: 2008

    14. Patterns and Correlates of Tic Disorder Diagnoses in Privately and Publicly Insured Youth (United States)

      Olfson, Mark; Crystal, Stephen; Gerhard, Tobias; Huang, Cecilia; Walkup, James T.; Scahill, Lawrence; Walkup, John T.


      Objective: This study examined the prevalence and demographic and clinical correlates of children diagnosed with Tourette disorder, chronic motor or vocal tic disorder, and other tic disorders in public and private insurance plans over the course of a 1-year period. Method: Claims were reviewed of Medicaid (n = 10,247,827) and privately (n =…

    15. Rutherford backscatering spectroscopy of optically silver doped amorphous chalcogenides

      Czech Academy of Sciences Publication Activity Database

      Wágner, T.; Krbal, M.; Vlček, M.; Frumar, M.; Peřina, Vratislav; Macková, Anna; Hnatowicz, Vladimír; Kasap, S. O.


      Roč. 53, č. 1 (2003), s. A247-A256 ISSN 0011-4626 R&D Projects: GA AV ČR KSK1010104 Keywords : backscatering * Ag2-Ge-S * films Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.263, year: 2003

    16. Sexual Activity and Contraceptive Use among Female Adolescents ...

      African Journals Online (AJOL)

      At the time of the survey, 190 girls (24.7%) were sexually active and 74.2% of their male consorts were older working men, suggesting financial gains as a motive for the girls' sexual activity. Other findings were high awareness (72.4%) of the relationship between sexual activity and sexually transmitted diseases; a rather low ...

    17. Relevance of Radiocaesium Interception Potential (RIP) on a worldwide scale to assess soil vulnerability to 137Cs contamination

      NARCIS (Netherlands)

      Vandebroek, L.; Hees, Van M.; Delvaux, B.; Spaargaren, O.; Thiry, Y.


      The extent of radiocaesium retention in soil is important to quantify the risk of further foodchain contamination. The Radiocaesium Interception Potential (RIP – Cremers et al., 1988, Nature 335, 247–249) is an intrinsic soil parameter which can be used to categorize soils or minerals in terms of

    18. "Something's Gotta Give:" Advanced-Degree Seeking Women's Experiences of Sexism, Role Overload, and Psychological Distress (United States)

      West, Lindsey M.


      With the rise in advanced-degree seeking women and the minimal research on the dual impact of sexism and role overload, the current study aims to better understand the impact of sexism and role overload on psychological distress in a particular sample of advanced-degree seeking women. Seventy-six female medical student participants (mean age 24.7)…

    19. Multidose pharmacokineetecs of orally administered florfenicol in channel catfish Ictalurus punctatus (United States)

      Plasma disposition of florfenicol in channel catfish was investigated after an oral dose (10mg/kg for 10 days) administered in freshwater at water temperatures ranging from 24.7 to 25.9°C. Florfenicol concentrations in plasma were analyzed by means of liquid chromatography with MS/MS detection. Af...

    20. Improving Mathematics Learning of Kindergarten Students through Computer-Assisted Instruction (United States)

      Foster, Matthew E.; Anthony, Jason L.; Clements, Doug H.; Sarama, Julie; Williams, Jeffrey M.


      This study evaluated the effects of a mathematics software program, the Building Blocks software suite, on young children's mathematics performance. Participants included 247 Kindergartners from 37 classrooms in 9 schools located in low-income communities. Children within classrooms were randomly assigned to receive 21 weeks of computer-assisted…

    1. Abelianization of the F-divided fundamental group scheme

      Indian Academy of Sciences (India)

      Author Affiliations. INDRANIL BISWAS1 JOAO PEDRO P DOS SANTOS2. School of Mathematics, Tata Institute of Fundamental Research, Homi Bhabha Road, Mumbai 400 005, India; Institut de Mathematiques de Jussieu – Paris Rive Gauche, 4 Place Jussieu, Case 247, 75252 Paris Cedex 5, France ...

    2. Outcomes for a Comprehensive School-Based Asthma Management Program (United States)

      Gerald, Lynn B.; Redden, David; Wittich, Angelina R.; Hains, Coralie; Turner-Henson, Anne; Hemstreet, Mary P.; Feinstein, Ronald; Erwin, Sue; Bailey, William C.


      This article describes the evaluation of a comprehensive school-based asthma management program in an inner-city, largely African-American school system. All 54 elementary schools (combined enrollment 13,247 students) from a single urban school system participated in this study. Schools were randomly divided between immediate and delayed…

    3. Retrospective study of dog bite cases reported to ECWA Veterinary ...

      African Journals Online (AJOL)

      A retrospective study of dog bite cases reported to ECWA Veterinary Clinic Bukuru was carried out in Plateau State, Nigeria to understand the pattern of occurrence in this region. A total of two hundred and forty seven (247) dog bite cases were reported between May, 2009 and June, 2010. The dogs profile showed that ...

    4. Progressive rod-cone degeneration (PRCD) in selected dog breeds and variability in its phenotypic expression

      Czech Academy of Sciences Publication Activity Database

      Dostál, Jaromír; Hrdlicová, Anna; Horák, Pavel


      Roč. 56, č. 5 (2011), s. 243-247 ISSN 0375-8427 Institutional research plan: CEZ:AV0Z50450515 Keywords : canine * retinitis pigmentosa * autosomal Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.748, year: 2011

    5. alpha-tocopheryl succinate-induced apoptosis in human gastric cancer cells is modulated by ERK1/2 and c-Jun N-terminal kinase in a biphasic manner

      Czech Academy of Sciences Publication Activity Database

      Zhao, Y.; Zhao, X.; Yang, B.; Neužil, Jiří; Wu, K.


      Roč. 247, č. 2 (2007), s. 345-352 ISSN 0304-3835 Institutional research plan: CEZ:AV0Z50520701; CEZ:AV0Z50520514 Keywords : α-tocopheryl succinate * MAP kinases * gastric carcinoma Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.398, year: 2007

    6. Evaluation of Interventions to Improve Solar Protection in Primary Schools. (United States)

      Girgis, Afaf; And Others


      An intensive intervention group (n=247) of 9-11 year olds were exposed to SKIN SAFE, a curriculum about sun protection. A standard group (n=180) received a lecture about skin cancer; control group numbered 185. The intensive group were significantly more likely to use high levels of protection; no differences were apparent between the standard and…

    7. Progress in all-order breakup reaction theories

      Indian Academy of Sciences (India)

      Progress in breakup reaction theories, like the distorted wave Born approximation, the continuum discretized coupled channels method and the dynamical eikonal approximation, is brought into focus. The need to calculate ... R Chatterjee1. Department of Physics, Indian Institute of Technology, Roorkee 247 667, India ...

    8. Bohr Hamiltonian with different mass parameters applied to band ...

      Indian Academy of Sciences (India)

      2Universidad Autónoma de la Ciudad de México, Prolongación San Isidro Col. San Lorenzo. Tezonco, Del. Iztapalapa, 09790 México D.F., Mexico. 3Department of Physics, Indian Institute of Technology, Roorkee 247 667, India. ∗. Corresponding author. E-mail: MS received 7 October 2014; revised 3 ...

    9. Underneath Hypercapitalism (United States)

      Luke, Allan


      As Joel Spring's (2007/this issue) description of Singapore's Orchard Road suggests, Benetton, Zara, Nike, BMW, LG, and Microsoft dominate the visual and textual landscape where signage, advertising, packaging, labeling, and the environments of the connected underground malls and walkways merge into a wall-to-wall, 24/7 print and visual…

    10. EPR spectra of MoS.sub.2./sub./C.sub.60./sub..

      Czech Academy of Sciences Publication Activity Database

      Blinc, R.; Cevc, P.; Mrzel, A.; Arčon, D.; Remškar, M.; Milia, F.; Laguta, Valentyn


      Roč. 247, 11-12 (2010), s. 3033-3034 ISSN 0370-1972 Institutional research plan: CEZ:AV0Z10100521 Keywords : EPR * lubricant * photoconductor Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.344, year: 2010

    11. Phylogeny of Trochetia species based on morphological and ...

      African Journals Online (AJOL)


      Molecular. Phylogenetics and Evolution 1 : 3 – 16. BALDWIN, B.G., SANDERSON, M.J., WOJCIECHOWSKI, M.F., CAMPBELL,. C.S. & DONOGHUE, M.J. (1995). The ITS region of nuclear ribosomal DNA: A valuable source of evidence on angiosperm phylogeny. Ann. of the Missouri. Botanical Garden. 82: 247- 275. BAUM ...

    12. Journal of Agriculture, Forestry and the Social Sciences - Vol 9, No 2 ...

      African Journals Online (AJOL)

      Rate of Decomposition of Leaflitter in an Age Series Gmelina Arborea Robx Plantation in a Nigerian Lowland Rain Forest · EMAIL FULL TEXT EMAIL FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. AL Ogunyebi, AO Omole, SO Bada, 236-247. ...

    13. Collective polyelectrolyte diffusion as a function of counterion size and dielectric constant

      Czech Academy of Sciences Publication Activity Database

      Filippov, Sergey K.; Seery, T. A. P.; Kříž, Jaroslav; Hrubý, Martin; Černoch, Peter; Sedláček, Ondřej; Kadlec, Petr; Pánek, Jiří; Štěpánek, Petr


      Roč. 62, č. 9 (2013), s. 1271-1276 ISSN 0959-8103 R&D Projects: GA MŠk ME09059 Institutional research plan: CEZ:AV0Z40500505 Keywords : polyelectrolyte * counterion binding * sodium polystyrene sulfonate Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.247, year: 2013

    14. Seismic anisotropy beneath the Northern Apennines (Italy): Mantle flow or lithosphere fabric?

      Czech Academy of Sciences Publication Activity Database

      Plomerová, Jaroslava; Margheriti, L.; Park, J.; Babuška, Vladislav; Pondrelli, S.; Vecsey, Luděk; Piccinini, D.; Levin, V.; Baccheschi, P.; Salimbeni, S.


      Roč. 247, 1/2 (2006), s. 157-170 ISSN 0012-821X R&D Projects: GA AV ČR IAA3012405 Institutional research plan: CEZ:AV0Z30120515 Keywords : seismic anisotropy * continental dynamics * Northern Apennines Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 3.887, year: 2006

    15. Chemical nature of catalysts of oxide nanoparticles in environment ...

      Indian Academy of Sciences (India)


      Chemical nature of catalysts of oxide nanoparticles in environment prevailing during growth of carbon nanostructures by CCVD. M. Jana*, A. Sil and S. Ray. †. Department of Metallurgical and Materials Engineering. Indian Institute of Technology Roorkee. Roorkee 247 667, India. Present address: *School of Materials ...

    16. Guild composition and seasonal distribution of insects on Protea ...

      African Journals Online (AJOL)


      Jun 12, 1990 ... with special reference to insect-plant interactions. Ph.D. thesis, University of Stellenbosch, Stellenbosch. 117 pp. DONNELLY, D. & GILIOMEE, J.H. 1985. Community structure of epigaeic ants (Hymenoptera: Formicidae) in fynbos. 249 vegetation in the Jonkershoek Valley. J. eN. Soc. sth. Afr. 48: 247-257.

    17. Comparison of total phenolic content and composition of individual ...

      African Journals Online (AJOL)

      Ciocalteu method and high-performance liquid chromatography (HPLC), respectively. The total phenolic contents of testae and testa-removed kernels varied from 2.47 ± 0.96 to 84.53 ± 5.57 and 0.07 ± 0.01 to 0.12 ± 0.01 mg gallic acid equivalent ...

    18. Magnetic tri-axial orientation in (Y1-xErx)2Ba4Cu7O15-y superconductors

      International Nuclear Information System (INIS)

      Horii, S.; Okuhira, S.; Yamaki, M.; Haruta, M.; Maeda, T.; Shimoyama, J.


      (Y 1-x Er x ) 2 Ba 4 Cu 7 O 15-y [(Y,Er)247] was synthesized for clarifying a magnetic role of Er ion. The three magnetization axes of (Y,Er)247 were obtained from tri-axial orientation using a modulated rotation magnetic field. Magnetic anisotropy of Er ion is roughly ten times higher than that for Y247 at room temperature. Importance of rare-earth ions was shown for reduction of required magnetic fields in the tri-axial magnetic orientation. We report the tri-axial grain-orientation effects under a modulated rotation magnetic field for (Y 1-x Er x ) 2 Ba 4 Cu 7 O y [(Y, Er)247]. The magnetic easy axis at room temperature was drastically changed around x ∼ 0.1; however, the Er-doping levels for the conversion of magnetic easy axes from the c-axis to the ab-direction and from the a- to b-axes were quite different. Tri-axial single-ion magnetic anisotropy of Er 3+ was roughly 10 times greater than tri-axial magnetic anisotropy generated by both the superconducting CuO 2 plane and the blocking Cu-O chain layer. An appropriate choice of rare-earth (RE) ions in RE-based cuprate superconductors enables the reduction of the required magnetic field for the production of bulks and thick films based on the magnetic orientation technique.

    19. IgG avidity to Pseudomonas aeruginosa over the course of chronic lung biofilm infection in cystic fibrosis

      DEFF Research Database (Denmark)

      Mauch, Renan Marrichi; Nørregaard, Lena Lingren; Ciofu, Oana


      colonization, using an ELISA technique with the thiocyanate elution method. Avidity was quantitatively determined by calculating the avidity Constant (Kav). Results: IgG avidity to St-Ag significantly increased at the onset (Median Kav = 2.47) and one year after the onset of chronic infection (Median Kav = 3...

    20. Tailoring Gut Microbiota for Enhanced Resilience and Performance Under Sleep-Deprived Conditions (United States)


      et al. (2011) Acute nicotine treatment prevents REM sleep deprivation-induced learning and memory impairment in rat. Hippocampus. 21:899-909...247-53. Teitelbaum AA, Gareau MG, Jury J, et al. (2008) Chronic peripheral administration of corticotropin-releasing factor causes colonic barrier

    1. Multiple Sexual Victimizations among Adolescent Boys and Girls: Prevalence and Associations with Eating Behaviors and Psychological Health (United States)

      Ackard, Diann M.; Neumark-Sztainer, Dianne


      The purpose of this study was to assess the prevalence of sexual abuse, including multiple victimizations, among adolescents and to examine associations among history of sexual abuse, disordered eating behaviors and psychological health. The sample included 81,247 students (40,946 girls and 40,301 boys) in 9th and 12th grades in Minnesota public…

    2. Augener & Co., London - neznámý Dvořákův nakladatel

      Czech Academy of Sciences Publication Activity Database

      Matějčková, Helena


      Roč. 49, č. 3 (2012), s. 247-266 ISSN 0018-7003 R&D Projects: GA ČR GA408/08/1020 Institutional support: RVO:68378076 Keywords : Dvořák * publishers * London Subject RIV: AL - Art, Architecture, Cultural Heritage

    3. Solid-state Photochemical [2+ 2] Cycloaddition Reaction of ...

      Indian Academy of Sciences (India)

      Home; Journals; Journal of Chemical Sciences; Volume 129; Issue 2. Solid-state Photochemical [2+2] Cycloaddition Reaction of Hydrogen-Bonded Zn(II) Metal Complex Containing Several Parallel C=C Bonds. ABDUL MALIK P PEEDIKAKKAL. Regular Article Volume 129 Issue 2 February 2017 pp 239-247 ...

    4. Cycloaddition Reaction of Hydrogen-Bonded Zn(II)

      Indian Academy of Sciences (India)

      J. Chem. Sci. Vol. 129, No. 2, February 2017, pp. 239–247. c Indian Academy of Sciences. DOI 10.1007/s12039-016-1218-6. REGULAR ARTICLE. Solid-state Photochemical [2+2] Cycloaddition Reaction of. Hydrogen-Bonded Zn(II) Metal Complex Containing Several Parallel. C=C Bonds. ABDUL MALIK P PEEDIKAKKAL.

    5. Antibioticumresistentie in Escherichia coli O 157 geisoleerd tussen 1998 en 2003 in Nederland = Antibiotic resistance in Escherichia coli O157 isolated between 1998 and 2003 in The Netherlands

      NARCIS (Netherlands)

      Roest, H.I.J.; Liebana, E.; Wannet, W.; Duynhoven, van Y.; Veldman, K.T.; Mevius, D.J.


      Nederlands: Over het vóórkomen van antibioticumresistentie bij E. coli O157 in Nederland is weinig bekend. In deze studie werden tussen 1998 en 2003 218 humane en 247 niethumane isolaten onderzocht op antibioticumgevoeligheid. Het antibioticumresistentieniveau van E. coli O157 geïsoleerd uit de

    6. CPAP Tips

      Medline Plus

      Full Text Available ... Queue __count__/__total__ It’s YouTube. Uninterrupted. Loading... Want music and videos with zero ads? Get YouTube Red. ... 908 views 6:14 Progressive House · Relaxing Focus Music · 24/7 Live Radio The Grand Sound 577 ...

    7. ORF Alignment: NC_003070 [GENIUS II[Archive

      Lifescience Database Archive (English)

      Full Text Available NC_003070 gi|42572131 >1ig6A 3 105 144 247 2e-18 ... ref|NP_177777.3| ARID/BRIGHT DNA...-binding domain-containing protein [Arabidopsis ... thaliana] ref|NP_974156.1| ARID/BRIGHT DNA-bindin

    8. ORF Alignment: NC_003070 [GENIUS II[Archive

      Lifescience Database Archive (English)

      Full Text Available NC_003070 gi|42563264 >1ig6A 3 105 144 247 2e-18 ... ref|NP_177777.3| ARID/BRIGHT DNA...-binding domain-containing protein [Arabidopsis ... thaliana] ref|NP_974156.1| ARID/BRIGHT DNA-bindin

    9. Coxeter groups A4, B4 and D4 for two-qubit systems

      Indian Academy of Sciences (India)

      physics pp. 247–260. Coxeter groups A4, B4 and D4 for two-qubit systems. RAMAZAN KOÇ1,∗. , M YAKUP HACIIBRAHIMO ˇGLU1 and MEHMET KOCA2 ... reflection matrices. The von Neumann entropy of each reduced density matrix is calculated. It is shown that these unitary matrix representations are naturally related to ...

    10. ORF Alignment: NC_005835 [GENIUS II[Archive

      Lifescience Database Archive (English)

      Full Text Available he Bacterial Chromosome Segregation Protein ... Soj pdb|1WCV|1 Chain 1, Structure Of The Bacterial ... Chromosome Segre...gation Protein Soj ... Length = 243 ... Query: 5 ... KVRRIALANQKGGVGKTTTAINLAAYLA... NC_005835 gi|46199907 >1wcv1 1 243 5 247 3e-93 ... pdb|2BEJ|A Chain A, Structure Of T

    11. Resource Allocation in the Department of Defense: A Case Study of Army Aviation Maintenance (United States)


      for the comments of Rand colleagues Chery 1 Cook, Christopher Harz , James Hosek, Robert Paulson, and Robert Shishko. Laura Goeglein, Helen Loesch, and...pp. 233-247. Harz , C., Problems in Army Vehicle Maintenance: Results of a Ques- tionnaire Survey, The Rand Corporation, R-2487-ARPA, June 1981

    12. File list: Pol.Epd.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

      Lifescience Database Archive (English)

      Full Text Available Pol.Epd.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...247,SRX080162,SRX807622 ...

    13. a structure of persuasion in galatians: epistolary and rhetorical

      African Journals Online (AJOL)

      toric” in a broad sense, so as to differentiate all kinds of persuasive commu- nication from convincing persuasion.1 Perelman and Olbrechts-Tyteca, for example, state: ..... Cf. my previous suggestion of a double target strategy for Gal. 2:6-10 (Mitter- nacht 1999:247-50). Nor should one neglect the power and control gain for ...

    14. STAT1 and STAT3 do not participate in FGF-mediated growth arrest in chondrocytes

      Czech Academy of Sciences Publication Activity Database

      Krejčí, Pavel; Salazar, L.; Goodridge, H.S.; Kashiwada, T.A.; Schibler, M.J.; Jelínková, P.; Thompson, L.M.; Wilcox, W.R.


      Roč. 121, č. 3 (2008), s. 272-281 ISSN 0021-9533 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : FGFR3 * STAT * cartilage Subject RIV: BO - Biophysics Impact factor: 6.247, year: 2008

    15. Investigation of nickel- and cobalt-based superalloys with protective coatings (United States)

      Veksler, Yu. G.; Mal'tseva, L. A.; Pastukhov, M. V.


      The structure and composition of the surface layers of MAR-M247 and MAR-M509 superalloys are studied after the formation of protective coatings by gas-circulation aluminizing and a high-energy ion-plasma technology.

    16. Highly efficient epoxidation of alkenes with m-chloroperbenzoic acid ...

      Indian Academy of Sciences (India)

      Department of Chemistry, Faculty of Sciences, University of Birjand, P. O. Box 97175-615, Birjand, Iran. Email:; ... metals have a key role in coordination chemistry.3 6. They can be prepared simply and ...... mer supported cobalt (II) catalysts for alkene epoxida- tion Appl. Catal. A: Gen. 247 295.

    17. Neumann and Robin problems in a cracked domain with jump conditions on cracks

      Czech Academy of Sciences Publication Activity Database

      Medková, Dagmar; Krutitskii, P.


      Roč. 301, č. 1 (2005), s. 99-114 ISSN 0022-247X Institutional research plan: CEZ:AV0Z10190503 Keywords : Laplace equation * crack * single layer potential Subject RIV: BA - General Mathematics Impact factor: 0.579, year: 2005

    18. Ethnic Microaggressions and the Depressive and Somatic Symptoms of Latino and Asian American Adolescents (United States)

      Huynh, Virginia W.


      Ethnic microaggressions are a form of everyday, interpersonal discrimination that are ambiguous and difficult to recognize as discrimination. This study examined the frequency and impact of microaggressions among Latino (n = 247) and Asian American (n = 113) adolescents (M[subscript age] = 17.18, SD = 0.75; 57% girls). Latino adolescents reported…

    19. How do South African obstetricians manage hypertensive disorders ...

      African Journals Online (AJOL)

      Forty-three of the respondents did not prescribe prophylactic anticonvulsant therapy. To prevent pre-eclampsia, 247 of the respondents (58%) said they would prescribe Iow-dose aspirin. Conclusion. This study demonstrates that South African obstetricians show great uniformity in terms of the treatment of hypertensive ...

    20. Innovative collection development for e-books at the TU Delft Library

      NARCIS (Netherlands)

      Brinkman Dzwig, Z.E.


      Thanks to new technologies libraries worldwide go digital and are accessible 24/7 from remote locations. The innovation is even more visible in traditional library tasks such as collection development and acquisitions. Those tasks are undergoing rapid transformation as well. One of the reasons is

    1. Bulletin of Materials Science | Indian Academy of Sciences

      Indian Academy of Sciences (India)

      Articles written in Bulletin of Materials Science. Volume 26 Issue 2 February 2003 pp 247-253 Electrical Properties. Impedance spectroscopy ... the a.c. conductivity data. Volume 26 Issue 7 December 2003 pp 745-747 Electrical Properties. Dielectric properties of piezoelectric 3–0 composites of lithium ferrite/barium titanate.

    2. Pain phenotype as a predictor for drug response in painful polyneuropathy A retrospective analysis of data from controlled clinical trials

      DEFF Research Database (Denmark)

      Holbech, Jakob V; Bach, Flemming W; Finnerup, Nanna B


      a better effect in patients with preserved large fiber function with a mean difference in total pain reduction 1.31 (CI: 0.15 to 2.47). No phenotype-specific effects were found for venlafaxine, escitalopram, oxcarbazepine, valproic acid, levetiracetam or St. john's wort. Thus, this post-hoc analysis of 8...

    3. Sleep disturbances and glucose homeostasis

      NARCIS (Netherlands)

      Barf, R. Paulien; Scheurink, Anton J.W.


      Sleep disturbances, induced by either lifestyle, shift work or sleeping disorders, have become more prevalent in our 24/7 Western society. Sleep disturbances are associated with impaired health including metabolic diseases such as obesity and type 2 diabetes. The question remains whether there is a

    4. Cross-sections of solution funnels

      Czech Academy of Sciences Publication Activity Database

      Hájek, Petr Pavel; Vivi, P.


      Roč. 433, č. 2 (2016), s. 957-973 ISSN 0022-247X R&D Projects: GA ČR(CZ) GAP201/11/0345 Institutional support: RVO:67985840 Keywords : Banach space * ODE * solution funnel Subject RIV: BA - General Mathematics Impact factor: 1.064, year: 2016

    5. A multi breed reference improves genotype imputation accuracy in Nordic Red cattle

      DEFF Research Database (Denmark)

      Brøndum, Rasmus Froberg; Ma, Peipei; Lund, Mogens Sandø


      the subsequent effect of the imputed HD data on the reliability of genomic prediction. HD genotype data was available for 247 Danish, 210 Swedish and 249 Finnish Red bulls, and for 546 Holstein bulls. A subset 50 of bulls from each of the Nordic Red populations was selected for validation. After quality control...

    6. Self-help treatment for insomnia through television and book: A randomized trial.

      NARCIS (Netherlands)

      van Straten, A.; Cuijpers, P.; Smit, H.F.E.; Spermon, M.; Verbeek, I.


      Objective: Recently, a Dutch educational broadcasting company developed a 6 week self-help course for insomnia, which consists of a book and television programmes. In this study we examined its effects. Methods: 247 subjects with sleep problems were recruited through the media and randomized to the

    7. Ecophysiological characterization of carnivorous plant roots: oxygen fluxes, respiration, and water exudation

      Czech Academy of Sciences Publication Activity Database

      Adamec, Lubomír


      Roč. 49, č. 2 (2005), s. 247-255 ISSN 0006-3134 R&D Projects: GA AV ČR(CZ) IAA6005909 Institutional research plan: CEZ:AV0Z6005908 Keywords : terrestrial carnivorous plants * soil anoxia * Genlisea traps Subject RIV: EF - Botanics Impact factor: 0.792, year: 2005

    8. Home range of Noack's round-leaf bat (Hipposideros aff. ruber) in an agricultural landscape of central Ghana

      Czech Academy of Sciences Publication Activity Database

      Nkrumah, E. E.; Vallo, Peter; Klose, S. M.; Ripperger, S.; Badu, E. K.; Drosten, C.; Kalko, E. K. V.; Tschapka, M.; Oppong, S. K.


      Roč. 18, č. 1 (2016), s. 239-247 ISSN 1508-1109 Institutional support: RVO:68081766 Keywords : core area * foraging area * local convex hull * maximum foraging distance * radio-tracking Subject RIV: EG - Zoology Impact factor: 1.040, year: 2016

    9. Resonance – Journal of Science Education | Indian Academy of ...

      Indian Academy of Sciences (India)

      Home; Journals; Resonance – Journal of Science Education; Volume 3; Issue 1. The Riddle of the Apparently Hollow Himalaya. Ramesh Chander. General Article Volume 3 Issue 1 January 1998 pp 21- ... Author Affiliations. Ramesh Chander1. Department of Earth Sciences, University of Roorkee, Roorkee 247 667, India.

    10. design and determination of the efficiency of a slanting-type solar

      African Journals Online (AJOL)


      There is almost no water left on Earth that is safe to drink without purification [1]. Solar distillation is possibly the ... Most of our earth surface is covered with water; however, less than 1% of total available water is fresh ..... via solar-heated hollow fibre membrane distillation system”, Desalination, Vol. 247,pp 403-411. 2009.

    11. Journal of Earth System Science | Indian Academy of Sciences

      Indian Academy of Sciences (India)

      pp 247-258. Improvements in medium range weather forecasting system of India · V S Prasad Saji Mohandas Surya Kanti Dutta M Das Gupta G R Iyengar E N Rajagopal Swati Basu · More Details Abstract Fulltext PDF. Medium range weather forecasts are being generated in real time using Global Data Assimilation ...

    12. New Fellows and Honorary Fellow

      Indian Academy of Sciences (India)

      Elected: 1998 Section: Earth & Planetary Sciences. Srivastava, Prof. Deepak Chandra Ph.D. (ISM, Dhanbad), FNASc, FNA. Date of birth: 1 October 1956. Specialization: Structural Geology and Fluid Inclusions Address: Head, Department of Earth Sciences, Indian Institute of Technology, Roorkee 247 667, Uttarakhand

    13. SINET: Ethiopian Journal of Science - Vol 23, No 2 (2000)

      African Journals Online (AJOL)

      Effect of Azospirillum isolates on the growth and nitrogen content of tef [Eragrostis tef (Zucc.) Trotter] · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Solomon Zewdie, Fassil Assefa, Masresha Fetene, 247-262. ...

    14. supersymmetry breaking with extra dimensions

      Indian Academy of Sciences (India)

      Lett. В134, 429 (1984). J Ellis, C Kounnas and D V Nanopoulos, Nucl. Phys. В241, 406 (1984); В247, 373. (1984). [6] C Kounnas, F Zwirner and I Pavel, Phys. Lett. В335, 403 (1994). [7] T Appelquist, A Chodos and P G O Freund (Eds), Modern Kaluza-Klein theories,. Frontiers in Physics (Benjamin/Cummings, 1985) vol. 65.

    15. Journal of Biosciences | Indian Academy of Sciences

      Indian Academy of Sciences (India)

      Home; Journals; Journal of Biosciences. Gamini Seneviratne. Articles written in Journal of Biosciences. Volume 28 Issue 2 March 2003 pp 243-247 Articles. Mycelial colonization by bradyrhizobia and azorhizobia · Gamini Seneviratne H S Jayasinghearachchi · More Details Abstract Fulltext PDF. This study examines ...

    16. Mechanisms of pH change in wood ant (.i.Formica polyctena./i.) nests

      Czech Academy of Sciences Publication Activity Database

      Jílková, Veronika; Šebek, O.; Frouz, J.


      Roč. 55, č. 5 (2012), s. 247-251 ISSN 0031-4056 Institutional research plan: CEZ:AV0Z60660521 Keywords : basic cations * glucose * honeydew Subject RIV: EH - Ecology, Behaviour Impact factor: 1.690, year: 2012

    17. Sampling for ants in different-aged spruce forests: A comparison of methods

      Czech Academy of Sciences Publication Activity Database

      Véle, A.; Holuša, J.; Frouz, Jan


      Roč. 45, č. 4 (2009), s. 301-305 ISSN 1164-5563 Institutional research plan: CEZ:AV0Z60660521 Keywords : ants * baits * methods comparison Subject RIV: EH - Ecology, Behaviour Impact factor: 1.247, year: 2009

    18. [Urologists in National Socialism: persecuted, displaced and murdered urologists: list of persons and overview of sources used]. (United States)

      Bellmann, J


      The names of 247 urologists or physicians working in the field of urology are mentioned, including their biographical data und the sources used to compile their biographies. Each name represents an individual experience of persecution, displacement and in some cases deliberate murder. Investigating these life histories has not yet been completed, as in the course of time additional information becomes available.

    19. Assessment of Current Cross-Infection Control Practices Among ...

      African Journals Online (AJOL)

      Twenty-eight respondents (34.6%) regularly wear gloves while handling dental impression. Only 20 respondents (24.7%) wear eyeglasses and face masks regularly. Most of the respondents always or often change pumice slurry, curing bath water and most rarely disinfect pliers. Most of the respondents (59.3%) had not ...

    20. Common fixed points for weakly compatible maps

      Indian Academy of Sciences (India)

      Springer Verlag Heidelberg #4 2048 1996 Dec 15 10:16:45

      Indian Acad. Sci. (Math. Sci.), Vol. 111, No. 2, May 2001, pp. 241–247. Printed in India. Common fixed points for weakly compatible maps. RENU CHUGH and SANJAY KUMAR. Department of Mathematics, Maharshi Dayanand University, Rohtak 124 001, India. MS received 31 January 2000; revised 11 December 2000.

    1. Levitation of NEG-123 at the temperature of liquid oxygen (90.2 K)

      Czech Academy of Sciences Publication Activity Database

      Muralidhar, M.; Sakai, N.; Jirsa, Miloš; Murakami, M.; Koshizuka, N.


      Roč. 16, - (2003), s. L46-L48 ISSN 0953-2048 Institutional research plan: CEZ:AV0Z1010914 Keywords : RE-123 * Gd 2 BaBuO 5 * ternary compounds * secondary phase * particles * levitation Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.247, year: 2003

    2. "You Cannot Talk with All of the Strangers in a Pub": A Longitudinal Case Study of International Postgraduate Students' Social Ties at a British University (United States)

      Schartner, Alina


      The formation of social ties is a major factor in the international student experience (Ramsay et al. in High Educ 54(2):247-265, 2007), influencing student wellbeing and adjustment to the new academic and sociocultural environment (Ward et al. in The psychology of culture shock. Routledge, Hove, 2001). Although a significant body of research in…

    3. Story of Fission

      Indian Academy of Sciences (India)

      Home; Journals; Resonance – Journal of Science Education; Volume 21; Issue 3. Story of Fission: Unlocking Power of the Nucleus. Amit Roy. General Article Volume 21 Issue 3 March 2016 pp 247-258. Fulltext. Click here to view fulltext PDF. Permanent link: ...

    4. Investigating the Substantive Aspect of Construct Validity for the Satisfaction with Life Scale Adapted for Children: A Focus on Cognitive Processes (United States)

      Gadermann, Anne M.; Guhn, Martin; Zumbo, Bruno D.


      The objective of this study was to investigate the substantive aspect of construct validity of the Satisfaction with Life Scale adapted for Children (SWLS-C; Gadermann et al. in Soc Indic Res 96:229-247, "2010"). Specifically, the study examined the cognitive processes of children when responding to the items of the SWLS-C to find out how they…

    5. The use of the psychological contract to explain self-perceived employability

      NARCIS (Netherlands)

      Sok, J.; Blomme, R.J.; Tromp, D.M.


      This study examines the relationship between the psychological contract and self-perceived employability (intra-organizational mobility intentions, employee development and perceived labor market opportunities). A survey was completed by 247 alumni of the Hotelschool The Hague, a hotel management

    6. The Role of Individualism-Collectivism in the Individual Creative Process (United States)

      Yao, Xiang; Wang, Shuhong; Dang, Junhua; Wang, Lei


      This study is among the first to examine how individuals' cultural value orientations impact 2 separate stages of creativity: idea generation and idea implementation. A total of 247 Chinese employees completed questionnaires including individualism-collectivism culture orientation and their idea generation behavior. Supervisor ratings of idea…

    7. ORF Alignment: NC_000913 [GENIUS II[Archive

      Lifescience Database Archive (English)

      Full Text Available s; ... ATP-dependent adenylate transferase, modifies MoaD ... [Escherichia coli K12] dbj|BAA35...nylate transferase, modifies MoaD [Escherichia ... coli K12] gb|AAC73913.1| molybdopterin biosynthesi... NC_000913 gi|16128794 >1jw9B 1 247 2 248 9e-96 ... ref|NP_415347.1| ATP-dependent ade

    8. The Relationships between Shyness and Unsociability and Peer Difficulties: The Moderating Role of Insecure Attachment (United States)

      Chen, Bin-Bin; Santo, Jonathan Bruce


      The main purpose of the study was to examine the moderating role of the insecure mother-child attachment in the relations between social withdraw and peer difficulties. Participants were 487 urban children (247 boys, 240 girls) in elementary schools in Shanghai, the People's Republic of China. Data on attachment-relevant coping styles in insecure…

    9. Research Trends in Social Network Sites' Educational Use: A Review of Publications in All SSCI Journals to 2015 (United States)

      Akçayir, Gökçe; Akçayir, Murat


      In the current study, 247 articles dealing with the use of SNSs (social network sites) in education and published in Social Sciences Citation Index (SSCI) journals up to 2015 were analysed. The articles' demographic (year, learner type, used SNS, major contributing countries, and academic discipline) and topic trends were determined. As a result…

    10. Study of motional processes in polymer blends composed of isotactic polypropylene and ethylene-propylene-diene monomer rubber by broad line 1H NMR

      Czech Academy of Sciences Publication Activity Database

      Olčák, D.; Onufer, J.; Mucha, L.; Raab, Miroslav; Spěváček, Jiří


      Roč. 91, č. 1 (2004), s. 247-252 ISSN 0021-8995 R&D Projects: GA AV ČR KSK4050111; GA ČR GA106/02/1249 Institutional research plan: CEZ:AV0Z4050913 Keywords : isotactic polypropylene * EPDM rubber * blend s Subject RIV: CD - Macromolecular Chemistry Impact factor: 1.021, year: 2004

    11. Pramana – Journal of Physics | Indian Academy of Sciences

      Indian Academy of Sciences (India)

      Home; Journals; Pramana – Journal of Physics. Mustafa Salti. Articles written in Pramana – Journal of Physics. Volume 67 Issue 2 August 2006 pp 239-247 Research Articles. Møller's energy in the dyadosphere of a charged black hole · Oktay Aydogdu Mustafa Salti · More Details Abstract Fulltext PDF. We use the Møller ...

    12. An efficient similarity measure technique for medical image registration

      Indian Academy of Sciences (India)

      Author Affiliations. Vilas H Gaidhane1 Yogesh V Hote2 Vijander Singh1. Department of Instrumentation and Control Engineering, Netaji Subhas Institute of Technology, University of Delhi, New Delhi, 110 078 India; Department of Electrical Engineering, Indian Institute of Technology, Roorkee, 247 667 India ...

    13. Designing robots with care: creating an ethical framework for the future design and implementation of care robots

      NARCIS (Netherlands)

      van Wynsberghe, Amy Louise


      This book begins by highlighting the range of positive and negative aspects associated with the initiative to design and use care robots. The positive aspects vary from; the reality that care is required 24/7 and a human caregiver cannot possibly meet such a standard, the reality that patients are

    14. Factors That Impact Nurses’ Utilization of Electronic Mail (E-Mail). (United States)


      e-mail (Hebda, Czar, & Mascara , 1998; Holtzclaw et al., 1993; Murray, 1996; Staggers, 1996). Staggers (1989) identified nurses as primary processors...pp. 247-274). St. Louis: Mosby-Year Book. Hebda, T., Czar, P., & Mascara , C. (1998). Handbook of informatics for nurses and health care

    15. Association between ulcer site and outcome in complicated peptic ulcer disease

      DEFF Research Database (Denmark)

      Lolle, Ida; Møller, Morten Hylander; Rosenstock, Steffen Jais


      was 10.2% and 24.7%, respectively. Duodenal bleeding ulcer, as compared to gastric ulcer (GU), was associated with a significantly increased risk of all-cause mortality within 90 and 30 d, and with re-intervention: adjusted odds ratio (OR) 1.47 (95% confidence interval 1.30-1.67); p 

    16. Mortality in patients with Parkinson's disease

      DEFF Research Database (Denmark)

      Wermuth, L; Stenager, E; Stenager, E


      . In the background population the median age at death was 80.69 years for men and 84.37 years for women. The SMR for men was 1.92 and for women 2.47. Infections, in particular lung infections, and heart diseases were the most common causes of death. Seventy percent of the death certificates had PD as a diagnosis...

    17. The artificial pancreas : From logic to life

      NARCIS (Netherlands)

      Kropff, J.


      In this thesis we investigated the efficacy of real-life use of an artificial pancreas starting with use of these systems in a hotel setting and finally 24/7 long-term use at home. We investigated the accuracy of continuous glucose monitoring (CGM) systems that act as input for the artificial

    18. Journal of Earth System Science | Indian Academy of Sciences

      Indian Academy of Sciences (India)

      Home; Journals; Journal of Earth System Science; Volume 119; Issue 3. Volume 119, Issue 3. June 2010, pages 229-396. pp 229-247. Active and break ... a quasi 5-day wave is also noticed with significant amplitude. pp 265-283. Assessing climate change impacts on water balance in the Mount Makiling forest, Philippines.

    19. Neural Resilience to Traumatic Brain Injury: Identification of Bioactive Metabolites of Docosahexaenoic Acids Involved in Neuroprotection and Recovery (United States)


      alpha-linolenate diet on general behavior and drug sensitivity in mice. J Lipid Res 34: 239–247. 35. Carrie I, Clement M, de Javel D, Frances H, Bourre JM...lipid mediators: a new pharmacologic genus . Br J Pharmacol 2008; 153(Suppl 1): S200–15. 43. Bazan NG: Neuroprotectin D1 (NPD1): a DHA-derived mediator

    20. Královské Vinohrady a jejich urbanizační vývoj v 19. a 20. století

      Czech Academy of Sciences Publication Activity Database

      Platovská, Marie


      Roč. 57, č. 3 (2009), s. 236-247 ISSN 0049-5123 R&D Projects: GA ČR GA408/04/1404 Institutional research plan: CEZ:AV0Z80330511 Keywords : urbanism * architecture * 19th century Subject RIV: AL - Art, Architecture, Cultural Heritage

    1. Možnosti zobrazení a analýzy v rastrovacím elektronovém mikroskopu s vysokým rozlišením.

      Czech Academy of Sciences Publication Activity Database

      Mika, Filip; Paták, Aleš; Pokorná, Zuzana


      Roč. 62, č. 10 (2017), s. 245-247 ISSN 0447-6441 R&D Projects: GA MŠk(CZ) LO1212 Institutional support: RVO:68081731 Keywords : scanning electron microscopy * display and analysis capabilities Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering OBOR OECD: Particles and field physics

    2. The effect of instruction type and dyadic or individual emulation on the quality of higher-order peer feedback in EFL

      NARCIS (Netherlands)

      van Steendam, E.; Rijlaarsdam, G.; Sercu, L.; van den Bergh, H.


      Studies in peer feedback on written texts show that instruction in revision is necessary for the effectiveness of global feedback. Participants in the study were 247 university freshmen, native speakers of Dutch, who took the same Business English course, and were instructed a revision strategy

    3. Skyrme–Hartree–Fock approach to the change of level occupancy of ...

      Indian Academy of Sciences (India)

      pp. 247–253. Skyrme–Hartree–Fock approach to the change of level occupancy of low mass halo nuclei. RUPAYAN BHATTACHARYA. Gurudas College, Narikeldanga, Calcutta 700 054, India. MS received 29 January 1999. Abstract. With a new parameterization of potential parameters which reproduces the ground state.

    4. Resolution of alpha/beta-amino acids by enantioselective penicillin G acylase from Achromobacter sp

      Czech Academy of Sciences Publication Activity Database

      Grulich, Michal; Brezovský, J.; Štěpánek, Václav; Palyzová, Andrea; Kyslíková, Eva; Kyslík, Pavel


      Roč. 122, DEC 2015 (2015), s. 240-247 ISSN 1381-1177 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : Penicillin G acylase * Enantioselectivity * Homologous model Subject RIV: CE - Biochemistry Impact factor: 2.189, year: 2015

    5. The Relation between Different Facets of Creativity and the Dark Side of Personality (United States)

      Dahmen-Wassenberg, Phoebe; Kämmerle, Monika; Unterrainer, Human-Friedrich; Fink, Andreas


      This study examined the relation between different facets of creativity and personality, focusing on the dark side of personality. In a sample of 247 students, psychometric measures for the assessment of the dark triad of personality (subclinical narcissism, Machiavellianism, subclinical psychopathy), personality organization (structural deficit:…

    6. Česká fyzikální chemie za Bohuslava Raýmana

      Czech Academy of Sciences Publication Activity Database

      Jindra, Jiří


      Roč. 3, č. 2 (2011), s. 232-247 ISSN 1803-9448 Institutional research plan: CEZ:AV0Z80630520 Keywords : B. Raýman 1852-1910 * education on physical chemistry in Prague * period 1882-1911 Subject RIV: AB - History

    7. The Tuskegee Airmen: Combat Motivation of the Lonely Eagles (United States)


      hero worship, and 24/7 news media outlets that spoon - feed predigested bits of information, the public has stopped thinking critically about the...exploits of popular black fliers like Bessie Coleman and Hubert Julian. By age ten, he tells readers, he routinely skipped school to hang out at a

    8. Journal of Earth System Science | Indian Academy of Sciences

      Indian Academy of Sciences (India)

      ... 2003 pp 61-77. Indian Ocean surface winds from NCMRWF analysis as compared to QuikSCAT and moored buoy winds ... Skills of different mesoscale models over Indian region during monsoon season: Forecast errors · Someshwar Das ... pp 247-258. Improvements in medium range weather forecasting system of India.

    9. Page 34

      African Journals Online (AJOL)


      The level of education and years of farming were the significant factors influencing access to credit by farmers in the area under study. 76.5% obtained loans from formal sources, while 23.5% got loans through informal sources. Further analysis, 24.7% of the farmers sampled, had problems of delay in approval and obtaining.

    10. Growth response of downy birch (Betula pubescens) to moisture treatment at an cut-over peat bog in the Šumava Mts., Czech Republic

      Czech Academy of Sciences Publication Activity Database

      Lanta, Vojtěch; Hazuková, I.


      Roč. 42, - (2005), s. 247-256 ISSN 0003-3847 R&D Projects: GA ČR GD206/03/H034 Institutional research plan: CEZ:AV0Z6005908 Keywords : Betula pubescens * cut-over peatland * increment Subject RIV: EF - Botanics Impact factor: 0.315, year: 2005

    11. Math-Gender Stereotypes in Elementary School Children (United States)

      Cvencek, Dario; Meltzoff, Andrew N.; Greenwald, Anthony G.


      A total of 247 American children between 6 and 10 years of age (126 girls and 121 boys) completed Implicit Association Tests and explicit self-report measures assessing the association of (a) "me" with "male" (gender identity), (b) "male" with "math" (math-gender stereotype), and (c) "me" with "math" (math self-concept). Two findings emerged.…

    12. Homelessness in Rural Areas: Causes, Patterns, and Trends. (United States)

      First, Richard J.; And Others


      Conducted study of rural homelessness in Ohio. Of 919 homeless adults interviewed, 247 were heading family units; 480 children were in these families. More than two-thirds of families were headed by single parents. Found differences in demographic characteristics of rural homeless population as compared to urban counterparts. Findings have…

    13. Genetic variants of the human H+/dipeptide transporter PEPT2

      DEFF Research Database (Denmark)

      Pinsonneault, Julia; Nielsen, Carsten Uhd; Sadée, Wolfgang


      . We have conducted a haplotype analysis of 27 single nucleotide polymorphisms located in or near exons of the human gene encoding hPEPT2 (SLC15A2), using genotyping data from 247 genomic DNA samples from the Coriell collection. Our analysis reveals that hPEPT2 has a >6-kilobase sequence block...

    14. Isothermal Vapour-Liquid Equilibrium with Chemical Reaction in the Quaternary Water + Methanol + Acetic Acid + Methyl Acetate System, and in Five Binary Subsystems.

      Czech Academy of Sciences Publication Activity Database

      Bernatová, Svatoslava; Aim, Karel; Wichterle, Ivan


      Roč. 247, 1-2 (2006) , s. 96-101 ISSN 0378-3812 R&D Projects: GA ČR(CZ) GA203/03/1588 Institutional research plan: CEZ:AV0Z40720504 Keywords : esterification * chemical equilibria * phase equilibria Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.680, year: 2006

    15. Dissipative weak solutions to compressible Navier–Stokes–Fokker–Planck systems with variable viscosity coefficients

      Czech Academy of Sciences Publication Activity Database

      Feireisl, Eduard; Lu, Y.; Süli, E.


      Roč. 443, č. 1 (2016), s. 322-351 ISSN 0022-247X Keywords : weak solutions * kinetic polymer models * FENE chain Subject RIV: BA - General Mathematics Impact factor: 1.064, year: 2016

    16. What to Do about Being Overwhelmed: Graduate Students, Stress and University Services (United States)

      Oswalt, Sara B.; Riddock, Christina C.


      Few studies have examined graduate students and stress. At a large, Southeastern university, 223 graduate students completed a survey about factors contributing their stress, current coping strategies and related university services. A majority felt stressed (48.9%) or very stressed (24.7%). There were significant differences in coping strategies…

    17. Recirkulace výkonu ve fúzních elektrárnách.

      Czech Academy of Sciences Publication Activity Database

      Entler, Slavomír; Kolovratník, M.; Dostál, V.


      Roč. 67, č. 4 (2017), s. 247-250 ISSN 0375-8842 Grant - others:AV ČR(CZ) StrategieAV21/2 Program:StrategieAV Institutional support: RVO:61389021 Keywords : fusion energy * power recirculation * net efficiency Subject RIV: JF - Nuclear Energetics OBOR OECD: Nuclear related engineering

    18. Identification of TMPRSS2 as a Susceptibility Gene for Severe 2009 Pandemic A(H1N1) Influenza and A(H7N9) Influenza

      NARCIS (Netherlands)

      Cheng, Zhongshan; Zhou, Jie; To, Kelvin Kai-Wang; Chu, Hin; Li, Cun; Wang, Dong; Yang, Dong; Zheng, Shufa; Hao, Ke; Bosse, Yohan; Obeidat, Ma'en; Brandsma, Corry-Anke; Song, You-Qiang; Chen, Yu; Zheng, Bo-Jian; Li, Lanjuan; Yuen, Kwok-Yung


      The genetic predisposition to severe A(H1N1) 2009 (A[H1N1]pdm09) influenza was evaluated in 409 patients, including 162 cases with severe infection and 247 controls with mild infection. We prioritized candidate variants based on the result of a pilot genome-wide association study and a lung

    19. A Bosque Riparian Community Index Model for the Middle Rio Grande, Albuquerque, New Mexico: Model Documentation (United States)


      764-3890 Schmader, Matt City of Albuquerque Open Space (505) 452-5200 Stretch, Doug MRGCD (505) 247...Panicum spp. panicgrass PANIC PANICU Sorghastrum nutans Indiangrass SONU2 SORNUT Forbs Anemopsis californica yerba mansa ANCA10 ANECAL Undesirable

    20. Alzheimer's Disease Facts and Figures

      Medline Plus

      Full Text Available | Find Your Chapter 24/7 Helpline: 1.800.272.3900 Find your chapter: search by ... under age 65 and have younger-onset Alzheimer's. One in 10 people age 65 and older (10 ...

    1. Alzheimer's Disease Facts and Figures

      Medline Plus

      Full Text Available | Find Your Chapter 24/7 Helpline: 1.800.272.3900 Find your chapter: search by ... a contribution to the nation valued at $230.1 billion. Approximately two-thirds of caregivers are women, ...

    2. The Relation between Exposure to Sophisticated and Complex Language and Early-Adolescent English-Only and Language Minority Learners' Vocabulary (United States)

      Gamez, Perla B.; Lesaux, Nonie K.


      This study investigated the relation between teachers' (N = 22) use of sophisticated and complex language in urban middle-school classrooms and their students' (mean age at pretest = 11.51 years; N = 782; 568 language minority and 247 English only) vocabulary knowledge. Using videotaped classroom observations, teachers' speech was transcribed and…

    3. Management and use of dairy cattle feed resources on smallholder certified organic pineapple farms in Central Uganda

      DEFF Research Database (Denmark)

      Kiggundu, Muhammad; Kabi, Fred; Vaarst, Mette


      as major dairy cattle feed resources while only 19% reported using elephant grass. Banana peels (25.1%) and sweet potato vines (24.7%) were the most important crop residues fed to cattle. Farmers reported high cost of concentrates and scarcity of feeds as their biggest challenges in dairy cattle production...

    4. Dicty_cDB: VFJ118 [Dicty_cDB

      Lifescience Database Archive (English)

      Full Text Available tefly... 242 7e-63 FJ899850_1( FJ899850 |pid:none) Populus maximowiczii x Populus n...bidopsis thaliana DNA chromosom... 247 3e-64 AF170086_1( AF170086 |pid:none) Cucurbita pepo silverleaf whi

    5. 48 CFR 652.237-71 - Identification/Building Pass. (United States)


      ... letter to the company Facility Security Officer (FSO) notifying them that the individual may proceed to... period of performance; (D) Type of access (24/7, normal business hours, escort authority or no escort... level; and, (D) Contract number and period of performance; (iii) The DS-1838, Request for Building Pass...

    6. Good agreement of conventional and gel-based direct agglutination test in immune-mediated haemolytic anaemia

      NARCIS (Netherlands)

      Piek, C.J.; Teske, E.; van Leeuwen, M.W.; Day, M.J.


      Abstract Background The aim of this study was to compare a gel-based test with the traditional direct agglutination test (DAT) for the diagnosis of immune-mediated haemolytic anaemia (IMHA). Methods Canine (n = 247) and feline (n = 74) blood samples were submitted for DAT testing to two

    7. Depth-To-Basement Mapping Using Fractal Technique: Application ...

      African Journals Online (AJOL)

      ... and can thus be obtained at source level. Application to aeromagnetic data from the Chad basin north eastern Nigeria produced a basement relief which range from depths of 2.47 km to 5.40 km with an average of 3.92 +- 0.66 km. Keywords: Fractal, depth, basement, spectra, aeromagnetic. Nigerian Journal of Physics Vol ...


      African Journals Online (AJOL)

      South African obstetricians manage hypertensive disorders of pregnancy. RESULTS. MATERIALS AND METHODS pre-eclampsia, 247 of the respondents (58%) said they would prescribe Iow-dose aspirin. Conclusion. This study demonstrates that South African obstetricians show great uniformity in terms of the treatment.

    9. Do Antenatal and Postnatal Parental Psychological Distress, and Recognized Need of Help Predict Preadolescent's Psychiatric Symptoms? The Finnish Family Competence Cohort Study (United States)

      Pihlakoski, Leena; Sourander, Andre; Aromaa, Minna; Ronning, John A.; Rautava, Paivi; Helenius, Hans; Sillanpaa, Matti


      In a prospective population-based study, mothers and fathers of 1,247 children reported their physical and mental health during pregnancy, after delivery, within the child's first 18 months of life, and at 12 years. Additionally, maternal health clinic nurses rated parents' well-being and perceived need for support. At age 12, child outcomes were…

    10. In situ high temperature XRD studies of ZnO nanopowder prepared ...

      Indian Academy of Sciences (India)


      Department of Chemistry and Centre of Nanotechnology,. Indian Institute of Technology Roorkee, Roorkee 247 667, India. Abstract. Ultrasonic mist chemical vapour deposition (UM–CVD) system has been developed to prepare. ZnO nanopowder. This is a promising method for large area deposition at low temperature ...

    11. Sequence Classification: 892271 [

      Lifescience Database Archive (English)

      Full Text Available Non-TMB Non-TMH Non-TMB Non-TMB Non-TMB Non-TMB >gi|33438860|ref|NP_878148.1| Identified by expression profi...ling and mass spectrometry; Ymr247w-ap || ...

    12. Analysis of genetic diversity of Piper spp. in Hainan Island (China ...

      African Journals Online (AJOL)



      Oct 26, 2011 ... Inter-simple sequence repeat (ISSR) analysis was used to evaluate the genetic variation of Piper spp. from Hainan, China. 247 polymorphic bands out of a total of 248 (99.60%) were generated from 74 individual plants of Piper spp. The overall level of genetic diversity among Piper spp. in Hainan was.

    13. Nutritional status and effect of maternal employment among children ...

      African Journals Online (AJOL)

      Background: Childhood malnutrition remains common in many parts of the world; the magnitude of worldwide stunting, underweight and wasting in children under five years of age were 24.7 %, 15.1 % and 7.8 %, respectively. More than 150 million children under the age of five years in the developing world are ...

    14. Polypyrrole nanotubes: the tuning of morphology and conductivity

      Czech Academy of Sciences Publication Activity Database

      Sapurina, Irina; Li, Yu; Alekseeva, E.; Bober, Patrycja; Trchová, Miroslava; Morávková, Zuzana; Stejskal, Jaroslav


      Roč. 113, 24 March (2017), s. 247-258 ISSN 0032-3861 R&D Projects: GA ČR(CZ) GA16-02787S Institutional support: RVO:61389013 Keywords : conducting polymer * conductivity * dyes Subject RIV: CD - Macromolecular Chemistry OBOR OECD: Polymer science Impact factor: 3.684, year: 2016

    15. Huttonia spicata (Sternberg) emend. and its spores, the Radnice Basin (Bolsovian), Carboniferous continental basins of the Czech Republic

      Czech Academy of Sciences Publication Activity Database

      Libertín, M.; Bek, Jiří


      Roč. 128, 3/4 (2004), s. 247-261 ISSN 0034-6667 R&D Projects: GA AV ČR(CZ) IAA3013902 Keywords : Huttonia * in situ spores * sphenopsids Subject RIV: DB - Geology ; Mineralogy Impact factor: 0.886, year: 2004

    16. Production of K*(892)(0) and phi(1020) in pp collisions at root s=7 TeV

      Czech Academy of Sciences Publication Activity Database

      Abelev, B.; Adam, J.; Adamová, Dagmar; Bielčík, J.; Bielčíková, Jana; Čepila, J.; Křelina, M.; Krus, M.; Kushpil, Svetlana; Kushpil, Vasilij; Mareš, Jiří A.; Pachr, M.; Petráček, V.; Petráň, M.; Pospíšil, V.; Šmakal, R.; Šumbera, Michal; Vajzer, Michal; Zach, Č.; Závada, Petr


      Roč. 72, č. 10 (2012), s. 2183 ISSN 1434-6044 R&D Projects: GA MŠk LA08015 Institutional support: RVO:61389005 ; RVO:68378271 Keywords : hadron production * heavy ion collisions * ALICE Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders; BF - Elementary Particles and High Energy Physics (FZU-D) Impact factor: 5.247, year: 2012

    17. 75 FR 71079 - Site Renumbering Notice; Foreign-Trade Zone 29-Louisville, KY (United States)


      ... 2240 and 2250 Outer Loop Road) [formerly Site 4, Parcel D]; Site 12 (29 acres)--Salt River Business... acres)--located within the Riverport Industrial Complex (includes 247 acres along Johnsontown Road... junction of Gene Snyder Freeway and La Grange Road in eastern Jefferson County; Site 3 (142 acres, 1,629...

    18. The Effects of Cortisol, Corticosterone, Insulin and Glucose Pre- and Post-Treatment on Heatstroke in Rats and the Kinetics of Uptake and Cellular Response. (United States)


      on Ultrastructure and Cytodhaical Changes during Myocardial Iscamn. Am. J. Pathoi. 92:1, 1978. 11. Go11eh D, and! Dtz D. Heat Syndrom : A Raview. J...Fatty Acids. J. Biol. Chem. 247:3229, 1972. 21. Ken M, Minick 0, Baha R, Stein R, and Kent G. Ultrastrucural (arges in the Liver in Heattroks. Am. J

    19. 48 CFR 47.207-3 - Description of shipment, origin, and destination. (United States)


      ..., hazardous material, whether packed for export, or unusual value. (d) Exclusion of freight. The contracting officer shall (1) clearly identify any freight or types of shipments that are subject to exclusion; e.g... clause substantially the same as the clause at 52.247-7, Freight Excluded, when any commodities or types...

    20. Stressful Life Events: Moderators of the Relationships of Gender and Gender Roles to Self-Reported Depression and Suicidality among College Students. (United States)

      Waelde, Lynn C.; And Others


      Examines whether relationships of self-reported depression and suicidality to gender roles or gender are moderated by stressful life events. Results with 290 female and 247 male undergraduates support the androgyny model of adjustment and a self-schema model of depression. (SLD)

    1. A Study on the Characteristics of Carbon-Related Spectral Lines from a Laser-Induced Fly Ash Plasma

      International Nuclear Information System (INIS)

      Pan Gang; Lu Jidong; Dong Meirong; Yao Shunchun; Xie Zixin; Fan Ju


      A 1064 nm Nd:YAG laser was used to ablate fly ash samples. The characteristics of the spectral lines measured from the laserablated fly ash plasmas are presented with special attention to atomic and molecular carbon emission. It is shown that the intensity of the atomic line C I 192.9 nm is weak and the shot-to-shot intensity is fluctuant. The carbon atomic line C I 247.7 nm is relatively intensive and stable, however it is seriously interfered with by Fe I 247.8 nm. The intensity of the CN molecular line is close to that of C I 247.7 nm and the CN line is stable and less interfered with. The comparison of molecular CN emission under different conditions (air, Ar and N 2 ) shows that the CN lines detected from the plasmas formed in an atmospheric environment are correlated with the reaction of carbon atoms in the plasma with the nitrogen in air, which indicates that the CN line is also important in pulsed laser ablation fly ash plasmas and this information can be incorporated in the detection of unburned carbon content in fly ash. Finally, a calibration curve is established with a correlation coefficient R 2 of 0.999, using C I 247.7 nm and the CN molecular line as associated variables. In addition, accuracy is improved to a certain extent. (paper)

    2. Corrigendum to “Cross-sections of solution funnels” [J. Math. Anal. Appl. 433 (2) (2016) 957–973

      Czech Academy of Sciences Publication Activity Database

      Hájek, Petr Pavel; Vivi, P.


      Roč. 435, č. 1 (2016), s. 1017 ISSN 0022-247X Institutional support: RVO:67985840 Keywords : polynomial algebra Subject RIV: BA - General Math ematics Impact factor: 1.064, year: 2016

    3. Proto-Oncogenic Src Phosphorylates EB1 to Regulate the Microtubule-Focal Adhesion Crosstalk and Stimulate Cell Migration. (United States)

      Zhang, Yijun; Luo, Youguang; Lyu, Rui; Chen, Jie; Liu, Ruming; Li, Dengwen; Liu, Min; Zhou, Jun


      Cell migration, a complex process critical for tumor progression and metastasis, requires a dynamic crosstalk between microtubules (MTs) and focal adhesions (FAs). However, the molecular mechanisms underlying this event remain elusive. Herein we identify the proto-oncogenic protein Src as an important player in the regulation of the MT-FA crosstalk. Src interacts with and phosphorylates end-binding protein 1 (EB1), a member of MT plus end-tracking proteins (+TIPs), both in cells and in vitro . Systematic mutagenesis reveals that tyrosine-247 (Y247) is the primary residue of EB1 phosphorylated by Src. Interestingly, both constitutively activated Src and Y247-phosphorylated EB1 localize to the centrosome and FAs. Src-mediated EB1 phosphorylation diminishes its interactions with other +TIPs, including adenomatous polyposis coli (APC) and mitotic centromere associated kinesin (MCAK). In addition, EB1 phosphorylation at Y247 enhances the rate of MT catastrophe and significantly stimulates cell migration. These findings thus demonstrate that the Src-EB1 axis plays a crucial role in regulating the crosstalk between MTs and FAs to promote cell migration.

    4. 75 FR 25895 - Self-Regulatory Organizations; Notice of Filing and Immediate Effectiveness of a Proposed Rule... (United States)


      ... Trust. 287 EWT iShares MSCI Taiwan Index Fund. 237 COST Costco Wholesale Corp..... 288 KBH KB Home. 239... analysis. Index option products would be included in the quarterly expansions if the underlying index... ranking Symbol Security name 153 XLV Health Care Select Sector 247 JCP JC Penney Co Inc. SPDR Fund. 155...

    5. The Integral Equation Method and the Neumann Problem for the Poisson Equation on NTA Domains

      Czech Academy of Sciences Publication Activity Database

      Medková, Dagmar


      Roč. 63, č. 21 (2009), s. 227-247 ISSN 0378-620X Institutional research plan: CEZ:AV0Z10190503 Keywords : Poisson equation * Neumann problem * integral equation method Subject RIV: BA - General Mathematics Impact factor: 0.477, year: 2009

    6. DNA Barcodes of Lepidoptera Reared from Yawan, Papua New Guinea

      Czech Academy of Sciences Publication Activity Database

      Miller, S. E.; Rosati, M. E.; Gewa, B.; Novotný, Vojtěch; Weiblen, G. D.; Herbert, P. D. N.


      Roč. 117, č. 2 (2015), s. 247-250 ISSN 0013-8797 R&D Projects: GA ČR(CZ) GA14-04258S Institutional support: RVO:60077344 Keywords : DNA barcodes * Lepidoptera * Papua New Guinea Subject RIV: EH - Ecology, Behaviour Impact factor: 0.593, year: 2015

    7. Effect of soil invertebrates on the formation of humic substances under laboratory conditions

      Czech Academy of Sciences Publication Activity Database

      Frouz, Jan; Li, X.; Brune, A.; Pižl, Václav; Abakumov, E.V.


      Roč. 44, č. 8 (2011), s. 893-896 ISSN 1064-2293 R&D Projects: GA ČR GA526/01/1055; GA MŠk 2B08023 Institutional research plan: CEZ:AV0Z60660521 Keywords : mineralization * transformation * protein Subject RIV: EH - Ecology, Behaviour Impact factor: 0.247, year: 2011

    8. Oxygen consumption of the earthworm species .i.Dendrobaena mrazeki./i

      Czech Academy of Sciences Publication Activity Database

      Šustr, Vladimír; Pižl, Václav


      Roč. 45, 5-6 (2009), s. 478-482 ISSN 1164-5563 R&D Projects: GA ČR GA206/03/0056 Institutional research plan: CEZ:AV0Z60660521 Keywords : earthworms * Dendrobaena mrazeki * respiration rate Subject RIV: EH - Ecology, Behaviour Impact factor: 1.247, year: 2009

    9. Indian practice on estimation of scour around bridge piers—A ...

      Indian Academy of Sciences (India)

      Department of Civil Engineering, Indian Institute of Technology, Roorkee 247 667 e-mail: MS received 27 December 2005; revised 25 ... York in 1987, which killed 10 people, the US Federal Highway Administration mandated that all state highway agencies evaluate existing and proposed bridges for ...

    10. Almost periodic evolution systems with impulse action at state-dependent moments

      Czech Academy of Sciences Publication Activity Database

      Hakl, Robert; Pinto, M.; Tkachenko, V.; Trofimchuk, S.


      Roč. 446, č. 1 (2017), s. 1030-1045 ISSN 0022-247X Institutional support: RVO:67985840 Keywords : Wexler's almost periodic solution * evolution system * impulse action at variable times Subject RIV: BA - General Mathematics OBOR OECD: Applied mathematics Impact factor: 1.064, year: 2016

    11. Resonance – Journal of Science Education | Indian Academy of ...

      Indian Academy of Sciences (India)

      Home; Journals; Resonance – Journal of Science Education; Volume 18; Issue 3. Discovery of a Boson at CERN and Indian Connections. Gagan B Mohanty. General Article Volume 18 Issue 3 March 2013 pp 241-247. Fulltext. Click here to view fulltext PDF. Permanent link:

    12. Effect of supplementary nutrition with Fe, Zn chelates and urea on ...

      African Journals Online (AJOL)



      Feb 7, 2012 ... needs for food in sustainable ways. Plant Soil, 247: 3-24. Cakmak I, Kalayci M, Ekiz H, Braun HJ, Yilmaz A (1999). Zinc deficiency as an actual problem in plant and human nutrition in. Turkey: A NATO-Science for Stability Project. Field Crops Res. 60: 175-188. Cakmak I, Torun A, Millet E, Feldman M, ...

    13. The Future Direction of Correctional Services for Adult Offenders. (United States)

      Reynolds, William Bradford

      These remarks by William Bradford Reynolds, Assistant Attorney General of the Justice Department's Civil Rights Division under the Reagan Administration, cover the Department's position on providing improved correctional services for adult offenders. Reynolds cites P.L. 96-247, the Civil Rights of Institutionalized Persons Act, as an important…

    14. New Fellows and Honorary Fellow

      Indian Academy of Sciences (India)

      Elected: 1974 Section: Engineering & Technology. Lal, Prof. Shankar Ph.D. (CIT). Date of birth: 25 June 1923. Date of death: 25 September 1991. Specialization: Fluid Mechanics, Heat Transfer and Solid Mechanics Last known address: Dept. of Mechanical & Industrial, Engineering, University of Roorkee, Roorkee 247 667.

    15. Real-time H_2 and H_infty control of a gyroscope using a polynomial approach

      Czech Academy of Sciences Publication Activity Database

      Orozco, J. L. M.; Ruiz-Leon, J.; Henrion, Didier; Šebek, M.


      Roč. 35, č. 3 (2005), s. 247-254 R&D Projects: GA ČR GA102/02/0709 Institutional research plan: CEZ:AV0Z10750506 Keywords : control system design * optimization H_2 * polynomial H_infty Subject RIV: BC - Control Systems Theory


      African Journals Online (AJOL)


      The Abdus Salam International Centre for Theoretical Physics (ICTP) and. Swedish International Development Cooperation Agency (Sida) are thanked for their support. REFERENCES. 1. Kumar, D.; Gupta, P.K.; Syamal, A. J. Chem. Sci. 2005, 3, 247. 2. Britovsek, G.J.P.; Mastroianni, S.; Solan, G.A.; Baugh, S.P.D.; Redshaw, ...

    17. Ligand-based Reduction in a Molecular Rectangle with Four Organplatinum(IV) Vertices

      Czech Academy of Sciences Publication Activity Database

      Kavakli, C.; Schwederski, B.; Fiedler, Jan; Gudat, D.; Kaim, W.


      Roč. 636, č. 1 (2010), s. 114-120 ISSN 0044-2313 R&D Projects: GA MŠk OC09043; GA MŠk OC 140 Institutional research plan: CEZ:AV0Z40400503 Keywords : electrochemistry * organometallic compounds * platinum Subject RIV: CG - Electrochemistry Impact fac tor: 1.247, year: 2010

    18. 9 CFR 354.210 - Minimum standards for sanitation, facilities, and operating procedures in official plants. (United States)


      ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Minimum standards for sanitation, facilities, and operating procedures in official plants. 354.210 Section 354.210 Animals and Animal Products... sanitation, facilities, and operating procedures in official plants. The provisions of §§ 354.210 to 354.247...

    19. Case report

      African Journals Online (AJOL)


      5 mai 2016 ... Garcia JA, Garcia-Fernandez M, Romance A, Sanchez JC. Wandering spleen and gastric volvulus. Pediatr Radiol. 1994;. 24(7): 535-6. PubMed | Google Scholar. 3. Melikoglu M, Colak T, Kasasoglu. Two unusual cases of wandering spleen requiring splenectomy. Eur J Pediatr Surg. 1995; 5(1): 48-9.

    20. 77 FR 74177 - Information Collection Requirement; Defense Federal Acquisition Regulation Supplement; Production... (United States)


      ... material management and accounting systems conform to established DoD standards. c. The information... to establish, maintain, and disclose material management and accounting systems. c. DFARS 252.247... and Reporting (OMB Control Number 0704-0250) AGENCY: Defense Acquisition Regulations System...

    1. Bacteraemia due to Escherichia coli in a Danish university hospital, 1986-1990

      DEFF Research Database (Denmark)

      Olesen, B; Kolmos, H J; Orskov, F


      433 episodes of E. coli bactereaemia over a 5-year period in a Danish university hospital were studied with special emphasis on possible differences between nosocomial (NO) and community-acquired (CA) cases. Data from 186 males and 247 females with ages ranging from 9 days to 94 years were record...... to leukopenia (45%), immunosuppressive therapy and NO bacteraemia....

    2. Cost-efficient evaluation of ambulance services for community ...

      African Journals Online (AJOL)

      Victims requiring emergency obstetric care (EMOC) accounted for 24.7% of victims transported, road traffic accidents victims10.3% and the least were rape victims at 0.03%. The annual operational cost was Kshs. 70,328,627 (USD 717,639.05). Expenditure profiles indicated that staff wages accounted for 49% of total ...

    3. Download this PDF file

      African Journals Online (AJOL)

      insoluble “tar balls” of thc alsphaltenc residue either sink in mid-ocean or can be removed from beaches without great difficulty (Grant and Longs, 1947). Kerosene is .... OKPOKWASILI, G. C., AMANCHUKWU, S. C.. (1988): Petroleum Hydrocarbon Degradation by Candida species. Environment international. 14: 243 — 247.

    4. The Central Dogma of Molecular Biology

      Indian Academy of Sciences (India)

      Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 3. The Central Dogma of Molecular Biology - A Retrospective after Fifty Years. Michel Morange. General Article Volume 14 Issue 3 March 2009 pp 236-247. Fulltext. Click here to view fulltext PDF. Permanent link:

    5. Michel Morange

      Indian Academy of Sciences (India)

      Home; Journals; Resonance – Journal of Science Education. Michel Morange. Articles written in Resonance – Journal of Science Education. Volume 14 Issue 3 March 2009 pp 236-247 General Article. The Central Dogma of Molecular Biology - A Retrospective after Fifty Years · Michel Morange · More Details Fulltext PDF ...

    6. 48 CFR 3447.7000 - Foreign travel clause. (United States)


      ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Foreign travel clause... REGULATION CONTRACT MANAGEMENT TRANSPORTATION Foreign Travel 3447.7000 Foreign travel clause. The contracting officer shall insert the clause in 3452.247-70, Foreign Travel, in all solicitations and resultant cost...

    7. Conformational study of melectin and antapin antimicrobial peptides in model membrane environments

      Czech Academy of Sciences Publication Activity Database

      Kocourková, L.; Novotná, P.; Čujová, Sabína; Čeřovský, Václav; Urbanová, M.; Setnička, V.


      Roč. 170, Jan 5 (2017), s. 247-255 ISSN 1386-1425 Institutional support: RVO:61388963 Keywords : antimicrobial peptides * conformation * liposomes * model membranes * circular dichroism * infrared spectroscopy Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 2.536, year: 2016

    8. Interpersonal Competence Configurations and Peer Relations in Early Elementary Classrooms: Perceived Popular and Unpopular Aggressive Subtypes (United States)

      Robertson, Dylan L.; Farmer, Thomas W.; Fraser, Mark W.; Day, Steven H.; Duncan, Tisha; Crowther, Amity; Dadisman, Kimberly A.


      Social relations of second grade students (247 boys, 290 girls) were examined in rural elementary classrooms. Cluster analysis of teacher ratings was used to identify interpersonal competence configurations including perceived unpopular-aggressive (i.e., "Troubled") and perceived popular-aggressive (i.e., "Tough") subtypes for…

    9. Some Crandall–Rabinowitz type results and applications toreaction–diffusion systems

      Czech Academy of Sciences Publication Activity Database

      Väth, Martin


      Roč. 458, č. 2 (2018), s. 1324-1343 ISSN 0022-247X Institutional support: RVO:67985840 Keywords : Crandall–Rabinowitz theorem * jumping nonlinearity * splitting of critical point Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 1.064, year: 2016

    10. 49 CFR 174.86 - Maximum allowable operating speed. (United States)


      ... 49 Transportation 2 2010-10-01 2010-10-01 false Maximum allowable operating speed. 174.86 Section... operating speed. (a) For molten metals and molten glass shipped in packagings other than those prescribed in § 173.247 of this subchapter, the maximum allowable operating speed may not exceed 24 km/hour (15 mph...

    11. Antigenicity and immunogenicity of a novel Plasmodium vivax circumsporozoite derived synthetic vaccine construct

      DEFF Research Database (Denmark)

      Céspedes, Nora; Jiménez, Eliécer; Lopez-Perez, Mary


      and the two natural repeat variant regions known as VK210 and VK247. We studied the natural immune response to this region in human sera from different malaria-endemic areas and its immunogenicity in mice. RESULTS: PvNR1R2 was more frequently recognized by sera from Papua New Guinea (PNG) (83%) than...

    12. Egyptian Journal of Medical Human Genetics - Vol 15, No 3 (2014)

      African Journals Online (AJOL)

      Impact of copeptin on diagnosis of acute coronary syndrome · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Z H El Sayed, H A Mahmoud, L Y El Shall, F A El Sheshtawey, M A Mohamed, 241-247. ...

    13. Comments on "Design of Entrained-Flow and Moving-, Packed-, and Fluidized-Bed Sorption Systems: Grain-Model Kinetics for Hot Coal-Gas Desulfurization with Limestone"

      Czech Academy of Sciences Publication Activity Database

      Hartman, Miloslav; Svoboda, Karel; Trnka, Otakar


      Roč. 41, - (2002), s. 1914-1915 ISSN 0888-5885 Institutional research plan: CEZ:AV0Z4072921 Keywords : hydrogen sulfide * calcium oxide * coal gas Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 1.247, year: 2002

    14. Comments on "Proposal for a Regenerative High-Temperature Process for Coal Gas Cleanup with Calcined Limestone"

      Czech Academy of Sciences Publication Activity Database

      Hartman, Miloslav; Trnka, Otakar


      Roč. 41, č. 24 (2002), s. 6207-6208 ISSN 0888-5885 R&D Projects: GA ČR GA203/98/0101; GA AV ČR IAA4072711 Keywords : H2S removal * coal gas * limestone Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 1.247, year: 2002

    15. Single sodium channels from human ventricular muscle in planar lipid bilayers

      NARCIS (Netherlands)

      Wartenberg, H. C.; Wartenberg, J. P.; Urban, B. W.


      Sodium channels from human ventricular muscle membrane vesicles were incorporated into planar lipid bilayers and the steady-state behavior of single sodium channels were examined in the presence of batrachotoxin. In symmetrical 500 mM NaCl the averaged single channel conductance was 24.7 +/- 1.3 pS

    16. Modern Time as Historical Artifact

      DEFF Research Database (Denmark)

      Nye, David Edwin


      Explores different aspects of how Americans have understood and used time since the late eighteenth century through the historical transition that has led to the present 24/7 world, where time-keeping is built into a myriad of devices that record and to some degree direct our actions....

    17. Early Treatment in Shock (United States)


      Vitamin E in Health and Disease, Marcel Dekker, Inc., New York, pp 247-268. 17. Qureshi AA, Mo H, Packer L, and Peterson DM. (2000) Isolation and...increases in thromboxane A3, prostacyclin 9 PGI3., and leukotriene B5 . More generally, the leukotrienes, prostacyclins, 10 thromboxanes, and

    18. Bioremediation of PAH-contaminated soil with fungi - from laboratory to field scale

      Czech Academy of Sciences Publication Activity Database

      Winquist, E.; Björklöf, K.; Schultz, E.; Räsänen, M.; Salonen, K.; Anasonye, F.; Cajthaml, Tomáš; Steffen, K.; Jorgensen, K.S.; Tuomela, M.


      Roč. 86, č. 2 (2014), s. 238-247 ISSN 0964-8305 R&D Projects: GA TA ČR TE01020218 Institutional support: RVO:61388971 Keywords : bioremediation * contaminated soil * PAH * field scale Subject RIV: EE - Microbiology, Virology Impact factor: 2.131, year: 2014

    19. Optical properties of 1T and 2H phases of TaS2 and TaSe2

      Indian Academy of Sciences (India)

      Author Affiliations. Sangeeta Sharma1 S Auluck1 M A Khan2. Department of Physics, University of Roorkee, Roorkee 247 667, India; Institut de Physique et Chimie des materiaux Metalliques, 23, rue du loess, F-67037 Strasbourg Cedex, France ...

    20. Utilfredsstillende langtidsresultater efter konservativ behandling af patellofemoralt smertesyndrom

      DEFF Research Database (Denmark)

      Rathleff, Michael Skovdal; Rasmussen, Sten; Olesen, Jens Lykkegaard


      This review overviews the long-term prognosis of conservatively treated patients with patellofemoral pain syndrome (PFPS). Median values of the 16 included studies show that 29% of soldiers, 27.8% of sports active and 24,7% of the general public will become pain free after they are diagnosed...

    1. CHAPTER 1

      African Journals Online (AJOL)

      Dr Olaleye

      247(98.9%), Resistance was highest to Co-trimoxazole 108(44.8%) and Tetracycline: 108(43.7%). ... (Lieff et al., 2004) and gram-negative anaerobic bacteria .... pregnancy is as shown in Table 2. Table 3: Antibiotic Sensitivity Pattern. Antibiotic. Sensitive. Frequency (%). Resistant. Frequency (%). Augmentin. 166 (84.7).

    2. Effect of Preparation Method on Catalytic Properties of Co-Mn-Al Mixed Oxides for N2O Decomposition.

      Czech Academy of Sciences Publication Activity Database

      Klyushina, A.; Pacultová, K.; Karásková, K.; Jirátová, Květa; Ritz, M.; Fridrichová, D.; Volodorskaja, A.; Obalová, L.


      Roč. 425, DEC 15 (2016), s. 237-247 ISSN 1381-1169 R&D Projects: GA ČR GA14-13750S Institutional support: RVO:67985858 Keywords : Co-Mn-Al mixed oxide * N2O decomposition * preparation methods Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 4.211, year: 2016

    3. RADAMOL tool: Role of radiation quality and charge transfer in damage distribution along DNA oligomer

      Czech Academy of Sciences Publication Activity Database

      Štěpán, Václav; Davídková, Marie


      Roč. 68, č. 8 (2014), s. 240-247 ISSN 1434-6060 R&D Projects: GA MŠk LD12008; GA MŠk MP1002 Nano-IBCT Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:61389005 Keywords : radiation damage * ionizations * DNA Subject RIV: BO - Biophysics Impact factor: 1.228, year: 2014

    4. The Enjoyment Rewards of Fulfilling a Custodial Grandparenting Role in the Lives of Grandchildren Removed from Their Parents' Care (United States)

      Taylor, Myra F.; Marquis, Ruth; Coall, David A.; Werner, Jenni


      Custodial grandparenting (i.e. raising grandchildren on a full-time basis) is a global phenomenon. Despite the hardships associated with 24/7 custodial care, grandparents continue to invest in their grandchildren. Why they do so is a matter of much conjecture. For example, it has been posited that grandparents assume custodial care of their…

    5. Considerations about the light reflectance digital imaging colorimetry under linear approach

      Czech Academy of Sciences Publication Activity Database

      Pospíšil, Jaroslav; Hrdý, J.; Hrdý, jr., J.


      Roč. 51, č. 9 (2006), s. 247-251 ISSN 0447-6441 Institutional research plan: CEZ:AV0Z10100522 Keywords : light reflectance digital imaging colorimetry * digital color camera * tristimulus color coordinates * camera digital output color data Subject RIV: BH - Optics, Masers, Lasers

    6. Attachment, Autonomy, and Emotional Reliance: A Multilevel Model (United States)

      Lynch, Martin F.


      This article reports a test of a multilevel model investigating how attachment security and autonomy contribute to emotional reliance, or the willingness to seek interpersonal support. Participants ("N" = 247) completed online measures of attachment, autonomy, emotional reliance, and vitality with respect to several everyday…

    7. Journal of Chemical Sciences | Indian Academy of Sciences

      Indian Academy of Sciences (India)

      Though the reactions have both electrostatic control and frontier orbital control the former dominates in the initial stages of the reaction. pp 237-247. Influence of alkali and alkaline earth ions on the -alkylation of the lower rim phenolic-OH groups of -tert-butyl-calix[4]arene to result in amide-pendants: Template action of K ...

    8. Browse Title Index - African Journals Online

      African Journals Online (AJOL)

      Items 101 - 150 of 247 ... Vol 25, No 1 (2012), Mormon Impressions: Locating Mormon Footprints on the South African Religious Landscape, Abstract. BT Alston. Vol 19, No 2 (2006):, Mourning in a Minority Language: Assia Djebar's Algerian White, Abstract. A Schneider. Vol 27, No 1 (2014), Moving towards Understanding ...

    9. Associative Ionization of Excited Sodium Species with Various Ligands: Assessing Relative Bonding Strengths of Ion-ligand Interactions

      Czech Academy of Sciences Publication Activity Database

      Gilligan, J. J.; McCunn, L. R.; Leskiw, B. D.; Herman, Zdeněk; Castleman Jr., A. W.


      Roč. 204, 1/3 (2001), s. 247-253 ISSN 1387-3806 Institutional research plan: CEZ:AV0Z4040901 Keywords : associative ionization * cluster ions * sodium bonding energies Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.176, year: 2001

    10. Robotized Warehouse Systems: Developments and Research Opportunities

      NARCIS (Netherlands)

      K. Azadeh (Kaveh); M.B.M. de Koster (René); D. Roy (Debjit)


      textabstractRobotized handling systems are increasingly applied in distribution centers. They require little space, provide flexibility in managing varying demand requirements, and are able to work 24/7. This makes them particularly fit for e-commerce operations. This paper reviews new categories of

    11. Fulltext PDF

      Indian Academy of Sciences (India)


      Department of Metallurgical and Materials Engineering, Indian Institute of Technology, Roorkee 247 667, India ..... and Design 25 439. Siglu D, Mortpetit M C and Haworth W L 1983 Met. Trans. A14 931. Singh S 1985 Thermomechanical ageing of 2014 aluminium alloy, PhD Thesis, University of Roorkee, Roorkee. Singh S ...

    12. The Role of Teachers' Comments during Book Reading in Children's Vocabulary Growth (United States)

      Barnes, Erica M.; Dickinson, David K.; Grifenhagen, Jill F.


      This study described the commenting practices of Head Start teachers, and the relationship of comments to the expressive and receptive vocabulary growth of children with below-the-mean language ability across one year of preschool. Participants included 52 Head Start teachers, and 489 children (247 early intervention candidates and 242 Head Start…

    13. Cardiorespiratory Fitness of Inmates of a Maximum Security Prison ...

      African Journals Online (AJOL)


      The aim of this study is to determine the level of cardiorespiratory fitness (CRF) of inmates in Maiduguri. Maximum Security Prison; and also to determine the effects of age, gender, and period of incarceration on CRF. A total of 247 apparently healthy inmates of Maiduguri Maximum Security Prison participated in the. 2 study.

    14. Synthesis and characterization of electroless Ni–P coated graphite ...

      Indian Academy of Sciences (India)


      Metallurgical and Materials Engineering Department, Indian Institute of Technology Roorkee, Roorkee 247 667, India ... Electroless alkaline bath is used to coat Ni–P graphite particles of average size, 150 μm. ... irregular and fractured surfaces while the surface of coated particles revealed the presence of Ni–P globules.

    15. Studies on relaxation length of wood by method of gamma radiation ...

      African Journals Online (AJOL)

      Relaxation lengths of different types of wood were determined using gamma radiation from 60Co source. Results show that oxystigma (Oxystigma spp) has the highest relaxation length of 23.810 cm, while mangrove (Rhizophora spp) has the least relaxation length of 1.247 cm. A mathematical model has been developed ...

    16. Maternal mortality associated with eclampsia in Sokoto, Nigeria ...

      African Journals Online (AJOL)

      However, it was only in Glasgow coma score that a significant difference in case mortality was observed (p = 0.000). The perinatal death associated with eclampsia was 24.7%, and 61.5% of them occurred amongst mothers who died from eclampsia. Conclusion: Eclampsia is a major contributor to maternal mortality in the ...

    17. 78 FR 78063 - Appendix 4 to Draft Qualitative Risk Assessment of Risk of Activity/Food Combinations for... (United States)


      ... small or very small businesses that are engaged only in specific types of on-farm food production... Vol. 78 Tuesday, No. 247 December 24, 2013 Part IV Department of Health and Human Services Food... Risk of Activity/ Food Combinations for Activities (Outside the Farm Definition) Conducted in a...

    18. When All Signs Point to You: Lies Told in the Face of Evidence (United States)

      Evans, Angela D.; Xu, Fen; Lee, Kang


      Young children's ability to tell a strategic lie by making it consistent with the physical evidence of their transgression was investigated along with the sociocognitive correlates of such lie-telling behaviors. In Experiment 1, 247 Chinese children between 3 and 5 years of age (126 boys) were left alone in a room and asked not to lift a cup to…

    19. Scedosporium and Pseudallescheria low molecular weight metabolites revealed by database search

      Czech Academy of Sciences Publication Activity Database

      Krásný, Lukáš; Strohalm, Martin; Bouchara, J.-P.; Šulc, Miroslav; Lemr, Karel; Barreto-Bergter, E.; Havlíček, Vladimír


      Roč. 54, č. 3 (2011), s. 37-42 ISSN 0933-7407 R&D Projects: GA MŠk LC07017 Institutional research plan: CEZ:AV0Z50200510 Keywords : Scedosporium apiospermum * Scedosporium prolificans * Pseudallescheria boydii Subject RIV: CE - Biochemistry Impact factor: 2.247, year: 2011

    20. Written on the Writer's Face: Facial Width-to-Height Ratio among Nominees and Laureates of the Nobel Prize in Literature (United States)

      Lebuda, Izabela; Karwowski, Maciej


      This study examined the relationship between facial width-to-height ratio (fWHR), an established marker of testosterone level and dominance, and eminent writers' achievement. The fWHR of laureates (N = 39) and nominees (N = 247) of the Nobel Prize in Literature 1901-1950 was measured together with historiometric data. It was demonstrated that…

    1. Psychosociální stres žen: Přehled současných poznatků

      Czech Academy of Sciences Publication Activity Database

      Šolcová, Iva


      Roč. 40, č. 3 (1996), s. 237-247 ISSN 0009-062X R&D Projects: GA ČR GA406/95/0736 Keywords : women's health * multiple roles * total work load * women's stress Subject RIV: AN - Psychology Impact factor: 0.122, year: 1995

    2. Factors Affecting Training Effectiveness in Synchronous, Dispersed Virtual Environments (United States)


      Educational Psychology Mediating Processes Cognitive Attitude Bagozzi & Burnkrant, 1985; Yang & Yoo, 2004 Social Psychology, Information...Systems Cognitive Engagement Davis, 2012 Educational Psychology Table 1. Factors contributing to learning in synchronous, dispersed VLE with...effects of performance goals on self-regulatory strategy use? Educational Psychology , 24(2), 231–247. Brett, J. F., & VandeWalle, D. (1999). Goal

    3. Phylogeny of the Neotropical cichlid fish tribe Cichlasomatini (Teleostei: Cichlidae) based on morphological and molecular data, with the description of a new genus

      Czech Academy of Sciences Publication Activity Database

      Musilová, Zuzana; Říčan, Oldřich; Novák, J.


      Roč. 47, č. 3 (2009), s. 234-247 ISSN 0947-5745 R&D Projects: GA MŠk LC06073 Institutional research plan: CEZ:AV0Z50450515 Keywords : Cichlasomatini * And inoacara * Aequidens Subject RIV: EH - Ecology, Behaviour Impact factor: 1.850, year: 2009

    4. Micro and nanohardness testing of laser welds

      Czech Academy of Sciences Publication Activity Database

      Šebestová, H.; Čtvrtlík, Radim; Chmelíčková, H.; Tomáštík, J.


      Roč. 15, č. 3 (2014), s. 247-253 ISSN 1454-9069 R&D Projects: GA TA ČR TA01010517 Institutional support: RVO:68378271 Keywords : Vickers microhardness * depth sensing indentation * laser welding Subject RIV: JP - Industrial Processing Impact factor: 1.658, year: 2014

    5. A Report to the Congress: Joining Together To Fight Child Abuse. (United States)

      National Center on Child Abuse and Neglect (DHHS/OHDS), Washington, DC.

      This report concerns the coordination of goals, objectives, and activities of agencies which have responsibilities for programs and activities related to child abuse and neglect, as required by P.L. 93-247, as amended. It describes some of the combined efforts of federal agencies and other organizations for the calendar years 1983 and 1984 and…

    6. Endoglucanase and xylanase production by Bacillus sp. AR03 in co-culture. (United States)

      Hero, Johan S; Pisa, José H; Perotti, Nora I; Romero, Cintia M; Martínez, María A


      The behavior of three isolates retrieved from different cellulolytic consortia, Bacillus sp. AR03, Paenibacillus sp. AR247 and Achromobacter sp. AR476-2, were examined individually and as co-cultures in order to evaluate their ability to produce extracellular cellulases and xylanases. Utilizing a peptone-based medium supplemented with carboxymethyl cellulose (CMC), an increase estimation of 1.30 and 1.50 times was obtained by the co-culture containing the strains AR03 and AR247, with respect to enzyme titles registered by their individual cultivation. On the contrary, the extracellular enzymatic production decreased during the co-cultivation of strain AR03 with the non-cellulolytic Achromobacter sp. AR476-2. The synergistic behavior observed through the combined cultivation of the strains AR03 and AR247 might be a consequence of the consumption by Paenibacillus sp. AR247 of the products of the CMC hydrolysis (i.e., cellobiose and/or cello-oligosaccharides), which were mostly generated by the cellulase producer Bacillus sp. AR03. The effect observed could be driven by the requirement to fulfill the nutritional supply from both strains on the substrate evaluated. These results would contribute to a better description of the degradation of the cellulose fraction of the plant cell walls in nature, expected to an efficient utilization of renewable sources.


      African Journals Online (AJOL)


      ABSTRACT. Background: The well-being of women and children is one of the major determinants of the health of any nation and can ... preconception care, the result showed that majority (65.9%, n=247) of the respondents have not sought the care before pregnancy ... women have optimal health in order to give birth to.

    8. A Prospective Randomized Clinical Study of the Influence of Primary ...

      African Journals Online (AJOL)

      complete wound healing is achieved and contamination from the ... mean age of 24.7 ± 4.9 years (range 19‑33 years) for Group A ... clean wounds.[16]. The use of single suture and sutureless techniques to achieve secondary closure following third molar surgery have been reported.[10,17] These emerging techniques ...

    9. Animal Production Research Advances - Vol 6, No 4 (2010)

      African Journals Online (AJOL)

      Packed Cell Volume as an Indicator of Camel Trypanosomosis in the Sudan · EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. AM Ibrahim, AA Ismail, AA Majid, HS Sidig, ME Osman, AH Rahman, 247-251 ...

    10. Transmission problem for the Laplace equation and the integral equation method

      Czech Academy of Sciences Publication Activity Database

      Medková, Dagmar


      Roč. 387, č. 2 (2012), s. 837-843 ISSN 0022-247X Institutional research plan: CEZ:AV0Z10190503 Keywords : transmission problem * Laplace equation * boundary integral equation Subject RIV: BA - General Mathematics Impact factor: 1.050, year: 2012

    11. Møller's energy in the dyadosphere of a charged black hole

      Indian Academy of Sciences (India)

      black hole. OKTAY AYDOGDU and MUSTAFA SALTI. (Pramana – J. Phys. 67, 239–247 (2006)). We have added references which had been missed in our article and have refreshed the reference list. We list below the new references and point out the place where these have been added. • S S Xulu, gr-qc/0304081 (ref.

    12. Analysis of single nucleotide polymorphisms of PRNP gene in ...

      Indian Academy of Sciences (India)

      J. Genet. 89, 247–251] hypothesized to act as a superoxide dismutase (Wong et al. 2000a). About 85% cases of human prion diseases have been found to ... 2003). The putative functionality of the SNP is yet to be unearthed. Although the copper-binding ability and the level of superoxide dismutase activity do not seem.

    13. ORF Alignment: Ca19AnnotatedDec2004aaSeq [GENIUS II[Archive

      Lifescience Database Archive (English)

      Full Text Available Ca19AnnotatedDec2004aaSeq orf19.2937; >1u02A 1 220 11 247 4e-27 ... gb|EAL02637.1| hy....10454 [Candida ... albicans SC5314] gb|AAA34356.1| phosphomannomutase ... [Candida albicans] ...sp|P31353|PMM_CANAL ... Phosphomannomutase (PMM) ... Length = 237 ...

    14. Crossing Cross-Platform: Comparing Skills Preferences and Convergence Attitudes in Strategic Communication and News Disciplines (United States)

      Hubbard, Glenn T.; Kang, Jin-Ae; Crawford, Elizabeth Crisp


      National survey of college mass communication students (N = 247) analyzed attitudes on the teaching of print and electronic media skills, using journalism students as comparison group. Previous research had not explored strategic communication student responses to convergence. Found identity variables within public relations (PR) field related to…

    15. EST Table: FY016706 [KAIKOcDNA[Archive

      Lifescience Database Archive (English)

      Full Text Available FY016706 rbmov17i21 11/12/09 n.h 11/11/04 45 %/247 aa ref|XP_970998.1| PREDICTED: similar to Evolution...1094187|ref|XP_970998.1| PREDICTED: similar to Evolutionarily conserved signaling intermediate in Toll pathway, mitochondrial [Tribolium castaneum] FY016706 bmov ...

    16. Analysis of genetic diversity of Piper spp. in Hainan Island (China ...

      African Journals Online (AJOL)

      Inter-simple sequence repeat (ISSR) analysis was used to evaluate the genetic variation of Piper spp. from Hainan, China. 247 polymorphic bands out of a total of 248 (99.60%) were generated from 74 individual plants of Piper spp. The overall level of genetic diversity among Piper spp. in Hainan was high, with the mean ...

    17. Enamel paint techniques in archaeology and their identification using XRF and micro-XRF

      Czech Academy of Sciences Publication Activity Database

      Hložek, M.; Trojek, T.; Komoróczy, Balázs; Prokeš, R.


      Roč. 137, August (2017), s. 243-247 ISSN 0969-806X R&D Projects: GA ČR(CZ) GA15-20700S Keywords : X-ray fluorescence * Scanning * Enamel * Microanalysis Subject RIV: AC - Archeology, Anthropology, Ethnology OBOR OECD: Archaeology Impact factor: 1.315, year: 2016

    18. Efficiency/Equity Analysis of Water Resources Problems--A Game Theoretic Approach. (United States)


      Oskar Morgenstern appeared. In particular we are interested in games wherein all of the players voluntarily agree to cooperate because it is mutually...of justice, Journal of Philosophy and Public Affairs, 4, 223-247, 1975. Von Neumann, J., and 0. Morgenstern , Theory of Games and Economic Behavior

    19. SQSQh: 1H-detected SQ-SQ Experiment for Determination of Signed Silicon-Carbon Coupling Constants

      Czech Academy of Sciences Publication Activity Database

      Blechta, Vratislav; Schraml, Jan


      Roč. 48, č. 6 (2010), s. 464-470 ISSN 0749-1581 R&D Projects: GA AV ČR IAA400720706 Institutional research plan: CEZ:AV0Z40720504 Keywords : nmr * sqsq sequence * sign of coupling constant Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.247, year: 2010

    20. Banach spaces with projectional skeletons

      Czech Academy of Sciences Publication Activity Database

      Kubiś, Wieslaw


      Roč. 350, č. 2 (2009), s. 758-776 ISSN 0022-247X Institutional research plan: CEZ:AV0Z10190503 Keywords : projection * projectional skeleton * norming set Subject RIV: BA - General Mathematics Impact factor: 1.225, year: 2009