Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

Science.gov (United States)

Szymanski, Maciej; Karlowski, Wojciech M

2016-01-01

In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

Science.gov (United States)

Drouin, Guy; Tsang, Corey

2012-06-01

Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

An Archaea 5S rRNA analog is stably expressed in Escherichia coli

Science.gov (United States)

Yang, Y.; Fox, G. E.

1996-01-01

Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

Genetic Determinants of RNA Editing Levels of ADAR Targets in Drosophila melanogaster.

Science.gov (United States)

Kurmangaliyev, Yerbol Z; Ali, Sammi; Nuzhdin, Sergey V

2015-12-12

RNA editing usually affects only a fraction of expressed transcripts and there is a vast amount of variation in editing levels of ADAR (adenosine deaminase, RNA-specific) targets. Here we explore natural genetic variation affecting editing levels of particular sites in 81 natural strains of Drosophila melanogaster. The analysis of associations between editing levels and single-nucleotide polymorphisms allows us to map putative cis-regulatory regions affecting editing of 16 A-to-I editing sites (cis-RNA editing quantitative trait loci or cis-edQTLs, P < 10(-8)). The observed changes in editing levels are validated by independent molecular technique. All identified regulatory variants are located in close proximity of modulated editing sites. Moreover, colocalized editing sites are often regulated by same loci. Similar to expression and splicing QTL studies, the characterization of edQTLs will greatly expand our understanding of cis-regulatory evolution of gene expression. Copyright © 2016 Kurmangaliyev et al.

Genetic Determinants of RNA Editing Levels of ADAR Targets in Drosophila melanogaster

Directory of Open Access Journals (Sweden)

Yerbol Z. Kurmangaliyev

2016-02-01

Full Text Available RNA editing usually affects only a fraction of expressed transcripts and there is a vast amount of variation in editing levels of ADAR (adenosine deaminase, RNA-specific targets. Here we explore natural genetic variation affecting editing levels of particular sites in 81 natural strains of Drosophila melanogaster. The analysis of associations between editing levels and single-nucleotide polymorphisms allows us to map putative cis-regulatory regions affecting editing of 16 A-to-I editing sites (cis-RNA editing quantitative trait loci or cis-edQTLs, P < 10−8. The observed changes in editing levels are validated by independent molecular technique. All identified regulatory variants are located in close proximity of modulated editing sites. Moreover, colocalized editing sites are often regulated by same loci. Similar to expression and splicing QTL studies, the characterization of edQTLs will greatly expand our understanding of cis-regulatory evolution of gene expression.

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

Science.gov (United States)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

International Nuclear Information System (INIS)

Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

1987-01-01

A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

DEFF Research Database (Denmark)

Ostergaard, P; Phan, H; Johansen, L B

1998-01-01

The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

Origin of sphinx, a young chimeric RNA gene in Drosophila melanogaster

Science.gov (United States)

Wang, Wen; Brunet, Frédéric G.; Nevo, Eviatar; Long, Manyuan

2002-01-01

Non-protein-coding RNA genes play an important role in various biological processes. How new RNA genes originated and whether this process is controlled by similar evolutionary mechanisms for the origin of protein-coding genes remains unclear. A young chimeric RNA gene that we term sphinx (spx) provides the first insight into the early stage of evolution of RNA genes. spx originated as an insertion of a retroposed sequence of the ATP synthase chain F gene at the cytological region 60DB since the divergence of Drosophila melanogaster from its sibling species 2–3 million years ago. This retrosequence, which is located at 102F on the fourth chromosome, recruited a nearby exon and intron, thereby evolving a chimeric gene structure. This molecular process suggests that the mechanism of exon shuffling, which can generate protein-coding genes, also plays a role in the origin of RNA genes. The subsequent evolutionary process of spx has been associated with a high nucleotide substitution rate, possibly driven by a continuous positive Darwinian selection for a novel function, as is shown in its sex- and development-specific alternative splicing. To test whether spx has adapted to different environments, we investigated its population genetic structure in the unique “Evolution Canyon” in Israel, revealing a similar haplotype structure in spx, and thus similar evolutionary forces operating on spx between environments. PMID:11904380

A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

Science.gov (United States)

Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

Genetic selection and DNA sequences of 4.5S RNA homologs

DEFF Research Database (Denmark)

Brown, S; Thon, G; Tolentino, E

1989-01-01

A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

Science.gov (United States)

Kirpekar, F; Douthwaite, S; Roepstorff, P

2000-02-01

We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

Science.gov (United States)

Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

2016-12-01

Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?

International Nuclear Information System (INIS)

Pelczar, P.; Fiett, J.; Bartnik, E.

1994-01-01

We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig

Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

International Nuclear Information System (INIS)

Hirose, Yutaka; Harada, Fumio

2008-01-01

4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus

Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

Directory of Open Access Journals (Sweden)

Stern David B

2010-09-01

Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

Science.gov (United States)

Kamina, Anyango D; Williams, Noreen

2017-01-01

RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

A critical role for noncoding 5S rRNA in regulating Mdmx stability.

Science.gov (United States)

Li, Muyang; Gu, Wei

2011-09-16

Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

Science.gov (United States)

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

2018-04-06

Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

Dm5-HT2B: Pharmacological Characterization of the Fifth Serotonin Receptor Subtype of Drosophila melanogaster.

Science.gov (United States)

Blenau, Wolfgang; Daniel, Stöppler; Balfanz, Sabine; Thamm, Markus; Baumann, Arnd

2017-01-01

Serotonin (5-hydroxytryptamine, 5-HT) is an important regulator of physiological and behavioral processes in both protostomes (e.g., insects) and deuterostomes (e.g., mammals). In insects, serotonin has been found to modulate the heart rate and to control secretory processes, development, circadian rhythms, aggressive behavior, as well as to contribute to learning and memory. Serotonin exerts its activity by binding to and activating specific membrane receptors. The clear majority of these receptors belong to the superfamily of G-protein-coupled receptors. In Drosophila melanogaster , a total of five genes have been identified coding for 5-HT receptors. From this family of proteins, four have been pharmacologically examined in greater detail, so far. While Dm5-HT 1A , Dm5-HT 1B , and Dm5-HT 7 couple to cAMP signaling cascades, the Dm5-HT 2A receptor leads to Ca 2+ signaling in an inositol-1,4,5-trisphosphate-dependent manner. Based on sequence similarity to homologous genes in other insects, a fifth D. melanogaster gene was uncovered coding for a Dm5-HT 2B receptor. Knowledge about this receptor's pharmacological properties is very limited. This is quite surprising because Dm5-HT 2B has been attributed to distinct physiological functions based on genetic interference with its gene expression. Mutations were described reducing the response of the larval heart to 5-HT, and specific knockdown of Dm5-HT 2B mRNA in hemocytes resulted in a higher susceptibility of the flies to bacterial infection. To gain deeper understanding of Dm5-HT 2B 's pharmacology, we evaluated the receptor's response to a series of established 5-HT receptor agonists and antagonists in a functional cell-based assay. Metoclopramide and mianserin were identified as two potent antagonists that may allow pharmacological interference with Dm5-HT 2B signaling in vitro and in vivo .

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes

International Nuclear Information System (INIS)

Schubert, I.; Baeumlein, H.; Wobus, U.

1978-01-01

In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)

Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

Science.gov (United States)

Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

2017-11-01

Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

NARCIS (Netherlands)

Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

2012-01-01

Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

Science.gov (United States)

Ciganda, Martin; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

Common 5S rRNA variants are likely to be accepted in many sequence contexts

Science.gov (United States)

Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

2003-01-01

Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing

Science.gov (United States)

Kelleher, Erin S.

2016-01-01

Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614

The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

International Nuclear Information System (INIS)

Nuc, K.; Nuc, P.; Pawelkiewicz, J.

1993-01-01

We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

A ribonuclease-resistant region of 5S RNA and its relation to the RNA binding sites of proteins L18 and L25

DEFF Research Database (Denmark)

Douthwaite, S; Garrett, R A; Wagner, R

1979-01-01

An RNA fragment, constituting three subfragments of nucleotide sequences 1-11, 69-87 and 89-120, is the most ribonuclease-resistant part of the native 5S RNA of Escherichia coli, at 0 degrees C. A smaller fragment of nucleotide sequence 69-87 and 90-110 is ribonuclease-resistant at 25 degrees....... Degradation of the L25-5S RNA complex with ribonuclease A or T2 yielded RNA fragments similar to those of the free 5S RNA at 0 degrees C and 25 degrees C; moreover L25 remained strongly bound to both RNA fragments and also produced some opening of the RNA structure in at least two positions. Protein L18...... initially protected most of the 5S RNA against ribonuclease digestion, at 0 degrees C, but was then gradually released prior to the formation of the larger RNA fragment. It cannot be concluded, therefore, as it was earlier (Gray et al., 1973), that this RNA fragment contains the primary binding site of L18....

Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

Science.gov (United States)

Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

2017-04-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

Science.gov (United States)

Ahuja, Richa; Kumar, Vijay

2017-07-01

RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

Science.gov (United States)

Beauparlant, Marc A; Drouin, Guy

2014-02-01

Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

Science.gov (United States)

Tan, Cheng; Li, Wenfei; Wang, Wei

2013-12-19

Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

The 4.5 S RNA gene of Escherichia coli is essential for cell growth

DEFF Research Database (Denmark)

Brown, S; Fournier, M J

1984-01-01

The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...

Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

Science.gov (United States)

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

Science.gov (United States)

Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

2015-04-07

During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

Science.gov (United States)

Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

2015-03-11

A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster.

Science.gov (United States)

Webster, Claire L; Waldron, Fergal M; Robertson, Shaun; Crowson, Daisy; Ferrari, Giada; Quintana, Juan F; Brouqui, Jean-Michel; Bayne, Elizabeth H; Longdon, Ben; Buck, Amy H; Lazzaro, Brian P; Akorli, Jewelna; Haddrill, Penelope R; Obbard, Darren J

2015-07-01

Drosophila melanogaster is a valuable invertebrate model for viral infection and antiviral immunity, and is a focus for studies of insect-virus coevolution. Here we use a metagenomic approach to identify more than 20 previously undetected RNA viruses and a DNA virus associated with wild D. melanogaster. These viruses not only include distant relatives of known insect pathogens but also novel groups of insect-infecting viruses. By sequencing virus-derived small RNAs, we show that the viruses represent active infections of Drosophila. We find that the RNA viruses differ in the number and properties of their small RNAs, and we detect both siRNAs and a novel miRNA from the DNA virus. Analysis of small RNAs also allows us to identify putative viral sequences that lack detectable sequence similarity to known viruses. By surveying >2,000 individually collected wild adult Drosophila we show that more than 30% of D. melanogaster carry a detectable virus, and more than 6% carry multiple viruses. However, despite a high prevalence of the Wolbachia endosymbiont--which is known to be protective against virus infections in Drosophila--we were unable to detect any relationship between the presence of Wolbachia and the presence of any virus. Using publicly available RNA-seq datasets, we show that the community of viruses in Drosophila laboratories is very different from that seen in the wild, but that some of the newly discovered viruses are nevertheless widespread in laboratory lines and are ubiquitous in cell culture. By sequencing viruses from individual wild-collected flies we show that some viruses are shared between D. melanogaster and D. simulans. Our results provide an essential evolutionary and ecological context for host-virus interaction in Drosophila, and the newly reported viral sequences will help develop D. melanogaster further as a model for molecular and evolutionary virus research.

Involvement of oxidative stress in 4-vinylcyclohexene-induced toxicity in Drosophila melanogaster.

Science.gov (United States)

Abolaji, Amos Olalekan; Kamdem, Jean Paul; Lugokenski, Thiago Henrique; Nascimento, Thallita Kalar; Waczuk, Emily Pansera; Farombi, Ebenezer Olatunde; Loreto, Élgion Lúcio da Silva; Rocha, João Batista Teixeira

2014-06-01

4-Vinylcyclohexene (VCH) is a dimer of 1,3-butadiene produced as a by-product of pesticides, plastic, rubber, flame retardants, and tire production. Although, several studies have reported the ovotoxicity of VCH, information on a possible involvement of oxidative stress in the toxicity of this occupational chemical is scarce. Hence, this study was carried out to investigate further possible mechanisms of toxicity of VCH with a specific emphasis on oxidative stress using a Drosophila melanogaster model. D. melanogaster (both genders) of 1 to 3 days old were exposed to different concentrations of VCH (10 µM-1 mM) in the diet for 5 days. Subsequently, the survival and negative geotaxis assays and the quantification of reactive oxygen species (ROS) generation were determined. In addition, we evaluated RT-PCR expressions of selected oxidative stress and antioxidant mRNA genes (HSP27, 70, and 83, SOD, Nrf-2, MAPK2, and catalase). Furthermore, catalase, glutathione-S-transferase (GST), delta aminolevulinic acid dehydratase (δ-ALA-D), and acetylcholinesterase (AChE) activities were determined. VCH exposure impaired negative geotaxic behavior and induced the mRNA of SOD, Nrf-2, and MAPK2 genes expressions. There were increases in catalase and ROS production, as well as inhibitions of GST, δ-ALA-D, and AChE activities (Pbalance, and possible neurotoxic consequences due to decreased AChE activity, and impairments in negative geotaxic behavior. Thus, we conclude that D. melanogaster is a useful model for investigating the toxicity of VCH exposure, and here, we have provided further insights on the mechanism of VCH-induced toxicity. Copyright © 2014 Elsevier Inc. All rights reserved.

Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

Science.gov (United States)

Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

2012-07-01

Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

Science.gov (United States)

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-17

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

Viral unmasking of cellular 5S rRNA pseudogene transcripts induces RIG-I-mediated immunity.

Science.gov (United States)

Chiang, Jessica J; Sparrer, Konstantin M J; van Gent, Michiel; Lässig, Charlotte; Huang, Teng; Osterrieder, Nikolaus; Hopfner, Karl-Peter; Gack, Michaela U

2018-01-01

The sensor RIG-I detects double-stranded RNA derived from RNA viruses. Although RIG-I is also known to have a role in the antiviral response to DNA viruses, physiological RNA species recognized by RIG-I during infection with a DNA virus are largely unknown. Using next-generation RNA sequencing (RNAseq), we found that host-derived RNAs, most prominently 5S ribosomal RNA pseudogene 141 (RNA5SP141), bound to RIG-I during infection with herpes simplex virus 1 (HSV-1). Infection with HSV-1 induced relocalization of RNA5SP141 from the nucleus to the cytoplasm, and virus-induced shutoff of host protein synthesis downregulated the abundance of RNA5SP141-interacting proteins, which allowed RNA5SP141 to bind RIG-I and induce the expression of type I interferons. Silencing of RNA5SP141 strongly dampened the antiviral response to HSV-1 and the related virus Epstein-Barr virus (EBV), as well as influenza A virus (IAV). Our findings reveal that antiviral immunity can be triggered by host RNAs that are unshielded following depletion of their respective binding proteins by the virus.

Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

NARCIS (Netherlands)

Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

RNA-Sequencing of Drosophila melanogaster Head Tissue on High-Sugar and High-Fat Diets

Directory of Open Access Journals (Sweden)

Wayne Hemphill

2018-01-01

Full Text Available Obesity has been shown to increase risk for cardiovascular disease and type-2 diabetes. In addition, it has been implicated in aggravation of neurological conditions such as Alzheimer’s. In the model organism Drosophila melanogaster, a physiological state mimicking diet-induced obesity can be induced by subjecting fruit flies to a solid medium disproportionately higher in sugar than protein, or that has been supplemented with a rich source of saturated fat. These flies can exhibit increased circulating glucose levels, increased triglyceride content, insulin-like peptide resistance, and behavior indicative of neurological decline. We subjected flies to variants of the high-sugar diet, high-fat diet, or normal (control diet, followed by a total RNA extraction from fly heads of each diet group for the purpose of Poly-A selected RNA-Sequencing. Our objective was to identify the effects of obesogenic diets on transcriptome patterns, how they differed between obesogenic diets, and identify genes that may relate to pathogenesis accompanying an obesity-like state. Gene ontology analysis indicated an overrepresentation of affected genes associated with immunity, metabolism, and hemocyanin in the high-fat diet group, and CHK, cell cycle activity, and DNA binding and transcription in the high-sugar diet group. Our results also indicate differences in the effects of the high-fat diet and high-sugar diet on expression profiles in head tissue of flies, despite the reportedly similar phenotypic impacts of the diets. The impacted genes, and how they may relate to pathogenesis in the Drosophila obesity-like state, warrant further experimental investigation.

5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger.

Science.gov (United States)

Zheng, Xiaomei; Zheng, Ping; Zhang, Kun; Cairns, Timothy C; Meyer, Vera; Sun, Jibin; Ma, Yanhe

2018-04-30

The CRISPR/Cas9 system is a revolutionary genome editing tool. However, in eukaryotes, search and optimization of a suitable promoter for guide RNA expression is a significant technical challenge. Here we used the industrially important fungus, Aspergillus niger, to demonstrate that the 5S rRNA gene, which is both highly conserved and efficiently expressed in eukaryotes, can be used as a guide RNA promoter. The gene editing system was established with 100% rates of precision gene modifications among dozens of transformants using short (40-bp) homologous donor DNA. This system was also applicable for generation of designer chromosomes, as evidenced by deletion of a 48 kb gene cluster required for biosynthesis of the mycotoxin fumonisin B1. Moreover, this system also facilitated simultaneous mutagenesis of multiple genes in A. niger. We anticipate that the use of the 5S rRNA gene as guide RNA promoter can broadly be applied for engineering highly efficient eukaryotic CRISPR/Cas9 toolkits. Additionally, the system reported here will enable development of designer chromosomes in model and industrially important fungi.

The developmental transcriptome of Drosophila melanogaster

Energy Technology Data Exchange (ETDEWEB)

University of Connecticut; Graveley, Brenton R.; Brooks, Angela N.; Carlson, Joseph W.; Duff, Michael O.; Landolin, Jane M.; Yang, Li; Artieri, Carlo G.; van Baren, Marijke J.; Boley, Nathan; Booth, Benjamin W.; Brown, James B.; Cherbas, Lucy; Davis, Carrie A.; Dobin, Alex; Li, Renhua; Lin, Wei; Malone, John H.; Mattiuzzo, Nicolas R.; Miller, David; Sturgill, David; Tuch, Brian B.; Zaleski, Chris; Zhang, Dayu; Blanchette, Marco; Dudoit, Sandrine; Eads, Brian; Green, Richard E.; Hammonds, Ann; Jiang, Lichun; Kapranov, Phil; Langton, Laura; Perrimon, Norbert; Sandler, Jeremy E.; Wan, Kenneth H.; Willingham, Aarron; Zhang, Yu; Zou, Yi; Andrews, Justen; Bicke, Peter J.; Brenner, Steven E.; Brent, Michael R.; Cherbas, Peter; Gingeras, Thomas R.; Hoskins, Roger A.; Kaufman, Thomas C.; Oliver, Brian; Celniker, Susan E.

2010-12-02

Drosophila melanogaster is one of the most well studied genetic model organisms; nonetheless, its genome still contains unannotated coding and non-coding genes, transcripts, exons and RNA editing sites. Full discovery and annotation are pre-requisites for understanding how the regulation of transcription, splicing and RNA editing directs the development of this complex organism. Here we used RNA-Seq, tiling microarrays and cDNA sequencing to explore the transcriptome in 30 distinct developmental stages. We identified 111,195 new elements, including thousands of genes, coding and non-coding transcripts, exons, splicing and editing events, and inferred protein isoforms that previously eluded discovery using established experimental, prediction and conservation-based approaches. These data substantially expand the number of known transcribed elements in the Drosophila genome and provide a high-resolution view of transcriptome dynamics throughout development. Drosophila melanogaster is an important non-mammalian model system that has had a critical role in basic biological discoveries, such as identifying chromosomes as the carriers of genetic information and uncovering the role of genes in development. Because it shares a substantial genic content with humans, Drosophila is increasingly used as a translational model for human development, homeostasis and disease. High-quality maps are needed for all functional genomic elements. Previous studies demonstrated that a rich collection of genes is deployed during the life cycle of the fly. Although expression profiling using microarrays has revealed the expression of, 13,000 annotated genes, it is difficult to map splice junctions and individual base modifications generated by RNA editing using such approaches. Single-base resolution is essential to define precisely the elements that comprise the Drosophila transcriptome. Estimates of the number of transcript isoforms are less accurate than estimates of the number of genes

5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

Science.gov (United States)

Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

2012-07-17

In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

Determination of the number of copies of genes coding for 5s-rRNA and tRNA in the genomes of 43 species of wheat and Aegilops

International Nuclear Information System (INIS)

Vakhitov, V.A.; Gimalov, F.R.; Nikonorov, Yu.M.

1986-01-01

The number of 5s-rRNA and tRNA genes has been studied in 43 species of wheat and Aegilops differing in ploidy level, genomic composition and origin. It has been demonstrated that the repeatability of the 5s-rRNA and tRNA genes increases in wheat with increasing ploidy level, but not in proportion to the genome size. In Aegilops, in distinction from wheat, the relative as well as absolute number of 5s-RNA genes increases with increasing ploidy level. The proportion of the sequences coding for tRNA in the dipoloid and polyploid Aegilops species is practically similar, while the number of tRNA genes increases almost 2-3 times with increasing ploidy level. Large variability has been recorded between the species with similar genomic composition and ploidy level in respect of the number of the 5s-rRNA and tRNA genes. It has been demonstrated that integration of the initial genomes of the amphidiploids is accompanied by elimination of a particular part of these genomes. It has been concluded that the mechanisms of establishment and evolution of genomes in the intra- and intergeneric allopolyploids are not identical

SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

Science.gov (United States)

Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

2016-03-01

Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Polynucleotide Phosphorylase, RNase E/G, and YbeY Are Involved in the Maturation of 4.5S RNA in Corynebacterium glutamicum.

Science.gov (United States)

Maeda, Tomoya; Tanaka, Yuya; Wachi, Masaaki; Inui, Masayuki

2017-03-01

Corynebacterium glutamicum has been applied for the industrial production of various metabolites, such as amino acids. To understand the biosynthesis of the membrane protein in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP is found in all three domains of life and plays an important role in the membrane insertion of proteins. SRP RNA is initially transcribed as precursor molecules; however, relatively little is known about its maturation. In C. glutamicum , SRP consists of the Ffh protein and 4.5S RNA lacking an Alu domain. In this study, we found that 3'-to-5' exoribonuclease, polynucleotide phosphorylase (PNPase), and two endo-type RNases, RNase E/G and YbeY, are involved in the 3' maturation of 4.5S RNA in C. glutamicum The mature form of 4.5S RNA was inefficiently formed in Δ rneG Δ pnp mutant cells, suggesting the existence of an alternative pathway for the 3' maturation of 4.5S RNA. Primer extension analysis also revealed that the 5' mature end of 4.5S RNA corresponds to that of the transcriptional start site. Immunoprecipitated Ffh protein contained immature 4.5S RNA in Δ pnp , Δ rneG , and Δ ybeY mutants, suggesting that 4.5S RNA precursors can interact with Ffh. These results imply that the maturation of 4.5S RNA can be performed in the 4.5S RNA-Ffh complex. IMPORTANCE Overproduction of a membrane protein, such as a transporter, is useful for engineering of strains of Corynebacterium glutamicum , which is a workhorse of amino acid production. To understand membrane protein biogenesis in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP contains the Ffh protein and SRP RNA and plays an important role in the membrane insertion of proteins. Although SRP RNA is highly conserved among the three domains of life, relatively little is known about its maturation. We show that PNPase, RNase E/G, and YbeY are involved in the 3' maturation of the SRP RNA (4.5S RNA) in

Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

Science.gov (United States)

Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

2014-05-04

The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

Science.gov (United States)

Garcia, S; Kovařík, A

2013-07-01

In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

5SRNAdb: an information resource for 5S ribosomal RNAs.

Science.gov (United States)

Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

2016-01-04

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

International Nuclear Information System (INIS)

Lee, K.M.; Marshall, A.G.

1987-01-01

Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

Differential gene expression related to Nora virus infection of Drosophila melanogaster.

Science.gov (United States)

Cordes, Ethan J; Licking-Murray, Kellie D; Carlson, Kimberly A

2013-08-01

Nora virus is a recently discovered RNA picorna-like virus that produces a persistent infection in Drosophila melanogaster, but the antiviral pathway or change in gene expression is unknown. We performed cDNA microarray analysis comparing the gene expression profiles of Nora virus infected and uninfected wild-type D. melanogaster. This analysis yielded 58 genes exhibiting a 1.5-fold change or greater and p-value less than 0.01. Of these genes, 46 were up-regulated and 12 down-regulated in response to infection. To validate the microarray results, qRT-PCR was performed with probes for Chorion protein 16 and Troponin C isoform 4, which show good correspondence with cDNA microarray results. Differential regulation of genes associated with Toll and immune-deficient pathways, cytoskeletal development, Janus Kinase-Signal Transducer and Activator of Transcription interactions, and a potential gut-specific innate immune response were found. This genome-wide expression profile of Nora virus infection of D. melanogaster can pinpoint genes of interest for further investigation of antiviral pathways employed, genetic mechanisms, sites of replication, viral persistence, and developmental effects. Copyright © 2013. Published by Elsevier B.V.

Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

DEFF Research Database (Denmark)

Christiansen, J; Douthwaite, S R; Christensen, A

1985-01-01

Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...

Comparative Analysis of Drosophila melanogaster Gut Microbiota with Respect to Host Strain, Sex, and Age.

Science.gov (United States)

Han, Gangsik; Lee, Hyo Jung; Jeong, Sang Eun; Jeon, Che Ok; Hyun, Seogang

2017-07-01

Microbiota has a significant impact on the health of the host individual. The complexity of the interactions between mammalian hosts and their microbiota highlights the value of using Drosophila melanogaster as a model organism, because of its relatively simple microbial community and ease of physiological and genetic manipulation. However, highly variable and sometimes inconsistent results regarding the microbiota of D. melanogaster have been reported for host samples collected from different geographical locations; discrepancies that may be because of the inherent physiological conditions of the D. melanogaster host. Here, we conducted a comparative analysis of the gut microbiota of two D. melanogaster laboratory strains, w 1118 and Canton S, with respect to the sex and age of the host, by pyrosequencing of the 16S rRNA gene. In addition to the widespread and abundant commensal bacterial genera Lactobacillus and Acetobacter, we identified Enterococcus and Leuconostoc as major host-strain-specific bacterial genera. The relative proportions of these bacterial genera, and those of the species within each, were found to differ markedly with respect to strain, sex, and age of the host, even though host individuals were reared under the same nutritional conditions. By using various bioinformatic tools, we uncovered several characteristic features of microbiota corresponding to specific categories of the flies: host-sex-bias association of specific bacteria, age-dependent alteration of microbiota across host species and sex, and uniqueness of the microbiota of female w 1118 flies. Our results, thus, help to further our understanding of host-microbe interactions in the D. melanogaster model.

DNAzyme-mediated recovery of small recombinant RNAs from a 5S rRNA-derived chimera expressed in Escherichia coli

Directory of Open Access Journals (Sweden)

Willson Richard C

2010-12-01

Full Text Available Abstract Background Manufacturing large quantities of recombinant RNAs by overexpression in a bacterial host is hampered by their instability in intracellular environment. To overcome this problem, an RNA of interest can be fused into a stable bacterial RNA for the resulting chimeric construct to accumulate in the cytoplasm to a sufficiently high level. Being supplemented with cost-effective procedures for isolation of the chimera from cells and recovery of the recombinant RNA from stabilizing scaffold, this strategy might become a viable alternative to the existing methods of chemical or enzymatic RNA synthesis. Results Sequence encoding a 71-nucleotide recombinant RNA was inserted into a plasmid-borne deletion mutant of the Vibrio proteolyticus 5S rRNA gene in place of helix III - loop C segment of the original 5S rRNA. After transformation into Escherichia coli, the chimeric RNA (3×pen aRNA was expressed constitutively from E. coli rrnB P1 and P2 promoters. The RNA chimera accumulated to levels that exceeded those of the host's 5S rRNA. A novel method relying on liquid-solid partitioning of cellular constituents was developed for isolation of total RNA from bacterial cells. This protocol avoids toxic chemicals, and is therefore more suitable for large scale RNA purification than traditional methods. A pair of biotinylated 8-17 DNAzymes was used to bring about the quantitative excision of the 71-nt recombinant RNA from the chimera. The recombinant RNA was isolated by sequence-specific capture on beads with immobilized complementary deoxyoligonucleotide, while DNAzymes were recovered by biotin affinity chromatography for reuse. Conclusions The feasibility of a fermentation-based approach for manufacturing large quantities of small RNAs in vivo using a "5S rRNA scaffold" strategy is demonstrated. The approach provides a route towards an economical method for the large-scale production of small RNAs including shRNAs, siRNAs and aptamers for use

Wolbachia Influences the Maternal Transmission of the gypsy Endogenous Retrovirus in Drosophila melanogaster

OpenAIRE

Touret, Franck; Guiguen, Francois; Terzian, Christophe

2014-01-01

The endosymbiotic bacteria of the genus Wolbachia are present in most insects and are maternally transmitted through the germline. Moreover, these intracellular bacteria exert antiviral activity against insect RNA viruses, as in Drosophila melanogaster, which could explain the prevalence of Wolbachia bacteria in natural populations. Wolbachia is maternally transmitted in D. melanogaster through a mechanism that involves distribution at the posterior pole of mature oocytes and then incorporati...

Mutations in the gene for EF-G reduce the requirement for 4.5S RNA in the growth of E. coli

DEFF Research Database (Denmark)

Brown, S

1987-01-01

A general strategy is described for the isolation of suppressors of essential genes whose functions are unknown. This strategy was used to analyze the role of 4.5S RNA, an essential RNA of E. coli. In this strategy, the structural gene for 4.5S RNA is fused to the Ptac promoter in such a way...... that the strain becomes dependent upon inducers of lac for growth. Mutants mapping to fus, the structural gene for protein synthesis elongation factor G, appear as spontaneous, inducer-independent revertants. These mutants alter the intracellular distribution of 4.5S RNA such that it sediments at 70S or greater....... Furthermore, the increased sedimentation velocity is sensitive to the antibiotic puromycin. These results show that 4.5S RNA physically associates with the ribosome in performing its essential function, and that this association is mediated by elongation factor G....

5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

Directory of Open Access Journals (Sweden)

Giulio Donati

2013-07-01

Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

Science.gov (United States)

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

2013-07-11

Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

DIANA-microT web server v5.0: service integration into miRNA functional analysis workflows.

Science.gov (United States)

Paraskevopoulou, Maria D; Georgakilas, Georgios; Kostoulas, Nikos; Vlachos, Ioannis S; Vergoulis, Thanasis; Reczko, Martin; Filippidis, Christos; Dalamagas, Theodore; Hatzigeorgiou, A G

2013-07-01

MicroRNAs (miRNAs) are small endogenous RNA molecules that regulate gene expression through mRNA degradation and/or translation repression, affecting many biological processes. DIANA-microT web server (http://www.microrna.gr/webServer) is dedicated to miRNA target prediction/functional analysis, and it is being widely used from the scientific community, since its initial launch in 2009. DIANA-microT v5.0, the new version of the microT server, has been significantly enhanced with an improved target prediction algorithm, DIANA-microT-CDS. It has been updated to incorporate miRBase version 18 and Ensembl version 69. The in silico-predicted miRNA-gene interactions in Homo sapiens, Mus musculus, Drosophila melanogaster and Caenorhabditis elegans exceed 11 million in total. The web server was completely redesigned, to host a series of sophisticated workflows, which can be used directly from the on-line web interface, enabling users without the necessary bioinformatics infrastructure to perform advanced multi-step functional miRNA analyses. For instance, one available pipeline performs miRNA target prediction using different thresholds and meta-analysis statistics, followed by pathway enrichment analysis. DIANA-microT web server v5.0 also supports a complete integration with the Taverna Workflow Management System (WMS), using the in-house developed DIANA-Taverna Plug-in. This plug-in provides ready-to-use modules for miRNA target prediction and functional analysis, which can be used to form advanced high-throughput analysis pipelines.

Evaluation of 5.8S rRNA to identify Penaeus semisulcatus and its subspecies, Penaeus semisulcatus persicus (Penaeidae and some Decapoda species

Directory of Open Access Journals (Sweden)

Zahra Noroozi

2015-10-01

Full Text Available The green tiger prawn, Penaeus semisulcatus is one of the most important members of the family Penaeidae in the Persian Gulf. Based on the morphological characteristics, two groups, including P. semisulcatus and its subspecies viz. P. s. persicus are recognized. This study was conducted to investigate the genetic distance between P. semisulcatus and P. s. persicus by analyzing partial sequence of 5.8S rRNA. Another objective of this study is to evaluate the ability of 5.8S rRNA to identify the species of Decapoda. The results indicated that the 5.8S rRNA gene of both P. semisulcatus and P. s. persicus were exactly identical, and sequence variation was not observed. The results also indicated that 5.8S rRNA sequences between species of the same genus of analysed species of Decapoda are conserved, and no genetic distance was observed in species level. The low evolutionary rate and efficient conservation of the 5.8S rRNA can be attributed to its role in the translation process.

[PIWI protein as a nucleolus visitor in Drosophila melanogaster].

Science.gov (United States)

Mikhaleva, E A; Iakushev, E Iu; Stoliarenko, A D; Klenov, M S; Pozovskiĭ, Ia M; Gvozdev, V A

2015-01-01

The evolutionarily conserved nuclear Piwi protein of Drosophila melanogaster is a representative of the Argonaute small RNA binding protein family. Guided by small piRNAs, Piwi functions in transposon silencing in somatic and germ cells of the gonad. We found that in ovarian somatic and germ cells, as well as in the established ovarian somatic cell line, Piwi is concentrated predominantly in the nucleolus--the main nuclear compartment, participating not only in rRNA synthesis, but also in various cell stress responses. We demonstrated the colocalization of Piwi with nucleolar marker proteins--fibrillarin and Nopp140. A mutation preventing Piwi transport to the nucleus and disturbing transposon silencing (piwi(Nt)) leads to 6-8-fold upregulation of rRNA genes expression, as evaluated by the level of transcripts of transposon insertions in 28S rRNA genes. RNase treatment of live cultured ovarian somatic cells depletes Piwi from the nucleolus. The same effect is observed upon inhibiting RNA polymerase I which transcribes rRNA, but not RNA polymerase II. In contrast, upon heat shock Piwi is concentrated in the nucleolus and is depleted from the nucleoplasm. These results implicate Piwi in RNA polymerase activity modulation and stress response in the nucleolus. We discuss possible noncanonical Piwi functions along with its canonical role in transposon silencing by piRNAs.

The translation factors of Drosophila melanogaster.

Science.gov (United States)

Marygold, Steven J; Attrill, Helen; Lasko, Paul

2017-01-02

Synthesis of polypeptides from mRNA (translation) is a fundamental cellular process that is coordinated and catalyzed by a set of canonical 'translation factors'. Surprisingly, the translation factors of Drosophila melanogaster have not yet been systematically identified, leading to inconsistencies in their nomenclature and shortcomings in functional (Gene Ontology, GO) annotations. Here, we describe the complete set of translation factors in D. melanogaster, applying nomenclature already in widespread use in other species, and revising their functional annotation. The collection comprises 43 initiation factors, 12 elongation factors, 3 release factors and 6 recycling factors, totaling 64 of which 55 are cytoplasmic and 9 are mitochondrial. We also provide an overview of notable findings and particular insights derived from Drosophila about these factors. This catalog, together with the incorporation of the improved nomenclature and GO annotation into FlyBase, will greatly facilitate access to information about the functional roles of these important proteins.

YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407

DEFF Research Database (Denmark)

Andersen, Niels Møller; Douthwaite, Stephen

2006-01-01

generally require specific enzymes, and only one m5C rRNA methyltransferase, RsmB (formerly Fmu) that methylates nucleotide C967, has previously been identified. BLAST searches of the E.coli genome revealed a single gene, yebU, with sufficient similarity to rsmB to encode a putative m5C RNA...... methyltransferase. This suggested that the yebU gene product modifies C1407 and/or C1962. Here, we analysed the E.coli rRNAs by matrix assisted laser desorption/ionization mass spectrometry and show that inactivation of the yebU gene leads to loss of methylation at C1407 in 16 S rRNA, but does not interfere...

Wolbachia influences the maternal transmission of the gypsy endogenous retrovirus in Drosophila melanogaster.

Science.gov (United States)

Touret, Franck; Guiguen, François; Terzian, Christophe

2014-09-02

The endosymbiotic bacteria of the genus Wolbachia are present in most insects and are maternally transmitted through the germline. Moreover, these intracellular bacteria exert antiviral activity against insect RNA viruses, as in Drosophila melanogaster, which could explain the prevalence of Wolbachia bacteria in natural populations. Wolbachia is maternally transmitted in D. melanogaster through a mechanism that involves distribution at the posterior pole of mature oocytes and then incorporation into the pole cells of the embryos. In parallel, maternal transmission of several endogenous retroviruses is well documented in D. melanogaster. Notably, gypsy retrovirus is expressed in permissive follicle cells and transferred to the oocyte and then to the offspring by integrating into their genomes. Here, we show that the presence of Wolbachia wMel reduces the rate of gypsy insertion into the ovo gene. However, the presence of Wolbachia does not modify the expression levels of gypsy RNA and envelope glycoprotein from either permissive or restrictive ovaries. Moreover, Wolbachia affects the pattern of distribution of the retroviral particles and the gypsy envelope protein in permissive follicle cells. Altogether, our results enlarge the knowledge of the antiviral activity of Wolbachia to include reducing the maternal transmission of endogenous retroviruses in D. melanogaster. Animals have established complex relationships with bacteria and viruses that spread horizontally among individuals or are vertically transmitted, i.e., from parents to offspring. It is well established that members of the genus Wolbachia, maternally inherited symbiotic bacteria present mainly in arthropods, reduce the replication of several RNA viruses transmitted horizontally. Here, we demonstrate for the first time that Wolbachia diminishes the maternal transmission of gypsy, an endogenous retrovirus in Drosophila melanogaster. We hypothesize that gypsy cannot efficiently integrate into the germ

Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

Science.gov (United States)

Curtiss, W C; Vournakis, J N

1984-01-01

Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

Impact of the resident microbiota on the nutritional phenotype of Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Emma V Ridley

Full Text Available Animals are chronically infected by benign and beneficial microorganisms that generally promote animal health through their effects on the nutrition, immune function and other physiological systems of the host. Insight into the host-microbial interactions can be obtained by comparing the traits of animals experimentally deprived of their microbiota and untreated animals. Drosophila melanogaster is an experimentally tractable system to study host-microbial interactions.The nutritional significance of the microbiota was investigated in D. melanogaster bearing unmanipulated microbiota, demonstrated by 454 sequencing of 16S rRNA amplicons to be dominated by the α-proteobacterium Acetobacter, and experimentally deprived of the microbiota by egg dechorionation (conventional and axenic flies, respectively. In axenic flies, larval development rate was depressed with no effect on adult size relative to conventional flies, indicating that the microbiota promotes larval growth rates. Female fecundity did not differ significantly between conventional and axenic flies, but axenic flies had significantly reduced metabolic rate and altered carbohydrate allocation, including elevated glucose levels.We have shown that elimination of the resident microbiota extends larval development and perturbs energy homeostasis and carbohydrate allocation patterns of of D. melanogaster. Our results indicate that the resident microbiota promotes host nutrition and interacts with the regulation of host metabolism.

RNA editing differently affects protein-coding genes in D. melanogaster and H. sapiens.

Science.gov (United States)

Grassi, Luigi; Leoni, Guido; Tramontano, Anna

2015-07-14

When an RNA editing event occurs within a coding sequence it can lead to a different encoded amino acid. The biological significance of these events remains an open question: they can modulate protein functionality, increase the complexity of transcriptomes or arise from a loose specificity of the involved enzymes. We analysed the editing events in coding regions that produce or not a change in the encoded amino acid (nonsynonymous and synonymous events, respectively) in D. melanogaster and in H. sapiens and compared them with the appropriate random models. Interestingly, our results show that the phenomenon has rather different characteristics in the two organisms. For example, we confirm the observation that editing events occur more frequently in non-coding than in coding regions, and report that this effect is much more evident in H. sapiens. Additionally, in this latter organism, editing events tend to affect less conserved residues. The less frequently occurring editing events in Drosophila tend to avoid drastic amino acid changes. Interestingly, we find that, in Drosophila, changes from less frequently used codons to more frequently used ones are favoured, while this is not the case in H. sapiens.

Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

Science.gov (United States)

Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

2018-01-01

Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

Science.gov (United States)

Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

2014-04-01

Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

Duplication of Drosophila melanogaster mitochondrial EF-Tu: pre-adaptation to T-arm truncation and exclusion of bulky aminoacyl residues.

Science.gov (United States)

Sato, Aya; Suematsu, Takuma; Aihara, Koh-Ki; Kita, Kiyoshi; Suzuki, Tsutomu; Watanabe, Kimitsuna; Ohtsuki, Takashi; Watanabe, Yoh-Ichi

2017-03-07

Translation elongation factor Tu (EF-Tu) delivers aminoacyl-tRNA (aa-tRNA) to ribosomes in protein synthesis. EF-Tu generally recognizes aminoacyl moieties and acceptor- and T-stems of aa-tRNAs. However, nematode mitochondrial (mt) tRNAs frequently lack all or part of the T-arm that is recognized by canonical EF-Tu. We previously reported that two distinct EF-Tu species, EF-Tu1 and EF-Tu2, respectively, recognize mt tRNAs lacking T-arms and D-arms in the mitochondria of the chromadorean nematode Caenorhabditis elegans C. elegans EF-Tu2 specifically recognizes the seryl moiety of serylated D-armless tRNAs. Mitochondria of the enoplean nematode Trichinella possess three structural types of tRNAs: T-armless tRNAs, D-armless tRNAs, and cloverleaf tRNAs with a short T-arm. Trichinella mt EF-Tu1 binds to all three types and EF-Tu2 binds only to D-armless Ser-tRNAs, showing an evolutionary intermediate state from canonical EF-Tu to chromadorean nematode (e.g. C. elegans ) EF-Tu species. We report here that two EF-Tu species also participate in Drosophila melanogaster mitochondria. Both D. melanogaster EF-Tu1 and EF-Tu2 bound to cloverleaf and D-armless tRNAs. D. melanogaster EF-Tu1 has the ability to recognize T-armless tRNAs that do not evidently exist in D. melanogaster mitochondria, but do exist in related arthropod species. In addition, D. melanogaster EF-Tu2 preferentially bound to aa-tRNAs carrying small amino acids, but not to aa-tRNAs carrying bulky amino acids. These results suggest that the Drosophila mt translation system could be another intermediate state between the canonical and nematode mitochondria-type translation systems. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

Science.gov (United States)

Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

2012-01-01

5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

International Nuclear Information System (INIS)

Timmins, P.A.; Langowski, J.; Brown, R.S.

1988-01-01

The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA

The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

Science.gov (United States)

Branciamore, Sergio; Di Giulio, Massimo

2012-04-01

The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

Analysis of RNA binding by the dengue virus NS5 RNA capping enzyme.

Directory of Open Access Journals (Sweden)

Brittney R Henderson

Full Text Available Flaviviruses are small, capped positive sense RNA viruses that replicate in the cytoplasm of infected cells. Dengue virus and other related flaviviruses have evolved RNA capping enzymes to form the viral RNA cap structure that protects the viral genome and directs efficient viral polyprotein translation. The N-terminal domain of NS5 possesses the methyltransferase and guanylyltransferase activities necessary for forming mature RNA cap structures. The mechanism for flavivirus guanylyltransferase activity is currently unknown, and how the capping enzyme binds its diphosphorylated RNA substrate is important for deciphering how the flavivirus guanylyltransferase functions. In this report we examine how flavivirus NS5 N-terminal capping enzymes bind to the 5' end of the viral RNA using a fluorescence polarization-based RNA binding assay. We observed that the K(D for RNA binding is approximately 200 nM Dengue, Yellow Fever, and West Nile virus capping enzymes. Removal of one or both of the 5' phosphates reduces binding affinity, indicating that the terminal phosphates contribute significantly to binding. RNA binding affinity is negatively affected by the presence of GTP or ATP and positively affected by S-adensyl methoninine (SAM. Structural superpositioning of the dengue virus capping enzyme with the Vaccinia virus VP39 protein bound to RNA suggests how the flavivirus capping enzyme may bind RNA, and mutagenesis analysis of residues in the putative RNA binding site demonstrate that several basic residues are critical for RNA binding. Several mutants show differential binding to 5' di-, mono-, and un-phosphorylated RNAs. The mode of RNA binding appears similar to that found with other methyltransferase enzymes, and a discussion of diphosphorylated RNA binding is presented.

Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

Science.gov (United States)

Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

2010-08-16

In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

Science.gov (United States)

Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

2014-08-01

5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

Studies on a photoreactivating enzyme from Drosophila melanogaster cultured cells

International Nuclear Information System (INIS)

Beck, L.A.

1982-01-01

A photoreactivating enzyme was purified from Schneider's Line No. 2 Drosophila melanogaster cultured cells. DEAE cellulose chromatography with high potassium phosphate buffer conditions was used to separate nucleic acids from the protein component of the crude cell extract. The protein pass-through fraction from DEAE cellulose was chromatographed on phosphocellulose followed by hydroxylapatite, using linear potassium phosphate gradients to elute the enzyme. Gel filtration chromatography on Sephacryl S-200 resulted in a 4500-fold purification of the enzyme with a final recovery of 4%. The enzyme has an apparent gel filtration molecular weight of 32,900 (+/- 1350 daltons) and an isoelectric pH of 4.9. Optimum ionic strength for activity is 0.17 at pH 6.5 in potassium phosphate buffer. The action spectrum for photoreactivation in Drosophila has an optimum at 365 nm with a response to wavelengths in the range of 313 to 465 nm. Drosophila photoreactivating enzyme contains an essential RNA that is necessary for activity in vitro. The ability of the enzyme to photoreactivate dimers in vitro is abolished by treatment of the enzyme with ribonucleases, or by disruption of the enzyme-RNA complex by electrophoresis or adsorption to DEAE cellulose. The essential RNA is heterogeneous in size but contains a 10-12 base region that may interact with the active site of the enzyme, and thus is protected from degradation by contaminating RNase activities during purification. The RNA is thought to stabilize the photoreactivating enzyme by maintaining the enzyme in the proper configuration for binding to dimer-containing DNA. It is not known whether this RNA is essential for in vivo photoreactivation

Highly tissue specific expression of Sphinx supports its male courtship related role in Drosophila melanogaster.

Science.gov (United States)

Chen, Ying; Dai, Hongzheng; Chen, Sidi; Zhang, Luoying; Long, Manyuan

2011-04-26

Sphinx is a lineage-specific non-coding RNA gene involved in regulating courtship behavior in Drosophila melanogaster. The 5' flanking region of the gene is conserved across Drosophila species, with the proximal 300 bp being conserved out to D. virilis and a further 600 bp region being conserved amongst the melanogaster subgroup (D. melanogaster, D. simulans, D. sechellia, D. yakuba, and D. erecta). Using a green fluorescence protein transformation system, we demonstrated that a 253 bp region of the highly conserved segment was sufficient to drive sphinx expression in male accessory gland. GFP signals were also observed in brain, wing hairs and leg bristles. An additional ∼800 bp upstream region was able to enhance expression specifically in proboscis, suggesting the existence of enhancer elements. Using anti-GFP staining, we identified putative sphinx expression signal in the brain antennal lobe and inner antennocerebral tract, suggesting that sphinx might be involved in olfactory neuron mediated regulation of male courtship behavior. Whole genome expression profiling of the sphinx knockout mutation identified significant up-regulated gene categories related to accessory gland protein function and odor perception, suggesting sphinx might be a negative regulator of its target genes.

Highly tissue specific expression of Sphinx supports its male courtship related role in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Ying Chen

2011-04-01

Full Text Available Sphinx is a lineage-specific non-coding RNA gene involved in regulating courtship behavior in Drosophila melanogaster. The 5' flanking region of the gene is conserved across Drosophila species, with the proximal 300 bp being conserved out to D. virilis and a further 600 bp region being conserved amongst the melanogaster subgroup (D. melanogaster, D. simulans, D. sechellia, D. yakuba, and D. erecta. Using a green fluorescence protein transformation system, we demonstrated that a 253 bp region of the highly conserved segment was sufficient to drive sphinx expression in male accessory gland. GFP signals were also observed in brain, wing hairs and leg bristles. An additional ∼800 bp upstream region was able to enhance expression specifically in proboscis, suggesting the existence of enhancer elements. Using anti-GFP staining, we identified putative sphinx expression signal in the brain antennal lobe and inner antennocerebral tract, suggesting that sphinx might be involved in olfactory neuron mediated regulation of male courtship behavior. Whole genome expression profiling of the sphinx knockout mutation identified significant up-regulated gene categories related to accessory gland protein function and odor perception, suggesting sphinx might be a negative regulator of its target genes.

A Simple Method to Decode the Complete 18-5.8-28S rRNA Repeated Units of Green Algae by Genome Skimming.

Science.gov (United States)

Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der

2017-11-06

Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.

Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle

Energy Technology Data Exchange (ETDEWEB)

Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)

1976-01-01

An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.

Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

Science.gov (United States)

Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

2018-06-08

Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

Science.gov (United States)

Leontis, N B; Westhof, E

1998-09-01

A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

Science.gov (United States)

Burlibașa, Liliana; Suciu, Ilinca

2015-12-01

Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

A single methyltransferase YefA (RlmCD) catalyses both m5U747 and m5U1939 modifications in Bacillus subtilis 23S rRNA

DEFF Research Database (Denmark)

Desmolaize, Benoit; Fabret, Céline; Brégeon, Damien

2011-01-01

Escherichia coli possesses three paralogues. These comprise the methyltransferases TrmA that targets U54 in tRNAs, RlmC that modifies U747 in 23S rRNA and RlmD that is specific for U1939 in 23S rRNA. The tRNAs and rRNAs of the Gram-positive bacterium Bacillus subtilis have the same three m(5)U modifications....... However, as previously shown, the m(5)U54 modification in B. subtilis tRNAs is catalysed in a fundamentally different manner by the folate-dependent enzyme TrmFO, which is unrelated to the E. coli TrmA. Here, we show that methylation of U747 and U1939 in B. subtilis rRNA is catalysed by a single enzyme...

FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

Science.gov (United States)

Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

2016-02-01

Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

The RNA-binding proteins FMR1, rasputin and caprin act together with the UBA protein lingerer to restrict tissue growth in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Roland Baumgartner

Full Text Available Appropriate expression of growth-regulatory genes is essential to ensure normal animal development and to prevent diseases like cancer. Gene regulation at the levels of transcription and translational initiation mediated by the Hippo and Insulin signaling pathways and by the TORC1 complex, respectively, has been well documented. Whether translational control mediated by RNA-binding proteins contributes to the regulation of cellular growth is less clear. Here, we identify Lingerer (Lig, an UBA domain-containing protein, as growth suppressor that associates with the RNA-binding proteins Fragile X mental retardation protein 1 (FMR1 and Caprin (Capr and directly interacts with and regulates the RNA-binding protein Rasputin (Rin in Drosophila melanogaster. lig mutant organs overgrow due to increased proliferation, and a reporter for the JAK/STAT signaling pathway is upregulated in a lig mutant situation. rin, Capr or FMR1 in combination as double mutants, but not the respective single mutants, display lig like phenotypes, implicating a redundant function of Rin, Capr and FMR1 in growth control in epithelial tissues. Thus, Lig regulates cell proliferation during development in concert with Rin, Capr and FMR1.

The RNA-binding proteins FMR1, rasputin and caprin act together with the UBA protein lingerer to restrict tissue growth in Drosophila melanogaster.

Science.gov (United States)

Baumgartner, Roland; Stocker, Hugo; Hafen, Ernst

2013-01-01

Appropriate expression of growth-regulatory genes is essential to ensure normal animal development and to prevent diseases like cancer. Gene regulation at the levels of transcription and translational initiation mediated by the Hippo and Insulin signaling pathways and by the TORC1 complex, respectively, has been well documented. Whether translational control mediated by RNA-binding proteins contributes to the regulation of cellular growth is less clear. Here, we identify Lingerer (Lig), an UBA domain-containing protein, as growth suppressor that associates with the RNA-binding proteins Fragile X mental retardation protein 1 (FMR1) and Caprin (Capr) and directly interacts with and regulates the RNA-binding protein Rasputin (Rin) in Drosophila melanogaster. lig mutant organs overgrow due to increased proliferation, and a reporter for the JAK/STAT signaling pathway is upregulated in a lig mutant situation. rin, Capr or FMR1 in combination as double mutants, but not the respective single mutants, display lig like phenotypes, implicating a redundant function of Rin, Capr and FMR1 in growth control in epithelial tissues. Thus, Lig regulates cell proliferation during development in concert with Rin, Capr and FMR1.

The Role of piRNA-Mediated Epigenetic Silencing in the Population Dynamics of Transposable Elements in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Yuh Chwen G Lee

2015-06-01

Full Text Available The piwi-interacting RNAs (piRNA are small RNAs that target selfish transposable elements (TEs in many animal genomes. Until now, piRNAs' role in TE population dynamics has only been discussed in the context of their suppression of TE transposition, which alone is not sufficient to account for the skewed frequency spectrum and stable containment of TEs. On the other hand, euchromatic TEs can be epigenetically silenced via piRNA-dependent heterochromatin formation and, similar to the widely known "Position-effect variegation", heterochromatin induced by TEs can "spread" into nearby genes. We hypothesized that the piRNA-mediated spread of heterochromatin from TEs into adjacent genes has deleterious functional effects and leads to selection against individual TEs. Unlike previously identified deleterious effects of TEs due to the physical disruption of DNA, the functional effect we investigated here is mediated through the epigenetic influences of TEs. We found that the repressive chromatin mark, H3K9me, is elevated in sequences adjacent to euchromatic TEs at multiple developmental stages in Drosophila melanogaster. Furthermore, the heterochromatic states of genes depend not only on the number of and distance from adjacent TEs, but also on the likelihood that their nearest TEs are targeted by piRNAs. These variations in chromatin status probably have functional consequences, causing genes near TEs to have lower expression. Importantly, we found stronger selection against TEs that lead to higher H3K9me enrichment of adjacent genes, demonstrating the pervasive evolutionary consequences of TE-induced epigenetic silencing. Because of the intrinsic biological mechanism of piRNA amplification, spread of TE heterochromatin could result in the theoretically required synergistic deleterious effects of TE insertions for stable containment of TE copy number. The indirect deleterious impact of piRNA-mediated epigenetic silencing of TEs is a previously

Isolation of oogenesis-specific genes transcribed in the germ-line of Calliphora erythrocephala and Drosophila melanogaster

International Nuclear Information System (INIS)

Tucker, M.A.

1988-01-01

Poly(A) + RNA from early or mid-stage ovarian follicles of C. erythrocephala was used to generate radiolabelled oogenesis-specific cDNA probes for screening the phage libraries. A cDNA probe made from mid-stage embryo poly(A) + RNA was used as the differential screening probe. Thus plaques hybridizing to the two oogenesis-specific probes but not the mid-stage embryo probe were selected as potentially containing oogenesis-specific genes. Two further rounds of screening were used to eliminate false positives and, after plaque purification, restriction digests of the remaining clones were screened by Southern blot hybridization to identify DNA fragments transcribed in an oogenesis-specific manner. In situ hybridization to sections of ovarian follicles has been used to determine the cell types within the follicles in which the various genes are expressed. Radiolabelled RNA probes for four of the C. erythrocephala oogenesis-specific clones and the two D. melanogaster clones have been hybridized to ovarian follicles. Further studies have been concentrated on the two germ-line transcribed, oogenesis-specific clones isolated from the D. melanogaster clone library. Detailed genetic mapping of the DA clone and of these mutations was performed to determine which mutations might represent the DA gene. cDNA clones have been isolated for the transcribed region of clone DA and have been used to further define the transcription unit from this region of the D. melanogaster genome

Differential transcription of cytochrome P450s and glutathione S transferases in DDT-susceptible and resistant Drosophila melanogaster strains in response to DDT and oxidative stress

Science.gov (United States)

Metabolic DDT resistance in Drosophila melanogaster has previously been associated with constitutive over-transcription of cytochrome P450s. Increased P450 activity has also been associated with increased oxidative stress. In contrast, over-transcription of glutathione S transferases (GSTs) has been...

Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

International Nuclear Information System (INIS)

Oesterberg, R.; Garrett, A.

1977-01-01

The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

Dietary Resveratrol Does Not Affect Life Span, Body Composition, Stress Response, and Longevity-Related Gene Expression in Drosophila melanogaster.

Science.gov (United States)

Staats, Stefanie; Wagner, Anika E; Kowalewski, Bianca; Rieck, Florian T; Soukup, Sebastian T; Kulling, Sabine E; Rimbach, Gerald

2018-01-11

In this study, we tested the effect of the stilbene resveratrol on life span, body composition, locomotor activity, stress response, and the expression of genes encoding proteins centrally involved in ageing pathways in the model organism Drosophila melanogaster . Male and female w 1118 D. melanogaster were fed diets based on sucrose, corn meal, and yeast. Flies either received a control diet or a diet supplemented with 500 µmol/L resveratrol. Dietary resveratrol did not affect mean, median, and maximal life span of male and female flies. Furthermore, body composition remained largely unchanged following the resveratrol supplementation. Locomotor activity, as determined by the climbing index, was not significantly different between control and resveratrol-supplemented flies. Resveratrol-fed flies did not exhibit an improved stress response towards hydrogen peroxide as compared to controls. Resveratrol did not change mRNA steady levels of antioxidant ( catalase , glutathione-S-transferase , NADH dehydrogenase , glutathione peroxidase , superoxide dismutase 2 ) and longevity-related genes, including sirtuin 2 , spargel , and I'm Not Dead Yet . Collectively, present data suggest that resveratrol does not affect life span, body composition, locomotor activity, stress response, and longevity-associated gene expression in w 1118 D. melanogaster .

Dietary Resveratrol Does Not Affect Life Span, Body Composition, Stress Response, and Longevity-Related Gene Expression in Drosophila melanogaster

Directory of Open Access Journals (Sweden)

Stefanie Staats

2018-01-01

Full Text Available In this study, we tested the effect of the stilbene resveratrol on life span, body composition, locomotor activity, stress response, and the expression of genes encoding proteins centrally involved in ageing pathways in the model organism Drosophila melanogaster. Male and female w1118 D. melanogaster were fed diets based on sucrose, corn meal, and yeast. Flies either received a control diet or a diet supplemented with 500 µmol/L resveratrol. Dietary resveratrol did not affect mean, median, and maximal life span of male and female flies. Furthermore, body composition remained largely unchanged following the resveratrol supplementation. Locomotor activity, as determined by the climbing index, was not significantly different between control and resveratrol-supplemented flies. Resveratrol-fed flies did not exhibit an improved stress response towards hydrogen peroxide as compared to controls. Resveratrol did not change mRNA steady levels of antioxidant (catalase, glutathione-S-transferase, NADH dehydrogenase, glutathione peroxidase, superoxide dismutase 2 and longevity-related genes, including sirtuin 2, spargel, and I’m Not Dead Yet. Collectively, present data suggest that resveratrol does not affect life span, body composition, locomotor activity, stress response, and longevity-associated gene expression in w1118 D. melanogaster.

Relationship between organization and function of ribosomal genes in Drosophila melanogaster

International Nuclear Information System (INIS)

Karpen, G.H.

1987-01-01

In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional

Differential sexual survival of Drosophila melanogaster on copper sulfate.

Science.gov (United States)

Balinski, Michael A; Woodruff, Ronny C

2017-04-01

Based on studies of the influence of X-chromosomes on the viability of Drosophila melanogaster exposed to cadmium, and on the role of X-linked genes on copper homeostasis, we examined the effect of copper sulfate (CuSO 4 ) on offspring viability using three independent, inbred D. melanogaster crosses (ensuring identical autosomes for males and females within each cross). Each cross was performed with attached X-chromosome females and males with a single X-chromosome. As female D. melanogaster have less metallothionein RNA expression than males, we predicted fewer female offspring than male offspring in crosses exposed to CuSO 4 , even though females have two copies of X-chromosome genes, possibly resulting in overdominant heterozygosity. In two of three crosses, CuSO 4 caused significantly higher numbers of male offspring compared to female offspring. We hypothesized that these gender-based viability differences to copper exposure are caused by X-chromosome ploidy and X-linked genetic variation affecting metallothionein expression. Observed differential offspring viability responses among crosses to copper exposure also showed that different genetic backgrounds (autosomal and/or X-chromosome) can result in significant differences in heavy metal and metallothionein regulation. These results suggest that the effect of copper on offspring viability depends on both genetic background and gender, as both factors can affect the regulation of metallothionein proteins as well as homeostasis of biologically necessary heavy metals.

The ADAR RNA editing enzyme controls neuronal excitability in Drosophila melanogaster

Science.gov (United States)

Li, Xianghua; Overton, Ian M.; Baines, Richard A.; Keegan, Liam P.; O’Connell, Mary A.

2014-01-01

RNA editing by deamination of specific adenosine bases to inosines during pre-mRNA processing generates edited isoforms of proteins. Recoding RNA editing is more widespread in Drosophila than in vertebrates. Editing levels rise strongly at metamorphosis, and Adar5G1 null mutant flies lack editing events in hundreds of CNS transcripts; mutant flies have reduced viability, severely defective locomotion and age-dependent neurodegeneration. On the other hand, overexpressing an adult dADAR isoform with high enzymatic activity ubiquitously during larval and pupal stages is lethal. Advantage was taken of this to screen for genetic modifiers; Adar overexpression lethality is rescued by reduced dosage of the Rdl (Resistant to dieldrin), gene encoding a subunit of inhibitory GABA receptors. Reduced dosage of the Gad1 gene encoding the GABA synthetase also rescues Adar overexpression lethality. Drosophila Adar5G1 mutant phenotypes are ameliorated by feeding GABA modulators. We demonstrate that neuronal excitability is linked to dADAR expression levels in individual neurons; Adar-overexpressing larval motor neurons show reduced excitability whereas Adar5G1 null mutant or targeted Adar knockdown motor neurons exhibit increased excitability. GABA inhibitory signalling is impaired in human epileptic and autistic conditions, and vertebrate ADARs may have a relevant evolutionarily conserved control over neuronal excitability. PMID:24137011

Transcription elongation rate has a tissue-specific impact on alternative cleavage and polyadenylation in Drosophila melanogaster.

Science.gov (United States)

Liu, Xiaochuan; Freitas, Jaime; Zheng, Dinghai; Oliveira, Marta S; Hoque, Mainul; Martins, Torcato; Henriques, Telmo; Tian, Bin; Moreira, Alexandra

2017-12-01

Alternative polyadenylation (APA) is a mechanism that generates multiple mRNA isoforms with different 3'UTRs and/or coding sequences from a single gene. Here, using 3' region extraction and deep sequencing (3'READS), we have systematically mapped cleavage and polyadenylation sites (PASs) in Drosophila melanogaster , expanding the total repertoire of PASs previously identified for the species, especially those located in A-rich genomic sequences. Cis -element analysis revealed distinct sequence motifs around fly PASs when compared to mammalian ones, including the greater enrichment of upstream UAUA elements and the less prominent presence of downstream UGUG elements. We found that over 75% of mRNA genes in Drosophila melanogaster undergo APA. The head tissue tends to use distal PASs when compared to the body, leading to preferential expression of APA isoforms with long 3'UTRs as well as with distal terminal exons. The distance between the APA sites and intron location of PAS are important parameters for APA difference between body and head, suggesting distinct PAS selection contexts. APA analysis of the RpII215 C4 mutant strain, which harbors a mutant RNA polymerase II (RNAPII) with a slower elongation rate, revealed that a 50% decrease in transcriptional elongation rate leads to a mild trend of more usage of proximal, weaker PASs, both in 3'UTRs and in introns, consistent with the "first come, first served" model of APA regulation. However, this trend was not observed in the head, suggesting a different regulatory context in neuronal cells. Together, our data expand the PAS collection for Drosophila melanogaster and reveal a tissue-specific effect of APA regulation by RNAPII elongation rate. © 2017 Liu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Karyotype characterization of Crotalaria juncea (L. by chromosome banding and physical mapping of 18S-5.8S-26S and 5S rRNA gene sites

Directory of Open Access Journals (Sweden)

Mateus Mondin

2007-01-01

Full Text Available The chromosomes of Crotalaria juncea, a legume of agronomic interest with a 2n = 16 karyotype composed of metacentric chromosomes, were analyzed using several cytogenetic techniques. C-banding revealed heterochromatic regions around the centromeres in all chromosomes and adjacent to the secondary constriction on the chromosome 1 short arm. Fluorescent staining with the GC-specific chromomycin A3 (CMA highlighted these heterochromatic regions and a tiny site on the chromosome 1 long arm while the AT-specific stain 4'-6-diamidino-2-phenylindole (DAPI induced a reversed pattern. Staining with CMA combined with AT-specific distamycin A (DA counterstaining quenched the pericentromeric regions of all chromosomes, but enhanced fluorescence was observed at the heterochromatic regions around the secondary constriction and on the long arms of chromosomes 1 and 4. Fluorescence in situ hybridization (FISH revealed 18S-5.8S-26S rRNA gene sites (45S rDNA on chromosomes 1 and 4, and one 5S rDNA locus on chromosome 1. All the rDNA sites were co-located with the positive-CMA/DA bands, suggesting they were very rich in GC. Silver staining revealed signals at the main 45S rDNA locus on chromosome 1 and, in some cells, chromosome 4 was labeled. Two small nucleoli were detected in a few interphase cells, suggesting that the minor site on chromosome 4 could be active at some stages of the cell cycle.

Ultraviolet light-induced crosslinking reveals a unique region of local tertiary structure in potato spindle tuber viroid and HeLa 5S RNA

International Nuclear Information System (INIS)

Branch, A.D.; Benenfeld, B.J.; Robertson, H.D.

1985-01-01

The positions of intramolecular crosslinks induced by irradiation with ultraviolet light were mapped into potato spindle tuber viroid RNA and HeLa 5S rRNA. Crosslinking in each of these molecules occurred at a single major site, which was located by RNA fingerprinting and secondary analysis. Various lines of evidence suggest that these crosslinks identify a previously undescribed element of local tertiary structure common to these two widely divergent RNA molecules: (i) both crosslinks occur in an identical eight-base context, with the sequence 5 GGGAA 3 on one side and the sequence 5 UAC 3 on the other; (ii) both crosslinks connect bases that are not thought to be involved in conventional hydrogen bonding, within regions usually depicted as single-stranded loops flanked by short helical segments; and (iii) both crosslinks connect a purine and a pyrimidine residue, and both may generate the same G-U dimer. Furthermore, it is likely that the crosslinking site is of functional significance because it is located within the most highly conserved region of the viroid sequence and involves bases that are essentially invariant among eukaryotic 5S rRNA molecules

Mutagenic effects of irradiated glucose in Drosophila melanogaster

International Nuclear Information System (INIS)

Varma, M.B.; Rao, K.P.; Nandan, S.D.; Rao, M.S.

1982-01-01

The mutagenic effects of irradiated glucose were studied using the sex-linked recessive lethal test in Drosophila melanogaster. Oregon K males of D. melanogaster reared on a medium containing 20 or 40% glucose irradiated with a dose of 0.02, 0.10, 0.20, 2 or 5 Mrad #betta#-rays were scored for the induction of sex-linked recessive lethals. The results showed no significant increase in the frequency of X-lethals in Drosophila at any of the dose levels. (author)

Structures of a putative RNA 5-methyluridine methyltransferase, Thermus thermophilus TTHA1280, and its complex with S-adenosyl-l-homocysteine

International Nuclear Information System (INIS)

Pioszak, Augen A.; Murayama, Kazutaka; Nakagawa, Noriko; Ebihara, Akio; Kuramitsu, Seiki; Shirouzu, Mikako; Yokoyama, Shigeyuki

2005-01-01

Three structures of a putative RNA 5-methyluridine methyltransferase from T. thermophilus, including its complex with S-adenosyl-l-homocysteine, are presented. The structures reveal the mode of cofactor binding, architecture of the putative active site, and the presence of a deep cleft adjacent to the active site that may bind RNA. The Thermus thermophilus hypothetical protein TTHA1280 belongs to a family of predicted S-adenosyl-l-methionine (AdoMet) dependent RNA methyltransferases (MTases) present in many bacterial and archaeal species. Inspection of amino-acid sequence motifs common to class I Rossmann-fold-like MTases suggested a specific role as an RNA 5-methyluridine MTase. Selenomethionine (SeMet) labelled and native versions of the protein were expressed, purified and crystallized. Two crystal forms of the SeMet-labelled apoprotein were obtained: SeMet-ApoI and SeMet-ApoII. Cocrystallization of the native protein with S-adenosyl-l-homocysteine (AdoHcy) yielded a third crystal form, Native-AdoHcy. The SeMet-ApoI structure was solved by the multiple anomalous dispersion method and refined at 2.55 Å resolution. The SeMet-ApoII and Native-AdoHcy structures were solved by molecular replacement and refined at 1.80 and 2.60 Å, respectively. TTHA1280 formed a homodimer in the crystals and in solution. Each subunit folds into a three-domain structure composed of a small N-terminal PUA domain, a central α/β-domain and a C-terminal Rossmann-fold-like MTase domain. The three domains form an overall clamp-like shape, with the putative active site facing a deep cleft. The architecture of the active site is consistent with specific recognition of uridine and catalysis of methyl transfer to the 5-carbon position. The cleft is suitable in size and charge distribution for binding single-stranded RNA.

Apoptotic activity and gene responses in Drosophila melanogaster S2 cells, induced by azadirachtin A.

Science.gov (United States)

Xu, Lin; Li, Sheng; Ran, Xueqin; Liu, Chang; Lin, Rutao; Wang, Jiafu

2016-09-01

Azadirachtin has been used as an antifeedant and growth disruption agent for many insect species. Previous investigations have reported the apoptotic effects of azadirachtin on some insect cells, but the molecular mechanisms are still not clear. This study investigated the underlying molecular mechanisms for the apoptotic effects induced by azadirachtin on Drosophila melanogaster S2 cells in vitro. The results of the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide assay demonstrated that azadirachtin exhibited significant cytotoxicity to S2 cells in a time- and dose-dependent manner. The changes in cellular morphology and the DNA fragmentation demonstrated that azadirachtin induced remarkable apoptosis of S2 cells. Expression levels of 276 genes were found to be significantly changed in S2 cells after exposure to azadirachtin, as detected by Drosophila genome array. Among these genes, calmodulin (CaM) was the most highly upregulated gene. Azadirachtin was further demonstrated to trigger intracellular Ca(2+) release in S2 cells. The genes related to the apoptosis pathway, determined from chip data, were validated by the real-time quantitative polymerase chain reaction method. The results showed that azadirachtin-mediated intracellular Ca(2+) release was the primary event that triggered apoptosis in Drosophila S2 cells through both pathways of the Ca(2+) -CaM and EcR/Usp signalling cascade. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Studies on the role of NonA in mRNA biogenesis

International Nuclear Information System (INIS)

Kozlova, Natalia; Braga, Jose; Lundgren, Josefin; Rino, Jose; Young, Patrick; Carmo-Fonseca, Maria; Visa, Neus

2006-01-01

The NonA protein of Drosophila melanogaster is an abundant nuclear protein that belongs to the DBHS (Drosophila behavior, human splicing) protein family. The DBHS proteins bind both DNA and RNA in vitro and have been involved in different aspects of gene expression, including pre-mRNA splicing, transcription regulation and nuclear retention of mRNA. We have used double-stranded RNA interference in Drosophila S2 cells to silence the expression of NonA and to investigate its role in mRNA biogenesis. We show that knockdown of NonA does not affect transcription nor splicing. We demonstrate that NonA forms a complex with the essential nuclear export factor NXF1 in an RNA-dependent manner. We have constructed stable S2 cell lines that express full-length and truncated NXF1 fused to GFP in order to perform fluorescence recovery after photobleaching experiments. We show that knockdown of NonA reduces the intranuclear mobility of NXF1-GFP associated with poly(A) + RNA in vivo, while the mobility of the truncated NXF1-GFP that does not bind RNA is not affected. Our data suggest that NonA facilitates the intranuclear mobility of mRNP particles

Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

Science.gov (United States)

Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

2014-10-17

RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. Copyright © 2014 Elsevier B.V. All rights reserved.

RNA Processing Factor 5 is required for efficient 5' cleavage at a processing site conserved in RNAs of three different mitochondrial genes in Arabidopsis thaliana.

Science.gov (United States)

Hauler, Aron; Jonietz, Christian; Stoll, Birgit; Stoll, Katrin; Braun, Hans-Peter; Binder, Stefan

2013-05-01

The 5' ends of many mitochondrial transcripts are generated post-transcriptionally. Recently, we identified three RNA PROCESSING FACTORs required for 5' end maturation of different mitochondrial mRNAs in Arabidopsis thaliana. All of these factors are pentatricopeptide repeat proteins (PPRPs), highly similar to RESTORERs OF FERTILTY (RF), that rescue male fertility in cytoplasmic male-sterile lines from different species. Therefore, we suggested a general role of these RF-like PPRPs in mitochondrial 5' processing. We now identified RNA PROCESSING FACTOR 5, a PPRP not classified as an RF-like protein, required for the efficient 5' maturation of the nad6 and atp9 mRNAs as well as 26S rRNA. The precursor molecules of these RNAs share conserved sequence elements, approximately ranging from positions -50 to +9 relative to mature 5' mRNA termini, suggesting these sequences to be at least part of the cis elements required for processing. The knockout of RPF5 has only a moderate influence on 5' processing of atp9 mRNA, whereas the generation of the mature nad6 mRNA and 26S rRNA is almost completely abolished in the mutant. The latter leads to a 50% decrease of total 26S rRNA species, resulting in an imbalance between the large rRNA and 18S rRNA. Despite these severe changes in RNA levels and in the proportion between the 26S and 18S rRNAs, mitochondrial protein levels appear to be unaltered in the mutant, whereas seed germination capacity is markedly reduced. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Endosymbiont-based immunity in Drosophila melanogaster against parasitic nematode infection.

Science.gov (United States)

Yadav, Shruti; Frazer, Joanna; Banga, Ashima; Pruitt, Katherine; Harsh, Sneh; Jaenike, John; Eleftherianos, Ioannis

2018-01-01

Associations between endosymbiotic bacteria and their hosts represent a complex ecosystem within organisms ranging from humans to protozoa. Drosophila species are known to naturally harbor Wolbachia and Spiroplasma endosymbionts, which play a protective role against certain microbial infections. Here, we investigated whether the presence or absence of endosymbionts affects the immune response of Drosophila melanogaster larvae to infection by Steinernema carpocapsae nematodes carrying or lacking their mutualistic Gram-negative bacteria Xenorhabdus nematophila (symbiotic or axenic nematodes, respectively). We find that the presence of Wolbachia alone or together with Spiroplasma promotes the survival of larvae in response to infection with S. carpocapsae symbiotic nematodes, but not against axenic nematodes. We also find that Wolbachia numbers are reduced in Spiroplasma-free larvae infected with axenic compared to symbiotic nematodes, and they are also reduced in Spiroplasma-containing compared to Spiroplasma-free larvae infected with axenic nematodes. We further show that S. carpocapsae axenic nematode infection induces the Toll pathway in the absence of Wolbachia, and that symbiotic nematode infection leads to increased phenoloxidase activity in D. melanogaster larvae devoid of endosymbionts. Finally, infection with either type of nematode alters the metabolic status and the fat body lipid droplet size in D. melanogaster larvae containing only Wolbachia or both endosymbionts. Our results suggest an interaction between Wolbachia endosymbionts with the immune response of D. melanogaster against infection with the entomopathogenic nematodes S. carpocapsae. Results from this study indicate a complex interplay between insect hosts, endosymbiotic microbes and pathogenic organisms.

Evaluation of radioprotective efficacy of pyrimidine-5-carboxylate derivative on radiation induced oxidative stress using Drosophila melanogaster

International Nuclear Information System (INIS)

Sarojini, B.K.; Mohan, B.J.; Narayana, B.; Sanjeev, Ganesh

2014-01-01

In the present study, radioprotection efficacy of Ethyl 4-(4-fluorophenyl)-6-methyl-2-thioxo-1,2,3,4-tetra hydropyrimidine-5-carboxylate (PYR) was evaluated against the gamma ray induced oxidative stress using drosophila melanogaster (Oregon K). The gamma ray irradiated flies were assayed for oxidative stress markers namely; Thiobarbituric acid reactive substances (TBARS) and enzymatic antioxidant SOD and CAT. The oxidative stress was induced at 6 Gy. (author)

Genome-wide miRNA screening reveals miR-310 family members negatively regulate the immune response in Drosophila melanogaster via co-targeting Drosomycin.

Science.gov (United States)

Li, Yao; Li, Shengjie; Li, Ruimin; Xu, Jiao; Jin, Ping; Chen, Liming; Ma, Fei

2017-03-01

Although innate immunity mediated by Toll signaling has been extensively studied in Drosophila melanogaster, the role of miRNAs in regulating the Toll-mediated immune response remains largely unknown. In this study, following Gram-positive bacterial challenge, we identified 93 differentially expressed miRNAs via genome-wide miRNA screening. These miRNAs were regarded as immune response related (IRR). Eight miRNAs were confirmed to be involved in the Toll-mediated immune response upon Gram-positive bacterial infection through genetic screening of 41 UAS-miRNA lines covering 60 miRNAs of the 93 IRR miRNAs. Interestingly, four out of these eight miRNAs, miR-310, miR-311, miR-312 and miR-313, are clustered miRNAs and belong to the miR-310 family. These miR-310 family members were shown to target and regulate the expression of Drosomycin, an antimicrobial peptide produced by Toll signaling. Taken together, our study implies important regulatory roles of miRNAs in the Toll-mediated innate immune response of Drosophila upon Gram-positive bacterial infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

Transcriptome-wide mapping of 5-methylcytidine RNA modifications in bacteria, archaea, and yeast reveals m5C within archaeal mRNAs.

Directory of Open Access Journals (Sweden)

Sarit Edelheit

2013-06-01

Full Text Available The presence of 5-methylcytidine (m(5C in tRNA and rRNA molecules of a wide variety of organisms was first observed more than 40 years ago. However, detection of this modification was limited to specific, abundant, RNA species, due to the usage of low-throughput methods. To obtain a high resolution, systematic, and comprehensive transcriptome-wide overview of m(5C across the three domains of life, we used bisulfite treatment on total RNA from both gram positive (B. subtilis and gram negative (E. coli bacteria, an archaeon (S. solfataricus and a eukaryote (S. cerevisiae, followed by massively parallel sequencing. We were able to recover most previously documented m(5C sites on rRNA in the four organisms, and identified several novel sites in yeast and archaeal rRNAs. Our analyses also allowed quantification of methylated m(5C positions in 64 tRNAs in yeast and archaea, revealing stoichiometric differences between the methylation patterns of these organisms. Molecules of tRNAs in which m(5C was absent were also discovered. Intriguingly, we detected m(5C sites within archaeal mRNAs, and identified a consensus motif of AUCGANGU that directs methylation in S. solfataricus. Our results, which were validated using m(5C-specific RNA immunoprecipitation, provide the first evidence for mRNA modifications in archaea, suggesting that this mode of post-transcriptional regulation extends beyond the eukaryotic domain.

Rhizoxin analogs, orfamide A and chitinase production contribute to the toxicity of Pseudomonas protegens strain Pf-5 to Drosophila melanogaster

Science.gov (United States)

Pseudomonas protegens strain Pf-5 is a soil bacterium that was first described for its activity in biological control of plant diseases and has since been shown to be lethal to certain insects. Among these is the fruit fly Drosophila melanogaster, a well-established model organism for studies evalu...

Hesperidin, a citrus bioflavonoid, alleviates trichloroethylene-induced oxidative stress in Drosophila melanogaster.

Science.gov (United States)

Abolaji, Amos Olalekan; Babalola, Oluwatoyin Victoria; Adegoke, Abimbola Kehinde; Farombi, Ebenezer Olatunde

2017-10-01

Trichloroethylene (TCE) is a chlorinated organic pollutant of groundwater with diverse toxic effects in animals and humans. Here, we investigated the ameliorative role of hesperidin, a citrus bioflavonoid on TCE-induced toxicity in Drosophila melanogaster. Four groups of D. melanogaster (50 flies/vial, with 5 vials/group) were exposed to ethanol (2.5%, control), HSP (400mg/10g diet), TCE (10μM/10g diet) and TCE (10μM/10g diet)+HSP (400mg/10g diet) respectively in the diet for 5days. Then, selected oxidative stress and antioxidant markers were evaluated. The results showed that TCE significantly increased the level of reactive oxygen species (ROS) and inhibited catalase, glutathione S-transferase and acetylcholinesterase (AChE) activities with concurrent depletion of total thiol level. However, co-administration of TCE and hesperidin mitigated TCE-induced depletion of antioxidants, and restored ROS level and AChE activity in the flies (p<0.05). Overall, hesperidin offered protective potency on TCE-induced oxidative stress in the flies via anti-oxidative mechanism. Copyright © 2017 Elsevier B.V. All rights reserved.

Radioresistance and radiosensitivity in Drosophila melanogaster

International Nuclear Information System (INIS)

Reguly, M.L.

1983-01-01

Studying the mechanisms controlling radioresistant in Drosophila the sensibility of four strains of Drosophila melanogaster to sex-linked recessive lethal mutations induced by 5kR Cobalt-60 gamma radiation and 0,006 M EMS or 0,25% of caffeine was determined. (M.A.C.) [pt

Radioresistance and radiosensitivity in Drosophila melanogaster

International Nuclear Information System (INIS)

Reguly, M.L.; Marques, E.K.

1987-01-01

The mechanisms of radioresistance in Drosophila are studied. The mutagenic effects of 5KR of 60 Cobalt gamma radiation and of 0,006M dose of ethyl methanesulfonate (EMS) on four D. Melanogaster strains (RC 1 , CO 3 , BUE and LEN) are investigated. (M.A.C.) [pt

Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

Science.gov (United States)

Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

2016-12-01

In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

Recognition and Detoxification of the Insecticide DDT by Drosophila melanogaster Glutathione S-Transferase D1

Energy Technology Data Exchange (ETDEWEB)

Low, Wai Yee; Feil, Susanne C.; Ng, Hooi Ling; Gorman, Michael A.; Morton, Craig J.; Pyke, James; McConville, Malcolm J.; Bieri, Michael; Mok, Yee-Foong; Robin, Charles; Gooley, Paul R.; Parker, Michael W.; Batterham, Philip (SVIMR-A); (Melbourne)

2010-06-14

GSTD1 is one of several insect glutathione S-transferases capable of metabolizing the insecticide DDT. Here we use crystallography and NMR to elucidate the binding of DDT and glutathione to GSTD1. The crystal structure of Drosophila melanogaster GSTD1 has been determined to 1.1 {angstrom} resolution, which reveals that the enzyme adopts the canonical GST fold but with a partially occluded active site caused by the packing of a C-terminal helix against one wall of the binding site for substrates. This helix would need to unwind or be displaced to enable catalysis. When the C-terminal helix is removed from the model of the crystal structure, DDT can be computationally docked into the active site in an orientation favoring catalysis. Two-dimensional {sup 1}H,{sup 15}N heteronuclear single-quantum coherence NMR experiments of GSTD1 indicate that conformational changes occur upon glutathione and DDT binding and the residues that broaden upon DDT binding support the predicted binding site. We also show that the ancestral GSTD1 is likely to have possessed DDT dehydrochlorinase activity because both GSTD1 from D. melanogaster and its sibling species, Drosophila simulans, have this activity.

Variability in secondary structure of 18S ribosomal RNA as topological marker for identification of Paramecium species.

Science.gov (United States)

Shakoori, Farah R; Tasneem, Fareeda; Al-Ghanim, K; Mahboob, S; Al-Misned, F; Jahan, Nusrat; Shakoori, Abdul Rauf

2014-12-01

Besides cytological and molecular applications, Paramecium is being used in water quality assessment and for determination of saprobic levels. An unambiguous identification of these unicellular eukaryotes is not only essential, but its ecological diversity must also be explored in the local environment. 18SrRNA genes of all the strains of Paramecium species isolated from waste water were amplified, cloned and sequenced. Phylogenetic comparison of the nucleotide sequences of these strains with 23 closely related Paramecium species from GenBank Database enabled identification of Paramecium multimicronucleatum and Paramecium jenningsi. Some isolates did not show significant close association with other Paramecium species, and because of their unique position in the phylogenetic tree, they were considered new to the field. In the present report, these isolates are being designated as Paramecium caudatum pakistanicus. In this article, secondary structure of 18SrRNA has also been analyzed as an additional and perhaps more reliable topological marker for species discrimination and for determining possible phylogenetic relationship between the ciliate species. On the basis of comparison of secondary structure of 18SrRNA of various isolated Paramacium strains, and among Paramecium caudatum pakistanicus, Tetrahymena thermophila, Drosophila melanogaster, and Homo sapiens, it can be deduced that variable regions are more helpful in differentiating the species at interspecific level rather than at intraspecific level. It was concluded that V3 was the least variable region in all the organisms, V2 and V7 were the longest expansion segments of D. melanogaster and there was continuous mutational bias towards G.C base pairing in H. sapiens. © 2014 Wiley Periodicals, Inc.

Effects of mutation on the downfield proton nuclear magnetic resonance spectrum of the 5S RNA of Escherichia coli

International Nuclear Information System (INIS)

Gewirth, D.T.; Moore, P.B.

1987-01-01

The imino proton spectra of several mutants of the 5S RNA of Escherichia coli are compared with that of the wild type. Three of the variants discussed are point mutations, and the fourth is a deletion mutant lacking bases 11-69 of the parent sequence, all obtained by site-directed mutagenesis techniques. The spectroscopic effects of mutation are limited in all cases, and the differences between normal and mutant spectra can be used to make or confirm the assignments of resonances. Several new assignments in the 5S spectrum are reported. Spectroscopic differences due to sequence differences permit the products of single genes within the 5S gene family to be distinguished and their fates followed by NMR

1.8 Å structure of murine GITR ligand dimer expressed in Drosophila melanogaster S2 cells

International Nuclear Information System (INIS)

Chattopadhyay, Kausik; Ramagopal, Udupi A.; Nathenson, Stanley G.; Almo, Steven C.

2009-01-01

1.8 Å X-ray crystal structure of mouse GITRL expressed in D. melanogaster S2 cells shows an identical ‘strand-exchanged’ dimeric assembly similar to that observed previously for the E. coli-expressed protein. Glucocorticoid-induced TNF receptor ligand (GITRL), a prominent member of the TNF superfamily, activates its receptor on both effector and regulatory T cells to generate critical costimulatory signals that have been implicated in a wide range of T-cell immune functions. The crystal structures of murine and human orthologs of GITRL recombinantly expressed in Escherichia coli have previously been determined. In contrast to all classical TNF structures, including the human GITRL structure, murine GITRL demonstrated a unique ‘strand-exchanged’ dimeric organization. Such a novel assembly behavior indicated a dramatic impact on receptor activation as well as on the signaling mechanism associated with the murine GITRL costimulatory system. In this present work, the 1.8 Å resolution crystal structure of murine GITRL expressed in Drosophila melanogaster S2 cells is reported. The eukaryotic protein-expression system allows transport of the recombinant protein into the extracellular culture medium, thus maximizing the possibility of obtaining correctly folded material devoid of any folding/assembly artifacts that are often suspected with E. coli-expressed proteins. The S2 cell-expressed murine GITRL adopts an identical ‘strand-exchanged’ dimeric structure to that observed for the E. coli-expressed protein, thus conclusively demonstrating the novel quaternary structure assembly behavior of murine GITRL

1.8 Å structure of murine GITR ligand dimer expressed in Drosophila melanogaster S2 cells

Energy Technology Data Exchange (ETDEWEB)

Chattopadhyay, Kausik [Department of Microbiology and Immunology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Ramagopal, Udupi A. [Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Nathenson, Stanley G., E-mail: nathenso@aecom.yu.edu [Department of Microbiology and Immunology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Department of Cell Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Almo, Steven C., E-mail: nathenso@aecom.yu.edu [Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Department of Physiology and Biophysics, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Department of Microbiology and Immunology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States)

2009-05-01

1.8 Å X-ray crystal structure of mouse GITRL expressed in D. melanogaster S2 cells shows an identical ‘strand-exchanged’ dimeric assembly similar to that observed previously for the E. coli-expressed protein. Glucocorticoid-induced TNF receptor ligand (GITRL), a prominent member of the TNF superfamily, activates its receptor on both effector and regulatory T cells to generate critical costimulatory signals that have been implicated in a wide range of T-cell immune functions. The crystal structures of murine and human orthologs of GITRL recombinantly expressed in Escherichia coli have previously been determined. In contrast to all classical TNF structures, including the human GITRL structure, murine GITRL demonstrated a unique ‘strand-exchanged’ dimeric organization. Such a novel assembly behavior indicated a dramatic impact on receptor activation as well as on the signaling mechanism associated with the murine GITRL costimulatory system. In this present work, the 1.8 Å resolution crystal structure of murine GITRL expressed in Drosophila melanogaster S2 cells is reported. The eukaryotic protein-expression system allows transport of the recombinant protein into the extracellular culture medium, thus maximizing the possibility of obtaining correctly folded material devoid of any folding/assembly artifacts that are often suspected with E. coli-expressed proteins. The S2 cell-expressed murine GITRL adopts an identical ‘strand-exchanged’ dimeric structure to that observed for the E. coli-expressed protein, thus conclusively demonstrating the novel quaternary structure assembly behavior of murine GITRL.

A screen for F1 hybrid male rescue reveals no major-effect hybrid lethality loci in the Drosophila melanogaster autosomal genome.

Science.gov (United States)

Cuykendall, Tawny N; Satyaki, P; Ji, Shuqing; Clay, Derek M; Edelman, Nathaniel B; Kimchy, Alexandra; Li, Ling-Hei; Nuzzo, Erin A; Parekh, Neil; Park, Suna; Barbash, Daniel A

2014-10-27

Hybrid sons between Drosophila melanogaster females and D. simulans males die as 3rd instar larvae. Two genes, D. melanogaster Hybrid male rescue (Hmr) on the X chromosome, and D. simulans Lethal hybrid rescue (Lhr) on chromosome II, interact to cause this lethality. Loss-of-function mutations in either gene suppress lethality, but several pieces of evidence suggest that additional factors are required for hybrid lethality. Here we screen the D. melanogaster autosomal genome by using the Bloomington Stock Center Deficiency kit to search for additional regions that can rescue hybrid male lethality. Our screen is designed to identify putative hybrid incompatibility (HI) genes similar to Hmr and Lhr which, when removed, are dominant suppressors of lethality. After screening 89% of the autosomal genome, we found no regions that rescue males to the adult stage. We did, however, identify several regions that rescue up to 13% of males to the pharate adult stage. This weak rescue suggests the presence of multiple minor-effect HI loci, but we were unable to map these loci to high resolution, presumably because weak rescue can be masked by genetic background effects. We attempted to test one candidate, the dosage compensation gene male specific lethal-3 (msl-3), by using RNA interference with short hairpin microRNA constructs targeted specifically against D. simulans msl-3 but failed to achieve knockdown, in part due to off-target effects. We conclude that the D. melanogaster autosomal genome likely does not contain additional major-effect HI loci. We also show that Hmr is insufficient to fully account for the lethality associated with the D. melanogaster X chromosome, suggesting that additional X-linked genes contribute to hybrid lethality. Copyright © 2014 Cuykendall et al.

The Structure of the RNA m5C Methyltransferase YebU from Escherichia coli Reveals a C-terminal RNA-recruiting PUA Domain

DEFF Research Database (Denmark)

Hallberg, B. Martin; Ericsson, Ulrika B.; Johnson, Kenneth A

2006-01-01

potential that differ from other RNA-MTase structures, suggesting that YebU interacts with its RNA target in a different manner. Docking of YebU onto the 30 S subunit indicates that the PUA and MTase domains make several contacts with 16 S rRNA as well as with the ribosomal protein S12. The ribosomal...... protein interactions would explain why the assembled 30 S subunit, and not naked 16 S rRNA, is the preferred substrate for YebU....... by X-ray crystallography, and we present a molecular model for how YebU specifically recognizes, binds and methylates its ribosomal substrate. The YebU protein has an N-terminal SAM-binding catalytic domain with structural similarity to the equivalent domains in several other m(5)C RNA MTases including...

I prokaryota si chrání svoji RNA – nové typy 5'-RNA čepiček

Czech Academy of Sciences Publication Activity Database

Cahová, Hana

2017-01-01

Roč. 111, č. 7 (2017), s. 414-423 ISSN 0009-2770 R&D Projects: GA ČR(CZ) GJ16-16358Y Institutional support: RVO:61388963 Keywords : 5'-RNA cap * NAD-RNA * RNA chemical modification Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 0.387, year: 2016 http://www.chemicke-listy.cz/docs/full/2017_07_414-423.pdf

Catalytic mechanism and inhibition of tRNA (Uracil-5-)methyltransferase: evidence for covalent catalysis

International Nuclear Information System (INIS)

Santi, D.V.; Hardy, L.W.

1987-01-01

tRNA (Ura-5-) methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine (AdoMet) to the 5-carbon of a specific Urd residue in tRNA. This results in stoichiometric release of tritium from [5- 3 H] Urd-labeled substrate tRNA isolated from methyltransferase-deficient Escherichia coli. The enzyme also catalyzes an AdoMet-independent exchange reaction between [5- 3 H]-Urd-labeled substrate tRNA and protons of water at a rate that is about 1% that of the normal methylation reaction, but with identical stoichiometry. S-Adenosylhomocysteine inhibits the rate of the exchange reaction by 2-3-fold, whereas an analog having the sulfur of AdoMet replaced by nitrogen accelerates the exchange reaction 9-fold. In the presence (but not absence) of AdoMet, 5-fluorouracil-substituted tRNA (FUra-tRNA) leads to the first-order inactivation of the enzyme. This is accompanied by the formation of a stable covalent complex containing the enzyme, FUra-tRNA, and the methyl group AdoMet. A mechanism for catalysis is proposed that explains both the 5-H exchange reaction and the inhibition by FUra-tRNA: the enzyme forms a covalent Michael adduct with substrate or inhibitor tRNA by attack of a nucleophilic group of the enzyme at carbon 6 of the pyrimidine residue to be modified. As a result, an anion equivalent is generated at carbon 5 that is sufficiently reactive to be methylated by AdoMet. Preliminary experiments and precedents suggest that the nucleophilic catalyst of the enzyme is a thiol group of cysteine. The potent irreversible inhibition by FUra-tRNA suggest that a mechanism for the RNA effects of FUra may also involve irreversible inhibition of RNA-modifying enzymes

Pharmacodynamic study on insomnia-curing effects of Shuangxia Decoction in Drosophila melanogaster.

Science.gov (United States)

Zhang, Zhi-Qian; Degejin; Geng, Di; Zhang, Qi; Tian, Yan; Xi, Yuan; Wang, Wen-Qi; Tang, Hua-Qi; Xu, Bing; Lin, Hong-Ying; Sun, Yi-Kun

2016-09-01

The present study aimed to establish a pharmacodynamic method using the pySolo software to explore the influence of freeze-dried powders of Shuangxia Decoction (SXD) on the sleep of normal Drosophila melanogaster and the Drosophila melanogaster whose sleep was divested by light. The dose-effect and the time-effect relationships of SXD on sleep were examined. The effect-onset concentration of SXD was 0.25%, the plateau appeared at the concentration of 2.5% and the total sleep time showed a downtrend when the concentration was greater than 2.5%. The sleep time was the longest on the fourth day after SXD was given. The fruit fly sleep deprivation model was repeated by light stimulation at night. The middle dosage group (2.5%) had the best insomnia-curing effect. In conclusion, using the pySolo software, an approach for the pharmacodynamics study was established with Drosophila melanogaster as a model organism to determine the insomnia-curing effects of the traditional Chinese medicine (TCM). Our results demonstrated the reliability of this method. The freeze-dried powders of SXD could effectively improve the sleep quality of Drosophila melanogaster. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

Directory of Open Access Journals (Sweden)

Garcia Sònia

2012-06-01

Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.

Determination of sRNA expressions by RNA-seq in Yersinia pestis grown in vitro and during infection.

Directory of Open Access Journals (Sweden)

Yanfeng Yan

Full Text Available BACKGROUND: Small non-coding RNAs (sRNAs facilitate host-microbe interactions. They have a central function in the post-transcriptional regulation during pathogenic lifestyles. Hfq, an RNA-binding protein that many sRNAs act in conjunction with, is required for Y. pestis pathogenesis. However, information on how Yersinia pestis modulates the expression of sRNAs during infection is largely unknown. METHODOLOGY AND PRINCIPAL FINDINGS: We used RNA-seq technology to identify the sRNA candidates expressed from Y. pestis grown in vitro and in the infected lungs of mice. A total of 104 sRNAs were found, including 26 previously annotated sRNAs, by searching against the Rfam database with 78 novel sRNA candidates. Approximately 89% (93/104 of these sRNAs from Y. pestis are shared with its ancestor Y. pseudotuberculosis. Ninety-seven percent of these sRNAs (101/104 are shared among more than 80 sequenced genomes of 135 Y. pestis strains. These 78 novel sRNAs include 62 intergenic and 16 antisense sRNAs. Fourteen sRNAs were selected for verification by independent Northern blot analysis. Results showed that nine selected sRNA transcripts were Hfq-dependent. Interestingly, three novel sRNAs were identified as new members of the transcription factor CRP regulon. Semi-quantitative analysis revealed that Y. pestis from the infected lungs induced the expressions of six sRNAs including RyhB1, RyhB2, CyaR/RyeE, 6S RNA, RybB and sR039 and repressed the expressions of four sRNAs, including CsrB, CsrC, 4.5S RNA and sR027. CONCLUSIONS AND SIGNIFICANCE: This study is the first attempt to subject RNA from Y. pestis-infected samples to direct high-throughput sequencing. Many novel sRNAs were identified and the expression patterns of relevant sRNAs in Y. pestis during in vitro growth and in vivo infection were revealed. The annotated sRNAs accounted for the most abundant sRNAs either expressed in bacteria grown in vitro or differentially expressed in the infected lungs

Dietary consumption of monosodium L-glutamate induces adaptive response and reduction in the life span of Drosophila melanogaster.

Science.gov (United States)

Abolaji, Amos O; Olaiya, Charles O; Oluwadahunsi, Oluwagbenga J; Farombi, Ebenezer O

2017-04-01

Adaptive response is the ability of an organism to better counterattack stress-induced damage in response to a number of different cytotoxic agents. Monosodium L-glutamate (MSG), the sodium salt of amino acid glutamate, is commonly used as a food additive. We investigated the effects of MSG on the life span and antioxidant response in Drosophila melanogaster (D. melanogaster). Both genders (1 to 3 days old) of flies were fed with diet containing MSG (0.1, 0.5, and 2.5-g/kg diet) for 5 days to assess selected antioxidant and oxidative stress markers, while flies for longevity were fed for lifetime. Thereafter, the longevity assay, hydrogen peroxide (H 2 O 2 ), and reactive oxygen and nitrogen species levels were determined. Also, catalase, glutathione S-transferase and acetylcholinesterase activities, and total thiol content were evaluated in the flies. We found that MSG reduced the life span of the flies by up to 23% after continuous exposure. Also, MSG increased reactive oxygen and nitrogen species and H 2 O 2 generations and total thiol content as well as the activities of catalase and glutathione S-transferase in D. melanogaster (P reduced life span of flies. This study may therefore have public health significance in humans, and thus, moderate consumption of MSG is advocated by the authors. Copyright © 2017 John Wiley & Sons, Ltd.

Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

Directory of Open Access Journals (Sweden)

Michael H. Kohn

2008-01-01

Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

VHL Frameshift Mutation as Target of Nonsense-Mediated mRNA Decay in Drosophila melanogaster and Human HEK293 Cell Line

Directory of Open Access Journals (Sweden)

Lucia Micale

2009-01-01

Full Text Available There are many well-studied examples of human phenotypes resulting from nonsense or frameshift mutations that are modulated by Nonsense-Mediated mRNA Decay (NMD, a process that typically degrades transcripts containing premature termination codons (PTCs in order to prevent translation of unnecessary or aberrant transcripts. Different types of germline mutations in the VHL gene cause the von Hippel-Lindau disease, a dominantly inherited familial cancer syndrome with a marked phenotypic variability and age-dependent penetrance. By generating the Drosophila UAS:Upf1D45B line we showed the possible involvement of NMD mechanism in the modulation of the c.172delG frameshift mutation located in the exon 1 of Vhl gene. Further, by Quantitative Real-time PCR (QPCR we demonstrated that the corresponding c.163delG human mutation is targeted by NMD in human HEK 293 cells. The UAS:Upf1D45B line represents a useful system to identify novel substrates of NMD pathway in Drosophila melanogaster. Finally, we suggest the possible role of NMD on the regulation of VHL mutations.

CYP3A5 mRNA degradation by nonsense-mediated mRNA decay.

Science.gov (United States)

Busi, Florent; Cresteil, Thierry

2005-09-01

The total CYP3A5 mRNA level is significantly greater in carriers of the CYP3A5*1 allele than in CYP3A5*3 homozygotes. Most of the CYP3A5*3 mRNA includes an intronic sequence (exon 3B) containing premature termination codons (PTCs) between exons 3 and 4. Two models were used to investigate the degradation of CYP3A5 mRNA: a CYP3A5 minigene consisting of CYP3A5 exons and introns 3 to 6 transfected into MCF7 cells, and the endogenous CYP3A5 gene expressed in HepG2 cells. The 3'-untranslated region g.31611C>T mutation has no effect on CYP3A5 mRNA decay. Splice variants containing exon 3B were more unstable than wild-type (wt) CYP3A5 mRNA. Cycloheximide prevents the recognition of PTCs by ribosomes: in transfected MCF7 and HepG2 cells, cycloheximide slowed down the degradation of exon 3B-containing splice variants, suggesting the participation of nonsense-mediated decay (NMD). When PTCs were removed from pseudoexon 3B or when UPF1 small interfering RNA was used to impair the NMD mechanism, the decay of the splice variant was reduced, confirming the involvement of NMD in the degradation of CYP3A5 splice variants. Induction could represent a source of variability for CYP3A5 expression and could modify the proportion of splice variants. The extent of CYP3A5 induction was investigated after exposure to barbiturates or steroids: CYP3A4 was markedly induced in a pediatric population compared with untreated neonates. However, no effect could be detected in either the total CYP3A5 RNA, the proportion of splice variant RNA, or the protein level. Therefore, in these carriers, induction is unlikely to switch on the phenotypic CYP3A5 expression in carriers of CYP3A5*3/*3.

Diversity of 23S rRNA genes within individual prokaryotic genomes.

Directory of Open Access Journals (Sweden)

Anna Pei

Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.

Mutagenic effect of radionuclides incorporated into DNA of drosphila melanogaster. Progress report, 1976--1977

International Nuclear Information System (INIS)

Lee, W.R.

1977-01-01

Progress is reported on studies of the genetic effect of tritium incorporated into DNA of Drosophila melanogaster. Following a short pulse exposure to tritium-labeled uridine most of the radioactivity appeared in RNA; however, the turnover of radioactivity in tritium-labeled RNA was rapid whereas there was no exchange of tritium from the labeled DNA during spermatogenesis. Furthermore, most of the cytoplasm and most of the RNA in primary spermatocytes was lost during spermatogenesis and thus the mature sperm cell was left with only the DNA labeled. Preliminary experiments did not show a significant level of labeled RNA remaining in the mature sperm cell, whereas labeled DNA was verified after extraction and purification with phenol and enzyme digestion. Preliminary results of genetic tests on the progeny of normal females inseminated with tritium-labeled sperm cells are reported

Comparative genomic analysis of Drosophila melanogaster and vector mosquito developmental genes.

Directory of Open Access Journals (Sweden)

Susanta K Behura

Full Text Available Genome sequencing projects have presented the opportunity for analysis of developmental genes in three vector mosquito species: Aedes aegypti, Culex quinquefasciatus, and Anopheles gambiae. A comparative genomic analysis of developmental genes in Drosophila melanogaster and these three important vectors of human disease was performed in this investigation. While the study was comprehensive, special emphasis centered on genes that 1 are components of developmental signaling pathways, 2 regulate fundamental developmental processes, 3 are critical for the development of tissues of vector importance, 4 function in developmental processes known to have diverged within insects, and 5 encode microRNAs (miRNAs that regulate developmental transcripts in Drosophila. While most fruit fly developmental genes are conserved in the three vector mosquito species, several genes known to be critical for Drosophila development were not identified in one or more mosquito genomes. In other cases, mosquito lineage-specific gene gains with respect to D. melanogaster were noted. Sequence analyses also revealed that numerous repetitive sequences are a common structural feature of Drosophila and mosquito developmental genes. Finally, analysis of predicted miRNA binding sites in fruit fly and mosquito developmental genes suggests that the repertoire of developmental genes targeted by miRNAs is species-specific. The results of this study provide insight into the evolution of developmental genes and processes in dipterans and other arthropods, serve as a resource for those pursuing analysis of mosquito development, and will promote the design and refinement of functional analysis experiments.

Localization of tRNAsup(asp)2 genes from Drosophila melanogaster by 'in situ' hybridization

International Nuclear Information System (INIS)

Schmidt, T.; Egg, A.H.; Kubli, E.

1978-01-01

Transfer RNAsup(asp) 2 delta was isolated from Drosophila melanogaster by affinity chromatography on concanavalin A-Sepharose. The tRNA was iodinated 'in vitro' with Na[ 125 I] and hybridized 'in situ' to salivary gland chromosomes from Drosophila. Subsequent autoradiography allowed the localization of the genes for tRNAsup(asp) 2 delta to the left arm of the second chromosome in the regions 29 D and E. (orig.) [de

The Role of Exportin-5 in MicroRNA Biogenesis and Cancer

Directory of Open Access Journals (Sweden)

Ke Wu

2018-04-01

Full Text Available MicroRNAs (miRNAs are conserved small non-coding RNAs that play an important role in the regulation of gene expression and participate in a variety of biological processes. The biogenesis of miRNAs is tightly controlled at multiple steps, such as transcription of miRNA genes, processing by Drosha and Dicer, and transportation of precursor miRNAs (pre-miRNAs from the nucleus to the cytoplasm by exportin-5 (XPO5. Given the critical role of nuclear export of pre-miRNAs in miRNA biogenesis, any alterations of XPO5, resulting from either genetic mutation, epigenetic change, abnormal expression level or posttranslational modification, could affect miRNA expression and thus have profound effects on tumorigenesis. Importantly, XPO5 phosphorylation by ERK kinase and its cis/trans isomerization by the prolyl isomerase Pin1 impair XPO5′s nucleo-to-cytoplasmic transport ability of pre-miRNAs, leading to downregulation of mature miRNAs in hepatocellular carcinoma. In this review, we focus on how XPO5 transports pre-miRNAs in the cells and summarize the dysregulation of XPO5 in human tumors. Keywords: Exportin-5, MicroRNA, Biogenesis, Dysregulation, Cancer

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

Science.gov (United States)

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-05-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

Impact of the Chromatin Remodeling Factor CHD1 on Gut Microbiome Composition of Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Johanna Sebald

Full Text Available The composition of the intestinal microbiota of Drosophila has been studied in some detail in recent years. Environmental, developmental and host-specific genetic factors influence microbiome composition in the fly. Our previous work has indicated that intestinal bacterial load can be affected by chromatin-targeted regulatory mechanisms. Here we studied a potential role of the conserved chromatin assembly and remodeling factor CHD1 in the shaping of the gut microbiome in Drosophila melanogaster. Using high-throughput sequencing of 16S rRNA gene amplicons, we found that Chd1 deletion mutant flies exhibit significantly reduced microbial diversity compared to rescued control strains. Specifically, although Acetobacteraceae dominated the microbiota of both Chd1 wild-type and mutant guts, Chd1 mutants were virtually monoassociated with this bacterial family, whereas in control flies other bacterial taxa constituted ~20% of the microbiome. We further show age-linked differences in microbial load and microbiota composition between Chd1 mutant and control flies. Finally, diet supplementation experiments with Lactobacillus plantarum revealed that, in contrast to wild-type flies, Chd1 mutant flies were unable to maintain higher L. plantarum titres over time. Collectively, these data provide evidence that loss of the chromatin remodeler CHD1 has a major impact on the gut microbiome of Drosophila melanogaster.

Mapping of gene mutations in drosophila melanogaster

OpenAIRE

Halvorsen, Charlotte Marie

2004-01-01

In this experiment, mutant genes of a given unknown mutant strain of Drosophila melanogaster were mapped to specific chromosomes. Drosophila melanogaster, commonly known as the fruit fly, was the appropriate choice for the organism to use in this specific experiment because of its relatively rapid life cycle of 10-14 days and because of the small amount of space and food neccessary for maintaining thousands of flies. The D. Melanogaster unknown strain specifically used in this experiment wa...

Spaceflight Causes Increased Virulence of Serratia Marcescens on a Drosophila Melanogaster Host

Science.gov (United States)

Bhattacharya, Sharmila; Wade, William; Clemens-Grisham, Rachel; Hosamani, Ravikumar; Bhardwaj, Shilpa R.; Lera, Matthew P.; Gresser, Amy L.

2015-01-01

Drosophila melanogaster, or the fruit fly, has long been an important organism for Earth-based research, and is now increasingly utilized as a model system to understand the biological effects of spaceflight. Studies in Drosophila melanogaster have shown altered immune responses in 3rd instar larvae and adult males following spaceflight, changes similar to those observed in astronauts. In addition, spaceflight has also been shown to affect bacterial physiology, as evidenced by studies describing altered virulence of Salmonella typhimurium following spaceflight and variation in biofilm growth patterns for the opportunistic pathogen Pseudomonas aeruginosa during flight. We recently sent Serratia marcescens Db11, a Drosophila pathogen and an opportunistic human pathogen, to the ISS on SpaceX-5 (Fruit Fly Lab-01). S. marcescens samples were stored at 4degC for 24 days on-orbit and then allowed to grow for 120 hours at ambient station temperature before being returned to Earth. Upon return, bacteria were isolated and preserved in 50% glycerol or RNAlater. Storage, growth, and isolation for ground control samples were performed using the same procedures. Spaceflight and ground samples stored in 50% glycerol were diluted and injected into 5-7-day-old ground-born adult D. melanogaster. Lethality was significantly greater in flies injected with the spaceflight samples compared to those injected with ground bacterial samples. These results indicate a shift in the virulence profile of the spaceflight S. marcescens Db11 and will be further assessed with molecular biological analyses. Our findings strengthen the conclusion that spaceflight impacts the virulence of bacterial pathogens on model host organisms such as the fruit fly. This research was supported by NASA's ISS Program Office (ISSPO) and Space Life and Physical Sciences Research and Applications (SLPSRA).

RBPmap: a web server for mapping binding sites of RNA-binding proteins.

Science.gov (United States)

Paz, Inbal; Kosti, Idit; Ares, Manuel; Cline, Melissa; Mandel-Gutfreund, Yael

2014-07-01

Regulation of gene expression is executed in many cases by RNA-binding proteins (RBPs) that bind to mRNAs as well as to non-coding RNAs. RBPs recognize their RNA target via specific binding sites on the RNA. Predicting the binding sites of RBPs is known to be a major challenge. We present a new webserver, RBPmap, freely accessible through the website http://rbpmap.technion.ac.il/ for accurate prediction and mapping of RBP binding sites. RBPmap has been developed specifically for mapping RBPs in human, mouse and Drosophila melanogaster genomes, though it supports other organisms too. RBPmap enables the users to select motifs from a large database of experimentally defined motifs. In addition, users can provide any motif of interest, given as either a consensus or a PSSM. The algorithm for mapping the motifs is based on a Weighted-Rank approach, which considers the clustering propensity of the binding sites and the overall tendency of regulatory regions to be conserved. In addition, RBPmap incorporates a position-specific background model, designed uniquely for different genomic regions, such as splice sites, 5' and 3' UTRs, non-coding RNA and intergenic regions. RBPmap was tested on high-throughput RNA-binding experiments and was proved to be highly accurate. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Preparation and characterization of high-specific activity radiolabeled 50 S measles virus RNA

International Nuclear Information System (INIS)

Spruance, S.L.; Ashton, B.N.; Smith, C.B.

1980-01-01

A method is described to radiolabeled measles virus RNA for hybridization studies. Tritiated nucleosides were added to the media of measles virus infected Vero cells and negative-strand (genome) RNA with a specific activity of 6X10 5 c.p.m./μg was purified from viral nucleocapsids. 50 S RNA was the sole RNA present in nucleocapsids and self-annealed to 50% due to the presence of 25% 50 S plus-strands (anti-genomes). (Auth.)

Irradiation-resistance conferred by superoxide dismutase: possible adaptive role of a natural polymorphism in Drosophila melanogaster

International Nuclear Information System (INIS)

Peng, T.X.; Moya, A.; Ayala, F.J.

1986-01-01

The toxic effects of ionizing radiation to DNA are thought to be due to the generation of the superoxide radical, 02-. Superoxide dismutase (SOD), which scavenges 02-., has been invoked as a protecting enzyme against ionizing radiation in viruses, bacteria, mammalian cells in culture, and live mice. We now demonstrate that SOD is involved in the resistance of Drosophila melanogaster against irradiation. The protection is greatest when flies carry the S form of the enzyme (which exhibits highest in vitro specific activity), intermediate when they carry the F form of the enzyme, and lowest when they are homozygous for N, an allele that reduces the amount of the enzyme to 3.5% of the normal level. Natural selection experiments show that the fitness of the high-activity S allele is increased in an irradiated population relative to the nonirradiated control. These results point towards a possible adaptive function of the S/F polymorphism found in natural populations of D. melanogaster

Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

DEFF Research Database (Denmark)

Douthwaite, S; Christensen, A; Garrett, R A

1982-01-01

The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

Science.gov (United States)

Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

2013-11-01

Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

Obp56h Modulates Mating Behavior in Drosophila melanogaster

Directory of Open Access Journals (Sweden)

John R. Shorter

2016-10-01

Full Text Available Social interactions in insects are driven by conspecific chemical signals that are detected via olfactory and gustatory neurons. Odorant binding proteins (Obps transport volatile odorants to chemosensory receptors, but their effects on behaviors remain poorly characterized. Here, we report that RNAi knockdown of Obp56h gene expression in Drosophila melanogaster enhances mating behavior by reducing courtship latency. The change in mating behavior that results from inhibition of Obp56h expression is accompanied by significant alterations in cuticular hydrocarbon (CHC composition, including reduction in 5-tricosene (5-T, an inhibitory sex pheromone produced by males that increases copulation latency during courtship. Whole genome RNA sequencing confirms that expression of Obp56h is virtually abolished in Drosophila heads. Inhibition of Obp56h expression also affects expression of other chemoreception genes, including upregulation of lush in both sexes and Obp83ef in females, and reduction in expression of Obp19b and Or19b in males. In addition, several genes associated with lipid metabolism, which underlies the production of cuticular hydrocarbons, show altered transcript abundances. Our data show that modulation of mating behavior through reduction of Obp56h is accompanied by altered cuticular hydrocarbon profiles and implicate 5-T as a possible ligand for Obp56h.

Prader-Willi region non-protein coding RNA 1 suppressed gastric cancer growth as a competing endogenous RNA of microRNA-425-5p.

Science.gov (United States)

Chen, Zihao; Ju, Hongping; Yu, Shan; Zhao, Ting; Jing, Xiaojie; Li, Ping; Jia, Jing; Li, Nan; Tan, Bibo; Li, Yong

2018-03-13

Gastric cancer (GC) is one of a major global health problem especially in Asia. Nowadays, long non-coding RNA has gained significantly attention in the current research climate such as carcinogenesis. This research desired to explore the mechanism of Prader-Willi region non-protein coding RNA 1 (PWRN1) on regulating GC process. Differentially expressed lncRNAs in GC tissues were screened out through microarray analysis. The RNA and protein expression level was detected by qRT-PCR and western blot. Cell proliferation, apoptosis rate, metastasis abilities were respectively determined by CCK8, flow cytometry, wound healing and transwell assay. The luciferase reporter system was used to verify the targeting relationships between PWRN1, miR-425-5p and PTEN RIP assay was performed to prove whether PWRN1 acted as a competitive endogenous RNA (ceRNA) of miR-425-5p. Tumor xenograft model and immunohistochemistry were developed to study the influence of PWRN1 on tumor growth in vivo Microarray analysis determined that PWRN1 was different expressed between GC tissues and adjacent tissues. QRT-PCR revealed PWRN1 low expression in GC tissues and cells. PWRN1 up-regulated could reduce proliferation and metastasis and increased apoptosis in GC cells, while miR-425-5p had reverse effects. The RIP assay indicated that PWRN1 may target an oncogene miR-425-5p. The tumor xenograft assay found that up-regulated PWRN1 suppressed the tumor growth. The bioinformatic analysis, luciferase assay and western blot indicated that PWRN1 affected PTEN/Akt/MDM2/p53 axis via suppressing miR-425-5p. Our findings suggested that PWRN1 functioned as a ceRNA targeting to miR-425-5p and suppressed GC development via p53 signaling pathway. ©2018 The Author(s).

Analysis of immune-related genes during Nora virus infection of Drosophila melanogaster using next generation sequencing.

Science.gov (United States)

Lopez, Wilfredo; Page, Alexis M; Carlson, Darby J; Ericson, Brad L; Cserhati, Matyas F; Guda, Chittibabu; Carlson, Kimberly A

2018-01-01

Drosophila melanogaster depends upon the innate immune system to regulate and combat viral infection. This is a complex, yet widely conserved process that involves a number of immune pathways and gene interactions. In addition, expression of genes involved in immunity are differentially regulated as the organism ages. This is particularly true for viruses that demonstrate chronic infection, as is seen with Nora virus. Nora virus is a persistent non-pathogenic virus that replicates in a horizontal manner in D. melanogaster . The genes involved in the regulation of the immune response to Nora virus infection are largely unknown. In addition, the temporal response of immune response genes as a result of infection has not been examined. In this study, D. melanogaster either infected with Nora virus or left uninfected were aged for 2, 10, 20 and 30 days. The RNA from these samples was analyzed by next generation sequencing (NGS) and the resulting immune-related genes evaluated by utilizing both the PANTHER and DAVID databases, as well as comparison to lists of immune related genes and FlyBase. The data demonstrate that Nora virus infected D. melanogaster exhibit an increase in immune related gene expression over time. In addition, at day 30, the data demonstrate that a persistent immune response may occur leading to an upregulation of specific immune response genes. These results demonstrate the utility of NGS in determining the potential immune system genes involved in Nora virus replication, chronic infection and involvement of antiviral pathways.

The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

OpenAIRE

1986-01-01

We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...

A novel RNA binding surface of the TAM domain of TIP5/BAZ2A mediates epigenetic regulation of rRNA genes.

Science.gov (United States)

Anosova, Irina; Melnik, Svitlana; Tripsianes, Konstantinos; Kateb, Fatiha; Grummt, Ingrid; Sattler, Michael

2015-05-26

The chromatin remodeling complex NoRC, comprising the subunits SNF2h and TIP5/BAZ2A, mediates heterochromatin formation at major clusters of repetitive elements, including rRNA genes, centromeres and telomeres. Association with chromatin requires the interaction of the TAM (TIP5/ARBP/MBD) domain of TIP5 with noncoding RNA, which targets NoRC to specific genomic loci. Here, we show that the NMR structure of the TAM domain of TIP5 resembles the fold of the MBD domain, found in methyl-CpG binding proteins. However, the TAM domain exhibits an extended MBD fold with unique C-terminal extensions that constitute a novel surface for RNA binding. Mutation of critical amino acids within this surface abolishes RNA binding in vitro and in vivo. Our results explain the distinct binding specificities of TAM and MBD domains to RNA and methylated DNA, respectively, and reveal structural features for the interaction of NoRC with non-coding RNA. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Crystallization and preliminary crystallographic studies of the W2 domain of Drosophila melanogaster eukaryotic translation initiation factor 5C domain-containing protein

International Nuclear Information System (INIS)

Zhao, Hui; Wang, Hong; Liu, Huihui; Teng, Maikun; Li, Xu

2012-01-01

The crystallization and preliminary crystallographic studies of the carboxy-terminal domain of D. melanogaster eukaryotic translation initiation factor 5C domain-containing protein are reported. The Drosophila melanogaster eukaryotic translation initiation factor 5C domain-containing protein (ECP) is composed of two independently folded domains which belong to the basic leucine-zipper and W2 domain-containing protein (BZW) family. Based on the sequence similarity between the C-terminal W2 domain of ECP and some eukaryotic translation initiation factors (such as eIF2B∊, eIF4γ, eIF5 etc.), ECP has been speculated to participate in the translation initiation process. Structural information on the C-terminal W2 domain of ECP would be helpful in understanding the specific cellular function of this protein. Here, the W2 domain of ECP was expressed and crystallized. Crystals grown by the hanging-drop vapour-diffusion method diffracted to 2.70 Å resolution and belonged to space group I4, with unit-cell parameters a = b = 81.05, c = 57.44 Å. The Matthews coefficient suggested that there was one molecule per asymmetric unit in the crystal

Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

Czech Academy of Sciences Publication Activity Database

Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

2003-01-01

Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

Drosophila interspecific hybrids phenocopy piRNA-pathway mutants.

Directory of Open Access Journals (Sweden)

Erin S Kelleher

Full Text Available The Piwi-interacting RNA (piRNA pathway defends the germline of animals from the deleterious activity of selfish transposable elements (TEs through small-RNA mediated silencing. Adaptation to novel invasive TEs is proposed to occur by incorporating their sequences into the piRNA pool that females produce and deposit into their eggs, which then propagates immunity against specific TEs to future generations. In support of this model, the F1 offspring of crosses between strains of the same Drosophila species sometimes suffer from germline derepression of paternally inherited TE families, caused by a failure of the maternal strain to produce the piRNAs necessary for their regulation. However, many protein components of the Drosophila piRNA pathway exhibit signatures of positive selection, suggesting that they also contribute to the evolution of host genome defense. Here we investigate piRNA pathway function and TE regulation in the F1 hybrids of interspecific crosses between D. melanogaster and D. simulans and compare them with intraspecific control crosses of D. melanogaster. We confirm previous reports showing that intraspecific crosses are characterized by derepression of paternally inherited TE families that are rare or absent from the maternal genome and piRNA pool, consistent with the role of maternally deposited piRNAs in shaping TE silencing. In contrast to the intraspecific cross, we discover that interspecific hybrids are characterized by widespread derepression of both maternally and paternally inherited TE families. Furthermore, the pattern of derepression of TE families in interspecific hybrids cannot be attributed to their paucity or absence from the piRNA pool of the maternal species. Rather, we demonstrate that interspecific hybrids closely resemble piRNA effector-protein mutants in both TE misregulation and aberrant piRNA production. We suggest that TE derepression in interspecific hybrids largely reflects adaptive divergence of piRNA

Identification of pathogenic Nocardia species by reverse line blot hybridization targeting the 16S rRNA and 16S-23S rRNA gene spacer regions.

Science.gov (United States)

Xiao, Meng; Kong, Fanrong; Sorrell, Tania C; Cao, Yongyan; Lee, Ok Cha; Liu, Ying; Sintchenko, Vitali; Chen, Sharon C A

2010-02-01

Although 16S rRNA gene sequence analysis is employed most often for the definitive identification of Nocardia species, alternate molecular methods and polymorphisms in other gene targets have also enabled species determinations. We evaluated a combined Nocardia PCR-based reverse line blot (RLB) hybridization assay based on 16S and 16S-23S rRNA gene spacer region polymorphisms to identify 12 American Type Culture Collection and 123 clinical Nocardia isolates representing 14 species; results were compared with results from 16S rRNA gene sequencing. Thirteen 16S rRNA gene-based (two group-specific and 11 species-specific) and five 16S-23S spacer-targeted (two taxon-specific and three species-specific) probes were utilized. 16S rRNA gene-based probes correctly identified 124 of 135 isolates (sensitivity, 92%) but were unable to identify Nocardia paucivorans strains (n = 10 strains) and a Nocardia asteroides isolate with a novel 16S rRNA gene sequence. Nocardia farcinica and Nocardia cyriacigeorgica strains were identified by the sequential use of an N. farcinica-"negative" probe and a combined N. farcinica/N. cyriacigeorgica probe. The assay specificity was high (99%) except for weak cross-reactivity between the Nocardia brasiliensis probe with the Nocardia thailandica DNA product; however, cross-hybridization with closely related nontarget species may occur. The incorporation of 16S-23S rRNA gene spacer-based probes enabled the identification of all N. paucivorans strains. The overall sensitivity using both probe sets was >99%. Both N. farcinica-specific 16S-23S rRNA gene spacer-directed probes were required to identify all N. farcinica stains by using this probe set. The study demonstrates the utility of a combined PCR/RLB assay for the identification of clinically relevant Nocardia species and its potential for studying subtypes of N. farcinica. Where species assignment is ambiguous or not possible, 16S rRNA gene sequencing is recommended.

Covalent Chemical 5'-Functionalization of RNA with Diazo Reagents.

Science.gov (United States)

Gampe, Christian M; Hollis-Symynkywicz, Micah; Zécri, Frédéric

2016-08-22

Functionalization of RNA at the 5'-terminus is important for analytical and therapeutic purposes. Currently, these RNAs are synthesized de novo starting with a chemically functionalized 5'-nucleotide, which is incorporated into RNA using chemical synthesis or biochemical techniques. Methods for direct chemical modification of native RNA would provide an attractive alternative but are currently underexplored. Herein, we report that diazo compounds can be used to selectively alkylate the 5'-phosphate of ribo(oligo)nucleotides to give RNA labelled through a native phosphate ester bond. We applied this method to functionalize oligonucleotides with biotin and an orthosteric inhibitor of the eukaryotic initiation factor 4E (eIF4E), an enzyme involved in mRNA recognition. The modified RNA binds to eIF4E, demonstrating the utility of this labelling technique to modulate biological activity of RNA. This method complements existing techniques and may be used to chemically introduce a broad range of functional handles at the 5'-end of RNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

MicroRNAs That Contribute to Coordinating the Immune Response in Drosophila melanogaster.

Science.gov (United States)

Atilano, Magda L; Glittenberg, Marcus; Monteiro, Annabel; Copley, Richard R; Ligoxygakis, Petros

2017-09-01

Small noncoding RNAs called microRNAs (miRNAs) have emerged as post-transcriptional regulators of gene expression related to host defenses. Here, we have used Drosophila melanogaster to explore the contribution of individual or clusters of miRNAs in countering systemic Candida albicans infection. From a total of 72 tested, we identify 6 miRNA allelic mutant backgrounds that modulate the survival response to infection and the ability to control pathogen number. These mutants also exhibit dysregulation of the Toll pathway target transcripts Drosomycin ( Drs ) and Immune-Induced Molecule 1 ( IM1 ). These are characteristics of defects in Toll signaling, and consistent with this, we demonstrate dependency for one of the miRNA mutants on the NF-κΒ homolog Dif. We also quantify changes in the miRNA expression profile over time in response to three pathogen types, and identify 13 mature miRNA forms affected by pathogens that stimulate Toll signaling. To complement this, we provide a genome-wide map of potential NF-κB sites in proximity to miRNA genes. Finally, we demonstrate that systemic C. albicans infection contributes to a reduction in the total amount of branch-chained amino acids, which is miRNA-regulated. Overall, our data reveal a new layer of miRNA complexity regulating the fly response to systemic fungal infection. Copyright © 2017 Atilano et al.

Induction of morphological aberrations by enzyme inhibition in Drosophila melanogaster

NARCIS (Netherlands)

Bos, M.; Scharloo, W.; Bijlsma, R.; de Boer, I.M.; den Hollander, J.

1969-01-01

Zusatz zum Futter vonDrosophila melanogaster von 5-Fluoro-2-deoxyuridin oder Aminopterin induziert überzählige Skutellar- und Dorsozentralborsten sowie gekerbte Flügel. Diese Modifikationen wurden als Konsequenz von Enzymhemmung interpretiert.

SKI2 mediates degradation of RISC 5'-cleavage fragments and prevents secondary siRNA production from miRNA targets in Arabidopsis.

Science.gov (United States)

Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter

2015-12-15

Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20-24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5', but not 3'-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5' to the cleavage site, but several examples of 3'-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5'-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5'-cleavage fragments. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

[Characterizing Beijing's Airborne Bacterial Communities in PM2.5 and PM1 Samples During Haze Pollution Episodes Using 16S rRNA Gene Analysis Method].

Science.gov (United States)

Wang, Bu-ying; Lang, Ji-dong; Zhang, Li-na; Fang, Jian-huo; Cao, Chen; Hao, Ji-ming; Zhu, Ting; Tian, Geng; Jiang, Jing-kun

2015-08-01

During 8th-14th Jan., 2013, severe particulate matter (PM) pollution episodes happened in Beijing. These air pollution events lead to high risks for public health. In addition to various PM chemical compositions, biological components in the air may also impose threaten. Little is known about airborne microbial community in such severe air pollution conditions. PM2.5 and PM10 samples were collected during that 7-day pollution period. The 16S rRNA gene V3 amplification and the MiSeq sequencing were performed for analyzing these samples. It is found that there is no significant difference at phylum level for PM2.5 bacterial communities during that 7-day pollution period both at phylum and at genus level. At genus level, Arthrobacter and Frankia are the major airborne microbes presented in Beijing winter.samples. At genus level, there are 39 common genera (combined by first 50 genera bacterial of the two analysis) between the 16S rRNA gene analysis and those are found by Metagenomic analysis on the same PM samples. Frankia and Paracoccus are relatively more abundant in 16S rRNA gene data, while Kocuria and Geodermatophilus are relatively more abundant in Meta-data. PM10 bacterial communities are similar to those of PM2.5 with some noticeable differences, i.e., at phylum level, more Firmicutes and less Actinobacteria present in PM10 samples than in PM2.5 samples, while at genus level, more Clostridium presents in PM10 samples. The findings in Beijing were compared with three 16S rRNA gene studies in other countries. Although the sampling locations and times are different from each other, compositions of bacterial community are similar for those sampled at the ground atmosphere. Airborne microbial communities near the ground surface are different from those sampled in the upper troposphere.

The flavoprotein Mcap0476 (RlmFO) catalyzes m5U1939 modification in Mycoplasma capricolum 23S rRNA

DEFF Research Database (Denmark)

Lartigue, Carole; Lebaudy, Anne; Blanchard, Alain

2014-01-01

Efficient protein synthesis in all organisms requires the post-transcriptional methylation of specific ribosomal ribonucleic acid (rRNA) and transfer RNA (tRNA) nucleotides. The methylation reactions are almost invariably catalyzed by enzymes that use S-adenosylmethionine (AdoMet) as the methyl g...... specifically modifies m5U1939 in 23S rRNA, a conserved methylation catalyzed by AdoMet-dependent enzymes in all other characterized bacteria. The Mcap0476 methyltransferase (renamed RlmFO) represents the first folate-dependent flavoprotein seen to modify ribosomal RNA.......Efficient protein synthesis in all organisms requires the post-transcriptional methylation of specific ribosomal ribonucleic acid (rRNA) and transfer RNA (tRNA) nucleotides. The methylation reactions are almost invariably catalyzed by enzymes that use S-adenosylmethionine (AdoMet) as the methyl...... group donor. One noteworthy exception is seen in some bacteria, where the conserved tRNA methylation at m5U54 is added by the enzyme TrmFO using flavin adenine dinucleotide together with N5,N10-methylenetetrahydrofolate as the one-carbon donor. The minimalist bacterium Mycoplasma capricolum possesses...

Evolution of green plants as deduced from 5S rRNA sequences.

Science.gov (United States)

Hori, H; Lim, B L; Osawa, S

1985-02-01

We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

Exportin-5 mediates nuclear export of SRP RNA in vertebrates.

Science.gov (United States)

Takeiwa, Toshihiko; Taniguchi, Ichiro; Ohno, Mutsuhito

2015-04-01

The signal recognition particle is a ribonucleoprotein complex that is essential for the translocation of nascent proteins into the endoplasmic reticulum. It has been shown that the RNA component (SRP RNA) is exported from the nucleus by CRM1 in the budding yeast. However, how SRP RNA is exported in higher species has been elusive. Here, we show that SRP RNA does not use the CRM1 pathway in Xenopus oocytes. Instead, SRP RNA uses the same export pathway as pre-miRNA and tRNA as showed by cross-competition experiments. Consistently, the recombinant Exportin-5 protein specifically stimulated export of SRP RNA as well as of pre-miRNA and tRNA, whereas an antibody raised against Exportin-5 specifically inhibited export of the same RNA species. Moreover, biotinylated SRP RNA can pull down Exportin-5 but not CRM1 from HeLa cell nuclear extracts in a RanGTP-dependent manner. These results, taken together, strongly suggest that the principal export receptor for SRP RNA in vertebrates is Exportin-5 unlike in the budding yeast. © 2015 The Authors. Genes to Cells published by Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.

Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

Science.gov (United States)

Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

1984-01-01

Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

Limitations in the use of Drosophila melanogaster as a model host for gram-positive bacterial infection

DEFF Research Database (Denmark)

Jensen, Rikke Lind; Pedersen, K.S.; Loeschcke, V

2007-01-01

resistance respectively, were subjected to infection by L. monocytogenes, S. aureus and E. coli. Mortality rates were comparable with that of the Oregon R strain. Conclusions: Use of the injection method shows the limitation of D. melanogaster as a model host for gram-positive bacteria as opportunistic......Aims: To examine sensitivities of various Drosophila melanogaster strains towards human pathogenic and nonpathogenic gram-positive bacteria. Methods and Results: The D. melanogaster Oregon R strain was infected by injecting the thorax with a needle containing Escherichia coli (negative control...... with the negative control. Infection with L. innocua, B. subtilis or C. maltaromaticum also resulted in a high fly mortality, whereas Lact. plantarum and P. acidilactici resulted in a slightly increased mortality. Four additional D. melanogaster lines, three of which had been selected for heat, cold and desiccation...

Analysis of bacterial genetic diversity in biofloc by using ARDRA 16S-rRNA gene

Directory of Open Access Journals (Sweden)

, Widanarni

2015-05-01

Full Text Available ABSTRACT This study aimed to analyze the genetic diversity of bacteria associated in bioflocs using 16S-rRNA polymerase chain reaction (PCR with ARDRA technique. A total of 38 dominant bacterial isolates was obtained from bioflocs samples and of these isolates, 16S-rRNA gene was then isolated and amplified using PCR. The 16S-rRNA gene of the isolates was then cut using HaeIII (5’-GG↓CC and HhaI (5’-GCG↓C restriction enzymes resulting an ARDRA pattern which was further used as the binary data for the construction of phylogenetics tree that was used to estimate the group of bacteria. The result with HaeIII cut restriction enzyme from biofloc-associated bacteria gave 11 ARDRA patterns, while with the restriction enzyme HhaI gave eight ARDRA patterns. Phylogenetics of bacterial populations from biofloc-based cultivation system water consisted of at least 13 different bacterial species. Result of sequencing from two gene sample 16S-rRNA were identified as Microbacterium foliorumand and Pseudomonas putida. Keywords: bacterial diversity, ARDRA, biofloc, phylogeny  ABSTRAK Penelitian ini bertujuan untuk menganalisis keragaman genetika bakteri bioflok menggunakan metode polymerase chain reaction (PCR 16S-rRNA dengan teknik ARDRA. Sebanyak 38 isolat bakteri dominan yang diperoleh diamplifikasi gen 16S-rRNAnya dengan PCR, kemudian dipotong dengan enzim restriksi HaeIII (5’-GG↓CC dan HhaI (5’-GCG↓C. Pola ARDRA ini dijadikan data biner sebagai input untuk konstruksi pohon filogenetika yang dapat digunakan untuk memerkirakan jenis bakteri yang ada. Gen 16S-rRNA hasil PCR setelah dipotong dengan enzim restriksi HaeIII didapatkan 11 pola ARDRA, sedangkan dengan enzim restriksi HhaI menghasilkan delapan pola ARDRA. Berdasarkan pohon filogenetika, diketahui populasi bakteri pada air sistem budidaya bioflok sedikitnya terdiri atas 13 jenis bakteri. Berdasarkan sekuensing dari dua sampel gen 16S-rRNA teridentifikasi jenis bakteri Microbacterium

Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

Directory of Open Access Journals (Sweden)

Thibaut Josse

2007-09-01

Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

Science.gov (United States)

Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

2015-12-21

5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Characterization of the ptr5+ gene involved in nuclear mRNA export in fission yeast

International Nuclear Information System (INIS)

Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka; Tani, Tokio

2012-01-01

Highlights: ► We cloned the ptr5 + gene involved in nuclear mRNA export in fission yeast. ► The ptr5 + gene was found to encode nucleoporin 85 (Nup85). ► Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. ► Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. ► Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A) + RNA transport] 1 to 11, which accumulate poly(A) + RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5–1 mutant shows dots- or a ring-like accumulation of poly(A) + RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5 + gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5–1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5–1 mutation. In addition, we found that the ptr5–1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5–1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.

Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

Science.gov (United States)

Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

2003-08-01

Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

Science.gov (United States)

Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

2009-07-01

RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

Neurotoxicity of fungal volatile organic compounds in Drosophila melanogaster.

Science.gov (United States)

Inamdar, Arati A; Masurekar, Prakash; Bennett, Joan Wennstrom

2010-10-01

Many volatile organic compounds (VOCs) are found in indoor environment as products of microbial metabolism. In damp indoor environments, fungi are associated with poor air quality. Some epidemiological studies have suggested that microbial VOCs have a negative impact on human health. Our study was designed to provide a reductionist approach toward studying fungal VOC-mediated toxicity using the inexpensive model organism, Drosophila melanogaster, and pure chemical standards of several important fungal VOCs. Low concentrations of the following known fungal VOCs, 0.1% of 1-octen-3-ol and 0.5% of 2-octanone; 2,5 dimethylfuran; 3-octanol; and trans-2-octenal, caused locomotory defects and changes in green fluorescent protein (GFP)- and antigen-labeled dopaminergic neurons in adult D. melanogaster. Locomotory defects could be partially rescued with L-DOPA. Ingestion of the antioxidant, vitamin E, improved the survival span and delayed the VOC-mediated changes in dopaminergic neurons, indicating that the VOC-mediated toxicity was due, in part, to generation of reactive oxygen species.

Theoretical studies on sRNA-mediated regulation in bacteria

Science.gov (United States)

Chang, Xiao-Xue; Xu, Liu-Fang; Shi, Hua-Lin

2015-12-01

Small RNA(sRNA)-mediated post-transcriptional regulation differs from protein-mediated regulation. Through base-pairing, sRNA can regulate the target mRNA in a catalytic or stoichiometric manner. Some theoretical models were built for comparison of the protein-mediated and sRNA-mediated modes in the steady-state behaviors and noise properties. Many experiments demonstrated that a single sRNA can regulate several mRNAs, which causes crosstalk between the targets. Here, we focus on some models in which two target mRNAs are silenced by the same sRNA to discuss their crosstalk features. Additionally, the sequence-function relationship of sRNA and its role in the kinetic process of base-pairing have been highlighted in model building. Project supported by the National Basic Research Program of China (Grant No. 2013CB834100), the National Natural Science Foundation of China (Grant Nos. 11121403 and 11274320), the Open Project Program of State Key Laboratory of Theoretical Physics, Institute of Theoretical Physics, Chinese Academy of Sciences, China (Grant No. Y4KF171CJ1), the National Natural Science Foundation for Young Scholar of China (Grant No. 11304115), and the China Postdoctoral Science Foundation (Grant No. 2013M541282).

Global Analysis of RNA Secondary Structure in Two Metazoans

Directory of Open Access Journals (Sweden)

Fan Li

2012-01-01

Full Text Available The secondary structure of RNA is necessary for its maturation, regulation, processing, and function. However, the global influence of RNA folding in eukaryotes is still unclear. Here, we use a high-throughput, sequencing-based, structure-mapping approach to identify the paired (double-stranded RNA [dsRNA] and unpaired (single-stranded RNA [ssRNA] components of the Drosophila melanogaster and Caenorhabditis elegans transcriptomes, which allows us to identify conserved features of RNA secondary structure in metazoans. From this analysis, we find that ssRNAs and dsRNAs are significantly correlated with specific epigenetic modifications. Additionally, we find key structural patterns across protein-coding transcripts that indicate that RNA folding demarcates regions of protein translation and likely affects microRNA-mediated regulation of mRNAs in animals. Finally, we identify and characterize 546 mRNAs whose folding pattern is significantly correlated between these metazoans, suggesting that their structure has some function. Overall, our findings provide a global assessment of RNA folding in animals.

Dosage compensation of serine-4 transfer RNA in Drosophila melanogaster

International Nuclear Information System (INIS)

Birchler, J.A.; Owenby, R.K.; Jacobson, K.B.

1982-01-01

A dosage series of the X chromosome site for serine-4 transfer RNA consisting of one of three copies in females and one to two in males was constructed to test whether transfer RNA expression is governed by dosage compensation. A dosage effect on the level of the serine-4 isoacceptor was observed in both females and males when the structural locus was varied. However, in males, each dose had a relatively greater expression so the normal one dose was slightly greater than the total female value and the duplicated male had the highest relative expression of all the types examined. Serine-4 levels in males and females from an isogenic Oregon-R stock were similar. Thus the transfer RNA levels conform to the expectations of dosage compensation

The Regulatory Small RNA MarS Supports Virulence of Streptococcus pyogenes.

Science.gov (United States)

Pappesch, Roberto; Warnke, Philipp; Mikkat, Stefan; Normann, Jana; Wisniewska-Kucper, Aleksandra; Huschka, Franziska; Wittmann, Maja; Khani, Afsaneh; Schwengers, Oliver; Oehmcke-Hecht, Sonja; Hain, Torsten; Kreikemeyer, Bernd; Patenge, Nadja

2017-09-25

Small regulatory RNAs (sRNAs) play a role in the control of bacterial virulence gene expression. In this study, we investigated an sRNA that was identified in Streptococcus pyogenes (group A Streptococcus, GAS) but is conserved throughout various streptococci. In a deletion strain, expression of mga, the gene encoding the multiple virulence gene regulator, was reduced. Accordingly, transcript and proteome analyses revealed decreased expression of several Mga-activated genes. Therefore, and because the sRNA was shown to interact with the 5' UTR of the mga transcript in a gel-shift assay, we designated it MarS for m ga-activating regulatory sRNA. Down-regulation of important virulence factors, including the antiphagocytic M-protein, led to increased susceptibility of the deletion strain to phagocytosis and reduced adherence to human keratinocytes. In a mouse infection model, the marS deletion mutant showed reduced dissemination to the liver, kidney, and spleen. Additionally, deletion of marS led to increased tolerance towards oxidative stress. Our in vitro and in vivo results indicate a modulating effect of MarS on virulence gene expression and on the pathogenic potential of GAS.

Genetic mapping uncovers cis-regulatory landscape of RNA editing.

Science.gov (United States)

Ramaswami, Gokul; Deng, Patricia; Zhang, Rui; Anna Carbone, Mary; Mackay, Trudy F C; Li, Jin Billy

2015-09-16

Adenosine-to-inosine (A-to-I) RNA editing, catalysed by ADAR enzymes conserved in metazoans, plays an important role in neurological functions. Although the fine-tuning mechanism provided by A-to-I RNA editing is important, the underlying rules governing ADAR substrate recognition are not well understood. We apply a quantitative trait loci (QTL) mapping approach to identify genetic variants associated with variability in RNA editing. With very accurate measurement of RNA editing levels at 789 sites in 131 Drosophila melanogaster strains, here we identify 545 editing QTLs (edQTLs) associated with differences in RNA editing. We demonstrate that many edQTLs can act through changes in the local secondary structure for edited dsRNAs. Furthermore, we find that edQTLs located outside of the edited dsRNA duplex are enriched in secondary structure, suggesting that distal dsRNA structure beyond the editing site duplex affects RNA editing efficiency. Our work will facilitate the understanding of the cis-regulatory code of RNA editing.

Identification and characterization of novel natural pathogen of Drosophila melanogaster isolated from wild captured Drosophila spp.

Science.gov (United States)

Singh, Karan; Zulkifli, Mohammad; Prasad, N G

2016-12-01

Drosophila melanogaster is an emerging model system for the study of evolutionary ecology of immunity. However, a large number of studies have used non natural pathogens as very few natural pathogens have been isolated and identified. Our aim was to isolate and characterize natural pathogen/s of D. melanogaster. A bacterial pathogen was isolated from wild caught Drosophila spp., identified as a new strain of Staphylococcus succinus subsp. succinus and named PK-1. This strain induced substantial mortality (36-62%) in adults of several laboratory populations of D. melanogaster. PK-1 grew rapidly within the body of the flies post infection and both males and females had roughly same number of colony forming units. Mortality was affected by mode of infection and dosage of the pathogen. However mating status of the host had no effect on mortality post infection. Given that there are very few known natural bacterial pathogens of D. melanogaster and that PK-1 can establish a sustained infection across various outbred and inbred populations of D. melanogaster this new isolate is a potential resource for future studies on immunity. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

A high-resolution whole-genome map of key chromatin modifications in the adult Drosophila melanogaster.

Science.gov (United States)

Yin, Hang; Sweeney, Sarah; Raha, Debasish; Snyder, Michael; Lin, Haifan

2011-12-01

Epigenetic research has been focused on cell-type-specific regulation; less is known about common features of epigenetic programming shared by diverse cell types within an organism. Here, we report a modified method for chromatin immunoprecipitation and deep sequencing (ChIP-Seq) and its use to construct a high-resolution map of the Drosophila melanogaster key histone marks, heterochromatin protein 1a (HP1a) and RNA polymerase II (polII). These factors are mapped at 50-bp resolution genome-wide and at 5-bp resolution for regulatory sequences of genes, which reveals fundamental features of chromatin modification landscape shared by major adult Drosophila cell types: the enrichment of both heterochromatic and euchromatic marks in transposons and repetitive sequences, the accumulation of HP1a at transcription start sites with stalled polII, the signatures of histone code and polII level/position around the transcriptional start sites that predict both the mRNA level and functionality of genes, and the enrichment of elongating polII within exons at splicing junctions. These features, likely conserved among diverse epigenomes, reveal general strategies for chromatin modifications.

Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

International Nuclear Information System (INIS)

Gorelic, L.; Parker, D.

1978-01-01

The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

Proteome reference map of Drosophila melanogaster head.

Science.gov (United States)

Lee, Tian-Ren; Huang, Shun-Hong; Lee, Chi-Ching; Lee, Hsiao-Yun; Chan, Hsin-Tzu; Lin, Kuo-Sen; Chan, Hong-Lin; Lyu, Ping-Chiang

2012-06-01

Drosophila melanogaster has been used as a genetic model organism to understand the fundamental molecular mechanisms in human biology including memory formation that has been reported involving protein synthesis and/or post-translational modification. In this study, we employed a proteomic platform based on fluorescent 2DE and MALDI-TOF MS to build a standard D. melanogaster head proteome map for proteome-proteome comparison. In order to facilitate the comparison, an interactive database has been constructed for systematically integrating and analyzing the proteomes from different conditions and further implicated to study human diseases related to D. melanogaster model. In summary, the fundamental head proteomic database and bioinformatic analysis will be useful for further elucidating the biological mechanisms such as memory formation and neurodegenerative diseases. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Genetic architecture of natural variation in cuticular hydrocarbon composition in Drosophila melanogaster.

Science.gov (United States)

Dembeck, Lauren M; Böröczky, Katalin; Huang, Wen; Schal, Coby; Anholt, Robert R H; Mackay, Trudy F C

2015-11-14

Insect cuticular hydrocarbons (CHCs) prevent desiccation and serve as chemical signals that mediate social interactions. Drosophila melanogaster CHCs have been studied extensively, but the genetic basis for individual variation in CHC composition is largely unknown. We quantified variation in CHC profiles in the D. melanogaster Genetic Reference Panel (DGRP) and identified novel CHCs. We used principal component (PC) analysis to extract PCs that explain the majority of CHC variation and identified polymorphisms in or near 305 and 173 genes in females and males, respectively, associated with variation in these PCs. In addition, 17 DGRP lines contain the functional Desat2 allele characteristic of African and Caribbean D. melanogaster females (more 5,9-C27:2 and less 7,11-C27:2, female sex pheromone isomers). Disruption of expression of 24 candidate genes affected CHC composition in at least one sex. These genes are associated with fatty acid metabolism and represent mechanistic targets for individual variation in CHC composition.

5'-Phospho-RNA Acceptor Specificity of GDP Polyribonucleotidyltransferase of Vesicular Stomatitis Virus in mRNA Capping.

Science.gov (United States)

Ogino, Minako; Ogino, Tomoaki

2017-03-15

The GDP polyribonucleotidyltransferase (PRNTase) domain of the multifunctional L protein of rhabdoviruses, such as vesicular stomatitis virus (VSV) and rabies virus, catalyzes the transfer of 5'-phospho-RNA (pRNA) from 5'-triphospho-RNA (pppRNA) to GDP via a covalent enzyme-pRNA intermediate to generate a 5'-cap structure (GpppA). Here, using an improved oligo-RNA capping assay with the VSV L protein, we showed that the Michaelis constants for GDP and pppAACAG (VSV mRNA-start sequence) are 0.03 and 0.4 μM, respectively. A competition assay between GDP and GDP analogues in the GpppA formation and pRNA transfer assay using GDP analogues as pRNA acceptors indicated that the PRNTase domain recognizes the C-2-amino group, but not the C-6-oxo group, N-1-hydrogen, or N-7-nitrogen, of GDP for the cap formation. 2,6-Diaminopurine-riboside (DAP), 7-deazaguanosine (7-deaza-G), and 7-methylguanosine (m 7 G) diphosphates efficiently accepted pRNA, resulting in the formation of DAPpppA, 7-deaza-GpppA, and m 7 GpppA (cap 0), respectively. Furthermore, either the 2'- or 3'-hydroxyl group of GDP was found to be required for efficient pRNA transfer. A 5'-diphosphate form of antiviral ribavirin weakly inhibited the GpppA formation but did not act as a pRNA acceptor. These results indicate that the PRNTase domain has a unique guanosine-binding mode different from that of eukaryotic mRNA capping enzyme, guanylyltransferase. IMPORTANCE mRNAs of nonsegmented negative-strand (NNS) RNA viruses, such as VSV, possess a fully methylated cap structure, which is required for mRNA stability, efficient translation, and evasion of antiviral innate immunity in host cells. GDP polyribonucleotidyltransferase (PRNTase) is an unconventional mRNA capping enzyme of NNS RNA viruses that is distinct from the eukaryotic mRNA capping enzyme, guanylyltransferase. In this study, we studied the pRNA acceptor specificity of VSV PRNTase using various GDP analogues and identified chemical groups of GDP as

Characterization of the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast

Energy Technology Data Exchange (ETDEWEB)

Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan); Tani, Tokio, E-mail: ttani@sci.kumamoto-u.ac.jp [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan)

2012-02-03

Highlights: Black-Right-Pointing-Pointer We cloned the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast. Black-Right-Pointing-Pointer The ptr5{sup +} gene was found to encode nucleoporin 85 (Nup85). Black-Right-Pointing-Pointer Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. Black-Right-Pointing-Pointer Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. Black-Right-Pointing-Pointer Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A){sup +} RNA transport] 1 to 11, which accumulate poly(A){sup +} RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5-1 mutant shows dots- or a ring-like accumulation of poly(A){sup +} RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5{sup +} gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5-1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5-1 mutation. In addition, we found that the ptr5-1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5-1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.

The transcriptional response of Drosophila melanogaster to infection with the sigma virus (Rhabdoviridae.

Directory of Open Access Journals (Sweden)

Jennifer Carpenter

2009-08-01

Full Text Available Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae that occurs in wild populations of D. melanogaster.We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females.These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus.

The transcriptional response of Drosophila melanogaster to infection with the sigma virus (Rhabdoviridae).

Science.gov (United States)

Carpenter, Jennifer; Hutter, Stephan; Baines, John F; Roller, Julia; Saminadin-Peter, Sarah S; Parsch, John; Jiggins, Francis M

2009-08-31

Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae) that occurs in wild populations of D. melanogaster. We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females. These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus.

The Transcriptional Response of Drosophila melanogaster to Infection with the Sigma Virus (Rhabdoviridae)

Science.gov (United States)

Baines, John F.; Roller, Julia; Saminadin-Peter, Sarah S.; Parsch, John; Jiggins, Francis M.

2009-01-01

Background Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae) that occurs in wild populations of D. melanogaster. Principal Findings We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females. Conclusions These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus. PMID:19718442

Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

Directory of Open Access Journals (Sweden)

Kazuho Nishimura

2015-03-01

Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

RNA-dependent RNA polymerase of hepatitis C virus binds to its coding region RNA stem-loop structure, 5BSL3.2, and its negative strand.

Science.gov (United States)

Kanamori, Hiroshi; Yuhashi, Kazuhito; Ohnishi, Shin; Koike, Kazuhiko; Kodama, Tatsuhiko

2010-05-01

The hepatitis C virus NS5B RNA-dependent RNA polymerase (RdRp) is a key enzyme involved in viral replication. Interaction between NS5B RdRp and the viral RNA sequence is likely to be an important step in viral RNA replication. The C-terminal half of the NS5B-coding sequence, which contains the important cis-acting replication element, has been identified as an NS5B-binding sequence. In the present study, we confirm the specific binding of NS5B to one of the RNA stem-loop structures in the region, 5BSL3.2. In addition, we show that NS5B binds to the complementary strand of 5BSL3.2 (5BSL3.2N). The bulge structure of 5BSL3.2N was shown to be indispensable for tight binding to NS5B. In vitro RdRp activity was inhibited by 5BSL3.2N, indicating the importance of the RNA element in the polymerization by RdRp. These results suggest the involvement of the RNA stem-loop structure of the negative strand in the replication process.

Acetylcholine receptors and cholinergic ligands: biochemical and genetic aspects in Torpedo californica and Drosophila melanogaster

International Nuclear Information System (INIS)

Rosenthal, L.S.

1987-01-01

This study evaluates the biochemical and genetic aspects of the acetylcholine receptor proteins and cholinergic ligands in Drosophila melanogaster and Torpedo californica. Included are (1) a comparative study of nicotinic ligand-induced cation release from acetylcholine receptors isolated from Torpedo californica and from Drosophila melanogaster, (2) solution studies of the cholinergic ligands, nikethamide and ethamivan, aimed at measuring internal molecular rotational barriers in solvents of different polarity; and (3) the isolation and characterization of the gene(s) for the acetylcholine receptor in Drosophila melasogaster. Acetylcholine receptor proteins isolated from Drosphila melanogaster heads were found to behave kinetically similar (with regards to cholinergic ligand-induced 155 Eu: 3+ displacement from prelabeled proteins) to receptor proteins isolated from Torpedo californica electric tissue, providing additional biochemical evidence for the existence of a Drosophila acetylcholine receptor

Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

Science.gov (United States)

Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

2014-12-16

5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

The novel HSV-1 US5-1 RNA is transcribed off a domain encoding US 5, US 4, US 3, US 2 and α22

Directory of Open Access Journals (Sweden)

Roizman Bernard

2010-05-01

Full Text Available Abstract Background The genome of herpes simplex virus 1 encodes at least 84 transcripts from which proteins are translated and several additional RNAs whose status as mRNAs is unknown. These RNAs include latency-associated transcript, OriS1 and OriS2 RNAs and in case of α4 null mutant additional transcript that spans the junction between L and S component of the HSV-1 genome. Current data do not suggest that a peptide is translated from these RNAs. Results We describe here a novel RNA designated US5-1 that spans 4.5 kb of the unique-short (US region. The RNA initiates in US5 and terminates in the α22 open reading frame. It is expressed antisense to US5, US4, US3 and ICP22 mRNAs. This transcript is expressed with γ2 kinetics and has a half-life of 80 minutes. Conclusion These results identify a novel transcript encoded within HSV-1 genome. Since no major hypothetical open-reading frames are present in this transcript it is feasible that this RNA exerts its function as a non-coding RNA.

allele of the noncoding hsrω gene of Drosophila melanogaster is not ...

Indian Academy of Sciences (India)

, Martinez P. et al. 2000 Identification of genes that modify ataxin-1-induced neurodegeneration. Nature 408, 101–. 106. Lakhotia S. C. 2003 The non-coding, developmentally active and stress inducible hsrω gene of Drosophila melanogaster ...

Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9.

Science.gov (United States)

Ren, Xingjie; Sun, Jin; Housden, Benjamin E; Hu, Yanhui; Roesel, Charles; Lin, Shuailiang; Liu, Lu-Ping; Yang, Zhihao; Mao, Decai; Sun, Lingzhu; Wu, Qujie; Ji, Jun-Yuan; Xi, Jianzhong; Mohr, Stephanie E; Xu, Jiang; Perrimon, Norbert; Ni, Jian-Quan

2013-11-19

The ability to engineer genomes in a specific, systematic, and cost-effective way is critical for functional genomic studies. Recent advances using the CRISPR-associated single-guide RNA system (Cas9/sgRNA) illustrate the potential of this simple system for genome engineering in a number of organisms. Here we report an effective and inexpensive method for genome DNA editing in Drosophila melanogaster whereby plasmid DNAs encoding short sgRNAs under the control of the U6b promoter are injected into transgenic flies in which Cas9 is specifically expressed in the germ line via the nanos promoter. We evaluate the off-targets associated with the method and establish a Web-based resource, along with a searchable, genome-wide database of predicted sgRNAs appropriate for genome engineering in flies. Finally, we discuss the advantages of our method in comparison with other recently published approaches.

Cytochrome P450-Dependent Metabolism of Caffeine in Drosophila melanogaster

Science.gov (United States)

Coelho, Alexandra; Fraichard, Stephane; Le Goff, Gaëlle; Faure, Philippe; Artur, Yves; Ferveur, Jean-François; Heydel, Jean-Marie

2015-01-01

Caffeine (1, 3, 7-trimethylxanthine), an alkaloid produced by plants, has antioxidant and insecticide properties that can affect metabolism and cognition. In vertebrates, the metabolites derived from caffeine have been identified, and their functions have been characterized. However, the metabolites of caffeine in insects remain unknown. Thus, using radiolabelled caffeine, we have identified some of the primary caffeine metabolites produced in the body of Drosophila melanogaster males, including theobromine, paraxanthine and theophylline. In contrast to mammals, theobromine was the predominant metabolite (paraxanthine in humans; theophylline in monkeys; 1, 3, 7-trimethyluric acid in rodents). A transcriptomic screen of Drosophila flies exposed to caffeine revealed the coordinated variation of a large set of genes that encode xenobiotic-metabolizing proteins, including several cytochromes P450s (CYPs) that were highly overexpressed. Flies treated with metyrapone—an inhibitor of CYP enzymes—showed dramatically decreased caffeine metabolism, indicating that CYPs are involved in this process. Using interference RNA genetic silencing, we measured the metabolic and transcriptomic effect of three candidate CYPs. Silencing of CYP6d5 completely abolished theobromine synthesis, whereas CYP6a8 and CYP12d1 silencing induced different consequences on metabolism and gene expression. Therefore, we characterized several metabolic products and some enzymes potentially involved in the degradation of caffeine. In conclusion, this pioneer approach to caffeine metabolism in insects opens novel perspectives for the investigation of the physiological effects of caffeine metabolites. It also indicates that caffeine could be used as a biomarker to evaluate CYP phenotypes in Drosophila and other insects. PMID:25671424

Cytochrome P450-dependent metabolism of caffeine in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Alexandra Coelho

Full Text Available Caffeine (1, 3, 7-trimethylxanthine, an alkaloid produced by plants, has antioxidant and insecticide properties that can affect metabolism and cognition. In vertebrates, the metabolites derived from caffeine have been identified, and their functions have been characterized. However, the metabolites of caffeine in insects remain unknown. Thus, using radiolabelled caffeine, we have identified some of the primary caffeine metabolites produced in the body of Drosophila melanogaster males, including theobromine, paraxanthine and theophylline. In contrast to mammals, theobromine was the predominant metabolite (paraxanthine in humans; theophylline in monkeys; 1, 3, 7-trimethyluric acid in rodents. A transcriptomic screen of Drosophila flies exposed to caffeine revealed the coordinated variation of a large set of genes that encode xenobiotic-metabolizing proteins, including several cytochromes P450s (CYPs that were highly overexpressed. Flies treated with metyrapone--an inhibitor of CYP enzymes--showed dramatically decreased caffeine metabolism, indicating that CYPs are involved in this process. Using interference RNA genetic silencing, we measured the metabolic and transcriptomic effect of three candidate CYPs. Silencing of CYP6d5 completely abolished theobromine synthesis, whereas CYP6a8 and CYP12d1 silencing induced different consequences on metabolism and gene expression. Therefore, we characterized several metabolic products and some enzymes potentially involved in the degradation of caffeine. In conclusion, this pioneer approach to caffeine metabolism in insects opens novel perspectives for the investigation of the physiological effects of caffeine metabolites. It also indicates that caffeine could be used as a biomarker to evaluate CYP phenotypes in Drosophila and other insects.

Cerebral Innate Immunity in Drosophila Melanogaster

Directory of Open Access Journals (Sweden)

Brian P. Leung

2015-03-01

Full Text Available Modeling innate immunity in Drosophila melanogaster has a rich history that includes ground-breaking discoveries in pathogen detection and signaling. These studies revealed the evolutionary conservation of innate immune pathways and mechanisms of pathogen detection, resulting in an explosion of findings in the innate immunity field. In D. melanogaster, studies have focused primarily on responses driven by the larval fat body and hemocytes, analogs to vertebrate liver and macrophages, respectively. Aside from pathogen detection, many recent mammalian studies associate innate immune pathways with development and disease pathogenesis. Importantly, these studies stress that the innate immune response is integral to maintain central nervous system (CNS health. Microglia, which are the vertebrate CNS mononuclear phagocytes, drive vertebrate cerebral innate immunity. The invertebrate CNS contains microglial-like cells-ensheathing glia and reticular glia-that could be used to answer basic questions regarding the evolutionarily conserved innate immune processes in CNS development and health. A deeper understanding of the relationship between D. melanogaster phagocytic microglial-like cells and vertebrate microglia will be key to answering basic and translational questions related to cerebral innate immunity.

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

OpenAIRE

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-01-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...

Intrinsic resistance to aminoglycosides in Enterococcus faecium is conferred by the 16S rRNA m5C1404-specific methyltransferase EfmM

DEFF Research Database (Denmark)

Galimand, Marc; Schmitt, Emmanuelle; Panvert, Michel

2011-01-01

methyltransferase, as well as by the previously characterized aac(6')-Ii that encodes a 6'-N-aminoglycoside acetyltransferase. Inactivation of efmM in E. faecium increases susceptibility to the aminoglycosides kanamycin and tobramycin, and, conversely, expression of a recombinant version of efmM in Escherichia coli...... confers resistance to these drugs. The EfmM protein shows significant sequence similarity to E. coli RsmF (previously called YebU), which is a 5-methylcytidine (m(5)C) methyltransferase modifying 16S rRNA nucleotide C1407. The target for EfmM is shown by mass spectrometry to be a neighboring 16S r...

Comparison of traditional phenotypic identification methods with partial 5' 16S rRNA gene sequencing for species-level identification of nonfermenting Gram-negative bacilli.

Science.gov (United States)

Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander

2010-04-01

Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.

Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

Science.gov (United States)

Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

2015-03-03

The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

RNA editing in Drosophila melanogaster: new targets and functionalconsequences

Energy Technology Data Exchange (ETDEWEB)

Stapleton, Mark; Carlson, Joseph W.; Celniker, Susan E.

2006-09-05

Adenosine deaminases that act on RNA (ADARs) catalyze the site-specific conversion of adenosine to inosine in primary mRNA transcripts. These re-coding events affect coding potential, splice-sites, and stability of mature mRNAs. ADAR is an essential gene and studies in mouse, C. elegans, and Drosophila suggest its primary function is to modify adult behavior by altering signaling components in the nervous system. By comparing the sequence of isogenic cDNAs to genomic DNA, we have identified and experimentally verified 27 new targets of Drosophila ADAR. Our analyses lead us to identify new classes of genes whose transcripts are targets of ADAR including components of the actin cytoskeleton, and genes involved in ion homeostasis and signal transduction. Our results indicate that editing in Drosophila increases the diversity of the proteome, and does so in a manner that has direct functional consequences on protein function.

5′-Phospho-RNA Acceptor Specificity of GDP Polyribonucleotidyltransferase of Vesicular Stomatitis Virus in mRNA Capping

Science.gov (United States)

Ogino, Minako

2017-01-01

ABSTRACT The GDP polyribonucleotidyltransferase (PRNTase) domain of the multifunctional L protein of rhabdoviruses, such as vesicular stomatitis virus (VSV) and rabies virus, catalyzes the transfer of 5′-phospho-RNA (pRNA) from 5′-triphospho-RNA (pppRNA) to GDP via a covalent enzyme-pRNA intermediate to generate a 5′-cap structure (GpppA). Here, using an improved oligo-RNA capping assay with the VSV L protein, we showed that the Michaelis constants for GDP and pppAACAG (VSV mRNA-start sequence) are 0.03 and 0.4 μM, respectively. A competition assay between GDP and GDP analogues in the GpppA formation and pRNA transfer assay using GDP analogues as pRNA acceptors indicated that the PRNTase domain recognizes the C-2-amino group, but not the C-6-oxo group, N-1-hydrogen, or N-7-nitrogen, of GDP for the cap formation. 2,6-Diaminopurine-riboside (DAP), 7-deazaguanosine (7-deaza-G), and 7-methylguanosine (m7G) diphosphates efficiently accepted pRNA, resulting in the formation of DAPpppA, 7-deaza-GpppA, and m7GpppA (cap 0), respectively. Furthermore, either the 2′- or 3′-hydroxyl group of GDP was found to be required for efficient pRNA transfer. A 5′-diphosphate form of antiviral ribavirin weakly inhibited the GpppA formation but did not act as a pRNA acceptor. These results indicate that the PRNTase domain has a unique guanosine-binding mode different from that of eukaryotic mRNA capping enzyme, guanylyltransferase. IMPORTANCE mRNAs of nonsegmented negative-strand (NNS) RNA viruses, such as VSV, possess a fully methylated cap structure, which is required for mRNA stability, efficient translation, and evasion of antiviral innate immunity in host cells. GDP polyribonucleotidyltransferase (PRNTase) is an unconventional mRNA capping enzyme of NNS RNA viruses that is distinct from the eukaryotic mRNA capping enzyme, guanylyltransferase. In this study, we studied the pRNA acceptor specificity of VSV PRNTase using various GDP analogues and identified chemical groups

ADAR RNA editing below the backbone.

Science.gov (United States)

Keegan, Liam; Khan, Anzer; Vukic, Dragana; O'Connell, Mary

2017-09-01

ADAR RNA editing enzymes ( a denosine d e a minases acting on R NA) that convert adenosine bases to inosines were first identified biochemically 30 years ago. Since then, studies on ADARs in genetic model organisms, and evolutionary comparisons between them, continue to reveal a surprising range of pleiotropic biological effects of ADARs. This review focuses on Drosophila melanogaster , which has a single Adar gene encoding a homolog of vertebrate ADAR2 that site-specifically edits hundreds of transcripts to change individual codons in ion channel subunits and membrane and cytoskeletal proteins. Drosophila ADAR is involved in the control of neuronal excitability and neurodegeneration and, intriguingly, in the control of neuronal plasticity and sleep. Drosophila ADAR also interacts strongly with RNA interference, a key antiviral defense mechanism in invertebrates. Recent crystal structures of human ADAR2 deaminase domain-RNA complexes help to interpret available information on Drosophila ADAR isoforms and on the evolution of ADARs from tRNA deaminase ADAT proteins. ADAR RNA editing is a paradigm for the now rapidly expanding range of RNA modifications in mRNAs and ncRNAs. Even with recent progress, much remains to be understood about these groundbreaking ADAR RNA modification systems. © 2017 Keegan et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

The novel sRNA s015 improves nisin yield by increasing acid tolerance of Lactococcus lactis F44.

Science.gov (United States)

Qi, Jiakun; Caiyin, Qinggele; Wu, Hao; Tian, Kairen; Wang, Binbin; Li, Yanni; Qiao, Jianjun

2017-08-01

Nisin, a polycyclic antibacterial peptide produced by Lactococcus lactis, is stable at low pH. Improving the acid tolerance of L. lactis could thus enhance nisin yield. Small non-coding RNAs (sRNAs) play essential roles in acid tolerance by regulating their target mRNAs at the post-transcriptional level. In this study, a novel sRNA, s015, was identified in L. lactis F44 via the use of RNA sequencing, qRT-PCR analysis, and Northern blotting. s015 improved the acid tolerance of L. lactis and boosted nisin yield at low pH. In silico predictions enabled us to construct a library of possible s015 target mRNAs. Statistical analysis and validation suggested that s015 contains a highly conserved region (5'-GAAAAAAAC-3') that likely encompasses the regulatory core of the sRNA. atpG, busAB, cysD, ilvB, tcsR, ung, yudD, and ywdA were verified as direct targets of s015, and the interactions between s015 and its target genes were elucidated. This work provided new insight into the adaptation mechanism of L. lactis under acid stress.

5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

Science.gov (United States)

Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

1989-01-01

The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

CoLIde: a bioinformatics tool for CO-expression-based small RNA Loci Identification using high-throughput sequencing data.

Science.gov (United States)

Mohorianu, Irina; Stocks, Matthew Benedict; Wood, John; Dalmay, Tamas; Moulton, Vincent

2013-07-01

Small RNAs (sRNAs) are 20-25 nt non-coding RNAs that act as guides for the highly sequence-specific regulatory mechanism known as RNA silencing. Due to the recent increase in sequencing depth, a highly complex and diverse population of sRNAs in both plants and animals has been revealed. However, the exponential increase in sequencing data has also made the identification of individual sRNA transcripts corresponding to biological units (sRNA loci) more challenging when based exclusively on the genomic location of the constituent sRNAs, hindering existing approaches to identify sRNA loci. To infer the location of significant biological units, we propose an approach for sRNA loci detection called CoLIde (Co-expression based sRNA Loci Identification) that combines genomic location with the analysis of other information such as variation in expression levels (expression pattern) and size class distribution. For CoLIde, we define a locus as a union of regions sharing the same pattern and located in close proximity on the genome. Biological relevance, detected through the analysis of size class distribution, is also calculated for each locus. CoLIde can be applied on ordered (e.g., time-dependent) or un-ordered (e.g., organ, mutant) series of samples both with or without biological/technical replicates. The method reliably identifies known types of loci and shows improved performance on sequencing data from both plants (e.g., A. thaliana, S. lycopersicum) and animals (e.g., D. melanogaster) when compared with existing locus detection techniques. CoLIde is available for use within the UEA Small RNA Workbench which can be downloaded from: http://srna-workbench.cmp.uea.ac.uk.

40 CFR 798.5955 - Heritable translocation test in drosophila melanogaster.

Science.gov (United States)

2010-07-01

... drosophila melanogaster. 798.5955 Section 798.5955 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY....5955 Heritable translocation test in drosophila melanogaster. (a) Purpose. The heritable translocation test in Drosophila measures the induction of chromosomal translocations in germ cells of insects...

Effect of curcumin on aged Drosophila melanogaster: a pathway prediction analysis.

Science.gov (United States)

Zhang, Zhi-guo; Niu, Xu-yan; Lu, Ai-ping; Xiao, Gary Guishan

2015-02-01

To re-analyze the data published in order to explore plausible biological pathways that can be used to explain the anti-aging effect of curcumin. Microarray data generated from other study aiming to investigate effect of curcumin on extending lifespan of Drosophila melanogaster were further used for pathway prediction analysis. The differentially expressed genes were identified by using GeneSpring GX with a criterion of 3.0-fold change. Two Cytoscape plugins including BisoGenet and molecular complex detection (MCODE) were used to establish the protein-protein interaction (PPI) network based upon differential genes in order to detect highly connected regions. The function annotation clustering tool of Database for Annotation, Visualization and Integrated Discovery (DAVID) was used for pathway analysis. A total of 87 genes expressed differentially in D. melanogaster melanogaster treated with curcumin were identified, among which 50 were up-regulated significantly and 37 were remarkably down-regulated in D. melanogaster melanogaster treated with curcumin. Based upon these differential genes, PPI network was constructed with 1,082 nodes and 2,412 edges. Five highly connected regions in PPI networks were detected by MCODE algorithm, suggesting anti-aging effect of curcumin may be underlined through five different pathways including Notch signaling pathway, basal transcription factors, cell cycle regulation, ribosome, Wnt signaling pathway, and p53 pathway. Genes and their associated pathways in D. melanogaster melanogaster treated with anti-aging agent curcumin were identified using PPI network and MCODE algorithm, suggesting that curcumin may be developed as an alternative therapeutic medicine for treating aging-associated diseases.

Structure of glutaminyl cyclase from Drosophila melanogaster in space group I4

Czech Academy of Sciences Publication Activity Database

Kolenko, Petr; Koch, B.; Rahfeld, J.-U.; Schilling, S.; Demuth, H.-U.; Stubbs, M. T.

2013-01-01

Roč. 69, č. 4 (2013), s. 358-361 ISSN 1744-3091 R&D Projects: GA MŠk EE2.3.30.0029 Institutional support: RVO:61389013 Keywords : glutaminyl cyclases * Drosophila melanogaster * soaking Subject RIV: CE - Biochemistry Impact factor: 0.568, year: 2013

3'-5' RNA degradation pathways in human cells

DEFF Research Database (Denmark)

Lubas, Michal Szymon

RNA synthesis and degradation are key steps in the regulation of gene expression in all living organisms. During the course of his PhD studies, Michal Lubas centred his research on the nuclear and cytoplasmic RNA turnover of both noncoding and coding RNAs in human cells. His proteomic studies...... revealed the interaction network of the main 3'-5' RNA degradation machinery – the RNA exosome complex. One of the key findings was the identification and characterisation of the Nuclear Exosome Targeting (NEXT) complex, important for nuclear functions of the exosome. Michal Lubas also studied the role...

A viral microRNA down-regulates multiple cell cycle genes through mRNA 5'UTRs.

Directory of Open Access Journals (Sweden)

Finn Grey

2010-06-01

Full Text Available Global gene expression data combined with bioinformatic analysis provides strong evidence that mammalian miRNAs mediate repression of gene expression primarily through binding sites within the 3' untranslated region (UTR. Using RNA induced silencing complex immunoprecipitation (RISC-IP techniques we have identified multiple cellular targets for a human cytomegalovirus (HCMV miRNA, miR-US25-1. Strikingly, this miRNA binds target sites primarily within 5'UTRs, mediating significant reduction in gene expression. Intriguingly, many of the genes targeted by miR-US25-1 are associated with cell cycle control, including cyclin E2, BRCC3, EID1, MAPRE2, and CD147, suggesting that miR-US25-1 is targeting genes within a related pathway. Deletion of miR-US25-1 from HCMV results in over expression of cyclin E2 in the context of viral infection. Our studies demonstrate that a viral miRNA mediates translational repression of multiple cellular genes by targeting mRNA 5'UTRs.

Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

Science.gov (United States)

Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

2016-03-01

The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.

Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

Czech Academy of Sciences Publication Activity Database

Garcia, S.; Kovařík, Aleš

2013-01-01

Roč. 111, č. 1 (2013), s. 23-33 ISSN 0018-067X R&D Projects: GA ČR(CZ) GA13-10057S; GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : rRNA gene organisation * intergenic spacer * Ginkgo Subject RIV: BO - Biophysics Impact factor: 3.804, year: 2013

Transfection of Chinese hamster ovary DHFR/sup -/ cells with the gene coding for heat shock protein 70 from drosophila melanogaster

International Nuclear Information System (INIS)

Duffy, J.J.; Carper, S.W.; Gerner, E.W.

1987-01-01

Chinese hamster ovary DHFR/sup -/ cells (CHO-DHFR/sup -/) were transfected with the plasmid pSV2-dhfr expressing the mouse gene coding for dhfr or with the same plasmid containing the gene coding for the Drosophila melanogaster heat shock protein 70 (hsp70), pSVd-hsp70. Three subcloned cell lines selected for expression of the dhfr gene were shown to contain either the vector sequence (G cells) or varying copies of pSVd-hsp70 (H cells). One line of H cells was shown to contain > 30 copies of the D. melanogaster hsp70 gene and to express the hsp70 RNA at significant levels. No difference between G and H cells was observed in the rate of growth, in the development of thermotolerance, or in the sensitivity of actin microfilament bundles to heat shock. However, H cells containing the transfected hsp70 gene had an altered morphology when compared to the G cells and the parental CHO-DHFR/sup -/ cells being more fibroblastic. The adhesion properties of the H cells was also decreased when compared to the G cells. These results show that insertion of the D. melanogaster gene into CHO cells does not effect growth rates or heat shock responses but may alter cell morphology and adhesion

Phosphorylation of NS5A Serine-235 is essential to hepatitis C virus RNA replication and normal replication compartment formation

Energy Technology Data Exchange (ETDEWEB)

Eyre, Nicholas S., E-mail: nicholas.eyre@adelaide.edu.au [School of Biological Sciences and Research Centre for Infectious Diseases, University of Adelaide, Adelaide (Australia); Centre for Cancer Biology, SA Pathology, Adelaide (Australia); Hampton-Smith, Rachel J.; Aloia, Amanda L. [School of Biological Sciences and Research Centre for Infectious Diseases, University of Adelaide, Adelaide (Australia); Centre for Cancer Biology, SA Pathology, Adelaide (Australia); Eddes, James S. [Adelaide Proteomics Centre, School of Biological Sciences, University of Adelaide, Adelaide (Australia); Simpson, Kaylene J. [Victorian Centre for Functional Genomics, Peter MacCallum Cancer Centre, East Melbourne (Australia); The Sir Peter MacCallum Department of Oncology, University of Melbourne, Parkville (Australia); Hoffmann, Peter [Adelaide Proteomics Centre, School of Biological Sciences, University of Adelaide, Adelaide (Australia); Institute for Photonics and Advanced Sensing (IPAS), University of Adelaide, Adelaide (Australia); Beard, Michael R. [School of Biological Sciences and Research Centre for Infectious Diseases, University of Adelaide, Adelaide (Australia); Centre for Cancer Biology, SA Pathology, Adelaide (Australia)

2016-04-15

Hepatitis C virus (HCV) NS5A protein is essential for HCV RNA replication and virus assembly. Here we report the identification of NS5A phosphorylation sites Ser-222, Ser-235 and Thr-348 during an infectious HCV replication cycle and demonstrate that Ser-235 phosphorylation is essential for HCV RNA replication. Confocal microscopy revealed that both phosphoablatant (S235A) and phosphomimetic (S235D) mutants redistribute NS5A to large juxta-nuclear foci that display altered colocalization with known replication complex components. Using electron microscopy (EM) we found that S235D alters virus-induced membrane rearrangements while EM using ‘APEX2’-tagged viruses demonstrated S235D-mediated enrichment of NS5A in irregular membranous foci. Finally, using a customized siRNA screen of candidate NS5A kinases and subsequent analysis using a phospho-specific antibody, we show that phosphatidylinositol-4 kinase III alpha (PI4KIIIα) is important for Ser-235 phosphorylation. We conclude that Ser-235 phosphorylation of NS5A is essential for HCV RNA replication and normal replication complex formation and is regulated by PI4KIIIα. - Highlights: • NS5A residues Ser-222, Ser-235 and Thr-348 are phosphorylated during HCV infection. • Phosphorylation of Ser-235 is essential to HCV RNA replication. • Mutation of Ser-235 alters replication compartment localization and morphology. • Phosphatidylinositol-4 kinase III alpha is important for Ser-235 phosphorylation.

LNA-modified oligonucleotides mediate specific inhibition of microRNA function

DEFF Research Database (Denmark)

Ørom, Ulf Andersson; Kauppinen, Sakari; Lund, Anders H

2006-01-01

microRNAs are short, endogenous non-coding RNAs that act as post-transcriptional modulators of gene expression. Important functions for microRNAs have been found in the regulation of development, cellular proliferation and differentiation, while perturbed miRNA expression patterns have been...... observed in many human cancers. Here we present a method for specific inhibition of miRNA function through interaction with LNA-modified antisense oligonucleotides and report the specificity of this application. We show that LNA-modified oligonucleotides can inhibit exogenously introduced miRNAs with high...... specificity using a heterologous reporter assay, and furthermore demonstrate their ability to inhibit an endogenous miRNA in Drosophila melanogaster cells, leading to up-regulation of the cognate target protein. The method shows stoichiometric and reliable inhibition of the targeted miRNA and can thus...

The RNA 5 of Prunus necrotic ringspot virus is a biologically inactive copy of the 3'-UTR of the genomic RNA 3.

Science.gov (United States)

Di Terlizzi, B; Skrzeczkowski, L J; Mink, G I; Scott, S W; Zimmerman, M T

2001-01-01

In addition to the four RNAs known to be encapsidated by Prunus necrotic ringspot virus (PNRSV) and Apple mosaic virus (ApMV), an additional small RNA (RNA 5) was present in purified preparations of several isolates of both viruses. RNA 5 was always produced following infection of a susceptible host by an artificial mixture of RNAs 1, 2, 3, and 4 indicating that it was a product of viral replication. RNA 5 does not activate the infectivity of mixtures that contain the three genomic RNAs (RNA 1 + RNA 2 + RNA 3) nor does it appear to modify symptom expression. Results from hybridization studies suggested that RNA 5 had partial sequence homology with RNAs 1, 2, 3, and 4. Cloning and sequencing the RNA 5 of isolate CH 57/1-M of PNRSV, and the 3' termini of the RNA 1, RNA 2 and RNA 3 of this isolate indicated that it was a copy of the 3' untranslated terminal region (3'-UTR) of the genomic RNA 3.

Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

DEFF Research Database (Denmark)

Dam, M; Douthwaite, S; Tenson, T

1996-01-01

Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore......, the erythromycin resistance determinant in the mutants was shown to be confined to a small 23 S rRNA segment containing the coding region and the ribosome binding site of the E-peptide open reading frame. It thus appears that the domain II mutations mediate erythromycin resistance by increasing expression...

Drosophila melanogaster as a High-Throughput Model for Host–Microbiota Interactions

Directory of Open Access Journals (Sweden)

Gregor Reid

2017-04-01

Full Text Available Microbiota research often assumes that differences in abundance and identity of microorganisms have unique influences on host physiology. To test this concept mechanistically, germ-free mice are colonized with microbial communities to assess causation. Due to the cost, infrastructure challenges, and time-consuming nature of germ-free mouse models, an alternative approach is needed to investigate host–microbial interactions. Drosophila melanogaster (fruit flies can be used as a high throughput in vivo screening model of host–microbiome interactions as they are affordable, convenient, and replicable. D. melanogaster were essential in discovering components of the innate immune response to pathogens. However, axenic D. melanogaster can easily be generated for microbiome studies without the need for ethical considerations. The simplified microbiota structure enables researchers to evaluate permutations of how each microbial species within the microbiota contribute to host phenotypes of interest. This enables the possibility of thorough strain-level analysis of host and microbial properties relevant to physiological outcomes. Moreover, a wide range of mutant D. melanogaster strains can be affordably obtained from public stock centers. Given this, D. melanogaster can be used to identify candidate mechanisms of host–microbe symbioses relevant to pathogen exclusion, innate immunity modulation, diet, xenobiotics, and probiotic/prebiotic properties in a high throughput manner. This perspective comments on the most promising areas of microbiota research that could immediately benefit from using the D. melanogaster model.

Drosophila melanogaster as a High-Throughput Model for Host-Microbiota Interactions.

Science.gov (United States)

Trinder, Mark; Daisley, Brendan A; Dube, Josh S; Reid, Gregor

2017-01-01

Microbiota research often assumes that differences in abundance and identity of microorganisms have unique influences on host physiology. To test this concept mechanistically, germ-free mice are colonized with microbial communities to assess causation. Due to the cost, infrastructure challenges, and time-consuming nature of germ-free mouse models, an alternative approach is needed to investigate host-microbial interactions. Drosophila melanogaster (fruit flies) can be used as a high throughput in vivo screening model of host-microbiome interactions as they are affordable, convenient, and replicable. D. melanogaster were essential in discovering components of the innate immune response to pathogens. However, axenic D. melanogaster can easily be generated for microbiome studies without the need for ethical considerations. The simplified microbiota structure enables researchers to evaluate permutations of how each microbial species within the microbiota contribute to host phenotypes of interest. This enables the possibility of thorough strain-level analysis of host and microbial properties relevant to physiological outcomes. Moreover, a wide range of mutant D. melanogaster strains can be affordably obtained from public stock centers. Given this, D. melanogaster can be used to identify candidate mechanisms of host-microbe symbioses relevant to pathogen exclusion, innate immunity modulation, diet, xenobiotics, and probiotic/prebiotic properties in a high throughput manner. This perspective comments on the most promising areas of microbiota research that could immediately benefit from using the D. melanogaster model.

Drosophila melanogaster Meigen: 3. sensibilidade ao carbofuran e biomonitoramento de seus resíduos em repolho Drosophila melanogaster Meigen: 3. susceptibility to carbofuran and biomonitoring of its residues in cabbage

Directory of Open Access Journals (Sweden)

Garcia Rodrigues de Almeida

2001-12-01

Full Text Available The susceptibility of Drosophila melanogaster to carbofuran and the use of this organism in biomonitoring residues of the insecticide in cabbage was evaluated. Under the conditions of the bioassay, residues-film bioassay in Petri dish, carbofuran degraded depending on the temperature and time of exposure. Bioassays conducted with D. melanogaster showed that its toxicity increases with temperature (20 to 35 °C. LC50 values, calculated as a function of temperature, ranged from 3.6 to 10.5 mg/g body weight (bw for males and from 2.9 to 8.7 mg/g bw for females. The formulated product Furadan® G was applied on cabbage (Brassica oleracea, var. capitata and the residues of carbofuran were determined by bioassay. The determination limit of the bioassay was 0.1 mg/kg and the method presented reproducibility with coefficient variation of 17 %. The validation of the bioassay by high performance liquid chromatography confirms the viability of the bioassay with D. melanogaster in monitoring the residues of carbofuran in cabbage.

Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

Directory of Open Access Journals (Sweden)

Hiraku Takada

Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

Drosophila melanogaster cellular repressor of E1A-stimulated genes is a lysosomal protein essential for fly development

OpenAIRE

Kowalewski-Nimmerfall, Elisabeth; Sch?hs, Philipp; Maresch, Daniel; Rendic, Dubravko; Kr?mer, Helmut; Mach, Lukas

2014-01-01

Mammalian cellular repressor of E1A-stimulated genes is a lysosomal glycoprotein implicated in cellular growth and differentiation. The genome of the fruit fly Drosophila melanogaster encodes a putative orthologue (dCREG), suggesting evolutionarily conserved physiological functions of this protein. In D. melanogaster S2 cells, dCREG was found to localize in lysosomes. Further studies revealed that intracellular dCREG is subject of proteolytic maturation. Processing and turnover could be subst...

Essential loci in centromeric heterochromatin of Drosophila melanogaster. I: the right arm of chromosome 2.

Science.gov (United States)

Coulthard, Alistair B; Alm, Christina; Cealiac, Iulia; Sinclair, Don A; Honda, Barry M; Rossi, Fabrizio; Dimitri, Patrizio; Hilliker, Arthur J

2010-06-01

With the most recent releases of the Drosophila melanogaster genome sequences, much of the previously absent heterochromatic sequences have now been annotated. We undertook an extensive genetic analysis of existing lethal mutations, as well as molecular mapping and sequence analysis (using a candidate gene approach) to identify as many essential genes as possible in the centromeric heterochromatin on the right arm of the second chromosome (2Rh) of D. melanogaster. We also utilized available RNA interference lines to knock down the expression of genes in 2Rh as another approach to identifying essential genes. In total, we verified the existence of eight novel essential loci in 2Rh: CG17665, CG17683, CG17684, CG17883, CG40127, CG41265, CG42595, and Atf6. Two of these essential loci, CG41265 and CG42595, are synonymous with the previously characterized loci l(2)41Ab and unextended, respectively. The genetic and molecular analysis of the previously reported locus, l(2)41Ae, revealed that this is not a single locus, but rather it is a large region of 2Rh that extends from unextended (CG42595) to CG17665 and includes four of the novel loci uncovered here.

Ms1, a novel sRNA interacting with the RNA polymerase core in mycobacteria

Czech Academy of Sciences Publication Activity Database

Hnilicová, Jarmila; Jirát-Matějčková, Jitka; Šiková, Michaela; Pospíšil, Jiří; Halada, Petr; Pánek, Josef; Krásný, Libor

2014-01-01

Roč. 42, č. 18 (2014), s. 11763-11776 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GBP305/12/G034; GA ČR GP13-27150P Grant - others:Magistrát hl. m. P.(CZ) CZ.2.16/3.1.00/24023 Institutional support: RVO:61388971 Keywords : ESCHERICHIA-COLI * 6S RNA * NONCODING RNA Subject RIV: EE - Microbiology, Virology Impact factor: 9.112, year: 2014

Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

OpenAIRE

Kirpekar, F; Douthwaite, S; Roepstorff, P

2000-01-01

We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of post...

The DEAD-Box RNA Helicase DDX3 Interacts with m6A RNA Demethylase ALKBH5

Directory of Open Access Journals (Sweden)

Abdullah Shah

2017-01-01

Full Text Available DDX3 is a member of the family of DEAD-box RNA helicases. DDX3 is a multifaceted helicase and plays essential roles in key biological processes such as cell cycle, stress response, apoptosis, and RNA metabolism. In this study, we found that DDX3 interacted with ALKBH5, an m6A RNA demethylase. The ATP domain of DDX3 and DSBH domain of ALKBH5 were indispensable to their interaction with each other. Furthermore, DDX3 could modulate the demethylation of mRNAs. We also showed that DDX3 regulated the methylation status of microRNAs and there was an interaction between DDX3 and AGO2. The dynamics of m6A RNA modification is still a field demanding further investigation, and here, we add a link by showing that RNA demethylation can be regulated by proteins such as DDX3.

Swing Boat: Inducing and Recording Locomotor Activity in a Drosophila melanogaster Model of Alzheimer’s Disease

Directory of Open Access Journals (Sweden)

Johannes Berlandi

2017-08-01

Full Text Available Recent studies indicate that physical activity can slow down progression of neurodegeneration in humans. To date, automated ways to induce activity have been predominantly described in rodent models. To study the impact of activity on behavior and survival in adult Drosophila melanogaster, we aimed to develop a rotating tube device “swing boat” which is capable of monitoring activity and sleep patterns as well as survival rates of flies. For the purpose of a first application, we tested our device on a transgenic fly model of Alzheimer’s disease (AD. Activity of flies was recorded in a climate chamber using the Drosophila Activity Monitoring (DAM System connected to data acquisition software. Locomotor activity was induced by a rotating tube device “swing boat” by repetitively tilting the tubes for 30 min per day. A non-exercising group of flies was used as control and activity and sleep patterns were obtained. The GAL4-/UAS system was used to drive pan-neuronal expression of human Aβ42 in flies. Immunohistochemical stainings for Aβ42 were performed on paraffin sections of adult fly brains. Daily rotation of the fly tubes evoked a pronounced peak of activity during the 30 min exercise period. Pan-neuronal expression of human Aβ42 in flies caused abnormalities in locomotor activity, reduction of life span and elevated sleep fragmentation in comparison to wild type flies. Furthermore, the formation of amyloid accumulations was observed in the adult fly brain. Gently induced activity over 12 days did not evoke prominent effects in wild type flies but resulted in prolongation of median survival time by 7 days (32.6% in Aβ42-expressing flies. Additionally, restoration of abnormally decreased night time sleep (10% and reduced sleep fragmentation (28% were observed compared to non-exercising Aβ42-expressing flies. On a structural level no prominent effects regarding prevalence of amyloid aggregations and Aβ42 RNA expression were

MDA5 Detects the Double-Stranded RNA Replicative Form in Picornavirus-Infected Cells

Directory of Open Access Journals (Sweden)

Qian Feng

2012-11-01

Full Text Available RIG-I and MDA5 are cytosolic RNA sensors that play a critical role in innate antiviral responses. Major advances have been made in identifying RIG-I ligands, but our knowledge of the ligands for MDA5 remains restricted to data from transfection experiments mostly using poly(I:C, a synthetic dsRNA mimic. Here, we dissected the IFN-α/β-stimulatory activity of different viral RNA species produced during picornavirus infection, both by RNA transfection and in infected cells in which specific steps of viral RNA replication were inhibited. Our results show that the incoming genomic plus-strand RNA does not activate MDA5, but minus-strand RNA synthesis and production of the 7.5 kbp replicative form trigger a strong IFN-α/β response. IFN-α/β production does not rely on plus-strand RNA synthesis and thus generation of the partially double-stranded replicative intermediate. This study reports MDA5 activation by a natural RNA ligand under physiological conditions.

Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends

Science.gov (United States)

2016-08-24

either protein ORIGINAL RESEARCH Toxin MqsR cleaves single- stranded mRNA with various 5’ ends Nityananda Chowdhury1,*, Brian W. Kwan1,*, Louise C...in which a single 5′- GCU site was predicted to be single- stranded (ssRNA), double- stranded (dsRNA), in the loop of a stem - loop (slRNA), or in a...single- stranded 5′- GCU sites since cleavage was approximately 20- fold higher than cleavage seen with the 5′- GCU site in the stem - loop and

sRNAnalyzer-a flexible and customizable small RNA sequencing data analysis pipeline.

Science.gov (United States)

Wu, Xiaogang; Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J; Wang, Kai

2017-12-01

Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline-sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Characterization of the regions from E. coli 16 S RNA covalently linked to ribosomal proteins S4 and S20 after ultraviolet irradiation

International Nuclear Information System (INIS)

Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.

1977-01-01

The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes

Drosophila melanogaster cellular repressor of E1A-stimulated genes is a lysosomal protein essential for fly development.

Science.gov (United States)

Kowalewski-Nimmerfall, Elisabeth; Schähs, Philipp; Maresch, Daniel; Rendic, Dubravko; Krämer, Helmut; Mach, Lukas

2014-12-01

Mammalian cellular repressor of E1A-stimulated genes is a lysosomal glycoprotein implicated in cellular growth and differentiation. The genome of the fruit fly Drosophila melanogaster encodes a putative orthologue (dCREG), suggesting evolutionarily conserved physiological functions of this protein. In D. melanogaster S2 cells, dCREG was found to localize in lysosomes. Further studies revealed that intracellular dCREG is subject of proteolytic maturation. Processing and turnover could be substantially reduced by RNAi-mediated silencing of cathepsin L. In contrast to mammalian cells, lysosomal delivery of dCREG does not depend on its carbohydrate moiety. Furthermore, depletion of the putative D. melanogaster lysosomal sorting receptor lysosomal enzyme receptor protein did not compromise cellular retention of dCREG. We also investigated the developmental consequences of dCREG ablation in whole D. melanogaster flies. Ubiquitous depletion of dCREG proved lethal at the late pupal stage once a knock-down efficiency of >95% was achieved. These results demonstrate that dCREG is essential for proper completion of fly development. Copyright © 2014. Published by Elsevier B.V.

Phenetic distances in the Drosophila melanogaster-subgroup species and oviposition-site preference for food components

NARCIS (Netherlands)

Bos, M.; Boerema, A.

1981-01-01

Oviposition-site preferences (O.S.P.) have been investigated in females of six sibling species of the Drosophila melanogaster subgroup. O.S.P. were determined for standard food components and yeast genotypes. Females of all species showed a strong preference for complete medium and avoidance of pure

Distribution of protein and RNA in the 30S ribosomal subunit

International Nuclear Information System (INIS)

Ramakrishnan, V.

1986-01-01

In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms

Neurogenetics of female reproductive behaviors in Drosophila melanogaster.

Science.gov (United States)

Laturney, Meghan; Billeter, Jean-Christophe

2014-01-01

We follow an adult Drosophila melanogaster female through the major reproductive decisions she makes during her lifetime, including habitat selection, precopulatory mate choice, postcopulatory physiological changes, polyandry, and egg-laying site selection. In the process, we review the molecular and neuronal mechanisms allowing females to integrate signals from both environmental and social sources to produce those behavioral outputs. We pay attention to how an understanding of D. melanogaster female reproductive behaviors contributes to a wider understanding of evolutionary processes such as pre- and postcopulatory sexual selection as well as sexual conflict. Within each section, we attempt to connect the theories that pertain to the evolution of female reproductive behaviors with the molecular and neurobiological data that support these theories. We draw attention to the fact that the evolutionary and mechanistic basis of female reproductive behaviors, even in a species as extensively studied as D. melanogaster, remains poorly understood. Copyright © 2014 Elsevier Inc. All rights reserved.

Base pairing and structural insights into the 5-formylcytosine in RNA duplex

Science.gov (United States)

Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

2016-01-01

Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

DEFF Research Database (Denmark)

Douthwaite, S; Garrett, R A

1981-01-01

The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

ADN ribosomique 5S chez Arabidopsis thaliana : dynamique chromatinienne et ARN polymérase IV

OpenAIRE

Douet , Julien

2008-01-01

In Arabidopsis thaliana, 5S rRNA genes are found clustered at pericentromeric heterochromatin of chromosomes 3, 4 and 5. 5S rRNA genes transcription is epigenetically regulated through the formation of specific chromatin structure. In order to determine the events that lead to the establishment of such structures, a study during the first steps of post-germinative plant development was done. Unexpectedly, we observed a decondensation followed by a rapid "re"condensation of 5S rDNA chromatin. ...

Cloning and identification of the gene coding for the 140-kd subunit of Drosophila RNA polymerase II

OpenAIRE

Faust, Daniela M.; Renkawitz-Pohl, Renate; Falkenburg, Dieter; Gasch, Alexander; Bialojan, Siegfried; Young, Richard A.; Bautz, Ekkehard K. F.

1986-01-01

Genomic clones of Drosophila melanogaster were isolated from a λ library by cross-hybridization with the yeast gene coding for the 150-kd subunit of RNA polymerase II. Clones containing a region of ∼2.0 kb with strong homology to the yeast gene were shown to code for a 3.9-kb poly(A)+-RNA. Part of the coding region was cloned into an expression vector. A fusion protein was obtained which reacted with an antibody directed against RNA polymerase II of Drosophila. Peptide mapping of the fusion p...

C6/36 Aedes albopictus cells have a dysfunctional antiviral RNA interference response.

Directory of Open Access Journals (Sweden)

Doug E Brackney

2010-10-01

Full Text Available Mosquitoes rely on RNA interference (RNAi as their primary defense against viral infections. To this end, the combination of RNAi and invertebrate cell culture systems has become an invaluable tool in studying virus-vector interactions. Nevertheless, a recent study failed to detect an active RNAi response to West Nile virus (WNV infection in C6/36 (Aedes albopictus cells, a mosquito cell line frequently used to study arthropod-borne viruses (arboviruses. Therefore, we sought to determine if WNV actively evades the host's RNAi response or if C6/36 cells have a dysfunctional RNAi pathway. C6/36 and Drosophila melanogaster S2 cells were infected with WNV (Flaviviridae, Sindbis virus (SINV, Togaviridae and La Crosse virus (LACV, Bunyaviridae and total RNA recovered from cell lysates. Small RNA (sRNA libraries were constructed and subjected to high-throughput sequencing. In S2 cells, virus-derived small interfering RNAs (viRNAs from all three viruses were predominantly 21 nt in length, a hallmark of the RNAi pathway. However, in C6/36 cells, viRNAs were primarily 17 nt in length from WNV infected cells and 26-27 nt in length in SINV and LACV infected cells. Furthermore, the origin (positive or negative viral strand and distribution (position along viral genome of S2 cell generated viRNA populations was consistent with previously published studies, but the profile of sRNAs isolated from C6/36 cells was altered. In total, these results suggest that C6/36 cells lack a functional antiviral RNAi response. These findings are analogous to the type-I interferon deficiency described in Vero (African green monkey kidney cells and suggest that C6/36 cells may fail to accurately model mosquito-arbovirus interactions at the molecular level.

HCV RNA traffic and association with NS5A in living cells

Energy Technology Data Exchange (ETDEWEB)

Fiches, Guillaume N.; Eyre, Nicholas S.; Aloia, Amanda L.; Van Der Hoek, Kylie [Department of Molecular and Cellular Biology, Research Centre for Infectious Diseases, University of Adelaide, Adelaide and Centre for Cancer Biology, SA Pathology, Adelaide, SA (Australia); Betz-Stablein, Brigit; Luciani, Fabio [Systems Immunology, School of Medical Sciences, University of New South Wales, Sydney, NSW (Australia); Chopra, Abha [Institute for Immunology and infectious diseases (IIID), Murdoch University, Perth, WA (Australia); Beard, Michael R., E-mail: michael.beard@adelaide.edu.au [Department of Molecular and Cellular Biology, Research Centre for Infectious Diseases, University of Adelaide, Adelaide and Centre for Cancer Biology, SA Pathology, Adelaide, SA (Australia)

2016-06-15

The spatiotemporal dynamics of Hepatitis C Virus (HCV) RNA localisation are poorly understood. To address this we engineered HCV genomes harbouring MS2 bacteriophage RNA stem-loops within the 3′-untranslated region to allow tracking of HCV RNA via specific interaction with a MS2-Coat-mCherry fusion protein. Despite the impact of these insertions on viral fitness, live imaging revealed that replication of tagged-HCV genomes induced specific redistribution of the mCherry-tagged-MS2-Coat protein to motile and static foci. Further analysis showed that HCV RNA was associated with NS5A in both static and motile structures while a subset of motile NS5A structures was devoid of HCV RNA. Further investigation of viral RNA traffic with respect to lipid droplets (LDs) revealed HCV RNA-positive structures in close association with LDs. These studies provide new insights into the dynamics of HCV RNA traffic with NS5A and LDs and provide a platform for future investigations of HCV replication and assembly. - Highlights: • HCV can tolerate can bacteriophage MS2 stem-loop insertions within the 3′ UTR. • MS2 stem-loop containing HCV genomes allow for real-time imaging of HCV RNA. • HCV RNA is both static and motile and associates with NS5A and lipid droplets.

HCV RNA traffic and association with NS5A in living cells

International Nuclear Information System (INIS)

Fiches, Guillaume N.; Eyre, Nicholas S.; Aloia, Amanda L.; Van Der Hoek, Kylie; Betz-Stablein, Brigit; Luciani, Fabio; Chopra, Abha; Beard, Michael R.

2016-01-01

The spatiotemporal dynamics of Hepatitis C Virus (HCV) RNA localisation are poorly understood. To address this we engineered HCV genomes harbouring MS2 bacteriophage RNA stem-loops within the 3′-untranslated region to allow tracking of HCV RNA via specific interaction with a MS2-Coat-mCherry fusion protein. Despite the impact of these insertions on viral fitness, live imaging revealed that replication of tagged-HCV genomes induced specific redistribution of the mCherry-tagged-MS2-Coat protein to motile and static foci. Further analysis showed that HCV RNA was associated with NS5A in both static and motile structures while a subset of motile NS5A structures was devoid of HCV RNA. Further investigation of viral RNA traffic with respect to lipid droplets (LDs) revealed HCV RNA-positive structures in close association with LDs. These studies provide new insights into the dynamics of HCV RNA traffic with NS5A and LDs and provide a platform for future investigations of HCV replication and assembly. - Highlights: • HCV can tolerate can bacteriophage MS2 stem-loop insertions within the 3′ UTR. • MS2 stem-loop containing HCV genomes allow for real-time imaging of HCV RNA. • HCV RNA is both static and motile and associates with NS5A and lipid droplets.

Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

Science.gov (United States)

Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

2018-04-14

To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

sRNAnalyzer—a flexible and customizable small RNA sequencing data analysis pipeline

Science.gov (United States)

Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J.

2017-01-01

Abstract Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline—sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. PMID:29069500

GLASSgo – Automated and Reliable Detection of sRNA Homologs From a Single Input Sequence

Directory of Open Access Journals (Sweden)

Steffen C. Lott

2018-04-01

Full Text Available Bacterial small RNAs (sRNAs are important post-transcriptional regulators of gene expression. The functional and evolutionary characterization of sRNAs requires the identification of homologs, which is frequently challenging due to their heterogeneity, short length and partly, little sequence conservation. We developed the GLobal Automatic Small RNA Search go (GLASSgo algorithm to identify sRNA homologs in complex genomic databases starting from a single sequence. GLASSgo combines an iterative BLAST strategy with pairwise identity filtering and a graph-based clustering method that utilizes RNA secondary structure information. We tested the specificity, sensitivity and runtime of GLASSgo, BLAST and the combination RNAlien/cmsearch in a typical use case scenario on 40 bacterial sRNA families. The sensitivity of the tested methods was similar, while the specificity of GLASSgo and RNAlien/cmsearch was significantly higher than that of BLAST. GLASSgo was on average ∼87 times faster than RNAlien/cmsearch, and only ∼7.5 times slower than BLAST, which shows that GLASSgo optimizes the trade-off between speed and accuracy in the task of finding sRNA homologs. GLASSgo is fully automated, whereas BLAST often recovers only parts of homologs and RNAlien/cmsearch requires extensive additional bioinformatic work to get a comprehensive set of homologs. GLASSgo is available as an easy-to-use web server to find homologous sRNAs in large databases.

Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

Science.gov (United States)

Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

2017-05-27

Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

Study of radioadaptive response in Drosophila melanogaster at different oogenesis stages

International Nuclear Information System (INIS)

Glushkova, I.V.; Aksyutik, T.V.

2005-01-01

We study radioadaptive response in the Canton-S strain of Drosophila melanogaster at different oogenesis stages using the test of dominant lethal mutations (DLM). AR was not revealed at the stages of 14-7 and 7--1 oocytes in the studied Drosophila stock. It is likely to be associated with a genetic constitution of the Drosophila strain under study. (authors)

Fine genetic structure of the 2D3-2F5 region of the X-chromosome of Drosophila melanogaster

International Nuclear Information System (INIS)

Gvozdev, V.A.; Gostimsky, S.A.; Gerasimova, T.I.; Dubrovskaya, E.S.; Braslavskaya, O.Yu.

1975-01-01

97 lethal and semilethal mutations were induced by ethyl methanesulfonate, nitrosomethyl urea and γ-irradiation in the 2D3-F5 region of the X-chromosome of D. melanogaster. Approximately 1 per cent of the tested X-chromosomes carried a lethal in the 2D3-2F5 region. The mutation frequencies per band of DNA content in this region and the whole X-chromosome are equal. Complementation analysis revealed at least 10 functionally independent essential loci in this region including about 10 bands. The data presented in this study support the one band - one gene hypothesis. The Pgd locus coding for 6-phosphogluconate dehydrogenase (6PGD) is mapped in the 2D3 (or 2D4) band. Isolation of 11 lethal or semilethal point mutations with null or reduced 6PGD acticity shows that the Pgd locus is a vital one. (orig.) [de

Polymorphism patterns in two tightly linked developmental genes, Idgf1 and Idgf3, of Drosophila melanogaster

Czech Academy of Sciences Publication Activity Database

Žurovcová, Martina; Ayala, F. J.

2002-01-01

Roč. 162, - (2002), s. 177-188 ISSN 0016-6731 Institutional research plan: CEZ:AV0Z5007907 Keywords : Drosophila melanogaster Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.483, year: 2002

A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

Science.gov (United States)

Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

2016-06-01

The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.

RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

Science.gov (United States)

Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

2015-06-01

4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.

Optogenetic pacing in Drosophila melanogaster

Science.gov (United States)

Alex, Aneesh; Li, Airong; Tanzi, Rudolph E.; Zhou, Chao

2015-01-01

Electrical stimulation is currently the gold standard for cardiac pacing. However, it is invasive and nonspecific for cardiac tissues. We recently developed a noninvasive cardiac pacing technique using optogenetic tools, which are widely used in neuroscience. Optogenetic pacing of the heart provides high spatial and temporal precisions, is specific for cardiac tissues, avoids artifacts associated with electrical stimulation, and therefore promises to be a powerful tool in basic cardiac research. We demonstrated optogenetic control of heart rhythm in a well-established model organism, Drosophila melanogaster. We developed transgenic flies expressing a light-gated cation channel, channelrhodopsin-2 (ChR2), specifically in their hearts and demonstrated successful optogenetic pacing of ChR2-expressing Drosophila at different developmental stages, including the larva, pupa, and adult stages. A high-speed and ultrahigh-resolution optical coherence microscopy imaging system that is capable of providing images at a rate of 130 frames/s with axial and transverse resolutions of 1.5 and 3.9 μm, respectively, was used to noninvasively monitor Drosophila cardiac function and its response to pacing stimulation. The development of a noninvasive integrated optical pacing and imaging system provides a novel platform for performing research studies in developmental cardiology. PMID:26601299

Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

Science.gov (United States)

Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

2013-11-01

Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

How conserved are the conserved 16S-rRNA regions?

Directory of Open Access Journals (Sweden)

Marcel Martinez-Porchas

2017-02-01

Full Text Available The 16S rRNA gene has been used as master key for studying prokaryotic diversity in almost every environment. Despite the claim of several researchers to have the best universal primers, the reality is that no primer has been demonstrated to be truly universal. This suggests that conserved regions of the gene may not be as conserved as expected. The aim of this study was to evaluate the conservation degree of the so-called conserved regions flanking the hypervariable regions of the 16S rRNA gene. Data contained in SILVA database (release 123 were used for the study. Primers reported as matches of each conserved region were assembled to form contigs; sequences sizing 12 nucleotides (12-mers were extracted from these contigs and searched into the entire set of SILVA sequences. Frequency analysis shown that extreme regions, 1 and 10, registered the lowest frequencies. 12-mer frequencies revealed segments of contigs that were not as conserved as expected (≤90%. Fragments corresponding to the primer contigs 3, 4, 5b and 6a were recovered from all sequences in SILVA database. Nucleotide frequency analysis in each consensus demonstrated that only a small fraction of these so-called conserved regions is truly conserved in non-redundant sequences. It could be concluded that conserved regions of the 16S rRNA gene exhibit considerable variation that has to be considered when using this gene as biomarker.

The 5s25p2 - (5s25p5d + 5s5p3 + 5s25p6s + 5s25p7s) transitions in Sb II and 5s25p - (5s5p2 + 5s2nl) transitions in Sb III

International Nuclear Information System (INIS)

Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.

1989-01-01

The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig

Comparative Analysis of Satellite DNA in the Drosophila melanogaster Species Complex

Directory of Open Access Journals (Sweden)

Madhav Jagannathan

2017-02-01

Full Text Available Satellite DNAs are highly repetitive sequences that account for the majority of constitutive heterochromatin in many eukaryotic genomes. It is widely recognized that sequences and locations of satellite DNAs are highly divergent even in closely related species, contributing to the hypothesis that satellite DNA differences may underlie speciation. However, due to its repetitive nature, the mapping of satellite DNAs has been mostly left out of recent genomics analyses, hampering the use of molecular genetics techniques to better understand their role in speciation and evolution. Satellite DNAs are most extensively and comprehensively mapped in Drosophila melanogaster, a species that is also an excellent model system with which to study speciation. Yet the lack of comprehensive knowledge regarding satellite DNA identity and location in its sibling species (D. simulans, D. mauritiana, and D. sechellia has prevented the full utilization of D. melanogaster in studying speciation. To overcome this problem, we initiated the mapping of satellite DNAs on the genomes of the D. melanogaster species complex (D. melanogaster, D. simulans, D. mauritiana, and D. sechellia using multi-color fluorescent in situ hybridization (FISH probes. Our study confirms a striking divergence of satellite DNAs in the D. melanogaster species complex, even among the closely related species of the D. simulans clade (D. simulans, D. mauritiana, and D. sechellia, and suggests the presence of unidentified satellite sequences in these species.

Parallel Evolution of Copy-Number Variation across Continents in Drosophila melanogaster

Science.gov (United States)

Schrider, Daniel R.; Hahn, Matthew W.; Begun, David J.

2016-01-01

Genetic differentiation across populations that is maintained in the presence of gene flow is a hallmark of spatially varying selection. In Drosophila melanogaster, the latitudinal clines across the eastern coasts of Australia and North America appear to be examples of this type of selection, with recent studies showing that a substantial portion of the D. melanogaster genome exhibits allele frequency differentiation with respect to latitude on both continents. As of yet there has been no genome-wide examination of differentiated copy-number variants (CNVs) in these geographic regions, despite their potential importance for phenotypic variation in Drosophila and other taxa. Here, we present an analysis of geographic variation in CNVs in D. melanogaster. We also present the first genomic analysis of geographic variation for copy-number variation in the sister species, D. simulans, in order to investigate patterns of parallel evolution in these close relatives. In D. melanogaster we find hundreds of CNVs, many of which show parallel patterns of geographic variation on both continents, lending support to the idea that they are influenced by spatially varying selection. These findings support the idea that polymorphic CNVs contribute to local adaptation in D. melanogaster. In contrast, we find very few CNVs in D. simulans that are geographically differentiated in parallel on both continents, consistent with earlier work suggesting that clinal patterns are weaker in this species. PMID:26809315

Allelic asymmetry of the Lethal hybrid rescue (Lhr) gene expression in the hybrid between Drosophila melanogaster and D. simulans: confirmation by using genetic variations of D. melanogaster.

Science.gov (United States)

Shirata, Mika; Araye, Quenta; Maehara, Kazunori; Enya, Sora; Takano-Shimizu, Toshiyuki; Sawamura, Kyoichi

2014-02-01

In the cross between Drosophila melanogaster females and D. simulans males, hybrid males die at the late larval stage, and the sibling females also die at later stages at high temperatures. Removing the D. simulans allele of the Lethal hybrid rescue gene (Lhr (sim) ) improves the hybrid incompatibility phenotypes. However, the loss-of-function mutation of Lhr (sim) (Lhr (sim0) ) does not rescue the hybrid males in crosses with several D. melanogaster strains. We first describe the genetic factor possessed by the D. melanogaster strains. It has been suggested that removing the D. melanogaster allele of Lhr (Lhr (mel) ), that is Lhr (mel0) , does not have the hybrid male rescue effect, contrasting to Lhr (sim0) . Because the expression level of the Lhr gene is known to be Lhr (sim) > Lhr (mel) in the hybrid, Lhr (mel0) may not lead to enough of a reduction in total Lhr expression. Then, there is a possibility that the D. melanogaster factor changes the expression level to Lhr (sim) Lhr (mel) in the hybrid irrespectively of the presence of the factor. At last, we showed that Lhr (mel0) slightly improves the viability of hybrid females, which was not realized previously. All of the present results are consistent with the allelic asymmetry model of the Lhr gene expression in the hybrid.

Looking for inhibitors of the dengue virus NS5 RNA-dependent RNA-polymerase using a molecular docking approach

Directory of Open Access Journals (Sweden)

Galiano V

2016-10-01

Full Text Available Vicente Galiano,1 Pablo Garcia-Valtanen,2 Vicente Micol,3,4 José Antonio Encinar3 1Physics and Computer Architecture Department, Miguel Hernández University (UMH, Elche, Spain; 2Experimental Therapeutics Laboratory, Hanson and Sansom Institute for Health Research, School of Pharmacy and Medical Science, University of South Australia, Adelaide, Australia; 3Molecular and Cell Biology Institute, Miguel Hernández University (UMH, Elche, Spain; 4CIBER: CB12/03/30038, Physiopathology of the Obesity and Nutrition, CIBERobn, Instituto de Salud Carlos III, Palma de Mallorca, Spain Abstract: The dengue virus (DENV nonstructural protein 5 (NS5 contains both an N-terminal methyltransferase domain and a C-terminal RNA-dependent RNA polymerase domain. Polymerase activity is responsible for viral RNA synthesis by a de novo initiation mechanism and represents an attractive target for antiviral therapy. The incidence of DENV has grown rapidly and it is now estimated that half of the human population is at risk of becoming infected with this virus. Despite this, there are no effective drugs to treat DENV infections. The present in silico study aimed at finding new inhibitors of the NS5 RNA-dependent RNA polymerase of the four serotypes of DENV. We used a chemical library comprising 372,792 nonnucleotide compounds (around 325,319 natural compounds to perform molecular docking experiments against a binding site of the RNA template tunnel of the virus polymerase. Compounds with high negative free energy variation (ΔG <-10.5 kcal/mol were selected as putative inhibitors. Additional filters for favorable druggability and good absorption, distribution, metabolism, excretion, and toxicity were applied. Finally, after the screening process was completed, we identified 39 compounds as lead DENV polymerase inhibitor candidates. Potentially, these compounds could act as efficient DENV polymerase inhibitors in vitro and in vivo. Keywords: virtual screening, molecular

MicroRNA-124 slows down the progression of Huntington′s disease by promoting neurogenesis in the striatum

Directory of Open Access Journals (Sweden)

Tian Liu

2015-01-01

Full Text Available MicroRNA-124 contributes to neurogenesis through regulating its targets, but its expression both in the brain of Huntington′s disease mouse models and patients is decreased. However, the effects of microRNA-124 on the progression of Huntington′s disease have not been reported. Results from this study showed that microRNA-124 increased the latency to fall for each R6/2 Huntington′s disease transgenic mouse in the rotarod test. 5-Bromo-2′-deoxyuridine (BrdU staining of the striatum shows an increase in neurogenesis. In addition, brain-derived neurotrophic factor and peroxisome proliferator-activated receptor gamma coactivator 1-alpha protein levels in the striatum were increased and SRY-related HMG box transcription factor 9 protein level was decreased. These findings suggest that microRNA-124 slows down the progression of Huntington′s disease possibly through its important role in neuronal differentiation and survival.

Gene : CBRC-DMEL-06-0010 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-06-0010 X D UNKNOWN PCX_DROME 0.0 95% ref|NP_525045.2| pecanex CG3443-PB ...[Drosophila melanogaster] sp|P18490|PCX_DROME Protein pecanex gb|AAF45756.2| CG3443-PB [Drosophila melanogas...ter] 0.0 95% gnl|UG|Dm#S13283457 Drosophila melanogaster pecanex CG3443-RB (pcx), mRNA /cds=p(1,10302) /gb=N

Evidence for a Complex Class of Nonadenylated mRNA in Drosophila

Science.gov (United States)

Zimmerman, J. Lynn; Fouts, David L.; Manning, Jerry E.

1980-01-01

The amount, by mass, of poly(A+) mRNA present in the polyribosomes of third-instar larvae of Drosophila melanogaster, and the relative contribution of the poly(A+) mRNA to the sequence complexity of total polysomal RNA, has been determined. Selective removal of poly(A+) mRNA from total polysomal RNA by use of either oligo-dT-cellulose, or poly(U)-sepharose affinity chromatography, revealed that only 0.15% of the mass of the polysomal RNA was present as poly(A+) mRNA. The present study shows that this RNA hybridized at saturation with 3.3% of the single-copy DNA in the Drosophila genome. After correction for asymmetric transcription and reactability of the DNA, 7.4% of the single-copy DNA in the Drosophila genome is represented in larval poly(A+) mRNA. This corresponds to 6.73 x 106 nucleotides of mRNA coding sequences, or approximately 5,384 diverse RNA sequences of average size 1,250 nucleotides. However, total polysomal RNA hybridizes at saturation to 10.9% of the single-copy DNA sequences. After correcting this value for asymmetric transcription and tracer DNA reactability, 24% of the single-copy DNA in Drosophila is represented in total polysomal RNA. This corresponds to 2.18 x 107 nucleotides of RNA coding sequences or 17,440 diverse RNA molecules of size 1,250 nucleotides. This value is 3.2 times greater than that observed for poly(A+) mRNA, and indicates that ≃69% of the polysomal RNA sequence complexity is contributed by nonadenylated RNA. Furthermore, if the number of different structural genes represented in total polysomal RNA is ≃1.7 x 104, then the number of genes expressed in third-instar larvae exceeds the number of chromomeres in Drosophila by about a factor of three. This numerology indicates that the number of chromomeres observed in polytene chromosomes does not reflect the number of structural gene sequences in the Drosophila genome. PMID:6777246

Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

Science.gov (United States)

Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

2016-01-01

The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

PAI-1 mRNA expression and plasma level in rheumatoid arthritis: relationship with 4G/5G PAI-1 polymorphism.

Science.gov (United States)

Muñoz-Valle, José Francisco; Ruiz-Quezada, Sandra Luz; Oregón-Romero, Edith; Navarro-Hernández, Rosa Elena; Castañeda-Saucedo, Eduardo; De la Cruz-Mosso, Ulises; Illades-Aguiar, Berenice; Leyva-Vázquez, Marco Antonio; Castro-Alarcón, Natividad; Parra-Rojas, Isela

2012-12-01

Rheumatoid arthritis (RA) is a chronic inflammatory disease affecting the synovial membrane, cartilage and bone. PAI-1 is a key regulator of the fibrinolytic system through which plasminogen is converted to plasmin. The plasmin activates the matrix metalloproteinase system, which is closely related with the joint damage and bone destruction in RA. The aim of this study was to investigate the relationship between 4G/5G PAI-1 polymorphism with mRNA expression and PAI-1 plasma protein levels in RA patients. 113 RA patients and 123 healthy subjects (HS) were included in the study. The 4G/5G PAI-1 polymorphism was determined by polymerase chain reaction-restriction fragment length polymorphism method; the PAI-1 mRNA expression was determined by real-time PCR; and the soluble PAI-1 (sPAI-1) levels were quantified using an ELISA kit. No significant differences in the genotype and allele frequencies of 4G/5G PAI-1 polymorphism were found between RA patients and HS. However, the 5G/5G genotype was the most frequent in both studied groups: RA (42%) and HS (44%). PAI-1 mRNA expression was slightly increased (0.67 fold) in RA patients with respect to HS (P = 0.0001). In addition, in RA patients, the 4G/4G genotype carriers showed increased PAI-1 mRNA expression (3.82 fold) versus 4G/5G and 5G/5G genotypes (P = 0.0001), whereas the sPAI-1 plasma levels did not show significant differences. Our results indicate that the 4G/5G PAI-1 polymorphism is not a marker of susceptibility in the Western Mexico. However, the 4G/4G genotype is associated with high PAI-1 mRNA expression but not with the sPAI-1 levels in RA patients.

Isolation of a novel protein, P12-from adult Drosophila melanogaster that inhibits deoxyribonucleoside and protein kinase activities and activates 3'-5'-exonuclease activity

DEFF Research Database (Denmark)

Christiansen, Louise Slot; Zanten, Gabriella van; Berenstein, Dvora

2016-01-01

We have previously found that Drosophila melanogaster only has one deoxyribonucleoside kinase, Dm-dNK, however, capable to phosphorylate all four natural deoxyribonucleosides. Dm-dNK was originally isolated from an embryonic cell line. We wanted to study the expression of Dm-dNK during development......-dNK, also inhibited the two protein kinases to the same degree. Furthermore, testing P12 in a DNA polymerase based assay we found that the 3'-5'-exonuclease part of the DNA polymerase (Klenow polymerase) was activated....

Comparative population genomics of latitudinal variation in Drosophila simulans and Drosophila melanogaster.

Science.gov (United States)

Machado, Heather E; Bergland, Alan O; O'Brien, Katherine R; Behrman, Emily L; Schmidt, Paul S; Petrov, Dmitri A

2016-02-01

Examples of clinal variation in phenotypes and genotypes across latitudinal transects have served as important models for understanding how spatially varying selection and demographic forces shape variation within species. Here, we examine the selective and demographic contributions to latitudinal variation through the largest comparative genomic study to date of Drosophila simulans and Drosophila melanogaster, with genomic sequence data from 382 individual fruit flies, collected across a spatial transect of 19 degrees latitude and at multiple time points over 2 years. Consistent with phenotypic studies, we find less clinal variation in D. simulans than D. melanogaster, particularly for the autosomes. Moreover, we find that clinally varying loci in D. simulans are less stable over multiple years than comparable clines in D. melanogaster. D. simulans shows a significantly weaker pattern of isolation by distance than D. melanogaster and we find evidence for a stronger contribution of migration to D. simulans population genetic structure. While population bottlenecks and migration can plausibly explain the differences in stability of clinal variation between the two species, we also observe a significant enrichment of shared clinal genes, suggesting that the selective forces associated with climate are acting on the same genes and phenotypes in D. simulans and D. melanogaster. © 2015 John Wiley & Sons Ltd.

Evolutionary Transitions of MicroRNA-Target Pairs

KAUST Repository

Nozawa, Masafumi; Fujimi, Mai; Iwamoto, Chie; Onizuka, Kanako; Fukuda, Nana; Ikeo, Kazuho; Gojobori, Takashi

2016-01-01

How newly generated microRNA (miRNA) genes are integrated into gene regulatory networks during evolution is fundamental in understanding the molecular and evolutionary bases of robustness and plasticity in gene regulation. A recent model proposed that after the birth of a miRNA, the miRNA is generally integrated into the network by decreasing the number of target genes during evolution. However, this decreasing model remains to be carefully examined by considering in vivo conditions. In this study, we therefore compared the number of target genes among miRNAs with different ages, combining experiments with bioinformatics predictions. First, we focused on three Drosophila miRNAs with different ages. As a result, we found that an older miRNA has a greater number of target genes than a younger miRNA, suggesting the increasing number of targets for each miRNA during evolution (increasing model). To further confirm our results, we also predicted all target genes for all miRNAs in D. melanogaster, considering co-expression of miRNAs and mRNAs in vivo. The results obtained also do not support the decreasing model but are reasonably consistent with the increasing model of miRNA-target pairs. Furthermore, our large-scale analyses of currently available experimental data of miRNA-target pairs also showed a weak but the same trend in humans. These results indicate that the current decreasing model of miRNA-target pairs should be reconsidered and the increasing model may be more appropriate to explain the evolutionary transitions of miRNA-target pairs in many organisms.

Evolutionary Transitions of MicroRNA-Target Pairs

KAUST Repository

Nozawa, Masafumi

2016-04-27

How newly generated microRNA (miRNA) genes are integrated into gene regulatory networks during evolution is fundamental in understanding the molecular and evolutionary bases of robustness and plasticity in gene regulation. A recent model proposed that after the birth of a miRNA, the miRNA is generally integrated into the network by decreasing the number of target genes during evolution. However, this decreasing model remains to be carefully examined by considering in vivo conditions. In this study, we therefore compared the number of target genes among miRNAs with different ages, combining experiments with bioinformatics predictions. First, we focused on three Drosophila miRNAs with different ages. As a result, we found that an older miRNA has a greater number of target genes than a younger miRNA, suggesting the increasing number of targets for each miRNA during evolution (increasing model). To further confirm our results, we also predicted all target genes for all miRNAs in D. melanogaster, considering co-expression of miRNAs and mRNAs in vivo. The results obtained also do not support the decreasing model but are reasonably consistent with the increasing model of miRNA-target pairs. Furthermore, our large-scale analyses of currently available experimental data of miRNA-target pairs also showed a weak but the same trend in humans. These results indicate that the current decreasing model of miRNA-target pairs should be reconsidered and the increasing model may be more appropriate to explain the evolutionary transitions of miRNA-target pairs in many organisms.

Genetic organization of interphase chromosome bands and interbands in Drosophila melanogaster.

Science.gov (United States)

Zhimulev, Igor F; Zykova, Tatyana Yu; Goncharov, Fyodor P; Khoroshko, Varvara A; Demakova, Olga V; Semeshin, Valeriy F; Pokholkova, Galina V; Boldyreva, Lidiya V; Demidova, Darya S; Babenko, Vladimir N; Demakov, Sergey A; Belyaeva, Elena S

2014-01-01

Drosophila melanogaster polytene chromosomes display specific banding pattern; the underlying genetic organization of this pattern has remained elusive for many years. In the present paper, we analyze 32 cytology-mapped polytene chromosome interbands. We estimated molecular locations of these interbands, described their molecular and genetic organization and demonstrate that polytene chromosome interbands contain the 5' ends of housekeeping genes. As a rule, interbands display preferential "head-to-head" orientation of genes. They are enriched for "broad" class promoters characteristic of housekeeping genes and associate with open chromatin proteins and Origin Recognition Complex (ORC) components. In two regions, 10A and 100B, coding sequences of genes whose 5'-ends reside in interbands map to constantly loosely compacted, early-replicating, so-called "grey" bands. Comparison of expression patterns of genes mapping to late-replicating dense bands vs genes whose promoter regions map to interbands shows that the former are generally tissue-specific, whereas the latter are represented by ubiquitously active genes. Analysis of RNA-seq data (modENCODE-FlyBase) indicates that transcripts from interband-mapping genes are present in most tissues and cell lines studied, across most developmental stages and upon various treatment conditions. We developed a special algorithm to computationally process protein localization data generated by the modENCODE project and show that Drosophila genome has about 5700 sites that demonstrate all the features shared by the interbands cytologically mapped to date.

Genetic organization of interphase chromosome bands and interbands in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Igor F Zhimulev

Full Text Available Drosophila melanogaster polytene chromosomes display specific banding pattern; the underlying genetic organization of this pattern has remained elusive for many years. In the present paper, we analyze 32 cytology-mapped polytene chromosome interbands. We estimated molecular locations of these interbands, described their molecular and genetic organization and demonstrate that polytene chromosome interbands contain the 5' ends of housekeeping genes. As a rule, interbands display preferential "head-to-head" orientation of genes. They are enriched for "broad" class promoters characteristic of housekeeping genes and associate with open chromatin proteins and Origin Recognition Complex (ORC components. In two regions, 10A and 100B, coding sequences of genes whose 5'-ends reside in interbands map to constantly loosely compacted, early-replicating, so-called "grey" bands. Comparison of expression patterns of genes mapping to late-replicating dense bands vs genes whose promoter regions map to interbands shows that the former are generally tissue-specific, whereas the latter are represented by ubiquitously active genes. Analysis of RNA-seq data (modENCODE-FlyBase indicates that transcripts from interband-mapping genes are present in most tissues and cell lines studied, across most developmental stages and upon various treatment conditions. We developed a special algorithm to computationally process protein localization data generated by the modENCODE project and show that Drosophila genome has about 5700 sites that demonstrate all the features shared by the interbands cytologically mapped to date.

Molecular Mechanisms for High Hydrostatic Pressure-Induced Wing Mutagenesis in Drosophila melanogaster.

Science.gov (United States)

Wang, Hua; Wang, Kai; Xiao, Guanjun; Ma, Junfeng; Wang, Bingying; Shen, Sile; Fu, Xueqi; Zou, Guangtian; Zou, Bo

2015-10-08

Although High hydrostatic pressure (HHP) as an important physical and chemical tool has been increasingly applied to research of organism, the response mechanisms of organism to HHP have not been elucidated clearly thus far. To identify mutagenic mechanisms of HHP on organisms, here, we treated Drosophila melanogaster (D. melanogaster) eggs with HHP. Approximately 75% of the surviving flies showed significant morphological abnormalities from the egg to the adult stages compared with control flies (p melanogaster induced by HHP were used to investigate the mutagenic mechanisms of HHP on organism. Thus 285 differentially expressed genes associated with wing mutations were identified using Affymetrix Drosophila Genome Array 2.0 and verified with RT-PCR. We also compared wing development-related central genes in the mutant flies with control flies using DNA sequencing to show two point mutations in the vestigial (vg) gene. This study revealed the mutagenic mechanisms of HHP-induced mutagenesis in D. melanogaster and provided a new model for the study of evolution on organisms.

Drosophila melanogaster gene expression changes after spaceflight.

Data.gov (United States)

National Aeronautics and Space Administration — Gene expression levels were determined in 3rd instar and adult Drosophila melanogaster reared during spaceflight to elucidate the genetic and molecular mechanisms...

Unigene BLAST: CBRC-DMEL-04-0014 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-04-0014 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 1e-37 49% ...

Unigene BLAST: CBRC-DMEL-03-0057 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-03-0057 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 6e-13 25% ...

Unigene BLAST: CBRC-DMEL-03-0039 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-03-0039 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 7e-31 40% ...

Unigene BLAST: CBRC-DMEL-02-0056 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-02-0056 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 2e-11 26% ...

Unigene BLAST: CBRC-DMEL-03-0045 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-03-0045 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 1e-23 38% ...

Unigene BLAST: CBRC-DMEL-02-0034 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-02-0034 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 8e-12 25% ...

Unigene BLAST: CBRC-DMEL-04-0013 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-04-0013 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 7e-29 43% ...

Unigene BLAST: CBRC-DMEL-04-0037 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-04-0037 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 2e-04 26% ...

Unigene BLAST: CBRC-DMEL-04-0005 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-04-0005 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 2e-06 20% ...

Unigene BLAST: CBRC-DMEL-02-0008 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-02-0008 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 3e-12 22% ...

Unigene BLAST: CBRC-DMEL-02-0037 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-02-0037 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 2e-12 26% ...

Unigene BLAST: CBRC-DMEL-04-0058 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-04-0058 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 9e-26 32% ...

Unigene BLAST: CBRC-DMEL-04-0021 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-04-0021 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 2e-16 32% ...

Unigene BLAST: CBRC-DMEL-04-0006 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-04-0006 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 0.048 17% ...

Unigene BLAST: CBRC-DMEL-04-0015 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-04-0015 gnl|UG|Dm#S40593060 DMG1C.3_1.C08.C1 MODENCODE_DM_A Drosophila melanogaster cDNA clone DMG...1-chr3R.5.051.a, mRNA sequence /clone=DMG1-chr3R.5.051.a /gb=EW713099 /gi=156142053 /ug=Dm.27239 /len=1584 9e-82 98% ...

Effect of secondary compounds in forages on rumen micro-organisms quantified by 16S and 18S rRNA

International Nuclear Information System (INIS)

Wina, E.; Muetzel, S.; Hoffman, E.; Becker, K.; Makkar, H.P.S.

2005-01-01

A gas syringe method was used to evaluate the effect of secondary compounds from plant materials on in vitro fermentation products and microbial biomass. The experiment used Pennisetum purpureum, Morinda citrifolia fruit, Nothopanax scutellarium leaves, Sesbania sesban LS (low saponins type), Sesbania sesban HS (high saponins type) and Sapindus rarak fruit as substrates. The incubation was conducted with and without polyethylene glycol 6000 (PEG) addition for 24 hours. Gas production and short-chain fatty acids (SCFA) were analysed. Prokaryotic and eukaryotic concentrations were measured by quantifying 16S and 18S rRNA. The percentage increase in gas production due to PEG was very small (<5%) for all plant materials, which indicated that the biological effect of tannin in these plant materials is limited. TLC analysis revealed that all materials contained saponin, but only S. rarak, followed by S. sesban, contained a high diversity of saponins. S. sesban gave the highest (234 ml/g) while S. rarak gave the lowest gas production (115 ml/g). S. rarak gave the lowest SCFA production (3.57 mmole/g) and also the lowest ratio of acetate to propionate (1.76), indicating a change in pattern of SCFA production. Total elimination of eukaryotic concentration was evident from the absence of the 18S rRNA band when S. rarak and S. sesban were used as sole substrates. S. rarak also reduced the prokaryotic concentration. To use S. rarak as a defaunating agent without affecting prokaryotes, a crude saponin extract was prepared from S. rarak for further experiment. Different concentrations of crude saponins in a methanol extract of S. rarak fruit dissolved in rumen buffer were added to a substrate consisting of elephant grass and wheat bran (7:3 w/w). Microbial biomass yield was quantified by gravimetry and using rRNA as a marker. Addition of crude saponin extract from S. rarak to a high-roughage diet increased microbial biomass (MB) yield to 1.07 and 1.14 times MB yield of the

Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

International Nuclear Information System (INIS)

Gravel, M.; Melancon, P.; Barkier-Gingras, L.

1987-01-01

[ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

Directory of Open Access Journals (Sweden)

Seyed Bagher Mosavi-Azam

2008-10-01

Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

Characterization of hydrocortisone biometabolites and 18S rRNA gene in Chlamydomonas reinhardtii cultures.

Science.gov (United States)

Ghasemi, Younes; Rasoul-Amini, Sara; Morowvat, Mohammad Hossein; Raee, Mohammad Javad; Ghoshoon, Mohammad Bagher; Nouri, Fatemeh; Negintaji, Narges; Parvizi, Rezvan; Mosavi-Azam, Seyed Bagher

2008-10-31

A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17 beta-Dihydroxyandrost-4-en-3-one (2), 11 beta-hydroxyandrost-4-en-3,17-dione (3), 11 beta,17 alpha,20 beta,21-tetrahydroxypregn-4-en-3-one (4) and prednisolone (5) were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

Beet Necrotic Yellow Vein Virus Noncoding RNA Production Depends on a 5′→3′ Xrn Exoribonuclease Activity

Directory of Open Access Journals (Sweden)

Alyssa Flobinus

2018-03-01

Full Text Available The RNA3 species of the beet necrotic yellow vein virus (BNYVV, a multipartite positive-stranded RNA phytovirus, contains the ‘core’ nucleotide sequence required for its systemic movement in Beta macrocarpa. Within this ‘core’ sequence resides a conserved “coremin” motif of 20 nucleotides that is absolutely essential for long-distance movement. RNA3 undergoes processing steps to yield a noncoding RNA3 (ncRNA3 possessing “coremin” at its 5′ end, a mandatory element for ncRNA3 accumulation. Expression of wild-type (wt or mutated RNA3 in Saccharomyces cerevisiae allows for the accumulation of ncRNA3 species. Screening of S. cerevisiae ribonuclease mutants identified the 5′-to-3′ exoribonuclease Xrn1 as a key enzyme in RNA3 processing that was recapitulated both in vitro and in insect cell extracts. Xrn1 stalled on ncRNA3-containing RNA substrates in these decay assays in a similar fashion as the flavivirus Xrn1-resistant structure (sfRNA. Substitution of the BNYVV-RNA3 ‘core’ sequence by the sfRNA sequence led to the accumulation of an ncRNA species in yeast in vitro but not in planta and no viral long distance occurred. Interestingly, XRN4 knockdown reduced BNYVV RNA accumulation suggesting a dual role for the ribonuclease in the viral cycle.

Radioprotective efficacy of bisarylidene cyclopentanone on electron beam radiation induced oxidative stress in Drosophila melanogaster

International Nuclear Information System (INIS)

Darshan Raj, C.G.; Sarojini, B.K.; Musthafa Khaleel, V.; Ramesh, S.R.; Ramakrishna, M.K.; Narayana, B.; Sanjeev, Ganesh

2010-01-01

Present study was carried out for evaluating the radioprotective effect of bischalcone (2E, 5E) - 2,5-bis (3-methoxy-4-hydroxy-benzylidene) cyclopentanone (curcumin analog (CA)), on electron beam radiation induced oxidative stress in Drosophila melanogaster adults. The oxidative stress markers and antioxidants included superoxide dismutase (SOD) and catalase (CAT). The oxidative stress was induced at 1.5 Gy. (author)

The RNA-binding protein HOS5 and serine/arginine-rich proteins RS40 and RS41 participate in miRNA biogenesis in Arabidopsis

KAUST Repository

Chen, Tao

2015-07-30

MicroRNAs are a class of small regulatory RNAs that are generated from primary miRNA (pri-miRNA) transcripts with a stem-loop structure. Accuracy of the processing of pri-miRNA into mature miRNA in plants can be enhanced by SERRATE (SE) and HYPONASTIC LEAVES 1 (HYL1). HYL1 activity is regulated by the FIERY2 (FRY2)/RNA polymerase II C-terminal domain phosphatase-like 1 (CPL1). Here, we discover that HIGH OSMOTIC STRESS GENE EXPRESSION 5 (HOS5) and two serine/arginine-rich splicing factors RS40 and RS41, previously shown to be involved in pre-mRNA splicing, affect the biogenesis of a subset of miRNA. These proteins are required for correct miRNA strand selection and the maintenance of miRNA levels. FRY2 dephosphorylates HOS5 whose phosphorylation status affects its subnuclear localization. HOS5 and the RS proteins bind both intronless and intron-containing pri-miRNAs. Importantly, all of these splicing-related factors directly interact with both HYL1 and SE in nuclear splicing speckles. Our results indicate that these splicing factors are directly involved in the biogenesis of a group of miRNA.

Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA).

Science.gov (United States)

Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L

2015-10-08

Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission.

High throughput 16S rRNA gene amplicon sequencing

DEFF Research Database (Denmark)

Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

Science.gov (United States)

Spirin, Alexander S

2009-11-17

A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

Mycobacterium smegmatis HelY Is an RNA-Activated ATPase/dATPase and 3'-to-5' Helicase That Unwinds 3'-Tailed RNA Duplexes and RNA:DNA Hybrids.

Science.gov (United States)

Uson, Maria Loressa; Ordonez, Heather; Shuman, Stewart

2015-10-01

Mycobacteria have a large and distinctive ensemble of DNA helicases that function in DNA replication, repair, and recombination. Little is known about the roster of RNA helicases in mycobacteria or their roles in RNA transactions. The 912-amino-acid Mycobacterium smegmatis HelY (MSMEG_3885) protein is a bacterial homolog of the Mtr4 and Ski2 helicases that regulate RNA 3' processing and turnover by the eukaryal exosome. Here we characterize HelY as an RNA-stimulated ATPase/dATPase and an ATP/dATP-dependent 3'-to-5' helicase. HelY requires a 3' single-strand RNA tail (a loading RNA strand) to displace the complementary strand of a tailed RNA:RNA or RNA:DNA duplex. The findings that HelY ATPase is unresponsive to a DNA polynucleotide cofactor and that HelY is unable to unwind a 3'-tailed duplex in which the loading strand is DNA distinguish HelY from other mycobacterial nucleoside triphosphatases/helicases characterized previously. The biochemical properties of HelY, which resemble those of Mtr4/Ski2, hint at a role for HelY in mycobacterial RNA catabolism. RNA helicases play crucial roles in transcription, RNA processing, and translation by virtue of their ability to alter RNA secondary structure or remodel RNA-protein interactions. In eukarya, the RNA helicases Mtr4 and Ski2 regulate RNA 3' resection by the exosome. Mycobacterium smegmatis HelY, a bacterial homolog of Mtr4/Ski2, is characterized here as a unidirectional helicase, powered by RNA-dependent ATP/dATP hydrolysis, that tracks 3' to 5' along a loading RNA strand to displace the complementary strand of a tailed RNA:RNA or RNA:DNA duplex. The biochemical properties of HelY suggest a role in bacterial RNA transactions. HelY homologs are present in pathogenic mycobacteria (e.g., M. tuberculosis and M. leprae) and are widely prevalent in Actinobacteria and Cyanobacteria but occur sporadically elsewhere in the bacterial domain. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Lethality and Developmental Delay of Drosophila melanogaster Following Ingestion of Selected Pseudomonas fluorescens Strains

Science.gov (United States)

Pseudomonas fluorescens secretes antimicrobial compounds that promote plant health and provide protection from pathogens. We used a non-invasive feeding assay to study the toxicity of P. fluorescens strains Pf0-1, SBW25, and Pf-5 to Drosophila melanogaster. The three strains of P. fluorescens varie...