WorldWideScience

Sample records for melanogaster 5s rna

  1. Chaperoning 5S RNA assembly.

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  2. 5S rRNA and ribosome.

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  3. Eukaryotic 5S rRNA biogenesis

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  4. Developmental regulation of Xenopus 5S RNA genes

    Wormington, W.M.; Schlissel, M.; Brown, D.D.

    1983-01-01

    In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

  5. 5S ribosomal RNA database Y2K.

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  6. Increased 5S rRNA oxidation in Alzheimer's disease.

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  7. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  8. MicroRNA function in Drosophila melanogaster.

    Carthew, Richard W; Agbu, Pamela; Giri, Ritika

    2017-05-01

    Over the last decade, microRNAs have emerged as critical regulators in the expression and function of animal genomes. This review article discusses the relationship between microRNA-mediated regulation and the biology of the fruit fly Drosophila melanogaster. We focus on the roles that microRNAs play in tissue growth, germ cell development, hormone action, and the development and activity of the central nervous system. We also discuss the ways in which microRNAs affect robustness. Many gene regulatory networks are robust; they are relatively insensitive to the precise values of reaction constants and concentrations of molecules acting within the networks. MicroRNAs involved in robustness appear to be nonessential under uniform conditions used in conventional laboratory experiments. However, the robust functions of microRNAs can be revealed when environmental or genetic variation otherwise has an impact on developmental outcomes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. 5S rRNA-derived and tRNA-derived SINEs in fruit bats.

    Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A

    2009-05-01

    Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.

  10. Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

    Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

    1987-01-01

    A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

  11. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  12. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  13. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  14. Time of action of 4.5 S RNA in Escherichia coli translation

    Brown, S

    1989-01-01

    A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  15. Genetic selection and DNA sequences of 4.5S RNA homologs

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  16. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  17. How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?

    Pelczar, P.; Fiett, J.; Bartnik, E.

    1994-01-01

    We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig

  18. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  19. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  20. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  1. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  2. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  3. The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

    1986-01-01

    We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...

  4. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  5. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  6. Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

    Kamina, Anyango D; Williams, Noreen

    2017-01-01

    RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

  7. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus

  8. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    Brown, S; Fournier, M J

    1984-01-01

    The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...

  9. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

    Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

    2011-01-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

  11. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-02-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

  12. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  13. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  14. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  15. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    Leontis, N B; Westhof, E

    1998-09-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  16. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  17. Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

    Curtiss, W C; Vournakis, J N

    1984-01-01

    Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

  18. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  19. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  20. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  1. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    Christiansen, J; Douthwaite, S R; Christensen, A

    1985-01-01

    Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...

  2. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  3. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  4. Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation

    Terao, K.; Uchiumi, T.; Ogata, K.

    1980-01-01

    After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)

  5. In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes

    Schubert, I.; Baeumlein, H.; Wobus, U.

    1978-01-01

    In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)

  6. Evolution of green plants as deduced from 5S rRNA sequences.

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  7. Dosage compensation of serine-4 transfer RNA in Drosophila melanogaster

    Birchler, J.A.; Owenby, R.K.; Jacobson, K.B.

    1982-01-01

    A dosage series of the X chromosome site for serine-4 transfer RNA consisting of one of three copies in females and one to two in males was constructed to test whether transfer RNA expression is governed by dosage compensation. A dosage effect on the level of the serine-4 isoacceptor was observed in both females and males when the structural locus was varied. However, in males, each dose had a relatively greater expression so the normal one dose was slightly greater than the total female value and the duplicated male had the highest relative expression of all the types examined. Serine-4 levels in males and females from an isogenic Oregon-R stock were similar. Thus the transfer RNA levels conform to the expectations of dosage compensation

  8. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  9. A ribonuclease-resistant region of 5S RNA and its relation to the RNA binding sites of proteins L18 and L25

    Douthwaite, S; Garrett, R A; Wagner, R

    1979-01-01

    An RNA fragment, constituting three subfragments of nucleotide sequences 1-11, 69-87 and 89-120, is the most ribonuclease-resistant part of the native 5S RNA of Escherichia coli, at 0 degrees C. A smaller fragment of nucleotide sequence 69-87 and 90-110 is ribonuclease-resistant at 25 degrees....... Degradation of the L25-5S RNA complex with ribonuclease A or T2 yielded RNA fragments similar to those of the free 5S RNA at 0 degrees C and 25 degrees C; moreover L25 remained strongly bound to both RNA fragments and also produced some opening of the RNA structure in at least two positions. Protein L18...... initially protected most of the 5S RNA against ribonuclease digestion, at 0 degrees C, but was then gradually released prior to the formation of the larger RNA fragment. It cannot be concluded, therefore, as it was earlier (Gray et al., 1973), that this RNA fragment contains the primary binding site of L18....

  10. RNA editing in Drosophila melanogaster: new targets and functionalconsequences

    Stapleton, Mark; Carlson, Joseph W.; Celniker, Susan E.

    2006-09-05

    Adenosine deaminases that act on RNA (ADARs) catalyze the site-specific conversion of adenosine to inosine in primary mRNA transcripts. These re-coding events affect coding potential, splice-sites, and stability of mature mRNAs. ADAR is an essential gene and studies in mouse, C. elegans, and Drosophila suggest its primary function is to modify adult behavior by altering signaling components in the nervous system. By comparing the sequence of isogenic cDNAs to genomic DNA, we have identified and experimentally verified 27 new targets of Drosophila ADAR. Our analyses lead us to identify new classes of genes whose transcripts are targets of ADAR including components of the actin cytoskeleton, and genes involved in ion homeostasis and signal transduction. Our results indicate that editing in Drosophila increases the diversity of the proteome, and does so in a manner that has direct functional consequences on protein function.

  11. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  12. Evolution of primary and secondary structures in 5S and 5.8S rRNA

    Curtiss, W.C.

    1986-01-01

    The secondary structure of Bombyx mori 5S rRNA was studied using the sing-strand specific S1 nuclease and the base pair specific cobra venom ribonuclease. The RNA was end-labeled with [ 32 P] at either the 5' or 3' end and sequenced using enzymatic digestion techniques. These enzymatic data coupled with thermodynamic structure prediction were used to generate a secondary structure for 5S rRNA. A computer algorithm has been implemented to aid in the comparison of a large set of homologous RNAs. Eukaryotic 5S rRNA sequences from thirty four diverse species were compared by (1) alignment or the sequences, (2) the positions of substitutions were located with respect to the aligned sequence and secondary structure, and (3) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. Eukaryotic 5S rRNA was found to have significant sequence variation throughout much of the molecule while maintaining a relatively constant secondary structure. A detailed analysis of the sequence and structure variability in each region of the molecule is presented

  13. Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

    Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

    2014-05-04

    The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

  14. Timing of RNA synthesis for sperimiogenesis in organ cultures of Drosophila melanogaster teste

    Gould-Somero, M; Holland, L

    1974-01-01

    A method for the organ culture of Drosophila testes is described which supports the differentiation of primary spermatocytes through the meiotic divisions to elongating spermatids. Autoradiographic and inhibitor studies reveal no evidence for RNA synthesis by developing spermatids of Drosophila melanogaster; most, if not all, of the RNA required for the differentiation and elongation of sperm is synthesized earlier in the primary spermatocytes. Primary spermatocytes will differentiate into elongating spermatids in organ culture, despite severe (96 to 98%) inhibition of /sup 3/H-uridine incorporation into RNA effected by 50 ..mu..g/ml 3'-deoxyadenosine. Protein synthesis in spermatids continues to be active in the presence of 3'-deoxyadenosine, but that in growing spermatocytes is severely inhibited.

  15. Genetic Determinants of RNA Editing Levels of ADAR Targets in Drosophila melanogaster

    Yerbol Z. Kurmangaliyev

    2016-02-01

    Full Text Available RNA editing usually affects only a fraction of expressed transcripts and there is a vast amount of variation in editing levels of ADAR (adenosine deaminase, RNA-specific targets. Here we explore natural genetic variation affecting editing levels of particular sites in 81 natural strains of Drosophila melanogaster. The analysis of associations between editing levels and single-nucleotide polymorphisms allows us to map putative cis-regulatory regions affecting editing of 16 A-to-I editing sites (cis-RNA editing quantitative trait loci or cis-edQTLs, P < 10−8. The observed changes in editing levels are validated by independent molecular technique. All identified regulatory variants are located in close proximity of modulated editing sites. Moreover, colocalized editing sites are often regulated by same loci. Similar to expression and splicing QTL studies, the characterization of edQTLs will greatly expand our understanding of cis-regulatory evolution of gene expression.

  16. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

  17. Viral unmasking of cellular 5S rRNA pseudogene transcripts induces RIG-I-mediated immunity.

    Chiang, Jessica J; Sparrer, Konstantin M J; van Gent, Michiel; Lässig, Charlotte; Huang, Teng; Osterrieder, Nikolaus; Hopfner, Karl-Peter; Gack, Michaela U

    2018-01-01

    The sensor RIG-I detects double-stranded RNA derived from RNA viruses. Although RIG-I is also known to have a role in the antiviral response to DNA viruses, physiological RNA species recognized by RIG-I during infection with a DNA virus are largely unknown. Using next-generation RNA sequencing (RNAseq), we found that host-derived RNAs, most prominently 5S ribosomal RNA pseudogene 141 (RNA5SP141), bound to RIG-I during infection with herpes simplex virus 1 (HSV-1). Infection with HSV-1 induced relocalization of RNA5SP141 from the nucleus to the cytoplasm, and virus-induced shutoff of host protein synthesis downregulated the abundance of RNA5SP141-interacting proteins, which allowed RNA5SP141 to bind RIG-I and induce the expression of type I interferons. Silencing of RNA5SP141 strongly dampened the antiviral response to HSV-1 and the related virus Epstein-Barr virus (EBV), as well as influenza A virus (IAV). Our findings reveal that antiviral immunity can be triggered by host RNAs that are unshielded following depletion of their respective binding proteins by the virus.

  18. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  19. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  20. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  1. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

    Stern David B

    2010-09-01

    Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  2. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of post...

  3. Effects of mutation on the downfield proton nuclear magnetic resonance spectrum of the 5S RNA of Escherichia coli

    Gewirth, D.T.; Moore, P.B.

    1987-01-01

    The imino proton spectra of several mutants of the 5S RNA of Escherichia coli are compared with that of the wild type. Three of the variants discussed are point mutations, and the fourth is a deletion mutant lacking bases 11-69 of the parent sequence, all obtained by site-directed mutagenesis techniques. The spectroscopic effects of mutation are limited in all cases, and the differences between normal and mutant spectra can be used to make or confirm the assignments of resonances. Several new assignments in the 5S spectrum are reported. Spectroscopic differences due to sequence differences permit the products of single genes within the 5S gene family to be distinguished and their fates followed by NMR

  4. Origin of sphinx, a young chimeric RNA gene in Drosophila melanogaster

    Wang, Wen; Brunet, Frédéric G.; Nevo, Eviatar; Long, Manyuan

    2002-01-01

    Non-protein-coding RNA genes play an important role in various biological processes. How new RNA genes originated and whether this process is controlled by similar evolutionary mechanisms for the origin of protein-coding genes remains unclear. A young chimeric RNA gene that we term sphinx (spx) provides the first insight into the early stage of evolution of RNA genes. spx originated as an insertion of a retroposed sequence of the ATP synthase chain F gene at the cytological region 60DB since the divergence of Drosophila melanogaster from its sibling species 2–3 million years ago. This retrosequence, which is located at 102F on the fourth chromosome, recruited a nearby exon and intron, thereby evolving a chimeric gene structure. This molecular process suggests that the mechanism of exon shuffling, which can generate protein-coding genes, also plays a role in the origin of RNA genes. The subsequent evolutionary process of spx has been associated with a high nucleotide substitution rate, possibly driven by a continuous positive Darwinian selection for a novel function, as is shown in its sex- and development-specific alternative splicing. To test whether spx has adapted to different environments, we investigated its population genetic structure in the unique “Evolution Canyon” in Israel, revealing a similar haplotype structure in spx, and thus similar evolutionary forces operating on spx between environments. PMID:11904380

  5. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  7. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  8. Genetic Determinants of RNA Editing Levels of ADAR Targets in Drosophila melanogaster.

    Kurmangaliyev, Yerbol Z; Ali, Sammi; Nuzhdin, Sergey V

    2015-12-12

    RNA editing usually affects only a fraction of expressed transcripts and there is a vast amount of variation in editing levels of ADAR (adenosine deaminase, RNA-specific) targets. Here we explore natural genetic variation affecting editing levels of particular sites in 81 natural strains of Drosophila melanogaster. The analysis of associations between editing levels and single-nucleotide polymorphisms allows us to map putative cis-regulatory regions affecting editing of 16 A-to-I editing sites (cis-RNA editing quantitative trait loci or cis-edQTLs, P < 10(-8)). The observed changes in editing levels are validated by independent molecular technique. All identified regulatory variants are located in close proximity of modulated editing sites. Moreover, colocalized editing sites are often regulated by same loci. Similar to expression and splicing QTL studies, the characterization of edQTLs will greatly expand our understanding of cis-regulatory evolution of gene expression. Copyright © 2016 Kurmangaliyev et al.

  9. Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

  10. 5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger.

    Zheng, Xiaomei; Zheng, Ping; Zhang, Kun; Cairns, Timothy C; Meyer, Vera; Sun, Jibin; Ma, Yanhe

    2018-04-30

    The CRISPR/Cas9 system is a revolutionary genome editing tool. However, in eukaryotes, search and optimization of a suitable promoter for guide RNA expression is a significant technical challenge. Here we used the industrially important fungus, Aspergillus niger, to demonstrate that the 5S rRNA gene, which is both highly conserved and efficiently expressed in eukaryotes, can be used as a guide RNA promoter. The gene editing system was established with 100% rates of precision gene modifications among dozens of transformants using short (40-bp) homologous donor DNA. This system was also applicable for generation of designer chromosomes, as evidenced by deletion of a 48 kb gene cluster required for biosynthesis of the mycotoxin fumonisin B1. Moreover, this system also facilitated simultaneous mutagenesis of multiple genes in A. niger. We anticipate that the use of the 5S rRNA gene as guide RNA promoter can broadly be applied for engineering highly efficient eukaryotic CRISPR/Cas9 toolkits. Additionally, the system reported here will enable development of designer chromosomes in model and industrially important fungi.

  11. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  12. Mutations in the gene for EF-G reduce the requirement for 4.5S RNA in the growth of E. coli

    Brown, S

    1987-01-01

    A general strategy is described for the isolation of suppressors of essential genes whose functions are unknown. This strategy was used to analyze the role of 4.5S RNA, an essential RNA of E. coli. In this strategy, the structural gene for 4.5S RNA is fused to the Ptac promoter in such a way...... that the strain becomes dependent upon inducers of lac for growth. Mutants mapping to fus, the structural gene for protein synthesis elongation factor G, appear as spontaneous, inducer-independent revertants. These mutants alter the intracellular distribution of 4.5S RNA such that it sediments at 70S or greater....... Furthermore, the increased sedimentation velocity is sensitive to the antibiotic puromycin. These results show that 4.5S RNA physically associates with the ribosome in performing its essential function, and that this association is mediated by elongation factor G....

  13. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  14. Polynucleotide Phosphorylase, RNase E/G, and YbeY Are Involved in the Maturation of 4.5S RNA in Corynebacterium glutamicum.

    Maeda, Tomoya; Tanaka, Yuya; Wachi, Masaaki; Inui, Masayuki

    2017-03-01

    Corynebacterium glutamicum has been applied for the industrial production of various metabolites, such as amino acids. To understand the biosynthesis of the membrane protein in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP is found in all three domains of life and plays an important role in the membrane insertion of proteins. SRP RNA is initially transcribed as precursor molecules; however, relatively little is known about its maturation. In C. glutamicum , SRP consists of the Ffh protein and 4.5S RNA lacking an Alu domain. In this study, we found that 3'-to-5' exoribonuclease, polynucleotide phosphorylase (PNPase), and two endo-type RNases, RNase E/G and YbeY, are involved in the 3' maturation of 4.5S RNA in C. glutamicum The mature form of 4.5S RNA was inefficiently formed in Δ rneG Δ pnp mutant cells, suggesting the existence of an alternative pathway for the 3' maturation of 4.5S RNA. Primer extension analysis also revealed that the 5' mature end of 4.5S RNA corresponds to that of the transcriptional start site. Immunoprecipitated Ffh protein contained immature 4.5S RNA in Δ pnp , Δ rneG , and Δ ybeY mutants, suggesting that 4.5S RNA precursors can interact with Ffh. These results imply that the maturation of 4.5S RNA can be performed in the 4.5S RNA-Ffh complex. IMPORTANCE Overproduction of a membrane protein, such as a transporter, is useful for engineering of strains of Corynebacterium glutamicum , which is a workhorse of amino acid production. To understand membrane protein biogenesis in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP contains the Ffh protein and SRP RNA and plays an important role in the membrane insertion of proteins. Although SRP RNA is highly conserved among the three domains of life, relatively little is known about its maturation. We show that PNPase, RNase E/G, and YbeY are involved in the 3' maturation of the SRP RNA (4.5S RNA) in

  15. RNA editing differently affects protein-coding genes in D. melanogaster and H. sapiens.

    Grassi, Luigi; Leoni, Guido; Tramontano, Anna

    2015-07-14

    When an RNA editing event occurs within a coding sequence it can lead to a different encoded amino acid. The biological significance of these events remains an open question: they can modulate protein functionality, increase the complexity of transcriptomes or arise from a loose specificity of the involved enzymes. We analysed the editing events in coding regions that produce or not a change in the encoded amino acid (nonsynonymous and synonymous events, respectively) in D. melanogaster and in H. sapiens and compared them with the appropriate random models. Interestingly, our results show that the phenomenon has rather different characteristics in the two organisms. For example, we confirm the observation that editing events occur more frequently in non-coding than in coding regions, and report that this effect is much more evident in H. sapiens. Additionally, in this latter organism, editing events tend to affect less conserved residues. The less frequently occurring editing events in Drosophila tend to avoid drastic amino acid changes. Interestingly, we find that, in Drosophila, changes from less frequently used codons to more frequently used ones are favoured, while this is not the case in H. sapiens.

  16. Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development.

    Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton

    2017-07-01

    The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

  17. Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

    Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

    2012-01-01

    5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

  18. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  19. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  20. A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

  1. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  2. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  3. DNAzyme-mediated recovery of small recombinant RNAs from a 5S rRNA-derived chimera expressed in Escherichia coli

    Willson Richard C

    2010-12-01

    Full Text Available Abstract Background Manufacturing large quantities of recombinant RNAs by overexpression in a bacterial host is hampered by their instability in intracellular environment. To overcome this problem, an RNA of interest can be fused into a stable bacterial RNA for the resulting chimeric construct to accumulate in the cytoplasm to a sufficiently high level. Being supplemented with cost-effective procedures for isolation of the chimera from cells and recovery of the recombinant RNA from stabilizing scaffold, this strategy might become a viable alternative to the existing methods of chemical or enzymatic RNA synthesis. Results Sequence encoding a 71-nucleotide recombinant RNA was inserted into a plasmid-borne deletion mutant of the Vibrio proteolyticus 5S rRNA gene in place of helix III - loop C segment of the original 5S rRNA. After transformation into Escherichia coli, the chimeric RNA (3×pen aRNA was expressed constitutively from E. coli rrnB P1 and P2 promoters. The RNA chimera accumulated to levels that exceeded those of the host's 5S rRNA. A novel method relying on liquid-solid partitioning of cellular constituents was developed for isolation of total RNA from bacterial cells. This protocol avoids toxic chemicals, and is therefore more suitable for large scale RNA purification than traditional methods. A pair of biotinylated 8-17 DNAzymes was used to bring about the quantitative excision of the 71-nt recombinant RNA from the chimera. The recombinant RNA was isolated by sequence-specific capture on beads with immobilized complementary deoxyoligonucleotide, while DNAzymes were recovered by biotin affinity chromatography for reuse. Conclusions The feasibility of a fermentation-based approach for manufacturing large quantities of small RNAs in vivo using a "5S rRNA scaffold" strategy is demonstrated. The approach provides a route towards an economical method for the large-scale production of small RNAs including shRNAs, siRNAs and aptamers for use

  4. Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli

    Brown, S

    1991-01-01

    4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....

  5. Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing

    Kelleher, Erin S.

    2016-01-01

    Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614

  6. An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

    Timmins, P.A.; Langowski, J.; Brown, R.S.

    1988-01-01

    The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA

  7. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  8. RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells

    Gilmour, D.S.; Lis, J.T.

    1986-01-01

    By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation

  9. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  10. Determination of the number of copies of genes coding for 5s-rRNA and tRNA in the genomes of 43 species of wheat and Aegilops

    Vakhitov, V.A.; Gimalov, F.R.; Nikonorov, Yu.M.

    1986-01-01

    The number of 5s-rRNA and tRNA genes has been studied in 43 species of wheat and Aegilops differing in ploidy level, genomic composition and origin. It has been demonstrated that the repeatability of the 5s-rRNA and tRNA genes increases in wheat with increasing ploidy level, but not in proportion to the genome size. In Aegilops, in distinction from wheat, the relative as well as absolute number of 5s-RNA genes increases with increasing ploidy level. The proportion of the sequences coding for tRNA in the dipoloid and polyploid Aegilops species is practically similar, while the number of tRNA genes increases almost 2-3 times with increasing ploidy level. Large variability has been recorded between the species with similar genomic composition and ploidy level in respect of the number of the 5s-rRNA and tRNA genes. It has been demonstrated that integration of the initial genomes of the amphidiploids is accompanied by elimination of a particular part of these genomes. It has been concluded that the mechanisms of establishment and evolution of genomes in the intra- and intergeneric allopolyploids are not identical

  11. Ultraviolet light-induced crosslinking reveals a unique region of local tertiary structure in potato spindle tuber viroid and HeLa 5S RNA

    Branch, A.D.; Benenfeld, B.J.; Robertson, H.D.

    1985-01-01

    The positions of intramolecular crosslinks induced by irradiation with ultraviolet light were mapped into potato spindle tuber viroid RNA and HeLa 5S rRNA. Crosslinking in each of these molecules occurred at a single major site, which was located by RNA fingerprinting and secondary analysis. Various lines of evidence suggest that these crosslinks identify a previously undescribed element of local tertiary structure common to these two widely divergent RNA molecules: (i) both crosslinks occur in an identical eight-base context, with the sequence 5 GGGAA 3 on one side and the sequence 5 UAC 3 on the other; (ii) both crosslinks connect bases that are not thought to be involved in conventional hydrogen bonding, within regions usually depicted as single-stranded loops flanked by short helical segments; and (iii) both crosslinks connect a purine and a pyrimidine residue, and both may generate the same G-U dimer. Furthermore, it is likely that the crosslinking site is of functional significance because it is located within the most highly conserved region of the viroid sequence and involves bases that are essentially invariant among eukaryotic 5S rRNA molecules

  12. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair.

  13. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  14. The Role of piRNA-Mediated Epigenetic Silencing in the Population Dynamics of Transposable Elements in Drosophila melanogaster.

    Yuh Chwen G Lee

    2015-06-01

    Full Text Available The piwi-interacting RNAs (piRNA are small RNAs that target selfish transposable elements (TEs in many animal genomes. Until now, piRNAs' role in TE population dynamics has only been discussed in the context of their suppression of TE transposition, which alone is not sufficient to account for the skewed frequency spectrum and stable containment of TEs. On the other hand, euchromatic TEs can be epigenetically silenced via piRNA-dependent heterochromatin formation and, similar to the widely known "Position-effect variegation", heterochromatin induced by TEs can "spread" into nearby genes. We hypothesized that the piRNA-mediated spread of heterochromatin from TEs into adjacent genes has deleterious functional effects and leads to selection against individual TEs. Unlike previously identified deleterious effects of TEs due to the physical disruption of DNA, the functional effect we investigated here is mediated through the epigenetic influences of TEs. We found that the repressive chromatin mark, H3K9me, is elevated in sequences adjacent to euchromatic TEs at multiple developmental stages in Drosophila melanogaster. Furthermore, the heterochromatic states of genes depend not only on the number of and distance from adjacent TEs, but also on the likelihood that their nearest TEs are targeted by piRNAs. These variations in chromatin status probably have functional consequences, causing genes near TEs to have lower expression. Importantly, we found stronger selection against TEs that lead to higher H3K9me enrichment of adjacent genes, demonstrating the pervasive evolutionary consequences of TE-induced epigenetic silencing. Because of the intrinsic biological mechanism of piRNA amplification, spread of TE heterochromatin could result in the theoretically required synergistic deleterious effects of TE insertions for stable containment of TE copy number. The indirect deleterious impact of piRNA-mediated epigenetic silencing of TEs is a previously

  15. RNA-Sequencing of Drosophila melanogaster Head Tissue on High-Sugar and High-Fat Diets

    Wayne Hemphill

    2018-01-01

    Full Text Available Obesity has been shown to increase risk for cardiovascular disease and type-2 diabetes. In addition, it has been implicated in aggravation of neurological conditions such as Alzheimer’s. In the model organism Drosophila melanogaster, a physiological state mimicking diet-induced obesity can be induced by subjecting fruit flies to a solid medium disproportionately higher in sugar than protein, or that has been supplemented with a rich source of saturated fat. These flies can exhibit increased circulating glucose levels, increased triglyceride content, insulin-like peptide resistance, and behavior indicative of neurological decline. We subjected flies to variants of the high-sugar diet, high-fat diet, or normal (control diet, followed by a total RNA extraction from fly heads of each diet group for the purpose of Poly-A selected RNA-Sequencing. Our objective was to identify the effects of obesogenic diets on transcriptome patterns, how they differed between obesogenic diets, and identify genes that may relate to pathogenesis accompanying an obesity-like state. Gene ontology analysis indicated an overrepresentation of affected genes associated with immunity, metabolism, and hemocyanin in the high-fat diet group, and CHK, cell cycle activity, and DNA binding and transcription in the high-sugar diet group. Our results also indicate differences in the effects of the high-fat diet and high-sugar diet on expression profiles in head tissue of flies, despite the reportedly similar phenotypic impacts of the diets. The impacted genes, and how they may relate to pathogenesis in the Drosophila obesity-like state, warrant further experimental investigation.

  16. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. The ADAR RNA editing enzyme controls neuronal excitability in Drosophila melanogaster

    Li, Xianghua; Overton, Ian M.; Baines, Richard A.; Keegan, Liam P.; O’Connell, Mary A.

    2014-01-01

    RNA editing by deamination of specific adenosine bases to inosines during pre-mRNA processing generates edited isoforms of proteins. Recoding RNA editing is more widespread in Drosophila than in vertebrates. Editing levels rise strongly at metamorphosis, and Adar5G1 null mutant flies lack editing events in hundreds of CNS transcripts; mutant flies have reduced viability, severely defective locomotion and age-dependent neurodegeneration. On the other hand, overexpressing an adult dADAR isoform with high enzymatic activity ubiquitously during larval and pupal stages is lethal. Advantage was taken of this to screen for genetic modifiers; Adar overexpression lethality is rescued by reduced dosage of the Rdl (Resistant to dieldrin), gene encoding a subunit of inhibitory GABA receptors. Reduced dosage of the Gad1 gene encoding the GABA synthetase also rescues Adar overexpression lethality. Drosophila Adar5G1 mutant phenotypes are ameliorated by feeding GABA modulators. We demonstrate that neuronal excitability is linked to dADAR expression levels in individual neurons; Adar-overexpressing larval motor neurons show reduced excitability whereas Adar5G1 null mutant or targeted Adar knockdown motor neurons exhibit increased excitability. GABA inhibitory signalling is impaired in human epileptic and autistic conditions, and vertebrate ADARs may have a relevant evolutionarily conserved control over neuronal excitability. PMID:24137011

  18. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  19. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  20. Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

    Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

    2015-12-21

    5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  1. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  2. Fluorescent in situ hybridization of the ribosomal RNA genes (5S and 35S in the genus Lolium: Lolium canariense, the missing link with Festuca?

    Inda, Luis A.

    2013-06-01

    Full Text Available Two groups of taxa can be distinguished within the genus Lolium L. based on the pollination system, chromosome size, chromosomal location of nrDNA (5S and 35S (18S-5.8S-26S] and nrDNA phylogeny. The first group includes self-pollinated taxa (L. temulentum, L. persicum and L. remotum, whereas the second group comprises cross-pollinated species (L. perenne, L. multiflorum and L. rigidum. Here we describe that the autogamous species have two 5S sites and four 35S sites in their genome. Two of the 35S sites are present in the chromosomes containing the 5S regions. The allogamous taxa possess two 5S rDNA sites and 6-10 35S sites per genome, depending on the species. Two of these regions (35S may also be present in the chromosomes bearing 5S sites. Our study also demonstrates that Lolium canariense shows a distinctive pattern. It has two 5S and four 35S sites. In this case, the 35S loci are located in different chromosomes than the 5S. This cytogenetic pattern is consistent with that of Festuca pratensis. Thus, despite being allogamous, Lolium canariense does not entirely fit in either of the groups defined for the genus Lolium. The physical mapping of the nrDNA regions in L. canariense is different, and resembles that of F. pratensis, suggesting that this Macaronesian Lolium could be intermediate between Festuca and Lolium.En trabajos previos se ha descrito que el género Lolium L. está formado por dos grupos de taxones basados en el tipo de polinización, tamaño de los cromosomas, localización cromosómica de los loci del ADN ribosómico [5S y 35S (18S-5.8S-26S] y filogenia molecular basada en secuencias de ADN ribosómico. Los dos grupos son: especies autógamas (L. temulentum, L. persicum y L. remotum y especies alógamas (L. perenne, L. multiflorum y L. rigidum. Aquí describimos que según la localización cromosómica de los loci ribosómicos, las especies autógamas tienen dos sitios 5S y cuatro sitios 35S; dos de las cuales coinciden en

  3. The RNA-binding proteins FMR1, rasputin and caprin act together with the UBA protein lingerer to restrict tissue growth in Drosophila melanogaster.

    Roland Baumgartner

    Full Text Available Appropriate expression of growth-regulatory genes is essential to ensure normal animal development and to prevent diseases like cancer. Gene regulation at the levels of transcription and translational initiation mediated by the Hippo and Insulin signaling pathways and by the TORC1 complex, respectively, has been well documented. Whether translational control mediated by RNA-binding proteins contributes to the regulation of cellular growth is less clear. Here, we identify Lingerer (Lig, an UBA domain-containing protein, as growth suppressor that associates with the RNA-binding proteins Fragile X mental retardation protein 1 (FMR1 and Caprin (Capr and directly interacts with and regulates the RNA-binding protein Rasputin (Rin in Drosophila melanogaster. lig mutant organs overgrow due to increased proliferation, and a reporter for the JAK/STAT signaling pathway is upregulated in a lig mutant situation. rin, Capr or FMR1 in combination as double mutants, but not the respective single mutants, display lig like phenotypes, implicating a redundant function of Rin, Capr and FMR1 in growth control in epithelial tissues. Thus, Lig regulates cell proliferation during development in concert with Rin, Capr and FMR1.

  4. The RNA-binding proteins FMR1, rasputin and caprin act together with the UBA protein lingerer to restrict tissue growth in Drosophila melanogaster.

    Baumgartner, Roland; Stocker, Hugo; Hafen, Ernst

    2013-01-01

    Appropriate expression of growth-regulatory genes is essential to ensure normal animal development and to prevent diseases like cancer. Gene regulation at the levels of transcription and translational initiation mediated by the Hippo and Insulin signaling pathways and by the TORC1 complex, respectively, has been well documented. Whether translational control mediated by RNA-binding proteins contributes to the regulation of cellular growth is less clear. Here, we identify Lingerer (Lig), an UBA domain-containing protein, as growth suppressor that associates with the RNA-binding proteins Fragile X mental retardation protein 1 (FMR1) and Caprin (Capr) and directly interacts with and regulates the RNA-binding protein Rasputin (Rin) in Drosophila melanogaster. lig mutant organs overgrow due to increased proliferation, and a reporter for the JAK/STAT signaling pathway is upregulated in a lig mutant situation. rin, Capr or FMR1 in combination as double mutants, but not the respective single mutants, display lig like phenotypes, implicating a redundant function of Rin, Capr and FMR1 in growth control in epithelial tissues. Thus, Lig regulates cell proliferation during development in concert with Rin, Capr and FMR1.

  5. Mapping of the 18S and 5S ribosomal RNA genes in Astyanax altiparanae Garutti & Britski, 2000 (Teleostei, Characidae from the upper Paraná river basin, Brazil

    Carlos Alexandre Fernandes

    2006-01-01

    Full Text Available Fluorescence in situ hybridization (FISH was undertaken in order to determinate the chromosomal distribution pattern of 18S and 5S ribosomal DNAs (rDNA in four populations of the characid fish Astyanax altiparanae from the upper Paraná river basin, Brazil. The 18S rDNA probe FISH revealed numerical and positional variations among specimens from the Keçaba stream compared to specimens of the other populations studied. In contrast to the variable 18S rDNA distribution pattern, highly stable chromosomal positioning of the 5S rDNA sites was observed in the four A. altiparanae populations. Divergence in the distribution pattern of 18S and 5S rDNA sites is also discussed.

  6. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.

  7. Genome-wide miRNA screening reveals miR-310 family members negatively regulate the immune response in Drosophila melanogaster via co-targeting Drosomycin.

    Li, Yao; Li, Shengjie; Li, Ruimin; Xu, Jiao; Jin, Ping; Chen, Liming; Ma, Fei

    2017-03-01

    Although innate immunity mediated by Toll signaling has been extensively studied in Drosophila melanogaster, the role of miRNAs in regulating the Toll-mediated immune response remains largely unknown. In this study, following Gram-positive bacterial challenge, we identified 93 differentially expressed miRNAs via genome-wide miRNA screening. These miRNAs were regarded as immune response related (IRR). Eight miRNAs were confirmed to be involved in the Toll-mediated immune response upon Gram-positive bacterial infection through genetic screening of 41 UAS-miRNA lines covering 60 miRNAs of the 93 IRR miRNAs. Interestingly, four out of these eight miRNAs, miR-310, miR-311, miR-312 and miR-313, are clustered miRNAs and belong to the miR-310 family. These miR-310 family members were shown to target and regulate the expression of Drosomycin, an antimicrobial peptide produced by Toll signaling. Taken together, our study implies important regulatory roles of miRNAs in the Toll-mediated innate immune response of Drosophila upon Gram-positive bacterial infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    Garcia, S.; Kovařík, Aleš

    2013-01-01

    Roč. 111, č. 1 (2013), s. 23-33 ISSN 0018-067X R&D Projects: GA ČR(CZ) GA13-10057S; GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : rRNA gene organisation * intergenic spacer * Ginkgo Subject RIV: BO - Biophysics Impact factor: 3.804, year: 2013

  9. Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

    Oesterberg, R.; Garrett, A.

    1977-01-01

    The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

  10. VHL Frameshift Mutation as Target of Nonsense-Mediated mRNA Decay in Drosophila melanogaster and Human HEK293 Cell Line

    Lucia Micale

    2009-01-01

    Full Text Available There are many well-studied examples of human phenotypes resulting from nonsense or frameshift mutations that are modulated by Nonsense-Mediated mRNA Decay (NMD, a process that typically degrades transcripts containing premature termination codons (PTCs in order to prevent translation of unnecessary or aberrant transcripts. Different types of germline mutations in the VHL gene cause the von Hippel-Lindau disease, a dominantly inherited familial cancer syndrome with a marked phenotypic variability and age-dependent penetrance. By generating the Drosophila UAS:Upf1D45B line we showed the possible involvement of NMD mechanism in the modulation of the c.172delG frameshift mutation located in the exon 1 of Vhl gene. Further, by Quantitative Real-time PCR (QPCR we demonstrated that the corresponding c.163delG human mutation is targeted by NMD in human HEK 293 cells. The UAS:Upf1D45B line represents a useful system to identify novel substrates of NMD pathway in Drosophila melanogaster. Finally, we suggest the possible role of NMD on the regulation of VHL mutations.

  11. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    Garcia Sònia

    2012-06-01

    Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.

  12. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Karyotype characterization of Crotalaria juncea (L. by chromosome banding and physical mapping of 18S-5.8S-26S and 5S rRNA gene sites

    Mateus Mondin

    2007-01-01

    Full Text Available The chromosomes of Crotalaria juncea, a legume of agronomic interest with a 2n = 16 karyotype composed of metacentric chromosomes, were analyzed using several cytogenetic techniques. C-banding revealed heterochromatic regions around the centromeres in all chromosomes and adjacent to the secondary constriction on the chromosome 1 short arm. Fluorescent staining with the GC-specific chromomycin A3 (CMA highlighted these heterochromatic regions and a tiny site on the chromosome 1 long arm while the AT-specific stain 4'-6-diamidino-2-phenylindole (DAPI induced a reversed pattern. Staining with CMA combined with AT-specific distamycin A (DA counterstaining quenched the pericentromeric regions of all chromosomes, but enhanced fluorescence was observed at the heterochromatic regions around the secondary constriction and on the long arms of chromosomes 1 and 4. Fluorescence in situ hybridization (FISH revealed 18S-5.8S-26S rRNA gene sites (45S rDNA on chromosomes 1 and 4, and one 5S rDNA locus on chromosome 1. All the rDNA sites were co-located with the positive-CMA/DA bands, suggesting they were very rich in GC. Silver staining revealed signals at the main 45S rDNA locus on chromosome 1 and, in some cells, chromosome 4 was labeled. Two small nucleoli were detected in a few interphase cells, suggesting that the minor site on chromosome 4 could be active at some stages of the cell cycle.

  14. 5S IN QUALITY MANAGEMENT

    BOCA GRATIELA DANA

    2015-07-01

    Full Text Available The fundamental principles of organization are customer satisfaction, eliminating waste, achieving a continuous flow in production and continuous improvement. The 5S method is a structured program for implementation the standardization and organization, simplifies the environment of the workplace (Gemba, reduce losses and unnecessary activities, and improve quality efficiency and safety. Keeping the workplace clean, providing a good working environment and promote productivity, reducing costs, ensure security and removes all types of losses. The case study present the 5S method as a tool which can be used efficiently to keep those things necessary for the proper conduct of the organization and the elimination of unless things.

  15. The RNA helicase Rm62 cooperates with SU(VAR3-9 to re-silence active transcription in Drosophila melanogaster.

    Joern Boeke

    Full Text Available Gene expression is highly dynamic and many genes show a wide range in expression over several orders of magnitude. This regulation is often mediated by sequence specific transcription factors. In addition, the tight packaging of DNA into chromatin can provide an additional layer of control resulting in a dynamic range of gene expression covering several orders of magnitude. During transcriptional activation, chromatin barriers have to be eliminated to allow an efficient progression of the RNA polymerase. This repressive chromatin structure has to be re-established quickly after it has been activated in order to tightly regulate gene activity. We show that the DExD/H box containing RNA helicase Rm62 is targeted to a site of rapid induction of transcription where it is responsible for an increased degree of methylation at H3K9 at the heat shock locus after removal of the heat shock stimulus. The RNA helicase interacts with the well-characterized histone methyltransferase SU(VAR3-9 via its N-terminus, which provides a potential mechanism for the targeting of H3K9 methylation to highly regulated genes. The recruitment of SU(VAR3-9 through interaction with a RNA helicase to a site of active transcription might be a general mechanism that allows an efficient silencing of highly regulated genes thereby enabling a cell to fine tune its gene activity over a wide range.

  16. RNA.

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  17. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  18. The translation factors of Drosophila melanogaster.

    Marygold, Steven J; Attrill, Helen; Lasko, Paul

    2017-01-02

    Synthesis of polypeptides from mRNA (translation) is a fundamental cellular process that is coordinated and catalyzed by a set of canonical 'translation factors'. Surprisingly, the translation factors of Drosophila melanogaster have not yet been systematically identified, leading to inconsistencies in their nomenclature and shortcomings in functional (Gene Ontology, GO) annotations. Here, we describe the complete set of translation factors in D. melanogaster, applying nomenclature already in widespread use in other species, and revising their functional annotation. The collection comprises 43 initiation factors, 12 elongation factors, 3 release factors and 6 recycling factors, totaling 64 of which 55 are cytoplasmic and 9 are mitochondrial. We also provide an overview of notable findings and particular insights derived from Drosophila about these factors. This catalog, together with the incorporation of the improved nomenclature and GO annotation into FlyBase, will greatly facilitate access to information about the functional roles of these important proteins.

  19. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  20. Wolbachia Influences the Maternal Transmission of the gypsy Endogenous Retrovirus in Drosophila melanogaster

    Touret, Franck; Guiguen, Francois; Terzian, Christophe

    2014-01-01

    The endosymbiotic bacteria of the genus Wolbachia are present in most insects and are maternally transmitted through the germline. Moreover, these intracellular bacteria exert antiviral activity against insect RNA viruses, as in Drosophila melanogaster, which could explain the prevalence of Wolbachia bacteria in natural populations. Wolbachia is maternally transmitted in D. melanogaster through a mechanism that involves distribution at the posterior pole of mature oocytes and then incorporati...

  1. The developmental transcriptome of Drosophila melanogaster

    University of Connecticut; Graveley, Brenton R.; Brooks, Angela N.; Carlson, Joseph W.; Duff, Michael O.; Landolin, Jane M.; Yang, Li; Artieri, Carlo G.; van Baren, Marijke J.; Boley, Nathan; Booth, Benjamin W.; Brown, James B.; Cherbas, Lucy; Davis, Carrie A.; Dobin, Alex; Li, Renhua; Lin, Wei; Malone, John H.; Mattiuzzo, Nicolas R.; Miller, David; Sturgill, David; Tuch, Brian B.; Zaleski, Chris; Zhang, Dayu; Blanchette, Marco; Dudoit, Sandrine; Eads, Brian; Green, Richard E.; Hammonds, Ann; Jiang, Lichun; Kapranov, Phil; Langton, Laura; Perrimon, Norbert; Sandler, Jeremy E.; Wan, Kenneth H.; Willingham, Aarron; Zhang, Yu; Zou, Yi; Andrews, Justen; Bicke, Peter J.; Brenner, Steven E.; Brent, Michael R.; Cherbas, Peter; Gingeras, Thomas R.; Hoskins, Roger A.; Kaufman, Thomas C.; Oliver, Brian; Celniker, Susan E.

    2010-12-02

    Drosophila melanogaster is one of the most well studied genetic model organisms; nonetheless, its genome still contains unannotated coding and non-coding genes, transcripts, exons and RNA editing sites. Full discovery and annotation are pre-requisites for understanding how the regulation of transcription, splicing and RNA editing directs the development of this complex organism. Here we used RNA-Seq, tiling microarrays and cDNA sequencing to explore the transcriptome in 30 distinct developmental stages. We identified 111,195 new elements, including thousands of genes, coding and non-coding transcripts, exons, splicing and editing events, and inferred protein isoforms that previously eluded discovery using established experimental, prediction and conservation-based approaches. These data substantially expand the number of known transcribed elements in the Drosophila genome and provide a high-resolution view of transcriptome dynamics throughout development. Drosophila melanogaster is an important non-mammalian model system that has had a critical role in basic biological discoveries, such as identifying chromosomes as the carriers of genetic information and uncovering the role of genes in development. Because it shares a substantial genic content with humans, Drosophila is increasingly used as a translational model for human development, homeostasis and disease. High-quality maps are needed for all functional genomic elements. Previous studies demonstrated that a rich collection of genes is deployed during the life cycle of the fly. Although expression profiling using microarrays has revealed the expression of, 13,000 annotated genes, it is difficult to map splice junctions and individual base modifications generated by RNA editing using such approaches. Single-base resolution is essential to define precisely the elements that comprise the Drosophila transcriptome. Estimates of the number of transcript isoforms are less accurate than estimates of the number of genes

  2. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  3. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  4. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  5. 5S-menetelmän implementointi

    Kaikula, Kari-Marko

    2017-01-01

    Tässä opinnäytetyössä tavoiteltiin siisteyden ja järjestyksen tuomista 5S-menetelmän avulla Helen Oy:n kunnossapidon varaosavarastoon Salmisaaren voimalaitoksella. Helen Oy on Helsingin kaupungin omistama energia-alan yritys. Kehittämistehtävänä työssä oli 5S-menetelmän implementointi. Tutkimuksen tarkoituksena oli tutkia niitä seikkoja, jotka vaikuttavat 5S-menetelmän käyttöönottoon. 5S on menetelmä, jolla tuodaan siisteyttä ja järjestystä työympäristöön. Tutkimusmenetelmänä oli toiminta...

  6. 5S-menetelmän pilotointi

    Lampela, Saara

    2017-01-01

    Tämän opinnäytetyön tavoitteena oli siisteys- ja järjestystason parantaminen 5S-menetelmän avulla UPM Kaukaan paperitehtaalla. 5S on tuottavuuden parantamiseen keskittyvä lean-työkalu, jonka päätehtäväksi paperitehtaalla määritettiin erityisesti seisokkitilanteissa työvälineiden ja tavaroiden etsimiseen käytetyn ajan vähentäminen sekä työn yleinen jouhevoituminen. 5S-menetelmän nimi tulee japanin kielen sanoista Seiri, Seiton, Seiso, Seiketsu ja Shitsuke. Suomeksi vaiheet ovat lajittelu, järj...

  7. The 5s25p2 - (5s25p5d + 5s5p3 + 5s25p6s + 5s25p7s) transitions in Sb II and 5s25p - (5s5p2 + 5s2nl) transitions in Sb III

    Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.

    1989-01-01

    The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig

  8. Generalized oscillator strengths for 5s, 5s', and 5p excitations of krypton

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing

    2003-01-01

    The absolute generalized oscillator strengths (GOSs) for 5s, 5s ' , 5p [5/2] 3,2 , 5p [3/2] 1,2 , and 5p [1/2] 0 transitions of krypton have been determined in a large K 2 region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s ' transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s ' transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)

  9. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  10. ADN ribosomique 5S chez Arabidopsis thaliana : dynamique chromatinienne et ARN polymérase IV

    Douet , Julien

    2008-01-01

    In Arabidopsis thaliana, 5S rRNA genes are found clustered at pericentromeric heterochromatin of chromosomes 3, 4 and 5. 5S rRNA genes transcription is epigenetically regulated through the formation of specific chromatin structure. In order to determine the events that lead to the establishment of such structures, a study during the first steps of post-germinative plant development was done. Unexpectedly, we observed a decondensation followed by a rapid "re"condensation of 5S rDNA chromatin. ...

  11. Implementacija metode 5S v proces proizvodnje

    Alojz Gorše

    2016-03-01

    Full Text Available Abstract: Research Question (RQ: The following research tries to show how the introduction of 5S methodology of work affects the production process itself, where the greatest changes are shown and how they are reflected in performance indicators. Purpose: The purpose of this project is to examine the existing methods and their application in practice as well as show the logic of actions we introduce in a particular process by using the 5S method. We will try to compare all the information using a practical example of company X. The results obtained are the basis for further improvements in an analyzed company. Method: We expect positive results in terms of certain improvements in the working environment within the company, as well as the opportunity for improvement in terms of increased efficiency and, consequently, more profit. Results: The results can represent the basis for achieving eve n better work in other processes in the studied company. It is very important to identify all the key activities that are important in generating profits while all the rest are eliminated from the process. Organization: The 5S model is applicable to all levels of the organization so it can be experienced by the highest levels of management in running a business. Society: The impact of the model will surely be seen by employees as they are offered a model after which they will work well, quickly, safely and without loss of time, which in today's world means competitive advantage. Originality: The research work represents an important contribution to the implementation of the 5S model in the company and to the positive things it brings. Limitations/Future Research: The survey as a case study was done in only one organization, in which they were implemented all phases of the method. In the direction of further research it is reasonable to make a quantitative analysis of the increase in profit, increase employee satisfaction analysis, to determine the reduction

  12. Mapping of gene mutations in drosophila melanogaster

    Halvorsen, Charlotte Marie

    2004-01-01

    In this experiment, mutant genes of a given unknown mutant strain of Drosophila melanogaster were mapped to specific chromosomes. Drosophila melanogaster, commonly known as the fruit fly, was the appropriate choice for the organism to use in this specific experiment because of its relatively rapid life cycle of 10-14 days and because of the small amount of space and food neccessary for maintaining thousands of flies. The D. Melanogaster unknown strain specifically used in this experiment wa...

  13. Differential sexual survival of Drosophila melanogaster on copper sulfate.

    Balinski, Michael A; Woodruff, Ronny C

    2017-04-01

    Based on studies of the influence of X-chromosomes on the viability of Drosophila melanogaster exposed to cadmium, and on the role of X-linked genes on copper homeostasis, we examined the effect of copper sulfate (CuSO 4 ) on offspring viability using three independent, inbred D. melanogaster crosses (ensuring identical autosomes for males and females within each cross). Each cross was performed with attached X-chromosome females and males with a single X-chromosome. As female D. melanogaster have less metallothionein RNA expression than males, we predicted fewer female offspring than male offspring in crosses exposed to CuSO 4 , even though females have two copies of X-chromosome genes, possibly resulting in overdominant heterozygosity. In two of three crosses, CuSO 4 caused significantly higher numbers of male offspring compared to female offspring. We hypothesized that these gender-based viability differences to copper exposure are caused by X-chromosome ploidy and X-linked genetic variation affecting metallothionein expression. Observed differential offspring viability responses among crosses to copper exposure also showed that different genetic backgrounds (autosomal and/or X-chromosome) can result in significant differences in heavy metal and metallothionein regulation. These results suggest that the effect of copper on offspring viability depends on both genetic background and gender, as both factors can affect the regulation of metallothionein proteins as well as homeostasis of biologically necessary heavy metals.

  14. [PIWI protein as a nucleolus visitor in Drosophila melanogaster].

    Mikhaleva, E A; Iakushev, E Iu; Stoliarenko, A D; Klenov, M S; Pozovskiĭ, Ia M; Gvozdev, V A

    2015-01-01

    The evolutionarily conserved nuclear Piwi protein of Drosophila melanogaster is a representative of the Argonaute small RNA binding protein family. Guided by small piRNAs, Piwi functions in transposon silencing in somatic and germ cells of the gonad. We found that in ovarian somatic and germ cells, as well as in the established ovarian somatic cell line, Piwi is concentrated predominantly in the nucleolus--the main nuclear compartment, participating not only in rRNA synthesis, but also in various cell stress responses. We demonstrated the colocalization of Piwi with nucleolar marker proteins--fibrillarin and Nopp140. A mutation preventing Piwi transport to the nucleus and disturbing transposon silencing (piwi(Nt)) leads to 6-8-fold upregulation of rRNA genes expression, as evaluated by the level of transcripts of transposon insertions in 28S rRNA genes. RNase treatment of live cultured ovarian somatic cells depletes Piwi from the nucleolus. The same effect is observed upon inhibiting RNA polymerase I which transcribes rRNA, but not RNA polymerase II. In contrast, upon heat shock Piwi is concentrated in the nucleolus and is depleted from the nucleoplasm. These results implicate Piwi in RNA polymerase activity modulation and stress response in the nucleolus. We discuss possible noncanonical Piwi functions along with its canonical role in transposon silencing by piRNAs.

  15. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster.

    Webster, Claire L; Waldron, Fergal M; Robertson, Shaun; Crowson, Daisy; Ferrari, Giada; Quintana, Juan F; Brouqui, Jean-Michel; Bayne, Elizabeth H; Longdon, Ben; Buck, Amy H; Lazzaro, Brian P; Akorli, Jewelna; Haddrill, Penelope R; Obbard, Darren J

    2015-07-01

    Drosophila melanogaster is a valuable invertebrate model for viral infection and antiviral immunity, and is a focus for studies of insect-virus coevolution. Here we use a metagenomic approach to identify more than 20 previously undetected RNA viruses and a DNA virus associated with wild D. melanogaster. These viruses not only include distant relatives of known insect pathogens but also novel groups of insect-infecting viruses. By sequencing virus-derived small RNAs, we show that the viruses represent active infections of Drosophila. We find that the RNA viruses differ in the number and properties of their small RNAs, and we detect both siRNAs and a novel miRNA from the DNA virus. Analysis of small RNAs also allows us to identify putative viral sequences that lack detectable sequence similarity to known viruses. By surveying >2,000 individually collected wild adult Drosophila we show that more than 30% of D. melanogaster carry a detectable virus, and more than 6% carry multiple viruses. However, despite a high prevalence of the Wolbachia endosymbiont--which is known to be protective against virus infections in Drosophila--we were unable to detect any relationship between the presence of Wolbachia and the presence of any virus. Using publicly available RNA-seq datasets, we show that the community of viruses in Drosophila laboratories is very different from that seen in the wild, but that some of the newly discovered viruses are nevertheless widespread in laboratory lines and are ubiquitous in cell culture. By sequencing viruses from individual wild-collected flies we show that some viruses are shared between D. melanogaster and D. simulans. Our results provide an essential evolutionary and ecological context for host-virus interaction in Drosophila, and the newly reported viral sequences will help develop D. melanogaster further as a model for molecular and evolutionary virus research.

  16. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  17. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Exposure to low-dose X-rays promotes peculiar autophagic cell death in Drosophila melanogaster, an effect that can be regulated by the inducible expression of Hml dsRNA

    Kanao, Tomoko [Department of Radiological Sciences, International University of Health and Welfare, Kitakanemaru 2600-1, Ohtawara-shi, Tochigi-ken 324-8501 (Japan); Miyachi, Yukihisa [Department of Radiological Sciences, International University of Health and Welfare, Kitakanemaru 2600-1, Ohtawara-shi, Tochigi-ken 324-8501 (Japan)]. E-mail: ymiyachi@iuhw.ac.jp

    2006-03-20

    We previously reported that to induce an early emergence effect with low-dose X-irradiation in Drosophila, exposure during the prepupae stage is necessary. The present study examined the mechanism by which low-dose radiation rapidly eliminates larval cells and activates the formation of the imaginal discs during metamorphosis. Upon exposure to 0.5 Gy X-rays at 2 h after puparium formation (APF), the larval salivary glands swelled and were surrounded by remarkably thick structures containing an acid phosphatase (Acph) enzyme, implicating a peculiar autophagic cell death. TUNEL staining revealed the presence of DNA fragmentations compared with cells from sham controls which remained unchanged until 12 h APF. Additionally, the salivary glands of exposed flies were completely destroyed by 10 h APF. Furthermore, exposure to 0.5 Gy X-rays also facilitated the activity of the engulfment function of dendritic cells (DCs); they were generated in the larval salivary glands, engulfed the cell corpses and finally moved to the fat body. Data from an experiment demonstrating the inducible expression of Hml double-stranded RNA (dsRNA) indicate that a slow rate of engulfment of larval cells results in a longer time to emergence. Thus, the animals subjected to low-dose X-rays activated autophagic processes, resulting in significantly faster adult eclosion.

  19. Exposure to low-dose X-rays promotes peculiar autophagic cell death in Drosophila melanogaster, an effect that can be regulated by the inducible expression of Hml dsRNA

    Kanao, Tomoko; Miyachi, Yukihisa

    2006-01-01

    We previously reported that to induce an early emergence effect with low-dose X-irradiation in Drosophila, exposure during the prepupae stage is necessary. The present study examined the mechanism by which low-dose radiation rapidly eliminates larval cells and activates the formation of the imaginal discs during metamorphosis. Upon exposure to 0.5 Gy X-rays at 2 h after puparium formation (APF), the larval salivary glands swelled and were surrounded by remarkably thick structures containing an acid phosphatase (Acph) enzyme, implicating a peculiar autophagic cell death. TUNEL staining revealed the presence of DNA fragmentations compared with cells from sham controls which remained unchanged until 12 h APF. Additionally, the salivary glands of exposed flies were completely destroyed by 10 h APF. Furthermore, exposure to 0.5 Gy X-rays also facilitated the activity of the engulfment function of dendritic cells (DCs); they were generated in the larval salivary glands, engulfed the cell corpses and finally moved to the fat body. Data from an experiment demonstrating the inducible expression of Hml double-stranded RNA (dsRNA) indicate that a slow rate of engulfment of larval cells results in a longer time to emergence. Thus, the animals subjected to low-dose X-rays activated autophagic processes, resulting in significantly faster adult eclosion

  20. Drosophila melanogaster gene expression changes after spaceflight.

    National Aeronautics and Space Administration — Gene expression levels were determined in 3rd instar and adult Drosophila melanogaster reared during spaceflight to elucidate the genetic and molecular mechanisms...

  1. Ecdysteroid receptors in Drosophila melanogaster adult females

    Ecdysteroid receptors were identified and partially characterized from total cell extracts of whole animals and dissected tissues from Drosophila melanogaster adult females. Binding studies indicated the presence of two ecdysteroid binding components having high affinity and specificity consistent w...

  2. Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

    Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

    1984-01-01

    Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

  3. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. The Drosophila melanogaster host model

    Igboin, Christina O.; Griffen, Ann L.; Leys, Eugene J.

    2012-01-01

    The deleterious and sometimes fatal outcomes of bacterial infectious diseases are the net result of the interactions between the pathogen and the host, and the genetically tractable fruit fly, Drosophila melanogaster, has emerged as a valuable tool for modeling the pathogen–host interactions of a wide variety of bacteria. These studies have revealed that there is a remarkable conservation of bacterial pathogenesis and host defence mechanisms between higher host organisms and Drosophila. This review presents an in-depth discussion of the Drosophila immune response, the Drosophila killing model, and the use of the model to examine bacterial–host interactions. The recent introduction of the Drosophila model into the oral microbiology field is discussed, specifically the use of the model to examine Porphyromonas gingivalis–host interactions, and finally the potential uses of this powerful model system to further elucidate oral bacterial-host interactions are addressed. PMID:22368770

  5. Gustatory Processing in Drosophila melanogaster.

    Scott, Kristin

    2018-01-07

    The ability to identify nutrient-rich food and avoid toxic substances is essential for an animal's survival. Although olfaction and vision contribute to food detection, the gustatory system acts as a final checkpoint control for food acceptance or rejection. The vinegar fly Drosophila melanogaster tastes many of the same stimuli as mammals and provides an excellent model system for comparative studies of taste detection. The relative simplicity of the fly brain and behaviors, along with the molecular genetic and functional approaches available in this system, allow the examination of gustatory neural circuits from sensory input to motor output. This review discusses the molecules and cells that detect taste compounds in the periphery and the circuits that process taste information in the brain. These studies are providing insight into how the detection of taste compounds regulates feeding decisions.

  6. The Drosophila melanogaster host model

    Christina O. Igboin

    2012-02-01

    Full Text Available The deleterious and sometimes fatal outcomes of bacterial infectious diseases are the net result of the interactions between the pathogen and the host, and the genetically tractable fruit fly, Drosophila melanogaster, has emerged as a valuable tool for modeling the pathogen–host interactions of a wide variety of bacteria. These studies have revealed that there is a remarkable conservation of bacterial pathogenesis and host defence mechanisms between higher host organisms and Drosophila. This review presents an in-depth discussion of the Drosophila immune response, the Drosophila killing model, and the use of the model to examine bacterial–host interactions. The recent introduction of the Drosophila model into the oral microbiology field is discussed, specifically the use of the model to examine Porphyromonas gingivalis–host interactions, and finally the potential uses of this powerful model system to further elucidate oral bacterial-host interactions are addressed.

  7. The Drosophila melanogaster host model.

    Igboin, Christina O; Griffen, Ann L; Leys, Eugene J

    2012-01-01

    The deleterious and sometimes fatal outcomes of bacterial infectious diseases are the net result of the interactions between the pathogen and the host, and the genetically tractable fruit fly, Drosophila melanogaster, has emerged as a valuable tool for modeling the pathogen-host interactions of a wide variety of bacteria. These studies have revealed that there is a remarkable conservation of bacterial pathogenesis and host defence mechanisms between higher host organisms and Drosophila. This review presents an in-depth discussion of the Drosophila immune response, the Drosophila killing model, and the use of the model to examine bacterial-host interactions. The recent introduction of the Drosophila model into the oral microbiology field is discussed, specifically the use of the model to examine Porphyromonas gingivalis-host interactions, and finally the potential uses of this powerful model system to further elucidate oral bacterial-host interactions are addressed.

  8. Localization of tRNAsup(asp)2 genes from Drosophila melanogaster by 'in situ' hybridization

    Schmidt, T.; Egg, A.H.; Kubli, E.

    1978-01-01

    Transfer RNAsup(asp) 2 delta was isolated from Drosophila melanogaster by affinity chromatography on concanavalin A-Sepharose. The tRNA was iodinated 'in vitro' with Na[ 125 I] and hybridized 'in situ' to salivary gland chromosomes from Drosophila. Subsequent autoradiography allowed the localization of the genes for tRNAsup(asp) 2 delta to the left arm of the second chromosome in the regions 29 D and E. (orig.) [de

  9. Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.

    Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen

    2017-01-01

    Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of

  10. Making safety an integral part of 5S in healthcare.

    Ikuma, Laura H; Nahmens, Isabelina

    2014-01-01

    Healthcare faces major challenges with provider safety and rising costs, and many organizations are using Lean to instigate change. One Lean tool, 5S, is becoming popular for improving efficiency of physical work environments, and it can also improve safety. This paper demonstrates that safety is an integral part of 5S by examining five specific 5S events in acute care facilities. We provide two arguments for how safety is linked to 5S:1. Safety is affected by 5S events, regardless of whether safety is a specific goal and 2. Safety can and should permeate all five S's as part of a comprehensive plan for system improvement. Reports of 5S events from five departments in one health system were used to evaluate how changes made at each step of the 5S impacted safety. Safety was affected positively in each step of the 5S through initial safety goals and side effects of other changes. The case studies show that 5S can be a mechanism for improving safety. Practitioners may reap additional safety benefits by incorporating safety into 5S events through a safety analysis before the 5S, safety goals and considerations during the 5S, and follow-up safety analysis.

  11. Carbon magnetic resonance spectroscopy on carbon-13-labeled uracil in 5S ribonucleic acid

    Hamill, W.D.; Grant, D.M.; Cooper, R.B.; Harmon, S.A.

    1978-01-01

    The carbon-13 nuclear magnetic resonance spectra of the 13 C-enriched C-4 uridine carbons in 5S ribosomal ribonucleic acid of Salmonella typhimurium, strain JL-1055, was obtained. The most striking feature of the 5S RNA spectrum was the large number of well-resolved lines in the uridine band covering a chemical shift range of approximately 3.6 ppM. This data was used to obtain information on the secondary structure. The number of uridines involved in secondary interactions is estimated to be at least 75% and may be as high as 95%

  12. Optogenetic pacing in Drosophila melanogaster

    Alex, Aneesh; Li, Airong; Tanzi, Rudolph E.; Zhou, Chao

    2015-01-01

    Electrical stimulation is currently the gold standard for cardiac pacing. However, it is invasive and nonspecific for cardiac tissues. We recently developed a noninvasive cardiac pacing technique using optogenetic tools, which are widely used in neuroscience. Optogenetic pacing of the heart provides high spatial and temporal precisions, is specific for cardiac tissues, avoids artifacts associated with electrical stimulation, and therefore promises to be a powerful tool in basic cardiac research. We demonstrated optogenetic control of heart rhythm in a well-established model organism, Drosophila melanogaster. We developed transgenic flies expressing a light-gated cation channel, channelrhodopsin-2 (ChR2), specifically in their hearts and demonstrated successful optogenetic pacing of ChR2-expressing Drosophila at different developmental stages, including the larva, pupa, and adult stages. A high-speed and ultrahigh-resolution optical coherence microscopy imaging system that is capable of providing images at a rate of 130 frames/s with axial and transverse resolutions of 1.5 and 3.9 μm, respectively, was used to noninvasively monitor Drosophila cardiac function and its response to pacing stimulation. The development of a noninvasive integrated optical pacing and imaging system provides a novel platform for performing research studies in developmental cardiology. PMID:26601299

  13. Behavioral Teratogenesis in Drosophila melanogaster.

    Mishra, Monalisa; Barik, Bedanta Kumar

    2018-01-01

    Developmental biology is a fascinating branch of science which helps us to understand the mechanism of development, thus the findings are used in various therapeutic approach. Drosophila melanogaster served as a model to find the key molecules that initiate and regulate the mechanism of development. Various genes, transcription factors, and signaling pathways helping in development are identified in Drosophila. Many toxic compounds, which can affect the development, are also recognized using Drosophila model. These compounds, which can affect the development, are named as a teratogen. Many teratogens identified using Drosophila may also act as a teratogen for a human being since 75% of conservation exist between the disease genes present in Drosophila and human. There are certain teratogens, which do not cause developmental defect if exposed during pregnancy, however; behavioral defect appears in later part of development. Such compounds are named as a behavioral teratogen. Thus, it is worthy to identify the potential behavioral teratogen using Drosophila model. Drosophila behavior is well studied in various developmental stages. This chapter describes various methods which can be employed to test behavioral teratogenesis in Drosophila.

  14. Microwave effects in Drosophila melanogaster

    Dardalhon, M.; Averbeck, D.; Berteaud, A.J.

    1979-01-01

    Experiments were set up to investigate the effects of open space microwave irradiation of the millimeter (73 GHz) and the centimeter (17 GHz) range in Drosophila melanogaster. We used the wild type strain Paris and the strain delta carrying melanitic tumors in the 3rd larval stage, in the pupae and the adults. The power densities were up to 100mW.cm -2 for 73 GHz and about 60 mW.cm -2 for microwaves at 17 GHz. After 2h exposure to microwaves of 17 GHz or 73 GHz the hatching of the irradiated eggs and their development were normal. In a few cases there was a tendency towards a diminution of the survival of eggs treated at different stages, of larvae treated in the stages 1, 2 and 3 and of treated pupae. However, this was not always statistically significant. The microwave treatment did not induce teratological changes in the adults. A statistical analysis brought about slight diminutions in the incidence and multiplicity of tumors in adult flies. When wild type females were exposed to microwaves of 17 GHz for 16 or 21 h and crossed with untreated males we observed a marked increase in fertility as compared to untreated samples. The viability and tumor incidence in the offspring was not affected. Similar results were obtained when microwaves treated males were crossed with untreated females

  15. Comparative Analysis of Drosophila melanogaster Gut Microbiota with Respect to Host Strain, Sex, and Age.

    Han, Gangsik; Lee, Hyo Jung; Jeong, Sang Eun; Jeon, Che Ok; Hyun, Seogang

    2017-07-01

    Microbiota has a significant impact on the health of the host individual. The complexity of the interactions between mammalian hosts and their microbiota highlights the value of using Drosophila melanogaster as a model organism, because of its relatively simple microbial community and ease of physiological and genetic manipulation. However, highly variable and sometimes inconsistent results regarding the microbiota of D. melanogaster have been reported for host samples collected from different geographical locations; discrepancies that may be because of the inherent physiological conditions of the D. melanogaster host. Here, we conducted a comparative analysis of the gut microbiota of two D. melanogaster laboratory strains, w 1118 and Canton S, with respect to the sex and age of the host, by pyrosequencing of the 16S rRNA gene. In addition to the widespread and abundant commensal bacterial genera Lactobacillus and Acetobacter, we identified Enterococcus and Leuconostoc as major host-strain-specific bacterial genera. The relative proportions of these bacterial genera, and those of the species within each, were found to differ markedly with respect to strain, sex, and age of the host, even though host individuals were reared under the same nutritional conditions. By using various bioinformatic tools, we uncovered several characteristic features of microbiota corresponding to specific categories of the flies: host-sex-bias association of specific bacteria, age-dependent alteration of microbiota across host species and sex, and uniqueness of the microbiota of female w 1118 flies. Our results, thus, help to further our understanding of host-microbe interactions in the D. melanogaster model.

  16. Proteome reference map of Drosophila melanogaster head.

    Lee, Tian-Ren; Huang, Shun-Hong; Lee, Chi-Ching; Lee, Hsiao-Yun; Chan, Hsin-Tzu; Lin, Kuo-Sen; Chan, Hong-Lin; Lyu, Ping-Chiang

    2012-06-01

    Drosophila melanogaster has been used as a genetic model organism to understand the fundamental molecular mechanisms in human biology including memory formation that has been reported involving protein synthesis and/or post-translational modification. In this study, we employed a proteomic platform based on fluorescent 2DE and MALDI-TOF MS to build a standard D. melanogaster head proteome map for proteome-proteome comparison. In order to facilitate the comparison, an interactive database has been constructed for systematically integrating and analyzing the proteomes from different conditions and further implicated to study human diseases related to D. melanogaster model. In summary, the fundamental head proteomic database and bioinformatic analysis will be useful for further elucidating the biological mechanisms such as memory formation and neurodegenerative diseases. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Review on Implementation of 5S in Various Organization

    Vipulkumar C. Patel; Dr. Hemant Thakkar

    2014-01-01

    This paper explains the methods and techniques of 5 S uses to increase the efficiency of all processes in the company. Special emphasis will be given to the implementation of 5S system and elimination of losses in the company. It can be observed that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs‟ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines‟ effic...

  19. PROBLEMS OF IMPLEMENTATION 5S PRACTICES IN AN INDUSTRIAL COMPANY

    Beata GALA

    2013-10-01

    Full Text Available 5S is a one of the tools of Lean Management enabling to organize workplace in an effective way. It could be implemented in all the spheres of the company. The article provides the theoretic description of Lean Management and 5S and also shows a case study based on gained experience. The author also describe the problems occured during the implementation of the 5S.

  20. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  1. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  3. Studies on a photoreactivating enzyme from Drosophila melanogaster cultured cells

    Beck, L.A.

    1982-01-01

    A photoreactivating enzyme was purified from Schneider's Line No. 2 Drosophila melanogaster cultured cells. DEAE cellulose chromatography with high potassium phosphate buffer conditions was used to separate nucleic acids from the protein component of the crude cell extract. The protein pass-through fraction from DEAE cellulose was chromatographed on phosphocellulose followed by hydroxylapatite, using linear potassium phosphate gradients to elute the enzyme. Gel filtration chromatography on Sephacryl S-200 resulted in a 4500-fold purification of the enzyme with a final recovery of 4%. The enzyme has an apparent gel filtration molecular weight of 32,900 (+/- 1350 daltons) and an isoelectric pH of 4.9. Optimum ionic strength for activity is 0.17 at pH 6.5 in potassium phosphate buffer. The action spectrum for photoreactivation in Drosophila has an optimum at 365 nm with a response to wavelengths in the range of 313 to 465 nm. Drosophila photoreactivating enzyme contains an essential RNA that is necessary for activity in vitro. The ability of the enzyme to photoreactivate dimers in vitro is abolished by treatment of the enzyme with ribonucleases, or by disruption of the enzyme-RNA complex by electrophoresis or adsorption to DEAE cellulose. The essential RNA is heterogeneous in size but contains a 10-12 base region that may interact with the active site of the enzyme, and thus is protected from degradation by contaminating RNase activities during purification. The RNA is thought to stabilize the photoreactivating enzyme by maintaining the enzyme in the proper configuration for binding to dimer-containing DNA. It is not known whether this RNA is essential for in vivo photoreactivation

  4. Drosophila melanogaster deoxyribonucleoside kinase activates gemcitabine

    Knecht, Wolfgang; Mikkelsen, N.E.; Clausen, A.R.

    2009-01-01

    Drosophila melanogaster multisubstrate deoxyribonucleoside kinase (Dm-dNK) can additionally sensitize human cancer cell lines towards the anti-cancer drug gemcitabine. We show that this property is based on the Dm-dNK ability to efficiently phosphorylate gemcitabine. The 2.2 angstrom resolution...

  5. Radioresistance and radiosensitivity in Drosophila melanogaster

    Reguly, M.L.

    1983-01-01

    Studying the mechanisms controlling radioresistant in Drosophila the sensibility of four strains of Drosophila melanogaster to sex-linked recessive lethal mutations induced by 5kR Cobalt-60 gamma radiation and 0,006 M EMS or 0,25% of caffeine was determined. (M.A.C.) [pt

  6. The Drosophila melanogaster circadian pacemaker circuit

    2016-08-26

    Aug 26, 2016 ... Keywords. circadian rhythm; neuronal network; ion channel; behaviour; neurotransmitter; electrophysiology; Drosophila. Abstract. As an experimental model system, the fruit fly Drosophila melanogaster has been seminal in shaping our understanding of the circadian clockwork. The wealth of genetic tools ...

  7. Radioresistance and radiosensitivity in Drosophila melanogaster

    Reguly, M.L.; Marques, E.K.

    1987-01-01

    The mechanisms of radioresistance in Drosophila are studied. The mutagenic effects of 5KR of 60 Cobalt gamma radiation and of 0,006M dose of ethyl methanesulfonate (EMS) on four D. Melanogaster strains (RC 1 , CO 3 , BUE and LEN) are investigated. (M.A.C.) [pt

  8. Mutagenic effect of radionuclides incorporated into DNA of drosphila melanogaster. Progress report, 1976--1977

    Lee, W.R.

    1977-01-01

    Progress is reported on studies of the genetic effect of tritium incorporated into DNA of Drosophila melanogaster. Following a short pulse exposure to tritium-labeled uridine most of the radioactivity appeared in RNA; however, the turnover of radioactivity in tritium-labeled RNA was rapid whereas there was no exchange of tritium from the labeled DNA during spermatogenesis. Furthermore, most of the cytoplasm and most of the RNA in primary spermatocytes was lost during spermatogenesis and thus the mature sperm cell was left with only the DNA labeled. Preliminary experiments did not show a significant level of labeled RNA remaining in the mature sperm cell, whereas labeled DNA was verified after extraction and purification with phenol and enzyme digestion. Preliminary results of genetic tests on the progeny of normal females inseminated with tritium-labeled sperm cells are reported

  9. Wolbachia influences the maternal transmission of the gypsy endogenous retrovirus in Drosophila melanogaster.

    Touret, Franck; Guiguen, François; Terzian, Christophe

    2014-09-02

    The endosymbiotic bacteria of the genus Wolbachia are present in most insects and are maternally transmitted through the germline. Moreover, these intracellular bacteria exert antiviral activity against insect RNA viruses, as in Drosophila melanogaster, which could explain the prevalence of Wolbachia bacteria in natural populations. Wolbachia is maternally transmitted in D. melanogaster through a mechanism that involves distribution at the posterior pole of mature oocytes and then incorporation into the pole cells of the embryos. In parallel, maternal transmission of several endogenous retroviruses is well documented in D. melanogaster. Notably, gypsy retrovirus is expressed in permissive follicle cells and transferred to the oocyte and then to the offspring by integrating into their genomes. Here, we show that the presence of Wolbachia wMel reduces the rate of gypsy insertion into the ovo gene. However, the presence of Wolbachia does not modify the expression levels of gypsy RNA and envelope glycoprotein from either permissive or restrictive ovaries. Moreover, Wolbachia affects the pattern of distribution of the retroviral particles and the gypsy envelope protein in permissive follicle cells. Altogether, our results enlarge the knowledge of the antiviral activity of Wolbachia to include reducing the maternal transmission of endogenous retroviruses in D. melanogaster. Animals have established complex relationships with bacteria and viruses that spread horizontally among individuals or are vertically transmitted, i.e., from parents to offspring. It is well established that members of the genus Wolbachia, maternally inherited symbiotic bacteria present mainly in arthropods, reduce the replication of several RNA viruses transmitted horizontally. Here, we demonstrate for the first time that Wolbachia diminishes the maternal transmission of gypsy, an endogenous retrovirus in Drosophila melanogaster. We hypothesize that gypsy cannot efficiently integrate into the germ

  10. Genome-wide analysis of promoter architecture in Drosophila melanogaster

    Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.

    2010-10-20

    Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.

  11. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Jie Hong

    Full Text Available Mechanisms of the progression from Barrett's esophagus (BE to esophageal adenocarcinoma (EA are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  12. Impact of the resident microbiota on the nutritional phenotype of Drosophila melanogaster.

    Emma V Ridley

    Full Text Available Animals are chronically infected by benign and beneficial microorganisms that generally promote animal health through their effects on the nutrition, immune function and other physiological systems of the host. Insight into the host-microbial interactions can be obtained by comparing the traits of animals experimentally deprived of their microbiota and untreated animals. Drosophila melanogaster is an experimentally tractable system to study host-microbial interactions.The nutritional significance of the microbiota was investigated in D. melanogaster bearing unmanipulated microbiota, demonstrated by 454 sequencing of 16S rRNA amplicons to be dominated by the α-proteobacterium Acetobacter, and experimentally deprived of the microbiota by egg dechorionation (conventional and axenic flies, respectively. In axenic flies, larval development rate was depressed with no effect on adult size relative to conventional flies, indicating that the microbiota promotes larval growth rates. Female fecundity did not differ significantly between conventional and axenic flies, but axenic flies had significantly reduced metabolic rate and altered carbohydrate allocation, including elevated glucose levels.We have shown that elimination of the resident microbiota extends larval development and perturbs energy homeostasis and carbohydrate allocation patterns of of D. melanogaster. Our results indicate that the resident microbiota promotes host nutrition and interacts with the regulation of host metabolism.

  13. Highly tissue specific expression of Sphinx supports its male courtship related role in Drosophila melanogaster.

    Chen, Ying; Dai, Hongzheng; Chen, Sidi; Zhang, Luoying; Long, Manyuan

    2011-04-26

    Sphinx is a lineage-specific non-coding RNA gene involved in regulating courtship behavior in Drosophila melanogaster. The 5' flanking region of the gene is conserved across Drosophila species, with the proximal 300 bp being conserved out to D. virilis and a further 600 bp region being conserved amongst the melanogaster subgroup (D. melanogaster, D. simulans, D. sechellia, D. yakuba, and D. erecta). Using a green fluorescence protein transformation system, we demonstrated that a 253 bp region of the highly conserved segment was sufficient to drive sphinx expression in male accessory gland. GFP signals were also observed in brain, wing hairs and leg bristles. An additional ∼800 bp upstream region was able to enhance expression specifically in proboscis, suggesting the existence of enhancer elements. Using anti-GFP staining, we identified putative sphinx expression signal in the brain antennal lobe and inner antennocerebral tract, suggesting that sphinx might be involved in olfactory neuron mediated regulation of male courtship behavior. Whole genome expression profiling of the sphinx knockout mutation identified significant up-regulated gene categories related to accessory gland protein function and odor perception, suggesting sphinx might be a negative regulator of its target genes.

  14. Highly tissue specific expression of Sphinx supports its male courtship related role in Drosophila melanogaster.

    Ying Chen

    2011-04-01

    Full Text Available Sphinx is a lineage-specific non-coding RNA gene involved in regulating courtship behavior in Drosophila melanogaster. The 5' flanking region of the gene is conserved across Drosophila species, with the proximal 300 bp being conserved out to D. virilis and a further 600 bp region being conserved amongst the melanogaster subgroup (D. melanogaster, D. simulans, D. sechellia, D. yakuba, and D. erecta. Using a green fluorescence protein transformation system, we demonstrated that a 253 bp region of the highly conserved segment was sufficient to drive sphinx expression in male accessory gland. GFP signals were also observed in brain, wing hairs and leg bristles. An additional ∼800 bp upstream region was able to enhance expression specifically in proboscis, suggesting the existence of enhancer elements. Using anti-GFP staining, we identified putative sphinx expression signal in the brain antennal lobe and inner antennocerebral tract, suggesting that sphinx might be involved in olfactory neuron mediated regulation of male courtship behavior. Whole genome expression profiling of the sphinx knockout mutation identified significant up-regulated gene categories related to accessory gland protein function and odor perception, suggesting sphinx might be a negative regulator of its target genes.

  15. Differential gene expression related to Nora virus infection of Drosophila melanogaster.

    Cordes, Ethan J; Licking-Murray, Kellie D; Carlson, Kimberly A

    2013-08-01

    Nora virus is a recently discovered RNA picorna-like virus that produces a persistent infection in Drosophila melanogaster, but the antiviral pathway or change in gene expression is unknown. We performed cDNA microarray analysis comparing the gene expression profiles of Nora virus infected and uninfected wild-type D. melanogaster. This analysis yielded 58 genes exhibiting a 1.5-fold change or greater and p-value less than 0.01. Of these genes, 46 were up-regulated and 12 down-regulated in response to infection. To validate the microarray results, qRT-PCR was performed with probes for Chorion protein 16 and Troponin C isoform 4, which show good correspondence with cDNA microarray results. Differential regulation of genes associated with Toll and immune-deficient pathways, cytoskeletal development, Janus Kinase-Signal Transducer and Activator of Transcription interactions, and a potential gut-specific innate immune response were found. This genome-wide expression profile of Nora virus infection of D. melanogaster can pinpoint genes of interest for further investigation of antiviral pathways employed, genetic mechanisms, sites of replication, viral persistence, and developmental effects. Copyright © 2013. Published by Elsevier B.V.

  16. Isolation of oogenesis-specific genes transcribed in the germ-line of Calliphora erythrocephala and Drosophila melanogaster

    Tucker, M.A.

    1988-01-01

    Poly(A) + RNA from early or mid-stage ovarian follicles of C. erythrocephala was used to generate radiolabelled oogenesis-specific cDNA probes for screening the phage libraries. A cDNA probe made from mid-stage embryo poly(A) + RNA was used as the differential screening probe. Thus plaques hybridizing to the two oogenesis-specific probes but not the mid-stage embryo probe were selected as potentially containing oogenesis-specific genes. Two further rounds of screening were used to eliminate false positives and, after plaque purification, restriction digests of the remaining clones were screened by Southern blot hybridization to identify DNA fragments transcribed in an oogenesis-specific manner. In situ hybridization to sections of ovarian follicles has been used to determine the cell types within the follicles in which the various genes are expressed. Radiolabelled RNA probes for four of the C. erythrocephala oogenesis-specific clones and the two D. melanogaster clones have been hybridized to ovarian follicles. Further studies have been concentrated on the two germ-line transcribed, oogenesis-specific clones isolated from the D. melanogaster clone library. Detailed genetic mapping of the DA clone and of these mutations was performed to determine which mutations might represent the DA gene. cDNA clones have been isolated for the transcribed region of clone DA and have been used to further define the transcription unit from this region of the D. melanogaster genome

  17. Analysis of immune-related genes during Nora virus infection of Drosophila melanogaster using next generation sequencing.

    Lopez, Wilfredo; Page, Alexis M; Carlson, Darby J; Ericson, Brad L; Cserhati, Matyas F; Guda, Chittibabu; Carlson, Kimberly A

    2018-01-01

    Drosophila melanogaster depends upon the innate immune system to regulate and combat viral infection. This is a complex, yet widely conserved process that involves a number of immune pathways and gene interactions. In addition, expression of genes involved in immunity are differentially regulated as the organism ages. This is particularly true for viruses that demonstrate chronic infection, as is seen with Nora virus. Nora virus is a persistent non-pathogenic virus that replicates in a horizontal manner in D. melanogaster . The genes involved in the regulation of the immune response to Nora virus infection are largely unknown. In addition, the temporal response of immune response genes as a result of infection has not been examined. In this study, D. melanogaster either infected with Nora virus or left uninfected were aged for 2, 10, 20 and 30 days. The RNA from these samples was analyzed by next generation sequencing (NGS) and the resulting immune-related genes evaluated by utilizing both the PANTHER and DAVID databases, as well as comparison to lists of immune related genes and FlyBase. The data demonstrate that Nora virus infected D. melanogaster exhibit an increase in immune related gene expression over time. In addition, at day 30, the data demonstrate that a persistent immune response may occur leading to an upregulation of specific immune response genes. These results demonstrate the utility of NGS in determining the potential immune system genes involved in Nora virus replication, chronic infection and involvement of antiviral pathways.

  18. Cerebral Innate Immunity in Drosophila Melanogaster

    Brian P. Leung

    2015-03-01

    Full Text Available Modeling innate immunity in Drosophila melanogaster has a rich history that includes ground-breaking discoveries in pathogen detection and signaling. These studies revealed the evolutionary conservation of innate immune pathways and mechanisms of pathogen detection, resulting in an explosion of findings in the innate immunity field. In D. melanogaster, studies have focused primarily on responses driven by the larval fat body and hemocytes, analogs to vertebrate liver and macrophages, respectively. Aside from pathogen detection, many recent mammalian studies associate innate immune pathways with development and disease pathogenesis. Importantly, these studies stress that the innate immune response is integral to maintain central nervous system (CNS health. Microglia, which are the vertebrate CNS mononuclear phagocytes, drive vertebrate cerebral innate immunity. The invertebrate CNS contains microglial-like cells-ensheathing glia and reticular glia-that could be used to answer basic questions regarding the evolutionarily conserved innate immune processes in CNS development and health. A deeper understanding of the relationship between D. melanogaster phagocytic microglial-like cells and vertebrate microglia will be key to answering basic and translational questions related to cerebral innate immunity.

  19. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  20. Large Scale Construction Project Innovative Management Through 5-S

    Hashim Hj. Abdul Ghani Mohd.

    2014-11-01

    Full Text Available It has been well-recognised that Japanese construction firms are good in safety, hygiene, quality, productivity and image. Over the last century, the Japanese have formalised the technique and name it as '5S' Practice. Through his research in Japan in 1988, the author has re-define the name as '5-S' and developed the world's first 5-S Audit Checklist. Since 1993, he used an innovative 5-S Checklist developed at SIRIM for training and consultancy in no less than 20 countries with over 100,000 persons from around 8,000 organisations world-wide. The objective of this paper is to explain the intricacy of the 5-S so that it can be understood easily and adopted readily by those who may find the tool useful. Some experience will also be shared in this article. It is hoped that this article can arouse the interest of the construction industry in Malaysia to take up this important and effective tool for quality improvement.

  1. Implementation of 5S Method for Ergonomic Laboratory

    Dila Sari, Amarria; Ilma Rahmillah, Fety; Prabowo Aji, Bagus

    2017-06-01

    This article discusses 5S implementation in Work System Design and Ergonomic Laboratory, Department of Industrial Engineering, Islamic University of Indonesia. There are some problems related to equipment settings for activity involving students such as files which is accumulated over the previous year practicum, as well as the movement of waste in the form of time due to the placement of goods that do not fit. Therefore, this study aims to apply the 5S method in DSK & E laboratory to facilitate the work processes and reduce waste. The project is performed by laboratory management using 5S methods in response to continuous improvement (Kaizen). Moreover, some strategy and suggestions are promoted to impose 5S system within the laboratory. As a result, the tidiness and cleanliness can be achieved that lead to the great performance of laboratory users. Score assessment before implementing 5S DSKE laboratory is at 64 (2.56) while the score after implementation is 32 (1.28) and shows an improvement of 50%. This has implications for better use in the laboratory area, save time when looking for tools and materials due to its location and good visual control, as well as improving the culture and spirit of ‘5S’ on staff regarding better working environment

  2. Strong decays and dipion transitions of Y(5S)

    Simonov, Yu.A.; Veselov, A.I.

    2009-01-01

    Dipion transitions of Y(nS) with n=5, n ' =1,2,3 are studied using the Field Correlator Method, applied previously to dipion transitions with n=2,3,4. The only two parameters of effective Lagrangian were fixed in that earlier study, and total widths Γ ππ (5,n ' ) as well as pionless decay widths Γ BB (5S), Γ BB* (5S), Γ B*B* (5S) and Γ KK (5,n ' ) were calculated and are in a reasonable agreement with experiment. The experimental ππ spectra for (5,1) and (5,2) transitions are well reproduced taking into account FSI in the ππ

  3. Assessment of application of 5S practices in ceramic industry

    Danel Kleszcz

    2017-10-01

    Full Text Available Results of research connected with determining the degree of implementation of 5S practices in ceramics industry are discussed in this paper. Direct survey with employees of companies plus ex-pert interview was used in the research. A 21 point scale was used to assess the degree of implemen-tation the 5S practices at individual stages of the manufacturing process. The specificity of produc-tion in ceramics industry enforces maintaining the regime of cleanliness during production. The research revealed that the level of conscious implementation of the 5S practices in companies de-pends on the culture of organization and the degree of involvement of employees in the improvement actions in their company. The presented results are a part of the research aimed at determining refer-ence requirements for companies in terms of implementation and making use of the Lean Manage-ment (LM instruments.

  4. 5S-toimintamallin kehittäminen nostintuotannossa

    Laine, Atte

    2017-01-01

    TIIVISTELMÄ Opinnäytetyön aiheena oli kehittää 5S-toimintamallia Konecranes Finland Oy:n nostintuotannossa Hämeenlinnan nostintehtaalla. Konecranesilla käytetään Lean Six Sigma -menetelmiä prosessien ja liiketoiminnan kehittämiseen ja 5S-toimintamalli on yksi näistä Lean Six Sigmaan kuuluvista menetelmistä. Se on jo osittain käytössä Hämeenlinnan nostintehtaalla ja nyt tehtaan nostinkokoonpanoon oli saatava sama toimintamalli kuin muillakin tehtaan osastoilla. Opinnäytetyössä perehdyttiin...

  5. Radiative transitions from Υ(5S) to molecular bottomonium

    Voloshin, M. B.

    2011-01-01

    The heavy quark spin symmetry implies that in addition to the recently observed Z(10610) and Z(10650) molecular resonances with I G =1 + , there should exist two or four molecular bottomonium-like states with I G =1 - . Properties of these G-odd states are considered, including their production in the radiative transitions from Υ(5S), by applying the same symmetry to the Υ(5S) resonance and the transition amplitudes. The considered radiative processes can provide a realistic option for observing the yet hypothetical states.

  6. TEXTILE INDUSTRY APPLICATION OF THE 5S METHOD

    Raluca BRAD

    2015-05-01

    Full Text Available The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visual elements, posters or graphics. The 5 phases are Seiri, Seiton, Seiso, Seiketsu and Shitsuke, which can be translate as Sort, Set in order, Scrub, Standardize, and Sustain, focusing on orderliness and being applied especially in Japanese factories. The stages includes inputs objectives related to the efficiency and effectiveness of the process, but also subjective, which refers to moral values, education, training, culture. For each S stage, the most important elements which are underlying the implementation and maintain the compliance are described. Any company that applied the 5S program will have quick and visible results, reducing different types of waste. The final section presents a case study and some rules in order to sustain the designed standards and implement a continuous quality improvement. The concluding remarks could be considered as work instructions in order to implement the 5S rules.

  7. Analyzing Digital Library Initiatives: 5S Theory Perspective

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  8. MicroRNAs That Contribute to Coordinating the Immune Response in Drosophila melanogaster.

    Atilano, Magda L; Glittenberg, Marcus; Monteiro, Annabel; Copley, Richard R; Ligoxygakis, Petros

    2017-09-01

    Small noncoding RNAs called microRNAs (miRNAs) have emerged as post-transcriptional regulators of gene expression related to host defenses. Here, we have used Drosophila melanogaster to explore the contribution of individual or clusters of miRNAs in countering systemic Candida albicans infection. From a total of 72 tested, we identify 6 miRNA allelic mutant backgrounds that modulate the survival response to infection and the ability to control pathogen number. These mutants also exhibit dysregulation of the Toll pathway target transcripts Drosomycin ( Drs ) and Immune-Induced Molecule 1 ( IM1 ). These are characteristics of defects in Toll signaling, and consistent with this, we demonstrate dependency for one of the miRNA mutants on the NF-κΒ homolog Dif. We also quantify changes in the miRNA expression profile over time in response to three pathogen types, and identify 13 mature miRNA forms affected by pathogens that stimulate Toll signaling. To complement this, we provide a genome-wide map of potential NF-κB sites in proximity to miRNA genes. Finally, we demonstrate that systemic C. albicans infection contributes to a reduction in the total amount of branch-chained amino acids, which is miRNA-regulated. Overall, our data reveal a new layer of miRNA complexity regulating the fly response to systemic fungal infection. Copyright © 2017 Atilano et al.

  9. Involvement of oxidative stress in 4-vinylcyclohexene-induced toxicity in Drosophila melanogaster.

    Abolaji, Amos Olalekan; Kamdem, Jean Paul; Lugokenski, Thiago Henrique; Nascimento, Thallita Kalar; Waczuk, Emily Pansera; Farombi, Ebenezer Olatunde; Loreto, Élgion Lúcio da Silva; Rocha, João Batista Teixeira

    2014-06-01

    4-Vinylcyclohexene (VCH) is a dimer of 1,3-butadiene produced as a by-product of pesticides, plastic, rubber, flame retardants, and tire production. Although, several studies have reported the ovotoxicity of VCH, information on a possible involvement of oxidative stress in the toxicity of this occupational chemical is scarce. Hence, this study was carried out to investigate further possible mechanisms of toxicity of VCH with a specific emphasis on oxidative stress using a Drosophila melanogaster model. D. melanogaster (both genders) of 1 to 3 days old were exposed to different concentrations of VCH (10 µM-1 mM) in the diet for 5 days. Subsequently, the survival and negative geotaxis assays and the quantification of reactive oxygen species (ROS) generation were determined. In addition, we evaluated RT-PCR expressions of selected oxidative stress and antioxidant mRNA genes (HSP27, 70, and 83, SOD, Nrf-2, MAPK2, and catalase). Furthermore, catalase, glutathione-S-transferase (GST), delta aminolevulinic acid dehydratase (δ-ALA-D), and acetylcholinesterase (AChE) activities were determined. VCH exposure impaired negative geotaxic behavior and induced the mRNA of SOD, Nrf-2, and MAPK2 genes expressions. There were increases in catalase and ROS production, as well as inhibitions of GST, δ-ALA-D, and AChE activities (Pbalance, and possible neurotoxic consequences due to decreased AChE activity, and impairments in negative geotaxic behavior. Thus, we conclude that D. melanogaster is a useful model for investigating the toxicity of VCH exposure, and here, we have provided further insights on the mechanism of VCH-induced toxicity. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Altered Gravity Induces Oxidative Stress in Drosophila Melanogaster

    Bhattacharya, Sharmila; Hosamani, Ravikumar

    2015-01-01

    Altered gravity environments can induce increased oxidative stress in biological systems. Microarray data from our previous spaceflight experiment (FIT experiment on STS-121) indicated significant changes in the expression of oxidative stress genes in adult fruit flies after spaceflight. Currently, our lab is focused on elucidating the role of hypergravity-induced oxidative stress and its impact on the nervous system in Drosophila melanogaster. Biochemical, molecular, and genetic approaches were combined to study this effect on the ground. Adult flies (2-3 days old) exposed to acute hypergravity (3g, for 1 hour and 2 hours) showed significantly elevated levels of Reactive Oxygen Species (ROS) in fly brains compared to control samples. This data was supported by significant changes in mRNA expression of specific oxidative stress and antioxidant defense related genes. As anticipated, a stress-resistant mutant line, Indy302, was less vulnerable to hypergravity-induced oxidative stress compared to wild-type flies. Survival curves were generated to study the combined effect of hypergravity and pro-oxidant treatment. Interestingly, many of the oxidative stress changes that were measured in flies showed sex specific differences. Collectively, our data demonstrate that altered gravity significantly induces oxidative stress in Drosophila, and that one of the organs where this effect is evident is the brain.

  11. Obp56h Modulates Mating Behavior in Drosophila melanogaster

    John R. Shorter

    2016-10-01

    Full Text Available Social interactions in insects are driven by conspecific chemical signals that are detected via olfactory and gustatory neurons. Odorant binding proteins (Obps transport volatile odorants to chemosensory receptors, but their effects on behaviors remain poorly characterized. Here, we report that RNAi knockdown of Obp56h gene expression in Drosophila melanogaster enhances mating behavior by reducing courtship latency. The change in mating behavior that results from inhibition of Obp56h expression is accompanied by significant alterations in cuticular hydrocarbon (CHC composition, including reduction in 5-tricosene (5-T, an inhibitory sex pheromone produced by males that increases copulation latency during courtship. Whole genome RNA sequencing confirms that expression of Obp56h is virtually abolished in Drosophila heads. Inhibition of Obp56h expression also affects expression of other chemoreception genes, including upregulation of lush in both sexes and Obp83ef in females, and reduction in expression of Obp19b and Or19b in males. In addition, several genes associated with lipid metabolism, which underlies the production of cuticular hydrocarbons, show altered transcript abundances. Our data show that modulation of mating behavior through reduction of Obp56h is accompanied by altered cuticular hydrocarbon profiles and implicate 5-T as a possible ligand for Obp56h.

  12. Population and sex differences in Drosophila melanogaster brain gene expression

    Catalán Ana

    2012-11-01

    Full Text Available Abstract Background Changes in gene regulation are thought to be crucial for the adaptation of organisms to their environment. Transcriptome analyses can be used to identify candidate genes for ecological adaptation, but can be complicated by variation in gene expression between tissues, sexes, or individuals. Here we use high-throughput RNA sequencing of a single Drosophila melanogaster tissue to detect brain-specific differences in gene expression between the sexes and between two populations, one from the ancestral species range in sub-Saharan Africa and one from the recently colonized species range in Europe. Results Relatively few genes (Cyp6g1 and CHKov1. Conclusions Analysis of the brain transcriptome revealed many genes differing in expression between populations that were not detected in previous studies using whole flies. There was little evidence for sex-specific regulatory adaptation in the brain, as most expression differences between populations were observed in both males and females. The enrichment of genes with sexually dimorphic expression on the X chromosome is consistent with dosage compensation mechanisms affecting sex-biased expression in somatic tissues.

  13. Diversity of insect trypanosomatids assessed from the spliced leader RNA and 5S rRNA genes and intergenic regions

    Podlipaev, Sergei; Sturm, N. R.; Fiala, Ivan; Fernandes, O.; Westenberger, S. J.; Dollet, M.; Campbell, D. A.; Lukeš, Julius

    2004-01-01

    Roč. 51, č. 3 (2004), s. 283-290 ISSN 1066-5234 Grant - others:European Community(XE) QLK 2-CT-2001-01810 Institutional research plan: CEZ:AV0Z6022909 Keywords : Kinetoplastida * phylogeny * Trypanosomatidae Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.403, year: 2004

  14. Drosophila melanogaster deoxyribonucleoside kinase activates gemcitabine

    Knecht, Wolfgang [BioCentrum-DTU, Technical University of Denmark, DK-2800 Lyngby (Denmark); Mikkelsen, Nils Egil [Department of Molecular Biology, Swedish University of Agricultural Sciences, Biomedical Centre, SE-751 24 Uppsala (Sweden); Clausen, Anders Ranegaard [Cell and Organism Biology, Lund University, Soelvegatan 35, SE-22362 Lund (Sweden); Willer, Mette [ZGene A/S, Agern Alle 7, DK-2970 Horsholm (Denmark); Eklund, Hans [Department of Molecular Biology, Swedish University of Agricultural Sciences, Biomedical Centre, SE-751 24 Uppsala (Sweden); Gojkovic, Zoran [ZGene A/S, Agern Alle 7, DK-2970 Horsholm (Denmark); Piskur, Jure, E-mail: Jure.Piskur@cob.lu.se [BioCentrum-DTU, Technical University of Denmark, DK-2800 Lyngby (Denmark); Cell and Organism Biology, Lund University, Soelvegatan 35, SE-22362 Lund (Sweden)

    2009-05-01

    Drosophila melanogaster multisubstrate deoxyribonucleoside kinase (Dm-dNK) can additionally sensitize human cancer cell lines towards the anti-cancer drug gemcitabine. We show that this property is based on the Dm-dNK ability to efficiently phosphorylate gemcitabine. The 2.2 A resolution structure of Dm-dNK in complex with gemcitabine shows that the residues Tyr70 and Arg105 play a crucial role in the firm positioning of gemcitabine by extra interactions made by the fluoride atoms. This explains why gemcitabine is a good substrate for Dm-dNK.

  15. Crystal structure of enolase from Drosophila melanogaster.

    Sun, Congcong; Xu, Baokui; Liu, Xueyan; Zhang, Zhen; Su, Zhongliang

    2017-04-01

    Enolase is an important enzyme in glycolysis and various biological processes. Its dysfunction is closely associated with diseases. Here, the enolase from Drosophila melanogaster (DmENO) was purified and crystallized. A crystal of DmENO diffracted to 2.0 Å resolution and belonged to space group R32. The structure was solved by molecular replacement. Like most enolases, DmENO forms a homodimer with conserved residues in the dimer interface. DmENO possesses an open conformation in this structure and contains conserved elements for catalytic activity. This work provides a structural basis for further functional and evolutionary studies of enolase.

  16. Structural similarities between prokaryotic and eukaryotic 5S ribosomal RNAs

    Welfle, H.; Boehm, S.; Damaschun, G.; Fabian, H.; Gast, K.; Misselwitz, R.; Mueller, J.J.; Zirwer, D.; Filimonov, V.V.; Venyaminov, S.Yu.; Zalkova, T.N.

    1986-01-01

    5S RNAs from rat liver and E. coli have been studied by diffuse X-ray and dynamic light scattering and by infrared and Raman spectroscopy. Identical structures at a resolution of 1 nm can be deduced from the comparison of the experimental X-ray scattering curves and electron distance distribution functions and from the agreement of the shape parameters. A flat shape model with a compact central region and two protruding arms was derived. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. The number of base pairs (26 GC, 9 AU for E. coli; 27 GC, 9 AU for rat liver) and the degree of base stacking are the same within the experimental error. A very high regularity in the ribophosphate backbone is indicated for both 5S RNAs. The observed structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest the conclusion that prokaryotic and eukaryotic 5S RNAs are in general very similar with respect to their fundamental structural features. (author)

  17. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    2011-01-01

    Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815

  18. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  19. Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9.

    Ren, Xingjie; Sun, Jin; Housden, Benjamin E; Hu, Yanhui; Roesel, Charles; Lin, Shuailiang; Liu, Lu-Ping; Yang, Zhihao; Mao, Decai; Sun, Lingzhu; Wu, Qujie; Ji, Jun-Yuan; Xi, Jianzhong; Mohr, Stephanie E; Xu, Jiang; Perrimon, Norbert; Ni, Jian-Quan

    2013-11-19

    The ability to engineer genomes in a specific, systematic, and cost-effective way is critical for functional genomic studies. Recent advances using the CRISPR-associated single-guide RNA system (Cas9/sgRNA) illustrate the potential of this simple system for genome engineering in a number of organisms. Here we report an effective and inexpensive method for genome DNA editing in Drosophila melanogaster whereby plasmid DNAs encoding short sgRNAs under the control of the U6b promoter are injected into transgenic flies in which Cas9 is specifically expressed in the germ line via the nanos promoter. We evaluate the off-targets associated with the method and establish a Web-based resource, along with a searchable, genome-wide database of predicted sgRNAs appropriate for genome engineering in flies. Finally, we discuss the advantages of our method in comparison with other recently published approaches.

  20. Structure of PCNA from Drosophila melanogaster

    Wang, Ke; Shi, Zhubing; Zhang, Min; Cheng, Dianlin

    2013-01-01

    Proliferating cell nuclear antigen (PCNA) plays essential roles in DNA replication, DNA repair, cell-cycle regulation and chromatin metabolism. The PCNA from Drosophila melanogaster (DmPCNA) has been purified and crystallized. Proliferating cell nuclear antigen (PCNA) plays essential roles in DNA replication, DNA repair, cell-cycle regulation and chromatin metabolism. The PCNA from Drosophila melanogaster (DmPCNA) was purified and crystallized. The crystal of DmPCNA diffracted to 2.0 Å resolution and belonged to space group H3, with unit-cell parameters a = b = 151.16, c = 38.28 Å. The structure of DmPCNA was determined by molecular replacement. DmPCNA forms a symmetric homotrimer in a head-to-tail manner. An interdomain connector loop (IDCL) links the N- and C-terminal domains. Additionally, the N-terminal and C-terminal domains contact each other through hydrophobic associations. Compared with human PCNA, the IDCL of DmPCNA has conformational changes, which may explain their difference in function. This work provides a structural basis for further functional and evolutionary studies of PCNA

  1. Transcription elongation rate has a tissue-specific impact on alternative cleavage and polyadenylation in Drosophila melanogaster.

    Liu, Xiaochuan; Freitas, Jaime; Zheng, Dinghai; Oliveira, Marta S; Hoque, Mainul; Martins, Torcato; Henriques, Telmo; Tian, Bin; Moreira, Alexandra

    2017-12-01

    Alternative polyadenylation (APA) is a mechanism that generates multiple mRNA isoforms with different 3'UTRs and/or coding sequences from a single gene. Here, using 3' region extraction and deep sequencing (3'READS), we have systematically mapped cleavage and polyadenylation sites (PASs) in Drosophila melanogaster , expanding the total repertoire of PASs previously identified for the species, especially those located in A-rich genomic sequences. Cis -element analysis revealed distinct sequence motifs around fly PASs when compared to mammalian ones, including the greater enrichment of upstream UAUA elements and the less prominent presence of downstream UGUG elements. We found that over 75% of mRNA genes in Drosophila melanogaster undergo APA. The head tissue tends to use distal PASs when compared to the body, leading to preferential expression of APA isoforms with long 3'UTRs as well as with distal terminal exons. The distance between the APA sites and intron location of PAS are important parameters for APA difference between body and head, suggesting distinct PAS selection contexts. APA analysis of the RpII215 C4 mutant strain, which harbors a mutant RNA polymerase II (RNAPII) with a slower elongation rate, revealed that a 50% decrease in transcriptional elongation rate leads to a mild trend of more usage of proximal, weaker PASs, both in 3'UTRs and in introns, consistent with the "first come, first served" model of APA regulation. However, this trend was not observed in the head, suggesting a different regulatory context in neuronal cells. Together, our data expand the PAS collection for Drosophila melanogaster and reveal a tissue-specific effect of APA regulation by RNAPII elongation rate. © 2017 Liu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  2. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form U5S, for annual reports filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed under...

  3. Latitudinal clines in Drosophila melanogaster: body size, allozyme ...

    Unknown

    logy, in explaining such natural genetic variation in D. melanogaster body size and development time. It is argued .... high latitudes were found to use limited food more effi- ciently, so ..... always associate fast development with small body size.

  4. Neurogenetics of female reproductive behaviors in Drosophila melanogaster

    Laturney, Meghan; Billeter, Jean-Christophe; Friedmann, T; Dunlap, JC; Goodwin, SF

    2014-01-01

    We follow an adult Drosophila melanogaster female through the major reproductive decisions she makes during her lifetime, including habitat selection, precopulatory mate choice, postcopulatory physiological changes, polyandry, and egg-laying site selection. In the process, we review the molecular

  5. Induction of morphological aberrations by enzyme inhibition in Drosophila melanogaster

    Bos, M.; Scharloo, W.; Bijlsma, R.; de Boer, I.M.; den Hollander, J.

    1969-01-01

    Zusatz zum Futter vonDrosophila melanogaster von 5-Fluoro-2-deoxyuridin oder Aminopterin induziert überzählige Skutellar- und Dorsozentralborsten sowie gekerbte Flügel. Diese Modifikationen wurden als Konsequenz von Enzymhemmung interpretiert.

  6. Exquisite light sensitivity of Drosophila melanogaster cryptochrome.

    Pooja Vinayak

    Full Text Available Drosophila melanogaster shows exquisite light sensitivity for modulation of circadian functions in vivo, yet the activities of the Drosophila circadian photopigment cryptochrome (CRY have only been observed at high light levels. We studied intensity/duration parameters for light pulse induced circadian phase shifts under dim light conditions in vivo. Flies show far greater light sensitivity than previously appreciated, and show a surprising sensitivity increase with pulse duration, implying a process of photic integration active up to at least 6 hours. The CRY target timeless (TIM shows dim light dependent degradation in circadian pacemaker neurons that parallels phase shift amplitude, indicating that integration occurs at this step, with the strongest effect in a single identified pacemaker neuron. Our findings indicate that CRY compensates for limited light sensitivity in vivo by photon integration over extraordinarily long times, and point to select circadian pacemaker neurons as having important roles.

  7. A screen for F1 hybrid male rescue reveals no major-effect hybrid lethality loci in the Drosophila melanogaster autosomal genome.

    Cuykendall, Tawny N; Satyaki, P; Ji, Shuqing; Clay, Derek M; Edelman, Nathaniel B; Kimchy, Alexandra; Li, Ling-Hei; Nuzzo, Erin A; Parekh, Neil; Park, Suna; Barbash, Daniel A

    2014-10-27

    Hybrid sons between Drosophila melanogaster females and D. simulans males die as 3rd instar larvae. Two genes, D. melanogaster Hybrid male rescue (Hmr) on the X chromosome, and D. simulans Lethal hybrid rescue (Lhr) on chromosome II, interact to cause this lethality. Loss-of-function mutations in either gene suppress lethality, but several pieces of evidence suggest that additional factors are required for hybrid lethality. Here we screen the D. melanogaster autosomal genome by using the Bloomington Stock Center Deficiency kit to search for additional regions that can rescue hybrid male lethality. Our screen is designed to identify putative hybrid incompatibility (HI) genes similar to Hmr and Lhr which, when removed, are dominant suppressors of lethality. After screening 89% of the autosomal genome, we found no regions that rescue males to the adult stage. We did, however, identify several regions that rescue up to 13% of males to the pharate adult stage. This weak rescue suggests the presence of multiple minor-effect HI loci, but we were unable to map these loci to high resolution, presumably because weak rescue can be masked by genetic background effects. We attempted to test one candidate, the dosage compensation gene male specific lethal-3 (msl-3), by using RNA interference with short hairpin microRNA constructs targeted specifically against D. simulans msl-3 but failed to achieve knockdown, in part due to off-target effects. We conclude that the D. melanogaster autosomal genome likely does not contain additional major-effect HI loci. We also show that Hmr is insufficient to fully account for the lethality associated with the D. melanogaster X chromosome, suggesting that additional X-linked genes contribute to hybrid lethality. Copyright © 2014 Cuykendall et al.

  8. Dietary Resveratrol Does Not Affect Life Span, Body Composition, Stress Response, and Longevity-Related Gene Expression in Drosophila melanogaster

    Stefanie Staats

    2018-01-01

    Full Text Available In this study, we tested the effect of the stilbene resveratrol on life span, body composition, locomotor activity, stress response, and the expression of genes encoding proteins centrally involved in ageing pathways in the model organism Drosophila melanogaster. Male and female w1118 D. melanogaster were fed diets based on sucrose, corn meal, and yeast. Flies either received a control diet or a diet supplemented with 500 µmol/L resveratrol. Dietary resveratrol did not affect mean, median, and maximal life span of male and female flies. Furthermore, body composition remained largely unchanged following the resveratrol supplementation. Locomotor activity, as determined by the climbing index, was not significantly different between control and resveratrol-supplemented flies. Resveratrol-fed flies did not exhibit an improved stress response towards hydrogen peroxide as compared to controls. Resveratrol did not change mRNA steady levels of antioxidant (catalase, glutathione-S-transferase, NADH dehydrogenase, glutathione peroxidase, superoxide dismutase 2 and longevity-related genes, including sirtuin 2, spargel, and I’m Not Dead Yet. Collectively, present data suggest that resveratrol does not affect life span, body composition, locomotor activity, stress response, and longevity-associated gene expression in w1118 D. melanogaster.

  9. RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

    Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

    2015-06-01

    4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Dietary Resveratrol Does Not Affect Life Span, Body Composition, Stress Response, and Longevity-Related Gene Expression in Drosophila melanogaster.

    Staats, Stefanie; Wagner, Anika E; Kowalewski, Bianca; Rieck, Florian T; Soukup, Sebastian T; Kulling, Sabine E; Rimbach, Gerald

    2018-01-11

    In this study, we tested the effect of the stilbene resveratrol on life span, body composition, locomotor activity, stress response, and the expression of genes encoding proteins centrally involved in ageing pathways in the model organism Drosophila melanogaster . Male and female w 1118 D. melanogaster were fed diets based on sucrose, corn meal, and yeast. Flies either received a control diet or a diet supplemented with 500 µmol/L resveratrol. Dietary resveratrol did not affect mean, median, and maximal life span of male and female flies. Furthermore, body composition remained largely unchanged following the resveratrol supplementation. Locomotor activity, as determined by the climbing index, was not significantly different between control and resveratrol-supplemented flies. Resveratrol-fed flies did not exhibit an improved stress response towards hydrogen peroxide as compared to controls. Resveratrol did not change mRNA steady levels of antioxidant ( catalase , glutathione-S-transferase , NADH dehydrogenase , glutathione peroxidase , superoxide dismutase 2 ) and longevity-related genes, including sirtuin 2 , spargel , and I'm Not Dead Yet . Collectively, present data suggest that resveratrol does not affect life span, body composition, locomotor activity, stress response, and longevity-associated gene expression in w 1118 D. melanogaster .

  11. Cytochrome P450-Dependent Metabolism of Caffeine in Drosophila melanogaster

    Coelho, Alexandra; Fraichard, Stephane; Le Goff, Gaëlle; Faure, Philippe; Artur, Yves; Ferveur, Jean-François; Heydel, Jean-Marie

    2015-01-01

    Caffeine (1, 3, 7-trimethylxanthine), an alkaloid produced by plants, has antioxidant and insecticide properties that can affect metabolism and cognition. In vertebrates, the metabolites derived from caffeine have been identified, and their functions have been characterized. However, the metabolites of caffeine in insects remain unknown. Thus, using radiolabelled caffeine, we have identified some of the primary caffeine metabolites produced in the body of Drosophila melanogaster males, including theobromine, paraxanthine and theophylline. In contrast to mammals, theobromine was the predominant metabolite (paraxanthine in humans; theophylline in monkeys; 1, 3, 7-trimethyluric acid in rodents). A transcriptomic screen of Drosophila flies exposed to caffeine revealed the coordinated variation of a large set of genes that encode xenobiotic-metabolizing proteins, including several cytochromes P450s (CYPs) that were highly overexpressed. Flies treated with metyrapone—an inhibitor of CYP enzymes—showed dramatically decreased caffeine metabolism, indicating that CYPs are involved in this process. Using interference RNA genetic silencing, we measured the metabolic and transcriptomic effect of three candidate CYPs. Silencing of CYP6d5 completely abolished theobromine synthesis, whereas CYP6a8 and CYP12d1 silencing induced different consequences on metabolism and gene expression. Therefore, we characterized several metabolic products and some enzymes potentially involved in the degradation of caffeine. In conclusion, this pioneer approach to caffeine metabolism in insects opens novel perspectives for the investigation of the physiological effects of caffeine metabolites. It also indicates that caffeine could be used as a biomarker to evaluate CYP phenotypes in Drosophila and other insects. PMID:25671424

  12. The Release 6 reference sequence of the Drosophila melanogaster genome.

    Hoskins, Roger A; Carlson, Joseph W; Wan, Kenneth H; Park, Soo; Mendez, Ivonne; Galle, Samuel E; Booth, Benjamin W; Pfeiffer, Barret D; George, Reed A; Svirskas, Robert; Krzywinski, Martin; Schein, Jacqueline; Accardo, Maria Carmela; Damia, Elisabetta; Messina, Giovanni; Méndez-Lago, María; de Pablos, Beatriz; Demakova, Olga V; Andreyeva, Evgeniya N; Boldyreva, Lidiya V; Marra, Marco; Carvalho, A Bernardo; Dimitri, Patrizio; Villasante, Alfredo; Zhimulev, Igor F; Rubin, Gerald M; Karpen, Gary H; Celniker, Susan E

    2015-03-01

    Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy and middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. Further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads. © 2015 Hoskins et al.; Published by Cold Spring Harbor Laboratory Press.

  13. Cytochrome P450-dependent metabolism of caffeine in Drosophila melanogaster.

    Alexandra Coelho

    Full Text Available Caffeine (1, 3, 7-trimethylxanthine, an alkaloid produced by plants, has antioxidant and insecticide properties that can affect metabolism and cognition. In vertebrates, the metabolites derived from caffeine have been identified, and their functions have been characterized. However, the metabolites of caffeine in insects remain unknown. Thus, using radiolabelled caffeine, we have identified some of the primary caffeine metabolites produced in the body of Drosophila melanogaster males, including theobromine, paraxanthine and theophylline. In contrast to mammals, theobromine was the predominant metabolite (paraxanthine in humans; theophylline in monkeys; 1, 3, 7-trimethyluric acid in rodents. A transcriptomic screen of Drosophila flies exposed to caffeine revealed the coordinated variation of a large set of genes that encode xenobiotic-metabolizing proteins, including several cytochromes P450s (CYPs that were highly overexpressed. Flies treated with metyrapone--an inhibitor of CYP enzymes--showed dramatically decreased caffeine metabolism, indicating that CYPs are involved in this process. Using interference RNA genetic silencing, we measured the metabolic and transcriptomic effect of three candidate CYPs. Silencing of CYP6d5 completely abolished theobromine synthesis, whereas CYP6a8 and CYP12d1 silencing induced different consequences on metabolism and gene expression. Therefore, we characterized several metabolic products and some enzymes potentially involved in the degradation of caffeine. In conclusion, this pioneer approach to caffeine metabolism in insects opens novel perspectives for the investigation of the physiological effects of caffeine metabolites. It also indicates that caffeine could be used as a biomarker to evaluate CYP phenotypes in Drosophila and other insects.

  14. The transcriptional response of Drosophila melanogaster to infection with the sigma virus (Rhabdoviridae.

    Jennifer Carpenter

    2009-08-01

    Full Text Available Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae that occurs in wild populations of D. melanogaster.We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females.These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus.

  15. The transcriptional response of Drosophila melanogaster to infection with the sigma virus (Rhabdoviridae).

    Carpenter, Jennifer; Hutter, Stephan; Baines, John F; Roller, Julia; Saminadin-Peter, Sarah S; Parsch, John; Jiggins, Francis M

    2009-08-31

    Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae) that occurs in wild populations of D. melanogaster. We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females. These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus.

  16. The Transcriptional Response of Drosophila melanogaster to Infection with the Sigma Virus (Rhabdoviridae)

    Baines, John F.; Roller, Julia; Saminadin-Peter, Sarah S.; Parsch, John; Jiggins, Francis M.

    2009-01-01

    Background Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae) that occurs in wild populations of D. melanogaster. Principal Findings We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females. Conclusions These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus. PMID:19718442

  17. Comparative genomic analysis of Drosophila melanogaster and vector mosquito developmental genes.

    Susanta K Behura

    Full Text Available Genome sequencing projects have presented the opportunity for analysis of developmental genes in three vector mosquito species: Aedes aegypti, Culex quinquefasciatus, and Anopheles gambiae. A comparative genomic analysis of developmental genes in Drosophila melanogaster and these three important vectors of human disease was performed in this investigation. While the study was comprehensive, special emphasis centered on genes that 1 are components of developmental signaling pathways, 2 regulate fundamental developmental processes, 3 are critical for the development of tissues of vector importance, 4 function in developmental processes known to have diverged within insects, and 5 encode microRNAs (miRNAs that regulate developmental transcripts in Drosophila. While most fruit fly developmental genes are conserved in the three vector mosquito species, several genes known to be critical for Drosophila development were not identified in one or more mosquito genomes. In other cases, mosquito lineage-specific gene gains with respect to D. melanogaster were noted. Sequence analyses also revealed that numerous repetitive sequences are a common structural feature of Drosophila and mosquito developmental genes. Finally, analysis of predicted miRNA binding sites in fruit fly and mosquito developmental genes suggests that the repertoire of developmental genes targeted by miRNAs is species-specific. The results of this study provide insight into the evolution of developmental genes and processes in dipterans and other arthropods, serve as a resource for those pursuing analysis of mosquito development, and will promote the design and refinement of functional analysis experiments.

  18. Impact of the Chromatin Remodeling Factor CHD1 on Gut Microbiome Composition of Drosophila melanogaster.

    Johanna Sebald

    Full Text Available The composition of the intestinal microbiota of Drosophila has been studied in some detail in recent years. Environmental, developmental and host-specific genetic factors influence microbiome composition in the fly. Our previous work has indicated that intestinal bacterial load can be affected by chromatin-targeted regulatory mechanisms. Here we studied a potential role of the conserved chromatin assembly and remodeling factor CHD1 in the shaping of the gut microbiome in Drosophila melanogaster. Using high-throughput sequencing of 16S rRNA gene amplicons, we found that Chd1 deletion mutant flies exhibit significantly reduced microbial diversity compared to rescued control strains. Specifically, although Acetobacteraceae dominated the microbiota of both Chd1 wild-type and mutant guts, Chd1 mutants were virtually monoassociated with this bacterial family, whereas in control flies other bacterial taxa constituted ~20% of the microbiome. We further show age-linked differences in microbial load and microbiota composition between Chd1 mutant and control flies. Finally, diet supplementation experiments with Lactobacillus plantarum revealed that, in contrast to wild-type flies, Chd1 mutant flies were unable to maintain higher L. plantarum titres over time. Collectively, these data provide evidence that loss of the chromatin remodeler CHD1 has a major impact on the gut microbiome of Drosophila melanogaster.

  19. Essential loci in centromeric heterochromatin of Drosophila melanogaster. I: the right arm of chromosome 2.

    Coulthard, Alistair B; Alm, Christina; Cealiac, Iulia; Sinclair, Don A; Honda, Barry M; Rossi, Fabrizio; Dimitri, Patrizio; Hilliker, Arthur J

    2010-06-01

    With the most recent releases of the Drosophila melanogaster genome sequences, much of the previously absent heterochromatic sequences have now been annotated. We undertook an extensive genetic analysis of existing lethal mutations, as well as molecular mapping and sequence analysis (using a candidate gene approach) to identify as many essential genes as possible in the centromeric heterochromatin on the right arm of the second chromosome (2Rh) of D. melanogaster. We also utilized available RNA interference lines to knock down the expression of genes in 2Rh as another approach to identifying essential genes. In total, we verified the existence of eight novel essential loci in 2Rh: CG17665, CG17683, CG17684, CG17883, CG40127, CG41265, CG42595, and Atf6. Two of these essential loci, CG41265 and CG42595, are synonymous with the previously characterized loci l(2)41Ab and unextended, respectively. The genetic and molecular analysis of the previously reported locus, l(2)41Ae, revealed that this is not a single locus, but rather it is a large region of 2Rh that extends from unextended (CG42595) to CG17665 and includes four of the novel loci uncovered here.

  20. Preferences of AAA/AAG codon recognition by modified nucleosides, τm5s2U34 and t6A37 present in tRNALys.

    Sonawane, Kailas D; Kamble, Asmita S; Fandilolu, Prayagraj M

    2017-12-27

    Deficiency of 5-taurinomethyl-2-thiouridine, τm 5 s 2 U at the 34th 'wobble' position in tRNA Lys causes MERRF (Myoclonic Epilepsy with Ragged Red Fibers), a neuromuscular disease. This modified nucleoside of mt tRNA Lys , recognizes AAA/AAG codons during protein biosynthesis process. Its preference to identify cognate codons has not been studied at the atomic level. Hence, multiple MD simulations of various molecular models of anticodon stem loop (ASL) of mt tRNA Lys in presence and absence of τm 5 s 2 U 34 and N 6 -threonylcarbamoyl adenosine (t 6 A 37 ) along with AAA and AAG codons have been accomplished. Additional four MD simulations of multiple ASL mt tRNA Lys models in the context of ribosomal A-site residues have also been performed to investigate the role of A-site in recognition of AAA/AAG codons. MD simulation results show that, ASL models in presence of τm 5 s 2 U 34 and t 6 A 37 with codons AAA/AAG are more stable than the ASL lacking these modified bases. MD trajectories suggest that τm 5 s 2 U recognizes the codons initially by 'wobble' hydrogen bonding interactions, and then tRNA Lys might leave the explicit codon by a novel 'single' hydrogen bonding interaction in order to run the protein biosynthesis process smoothly. We propose this model as the 'Foot-Step Model' for codon recognition, in which the single hydrogen bond plays a crucial role. MD simulation results suggest that, tRNA Lys with τm 5 s 2 U and t 6 A recognizes AAA codon more preferably than AAG. Thus, these results reveal the consequences of τm 5 s 2 U and t 6 A in recognition of AAA/AAG codons in mitochondrial disease, MERRF.

  1. DEPLOYMENT OF 5S SYSTEM IN ARCHIVES MANAGEMENT

    Marcelo Cavaglieri

    2017-06-01

    Full Text Available An efficient document management brings various benefits, not only for professionals of the area but, mainly, for business managers who can use this information in their decisionmaking to enjoy competitive advantages on competitors. Having in mind that effectiveness is a constant pursuit for any company in order to achieve their strategic goals and improve the techniques which enable more productivity using fewer financial resources. In this sense, it was sought to apply the 5S philosophy in the document file management of Santa Fé Company, once it is necessary to improve the current processes with less waste and more efficiency, with a view to the need to suit the client more efficiently before their information necessities. Regarding to the method used, it is characterized as a researchaction in a quali-quantitative approach, classified as exploratory and descriptive. Among the obtained research results, it stands out in a quantitative way the reduction of waste, with significant gains of Lead Time, diminishing the time to process the activities. Financial gains were also obtained with a better use of resources and a redesigning of the way to keeping the documents. In a qualitative way, a better working environment is highlighted and increase of the service efficiency in bringing more customer satisfaction.

  2. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. © 2013 Elsevier Inc. All rights reserved.

  3. Observation of the strongest 5s2 5p6 5d-(5s2 5p5 5d6s+5s25p6 7p) transitions in Au XI to Bi XV ions

    Churilov, S.S.; Joshi, Y.N.

    2001-01-01

    The spectra of gold till bismuth were studied in the 90-135 A region. Nine most intense lines belonging to the 5s 2 5p 6 5d-5s 2 5p 5 5d6s array were identified in Au XI to Bi XV ions. The 5s 2 5p 6 7p 2 P 3/2,1/2 levels in Au XI and the 5s 2 5p 6 7p 2 P 3/2 level in Hg XII were also identified. The observed wavelengths and intensities agree quite well with the Hartree-Fock calculations. (orig.)

  4. Metabolome analysis of Drosophila melanogaster during embryogenesis.

    An, Phan Nguyen Thuy; Yamaguchi, Masamitsu; Bamba, Takeshi; Fukusaki, Eiichiro

    2014-01-01

    The Drosophila melanogaster embryo has been widely utilized as a model for genetics and developmental biology due to its small size, short generation time, and large brood size. Information on embryonic metabolism during developmental progression is important for further understanding the mechanisms of Drosophila embryogenesis. Therefore, the aim of this study is to assess the changes in embryos' metabolome that occur at different stages of the Drosophila embryonic development. Time course samples of Drosophila embryos were subjected to GC/MS-based metabolome analysis for profiling of low molecular weight hydrophilic metabolites, including sugars, amino acids, and organic acids. The results showed that the metabolic profiles of Drosophila embryo varied during the course of development and there was a strong correlation between the metabolome and different embryonic stages. Using the metabolome information, we were able to establish a prediction model for developmental stages of embryos starting from their high-resolution quantitative metabolite composition. Among the important metabolites revealed from our model, we suggest that different amino acids appear to play distinct roles in different developmental stages and an appropriate balance in trehalose-glucose ratio is crucial to supply the carbohydrate source for the development of Drosophila embryo.

  5. Gut-associated microbes of Drosophila melanogaster

    Broderick, Nichole; Lemaitre, Bruno

    2012-01-01

    There is growing interest in using Drosophila melanogaster to elucidate mechanisms that underlie the complex relationships between a host and its microbiota. In addition to the many genetic resources and tools Drosophila provides, its associated microbiota is relatively simple (1–30 taxa), in contrast to the complex diversity associated with vertebrates (> 500 taxa). These attributes highlight the potential of this system to dissect the complex cellular and molecular interactions that occur between a host and its microbiota. In this review, we summarize what is known regarding the composition of gut-associated microbes of Drosophila and their impact on host physiology. We also discuss these interactions in the context of their natural history and ecology and describe some recent insights into mechanisms by which Drosophila and its gut microbiota interact. “Workers with Drosophila have been considered fortunate in that they deal with the first multicellular invertebrate to be cultured monoxenically (Delcourt and Guyenot, 1910); the first to be handled axenically on a semisynthetic diet (Guyenot, 1917); and the first to be grown on a defined diet (Schultz et al., 1946). This list of advantages is somewhat embarrassing, since it implies an interest in nutrition that, in reality, was only secondary. The very first studies were concerned with the reduction of variability in genetic experiments (Delcourt and Guyenot, 1910) and standardization of the nutritional environment.” -James Sang, 1959 Ann NY Acad 1 PMID:22572876

  6. Ferritin Assembly in Enterocytes of Drosophila melanogaster

    Abraham Rosas-Arellano

    2016-02-01

    Full Text Available Ferritins are protein nanocages that accumulate inside their cavity thousands of oxidized iron atoms bound to oxygen and phosphates. Both characteristic types of eukaryotic ferritin subunits are present in secreted ferritins from insects, but here dimers between Ferritin 1 Heavy Chain Homolog (Fer1HCH and Ferritin 2 Light Chain Homolog (Fer2LCH are further stabilized by disulfide-bridge in the 24-subunit complex. We addressed ferritin assembly and iron loading in vivo using novel transgenic strains of Drosophila melanogaster. We concentrated on the intestine, where the ferritin induction process can be controlled experimentally by dietary iron manipulation. We showed that the expression pattern of Fer2LCH-Gal4 lines recapitulated iron-dependent endogenous expression of the ferritin subunits and used these lines to drive expression from UAS-mCherry-Fer2LCH transgenes. We found that the Gal4-mediated induction of mCherry-Fer2LCH subunits was too slow to effectively introduce them into newly formed ferritin complexes. Endogenous Fer2LCH and Fer1HCH assembled and stored excess dietary iron, instead. In contrast, when flies were genetically manipulated to co-express Fer2LCH and mCherry-Fer2LCH simultaneously, both subunits were incorporated with Fer1HCH in iron-loaded ferritin complexes. Our study provides fresh evidence that, in insects, ferritin assembly and iron loading in vivo are tightly regulated.

  7. Characterization of Autophagic Responses in Drosophila melanogaster.

    Xu, T; Kumar, S; Denton, D

    2017-01-01

    Drosophila is an excellent model system for studying autophagy during animal development due to the availability of genetic reagents and opportunity for in vivo cell biological analysis. The regulation and mechanism of autophagy are highly evolutionarily conserved and the role of autophagy has been characterized during various stages of Drosophila development as well as following starvation. Studies in Drosophila have revealed novel insights into the role of distinct components of the autophagy machinery. This chapter describes protocols for examining autophagy during Drosophila development. A crucial step in the induction of autophagy is the incorporation of Atg8a into the autophagosome. This can be measured as autophagic puncta using live fluorescent imaging, immunostaining, or immunoblot analysis of LC3/Atg8a processing. The level of autophagy can also be examined using other specific components of the autophagy pathway as markers detected by immunofluorescent imaging. Based on the distinct morphology of autophagy, it can also be examined by transmission electron microscopy. In addition, one of the advantages of using Drosophila as a model is the ability to undertake genetic analysis of individual components of the autophagy machinery. Current approaches that can be used to monitor autophagy, including the overall flux and individual steps in Drosophila melanogaster, will be discussed. © 2017 Elsevier Inc. All rights reserved.

  8. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  9. Neurogenetics of female reproductive behaviors in Drosophila melanogaster.

    Laturney, Meghan; Billeter, Jean-Christophe

    2014-01-01

    We follow an adult Drosophila melanogaster female through the major reproductive decisions she makes during her lifetime, including habitat selection, precopulatory mate choice, postcopulatory physiological changes, polyandry, and egg-laying site selection. In the process, we review the molecular and neuronal mechanisms allowing females to integrate signals from both environmental and social sources to produce those behavioral outputs. We pay attention to how an understanding of D. melanogaster female reproductive behaviors contributes to a wider understanding of evolutionary processes such as pre- and postcopulatory sexual selection as well as sexual conflict. Within each section, we attempt to connect the theories that pertain to the evolution of female reproductive behaviors with the molecular and neurobiological data that support these theories. We draw attention to the fact that the evolutionary and mechanistic basis of female reproductive behaviors, even in a species as extensively studied as D. melanogaster, remains poorly understood. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Mutagenic effects of irradiated glucose in Drosophila melanogaster

    Varma, M.B.; Rao, K.P.; Nandan, S.D.; Rao, M.S.

    1982-01-01

    The mutagenic effects of irradiated glucose were studied using the sex-linked recessive lethal test in Drosophila melanogaster. Oregon K males of D. melanogaster reared on a medium containing 20 or 40% glucose irradiated with a dose of 0.02, 0.10, 0.20, 2 or 5 Mrad #betta#-rays were scored for the induction of sex-linked recessive lethals. The results showed no significant increase in the frequency of X-lethals in Drosophila at any of the dose levels. (author)

  11. The calculation of oscillator strengths for the 5s21S0→5s5p1,3P1 transitions in Cd-like ions

    Li Guangyuan

    1998-01-01

    The screened hydrogenic model is employed to calculate the oscillator strength of the 5s 2 1 S 0 -5s5p 1 P 1 resonance transition in Cd-like ions (Z = 48 -74). The expression for the oscillator strength of the 5s 2 1 S 0 -5s5p 3 P1 is given, with the introduction of the correctional coefficient K and the mixing angle in jj-coupling. The results are compared with that of other authors, and some discussions are also given

  12. Measurement of lifespan in Drosophila melanogaster.

    Linford, Nancy J; Bilgir, Ceyda; Ro, Jennifer; Pletcher, Scott D

    2013-01-07

    Aging is a phenomenon that results in steady physiological deterioration in nearly all organisms in which it has been examined, leading to reduced physical performance and increased risk of disease. Individual aging is manifest at the population level as an increase in age-dependent mortality, which is often measured in the laboratory by observing lifespan in large cohorts of age-matched individuals. Experiments that seek to quantify the extent to which genetic or environmental manipulations impact lifespan in simple model organisms have been remarkably successful for understanding the aspects of aging that are conserved across taxa and for inspiring new strategies for extending lifespan and preventing age-associated disease in mammals. The vinegar fly, Drosophila melanogaster, is an attractive model organism for studying the mechanisms of aging due to its relatively short lifespan, convenient husbandry, and facile genetics. However, demographic measures of aging, including age-specific survival and mortality, are extraordinarily susceptible to even minor variations in experimental design and environment, and the maintenance of strict laboratory practices for the duration of aging experiments is required. These considerations, together with the need to practice careful control of genetic background, are essential for generating robust measurements. Indeed, there are many notable controversies surrounding inference from longevity experiments in yeast, worms, flies and mice that have been traced to environmental or genetic artifacts(1-4). In this protocol, we describe a set of procedures that have been optimized over many years of measuring longevity in Drosophila using laboratory vials. We also describe the use of the dLife software, which was developed by our laboratory and is available for download (http://sitemaker.umich.edu/pletcherlab/software). dLife accelerates throughput and promotes good practices by incorporating optimal experimental design, simplifying

  13. Optogenetic pacing in Drosophila melanogaster (Conference Presentation)

    Alex, Aneesh; Li, Airong; Men, Jing; Jerwick, Jason; Tanzi, Rudolph E.; Zhou, Chao

    2016-03-01

    A non-invasive, contact-less cardiac pacing technology can be a powerful tool in basic cardiac research and in clinics. Currently, electrical pacing is the gold standard for cardiac pacing. Although highly effective in controlling the cardiac function, the invasive nature, non-specificity to cardiac tissues and possible tissue damage limits its capabilities. Optical pacing of heart is a promising alternative, which is non-invasive and more specific, has high spatial and temporal precision, and avoids shortcomings in electrical stimulation. Optical coherence tomography has been proved to be an effective technique in non-invasive imaging in vivo with ultrahigh resolution and imaging speed. In the last several years, non-invasive specific optical pacing in animal hearts has been reported in quail, zebrafish, and rabbit models. However, Drosophila Melanogaster, which is a significant model with orthologs of 75% of human disease genes, has rarely been studied concerning their optical pacing in heart. Here, we combined optogenetic control of Drosophila heartbeat with optical coherence microscopy (OCM) technique for the first time. The light-gated cation channel, channelrhodopsin-2 (ChR2) was specifically expressed by transgene as a pacemaker in drosophila heart. By stimulating the pacemaker with 472 nm pulsed laser light at different frequencies, we achieved non-invasive and more specific optical control of the Drosophila heart rhythm, which demonstrates the wide potential of optical pacing for studying cardiac dynamics and development. Imaging capability of our customized OCM system was also involved to observe the pacing effect visually. No tissue damage was found after long exposure to laser pulses, which proved the safety of optogenetic control of Drosophila heart.

  14. O-5S quantitative real-time PCR: a new diagnostic tool for laboratory confirmation of human onchocerciasis.

    Mekonnen, Solomon A; Beissner, Marcus; Saar, Malkin; Ali, Solomon; Zeynudin, Ahmed; Tesfaye, Kassahun; Adbaru, Mulatu G; Battke, Florian; Poppert, Sven; Hoelscher, Michael; Löscher, Thomas; Bretzel, Gisela; Herbinger, Karl-Heinz

    2017-10-02

    Onchocerciasis is a parasitic disease caused by the filarial nematode Onchocerca volvulus. In endemic areas, the diagnosis is commonly confirmed by microscopic examination of skin snip samples, though this technique is considered to have low sensitivity. The available melting-curve based quantitative real-time PCR (qPCR) using degenerated primers targeting the O-150 repeat of O. volvulus was considered insufficient for confirming the individual diagnosis, especially in elimination studies. This study aimed to improve detection of O. volvulus DNA in clinical samples through the development of a highly sensitive qPCR assay. A novel hydrolysis probe based qPCR assay was designed targeting the specific sequence of the O. volvulus O-5S rRNA gene. A total of 200 clinically suspected onchocerciasis cases were included from Goma district in South-west Ethiopia, from October 2012 through May 2013. Skin snip samples were collected and subjected to microscopy, O-150 qPCR, and the novel O-5S qPCR. Among the 200 individuals, 133 patients tested positive (positivity rate of 66.5%) and 67 negative by O-5S qPCR, 74 tested positive by microscopy (37.0%) and 78 tested positive by O-150 qPCR (39.0%). Among the 133 O-5S qPCR positive individuals, microscopy and O-150 qPCR detected 55.6 and 59.4% patients, respectively, implying a higher sensitivity of O-5S qPCR than microscopy and O-150 qPCR. None of the 67 individuals who tested negative by O-5S qPCR tested positive by microscopy or O-150 qPCR, implying 100% specificity of the newly designed O-5S qPCR assay. The novel O-5S qPCR assay is more sensitive than both microscopic examination and the existing O-150 qPCR for the detection of O. volvulus from skin snip samples. The newly designed assay is an important step towards appropriate individual diagnosis and control of onchocerciasis.

  15. Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

    Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

    2017-11-14

    The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

  16. Global identification of bursicon-regulated genes in Drosophila melanogaster

    Beerntsen Brenda

    2008-09-01

    Full Text Available Abstract Background Bursicon is a heterodimer neuropeptide responsible for regulating cuticle sclerotization and wing expansion in several insect species. Recent studies indicate that the action of bursicon is mediated by a specific G protein-coupled receptor DLGR2 and the cAMP/PKA signaling pathway. However, little is known regarding the genes that are regulated by bursicon. The identification of bursicon-regulated genes is the focus of this investigation. Results We used DNA microarray analysis to identify bursicon-regulated genes in neck-ligated flies (Drosophila melanogaster that received recombinant bursicon (r-bursicon. Fifty four genes were found to be regulated by bursicon 1 h post r-bursicon injection, 52 being up-regulated and 2 down-regulated while 33 genes were influenced by r-bursicon 3 h post-injection (24 up-regulated and 9 down-regulated genes. Analysis of these genes by inference from the fly database http://flybase.bio.indiana.edu revealed that these genes encode proteins with diverse functions, including cell signaling, gene transcription, DNA/RNA binding, ion trafficking, proteolysis-peptidolysis, metabolism, cytoskeleton formation, immune response and cell-adhesion. Twenty eight genes randomly selected from the microarray-identified list were verified by real time PCR (qPCR which supported the microarray data. Temporal response studies of 13 identified and verified genes by qPCR revealed that the temporal expression patterns of these genes are consistent with the microarray data. Conclusion Using r-bursicon, we identified 87 genes that are regulated by bursicon, 30 of which have no previously known function. Most importantly, all genes randomly selected from the microarray-identified list were verified by real time PCR. Temporal analysis of 13 verified genes revealed that the expression of these genes was indeed induced by bursicon and correlated well with the cuticle sclerotization process. The composite data suggest that

  17. Hyperfine structure in 5s4d 3D-5snf transitions of 87Sr

    Bushaw, B.A.; Kluge, H.J.; Lantzsch, J.; Schwalbach, R.; Stenner, J.; Stevens, H.; Wendt, K.; Zimmer, K.

    1993-01-01

    The hyperfine spectra of the 5s4d 3 D 1 -5s20f, 5s4d 3 D 2 -5s23f, and 5s4d 3 D 3 -5s32f transitions of 87 Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a 5s and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d 3 D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)

  18. ADAR RNA editing below the backbone.

    Keegan, Liam; Khan, Anzer; Vukic, Dragana; O'Connell, Mary

    2017-09-01

    ADAR RNA editing enzymes ( a denosine d e a minases acting on R NA) that convert adenosine bases to inosines were first identified biochemically 30 years ago. Since then, studies on ADARs in genetic model organisms, and evolutionary comparisons between them, continue to reveal a surprising range of pleiotropic biological effects of ADARs. This review focuses on Drosophila melanogaster , which has a single Adar gene encoding a homolog of vertebrate ADAR2 that site-specifically edits hundreds of transcripts to change individual codons in ion channel subunits and membrane and cytoskeletal proteins. Drosophila ADAR is involved in the control of neuronal excitability and neurodegeneration and, intriguingly, in the control of neuronal plasticity and sleep. Drosophila ADAR also interacts strongly with RNA interference, a key antiviral defense mechanism in invertebrates. Recent crystal structures of human ADAR2 deaminase domain-RNA complexes help to interpret available information on Drosophila ADAR isoforms and on the evolution of ADARs from tRNA deaminase ADAT proteins. ADAR RNA editing is a paradigm for the now rapidly expanding range of RNA modifications in mRNAs and ncRNAs. Even with recent progress, much remains to be understood about these groundbreaking ADAR RNA modification systems. © 2017 Keegan et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  19. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-11-11

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

  20. Inbreeding affects locomotor activity in Drosophila melanogaster at different ages

    Manenti, Tommaso; Pertoldi, Cino; Nasiri Moghadam, Neda

    2015-01-01

    The ability to move is essential for many behavioural traits closely related to fitness. Here we studied the effect of inbreeding on locomotor activity (LA) of Drosophila melanogaster at different ages under both dark and light regimes. We expected to find a decreased LA in inbred lines compared...

  1. The metabolic profile of long-lived Drosophila melanogaster

    Sarup, Pernille Merete; Pedersen, Simon Metz; Nielsen, Niels Christian

    2012-01-01

    We investigated the age-related changes in the metabolic profile of male Drosophila melanogaster and compared the metabolic profile of flies selected for increased longevity to that of control flies of equal age. We found clear differences in metabolite composition between selection regimes...

  2. A high-quality catalog of the Drosophila melanogaster proteome

    Brunner, Erich; Ahrens, Christian H.; Mohanty, Sonaly

    2007-01-01

    % of the predicted Drosophila melanogaster proteome by detecting 9,124 proteins from 498,000 redundant and 72,281 distinct peptide identifications. This unprecedented high proteome coverage for a complex eukaryote was achieved by combining sample diversity, multidimensional biochemical fractionation and analysis...

  3. Ionizing radiation causes the stress response in Drosophila melanogaster

    Gruntenko, N.E.; Zakharenko, L.P.; Raushenbakh, I.Yu.

    1998-01-01

    Potentiality of the stress-reaction arising in Drosophila melanogaster under gamma-irradiation of the source with 137 Cs (irradiation dose is 10 Gy , radiation dose rate amounts 180 c Gy/min) is studied. It is shown that radiation induces the stress-reaction in Drosophila resulting in alterations in energetic metabolism (biogenic amines metabolic system) and in reproductive function [ru

  4. Nearly Neutral Evolution Across the Drosophila melanogaster Genome

    Esteve, David Castellano; James, Jennifer; Eyre-Walker, Adam

    2017-01-01

    Under the nearly neutral theory of molecular evolution the proportion of effectively neutral mutations is expected to depend upon the effective population size (Ne). Here we investigate whether this is the case across the genome of Drosophila melanogaster using polymorphism data from 128 North...

  5. Characterization of reproductive dormancy in male Drosophila melanogaster

    Kubrak, O. I.; Kučerová, Lucie; Theopold, U.; Nylin, S.; Nässel, D. R.

    2016-01-01

    Roč. 7, NOV 24 (2016), č. článku 572. ISSN 1664-042X Institutional support: RVO:60077344 Keywords : Drosophila melanogaster * diapause * reproduction Subject RIV: ED - Physiology Impact factor: 4.134, year: 2016 http://journal.frontiersin.org/article/10.3389/fphys.2016.00572/full

  6. NF-1 Dependent Gene Regulation in Drosophila Melanogaster

    2004-04-01

    standard cornmeal medium at 25oC in a humidified incubator. Flies were collected and frozen in liquid nitrogen at the same time of day to minimize...melanogaster media, strains and heat-shock conditions Flies were raised at room temperature (22–248C) on standard cornmeal medium. The Nf1 mutants Nf1P1 and

  7. DIRECT SELECTION ON LIFE-SPAN IN DROSOPHILA-MELANOGASTER

    ZWAAN, B; BIJLSMA, R; HOEKSTRA, RE

    An important issue in the study of the evolution of aging in Drosophila melanogaster is whether decreased early fecundity is inextricably coupled with increased life span in selection experiments on age at reproduction. Here, this problem has been tackled using an experimental design in which

  8. Heat shock protection against cold stress of Drosophila melanogaster

    Burton, Vicky; Mitchell, Herschel K.; Young, Patricia; Petersen, Nancy S.

    1988-01-01

    Heat shock protein synthesis can be induced during recovery from cold treatment of Drosophila melanogaster larvae. Survival of larvae after a cold treatment is dramatically improved by a mild heat shock just before the cold shock. The conditions which induce tolerance to cold are similar to those which confer tolerance to heat.

  9. Geographical analysis of diapause inducibility in European Drosophila melanogaster populations.

    Pegoraro, Mirko; Zonato, Valeria; Tyler, Elizabeth R; Fedele, Giorgio; Kyriacou, Charalambos P; Tauber, Eran

    2017-04-01

    Seasonal overwintering in insects represents an adaptation to stressful environments and in European Drosophila melanogaster females, low temperatures and short photoperiods can induce an ovarian diapause. Diapause may represent a recent (melanogaster from tropical sub-Saharan Africa, because African D. melanogaster and the sibling species D. simulans, have been reported to fail to undergo diapause. Over the past few centuries, D. melanogaster have also invaded North America and Australia, and eastern populations on both continents show a predictable latitudinal cline in diapause induction. In Europe however, a new diapause-enhancing timeless allele, ls-tim, is observed at high levels in southern Italy (∼80%), where it appears to have arisen and has spread throughout the continent with a frequency of ∼20% in Scandinavia. Given the phenotype of ls-tim and its geographical distribution, we might predict that it would work against any latitudinal cline in diapause induction within Europe. Indeed we reveal that any latitudinal cline for diapause in Europe is very weak, as predicted by ls-tim frequencies. In contrast, we determine ls-tim frequencies in North America and observe that they would be expected to strengthen the latitudinal pattern of diapause. Our results reveal how a newly arisen mutation, can, via the stochastic nature of where it initially arose, blur an otherwise adaptive geographical pattern. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. P element excision in drosophila melanogaster and related drosophilids

    The frequency of P element excision and the structure of the resulting excision products were determined in three drosophilid species, Drosophila melanogaster, D. virilis, and Chymomyza procnemis. A transient P element mobility assay was conducted in the cells of developing insect embryos, but unlik...

  11. mutations of Drosophila melanogaster cause nonrandom cell death ...

    In Drosophila melanogaster, the intersex (ix) is a terminally positioned gene in somatic sex determination hierarchy and function with the female specific product of double sex (DSXF) to implement female sexual differentiation. The null phenotype of ix is to transform diplo-X individuals into intersexes while leaving haplo-X ...

  12. Electron correlation in the 4d-16p→5s-26p and 5s-15p-16p resonance Auger transitions of Xe

    Osmekhin, S.; Nikkinen, J.; Sankari, R.; Maeaettae, M.; Kukk, E.; Huttula, M.; Heinaesmaeki, S.; Aksela, H.; Aksela, S.

    2007-01-01

    The Xe 4d -1 6p→5s 0 5p 6 6p and 5s 1 5p 5 6p resonant Auger transitions have been studied both theoretically and experimentally. High resolution resonant Auger spectra have been recoded with different photon bandwidths which have enabled to separate the first step Auger transition from the overlapping second step transitions. Theoretical calculations using multi-configuration Dirac-Fock approach with different configuration expansions were carried out, compared to each other and to the experiment. The calculations with the largest basis set were found to reproduce the distribution of the intensity to the main and satellite lines in both the 5s 0 5p 6 6p and 5s 1 5p 5 6p Auger groups reasonably well, and to predict the structure of the 4d -1 6p→5s 0 5p 6 6p main lines very well

  13. RNA Crystallization

    Golden, Barbara L.; Kundrot, Craig E.

    2003-01-01

    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  14. Biases in Drosophila melanogaster protein trap screens

    Müller Ilka

    2009-05-01

    Full Text Available Abstract Background The ability to localise or follow endogenous proteins in real time in vivo is of tremendous utility for cell biology or systems biology studies. Protein trap screens utilise the random genomic insertion of a transposon-borne artificial reporter exon (e.g. encoding the green fluorescent protein, GFP into an intron of an endogenous gene to generate a fluorescent fusion protein. Despite recent efforts aimed at achieving comprehensive coverage of the genes encoded in the Drosophila genome, the repertoire of genes that yield protein traps is still small. Results We analysed the collection of available protein trap lines in Drosophila melanogaster and identified potential biases that are likely to restrict genome coverage in protein trap screens. The protein trap screens investigated here primarily used P-element vectors and thus exhibit some of the same positional biases associated with this transposon that are evident from the comprehensive Drosophila Gene Disruption Project. We further found that protein trap target genes usually exhibit broad and persistent expression during embryonic development, which is likely to facilitate better detection. In addition, we investigated the likely influence of the GFP exon on host protein structure and found that protein trap insertions have a significant bias for exon-exon boundaries that encode disordered protein regions. 38.8% of GFP insertions land in disordered protein regions compared with only 23.4% in the case of non-trapping P-element insertions landing in coding sequence introns (p -4. Interestingly, even in cases where protein domains are predicted, protein trap insertions frequently occur in regions encoding surface exposed areas that are likely to be functionally neutral. Considering the various biases observed, we predict that less than one third of intron-containing genes are likely to be amenable to trapping by the existing methods. Conclusion Our analyses suggest that the

  15. Dm5-HT2B: Pharmacological Characterization of the Fifth Serotonin Receptor Subtype of Drosophila melanogaster

    Wolfgang Blenau

    2017-05-01

    Full Text Available Serotonin (5-hydroxytryptamine, 5-HT is an important regulator of physiological and behavioral processes in both protostomes (e.g., insects and deuterostomes (e.g., mammals. In insects, serotonin has been found to modulate the heart rate and to control secretory processes, development, circadian rhythms, aggressive behavior, as well as to contribute to learning and memory. Serotonin exerts its activity by binding to and activating specific membrane receptors. The clear majority of these receptors belong to the superfamily of G-protein-coupled receptors. In Drosophila melanogaster, a total of five genes have been identified coding for 5-HT receptors. From this family of proteins, four have been pharmacologically examined in greater detail, so far. While Dm5-HT1A, Dm5-HT1B, and Dm5-HT7 couple to cAMP signaling cascades, the Dm5-HT2A receptor leads to Ca2+ signaling in an inositol-1,4,5-trisphosphate-dependent manner. Based on sequence similarity to homologous genes in other insects, a fifth D. melanogaster gene was uncovered coding for a Dm5-HT2B receptor. Knowledge about this receptor’s pharmacological properties is very limited. This is quite surprising because Dm5-HT2B has been attributed to distinct physiological functions based on genetic interference with its gene expression. Mutations were described reducing the response of the larval heart to 5-HT, and specific knockdown of Dm5-HT2B mRNA in hemocytes resulted in a higher susceptibility of the flies to bacterial infection. To gain deeper understanding of Dm5-HT2B’s pharmacology, we evaluated the receptor’s response to a series of established 5-HT receptor agonists and antagonists in a functional cell-based assay. Metoclopramide and mianserin were identified as two potent antagonists that may allow pharmacological interference with Dm5-HT2B signaling in vitro and in vivo.

  16. Dm5-HT2B: Pharmacological Characterization of the Fifth Serotonin Receptor Subtype of Drosophila melanogaster.

    Blenau, Wolfgang; Daniel, Stöppler; Balfanz, Sabine; Thamm, Markus; Baumann, Arnd

    2017-01-01

    Serotonin (5-hydroxytryptamine, 5-HT) is an important regulator of physiological and behavioral processes in both protostomes (e.g., insects) and deuterostomes (e.g., mammals). In insects, serotonin has been found to modulate the heart rate and to control secretory processes, development, circadian rhythms, aggressive behavior, as well as to contribute to learning and memory. Serotonin exerts its activity by binding to and activating specific membrane receptors. The clear majority of these receptors belong to the superfamily of G-protein-coupled receptors. In Drosophila melanogaster , a total of five genes have been identified coding for 5-HT receptors. From this family of proteins, four have been pharmacologically examined in greater detail, so far. While Dm5-HT 1A , Dm5-HT 1B , and Dm5-HT 7 couple to cAMP signaling cascades, the Dm5-HT 2A receptor leads to Ca 2+ signaling in an inositol-1,4,5-trisphosphate-dependent manner. Based on sequence similarity to homologous genes in other insects, a fifth D. melanogaster gene was uncovered coding for a Dm5-HT 2B receptor. Knowledge about this receptor's pharmacological properties is very limited. This is quite surprising because Dm5-HT 2B has been attributed to distinct physiological functions based on genetic interference with its gene expression. Mutations were described reducing the response of the larval heart to 5-HT, and specific knockdown of Dm5-HT 2B mRNA in hemocytes resulted in a higher susceptibility of the flies to bacterial infection. To gain deeper understanding of Dm5-HT 2B 's pharmacology, we evaluated the receptor's response to a series of established 5-HT receptor agonists and antagonists in a functional cell-based assay. Metoclopramide and mianserin were identified as two potent antagonists that may allow pharmacological interference with Dm5-HT 2B signaling in vitro and in vivo .

  17. RNA Origami

    Sparvath, Steffen Lynge

    introducerede vores gruppe den enkeltstrengede RNA-origami metode, der giver mulighed for cotranscriptional foldning af veldefinerede nanostrukturer, og er en central del af arbejdet præsenteret heri. Denne ph.d.-afhandling udforsker potentielle anvendelser af RNA-origami nanostrukturer, som nanomedicin eller...... biosensorer. Afhandlingen består af en introduktion til RNA-nanoteknologi feltet, en introduktion af enkeltstrenget RNA-origami design, og fire studier, der beskriver design, produktion og karakterisering af både strukturelle og funktionelle RNA-origamier. Flere RNA-origami designs er blevet undersøgt, og...... projekterne, der indgår i denne afhandling, inkluderer de nyeste fremskridt indenfor strukturel RNA-nanoteknologi og udvikling af funktionelle RNA-baserede enheder. Det første studie beskriver konstruktion og karakterisering af en enkeltstrenget 6-helix RNA-origami stuktur, som er den første demonstration af...

  18. Drosophila interspecific hybrids phenocopy piRNA-pathway mutants.

    Erin S Kelleher

    Full Text Available The Piwi-interacting RNA (piRNA pathway defends the germline of animals from the deleterious activity of selfish transposable elements (TEs through small-RNA mediated silencing. Adaptation to novel invasive TEs is proposed to occur by incorporating their sequences into the piRNA pool that females produce and deposit into their eggs, which then propagates immunity against specific TEs to future generations. In support of this model, the F1 offspring of crosses between strains of the same Drosophila species sometimes suffer from germline derepression of paternally inherited TE families, caused by a failure of the maternal strain to produce the piRNAs necessary for their regulation. However, many protein components of the Drosophila piRNA pathway exhibit signatures of positive selection, suggesting that they also contribute to the evolution of host genome defense. Here we investigate piRNA pathway function and TE regulation in the F1 hybrids of interspecific crosses between D. melanogaster and D. simulans and compare them with intraspecific control crosses of D. melanogaster. We confirm previous reports showing that intraspecific crosses are characterized by derepression of paternally inherited TE families that are rare or absent from the maternal genome and piRNA pool, consistent with the role of maternally deposited piRNAs in shaping TE silencing. In contrast to the intraspecific cross, we discover that interspecific hybrids are characterized by widespread derepression of both maternally and paternally inherited TE families. Furthermore, the pattern of derepression of TE families in interspecific hybrids cannot be attributed to their paucity or absence from the piRNA pool of the maternal species. Rather, we demonstrate that interspecific hybrids closely resemble piRNA effector-protein mutants in both TE misregulation and aberrant piRNA production. We suggest that TE derepression in interspecific hybrids largely reflects adaptive divergence of piRNA

  19. Relationship between organization and function of ribosomal genes in Drosophila melanogaster

    Karpen, G.H.

    1987-01-01

    In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional

  20. Transfection of Chinese hamster ovary DHFR/sup -/ cells with the gene coding for heat shock protein 70 from drosophila melanogaster

    Duffy, J.J.; Carper, S.W.; Gerner, E.W.

    1987-01-01

    Chinese hamster ovary DHFR/sup -/ cells (CHO-DHFR/sup -/) were transfected with the plasmid pSV2-dhfr expressing the mouse gene coding for dhfr or with the same plasmid containing the gene coding for the Drosophila melanogaster heat shock protein 70 (hsp70), pSVd-hsp70. Three subcloned cell lines selected for expression of the dhfr gene were shown to contain either the vector sequence (G cells) or varying copies of pSVd-hsp70 (H cells). One line of H cells was shown to contain > 30 copies of the D. melanogaster hsp70 gene and to express the hsp70 RNA at significant levels. No difference between G and H cells was observed in the rate of growth, in the development of thermotolerance, or in the sensitivity of actin microfilament bundles to heat shock. However, H cells containing the transfected hsp70 gene had an altered morphology when compared to the G cells and the parental CHO-DHFR/sup -/ cells being more fibroblastic. The adhesion properties of the H cells was also decreased when compared to the G cells. These results show that insertion of the D. melanogaster gene into CHO cells does not effect growth rates or heat shock responses but may alter cell morphology and adhesion

  1. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.).

    Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš

    2017-05-18

    Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation

  2. Yolk proteins in the male reproductive system of the fruit fly Drosophila melanogaster: spatial and temporal patterns of expression.

    Majewska, Magdalena M; Suszczynska, Agnieszka; Kotwica-Rolinska, Joanna; Czerwik, Tomasz; Paterczyk, Bohdan; Polanska, Marta A; Bernatowicz, Piotr; Bebas, Piotr

    2014-04-01

    In insects, spermatozoa develop in the testes as clones of single spermatogonia covered by specialized somatic cyst cells (cc). Upon completion of spermatogenesis, spermatozoa are released to the vas deferens, while the cc remain in the testes and die. In the fruit fly Drosophila melanogaster, the released spermatozoa first reach the seminal vesicles (SV), the organ where post-testicular maturation begins. Here, we demonstrate the temporal (restricted to the evening and early night hours) accumulation of membranous vesicles containing proteins in the SV lumen of D. melanogaster. When SV vesicles were isolated from the semen and co-incubated with testis-derived spermatozoa in vitro, their contents bound to the spermatozoa along their tails. The proteins of the SV vesicles were then characterized using 2-D electrophoresis. We identified a prominent protein spot of around 45-47 kDa, which disappears from the SV vesicles in the night, i.e. shortly after they appear in the SV lumen. Sequencing of peptides derived from this spot by mass spectrometry revealed identity with three yolk proteins (YP1-3). This unexpected result was confirmed by western blotting, which demonstrated that SV vesicles contain proteins that are immunoreactive with an antibody against D. melanogaster YP1-3. The expression of all yp genes was shown to be a unique feature of testis tissues. Using RNA probes we found that their transcripts localize exclusively to the cc that cover fully developed spermatozoa in the distal part of each testis. Temporally, the expression of yp genes was found to be restricted to a short period during the day and is followed by the evening accumulation of YP proteins in the cc. Immunohistochemical staining confirmed that cc are the source of SV vesicles containing YPs that are released into the SV lumen. These vesicles interact with spermatozoa and as a result, YPs become extrinsic proteins of the sperm membrane. Thus, we describe for the first time the expression of

  3. Obp56h Modulates Mating Behavior in Drosophila melanogaster

    Shorter, John R.; Dembeck, Lauren M.; Everett, Logan J.; Morozova, Tatiana V.; Arya, Gunjan H.; Turlapati, Lavanya; St. Armour, Genevieve E.; Schal, Coby; Mackay, Trudy F. C.; Anholt, Robert R. H.

    2016-01-01

    Social interactions in insects are driven by conspecific chemical signals that are detected via olfactory and gustatory neurons. Odorant binding proteins (Obps) transport volatile odorants to chemosensory receptors, but their effects on behaviors remain poorly characterized. Here, we report that RNAi knockdown of Obp56h gene expression in Drosophila melanogaster enhances mating behavior by reducing courtship latency. The change in mating behavior that results from inhibition of Obp56h express...

  4. Population genomics of the Wolbachia endosymbiont in Drosophila melanogaster.

    Mark F Richardson

    Full Text Available Wolbachia are maternally inherited symbiotic bacteria, commonly found in arthropods, which are able to manipulate the reproduction of their host in order to maximise their transmission. The evolutionary history of endosymbionts like Wolbachia can be revealed by integrating information on infection status in natural populations with patterns of sequence variation in Wolbachia and host mitochondrial genomes. Here we use whole-genome resequencing data from 290 lines of Drosophila melanogaster from North America, Europe, and Africa to predict Wolbachia infection status, estimate relative cytoplasmic genome copy number, and reconstruct Wolbachia and mitochondrial genome sequences. Overall, 63% of Drosophila strains were predicted to be infected with Wolbachia by our in silico analysis pipeline, which shows 99% concordance with infection status determined by diagnostic PCR. Complete Wolbachia and mitochondrial genomes show congruent phylogenies, consistent with strict vertical transmission through the maternal cytoplasm and imperfect transmission of Wolbachia. Bayesian phylogenetic analysis reveals that the most recent common ancestor of all Wolbachia and mitochondrial genomes in D. melanogaster dates to around 8,000 years ago. We find evidence for a recent global replacement of ancestral Wolbachia and mtDNA lineages, but our data suggest that the derived wMel lineage arose several thousand years ago, not in the 20th century as previously proposed. Our data also provide evidence that this global replacement event is incomplete and is likely to be one of several similar incomplete replacement events that have occurred since the out-of-Africa migration that allowed D. melanogaster to colonize worldwide habitats. This study provides a complete genomic analysis of the evolutionary mode and temporal dynamics of the D. melanogaster-Wolbachia symbiosis, as well as important resources for further analyses of the impact of Wolbachia on host biology.

  5. Nanoliter hemolymph sampling and analysis of individual adult Drosophila melanogaster.

    Piyankarage, Sujeewa C; Featherstone, David E; Shippy, Scott A

    2012-05-15

    The fruit fly (Drosophila melanogaster) is an extensively used and powerful, genetic model organism. However, chemical studies using individual flies have been limited by the animal's small size. Introduced here is a method to sample nanoliter hemolymph volumes from individual adult fruit-flies for chemical analysis. The technique results in an ability to distinguish hemolymph chemical variations with developmental stage, fly sex, and sampling conditions. Also presented is the means for two-point monitoring of hemolymph composition for individual flies.

  6. Single Nucleotide Polymorphism Markers for Genetic Mapping in Drosophila melanogaster

    Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.

    2001-01-01

    For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that recently have revolutionized human, mouse, and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila by using a sequence tagged site-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that sp...

  7. Duplication of Drosophila melanogaster mitochondrial EF-Tu: pre-adaptation to T-arm truncation and exclusion of bulky aminoacyl residues.

    Sato, Aya; Suematsu, Takuma; Aihara, Koh-Ki; Kita, Kiyoshi; Suzuki, Tsutomu; Watanabe, Kimitsuna; Ohtsuki, Takashi; Watanabe, Yoh-Ichi

    2017-03-07

    Translation elongation factor Tu (EF-Tu) delivers aminoacyl-tRNA (aa-tRNA) to ribosomes in protein synthesis. EF-Tu generally recognizes aminoacyl moieties and acceptor- and T-stems of aa-tRNAs. However, nematode mitochondrial (mt) tRNAs frequently lack all or part of the T-arm that is recognized by canonical EF-Tu. We previously reported that two distinct EF-Tu species, EF-Tu1 and EF-Tu2, respectively, recognize mt tRNAs lacking T-arms and D-arms in the mitochondria of the chromadorean nematode Caenorhabditis elegans C. elegans EF-Tu2 specifically recognizes the seryl moiety of serylated D-armless tRNAs. Mitochondria of the enoplean nematode Trichinella possess three structural types of tRNAs: T-armless tRNAs, D-armless tRNAs, and cloverleaf tRNAs with a short T-arm. Trichinella mt EF-Tu1 binds to all three types and EF-Tu2 binds only to D-armless Ser-tRNAs, showing an evolutionary intermediate state from canonical EF-Tu to chromadorean nematode (e.g. C. elegans ) EF-Tu species. We report here that two EF-Tu species also participate in Drosophila melanogaster mitochondria. Both D. melanogaster EF-Tu1 and EF-Tu2 bound to cloverleaf and D-armless tRNAs. D. melanogaster EF-Tu1 has the ability to recognize T-armless tRNAs that do not evidently exist in D. melanogaster mitochondria, but do exist in related arthropod species. In addition, D. melanogaster EF-Tu2 preferentially bound to aa-tRNAs carrying small amino acids, but not to aa-tRNAs carrying bulky amino acids. These results suggest that the Drosophila mt translation system could be another intermediate state between the canonical and nematode mitochondria-type translation systems. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  8. Metabolic Activity of Radish Sprouts Derived Isothiocyanates in Drosophila melanogaster

    Nieves Baenas

    2016-02-01

    Full Text Available We used Drosophila melanogaster as a model system to study the absorption, metabolism and potential health benefits of plant bioactives derived from radish sprouts (Raphanus sativus cv. Rambo, a Brassicaceae species rich in glucosinolates and other phytochemicals. Flies were subjected to a diet supplemented with lyophilized radish sprouts (10.6 g/L for 10 days, containing high amounts of glucoraphenin and glucoraphasatin, which can be hydrolyzed by myrosinase to the isothiocyanates sulforaphene and raphasatin, respectively. We demonstrate that Drosophila melanogaster takes up and metabolizes isothiocyanates from radish sprouts through the detection of the metabolite sulforaphane-cysteine in fly homogenates. Moreover, we report a decrease in the glucose content of flies, an upregulation of spargel expression, the Drosophila homolog of the mammalian PPARγ-coactivator 1 α, as well as the inhibition of α-amylase and α-glucosidase in vitro. Overall, we show that the consumption of radish sprouts affects energy metabolism in Drosophila melanogaster which is reflected by lower glucose levels and an increased expression of spargel, a central player in mitochondrial biogenesis. These processes are often affected in chronic diseases associated with aging, including type II diabetes mellitus.

  9. The neurogenetics of group behavior in Drosophila melanogaster.

    Ramdya, Pavan; Schneider, Jonathan; Levine, Joel D

    2017-01-01

    Organisms rarely act in isolation. Their decisions and movements are often heavily influenced by direct and indirect interactions with conspecifics. For example, we each represent a single node within a social network of family and friends, and an even larger network of strangers. This group membership can affect our opinions and actions. Similarly, when in a crowd, we often coordinate our movements with others like fish in a school, or birds in a flock. Contributions of the group to individual behaviors are observed across a wide variety of taxa but their biological mechanisms remain largely unknown. With the advent of powerful computational tools as well as the unparalleled genetic accessibility and surprisingly rich social life of Drosophila melanogaster, researchers now have a unique opportunity to investigate molecular and neuronal determinants of group behavior. Conserved mechanisms and/or selective pressures in D. melanogaster can likely inform a much wider phylogenetic scale. Here, we highlight two examples to illustrate how quantitative and genetic tools can be combined to uncover mechanisms of two group behaviors in D. melanogaster: social network formation and collective behavior. Lastly, we discuss future challenges towards a full understanding how coordinated brain activity across many individuals gives rise to the behavioral patterns of animal societies. © 2017. Published by The Company of Biologists Ltd.

  10. Physiology declines prior to death in Drosophila melanogaster.

    Shahrestani, Parvin; Tran, Xuan; Mueller, Laurence D

    2012-10-01

    For a period of 6-15 days prior to death, the fecundity and virility of Drosophila melanogaster fall significantly below those of same-aged flies that are not near death. It is likely that other aspects of physiology may decline during this period. This study attempts to document changes in two physiological characteristics prior to death: desiccation resistance and time-in-motion. Using individual fecundity estimates and previously described models, it is possible to accurately predict which flies in a population are near death at any given age; these flies are said to be in the "death spiral". In this study of approximately 7,600 females, we used cohort mortality data and individual fecundity estimates to dichotomize each of five replicate populations of same-aged D. melanogaster into "death spiral" and "non-spiral" groups. We then compared these groups for two physiological characteristics that decline during aging. We describe the statistical properties of a new multivariate test statistic that allows us to compare the desiccation resistance and time-in-motion for two populations chosen on the basis of their fecundity. This multivariate representation of the desiccation resistance and time-in-motion of spiral and non-spiral females was shown to be significantly different with the spiral females characterized by lower desiccation resistance and time spent in motion. Our results suggest that D. melanogaster may be used as a model organism to study physiological changes that occur when death is imminent.

  11. Metabolic Activity of Radish Sprouts Derived Isothiocyanates in Drosophila melanogaster

    Baenas, Nieves; Piegholdt, Stefanie; Schloesser, Anke; Moreno, Diego A.; García-Viguera, Cristina; Rimbach, Gerald; Wagner, Anika E.

    2016-01-01

    We used Drosophila melanogaster as a model system to study the absorption, metabolism and potential health benefits of plant bioactives derived from radish sprouts (Raphanus sativus cv. Rambo), a Brassicaceae species rich in glucosinolates and other phytochemicals. Flies were subjected to a diet supplemented with lyophilized radish sprouts (10.6 g/L) for 10 days, containing high amounts of glucoraphenin and glucoraphasatin, which can be hydrolyzed by myrosinase to the isothiocyanates sulforaphene and raphasatin, respectively. We demonstrate that Drosophila melanogaster takes up and metabolizes isothiocyanates from radish sprouts through the detection of the metabolite sulforaphane-cysteine in fly homogenates. Moreover, we report a decrease in the glucose content of flies, an upregulation of spargel expression, the Drosophila homolog of the mammalian PPARγ-coactivator 1 α, as well as the inhibition of α-amylase and α-glucosidase in vitro. Overall, we show that the consumption of radish sprouts affects energy metabolism in Drosophila melanogaster which is reflected by lower glucose levels and an increased expression of spargel, a central player in mitochondrial biogenesis. These processes are often affected in chronic diseases associated with aging, including type II diabetes mellitus. PMID:26901196

  12. Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

    Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

    2017-10-01

    ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Drosophila Melanogaster as an Emerging Translational Model of Human Nephrolithiasis

    Miller, Joe; Chi, Thomas; Kapahi, Pankaj; Kahn, Arnold J.; Kim, Man Su; Hirata, Taku; Romero, Michael F.; Dow, Julian A.T.; Stoller, Marshall L.

    2013-01-01

    Purpose The limitations imposed by human clinical studies and mammalian models of nephrolithiasis have hampered the development of effective medical treatments and preventative measures for decades. The simple but elegant Drosophila melanogaster is emerging as a powerful translational model of human disease, including nephrolithiasis and may provide important information essential to our understanding of stone formation. We present the current state of research using D. melanogaster as a model of human nephrolithiasis. Materials and Methods A comprehensive review of the English language literature was performed using PUBMED. When necessary, authoritative texts on relevant subtopics were consulted. Results The genetic composition, anatomic structure and physiologic function of Drosophila Malpighian tubules are remarkably similar to those of the human nephron. The direct effects of dietary manipulation, environmental alteration, and genetic variation on stone formation can be observed and quantified in a matter of days. Several Drosophila models of human nephrolithiasis, including genetically linked and environmentally induced stones, have been developed. A model of calcium oxalate stone formation is among the most recent fly models of human nephrolithiasis. Conclusions The ability to readily manipulate and quantify stone formation in D. melanogaster models of human nephrolithiasis presents the urologic community with a unique opportunity to increase our understanding of this enigmatic disease. PMID:23500641

  14. Achieve Sustainable Hospital Excellence Through 5-S in an Emergency Department in Hong Kong

    Tsoi Vincent F. K.

    2014-11-01

    Full Text Available 5-S is the first step towards TQM. Over the last century, the Japanese have formalised the technique and named it as 5-S Practice. Since 1993, Sam Ho has improved and defined its terms in English/Chinese and developed the world's first 5-S Audit Checklist. In the article, an emergency department of a Hong Kong hospital was examined against 5-S 50-point Checklist for the improvement of their quality assurance systems towards its accreditation process with Australian standards. The findings evidently reveal that the impact of 5-S on hospital quality assurance in the unit are positive. Riding on the above scenario, the research aim is to identify whether the 5-S practice is a suitable and effective tool for healthcare quality assurance in an emergency setting which is led towards its accreditation process set by other mechanisms.

  15. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  16. The 5S methodology as a tool for improving the organisation

    J. Michalska; D. Szewieczek

    2007-01-01

    Purpose: The aim of this paper is showing the 5S methodology. In this paper it was introduced the way of implementing the 5S methodology in the company.Design/methodology/approach: In the frames of own research it has been analysed and implemented the 5S rules in the production process.Findings: On the basis of the own research it can be stated, that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs’ reduction, increasing of effectivene...

  17. Interaction of higher plant ribosomal 5S RNAs with ''Xenopus laevis'' transcriptional factor IIIA

    Barciszewska, M.Z.

    1994-01-01

    In this paper transcriptional factor IIIA (TFIIIA) has been used as a probe for identity of three-dimensional-structure of eukaryotic 5S rRNAs. I was interested in finding a common motif in plant and ''Xenopus'' 5S rRNAs for TFIIIA recognition. I found that the two eukaryotic 5S rRNAs (from wheat germ and lupin seeds) are recognized by ''X. laevis'' TFIIIA and the data clearly suggest that these 5S rRNAs have very similar if not identical three-dimensional structures. Also effects of various conditions on stability of these complexes have been studied. (author). 30 refs, 6 figs, 1 tab

  18. Manifestation of Strongly Delocalized Atomic States in the 5s Photoionization of Xenon

    Schmoranzer, H.; Lauer, S.; Vollweiler, F.; Reichardt, G.; Schartner, K.; Mentzel, G.; Wilhelmi, O.; Sukhorukov, V.L.; Lagutin, B.M.; Petrov, I.D.

    1997-01-01

    The photoionization (PI) of the Xe atom was investigated in the vicinity of the 5s -shell threshold by photon-induced fluorescence spectroscopy. The highest resolution so far attained of 2meV enabled us to observe a new series of resonance structures in the 5s -PI cross section closely above threshold. Calculations of the partial 5s - and 5p -PI cross sections were performed taking into account many-electron correlations. These structures were related with strongly delocalized f -resonances which affect the 5s -PI cross section due to their mixing with p -resonances. copyright 1997 The American Physical Society

  19. 4p-5s transitions in In XIII, In XIV and In XV

    Carroll, P.K.; Costello, J.T.; O'Sullivan, G.

    1986-01-01

    The spectrum of an indium plasma produced by a 1.5 J, 25 ns ruby laser was recorded in the XUV. At wavelengths below 100 A, the spectrum is dominated by 4p-5s transitions in a number of ion stages. Many lines arising from 4p 6 4d-4p 5 4d5s, 4p 6 -4p 5 5s and 4p 5 -4p 4 5s transitions in In XIII, In XIV and In XV have been identified by isoelectronic extrapolation and Dirac-Fock calculations. (orig.)

  20. Implementation Of 5S Methodology In The Small Scale Industry A Case Study

    R. S. Agrahari

    2015-04-01

    Full Text Available Abstract 5S is a basic foundation of Lean Manufacturing systems. It is a tool for cleaning sorting organizing and providing the necessary groundwork for workpiece improvement. This paper dealt with the implementation of 5S methodology in the small scale industry. By following the 5S methodology it shows significant improvements to safety productivity efficiency and housekeeping. The improvements before and after 5S implementation is shown by pictures in the paper. It also intends to build a stronger work ethic within the management and workers who would be expected to continue the good practices.

  1. Implementation Of 5S Quality Tool In Manufacturing Company A Case Study

    Vibhor Kakkar

    2015-02-01

    Full Text Available Abstract 5S system is a technique which maintains the quality of working conditions in the organization. Amongst various available Lean resources 5S is a powerful technique that can bolster objectives of the organization to get continuous improvement in performance and productivity. This paper presents the implementation of 5S in a manufacturing company amp 5S rating system was used to audit all changes in the company which enhanced the efficiency of the workers amp ultimately the productivity of the company is enhanced to 91 .

  2. 40 CFR 798.5955 - Heritable translocation test in drosophila melanogaster.

    2010-07-01

    ... drosophila melanogaster. 798.5955 Section 798.5955 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY....5955 Heritable translocation test in drosophila melanogaster. (a) Purpose. The heritable translocation test in Drosophila measures the induction of chromosomal translocations in germ cells of insects...

  3. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Hiraku Takada

    Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

  4. Global Analysis of RNA Secondary Structure in Two Metazoans

    Fan Li

    2012-01-01

    Full Text Available The secondary structure of RNA is necessary for its maturation, regulation, processing, and function. However, the global influence of RNA folding in eukaryotes is still unclear. Here, we use a high-throughput, sequencing-based, structure-mapping approach to identify the paired (double-stranded RNA [dsRNA] and unpaired (single-stranded RNA [ssRNA] components of the Drosophila melanogaster and Caenorhabditis elegans transcriptomes, which allows us to identify conserved features of RNA secondary structure in metazoans. From this analysis, we find that ssRNAs and dsRNAs are significantly correlated with specific epigenetic modifications. Additionally, we find key structural patterns across protein-coding transcripts that indicate that RNA folding demarcates regions of protein translation and likely affects microRNA-mediated regulation of mRNAs in animals. Finally, we identify and characterize 546 mRNAs whose folding pattern is significantly correlated between these metazoans, suggesting that their structure has some function. Overall, our findings provide a global assessment of RNA folding in animals.

  5. The prohibition order according to paragraph 5 S. 4 EnWG; Die Untersagungsverfuegung nach paragraph 5 S. 4 EnWG

    Rauch, Karsten [WSW Netz GmbH, Wuppertal (Germany)

    2011-02-10

    The introduction of prosecutorial investigation on suspicion of delaying the insolvency proceedings published in the autumn 2010 results to a general question of whether and to what extent a concomitant intervention of the regulatory authorities is indicated. Central to this are the basis for authorization given in paragraph 5 S. 4 Energy Economy Law and the related prohibition authority.

  6. Decay rate ratios of Υ(5S)→B anti B reactions

    Hwang, Dae Sung; Son, Hyungsuk

    2010-01-01

    We calculate the decay rate ratios for OZI allowed decays of Υ(5S) to two B mesons by using the decay amplitudes which incorporate the wave function of the Υ(5S) state. We obtain the result that the branching ratio of the Υ(5S) decay to B s * anti B s * is much larger than the branching ratio to B s anti B s * or anti B s B s * , in good agreement with the recent experimental results of CLEO and BELLE. This agreement with the experimental results is made possible since the nodes of the Υ(5S) radial wave function induce the nodes of the decay amplitude. We find that the results for the Υ(5S) decays to B u (*) anti B u (*) or B d (*) anti B d (*) pairs are sensitive to the parameter values used for the potential between heavy quarks. (orig.)

  7. The 5S lean method as a tool of industrial management performances

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  8. The transitions 4p-5s in Y VI, Zr VII, Nb VIII and Mo IX

    Chaghtai, M.S.Z.; Rahimullah, K.; Khatoon, S.

    1976-01-01

    With the help of the spectra recorded in the Physics Department of Lund University, Y VI, Zr VII, Nb VIII and Mo IX are freshly analysed. The five 4s 2 4p 4 ground levels and the ten 4s 2 4p 3 5s levels of previous analyses are confirmed in the first three spectra, except for revising in Y VI the 4p 4 1 S 0 and 4p 3 5s( 4 Ssub(3/2)) 2 levels and interchanging 5s( 2 Dsub(3/2)) 1 with 5s( 2 Dsub(3/2)) 2 . All level values are improved due to the new measurements. A new analysis of Mo IX establishing all the 4p 4 and 4p 3 5s levels is being reported. (Auth.)

  9. DEDB: a database of Drosophila melanogaster exons in splicing graph form

    Tan Tin

    2004-12-01

    Full Text Available Abstract Background A wealth of quality genomic and mRNA/EST sequences in recent years has provided the data required for large-scale genome-wide analysis of alternative splicing. We have capitalized on this by constructing a database that contains alternative splicing information organized as splicing graphs, where all transcripts arising from a single gene are collected, organized and classified. The splicing graph then serves as the basis for the classification of the various types of alternative splicing events. Description DEDB http://proline.bic.nus.edu.sg/dedb/index.html is a database of Drosophila melanogaster exons obtained from FlyBase arranged in a splicing graph form that permits the creation of simple rules allowing for the classification of alternative splicing events. Pfam domains were also mapped onto the protein sequences allowing users to access the impact of alternative splicing events on domain organization. Conclusions DEDB's catalogue of splicing graphs facilitates genome-wide classification of alternative splicing events for genome analysis. The splicing graph viewer brings together genome, transcript, protein and domain information to facilitate biologists in understanding the implications of alternative splicing.

  10. Genetic organization of interphase chromosome bands and interbands in Drosophila melanogaster.

    Zhimulev, Igor F; Zykova, Tatyana Yu; Goncharov, Fyodor P; Khoroshko, Varvara A; Demakova, Olga V; Semeshin, Valeriy F; Pokholkova, Galina V; Boldyreva, Lidiya V; Demidova, Darya S; Babenko, Vladimir N; Demakov, Sergey A; Belyaeva, Elena S

    2014-01-01

    Drosophila melanogaster polytene chromosomes display specific banding pattern; the underlying genetic organization of this pattern has remained elusive for many years. In the present paper, we analyze 32 cytology-mapped polytene chromosome interbands. We estimated molecular locations of these interbands, described their molecular and genetic organization and demonstrate that polytene chromosome interbands contain the 5' ends of housekeeping genes. As a rule, interbands display preferential "head-to-head" orientation of genes. They are enriched for "broad" class promoters characteristic of housekeeping genes and associate with open chromatin proteins and Origin Recognition Complex (ORC) components. In two regions, 10A and 100B, coding sequences of genes whose 5'-ends reside in interbands map to constantly loosely compacted, early-replicating, so-called "grey" bands. Comparison of expression patterns of genes mapping to late-replicating dense bands vs genes whose promoter regions map to interbands shows that the former are generally tissue-specific, whereas the latter are represented by ubiquitously active genes. Analysis of RNA-seq data (modENCODE-FlyBase) indicates that transcripts from interband-mapping genes are present in most tissues and cell lines studied, across most developmental stages and upon various treatment conditions. We developed a special algorithm to computationally process protein localization data generated by the modENCODE project and show that Drosophila genome has about 5700 sites that demonstrate all the features shared by the interbands cytologically mapped to date.

  11. Genetic and Genomic Response to Selection for Food Consumption in Drosophila melanogaster

    Garlapow, Megan E.; Everett, Logan J.; Zhou, Shanshan; Gearhart, Alexander W.; Fay, Kairsten A.; Huang, Wen; Morozova, Tatiana V.; Arya, Gunjan H.; Turlapati, Lavanya; Armour, Genevieve St.; Hussain, Yasmeen N.; McAdams, Sarah E.; Fochler, Sophia; Mackay, Trudy F. C.

    2016-01-01

    Food consumption is an essential component of animal fitness; however, excessive food intake in humans increases risk for many diseases. The roles of neuroendocrine feedback loops, food sensing modalities, and physiological state in regulating food intake are well understood, but not the genetic basis underlying variation in food consumption. Here, we applied ten generations of artificial selection for high and low food consumption in replicate populations of Drosophila melanogaster. The phenotypic response to selection was highly asymmetric, with significant responses only for increased food consumption and minimal correlated responses in body mass and composition. We assessed the molecular correlates of selection responses by DNA and RNA sequencing of the selection lines. The high and low selection lines had variants with significantly divergent allele frequencies within or near 2,081 genes and 3,526 differentially expressed genes in one or both sexes. A total of 519 genes were both genetically divergent and differentially expressed between the divergent selection lines. We performed functional analyses of the effects of RNAi suppression of gene expression and induced mutations for 27 of these candidate genes that have human orthologs and the strongest statistical support, and confirmed that 25 (93%) affected the mean and/or variance of food consumption. PMID:27704301

  12. Negative regulation of EGFR/MAPK pathway by Pumilio in Drosophila melanogaster.

    Sung Yun Kim

    Full Text Available In Drosophila melanogaster, specification of wing vein cells and sensory organ precursor (SOP cells, which later give rise to a bristle, requires EGFR signaling. Here, we show that Pumilio (Pum, an RNA-binding translational repressor, negatively regulates EGFR signaling in wing vein and bristle development. We observed that loss of Pum function yielded extra wing veins and additional bristles. Conversely, overexpression of Pum eliminated wing veins and bristles. Heterozygotes for Pum produced no phenotype on their own, but greatly enhanced phenotypes caused by the enhancement of EGFR signaling. Conversely, over-expression of Pum suppressed the effects of ectopic EGFR signaling. Components of the EGFR signaling pathway are encoded by mRNAs that have Nanos Response Element (NRE-like sequences in their 3'UTRs; NREs are known to bind Pum to confer regulation in other mRNAs. We show that these NRE-like sequences bind Pum and confer repression on a luciferase reporter in heterologous cells. Taken together, our evidence suggests that Pum functions as a negative regulator of EGFR signaling by directly targeting components of the pathway in Drosophila.

  13. Modeling glial contributions to seizures and epileptogenesis: cation-chloride cotransporters in Drosophila melanogaster.

    Zeid M Rusan

    Full Text Available Flies carrying a kcc loss-of-function mutation are more seizure-susceptible than wild-type flies. The kcc gene is the highly conserved Drosophila melanogaster ortholog of K+/Cl- cotransporter genes thought to be expressed in all animal cell types. Here, we examined the spatial and temporal requirements for kcc loss-of-function to modify seizure-susceptibility in flies. Targeted RNA interference (RNAi of kcc in various sets of neurons was sufficient to induce severe seizure-sensitivity. Interestingly, kcc RNAi in glia was particularly effective in causing seizure-sensitivity. Knockdown of kcc in glia or neurons during development caused a reduction in seizure induction threshold, cell swelling, and brain volume increase in 24-48 hour old adult flies. Third instar larval peripheral nerves were enlarged when kcc RNAi was expressed in neurons or glia. Results suggest that a threshold of K+/Cl- cotransport dysfunction in the nervous system during development is an important determinant of seizure-susceptibility in Drosophila. The findings presented are the first attributing a causative role for glial cation-chloride cotransporters in seizures and epileptogenesis. The importance of elucidating glial cell contributions to seizure disorders and the utility of Drosophila models is discussed.

  14. Embryo-larval exposure to atrazine reduces viability and alters oxidative stress parameters in Drosophila melanogaster.

    Figueira, Fernanda Hernandes; Aguiar, Lais Mattos de; Rosa, Carlos Eduardo da

    2017-01-01

    The herbicide atrazine has been used worldwide with subsequent residual contamination of water and food, which may cause adverse effects on non-target organisms. Animal exposure to this herbicide may affect development, reproduction and energy metabolism. Here, the effects of atrazine regarding survival and redox metabolism were assessed in the fruit fly D. melanogaster exposed during embryonic and larval development. The embryos (newly fertilized eggs) were exposed to different atrazine concentrations (10μM and 100μM) in the diet until the adult fly emerged. Pupation and emergence rates, developmental time and sex ratio were determined as well as oxidative stress parameters and gene expression of the antioxidant defence system were evaluated in newly emerged male and female flies. Atrazine exposure reduced pupation and emergence rates in fruit flies without alterations to developmental time and sex ratio. Different redox imbalance patterns were observed between males and females exposed to atrazine. Atrazine caused an increase in oxidative damage, reactive oxygen species generation and antioxidant capacity and decreased thiol-containing molecules. Further, atrazine exposure altered the mRNA expression of antioxidant genes (keap1, sod, sod2, cat, irc, gss, gclm, gclc, trxt, trxr-1 and trxr-2). Reductions in fruit fly larval and pupal viability observed here are likely consequences of the oxidative stress induced by atrazine exposure. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Genetic organization of interphase chromosome bands and interbands in Drosophila melanogaster.

    Igor F Zhimulev

    Full Text Available Drosophila melanogaster polytene chromosomes display specific banding pattern; the underlying genetic organization of this pattern has remained elusive for many years. In the present paper, we analyze 32 cytology-mapped polytene chromosome interbands. We estimated molecular locations of these interbands, described their molecular and genetic organization and demonstrate that polytene chromosome interbands contain the 5' ends of housekeeping genes. As a rule, interbands display preferential "head-to-head" orientation of genes. They are enriched for "broad" class promoters characteristic of housekeeping genes and associate with open chromatin proteins and Origin Recognition Complex (ORC components. In two regions, 10A and 100B, coding sequences of genes whose 5'-ends reside in interbands map to constantly loosely compacted, early-replicating, so-called "grey" bands. Comparison of expression patterns of genes mapping to late-replicating dense bands vs genes whose promoter regions map to interbands shows that the former are generally tissue-specific, whereas the latter are represented by ubiquitously active genes. Analysis of RNA-seq data (modENCODE-FlyBase indicates that transcripts from interband-mapping genes are present in most tissues and cell lines studied, across most developmental stages and upon various treatment conditions. We developed a special algorithm to computationally process protein localization data generated by the modENCODE project and show that Drosophila genome has about 5700 sites that demonstrate all the features shared by the interbands cytologically mapped to date.

  16. Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

    Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

    2016-12-01

    Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

  17. Three-dimensional imaging of Drosophila melanogaster.

    Leeanne McGurk

    2007-09-01

    Full Text Available The major hindrance to imaging the intact adult Drosophila is that the dark exoskeleton makes it impossible to image through the cuticle. We have overcome this obstacle and describe a method whereby the internal organs of adult Drosophila can be imaged in 3D by bleaching and clearing the adult and then imaging using a technique called optical projection tomography (OPT. The data is displayed as 2D optical sections and also in 3D to provide detail on the shape and structure of the adult anatomy.We have used OPT to visualize in 2D and 3D the detailed internal anatomy of the intact adult Drosophila. In addition this clearing method used for OPT was tested for imaging with confocal microscopy. Using OPT we have visualized the size and shape of neurodegenerative vacuoles from within the head capsule of flies that suffer from age-related neurodegeneration due to a lack of ADAR mediated RNA-editing. In addition we have visualized tau-lacZ expression in 2D and 3D. This shows that the wholemount adult can be stained without any manipulation and that this stain penetrates well as we have mapped the localization pattern with respect to the internal anatomy.We show for the first time that the intact adult Drosophila can be imaged in 3D using OPT, also we show that this method of clearing is also suitable for confocal microscopy to image the brain from within the intact head. The major advantage of this is that organs can be represented in 3D in their natural surroundings. Furthermore optical sections are generated in each of the three planes and are not prone to the technical limitations that are associated with manual sectioning. OPT can be used to dissect mutant phenotypes and to globally map gene expression in both 2D and 3D.

  18. Large-scale discovery of promoter motifs in Drosophila melanogaster.

    Thomas A Down

    2007-01-01

    Full Text Available A key step in understanding gene regulation is to identify the repertoire of transcription factor binding motifs (TFBMs that form the building blocks of promoters and other regulatory elements. Identifying these experimentally is very laborious, and the number of TFBMs discovered remains relatively small, especially when compared with the hundreds of transcription factor genes predicted in metazoan genomes. We have used a recently developed statistical motif discovery approach, NestedMICA, to detect candidate TFBMs from a large set of Drosophila melanogaster promoter regions. Of the 120 motifs inferred in our initial analysis, 25 were statistically significant matches to previously reported motifs, while 87 appeared to be novel. Analysis of sequence conservation and motif positioning suggested that the great majority of these discovered motifs are predictive of functional elements in the genome. Many motifs showed associations with specific patterns of gene expression in the D. melanogaster embryo, and we were able to obtain confident annotation of expression patterns for 25 of our motifs, including eight of the novel motifs. The motifs are available through Tiffin, a new database of DNA sequence motifs. We have discovered many new motifs that are overrepresented in D. melanogaster promoter regions, and offer several independent lines of evidence that these are novel TFBMs. Our motif dictionary provides a solid foundation for further investigation of regulatory elements in Drosophila, and demonstrates techniques that should be applicable in other species. We suggest that further improvements in computational motif discovery should narrow the gap between the set of known motifs and the total number of transcription factors in metazoan genomes.

  19. Methylmercury as a mitosis disturbing agent. [Allium cepa; Drosophila melanogaster

    Ramel, C

    1969-01-01

    Experiments were performed to investigate the genetic effects of mercurials. These investigations included both cytological and genetical analyses. One of the main purposes of the investigations was to establish the lowest dose of the mercurials, which was genetically active. For the cytological work root tips cells of Allium cepa were used, while the genetical analyses were preformed on Drosophila melanogaster. The cytological tests on Allium included methyl mercury hydroxide, methyl mercury dicyandiamide, phenyl mercury hydroxide, and methoxyethylmercury chloride. The pesticide Panogen was also tested. The results from these studies are summarized.

  20. Host-microbe interactions in the gut of Drosophila melanogaster

    Takayuki eKuraishi

    2013-12-01

    Full Text Available Many insect species subsist on decaying and contaminated matter and are thus exposed to large quantities of microorganisms. To control beneficial commensals and combat infectious pathogens, insects must be armed with efficient systems for microbial recognition, signaling pathways, and effector molecules. The molecular mechanisms regulating these host-microbe interactions in insects have been largely clarified in Drosophila melanogaster with its powerful genetic and genomic tools. Here we review recent advances in this field, focusing mainly on the relationships between microbes and epithelial cells in the intestinal tract where the host exposure to the external environment is most frequent.

  1. Analysis of a new morphogenetic mutation in Drosophila melanogaster

    Mglinets, V.A.

    1987-01-01

    Somatic mosaicism for mutations monster and yellow was induced by gamma-irradiation of Drosophila melanogaster y/y; Dp(1; 2)sc 19 M(2)z/mn d embryos and larvae. Frequencies of mosaicism increased with the age of treated larvae, especially in the end of the 2nd larval instar. Autonomous expression of mn was observed throughout the whole range of larval age studied, though neither for all y/y spots nor for all parts of the spots. Dissimilarities in dynamics of mosaic spots and duplication induction suggest that the latter are not due to mn expression in somatic clones

  2. Genetic mapping uncovers cis-regulatory landscape of RNA editing.

    Ramaswami, Gokul; Deng, Patricia; Zhang, Rui; Anna Carbone, Mary; Mackay, Trudy F C; Li, Jin Billy

    2015-09-16

    Adenosine-to-inosine (A-to-I) RNA editing, catalysed by ADAR enzymes conserved in metazoans, plays an important role in neurological functions. Although the fine-tuning mechanism provided by A-to-I RNA editing is important, the underlying rules governing ADAR substrate recognition are not well understood. We apply a quantitative trait loci (QTL) mapping approach to identify genetic variants associated with variability in RNA editing. With very accurate measurement of RNA editing levels at 789 sites in 131 Drosophila melanogaster strains, here we identify 545 editing QTLs (edQTLs) associated with differences in RNA editing. We demonstrate that many edQTLs can act through changes in the local secondary structure for edited dsRNAs. Furthermore, we find that edQTLs located outside of the edited dsRNA duplex are enriched in secondary structure, suggesting that distal dsRNA structure beyond the editing site duplex affects RNA editing efficiency. Our work will facilitate the understanding of the cis-regulatory code of RNA editing.

  3. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Czifra, György

    2017-09-01

    Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: "YES", because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  4. Hyperfine splitting of B mesons and Bs production at the Υ(5S)

    Lee-Franzini, J.; Heintz, U.; Lovelock, D.M.J.; Narain, M.; Schamberger, R.D.; Willins, J.; Yanagisawa, C.; Franzini, P.; Tuts, P.M.

    1990-01-01

    Using the Columbia University--Stony Brook (CUSB-II) detector we have studied the inclusive photon spectrum from 2.9x10 4 Υ(5S) decays. We observe a strong signal due to B * →Bγ decays. From this we obtain (i) the average B * -B mass difference, 46.7±0.4 MeV, (ii) the photon yield per Υ(5S) decay, left-angle γ/Υ(5S)right-angle=1.09±0.06, and (iii) the average velocity of the B * 's, left-angle β right-angle=0.156±0.010, for a mix of nonstrange (B) and strange (B s ) B * mesons from Υ(5S) decays. From the shape of the photon line, we find that both B and B s mesons are produced with nearly equal values for the hyperfine splitting of the B and B s meson systems

  5. Peak shifts due to B(*)-B(*) rescattering in Υ(5S) dipion transitions

    Meng Ce; Chao Kuangta

    2008-01-01

    We study the energy distributions of dipion transitions Υ(5S) to Υ(1S,2S,3S)π + π - in the final-state rescattering model. Since the Υ(5S) is well above the open bottom thresholds, the dipion transitions are expected to mainly proceed through the real processes Υ(5S)→B ( * ) B ( * ) and B ( * ) B ( * ) →Υ(1S,2S,3S)π + π - . We find that the energy distributions of Υ(1S,2S,3S)π + π - markedly differ from that of Υ(5S)→B ( * ) B ( * ) . In particular, the resonance peak will be pushed up by about 7-20 MeV for these dipion transitions relative to the main hadronic decay modes. These predictions can be used to test the final-state rescattering mechanism in hadronic transitions for heavy quarkonia above the open flavor thresholds.

  6. Y(5S): What has been learned and what can be learned

    Blusk, S.R.

    2007-01-01

    We present recent measurements of B and B s 0 production using data collected on the Y(5S) resonance at CLEO and Belle. We also briefly discuss what can be learned using sufficiently larger data samples in the future

  7. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Czifra György

    2017-09-01

    Full Text Available Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: “YES”, because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  8. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p5S it was observed and determined that facilitating the job and setting up a safe environment created a statistically significant effect on

  9. O5S, Calibration of Organic Scintillation Detector by Monte-Carlo

    1985-01-01

    1 - Nature of physical problem solved: O5S is designed to directly simulate the experimental techniques used to obtain the pulse height distribution for a parallel beam of mono-energetic neutrons incident on organic scintillator systems. Developed to accurately calibrate the nominally 2 in. by 2 in. liquid organic scintillator NE-213 (composition CH-1.2), the programme should be readily adaptable to many similar problems. 2 - Method of solution: O5S is a Monte Carlo programme patterned after the general-purpose Monte Carlo neutron transport programme system, O5R. The O5S Monte Carlo experiment follows the course of each neutron through the scintillator and obtains the energy-deposits of the ions produced by elastic scatterings and reactions. The light pulse produced by the neutron is obtained by summing up the contributions of the various ions with the use of appropriate light vs. ion-energy tables. Because of the specialized geometry and simpler cross section needs O5S is able to by-pass many features included in O5R. For instance, neutrons may be followed individually, their histories analyzed as they occur, and upon completion of the experiment, the results analyzed to obtain the pulse-height distribution during one pass on the computer. O5S does allow the absorption of neutrons, but does not allow splitting or Russian roulette (biased weighting schemes). SMOOTHIE is designed to smooth O5S histogram data using Gaussian functions with parameters specified by the user

  10. Neurotoxicity of fungal volatile organic compounds in Drosophila melanogaster.

    Inamdar, Arati A; Masurekar, Prakash; Bennett, Joan Wennstrom

    2010-10-01

    Many volatile organic compounds (VOCs) are found in indoor environment as products of microbial metabolism. In damp indoor environments, fungi are associated with poor air quality. Some epidemiological studies have suggested that microbial VOCs have a negative impact on human health. Our study was designed to provide a reductionist approach toward studying fungal VOC-mediated toxicity using the inexpensive model organism, Drosophila melanogaster, and pure chemical standards of several important fungal VOCs. Low concentrations of the following known fungal VOCs, 0.1% of 1-octen-3-ol and 0.5% of 2-octanone; 2,5 dimethylfuran; 3-octanol; and trans-2-octenal, caused locomotory defects and changes in green fluorescent protein (GFP)- and antigen-labeled dopaminergic neurons in adult D. melanogaster. Locomotory defects could be partially rescued with L-DOPA. Ingestion of the antioxidant, vitamin E, improved the survival span and delayed the VOC-mediated changes in dopaminergic neurons, indicating that the VOC-mediated toxicity was due, in part, to generation of reactive oxygen species.

  11. Social context influences chemical communication in D. melanogaster males.

    Kent, Clement; Azanchi, Reza; Smith, Ben; Formosa, Amanda; Levine, Joel D

    2008-09-23

    Chemical communication mediates social interactions in insects. For the fruit fly, D. melanogaster, the chemical display is a key fitness trait because it leads to mating. An exchange of cues that resembles a dialogue between males and females is enacted by pheromones, chemical signals that pass between individual flies to alter physiology and behavior. Chemical signals also affect the timing of locomotor activity and sleep. We investigated genetic and environmental determinants of chemical communication. To evaluate the role of the social environment, we extracted a chemical blend from individual males selected from groups composed of one genotype and compared these extracts to those from groups of mixed genotypes. To evaluate the role of the physical environment, these comparisons were performed under a light-dark cycle or in constant darkness. Here, we show that chemical signaling is affected by the social environment, light-dark cycle, and genotype as well as the complex interplay of these variables. Gene-by-environment interactions produce highly significant effects on chemical signaling. We also examined individual responses within the groups. Strikingly, the response of one wild-type fly to another is modulated by the genotypic composition of his neighbors. Chemical signaling in D. melanogaster may be a "fickle" trait that depends on the individual's social background.

  12. Sexual Experience Enhances Drosophila melanogaster Male Mating Behavior and Success

    Saleem, Sehresh; Ruggles, Patrick H.; Abbott, Wiley K.; Carney, Ginger E.

    2014-01-01

    Competition for mates is a wide-spread phenomenon affecting individual reproductive success. The ability of animals to adjust their behaviors in response to changing social environment is important and well documented. Drosophila melanogaster males compete with one another for matings with females and modify their reproductive behaviors based on prior social interactions. However, it remains to be determined how male social experience that culminates in mating with a female impacts subsequent male reproductive behaviors and mating success. Here we show that sexual experience enhances future mating success. Previously mated D. melanogaster males adjust their courtship behaviors and out-compete sexually inexperienced males for copulations. Interestingly, courtship experience alone is not sufficient in providing this competitive advantage, indicating that copulation plays a role in reinforcing this social learning. We also show that females use their sense of hearing to preferentially mate with experienced males when given a choice. Our results demonstrate the ability of previously mated males to learn from their positive sexual experiences and adjust their behaviors to gain a mating advantage. These experienced-based changes in behavior reveal strategies that animals likely use to increase their fecundity in natural competitive environments. PMID:24805129

  13. Variation in male mate choice in Drosophila melanogaster.

    Dominic A Edward

    Full Text Available Male mate choice has been reported in the fruit fly, Drosophila melanogaster, even though males of this species were previously thought to maximise their fitness by mating with all available females. To understand the evolution of male mate choice it is important to understand variation in male mating preferences. Two studies, using different stock populations and different methods, have reported contrasting patterns of variation in male mate choice in D. melanogaster. Two possible explanations are that there are evolved differences in each stock population or that the methods used to measure choice could have biased the results. We investigated these hypotheses here by repeating the methods used in one study in which variable male mate choice was found, using the stock population from the other study in which choice was not variable. The results showed a significant resource-independent male preference for less fecund, smaller females, which contrasts with previous observations of male mate choice. This indicates that different selection pressures between populations have resulted in evolved differences in the expression of male mate choice. It also reveals phenotypic plasticity in male mate choice in response to cues encountered in each choice environment. The results highlight the importance of variation in male mate choice, and of identifying mechanisms in order to understand the evolution of mate choice under varying ecological conditions.

  14. Stochastic model for gene transcription on Drosophila melanogaster embryos

    Prata, Guilherme N.; Hornos, José Eduardo M.; Ramos, Alexandre F.

    2016-02-01

    We examine immunostaining experimental data for the formation of stripe 2 of even-skipped (eve) transcripts on D. melanogaster embryos. An estimate of the factor converting immunofluorescence intensity units into molecular numbers is given. The analysis of the eve dynamics at the region of stripe 2 suggests that the promoter site of the gene has two distinct regimes: an earlier phase when it is predominantly activated until a critical time when it becomes mainly repressed. That suggests proposing a stochastic binary model for gene transcription on D. melanogaster embryos. Our model has two random variables: the transcripts number and the state of the source of mRNAs given as active or repressed. We are able to reproduce available experimental data for the average number of transcripts. An analysis of the random fluctuations on the number of eves and their consequences on the spatial precision of stripe 2 is presented. We show that the position of the anterior or posterior borders fluctuate around their average position by ˜1 % of the embryo length, which is similar to what is found experimentally. The fitting of data by such a simple model suggests that it can be useful to understand the functions of randomness during developmental processes.

  15. Sexual experience enhances Drosophila melanogaster male mating behavior and success.

    Sehresh Saleem

    Full Text Available Competition for mates is a wide-spread phenomenon affecting individual reproductive success. The ability of animals to adjust their behaviors in response to changing social environment is important and well documented. Drosophila melanogaster males compete with one another for matings with females and modify their reproductive behaviors based on prior social interactions. However, it remains to be determined how male social experience that culminates in mating with a female impacts subsequent male reproductive behaviors and mating success. Here we show that sexual experience enhances future mating success. Previously mated D. melanogaster males adjust their courtship behaviors and out-compete sexually inexperienced males for copulations. Interestingly, courtship experience alone is not sufficient in providing this competitive advantage, indicating that copulation plays a role in reinforcing this social learning. We also show that females use their sense of hearing to preferentially mate with experienced males when given a choice. Our results demonstrate the ability of previously mated males to learn from their positive sexual experiences and adjust their behaviors to gain a mating advantage. These experienced-based changes in behavior reveal strategies that animals likely use to increase their fecundity in natural competitive environments.

  16. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S r

  17. Measurement of B(Υ(5S)→Bs(*)Bs(*)) using φ mesons

    Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.; Coan, T. E.; Gao, Y. S.; Liu, F.

    2007-01-01

    Knowledge of the B s decay fraction of the Υ(5S) resonance, f S , is important for B s meson studies at the Υ(5S) energy. Using a data sample collected by the CLEO III detector at CESR consisting of 0.423 fb -1 on the Υ(5S) resonance, 6.34 fb -1 on the Υ(4S) and 2.32 fb -1 in the continuum below the Υ(4S), we measure B(Υ(5S)→φX)=(13.8±0.7 -1.5 +2.3 )% and B(Υ(4S)→φX)=(7.1±0.1±0.6)%; the ratio of the two rates is (1.9±0.1 -0.2 +0.3 ). This is the first measurement of the φ meson yield from the Υ(5S). Using these rates, and a model dependent estimate of B(B s →φX), we determine f S =(24.6±2.9 -5.3 +11.0 )%. We also update our previous independent measurement of f S made using the inclusive D s yields to now be (16.8±2.6 -3.4 +6.7 )%, due to a better estimate of the number of hadronic events. We also report the total Υ(5S) hadronic cross section above continuum to be σ(e + e - →Υ(5S))=(0.301±0.002±0.039) nb. This allows us to extract the fraction of B mesons as (58.9±10.0±9.2)%, equal to 1-f S . Averaging the three methods gives a model dependent result of f S =(21 -3 +6 )%

  18. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  19. Implementation of 5S in Manufacturing Industry: A Case of Foreign Workers in Melaka

    Chee Houa San

    2018-01-01

    Full Text Available Lean manufacturing system has been infiltrated in manufacturing sectors across the world. In fact, Lean manufacturing system is a practice which regards the use of the resources, creation of value for the end customers, and as the ways to eliminate the waste. There are several tools that can be used to eliminate the waste within the industry. This research is a study of the implementation of 5S in manufacturing industry. Despite this, the research study focused on manufacturing industry, which has been implemented 5S system in Melaka State. Although there are number of tools and technique available to help in improving the manufacturing process, however, there is only few industries could implement the tools successfully. In this research, foreign workers play a main role in implement the 5S systems as the manufacturing industry in Malaysia adopt large amount of foreign workers to work as employees. Therefore, it is important to ensure the foreign workers truly understand the concept of 5S system and adopt the best ways to implement it in order to have better performance. This research study has been proposed by the research model of the barriers to implementation of 5S in manufacturing industry among foreign workers. A several research method has been adopted to do the research, such as descriptive research design with quantitative methods, survey questionnaire and cross-sectional studies.

  20. Functional analysis of the glycogen binding subunit CG9238/Gbs-70E of protein phosphatase 1 in Drosophila melanogaster.

    Kerekes, Éva; Kókai, Endre; Páldy, Ferenc Sándor; Dombrádi, Viktor

    2014-06-01

    The product of the CG9238 gene that we termed glycogen binding subunit 70E (Gbs-70E) was characterized by biochemical and molecular genetics methods. The interaction between Gbs-70E and all catalytic subunits of protein phosphatase 1 (Pp1-87B, Pp1-9C, Pp1-96A and Pp1-13C) of Drosophila melanogaster was confirmed by pairwise yeast two-hybrid tests, co-immunoprecipitation and pull down experiments. The binding of Gbs-70E to glycogen was demonstrated by sedimentation analysis. With RT-PCR we found that the mRNAs coding for the longer Gbs-70E PB/PC protein were expressed in all developmental stages of the fruit flies while the mRNA for the shorter Gbs-70E PA was restricted to the eggs and the ovaries of the adult females. The development specific expression of the shorter splice variant was not conserved in different Drosophila species. The expression level of the gene was manipulated by P-element insertions and gene deletion to analyze the functions of the gene product. A small or moderate reduction in the gene expression resulted in no significant changes, however, a deletion mutant expressing very low level of the transcript lived shorter and exhibited reduced glycogen content in the imagos. In addition, the gene deletion decreased the fertility of the fruit flies. Our results prove that Gbs-70E functions as the glycogen binding subunit of protein phosphatase 1 that regulates glycogen content and plays a role in the development of eggs in D. melanogaster. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Allelic asymmetry of the Lethal hybrid rescue (Lhr) gene expression in the hybrid between Drosophila melanogaster and D. simulans: confirmation by using genetic variations of D. melanogaster.

    Shirata, Mika; Araye, Quenta; Maehara, Kazunori; Enya, Sora; Takano-Shimizu, Toshiyuki; Sawamura, Kyoichi

    2014-02-01

    In the cross between Drosophila melanogaster females and D. simulans males, hybrid males die at the late larval stage, and the sibling females also die at later stages at high temperatures. Removing the D. simulans allele of the Lethal hybrid rescue gene (Lhr (sim) ) improves the hybrid incompatibility phenotypes. However, the loss-of-function mutation of Lhr (sim) (Lhr (sim0) ) does not rescue the hybrid males in crosses with several D. melanogaster strains. We first describe the genetic factor possessed by the D. melanogaster strains. It has been suggested that removing the D. melanogaster allele of Lhr (Lhr (mel) ), that is Lhr (mel0) , does not have the hybrid male rescue effect, contrasting to Lhr (sim0) . Because the expression level of the Lhr gene is known to be Lhr (sim) > Lhr (mel) in the hybrid, Lhr (mel0) may not lead to enough of a reduction in total Lhr expression. Then, there is a possibility that the D. melanogaster factor changes the expression level to Lhr (sim) Lhr (mel) in the hybrid irrespectively of the presence of the factor. At last, we showed that Lhr (mel0) slightly improves the viability of hybrid females, which was not realized previously. All of the present results are consistent with the allelic asymmetry model of the Lhr gene expression in the hybrid.

  2. Studies of inelastic cross-section in Rb(7S) + Rb(5S) collisions

    Caiyan, L.; Ekers, A.; Latvia Univ., Riga; Klavins, J.; Jansons, M.

    1996-01-01

    The cross section σ = (8 ± 4) x 10 -15 cm 2 was determined for the Rb(7S) + Rb(5S) → Rb(5D) + Rb(5S) excitation energy transfer process, and the quenching cross section σ q = (2 ± 1) x 10 -14 cm 2 for the Rb(5D) state in collisions with ground state Rb atoms. Applying rubidium quasimolecular asymptotic potential curves at relatively large internuclear distances, a qualitative interpretation of the experimental results is presented. It is shown that the quenching of the Rb(5D) atoms in collisions may be explained by a reversed energy pooling process Rb(5D) + Rb(5S) → Rb(5P) + Rb(5P). (orig.)

  3. IMPLEMENTING THE 5S METHOD IN THE PRODUCTION SYSTEM OF DACIA & RENAULT

    Marin CIOBANU

    2014-11-01

    Full Text Available The aim of this paper is to demonstrate the usefulness of the 5S method in addressing the issues of continuous improvement of productivity and quality of work. There are presented the 5 steps, techniques and the adjacent tools. Solutions implemented in the production system Dacia & Renault are indicated. This article provides a practical framework. The 5S method follows the Deming PDCA cycle which constitutes the starting point of the SDCA cycle of continuous improvement of the company's activities in order to obtain excellence. The implementing time of the method depends on the resources and materials allocated. Deployment of 5S is achieved by a scheme of "3+2": the first 3S are tangible and immediate actions, the last 2S appeal to specific management actions. The efficacy of their own workplace in total autonomy creates comfort in the work environment and gives personal benefits to workers.

  4. Proteomic Characterization of Inbreeding-Related Cold Sensitivity in Drosophila melanogaster

    Vermeulen, C.J.; Pedersen, Kamilla Sofie; Beck, Hans C.

    2013-01-01

    insight into the molecular interplay between intrinsic stress responses, inbreeding depression and temperature tolerance, we performed a proteomic characterization of a well-defined conditional inbreeding effect in a single line of Drosophila melanogaster, which suffers from extreme cold sensitivity...

  5. The Phenotypic Effects of Royal Jelly on Wild-Type D. melanogaster Are Strain-Specific.

    Stefanie L Morgan

    Full Text Available The role for royal jelly (RJ in promoting caste differentiation of honeybee larvae into queens rather than workers is well characterized. A recent study demonstrated that this poorly understood complex nutrition drives strikingly similar phenotypic effects in Drosophila melanogaster, such as increased body size and reduced developmental time, making possible the use of D. melanogaster as a model system for the genetic analysis of the cellular mechanisms underlying RJ and caste differentiation. We demonstrate here that RJ increases the body size of some wild-type strains of D. melanogaster but not others, and report significant delays in developmental time in all flies reared on RJ. These findings suggest that cryptic genetic variation may be a factor in the D. melanogaster response to RJ, and should be considered when attempting to elucidate response mechanisms to environmental changes in non-honeybee species.

  6. Genetic effects of organic mercury compounds. II. Chromosome segregation in Drosophila melanogaster

    Ramel, C; Magnusson, J

    1969-01-01

    The genetic effect of organic mercury compounds on the fruit fly, Drosophila melanogaster was investigated. Treatments of larvae with methyl and phenyl mercury gave rise to development disturbances. Chromosomal abnormalities were noted.

  7. Behavioural plasticity in support of a benefit for aggregation pheromone use in Drosophila melanogaster

    Wertheim, B.; Dicke, M.; Vet, L.E.M.

    2002-01-01

    We explored behavioural plasticity in the use of aggregation pheromone in the fruit fly Drosophila melanogaster Meigen (Diptera: Drosophilidae). Based on previous field observations, we formulated two hypotheses on a benefit of using aggregation pheromone for aggregated oviposition. One hypothesis

  8. Behavioural plasticity in support of a benefit for aggregation pheromone use in Drosophila melanogaster

    Wertheim, B; Dicke, Marcel; Vet, LEM

    We explored behavioural plasticity in the use of aggregation pheromone in the fruit fly Drosophila melanogaster Meigen (Diptera: Drosophilidae). Based on previous field observations, we formulated two hypotheses on a benefit of using aggregation pheromone for aggregated oviposition. One hypothesis

  9. Biological effect of the magnetic resonance on fruit flies, drosophila melanogaster

    Restrepo, Ana; Angel Karen; Lopez P, Monica; Sanabria, Ana I; Lopez, Maria I

    1992-01-01

    This article describes an investigation in which fruit flies, D. Melanogaster of the white and vestigial strains, were exposed to a magnetic resonance field for 171 hours, to determine possible genetic alterations

  10. Polymorphism patterns in two tightly linked developmental genes, Idgf1 and Idgf3, of Drosophila melanogaster

    Žurovcová, Martina; Ayala, F. J.

    2002-01-01

    Roč. 162, - (2002), s. 177-188 ISSN 0016-6731 Institutional research plan: CEZ:AV0Z5007907 Keywords : Drosophila melanogaster Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.483, year: 2002

  11. Ethical and psychological factors in 5S and total productive maintenance

    Jamal Ahmed Hama Kareem

    2017-08-01

    Full Text Available Purpose: The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results.  Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b Panneerselvam (2012 Singh et al. (2013 and Poduval & Pramod (2015 in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM that are used to bring out the best productivity.

  12. Ethical and psychological factors in 5S and total productive maintenance

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-01-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  13. Ethical and psychological factors in 5S and total productive maintenance

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-07-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  14. 5S-MENETELMÄN KÄYTTÖÖNOTTO SERVICEPOINTILLA

    Ovaskainen, Tatu-Pekka

    2014-01-01

    Opinnäytetyö on tehty Servicepoint Kuopio Oy:n toimeksiannosta. Servicepoint Kuopio on teollisuuden kunnossapitoon automaatio- ja sähköistysprojekteihin sekä robottisovelluksiin erikoistunut yritys. Yrityksen kahden toimipisteen yhdistyminen lisäsi toimipisteellä henkilöstön ja työkalujen määrää. Yrityksessä toteutetaan sovelletusti Lean-ajattelumallia. Yksi Leanin työkaluista on 5S, joka haluttiin ottaa käyttöön yrityksessä. Opinnäytetyön tavoitteena oli ottaa käyttöön 5S-menetelmä Servi...

  15. 5S-menetelmän käyttöönotto Case: Planmeca Oy

    Velic, Adel

    2014-01-01

    Opinnäytetyön tavoitteena on tutkia Planmeca Oy:n panoraamaröntgentuotannossa syksyllä 2012 toteutetun 5S-projektin onnistuneisuutta. Työ kattaa sekä 5S-periaatteiden mukaisesti suunniteltujen ja toteutettujen panoraamaröntgentuotannon Elko-, Pystytys 1 -, Pystytys 2 - sekä Potilastuki- ja skannausmekanismitiimin työpisteiden että projektin toteutustavan onnistuneisuuden mittaamisen. Tutkimusmenetelmänä käytetään Elko-, Pystytys 1 -, Pystytys 2 - sekä Potilastuki- ja skannausmekanismitiim...

  16. Genetic effects induced by neutrons in Drosophila melanogaster I. Determination of absorbed dose

    Delfin, A.; Paredes, L.C.; Zambrano, F.; Guzman-Rincon, J.; Urena-Nunez, F.

    2001-01-01

    A method to obtain the absorbed dose in Drosophila melanogaster irradiated in the thermal column facility of the Triga Mark III Reactor has been developed. The method is based on the measurements of neutron activation of gold foils produced by neutron capture to obtain the neutron fluxes. These fluxes, combined with the calculations of kinetic energy released per unit mass, enables one to obtain the absorbed doses in Drosophila melanogaster

  17. The Phenotypic Effects of Royal Jelly on Wild-Type D. melanogaster Are Strain-Specific

    Morgan, Stefanie L.; Seggio, Joseph A.; Nascimento, Nara F.; Huh, Dana D.; Hicks, Jasmin A.; Sharp, Katherine A.; Axelrod, Jeffrey D.; Wang, Kevin C.

    2016-01-01

    The role for royal jelly (RJ) in promoting caste differentiation of honeybee larvae into queens rather than workers is well characterized. A recent study demonstrated that this poorly understood complex nutrition drives strikingly similar phenotypic effects in Drosophila melanogaster, such as increased body size and reduced developmental time, making possible the use of D. melanogaster as a model system for the genetic analysis of the cellular mechanisms underlying RJ and caste differentiatio...

  18. History and Structure of Sub-Saharan Populations of Drosophila melanogaster

    Pool, John E.; Aquadro, Charles F.

    2006-01-01

    Drosophila melanogaster is an important model organism in evolutionary genetics, yet little is known about the population structure and the demographic history of this species within sub-Saharan Africa, which is thought to contain its ancestral range. We surveyed nucleotide variation at four 1-kb fragments in 240 individual lines representing 21 sub-Saharan and 4 Palearctic population samples of D. melanogaster. In agreement with recent studies, we find a small but significant level of geneti...

  19. Non-Mendelian Dominant Maternal Effects Caused by CRISPR/Cas9 Transgenic Components in Drosophila melanogaster

    Chun-Chieh Lin

    2016-11-01

    Full Text Available The CRISPR/Cas9 system has revolutionized genomic editing. The Cas9 endonuclease targets DNA via an experimentally determined guide RNA (gRNA. This results in a double-strand break at the target site . We generated transgenic Drosophila melanogaster in which the CRISPR/Cas9 system was used to target a GAL4 transgene in vivo. To our surprise, progeny whose genomes did not contain CRISPR/Cas9 components were still capable of mutating GAL4 sequences. We demonstrate this effect was caused by maternal deposition of Cas9 and gRNAs into the embryo, leading to extensive GAL4 mutations in both somatic and germline tissues. This serves as a cautionary observation on the effects of maternal contributions when conducting experiments using genomically encoded CRISPR/Cas9 components. These results also highlight a mode of artificial inheritance in which maternal contributions of DNA editing components lead to transmissible mutant defects even in animals whose genomes lack the editing components. We suggest calling this a dominant maternal effect to reflect it is caused by the gain of maternally contributed products. Models of CRISPR-mediated gene drive will need to incorporate dominant maternal effects in order to accurately predict the efficiency and dynamics of gene drive in a population.

  20. miR-958 inhibits Toll signaling and Drosomycin expression via direct targeting of Toll and Dif in Drosophila melanogaster.

    Li, Shengjie; Li, Yao; Shen, Li; Jin, Ping; Chen, Liming; Ma, Fei

    2017-02-01

    Drosophila melanogaster is widely used as a model system to study innate immunity and signaling pathways related to innate immunity, including the Toll signaling pathway. Although this pathway is well studied, the precise mechanisms of posttranscriptional regulation of key components of the Toll signaling pathway by microRNAs (miRNAs) remain obscure. In this study, we used an in silico strategy in combination with the Gal80 ts -Gal4 driver system to identify microRNA-958 (miR-958) as a candidate Toll pathway regulating miRNA in Drosophila We report that overexpression of miR-958 significantly reduces the expression of Drosomycin, a key antimicrobial peptide involved in Toll signaling and the innate immune response. We further demonstrate in vitro and in vivo that miR-958 targets the Toll and Dif genes, key components of the Toll signaling pathway, to negatively regulate Drosomycin expression. In addition, a miR-958 sponge rescued the expression of Toll and Dif, resulting in increased expression of Drosomycin. These results, not only revealed a novel function and modulation pattern of miR-958, but also provided a new insight into the underlying molecular mechanisms of Toll signaling in regulation of innate immunity. Copyright © 2017 the American Physiological Society.

  1. Mapping of cis-regulatory sites in the promoter of testis-specific stellate genes of Drosophila melanogaster.

    Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V

    2012-11-01

    Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.

  2. A high-resolution whole-genome map of key chromatin modifications in the adult Drosophila melanogaster.

    Yin, Hang; Sweeney, Sarah; Raha, Debasish; Snyder, Michael; Lin, Haifan

    2011-12-01

    Epigenetic research has been focused on cell-type-specific regulation; less is known about common features of epigenetic programming shared by diverse cell types within an organism. Here, we report a modified method for chromatin immunoprecipitation and deep sequencing (ChIP-Seq) and its use to construct a high-resolution map of the Drosophila melanogaster key histone marks, heterochromatin protein 1a (HP1a) and RNA polymerase II (polII). These factors are mapped at 50-bp resolution genome-wide and at 5-bp resolution for regulatory sequences of genes, which reveals fundamental features of chromatin modification landscape shared by major adult Drosophila cell types: the enrichment of both heterochromatic and euchromatic marks in transposons and repetitive sequences, the accumulation of HP1a at transcription start sites with stalled polII, the signatures of histone code and polII level/position around the transcriptional start sites that predict both the mRNA level and functionality of genes, and the enrichment of elongating polII within exons at splicing junctions. These features, likely conserved among diverse epigenomes, reveal general strategies for chromatin modifications.

  3. A "bulged" double helix in a RNA-protein contact site

    Peattie, D A; Douthwaite, S; Garrett, R A

    1981-01-01

    as a singly bulged nucleotide extending the Fox and Woese central helix by two base pairs in the E. coli sequence (to positions 16-23/60-68) as well as in each of 61 (prokaryotic and eukaryotic) aligned 5S RNA sequences. In each case, the single bulged nucleotide is at the relative position of adenosine-66...... in the RNA sequences. The presence of this putative bulged nucleotide appears to have been conserved in 5S RNA sequences throughout evolution, and its identity varies with major phylogenetic divisions. This residue is likely involved in specific 5S RNA-protein recognition or interaction in prokaryotic...... and eukaryotic ribosomes. The uridine-65 to adenosine-66 internucleotide bond is protected from RNase A digestion in the complex, and carbethoxylation of E. coli adenosine-66 prior to L18 binding affects formation of a stable RNA-protein complex. Thus, we identify a region of E. coli 5S RNA protected...

  4. RNA oxidation

    Kjaer, L. K.; Cejvanovic, V.; Henriken, T.

    2015-01-01

    .9 significant hazard ratio for death compared with the quartile with the lowest 8oxoGuo excretion when adjusted for age, sex, BMI, smoker status, s-HbA1c, urine protein excretion and s-cholesterol. We conclude that it is now established that RNA oxidation is an independent risk factor for death in type 2...

  5. Drosophila melanogaster as a High-Throughput Model for Host–Microbiota Interactions

    Gregor Reid

    2017-04-01

    Full Text Available Microbiota research often assumes that differences in abundance and identity of microorganisms have unique influences on host physiology. To test this concept mechanistically, germ-free mice are colonized with microbial communities to assess causation. Due to the cost, infrastructure challenges, and time-consuming nature of germ-free mouse models, an alternative approach is needed to investigate host–microbial interactions. Drosophila melanogaster (fruit flies can be used as a high throughput in vivo screening model of host–microbiome interactions as they are affordable, convenient, and replicable. D. melanogaster were essential in discovering components of the innate immune response to pathogens. However, axenic D. melanogaster can easily be generated for microbiome studies without the need for ethical considerations. The simplified microbiota structure enables researchers to evaluate permutations of how each microbial species within the microbiota contribute to host phenotypes of interest. This enables the possibility of thorough strain-level analysis of host and microbial properties relevant to physiological outcomes. Moreover, a wide range of mutant D. melanogaster strains can be affordably obtained from public stock centers. Given this, D. melanogaster can be used to identify candidate mechanisms of host–microbe symbioses relevant to pathogen exclusion, innate immunity modulation, diet, xenobiotics, and probiotic/prebiotic properties in a high throughput manner. This perspective comments on the most promising areas of microbiota research that could immediately benefit from using the D. melanogaster model.

  6. Drosophila melanogaster as a High-Throughput Model for Host-Microbiota Interactions.

    Trinder, Mark; Daisley, Brendan A; Dube, Josh S; Reid, Gregor

    2017-01-01

    Microbiota research often assumes that differences in abundance and identity of microorganisms have unique influences on host physiology. To test this concept mechanistically, germ-free mice are colonized with microbial communities to assess causation. Due to the cost, infrastructure challenges, and time-consuming nature of germ-free mouse models, an alternative approach is needed to investigate host-microbial interactions. Drosophila melanogaster (fruit flies) can be used as a high throughput in vivo screening model of host-microbiome interactions as they are affordable, convenient, and replicable. D. melanogaster were essential in discovering components of the innate immune response to pathogens. However, axenic D. melanogaster can easily be generated for microbiome studies without the need for ethical considerations. The simplified microbiota structure enables researchers to evaluate permutations of how each microbial species within the microbiota contribute to host phenotypes of interest. This enables the possibility of thorough strain-level analysis of host and microbial properties relevant to physiological outcomes. Moreover, a wide range of mutant D. melanogaster strains can be affordably obtained from public stock centers. Given this, D. melanogaster can be used to identify candidate mechanisms of host-microbe symbioses relevant to pathogen exclusion, innate immunity modulation, diet, xenobiotics, and probiotic/prebiotic properties in a high throughput manner. This perspective comments on the most promising areas of microbiota research that could immediately benefit from using the D. melanogaster model.

  7. Effects of caffeine or maternal repair systems in Drosophila melanogaster

    Osgood, C.; Zimmering, S.

    1979-01-01

    Drosophila melanogaster females were treated with 1% caffeine, mated with X-rayed males and the frequencies of induced sex-chromosome loss, translocations between the major autosomes and between the Y-chromosome and the major autosomes determined. In a reversal of the results obtained previously with 0.2% caffeine by Mendelson and Sobels, treatment of females with 1% caffeine led to a decrease in sex-chromosome loss, confirming preliminary data of Zimmering and Osgood and in increase in autosome-autosome translocations. It is suggested that the higher concentration of caffeine inhibits replication permitting more time available for chromosome-type restitutions by means of caffeine-insensitive repair mechanisms. In contrast with results for autosome-autosome translocation, the fequency of Y-autosome translocations was depressed below controls suggesting an isolation (by any one of several means) of Y-chromosome breaks from those in the autosomes. (Auth.)

  8. A pulsed magnetic stress applied to Drosophila melanogaster flies

    Delle Side, D; Giuffreda, E; Nassisi, V; Velardi, L; Bozzetti, M P; Friscini, A; Specchia, V

    2014-01-01

    We report the development of a system to feed pulsed magnetic stress to biological samples. The device is based on a RLC circuit that transforms the energy stored in a high voltage capacitor into a magnetic field inside a coil. The field has been characterized and we found that charging the capacitor with 24 kV results in a peak field of 0.4 T. In order to test its effect, we applied such a stress to the Drosophila melanogaster model and we examined its bio-effects. We analysed, in the germ cells, the effects on the control of specific DNA repetitive sequences that are activated after different environmental stresses. The deregulation of these sequences causes genomic instability and chromosomes breaks leading to sterility. The magnetic field treatment did not produce effects on repetitive sequences in the germ cells of Drosophila. Hence, this field doesn't produce deleterious effects linked to repetitive sequences derepression.

  9. Phenomenon of life span instability in Drosophila melanogaster: Pt. 2

    Izmaylov, D.M.; Obukhova, L.K.; Okladnova, O.V.; Akifyev, A.P.

    1993-01-01

    The dynamics of life span (LS) have been studied in successive generations of postirradiation and control groups of Drosophila melanogaster, strain D-32, after a single exposure to Co 60 γ-quantum irradiation. It has been shown using mathematical procedures that in all postirradiation generations, with one exception, survival curves retain their canonical shape. This is indicative of the unchangeable nature of LS distribution. The means LS of the progeny of irradiated parents either coincides with control values or can be higher or lower. Moreover, single irradiation results in an altered time-scanning of LS variations in successive generations as compared with controls. The possible origin of LS instability is discussed. (author)

  10. Estimating spontaneous mutation rates at enzyme loci in Drosophila melanogaster

    Mukai, Terumi; Yamazaki, Tsuneyuki; Harada, Ko; Kusakabe, Shin-ichi

    1990-04-01

    Spontaneous mutations were accumulated for 1,620,826 allele-generations on chromosomes that originated from six stem second chromosomes of Drosophila melanogaster. Only null-electromorph mutations were detected. Band-electromorph mutations were not found. The average rate of null-electromorph mutations was 2.71 x 10 -5 per locus per generation. The 95% confidence interval (μ n ) was 1.97 x 10 -5 n -5 per locus per generation. The upper 95% confidence limit of the band-electromorph mutation rate (μ B ) was 2.28 x 10 -6 per locus per generation. It appeared that null mutations were induced by movable genetic elements and that the mutation rates were different from chromosome to chromosome. (author)

  11. Drosophila melanogaster as a model organism to study nanotoxicity.

    Ong, Cynthia; Yung, Lin-Yue Lanry; Cai, Yu; Bay, Boon-Huat; Baeg, Gyeong-Hun

    2015-05-01

    Drosophila melanogaster has been used as an in vivo model organism for the study of genetics and development since 100 years ago. Recently, the fruit fly Drosophila was also developed as an in vivo model organism for toxicology studies, in particular, the field of nanotoxicity. The incorporation of nanomaterials into consumer and biomedical products is a cause for concern as nanomaterials are often associated with toxicity in many in vitro studies. In vivo animal studies of the toxicity of nanomaterials with rodents and other mammals are, however, limited due to high operational cost and ethical objections. Hence, Drosophila, a genetically tractable organism with distinct developmental stages and short life cycle, serves as an ideal organism to study nanomaterial-mediated toxicity. This review discusses the basic biology of Drosophila, the toxicity of nanomaterials, as well as how the Drosophila model can be used to study the toxicity of various types of nanomaterials.

  12. Drosophila melanogaster: a fly through its history and current use.

    Stephenson, R; Metcalfe, N H

    2013-01-01

    Drosophila melanogaster, the common fruit fly, has been used as a model organism in both medical and scientific research for over a century. Work by Thomas Hunt Morgan (1866-1945) and his students at Columbia University at the beginning of the twentieth century led to great discoveries such as sex-linked inheritance and that ionising radiation causes mutations in genes. However, the use of Drosophila was not limited to genetic research. Experimentation with this model organism has also led to discoveries in neuroscience and neurodevelopment, including the basis of circadian rhythms. Its complex nervous system, conserved neurological function, and human disease-related loci allow Drosophila to be an ideal model organism for the study of neurodegenerative disease, for which it is used today, aiding research into diseases such as Alzheimer's and Parkinson's, which are becoming more prevalent in today's ageing population.

  13. Addition of molecular methods to mutation studies with Drosophila melanogaster

    Lee, W.R.

    1989-01-01

    For 80 years, Drosophila melanogaster has been used as a major tool in analyzing Mendelian genetics. By using chromosome inversions that suppress crossing over, geneticists have developed a large number of stocks for mutation analysis. These stocks permit numerous tests for specific locus mutations, lethals at multiple loci on any chromosome, chromosome exchanges, insertions, and deletions. The entire genome can be manipulated for a degree of genetic control not found in other germ-line systems. Recombinant DNA techniques now permit analysis of mutations to the nucleotide level. By combining classical genetic analysis with recombinant DNA techniques, it is possible to analyze mutations that range from chromosome aberrations and multilocus deficiencies to single nucleotide transitions

  14. Studies on mutagen-sensitive strains of Drosophila melanogaster. IV

    Ferro, W.

    1985-01-01

    The influence of defects in DNA repair processes on X-ray-induced genetic damage in post-meiotic male germ cell stages of Drosophila melanogaster was studied using the 'maternal effects approach'. Basc males were irradiated in N 2 , air or O 2 either as 48-h-old pupae (to sample spermatids) or as 3-4-day-old adults (to sample mature spermatozoa) and mated to females of 3 repair-deficient strains. Simultaneous controls involving mating of males to repair-proficient females (mei + ) were run. The frequencies of sex-linked recessive lethals and of autosomal translocations were determined following standard genetic procedures. The responses elicited in the different crosses with repair-deficient females were compared with those in mei + crosses. (Auth.)

  15. Assessing Pseudomonas virulence with a nonmammalian host: Drosophila melanogaster.

    Haller, Samantha; Limmer, Stefanie; Ferrandon, Dominique

    2014-01-01

    Drosophila melanogaster flies represent an interesting model to study host-pathogen interactions as: (1) they are cheap and easy to raise rapidly and do not bring up ethical issues, (2) available genetic tools are highly sophisticated, for instance allowing tissue-specific alteration of gene expression, e.g., of immune genes, (3) they have a relatively complex organization, with distinct digestive tract and body cavity in which local or systemic infections, respectively, take place, (4) a medium throughput can be achieved in genetic screens, for instance looking for Pseudomonas aeruginosa mutants with altered virulence. We present here the techniques used to investigate host-pathogen relationships, namely the two major models of infections as well as the relevant parameters used to monitor the infection (survival, bacterial titer, induction of host immune response).

  16. A pulsed magnetic stress applied to Drosophila melanogaster flies

    Delle Side, D.; Bozzetti, M. P.; Friscini, A.; Giuffreda, E.; Nassisi, V.; Specchia, V.; Velardi, L.

    2014-04-01

    We report the development of a system to feed pulsed magnetic stress to biological samples. The device is based on a RLC circuit that transforms the energy stored in a high voltage capacitor into a magnetic field inside a coil. The field has been characterized and we found that charging the capacitor with 24 kV results in a peak field of 0.4 T. In order to test its effect, we applied such a stress to the Drosophila melanogaster model and we examined its bio-effects. We analysed, in the germ cells, the effects on the control of specific DNA repetitive sequences that are activated after different environmental stresses. The deregulation of these sequences causes genomic instability and chromosomes breaks leading to sterility. The magnetic field treatment did not produce effects on repetitive sequences in the germ cells of Drosophila. Hence, this field doesn't produce deleterious effects linked to repetitive sequences derepression.

  17. The effects of chronic low dose irradiation on drosophila melanogaster

    Zajnullin, V.G.; Moskalev, A.A.; Shaposhnikov, M.V.; Yuraneva, I.N.; Taskaev, A.I.

    2001-01-01

    It was investigated the influence of the chronic gamma-irradiation in the dose rate of 0.17 cGy/h on the rate of genetic variability and on the life-span in the laboratory strains of Drosophila melanogaster with genotypic distinguishes in mobile genetic elements and defects in the DNA repair processes. It is shown that the radiation-induced alteration of the traits under study depends from genotype of investigated strains. In the different strains we have observed an increase as well as a decrease of the mutation rate and life-span. Also it was established that irradiation leads to the frequencies of the GD-sterility and mutability of the snw and h(w+) in the P-M and H-E dysgenic crosses. The obtained results suggest that mobile genetic elements play an important role in the forming of genetic effects in response to low dose irradiation. (author)

  18. Genetic effects of low-dose irradiation in Drosophila Melanogaster

    Zajnulin, V.G.; Shaposhnikov, M.V.; Yuraneva, I.N.

    2000-01-01

    Influence of chronic γ-irradiation at the dose rate of 0.17 cGy/h on the rate of genetic variability in the laboratory strains of Drosophila Melanogaster with genotypic distinguishes by families of mobile genetic elements and of systems of hybrid disgenesis and also violations in reparation processes control mechanisms. It was shown that the rates of induction of recessive lethal mutations depended on genotype of investigated strains. In the different strains an increase as well as a decrease of the mutation rate were observed. Also in was established that irradiation leads to the increase in frequencies of the gonads sterility and mutability of the sn w and h(w + ) in the P-M and H-E dysgenic crosses. Obtained results suggest that mobile genetic elements play an important role in the forming of genetic effects in response to low dose irradiation [ru

  19. GABAA receptor-expressing neurons promote consumption in Drosophila melanogaster.

    Cheung, Samantha K; Scott, Kristin

    2017-01-01

    Feeding decisions are highly plastic and bidirectionally regulated by neurons that either promote or inhibit feeding. In Drosophila melanogaster, recent studies have identified four GABAergic interneurons that act as critical brakes to prevent incessant feeding. These GABAergic neurons may inhibit target neurons that drive consumption. Here, we tested this hypothesis by examining GABA receptors and neurons that promote consumption. We find that Resistance to dieldrin (RDL), a GABAA type receptor, is required for proper control of ingestion. Knockdown of Rdl in a subset of neurons causes overconsumption of tastants. Acute activation of these neurons is sufficient to drive consumption of appetitive substances and non-appetitive substances and acute silencing of these neurons decreases consumption. Taken together, these studies identify GABAA receptor-expressing neurons that promote Drosophila ingestive behavior and provide insight into feeding regulation.

  20. Cytological investigations in populations of D. melanogaster exposed to radiation

    Wienberg, J.

    1983-01-01

    The study described was carried out to investigate structural changes in the chromosomes of irradiated populations of D.melanogaster that can be analysed on the basis of cytological methods. It mainly dealt with two particular aspects of this subject: I. Different types of chromosomes (polytene chromosomes, mitotic and meiotic chromosomes) were used to examine whether and to which extent chromosomal variability would alter or remain unchanged under the influence of mutation. II. The prophase of the first division of female cells was analysed with respect to the role of resistance factor rar-2. In this connection, it was of interest whether the prophase of meiosis would show visible cytological changes in the interchromosomal structure that are caused by factor rar-2. (orig./MG) [de

  1. Conserved family of glycerol kinase loci in Drosophila melanogaster

    Martinez Agosto, Julian A.; McCabe, Edward R.B.

    2009-01-01

    Glycerol kinase (GK) is an enzyme that catalyzes the formation of glycerol 3-phosphate from ATP and glycerol, the rate-limiting step in glycerol utilization. We analyzed the genome of the model organism Drosophila melanogaster and identified five GK orthologs, including two loci with sequence homology to the mammalian Xp21 GK protein. Using a combination of sequence analysis and evolutionary comparisons of orthologs between species, we characterized functional domains in the protein required for GK activity. Our findings include additional conserved domains that suggest novel nuclear and mitochondrial functions for glycerol kinase in apoptosis and transcriptional regulation. Investigation of GK function in Drosophila will inform us about the role of this enzyme in development and will provide us with a tool to examine genetic modifiers of human metabolic disorders. PMID:16545593

  2. Experimental evolution under hyper-promiscuity in Drosophila melanogaster.

    Perry, Jennifer C; Joag, Richa; Hosken, David J; Wedell, Nina; Radwan, Jacek; Wigby, Stuart

    2016-06-16

    The number of partners that individuals mate with over their lifetime is a defining feature of mating systems, and variation in mate number is thought to be a major driver of sexual evolution. Although previous research has investigated the evolutionary consequences of reductions in the number of mates, we know little about the costs and benefits of increased numbers of mates. Here, we use a genetic manipulation of mating frequency in Drosophila melanogaster to create a novel, highly promiscuous mating system. We generated D. melanogaster populations in which flies were deficient for the sex peptide receptor (SPR) gene - resulting in SPR- females that mated more frequently - and genetically-matched control populations, and allowed them to evolve for 55 generations. At several time-points during this experimental evolution, we assayed behavioural, morphological and transcriptional reproductive phenotypes expected to evolve in response to increased population mating frequencies. We found that males from the high mating frequency SPR- populations evolved decreased ability to inhibit the receptivity of their mates and decreased copulation duration, in line with predictions of decreased per-mating investment with increased sperm competition. Unexpectedly, SPR- population males also evolved weakly increased sex peptide (SP) gene expression. Males from SPR- populations initially (i.e., before experimental evolution) exhibited more frequent courtship and faster time until mating relative to controls, but over evolutionary time these differences diminished or reversed. In response to experimentally increased mating frequency, SPR- males evolved behavioural responses consistent with decreased male post-copulatory investment at each mating and decreased overall pre-copulatory performance. The trend towards increased SP gene expression might plausibly relate to functional differences in the two domains of the SP protein. Our study highlights the utility of genetic

  3. The selfish Segregation Distorter gene complex of Drosophila melanogaster.

    Larracuente, Amanda M; Presgraves, Daven C

    2012-09-01

    Segregation Distorter (SD) is an autosomal meiotic drive gene complex found worldwide in natural populations of Drosophila melanogaster. During spermatogenesis, SD induces dysfunction of SD(+) spermatids so that SD/SD(+) males sire almost exclusively SD-bearing progeny rather than the expected 1:1 Mendelian ratio. SD is thus evolutionarily "selfish," enhancing its own transmission at the expense of its bearers. Here we review the molecular and evolutionary genetics of SD. Genetic analyses show that the SD is a multilocus gene complex involving two key loci--the driver, Segregation distorter (Sd), and the target of drive, Responder (Rsp)--and at least three upward modifiers of distortion. Molecular analyses show that Sd encodes a truncated duplication of the gene RanGAP, whereas Rsp is a large pericentromeric block of satellite DNA. The Sd-RanGAP protein is enzymatically wild type but mislocalized within cells and, for reasons that remain unclear, appears to disrupt the histone-to-protamine transition in drive-sensitive spermatids bearing many Rsp satellite repeats but not drive-insensitive spermatids bearing few or no Rsp satellite repeats. Evolutionary analyses show that the Sd-RanGAP duplication arose recently within the D. melanogaster lineage, exploiting the preexisting and considerably older Rsp satellite locus. Once established, the SD haplotype collected enhancers of distortion and suppressors of recombination. Further dissection of the molecular genetic and cellular basis of SD-mediated distortion seems likely to provide insights into several important areas currently understudied, including the genetic control of spermatogenesis, the maintenance and evolution of satellite DNAs, the possible roles of small interfering RNAs in the germline, and the molecular population genetics of the interaction of genetic linkage and natural selection.

  4. Population Genomics of Inversion Polymorphisms in Drosophila melanogaster

    Corbett-Detig, Russell B.; Hartl, Daniel L.

    2012-01-01

    Chromosomal inversions have been an enduring interest of population geneticists since their discovery in Drosophila melanogaster. Numerous lines of evidence suggest powerful selective pressures govern the distributions of polymorphic inversions, and these observations have spurred the development of many explanatory models. However, due to a paucity of nucleotide data, little progress has been made towards investigating selective hypotheses or towards inferring the genealogical histories of inversions, which can inform models of inversion evolution and suggest selective mechanisms. Here, we utilize population genomic data to address persisting gaps in our knowledge of D. melanogaster's inversions. We develop a method, termed Reference-Assisted Reassembly, to assemble unbiased, highly accurate sequences near inversion breakpoints, which we use to estimate the age and the geographic origins of polymorphic inversions. We find that inversions are young, and most are African in origin, which is consistent with the demography of the species. The data suggest that inversions interact with polymorphism not only in breakpoint regions but also chromosome-wide. Inversions remain differentiated at low levels from standard haplotypes even in regions that are distant from breakpoints. Although genetic exchange appears fairly extensive, we identify numerous regions that are qualitatively consistent with selective hypotheses. Finally, we show that In(1)Be, which we estimate to be ∼60 years old (95% CI 5.9 to 372.8 years), has likely achieved high frequency via sex-ratio segregation distortion in males. With deeper sampling, it will be possible to build on our inferences of inversion histories to rigorously test selective models—particularly those that postulate that inversions achieve a selective advantage through the maintenance of co-adapted allele complexes. PMID:23284285

  5. Male killing Spiroplasma protects Drosophila melanogaster against two parasitoid wasps

    Xie, J; Butler, S; Sanchez, G; Mateos, M

    2014-01-01

    Maternally transmitted associations between endosymbiotic bacteria and insects are diverse and widespread in nature. Owing to imperfect vertical transmission, many heritable microbes have evolved compensational mechanisms to enhance their persistence in host lineages, such as manipulating host reproduction and conferring fitness benefits to host. Symbiont-mediated defense against natural enemies of hosts is increasingly recognized as an important mechanism by which endosymbionts enhance host fitness. Members of the genus Spiroplasma associated with distantly related Drosophila hosts are known to engage in either reproductive parasitism (i.e., male killing) or defense against natural enemies (the parasitic wasp Leptopilina heterotoma and a nematode). A male-killing strain of Spiroplasma (strain Melanogaster Sex Ratio Organism (MSRO)) co-occurs with Wolbachia (strain wMel) in certain wild populations of the model organism Drosophila melanogaster. We examined the effects of Spiroplasma MSRO and Wolbachia wMel on Drosophila survival against parasitism by two common wasps, Leptopilina heterotoma and Leptopilina boulardi, that differ in their host ranges and host evasion strategies. The results indicate that Spiroplasma MSRO prevents successful development of both wasps, and confers a small, albeit significant, increase in larva-to-adult survival of flies subjected to wasp attacks. We modeled the conditions under which defense can contribute to Spiroplasma persistence. Wolbachia also confers a weak, but significant, survival advantage to flies attacked by L. heterotoma. The host protective effects exhibited by Spiroplasma and Wolbachia are additive and may provide the conditions for such cotransmitted symbionts to become mutualists. Occurrence of Spiroplasma-mediated protection against distinct parasitoids in divergent Drosophila hosts suggests a general protection mechanism. PMID:24281548

  6. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study.

    Hanf, Matthieu; Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-11-08

    To assess at country level the association of mortality in under 5s with a large set of determinants. Longitudinal study. 193 United Nations member countries, 2000-09. Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. National rate of deaths in under 5s per 1000 live births The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015.

  7. Ba 5s photoionization in the region of the second Cooper minimum

    Whitfield, S B; Wehlitz, R; Dolmatov, V K

    2011-01-01

    We investigate the 5s angular distribution parameter and partial photoionization cross section of atomic Ba in the region of the second Cooper minimum covering a photon energy region from 120 to 260 eV. We observe a strong drop in the Ba 5s β value from 2.0, reaching a minimum of 1.57 ± 0.07 at a photon energy of 150 eV. The β value then slowly rises back towards its nominal value of 2.0 at photon energies beyond the minimum. Our measured 5s partial cross section also shows a pronounced dip around 170 eV due to interchannel coupling with the Ba 4d photoelectrons. After combining our measurements with previous experimental values at lower photon energies, we obtain a consistent data set spanning the photon energy range prior to the onset of the partial cross section maximum and through the cross section minimum. We also calculate the 5s partial cross section under several different levels of approximation. We find that the generalized random-phase approximation with exchange calculation models the shape and position of the combined experimental cross section data set rather well after incorporating experimental ionization energies and a shift in the photon energy scale.

  8. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA

    Kumke, K.; Macas, Jiří; Fuchs, J.; Altschmied, L.; Kour, J.; Dhar, M.K.; Houben, A.

    2016-01-01

    Roč. 148, č. 1 (2016), s. 68-73 ISSN 1424-8581 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Polymorhpic A chromosome segment * Satellite repeat * Supernumerary chromosome * 5S rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.354, year: 2016

  9. Dramatic nondipole effects in low-energy photoionization: Experimental and theoretical study of Xe 5s

    Hemmers, O.; Lindle, D.W.; Baker, J.; Hudson, A.; Lotrakul, M.; Tran, I.C.; Guillemin, R.; Stolte, W.C.; Wolska, A.; Yu, S.W.; Kanter, E.P.; Kraessig, B.; Southworth, S.H.; Wehlitz, R.; Rolles, D.; Amusia, M.Ya.; Cheng, K.T.; Chernysheva, L.V.; Johnson, W.R.; Manson, S.T.

    2003-01-01

    The Xe 5s nondipole photoelectron parameter γ is obtained experimentally and theoretically from threshold to ∼200 eV photon energy. Significant nondipole effects are seen even in the threshold region of this valence shell photoionization. In addition, contrary to previous understanding, clear evidence of interchannel coupling among quadrupole photoionization channels is found

  10. Cloning and identification of the gene coding for the 140-kd subunit of Drosophila RNA polymerase II

    Faust, Daniela M.; Renkawitz-Pohl, Renate; Falkenburg, Dieter; Gasch, Alexander; Bialojan, Siegfried; Young, Richard A.; Bautz, Ekkehard K. F.

    1986-01-01

    Genomic clones of Drosophila melanogaster were isolated from a λ library by cross-hybridization with the yeast gene coding for the 150-kd subunit of RNA polymerase II. Clones containing a region of ∼2.0 kb with strong homology to the yeast gene were shown to code for a 3.9-kb poly(A)+-RNA. Part of the coding region was cloned into an expression vector. A fusion protein was obtained which reacted with an antibody directed against RNA polymerase II of Drosophila. Peptide mapping of the fusion p...

  11. Extraforaminal Lumbar Interbody Fusion at the L5-S1 Level: Technical Considerations and Feasibility.

    Kurzbuch, Arthur Robert; Kaech, Denis; Baranowski, Pawel; Baranowska, Alicja; Recoules-Arche, Didier

    2017-09-01

    Background  Extraforaminal lumbar interbody fusion (ELIF) surgery is a muscle-sparing approach that allows the treatment of various degenerative spinal diseases. It is technical challenging to perform the ELIF approach at the L5-S1 level because the sacral ala obstructs the view of the intervertebral disk space. Methods  We reported earlier on the ELIF technique in which the intervertebral disk is targeted at an angle of 45 degrees relative to the midline. In this article we describe the technical process we developed to overcome the anatomic relation between the sacral ala and the intervertebral disk space L5-S1 that hinders the ELIF approach at this level. We then report in a retrospective analysis on the short-term clinical and radiologic outcome of 100 consecutive patients with degenerative L5-S1 pathologies who underwent ELIF surgery. Results  The L5-S1 ELIF approach could be realized in all patients. The short-term clinical outcome was evaluated 5 months after surgery: 92% of the patients were satisfied with their postoperative result; 8% had a poor result. Overall, 17% of the patients presented light radicular or low back pain not influencing their daily activity, and 82% of the patients working before surgery returned to work 3 to 7 months after surgery. The radiologic outcome was documented by computed tomography at 5 months after surgery and showed fusion in 99% of the patients. Lumbar magnetic resonance imaging performed in 5 patients at 6 months after surgery revealed the integrity of the paraspinal muscles. Conclusions  ELIF surgery at the L5-S1 level is technically feasible for various degenerative spinal diseases. Analysis of the clinical and radiologic data in a consecutive retrospective cohort of patients who underwent this surgical procedure showed a good short-term clinical outcome and fusion rate. Georg Thieme Verlag KG Stuttgart · New York.

  12. The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.

    Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun

    2015-12-03

    The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.

  13. Serotonin receptor activity is necessary for olfactory learning and memory in Drosophila melanogaster.

    Johnson, O; Becnel, J; Nichols, C D

    2011-09-29

    Learning and memory in the fruit fly, Drosophila melanogaster, is a complex behavior with many parallels to mammalian learning and memory. Although many neurotransmitters including acetylcholine, dopamine, glutamate, and GABA have previously been demonstrated to be involved in aversive olfactory learning and memory, the role of serotonin has not been well defined. Here, we present the first evidence of the involvement of individual serotonin receptors in olfactory learning and memory in the fly. We initially followed a pharmacological approach, utilizing serotonin receptor agonists and antagonists to demonstrate that all serotonin receptor families present in the fly are necessary for short-term learning and memory. Isobolographic analysis utilizing combinations of drugs revealed functional interactions are occurring between 5-HT(1A)-like and 5-HT(2), and 5-HT(2) and 5-HT(7) receptor circuits in mediating short-term learning and memory. Examination of long-term memory suggests that 5-HT(1A)-like receptors are necessary for consolidation and important for recall, 5-HT(2) receptors are important for consolidation and recall, and 5-HT(7) receptors are involved in all three phases. Importantly, we have validated our pharmacological results with genetic experiments and showed that hypomorph strains for 5-HT(2)Dro and 5-HT(1B)Dro receptors, as well as knockdown of 5-HT(7)Dro mRNA, significantly impair performance in short-term memory. Our data highlight the importance of the serotonin system and individual serotonin receptors to influence olfactory learning and memory in the fly, and position the fly as a model system to study the role of serotonin in cognitive processes relevant to mammalian CNS function. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

  14. Neuronal Cbl Controls Biosynthesis of Insulin-Like Peptides in Drosophila melanogaster

    Yu, Yue; Sun, Ying; He, Shengqi; Yan, Cheng; Rui, Liangyou; Li, Wenjun

    2012-01-01

    The Cbl family proteins function as both E3 ubiquitin ligases and adaptor proteins to regulate various cellular signaling events, including the insulin/insulin-like growth factor 1 (IGF1) and epidermal growth factor (EGF) pathways. These pathways play essential roles in growth, development, metabolism, and survival. Here we show that in Drosophila melanogaster, Drosophila Cbl (dCbl) regulates longevity and carbohydrate metabolism through downregulating the production of Drosophila insulin-like peptides (dILPs) in the brain. We found that dCbl was highly expressed in the brain and knockdown of the expression of dCbl specifically in neurons by RNA interference increased sensitivity to oxidative stress or starvation, decreased carbohydrate levels, and shortened life span. Insulin-producing neuron-specific knockdown of dCbl resulted in similar phenotypes. dCbl deficiency in either the brain or insulin-producing cells upregulated the expression of dilp genes, resulting in elevated activation of the dILP pathway, including phosphorylation of Drosophila Akt and Drosophila extracellular signal-regulated kinase (dERK). Genetic interaction analyses revealed that blocking Drosophila epidermal growth factor receptor (dEGFR)-dERK signaling in pan-neurons or insulin-producing cells by overexpressing a dominant-negative form of dEGFR abolished the effect of dCbl deficiency on the upregulation of dilp genes. Furthermore, knockdown of c-Cbl in INS-1 cells, a rat β-cell line, also increased insulin biosynthesis and glucose-stimulated secretion in an ERK-dependent manner. Collectively, these results suggest that neuronal dCbl regulates life span, stress responses, and metabolism by suppressing dILP production and the EGFR-ERK pathway mediates the dCbl action. Cbl suppression of insulin biosynthesis is evolutionarily conserved, raising the possibility that Cbl may similarly exert its physiological actions through regulating insulin production in β cells. PMID:22778134

  15. Roles of Female and Male Genotype in Post-Mating Responses in Drosophila melanogaster.

    Delbare, Sofie Y N; Chow, Clement Y; Wolfner, Mariana F; Clark, Andrew G

    2017-10-30

    Mating induces a multitude of changes in female behavior, physiology, and gene expression. Interactions between female and male genotype lead to variation in post-mating phenotypes and reproductive success. So far, few female molecules responsible for these interactions have been identified. Here, we used Drosophila melanogaster from 5 geographically dispersed populations to investigate such female × male genotypic interactions at the female transcriptomic and phenotypic levels. Females from each line were singly-mated to males from the same 5 lines, for a total of 25 combinations. Reproductive output and refractoriness to re-mating were assayed in females from the 25 mating combinations. Female × male genotypic interactions resulted in significant differences in these post-mating phenotypes. To assess whether female × male genotypic interactions affect the female post-mating transcriptome, next-generation RNA sequencing was performed on virgin and mated females at 5 to 6 h post-mating. Seventy-seven genes showed strong variation in mating-induced expression changes in a female × male genotype-dependent manner. These genes were enriched for immune response and odorant-binding functions, and for expression exclusively in the head. Strikingly, variation in post-mating transcript levels of a gene encoding a spermathecal endopeptidase was correlated with short-term egg production. The transcriptional variation found in specific functional classes of genes might be a read-out of female × male compatibility at a molecular level. Understanding the roles these genes play in the female post-mating response will be crucial to better understand the evolution of post-mating responses and related conflicts between the sexes. © The American Genetic Association 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. TAF10 and TAF10b partially redundant roles during Drosophila melanogaster morphogenesis.

    Pahi, Z; Borsos, B N; Vedelek, B; Shidlovskii, Y V; Georgieva, S G; Boros, I M; Pankotai, T

    2017-01-01

    Transcription of eukaryotic genes requires the cooperative action of the RNA polymerase complex, the general transcription factors (TFIIB, TFIID, TFIIE, TFIIF and TFIIH) and chromatin modifiers. The TFIID complex contributes to transcriptional activation by several mechanisms and has a subunit with associated histone acetyltransferase (HAT) activity. The histone modifier SAGA complex has both HAT and deubiquitylase (DUB) activities. TFIID and SAGA share several TBP-associated factors (TAFs), but not their HAT subunit. Recently, several duplicated TAF proteins have been identified in higher eukaryotes, but their functional diversity has been so far poorly characterized. Here, we report the functional similarities and differences of TAF10 and TAF10b, the two TAF10 orthologs of Drosophila melanogaster. Results from in silico modeling suggest that dTAF10 and dTAF10b have similar secondary structures characterized by the presence of a histone-fold domain. Additionally, dTAF10 and dTAF10b share interaction partners and show similar expression patterns in neuronal tissues. Nonetheless, dTAF10 and dTAF10b seem to have partly distinct functions. To investigate their roles, we generated dTaf10-dTaf10b double-mutants and rescued the mutant flies with transgenes, which allowed the translation of either dTAF10 or dTAF10b protein. We found that the loss of dTAF10b resulted in pupal lethality, while animals lacking dTAF10 were able to form puparium. dTaf10 mutant adults showed distorted eye morphology. During DNA repair, dTAF10 and dTAF10b act redundantly, suggesting that these proteins have distinct but partially overlapping functions.

  17. Definition of a RACK1 Interaction Network in Drosophila melanogaster Using SWATH-MS.

    Kuhn, Lauriane; Majzoub, Karim; Einhorn, Evelyne; Chicher, Johana; Pompon, Julien; Imler, Jean-Luc; Hammann, Philippe; Meignin, Carine

    2017-07-05

    Receptor for Activated protein C kinase 1 (RACK1) is a scaffold protein that has been found in association with several signaling complexes, and with the 40S subunit of the ribosome. Using the model organism Drosophila melanogaster , we recently showed that RACK1 is required at the ribosome for internal ribosome entry site (IRES)-mediated translation of viruses. Here, we report a proteomic characterization of the interactome of RACK1 in Drosophila S2 cells. We carried out Label-Free quantitation using both Data-Dependent and Data-Independent Acquisition (DDA and DIA, respectively) and observed a significant advantage for the Sequential Window Acquisition of all THeoretical fragment-ion spectra (SWATH) method, both in terms of identification of interactants and quantification of low abundance proteins. These data represent the first SWATH spectral library available for Drosophila and will be a useful resource for the community. A total of 52 interacting proteins were identified, including several molecules involved in translation such as structural components of the ribosome, factors regulating translation initiation or elongation, and RNA binding proteins. Among these 52 proteins, 15 were identified as partners by the SWATH strategy only. Interestingly, these 15 proteins are significantly enriched for the functions translation and nucleic acid binding. This enrichment reflects the engagement of RACK1 at the ribosome and highlights the added value of SWATH analysis. A functional screen did not reveal any protein sharing the interesting properties of RACK1, which is required for IRES-dependent translation and not essential for cell viability. Intriguingly however, 10 of the RACK1 partners identified restrict replication of Cricket paralysis virus (CrPV), an IRES-containing virus. Copyright © 2017 Kuhn et al.

  18. Genomic variation and its impact on gene expression in Drosophila melanogaster.

    Andreas Massouras

    Full Text Available Understanding the relationship between genetic and phenotypic variation is one of the great outstanding challenges in biology. To meet this challenge, comprehensive genomic variation maps of human as well as of model organism populations are required. Here, we present a nucleotide resolution catalog of single-nucleotide, multi-nucleotide, and structural variants in 39 Drosophila melanogaster Genetic Reference Panel inbred lines. Using an integrative, local assembly-based approach for variant discovery, we identify more than 3.6 million distinct variants, among which were more than 800,000 unique insertions, deletions (indels, and complex variants (1 to 6,000 bp. While the SNP density is higher near other variants, we find that variants themselves are not mutagenic, nor are regions with high variant density particularly mutation-prone. Rather, our data suggest that the elevated SNP density around variants is mainly due to population-level processes. We also provide insights into the regulatory architecture of gene expression variation in adult flies by mapping cis-expression quantitative trait loci (cis-eQTLs for more than 2,000 genes. Indels comprise around 10% of all cis-eQTLs and show larger effects than SNP cis-eQTLs. In addition, we identified two-fold more gene associations in males as compared to females and found that most cis-eQTLs are sex-specific, revealing a partial decoupling of the genomic architecture between the sexes as well as the importance of genetic factors in mediating sex-biased gene expression. Finally, we performed RNA-seq-based allelic expression imbalance analyses in the offspring of crosses between sequenced lines, which revealed that the majority of strong cis-eQTLs can be validated in heterozygous individuals.

  19. Evolutionary Transitions of MicroRNA-Target Pairs

    Nozawa, Masafumi; Fujimi, Mai; Iwamoto, Chie; Onizuka, Kanako; Fukuda, Nana; Ikeo, Kazuho; Gojobori, Takashi

    2016-01-01

    How newly generated microRNA (miRNA) genes are integrated into gene regulatory networks during evolution is fundamental in understanding the molecular and evolutionary bases of robustness and plasticity in gene regulation. A recent model proposed that after the birth of a miRNA, the miRNA is generally integrated into the network by decreasing the number of target genes during evolution. However, this decreasing model remains to be carefully examined by considering in vivo conditions. In this study, we therefore compared the number of target genes among miRNAs with different ages, combining experiments with bioinformatics predictions. First, we focused on three Drosophila miRNAs with different ages. As a result, we found that an older miRNA has a greater number of target genes than a younger miRNA, suggesting the increasing number of targets for each miRNA during evolution (increasing model). To further confirm our results, we also predicted all target genes for all miRNAs in D. melanogaster, considering co-expression of miRNAs and mRNAs in vivo. The results obtained also do not support the decreasing model but are reasonably consistent with the increasing model of miRNA-target pairs. Furthermore, our large-scale analyses of currently available experimental data of miRNA-target pairs also showed a weak but the same trend in humans. These results indicate that the current decreasing model of miRNA-target pairs should be reconsidered and the increasing model may be more appropriate to explain the evolutionary transitions of miRNA-target pairs in many organisms.

  20. Evolutionary Transitions of MicroRNA-Target Pairs

    Nozawa, Masafumi

    2016-04-27

    How newly generated microRNA (miRNA) genes are integrated into gene regulatory networks during evolution is fundamental in understanding the molecular and evolutionary bases of robustness and plasticity in gene regulation. A recent model proposed that after the birth of a miRNA, the miRNA is generally integrated into the network by decreasing the number of target genes during evolution. However, this decreasing model remains to be carefully examined by considering in vivo conditions. In this study, we therefore compared the number of target genes among miRNAs with different ages, combining experiments with bioinformatics predictions. First, we focused on three Drosophila miRNAs with different ages. As a result, we found that an older miRNA has a greater number of target genes than a younger miRNA, suggesting the increasing number of targets for each miRNA during evolution (increasing model). To further confirm our results, we also predicted all target genes for all miRNAs in D. melanogaster, considering co-expression of miRNAs and mRNAs in vivo. The results obtained also do not support the decreasing model but are reasonably consistent with the increasing model of miRNA-target pairs. Furthermore, our large-scale analyses of currently available experimental data of miRNA-target pairs also showed a weak but the same trend in humans. These results indicate that the current decreasing model of miRNA-target pairs should be reconsidered and the increasing model may be more appropriate to explain the evolutionary transitions of miRNA-target pairs in many organisms.

  1. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  2. Ellipsometry study of optical parameters of AgIn5S8 crystals

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  3. Ellipsometry study of optical parameters of AgIn{sub 5}S{sub 8} crystals

    Isik, Mehmet, E-mail: mehmet.isik@atilim.edu.tr [Department of Electrical and Electronics Engineering, Atilim University, 06836 Ankara (Turkey); Gasanly, Nizami [Department of Physics, Middle East Technical University, 06800 Ankara (Turkey); Virtual International Scientific Research Centre, Baku State University, 1148 Baku (Azerbaijan)

    2015-12-01

    AgIn{sub 5}S{sub 8} crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2–6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn{sub 5}S{sub 8} crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  4. Perception and analysis of the 5S program at a business service provider

    André Luiz Emmel Silva

    2016-09-01

    Full Text Available Given the importance that the service sector represents in our economy, the application of concepts and techniques for its administration and models aimed at improving its quality is growing. This article aims to analyze the main aspects of the 5S program in the implementation phase and in the course of its evolution at a service company. The methodology used is qualitative, implemented through a case study structured in 6 steps. The company under study performs strongly on the national market and therefore has a large amount of documents circulating daily through different sectors, which generated the need to implement a methodology capable of streamlining document flow management and reducing the time spent on bureaucracy by its employees. The 5S program was shown to have brought the company greater administrative efficiency and a more pleasant, safe and organized working environment, motivating employees, reducing costs and providing competitive advantages.

  5. Implementation of 5S tools as a starting point in business process reengineering

    Vorkapić Miloš 0000-0002-3463-8665

    2017-01-01

    Full Text Available The paper deals with the analysis of elements which represent a starting point in implementation of a business process reengineering. We have used Lean tools through the analysis of 5S model in our research. On the example of finalization of the finished transmitter in IHMT-CMT production, 5S tools were implemented with a focus on Quality elements although the theory shows that BPR and TQM are two opposite activities in an enterprise. We wanted to distinguish the significance of employees’ self-discipline which helps the process of product finalization to develop in time and without waste and losses. In addition, the employees keep their work place clean, tidy and functional.

  6. The blue light indicator in rubidium 5S-5P-5D cascade excitation

    Raja, Waseem; Ali, Md. Sabir; Chakrabarti, Alok; Ray, Ayan

    2017-07-01

    The cascade system has played an important role in contemporary research areas related to fields like Rydberg excitation, four wave mixing and non-classical light generation, etc. Depending on the specific objective, co or counter propagating pump-probe laser experimental geometry is followed. However, the stepwise excitation of atoms to states higher than the first excited state deals with increasingly much fewer number of atoms even compared to the population at first excited level. Hence, one needs a practical indicator to study the complex photon-atom interaction of the cascade system. Here, we experimentally analyze the case of rubidium 5S → 5P → 5D as a specimen of two-step excitation and highlight the efficacy of monitoring one branch, which emits 420 nm, of associated cascade decay route 5D → 6P → 5S, as an effective monitor of the coherence in the system.

  7. Attosecond relative delay among xenon 5p, 5s, and 4d photoionization

    Magrakvelidze, Maia; Madjet, Mohamed; Chakraborty, Himadri

    2017-04-01

    Attosecond Wigner-Smith (WS) time delays of the photoemissions of Xe valence 5p, 5s, and core 4d electrons are investigated in details using the time-dependent local density approximation (TDLDA). Electron correlations determine the energy-dependent structures in ionization phases of the dipole channels and in the resulting WS delays at various shape resonances, induced by the collective motion of 4d electrons, and at various Cooper minima. We find that our calculation closely agrees with the streaking measurement for the delay of 4d relative to 5s, and predicts accelerated emission of 5p with respect to 4d as was experimentally observed at similar photon energies for Xe atoms adsorbed on the tungsten surface. This work was supported by the U.S. National Science Foundation.

  8. Effect of curcumin on aged Drosophila melanogaster: a pathway prediction analysis.

    Zhang, Zhi-guo; Niu, Xu-yan; Lu, Ai-ping; Xiao, Gary Guishan

    2015-02-01

    To re-analyze the data published in order to explore plausible biological pathways that can be used to explain the anti-aging effect of curcumin. Microarray data generated from other study aiming to investigate effect of curcumin on extending lifespan of Drosophila melanogaster were further used for pathway prediction analysis. The differentially expressed genes were identified by using GeneSpring GX with a criterion of 3.0-fold change. Two Cytoscape plugins including BisoGenet and molecular complex detection (MCODE) were used to establish the protein-protein interaction (PPI) network based upon differential genes in order to detect highly connected regions. The function annotation clustering tool of Database for Annotation, Visualization and Integrated Discovery (DAVID) was used for pathway analysis. A total of 87 genes expressed differentially in D. melanogaster melanogaster treated with curcumin were identified, among which 50 were up-regulated significantly and 37 were remarkably down-regulated in D. melanogaster melanogaster treated with curcumin. Based upon these differential genes, PPI network was constructed with 1,082 nodes and 2,412 edges. Five highly connected regions in PPI networks were detected by MCODE algorithm, suggesting anti-aging effect of curcumin may be underlined through five different pathways including Notch signaling pathway, basal transcription factors, cell cycle regulation, ribosome, Wnt signaling pathway, and p53 pathway. Genes and their associated pathways in D. melanogaster melanogaster treated with anti-aging agent curcumin were identified using PPI network and MCODE algorithm, suggesting that curcumin may be developed as an alternative therapeutic medicine for treating aging-associated diseases.

  9. New antiferromagnetic semiconductor CuCr1.5Sb0.5S4

    Kesler, Ya.A.; Koroleva, L.I.; Mikheev, M.G.; Odintsov, A.G.; Filimonov, D.S.

    1993-01-01

    New halcogenide compound with spinel-antiferromagnetic semiconductor CuCr 1.5 Sb 0.5 S 4 are obtained and studied for the first time. Magnetic properties of this compound, namely, magnetization linear dependence, maximum on PHI(T) curve in the low-temperature area and realization of the Curie-Weis law for paramagnetic susceptibility with negative paramagnetic temperature testiby to the fact that this compound is antiferromagnetic

  10. Uudised : Eesti muusikalistaarid Euroopas. Tüüri 5.sümfoonia Tallinnas

    2005-01-01

    Koit Toome, Ele Millistver ja Lauri Liiv alustavad 1. detsembril Brnos rahvusvahelises muusikalitrupis "Hairi" proovidega. Esietendus on 26. dets. Iserlohni linnas Saksamaal ning etendusi antakse järgmise aasta 16. aprillini Saksa linnades, Austrias, Šveitsis ja Taanis. Erkki-Sven Tüüri 5. sümfoonia tuleb Eestis esiettekandele 10. dets. Estonia Kontserdisaalis, teose esiettekannet selle aasta veebruaris Stuttgardis dirigeeris Olari Elts

  11. Fuel and coolant motions following pin failure: EPIC models and the PBE-5S experiment

    Garner, P.L.; Abramson, P.B.

    1979-01-01

    The EPIC computer code has been used to analyze the post-fuel-pin-failure behavior in the PBE-5S experiment performed at Sandia Laboratories. The effects of modeling uncertainties on the calculation are examined. The calculations indicate that the majority of the piston motion observed in the test is due to the initial pressurization of the coolant channel by fuel vapor at cladding failure. A more definitive analysis requires improvements in calculational capabilities and experiment diagnostics

  12. The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.

    Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

    2017-10-27

    The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. Copyright © 2017 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com

  13. Synthesis and growth mechanism of Zn0.5Cd0.5S nanohexagon dendrite

    Yu, Wen; Fang, Pengfei; Wang, Shaojie

    2014-12-01

    Hierarchical Zn0.5Cd0.5S nanohexagon dendrites were synthesized by a one-step hydrothermal method. The Zn0.5Cd0.5S nanohexagon dendrites were made up of nanohexagons with a side length of about 90 nm. The nanohexagons were regularly arranged forming as embranchments which were parallel to each other along certain hexagonal directions. Furthermore, these embranchments made up primary trunks shaping as dendrites. The growth mechanism of Zn0.5Cd0.5S nanohexagon dendrites was proposed in which molecular soft template and lowest energy principle played key roles. By adjusting the composition of the reactants, a series of ZnxCd1-xS solid solutions could be obtained. The morphology of the synthesized ZnxCd1-xS depended much on the x value. The UV-vis spectra absorb edges of the ZnxCd1-xS samples continuously shifted indicating the changes of the band gap.

  14. Evidence-based management of otitis media: a 5S model approach.

    Wasson, J D; Yung, M W

    2015-02-01

    The 5S model proposes five hierarchical levels (systems, summaries, synopses, syntheses and studies) of pre-appraised evidence to guide evidence-based practice. This review aimed to identify and summarise pre-appraised evidence at the highest available 5S level for the management of different subsets of otitis media: acute otitis media, otitis media with effusion, chronic suppurative otitis media and cholesteatoma in both adults and children. Data sources were pre-appraised evidence resources. Evidence freely available from sources at the highest available level of the 5S model were summarised for this review. System level evidence exists for acute otitis media and otitis media with effusion. Summary level evidence exists for recurrent acute otitis media and medical management of chronic suppurative otitis media. There is an absence of randomised controlled trials to prove the efficacy of surgical management of chronic suppurative otitis media and cholesteatoma. Until randomised controlled trial data are generated, consensus publications on the surgical management of chronic suppurative otitis media and cholesteatoma should be used to guide best practice.

  15. Why are our children wasting: Determinants of wasting among under 5s in Ghana.

    Darteh, Eugene Kofuor Maafo; Acquah, Evelyn; Darteh, Florie

    2017-09-01

    Wasting is one of the indicators of malnutrition known to contribute to the deaths occurring from childhood malnutrition. It is the measure of body mass in relation to body length used to explain recent nutritional status. This paper examines the determinants of wasting among under 5s in Ghana. Data were drawn from the 2014 Ghana Demographic and Health Survey children's records file to examine the determinants of wasting among children. A total of 2720 children under 5 years with valid anthropometric data were used. Data on wasting were collected by measuring the weight and height of all children under 5 years of age. Bi-variate and multi-variate statistics are used to examine the determinants of wasting. The bi-variate analysis showed significant differences ( p 5s according to age of the child, region, and wealth status. On the other hand, the multi-variate analysis revealed that the odds of wasting were lower among children aged 24-35 months (Odds ratio (OR) = 0.37; p 5s. Also, efforts should be made by the relevant government agencies and other stakeholders to strengthen the socio-economic status of mothers to enable them to provide adequate nutrition and improve access to health insurance for their children in order to reduce the incidence of wasting among these children.

  16. Distraction manipulation reduction of an L5-S1 disk herniation.

    Cox, J M; Hazen, L J; Mungovan, M

    1993-06-01

    A computed tomography (CT)-confirmed L5-S1 disk protrusion is reported to be reduced following chiropractic adjustment, as seen on repeat CT scanning. Correlation of the CT reports with the patient's symptoms before and after manipulation is reported. A 38-yr-old female was treated for low back pain and right lower extremity first sacral dermatome sciatica. CT confirmed disk herniations at both the L4-L5 and L5-S1 levels were found. Motor weakness of the right gluteus maximus muscle was found and extremely tight hamstring muscles accompanying positive straight leg signs were elicited. A clinical and imaging diagnosis of an L5-S1 disk herniation was made. Distraction type chiropractic manipulation, electrical stimulation, exercises, nutrition advice and low back wellness class were administered with complete relief of sciatic pain and nearly complete relief of low back pain. Chiropractic distraction manipulation is an effective treatment of lumbar disk herniation, if the chiropractor is observant during its administration for patient tolerance to manipulation under distraction and any signs of neurological deficit demanding other types of care.

  17. Genome-wide analysis of SU(VAR)3-9 distribution in chromosomes of Drosophila melanogaster.

    Maksimov, Daniil A; Laktionov, Petr P; Posukh, Olga V; Belyakin, Stepan N; Koryakov, Dmitry E

    2018-03-01

    Histone modifications represent one of the key factors contributing to proper genome regulation. One of histone modifications involved in gene silencing is methylation of H3K9 residue. Present in the chromosomes across different eukaryotes, this epigenetic mark is controlled by SU(VAR)3-9 and its orthologs. Despite SU(VAR)3-9 was discovered over two decades ago, little is known about the details of its chromosomal distribution pattern. To fill in this gap, we used DamID-seq approach and obtained high-resolution genome-wide profiles for SU(VAR)3-9 in two somatic (salivary glands and brain ganglia) and two germline (ovarian nurse cells and testes) tissues of Drosophila melanogaster. Analysis of tissue and developmental expression of SU(VAR)3-9-bound genes indicates that in the somatic tissues tested, as well as in the ovarian nurse cells, SU(VAR)3-9 tends to associate with transcriptionally silent genes. In contrast, in the testes, SU(VAR)3-9 shows preferential association with testis-specific genes, and its binding appears dynamic during spermatogenesis. In somatic cells, the mere presence/absence of SU(VAR)3-9 binding correlates with lower/higher expression. No such correlation is found in the male germline. Interestingly, transcription units in piRNA clusters (particularly flanks thereof) are frequently targeted by SU(VAR)3-9, and Su(var)3-9 mutation affects the expression of select piRNA species. Our analyses suggest a context-dependent role of SU(VAR)3-9. In euchromatin, SU(VAR)3-9 may serve to fine-tune the expression of individual genes, whereas in heterochromatin, chromosome 4, and piRNA clusters, it may act more broadly over large chromatin domains.

  18. Hormetic efficacy of rutin to promote longevity in Drosophila melanogaster.

    Chattopadhyay, Debarati; Chitnis, Atith; Talekar, Aishwarya; Mulay, Prajakta; Makkar, Manyata; James, Joel; Thirumurugan, Kavitha

    2017-06-01

    Hormetins are compounds that mediate hormesis by being beneficial at low doses but detrimental at high doses. Recent studies have highlighted that many compounds that extended lifespan in model organisms did so by mediating hormesis. Rutin is a glycosylate conjugate of quercetin and rutinose and is abundant in citrus fruits and buckwheat seeds. Rutin possess ROS scavenging, anti-cancer, cardio-protective, skin-regenerative and neuro-protective properties. Drosophila melanogaster is an attractive model organism for longevity studies owing to its homology of organ and cellular-pathways with mammals. In this study, we aimed to understand the effect of rutin on extending longevity in Drosophila melanogaster. Male and female flies were administered with a range of rutin doses (100-800 µM) to analyse whether rutin mediated lifespan-extension by hormesis. Effect of rutin on physiological parameters like food intake, fecundity, climbing activity, development and resistance to various stresses was also studied. Lifespan assays showed that rutin at 200 and 400 µM significantly extended median lifespan in both male and female flies beyond which flies exhibited drastically reduced longevity. Increase in survival at 400 µM was associated with reduced food intake and fecundity. Flies exhibited improved climbing capability with both 200 and 400 µM rutin. Flies fed with 100 and 200 µM rutin exhibited enhanced survival upon exposure to oxidative stress with 400 µM rutin exhibiting no improvement in median lifespan following oxidative stress. Analysis of endogenous peroxide upon treatment with rutin (100-400 µM) with or without 5% H 2 O 2 showed elevated levels of endogenous peroxide with 400 µM rutin whereas no increase in hydrogen peroxide level was observed with rutin at 100 and 200 µM. Finally, gene expression studies in male flies revealed that rutin treatment at 200 and/or 400 µM elevated transcript levels of dFoxO, MnSod, Cat, dTsc1, dTsc2, Thor, dAtg1, d

  19. Evidence for 5S rDNA horizontal transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families.

    Merlo, Manuel A; Cross, Ismael; Palazón, José L; Ubeda-Manzanaro, María; Sarasquete, Carmen; Rebordinos, Laureana

    2012-10-07

    The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes and Clupeiformes orders. Two

  20. Evidence for 5S rDNA Horizontal Transfer in the toadfish Halobatrachus didactylus (Schneider, 1801 based on the analysis of three multigene families

    Merlo Manuel A

    2012-10-01

    Full Text Available Abstract Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH. Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not

  1. Comparative Analysis of Satellite DNA in the Drosophila melanogaster Species Complex

    Madhav Jagannathan

    2017-02-01

    Full Text Available Satellite DNAs are highly repetitive sequences that account for the majority of constitutive heterochromatin in many eukaryotic genomes. It is widely recognized that sequences and locations of satellite DNAs are highly divergent even in closely related species, contributing to the hypothesis that satellite DNA differences may underlie speciation. However, due to its repetitive nature, the mapping of satellite DNAs has been mostly left out of recent genomics analyses, hampering the use of molecular genetics techniques to better understand their role in speciation and evolution. Satellite DNAs are most extensively and comprehensively mapped in Drosophila melanogaster, a species that is also an excellent model system with which to study speciation. Yet the lack of comprehensive knowledge regarding satellite DNA identity and location in its sibling species (D. simulans, D. mauritiana, and D. sechellia has prevented the full utilization of D. melanogaster in studying speciation. To overcome this problem, we initiated the mapping of satellite DNAs on the genomes of the D. melanogaster species complex (D. melanogaster, D. simulans, D. mauritiana, and D. sechellia using multi-color fluorescent in situ hybridization (FISH probes. Our study confirms a striking divergence of satellite DNAs in the D. melanogaster species complex, even among the closely related species of the D. simulans clade (D. simulans, D. mauritiana, and D. sechellia, and suggests the presence of unidentified satellite sequences in these species.

  2. Identification and characterization of novel natural pathogen of Drosophila melanogaster isolated from wild captured Drosophila spp.

    Singh, Karan; Zulkifli, Mohammad; Prasad, N G

    2016-12-01

    Drosophila melanogaster is an emerging model system for the study of evolutionary ecology of immunity. However, a large number of studies have used non natural pathogens as very few natural pathogens have been isolated and identified. Our aim was to isolate and characterize natural pathogen/s of D. melanogaster. A bacterial pathogen was isolated from wild caught Drosophila spp., identified as a new strain of Staphylococcus succinus subsp. succinus and named PK-1. This strain induced substantial mortality (36-62%) in adults of several laboratory populations of D. melanogaster. PK-1 grew rapidly within the body of the flies post infection and both males and females had roughly same number of colony forming units. Mortality was affected by mode of infection and dosage of the pathogen. However mating status of the host had no effect on mortality post infection. Given that there are very few known natural bacterial pathogens of D. melanogaster and that PK-1 can establish a sustained infection across various outbred and inbred populations of D. melanogaster this new isolate is a potential resource for future studies on immunity. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  3. Parallel Evolution of Copy-Number Variation across Continents in Drosophila melanogaster

    Schrider, Daniel R.; Hahn, Matthew W.; Begun, David J.

    2016-01-01

    Genetic differentiation across populations that is maintained in the presence of gene flow is a hallmark of spatially varying selection. In Drosophila melanogaster, the latitudinal clines across the eastern coasts of Australia and North America appear to be examples of this type of selection, with recent studies showing that a substantial portion of the D. melanogaster genome exhibits allele frequency differentiation with respect to latitude on both continents. As of yet there has been no genome-wide examination of differentiated copy-number variants (CNVs) in these geographic regions, despite their potential importance for phenotypic variation in Drosophila and other taxa. Here, we present an analysis of geographic variation in CNVs in D. melanogaster. We also present the first genomic analysis of geographic variation for copy-number variation in the sister species, D. simulans, in order to investigate patterns of parallel evolution in these close relatives. In D. melanogaster we find hundreds of CNVs, many of which show parallel patterns of geographic variation on both continents, lending support to the idea that they are influenced by spatially varying selection. These findings support the idea that polymorphic CNVs contribute to local adaptation in D. melanogaster. In contrast, we find very few CNVs in D. simulans that are geographically differentiated in parallel on both continents, consistent with earlier work suggesting that clinal patterns are weaker in this species. PMID:26809315

  4. Comparative population genomics of latitudinal variation in Drosophila simulans and Drosophila melanogaster.

    Machado, Heather E; Bergland, Alan O; O'Brien, Katherine R; Behrman, Emily L; Schmidt, Paul S; Petrov, Dmitri A

    2016-02-01

    Examples of clinal variation in phenotypes and genotypes across latitudinal transects have served as important models for understanding how spatially varying selection and demographic forces shape variation within species. Here, we examine the selective and demographic contributions to latitudinal variation through the largest comparative genomic study to date of Drosophila simulans and Drosophila melanogaster, with genomic sequence data from 382 individual fruit flies, collected across a spatial transect of 19 degrees latitude and at multiple time points over 2 years. Consistent with phenotypic studies, we find less clinal variation in D. simulans than D. melanogaster, particularly for the autosomes. Moreover, we find that clinally varying loci in D. simulans are less stable over multiple years than comparable clines in D. melanogaster. D. simulans shows a significantly weaker pattern of isolation by distance than D. melanogaster and we find evidence for a stronger contribution of migration to D. simulans population genetic structure. While population bottlenecks and migration can plausibly explain the differences in stability of clinal variation between the two species, we also observe a significant enrichment of shared clinal genes, suggesting that the selective forces associated with climate are acting on the same genes and phenotypes in D. simulans and D. melanogaster. © 2015 John Wiley & Sons Ltd.

  5. FB elements can promote exon shuffling: a promoter-less white allele can be reactivated by FB mediated transposition in Drosophila melanogaster.

    Moschetti, R; Marsano, R M; Barsanti, P; Caggese, C; Caizzi, R

    2004-05-01

    Foldback ( FB) elements are transposable elements found in many eukaryotic genomes; they are thought to contribute significantly to genome plasticity. In Drosophila melanogaster, FBs have been shown to be involved in the transposition of large chromosomal regions and in the genetic instability of some alleles of the white gene. In this report we show that FB mediated transposition of w(67C23), a mutation that deletes the promoter of the white gene and its first exon, containing the start codon, can restore expression of the white gene. We have characterized three independent events in which a 14-kb fragment from the w(67C23) locus was transposed into an intron region in three different genes. In each case a local promoter drives the expression of white, producing a chimeric mRNA. These findings suggest that, on an evolutionary timescale, FB elements may contribute to the creation of new genes via exon shuffling.

  6. Isolation of protease-free alcohol dehydrogenase (ADH) from Drosophila simulans and several homozygous and heterozygous Drosophila melanogaster variants

    Smilda, T; Lamme, DA; Collu, G; Jekel, PA; Reinders, P; Beintema, JJ

    The enzyme alcohol dehydrogenase (ADH) from several naturally occurring ADH variants of Drosophila melanogaster and Drosophila simulans Lc,as isolated. Affinity chromatography with the ligand Cibacron Blue and elution with NAD(+) showed similar behavior for D. melanogaster ADH-FF, ADH-71k, and D.

  7. The Centrioles, Centrosomes, Basal Bodies, and Cilia of Drosophila melanogaster.

    Lattao, Ramona; Kovács, Levente; Glover, David M

    2017-05-01

    Centrioles play a key role in the development of the fly. They are needed for the correct formation of centrosomes, the organelles at the poles of the spindle that can persist as microtubule organizing centers (MTOCs) into interphase. The ability to nucleate cytoplasmic microtubules (MTs) is a property of the surrounding pericentriolar material (PCM). The centriole has a dual life, existing not only as the core of the centrosome but also as the basal body, the structure that templates the formation of cilia and flagellae. Thus the structure and functions of the centriole, the centrosome, and the basal body have an impact upon many aspects of development and physiology that can readily be modeled in Drosophila Centrosomes are essential to give organization to the rapidly increasing numbers of nuclei in the syncytial embryo and for the spatially precise execution of cell division in numerous tissues, particularly during male meiosis. Although mitotic cell cycles can take place in the absence of centrosomes, this is an error-prone process that opens up the fly to developmental defects and the potential of tumor formation. Here, we review the structure and functions of the centriole, the centrosome, and the basal body in different tissues and cultured cells of Drosophila melanogaster , highlighting their contributions to different aspects of development and cell division. Copyright © 2017 Lattao et al.

  8. Resources for Functional Genomics Studies in Drosophila melanogaster

    Mohr, Stephanie E.; Hu, Yanhui; Kim, Kevin; Housden, Benjamin E.; Perrimon, Norbert

    2014-01-01

    Drosophila melanogaster has become a system of choice for functional genomic studies. Many resources, including online databases and software tools, are now available to support design or identification of relevant fly stocks and reagents or analysis and mining of existing functional genomic, transcriptomic, proteomic, etc. datasets. These include large community collections of fly stocks and plasmid clones, “meta” information sites like FlyBase and FlyMine, and an increasing number of more specialized reagents, databases, and online tools. Here, we introduce key resources useful to plan large-scale functional genomics studies in Drosophila and to analyze, integrate, and mine the results of those studies in ways that facilitate identification of highest-confidence results and generation of new hypotheses. We also discuss ways in which existing resources can be used and might be improved and suggest a few areas of future development that would further support large- and small-scale studies in Drosophila and facilitate use of Drosophila information by the research community more generally. PMID:24653003

  9. Assessing sexual conflict in the Drosophila melanogaster laboratory model system

    Rice, William R; Stewart, Andrew D; Morrow, Edward H; Linder, Jodell E; Orteiza, Nicole; Byrne, Phillip G

    2006-01-01

    We describe a graphical model of interlocus coevolution used to distinguish between the interlocus sexual conflict that leads to sexually antagonistic coevolution, and the intrinsic conflict over mating rate that is an integral part of traditional models of sexual selection. We next distinguish the ‘laboratory island’ approach from the study of both inbred lines and laboratory populations that are newly derived from nature, discuss why we consider it to be one of the most fitting forms of laboratory analysis to study interlocus sexual conflict, and then describe four experiments using this approach with Drosophila melanogaster. The first experiment evaluates the efficacy of the laboratory model system to study interlocus sexual conflict by comparing remating rates of females when they are, or are not, provided with a spatial refuge from persistent male courtship. The second experiment tests for a lag-load in males that is due to adaptations that have accumulated in females, which diminish male-induced harm while simultaneously interfering with a male's ability to compete in the context of sexual selection. The third and fourth experiments test for a lag-load in females owing to direct costs from their interactions with males, and for the capacity for indirect benefits to compensate for these direct costs. PMID:16612888

  10. Rhythmic changes in synapse numbers in Drosophila melanogaster motor terminals.

    Santiago Ruiz

    Full Text Available Previous studies have shown that the morphology of the neuromuscular junction of the flight motor neuron MN5 in Drosophila melanogaster undergoes daily rhythmical changes, with smaller synaptic boutons during the night, when the fly is resting, than during the day, when the fly is active. With electron microscopy and laser confocal microscopy, we searched for a rhythmic change in synapse numbers in this neuron, both under light:darkness (LD cycles and constant darkness (DD. We expected the number of synapses to increase during the morning, when the fly has an intense phase of locomotion activity under LD and DD. Surprisingly, only our DD data were consistent with this hypothesis. In LD, we found more synapses at midnight than at midday. We propose that under LD conditions, there is a daily rhythm of formation of new synapses in the dark phase, when the fly is resting, and disassembly over the light phase, when the fly is active. Several parameters appeared to be light dependent, since they were affected differently under LD or DD. The great majority of boutons containing synapses had only one and very few had either two or more, with a 70∶25∶5 ratio (one, two and three or more synapses in LD and 75∶20∶5 in DD. Given the maintenance of this proportion even when both bouton and synapse numbers changed with time, we suggest that there is a homeostatic mechanism regulating synapse distribution among MN5 boutons.

  11. Evolutionary consequences of altered atmospheric oxygen in Drosophila melanogaster.

    Marc Charette

    Full Text Available Twelve replicate populations of Drosophila melanogaster, all derived from a common ancestor, were independently evolved for 34+ generations in one of three treatment environments of varying PO(2: hypoxia (5.0-10.1 kPa, normoxia (21.3 kPa, and hyperoxia (40.5 kPa. Several traits related to whole animal performance and metabolism were assayed at various stages via "common garden" and reciprocal transplant assays to directly compare evolved and acclimatory differences among treatments. Results clearly demonstrate the evolution of a greater tolerance to acute hypoxia in the hypoxia-evolved populations, consistent with adaptation to this environment. Greater hypoxia tolerance was associated with an increase in citrate synthase activity in fly homogenate when compared to normoxic (control populations, suggesting an increase in mitochondrial volume density in these populations. In contrast, no direct evidence of increased performance of the hyperoxia-evolved populations was detected, although a significant decrease in the tolerance of these populations to acute hypoxia suggests a cost to adaptation to hyperoxia. Hyperoxia-evolved populations had lower productivity overall (i.e., across treatment environments and there was no evidence that hypoxia or hyperoxia-evolved populations had greatest productivity or longevity in their respective treatment environments, suggesting that these assays failed to capture the components of fitness relevant to adaptation.

  12. Genetic analysis of the claret locus of Drosophila melanogaster

    Sequeira, W.; Nelson, C.R.; Szauter, P.

    1989-01-01

    The claret (ca) locus of Drosophila melanogaster comprises two separately mutable domains, one responsible for eye color and one responsible for proper disjunction of chromosomes in meiosis and early cleavage divisions. Previously isolated alleles are of three types: (1) alleles of the claret (ca) type that affect eye color only, (2) alleles of the claret-nondisjunctional (ca nd ) type that affect eye color and chromosome behavior, and (3) a meiotic mutation, non-claret disjunctional (ncd), that affects chromosome behavior only. In order to investigate the genetic structure of the claret locus, the authors have isolated 19 radiation-induced alleles of claret on the basis of the eye color phenotype. Two of these 19 new alleles are of the ca nd type, while 17 are of the ca type, demonstrating that the two domains do not often act as a single target for mutagenesis. This suggests that the two separately mutable functions are likely to be encoded by separate or overlapping genes rather than by a single gene. One of the new alleles of the ca nd type is a chromosome rearrangement with a breakpoint at the position of the claret locus. If this breakpoint is the cause of the mutant phenotype and there are no other mutations associated with the rearrangement, the two functions must be encoded by overlapping genes

  13. Automated identification of social interaction criteria in Drosophila melanogaster.

    Schneider, J; Levine, J D

    2014-10-01

    The study of social behaviour within groups has relied on fixed definitions of an 'interaction'. Criteria used in these definitions often involve a subjectively defined cut-off value for proximity, orientation and time (e.g. courtship, aggression and social interaction networks) and the same numerical values for these criteria are applied to all of the treatment groups within an experiment. One universal definition of an interaction could misidentify interactions within groups that differ in life histories, study treatments and/or genetic mutations. Here, we present an automated method for determining the values of interaction criteria using a pre-defined rule set rather than pre-defined values. We use this approach and show changing social behaviours in different manipulations of Drosophila melanogaster. We also show that chemosensory cues are an important modality of social spacing and interaction. This method will allow a more robust analysis of the properties of interacting groups, while helping us understand how specific groups regulate their social interaction space. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  14. Dopamine modulates metabolic rate and temperature sensitivity in Drosophila melanogaster.

    Taro Ueno

    Full Text Available Homeothermal animals, such as mammals, maintain their body temperature by heat generation and heat dissipation, while poikilothermal animals, such as insects, accomplish it by relocating to an environment of their favored temperature. Catecholamines are known to regulate thermogenesis and metabolic rate in mammals, but their roles in other animals are poorly understood. The fruit fly, Drosophila melanogaster, has been used as a model system for the genetic studies of temperature preference behavior. Here, we demonstrate that metabolic rate and temperature sensitivity of some temperature sensitive behaviors are regulated by dopamine in Drosophila. Temperature-sensitive molecules like dTrpA1 and shi(ts induce temperature-dependent behavioral changes, and the temperature at which the changes are induced were lowered in the dopamine transporter-defective mutant, fumin. The mutant also displays a preference for lower temperatures. This thermophobic phenotype was rescued by the genetic recovery of the dopamine transporter in dopamine neurons. Flies fed with a dopamine biosynthesis inhibitor (3-iodo-L-tyrosine, which diminishes dopamine signaling, exhibited preference for a higher temperature. Furthermore, we found that the metabolic rate is up-regulated in the fumin mutant. Taken together, dopamine has functions in the temperature sensitivity of behavioral changes and metabolic rate regulation in Drosophila, as well as its previously reported functions in arousal/sleep regulation.

  15. Radiation and transposon-induced genetic damage in Drosophila melanogaster

    Balter, H.; Griffith, C.S.; American Museum of Natural History, New York; Margulies, L.

    1992-01-01

    The interaction of X-ray-induced and transposon-induced damage was investigated in P-M hybrid dysgenesis in Drosophila melanogaster. X-ray dose-response of 330-1320 rad was monitored for sterility, fecundicity and partial X/Y chromosome loss among F 2 progeny derived from dysgenic cross of M strain females xP strain males (cross A) and its reciprocal (cross B), using a weaker and the standard Harwich P strain subline. The synergistic effect of P element activity and X-rays on sterility was observed only in cross A hybrids and the dose-response was nonlinear in hybrids derived from the strong standard reference Harwich subline, H W . This finding suggests that lesions induced by both mutator systems which produce the synergistic effects are 2-break events. Effect of increasing dose on the decline of fecundicity was synergistic, but linear, in hybrids of either subline. There was no interaction evident and thus no synergism in X/Y nondisjunction and partial Y chromosome loss measured by the loss of the B s marker alone or together with the y + marker. Interaction was detected in the loss of the y + marker alone from the X and Y chromosomes. The possible three-way interaction of X-rays (660 rad), post-replication repair deficiency and P elements mobility was assessed by measuring transmission distortion in dysgenic males derived from the Π 2 P strain. (author). 38 refs.; 5 tabs

  16. The cuticular nature of corneal lenses in Drosophila melanogaster.

    Stahl, Aaron L; Charlton-Perkins, Mark; Buschbeck, Elke K; Cook, Tiffany A

    2017-07-01

    The dioptric visual system relies on precisely focusing lenses that project light onto a neural retina. While the proteins that constitute the lenses of many vertebrates are relatively well characterized, less is known about the proteins that constitute invertebrate lenses, especially the lens facets in insect compound eyes. To address this question, we used mass spectrophotometry to define the major proteins that comprise the corneal lenses from the adult Drosophila melanogaster compound eye. This led to the identification of four cuticular proteins: two previously identified lens proteins, drosocrystallin and retinin, and two newly identified proteins, Cpr66D and Cpr72Ec. To determine which ommatidial cells contribute each of these proteins to the lens, we conducted in situ hybridization at 50% pupal development, a key age for lens secretion. Our results confirm previous reports that drosocrystallin and retinin are expressed in the two primary corneagenous cells-cone cells and primary pigment cells. Cpr72Ec and Cpr66D, on the other hand, are more highly expressed in higher order interommatidial pigment cells. These data suggest that the complementary expression of cuticular proteins give rise to the center vs periphery of the corneal lens facet, possibly facilitating a refractive gradient that is known to reduce spherical aberration. Moreover, these studies provide a framework for future studies aimed at understanding the cuticular basis of corneal lens function in holometabolous insect eyes.

  17. Experimental evolution of olfactory memory in Drosophila melanogaster.

    Mery, Frederic; Pont, Juliette; Preat, Thomas; Kawecki, Tadeusz J

    2007-01-01

    In order to address the nature of genetic variation in learning performance, we investigated the response to classical olfactory conditioning in "high-learning" Drosophila melanogaster lines previously subject to selection for the ability to learn an association between the flavor of an oviposition medium and bitter taste. In a T-maze choice test, the seven high-learning lines were better at avoiding an odor previously associated with aversive mechanical shock than were five unselected "low-learning" lines originating from the same natural population. Thus, the evolved improvement in learning ability of high-learning lines generalized to another aversion learning task involving a different aversive stimulus (shock instead of bitter taste) and a different behavioral context than that used to impose selection. In this olfactory shock task, the high-learning lines showed improvements in the learning rate as well as in two forms of consolidated memory: anesthesia-resistant memory and long-term memory. Thus, genetic variation underlying the experimental evolution of learning performance in the high-learning lines affected several phases of memory formation in the course of olfactory aversive learning. However, the two forms of consolidated memory were negatively correlated among replicate high-learning lines, which is consistent with a recent hypothesis that these two forms of consolidated memory are antagonistic.

  18. 5S-MENETELMÄN KÄYTTÖÖNOTTO: LUVATA PORI OY

    Rantanen, Suvi

    2015-01-01

    Opinnäytetyön aiheena oli 5S-menetelmän käyttöönotto Luvata Pori Oy:n tuotannos-sa. Tutkimuksen lähtökohtana ja ongelmana oli siisteyden ja järjestyksen puute. Ta-voitteena oli aikaansaada valittuun pilottikohteeseen toimivat, siistit ja turvalliset tuotantotilat sekä luoda järjestelmä, jonka avulla ylläpidetään saavutettu taso. Lisäksi tavoiteltiin hukan poistamista ja Luvatan Lean toimintatavan syventämistä. Projekti toteutettiin toimintatutkimuksena syksyn 2015 aikana. Tutkimuksen teor...

  19. Discrimination of Shark species by simple PCR of 5S rDNA repeats

    Pinhal, Danillo [UNESP; Gadig, Otto Bismarck Fazzano [UNESP; Wasko, Adriane Pinto [UNESP; Oliveira, Claudio [UNESP; Ron, Ernesto; Foresti, Fausto [UNESP; Martins, Cesar [UNESP

    2008-01-01

    Sharks are suffering from intensive exploitation by worldwide fisheries leading to a severe decline in several populations in the last decades. The lack of biological data on a species-specific basis, associated with a k-strategist life history make it difficult to correctly manage and conserve these animals. The aim of the present study was to develop a DNA-based procedure to discriminate shark species by means of a rapid, low cost and easily applicable PCR analysis based on 5S rDNA repeat u...

  20. LNA-modified oligonucleotides mediate specific inhibition of microRNA function

    Ørom, Ulf Andersson; Kauppinen, Sakari; Lund, Anders H

    2006-01-01

    microRNAs are short, endogenous non-coding RNAs that act as post-transcriptional modulators of gene expression. Important functions for microRNAs have been found in the regulation of development, cellular proliferation and differentiation, while perturbed miRNA expression patterns have been...... observed in many human cancers. Here we present a method for specific inhibition of miRNA function through interaction with LNA-modified antisense oligonucleotides and report the specificity of this application. We show that LNA-modified oligonucleotides can inhibit exogenously introduced miRNAs with high...... specificity using a heterologous reporter assay, and furthermore demonstrate their ability to inhibit an endogenous miRNA in Drosophila melanogaster cells, leading to up-regulation of the cognate target protein. The method shows stoichiometric and reliable inhibition of the targeted miRNA and can thus...

  1. The Fruit Fly Drosophila melanogaster as a Model for Aging Research.

    Brandt, Annely; Vilcinskas, Andreas

    2013-01-01

    : Average human life expectancy is increasing and so is the impact on society of aging and age-related diseases. Here we highlight recent advances in the diverse and multidisciplinary field of aging research, focusing on the fruit fly Drosophila melanogaster, an excellent model system in which to dissect the genetic and molecular basis of the aging processes. The conservation of human disease genes in D. melanogaster allows the functional analysis of orthologues implicated in human aging and age-related diseases. D. melanogaster models have been developed for a variety of age-related processes and disorders, including stem cell decline, Alzheimer's disease, and cardiovascular deterioration. Understanding the detailed molecular events involved in normal aging and age-related diseases could facilitate the development of strategies and treatments that reduce their impact, thus improving human health and increasing longevity.

  2. Acetylcholine receptors and cholinergic ligands: biochemical and genetic aspects in Torpedo californica and Drosophila melanogaster

    Rosenthal, L.S.

    1987-01-01

    This study evaluates the biochemical and genetic aspects of the acetylcholine receptor proteins and cholinergic ligands in Drosophila melanogaster and Torpedo californica. Included are (1) a comparative study of nicotinic ligand-induced cation release from acetylcholine receptors isolated from Torpedo californica and from Drosophila melanogaster, (2) solution studies of the cholinergic ligands, nikethamide and ethamivan, aimed at measuring internal molecular rotational barriers in solvents of different polarity; and (3) the isolation and characterization of the gene(s) for the acetylcholine receptor in Drosophila melasogaster. Acetylcholine receptor proteins isolated from Drosphila melanogaster heads were found to behave kinetically similar (with regards to cholinergic ligand-induced 155 Eu: 3+ displacement from prelabeled proteins) to receptor proteins isolated from Torpedo californica electric tissue, providing additional biochemical evidence for the existence of a Drosophila acetylcholine receptor

  3. Light wavelength dependency of mating activity in the drosophila melanogaster species subgroup

    Sakai, Takaomi; Tomaru, Masatoshi; Oguma, Yuzuru; Isono, Kunio; Fukatami, Akishi

    2002-01-01

    The action spectra of mating activity among the six species of the Drosophila melanogaster species subgroup were compared to understand how light wavelength affects mating activity. The species fell into three groups with respect to the action spectrum of mating activity. We chose one representative species from each of the three types for detailed study: D. melanogaster, D. sechellia and D. yakuba. The mating activities were investigated under three different light intensities of three monochromatic lights stimulus. Each species showed a unique spectral and intensity response. To know the evolutionary meaning of the light wavelength dependency of mating activity, we superimposed the type of action spectrum of mating activity in these six species on a cladogram. Mating inhibition under UV was conserved in evolution among these species. Furthermore we clarified that D. melanogaster showed low mating activity under UV because males courted less under UV. (author)

  4. Genetic architecture of natural variation in cuticular hydrocarbon composition in Drosophila melanogaster.

    Dembeck, Lauren M; Böröczky, Katalin; Huang, Wen; Schal, Coby; Anholt, Robert R H; Mackay, Trudy F C

    2015-11-14

    Insect cuticular hydrocarbons (CHCs) prevent desiccation and serve as chemical signals that mediate social interactions. Drosophila melanogaster CHCs have been studied extensively, but the genetic basis for individual variation in CHC composition is largely unknown. We quantified variation in CHC profiles in the D. melanogaster Genetic Reference Panel (DGRP) and identified novel CHCs. We used principal component (PC) analysis to extract PCs that explain the majority of CHC variation and identified polymorphisms in or near 305 and 173 genes in females and males, respectively, associated with variation in these PCs. In addition, 17 DGRP lines contain the functional Desat2 allele characteristic of African and Caribbean D. melanogaster females (more 5,9-C27:2 and less 7,11-C27:2, female sex pheromone isomers). Disruption of expression of 24 candidate genes affected CHC composition in at least one sex. These genes are associated with fatty acid metabolism and represent mechanistic targets for individual variation in CHC composition.

  5. Facilitating RNA structure prediction with microarrays.

    Kierzek, Elzbieta; Kierzek, Ryszard; Turner, Douglas H; Catrina, Irina E

    2006-01-17

    Determining RNA secondary structure is important for understanding structure-function relationships and identifying potential drug targets. This paper reports the use of microarrays with heptamer 2'-O-methyl oligoribonucleotides to probe the secondary structure of an RNA and thereby improve the prediction of that secondary structure. When experimental constraints from hybridization results are added to a free-energy minimization algorithm, the prediction of the secondary structure of Escherichia coli 5S rRNA improves from 27 to 92% of the known canonical base pairs. Optimization of buffer conditions for hybridization and application of 2'-O-methyl-2-thiouridine to enhance binding and improve discrimination between AU and GU pairs are also described. The results suggest that probing RNA with oligonucleotide microarrays can facilitate determination of secondary structure.

  6. Intelligent Diagnostic Assistant for Complicated Skin Diseases through C5's Algorithm.

    Jeddi, Fatemeh Rangraz; Arabfard, Masoud; Kermany, Zahra Arab

    2017-09-01

    Intelligent Diagnostic Assistant can be used for complicated diagnosis of skin diseases, which are among the most common causes of disability. The aim of this study was to design and implement a computerized intelligent diagnostic assistant for complicated skin diseases through C5's Algorithm. An applied-developmental study was done in 2015. Knowledge base was developed based on interviews with dermatologists through questionnaires and checklists. Knowledge representation was obtained from the train data in the database using Excel Microsoft Office. Clementine Software and C5's Algorithms were applied to draw the decision tree. Analysis of test accuracy was performed based on rules extracted using inference chains. The rules extracted from the decision tree were entered into the CLIPS programming environment and the intelligent diagnostic assistant was designed then. The rules were defined using forward chaining inference technique and were entered into Clips programming environment as RULE. The accuracy and error rates obtained in the training phase from the decision tree were 99.56% and 0.44%, respectively. The accuracy of the decision tree was 98% and the error was 2% in the test phase. Intelligent diagnostic assistant can be used as a reliable system with high accuracy, sensitivity, specificity, and agreement.

  7. Spondylolysis and End Plate Arthrosis at L5-S1: A Cadaveric Study.

    McCunniff, Peter T; Yoo, Hojun; Yu, Charles; Bajwa, Navkirat S; Toy, Jason O; Ahn, Uri M; Ahn, Nicholas

    2017-01-01

    This study examined the effect of bilateral and unilateral L5 pars defects on the degree of disk degeneration at the L5-S1 level in cadaveric specimens. An observational study was performed of 690 cadaveric specimens selected at random. These specimens represent individuals who died between 1893 and 1938. The study included 558 male and 132 female cadavers. Of the 120 specimens with L5 spondylolysis, 95 cases were bilateral and 25 were unilateral. The remaining 544 specimens were used as the control cohort. Degenerative disk disease was measured by the classification of Eubanks et al. According to this classification, degenerative disk disease was graded from no arthrosis (grade 0) to complete ankylosis (grade IV). Linear regression analysis corrected for age, sex, and race showed that subjects with bilateral spondylolysis at L5 had a statistically significant increase in the amount of disk degeneration (P=.02) compared with those with unilateral lesions. Student's t tests showed significant differences (Pspondylolysis above what would be predicted in the normal control population. A positive correlation was found between the number of pars defects at L5 and the degree of disk degeneration at L5-S1. These results support the idea that individuals with spondylolysis at these levels may be at increased risk for development of low back pain and reduced quality of life. [Orthopedics. 2017; 40(1):e59-e64.]. Copyright 2016, SLACK Incorporated.

  8. Extrachromosomal circles of satellite repeats and 5S ribosomal DNA in human cells

    Cohen Sarit

    2010-03-01

    Full Text Available Abstract Background Extrachomosomal circular DNA (eccDNA is ubiquitous in eukaryotic organisms and was detected in every organism tested, including in humans. A two-dimensional gel electrophoresis facilitates the detection of eccDNA in preparations of genomic DNA. Using this technique we have previously demonstrated that most of eccDNA consists of exact multiples of chromosomal tandemly repeated DNA, including both coding genes and satellite DNA. Results Here we report the occurrence of eccDNA in every tested human cell line. It has heterogeneous mass ranging from less than 2 kb to over 20 kb. We describe eccDNA homologous to human alpha satellite and the SstI mega satellite. Moreover, we show, for the first time, circular multimers of the human 5S ribosomal DNA (rDNA, similar to previous findings in Drosophila and plants. We further demonstrate structures that correspond to intermediates of rolling circle replication, which emerge from the circular multimers of 5S rDNA and SstI satellite. Conclusions These findings, and previous reports, support the general notion that every chromosomal tandem repeat is prone to generate eccDNA in eukryoric organisms including humans. They suggest the possible involvement of eccDNA in the length variability observed in arrays of tandem repeats. The implications of eccDNA on genome biology may include mechanisms of centromere evolution, concerted evolution and homogenization of tandem repeats and genomic plasticity.

  9. Spectral analysis of 5s25p2(6p+6d+7s) configurations of Ba VI

    Sharma, M.K.; Tauheed, A.; Rahimullah, K.

    2014-01-01

    The sixth spectrum of barium (Ba VI) has been investigated with the aid of experimental recordings made on a 3-m normal incidence vacuum spectrograph of Antigonish laboratory (Canada) in the wavelength region 300–2080 Å using triggered spark as an excitation source. The spectral analysis has been extended considerably to include new configuration the 5s 2 5p 2 6p in odd parity matrix and the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations in even parity matrix. Previously reported levels of the ground configuration (5s 2 5p 3 ) and three lowest excited configurations the 5s5p 4 , 5s 2 5p 2 5d and 5s 2 5p 2 6s have been confirmed and the two unknown levels of the 5s 2 5p 2 5d configuration with J=9/2, have now been established through the identification of transitions from the 5s 2 5p 2 6p levels. All twenty one levels of the 5s 2 5p 2 6p configuration and twenty nine levels out of thirty six of the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations have now been established. Hartree–Fock calculations involving configuration interactions support the analyses. The accuracy of our wavelength measurement is ±0.005 Å for sharp lines. - Highlights: • The spectrum of Ba was recorded on a 3-m spectrograph with triggered spark source. • Atomic transitions for Ba VI were identified to established new energy levels. • CI calculations with relativistic corrections were made for theoretical predictions. • Weighted oscillator strength (gf) and transition probabilities (gA) were calculated

  10. Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

    Thibaut Josse

    2007-09-01

    Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

  11. A genome-wide gene function prediction resource for Drosophila melanogaster.

    Han Yan

    2010-08-01

    Full Text Available Predicting gene functions by integrating large-scale biological data remains a challenge for systems biology. Here we present a resource for Drosophila melanogaster gene function predictions. We trained function-specific classifiers to optimize the influence of different biological datasets for each functional category. Our model predicted GO terms and KEGG pathway memberships for Drosophila melanogaster genes with high accuracy, as affirmed by cross-validation, supporting literature evidence, and large-scale RNAi screens. The resulting resource of prioritized associations between Drosophila genes and their potential functions offers a guide for experimental investigations.

  12. Hyperfine structure in 5s4d [sup 3]D-5snf transitions of [sup 87]Sr

    Bushaw, B.A. (Pacific Northwest Lab., Richland, WA (United States)); Kluge, H.J. (Mainz Univ. (Germany). Inst. fuer Physik); Lantzsch, J. (Mainz Univ. (Germany). Inst. fuer Physik); Schwalbach, R. (Mainz Univ. (Germany). Inst. fuer Physik); Stenner, J. (Mainz Univ. (Germany). Inst. fuer Physik); Stevens, H. (Mainz Univ. (Germany). Inst. fuer Physik); Wendt, K. (Mainz Univ. (Germany). Inst. fuer Physik); Zimmer, K. (Mainz Univ. (Germany). Inst. fuer Physik)

    1993-12-01

    The hyperfine spectra of the 5s4d[sup 3]D[sub 1]-5s20f, 5s4d[sup 3]D[sub 2]-5s23f, and 5s4d[sup 3]D[sub 3]-5s32f transitions of [sup 87]Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a[sub 5s] and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d[sup 3]D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)

  13. Uncovering the molecular organization of unusual highly scattered 5S rDNA: The case of Chariesterus armatus (Heteroptera).

    Bardella, Vanessa Bellini; Cabral-de-Mello, Diogo Cavalcanti

    2018-03-10

    One cluster of 5S rDNA per haploid genome is the most common pattern among Heteroptera. However, in Chariesterus armatus, highly scattered signals were noticed. We isolated and characterized the entire 5S rDNA unit of C. armatus aiming to a deeper knowledge of molecular organization of the 5S rDNA among Heteroptera and to understand possible causes and consequences of 5S rDNA chromosomal spreading. For a comparative analysis, we performed the same approach in Holymenia histrio with 5S rDNA restricted to one bivalent. Multiple 5S rDNA variants were observed in both species, though they were more variable in C. armatus, with some of variants corresponding to pseudogenes. These pseudogenes suggest birth-and-death mechanism, though homogenization was also observed (concerted evolution), indicating evolution through mixed model. Association between transposable elements and 5S rDNA was not observed, suggesting spreading of 5S rDNA through other mechanisms, like ectopic recombination. Scattered organization is a rare example for 5S rDNA, and such organization in C. armatus genome could have led to the high diversification of sequences favoring their pseudogenization. Copyright © 2017. Published by Elsevier B.V.

  14. Question of the total gene number in Drosophila melanogaster

    Lefevre, G.; Watkins, W.

    1986-01-01

    A statistical analysis has been carried out on the distribution and allelism of nearly 500 sex-linked, X-ray-induced, cytologically normal and rearranged lethal mutations in Drosophila melanogaster that were obtained by G. Lefevre. The mutations were induced in four different regions of the X chromosome: (1) 1A1-3E8, (2) 6D1-8A5, (3) 9E1-11A7 and (4) 19A1-20F4, which together comprise more than one-third of the entire chromosome.--The analysis shows that the number of alleles found at different loci does not fit a Poisson distribution, even when the proper procedures are taken to accommodate the truncated nature of the data. However, the allele distribution fits a truncated negative binomial distribution quite well, with cytologically normal mutations fitting better than rearrangement mutations. This indicates that genes are not equimutable, as required for the data to fit a Poisson distribution.--Using the negative binomial parameters to estimate the number of genes that did not produce a detectable lethal mutation in our experiment (n0) gave a larger number than that derived from the use of the Poisson parameter. Unfortunately, we cannot estimate the total numbers of nonvital loci, loci with undetectable phenotypes and loci having extremely low mutabilities. In any event, our estimate of the total vital gene number was far short of the total number of bands in the analyzed regions; yet, in several short intervals, we have found more vital genes than bands; in other intervals, fewer. We conclude that the one-band, one-gene hypothesis, in its literal sense, is not true; furthermore, it is difficult to support, even approximately.--The question of the total gene number in Drosophila will, not doubt, eventually be solved by molecular analyses, not by statistical analysis of mutation data or saturation studies

  15. Female Meiosis: Synapsis, Recombination, and Segregation in Drosophila melanogaster

    Hughes, Stacie E.; Miller, Danny E.; Miller, Angela L.; Hawley, R. Scott

    2018-01-01

    A century of genetic studies of the meiotic process in Drosophila melanogaster females has been greatly augmented by both modern molecular biology and major advances in cytology. These approaches, and the findings they have allowed, are the subject of this review. Specifically, these efforts have revealed that meiotic pairing in Drosophila females is not an extension of somatic pairing, but rather occurs by a poorly understood process during premeiotic mitoses. This process of meiotic pairing requires the function of several components of the synaptonemal complex (SC). When fully assembled, the SC also plays a critical role in maintaining homolog synapsis and in facilitating the maturation of double-strand breaks (DSBs) into mature crossover (CO) events. Considerable progress has been made in elucidating not only the structure, function, and assembly of the SC, but also the proteins that facilitate the formation and repair of DSBs into both COs and noncrossovers (NCOs). The events that control the decision to mature a DSB as either a CO or an NCO, as well as determining which of the two CO pathways (class I or class II) might be employed, are also being characterized by genetic and genomic approaches. These advances allow a reconsideration of meiotic phenomena such as interference and the centromere effect, which were previously described only by genetic studies. In delineating the mechanisms by which the oocyte controls the number and position of COs, it becomes possible to understand the role of CO position in ensuring the proper orientation of homologs on the first meiotic spindle. Studies of bivalent orientation have occurred in the context of numerous investigations into the assembly, structure, and function of the first meiotic spindle. Additionally, studies have examined the mechanisms ensuring the segregation of chromosomes that have failed to undergo crossing over. PMID:29487146

  16. Courtship initiation is stimulated by acoustic signals in Drosophila melanogaster.

    Aki Ejima

    2008-09-01

    Full Text Available Finding a mating partner is a critical task for many organisms. It is in the interest of males to employ multiple sensory modalities to search for females. In Drosophila melanogaster, vision is thought to be the most important courtship stimulating cue at long distance, while chemosensory cues are used at relatively short distance. In this report, we show that when visual cues are not available, sounds produced by the female allow the male to detect her presence in a large arena. When the target female was artificially immobilized, the male spent a prolonged time searching before starting courtship. This delay in courtship initiation was completely rescued by playing either white noise or recorded fly movement sounds to the male, indicating that the acoustic and/or seismic stimulus produced by movement stimulates courtship initiation, most likely by increasing the general arousal state of the male. Mutant males expressing tetanus toxin (TNT under the control of Gr68a-GAL4 had a defect in finding active females and a delay in courtship initiation in a large arena, but not in a small arena. Gr68a-GAL4 was found to be expressed pleiotropically not only in putative gustatory pheromone receptor neurons but also in mechanosensory neurons, suggesting that Gr68a-positive mechanosensory neurons, not gustatory neurons, provide motion detection necessary for courtship initiation. TNT/Gr68a males were capable of discriminating the copulation status and age of target females in courtship conditioning, indicating that female discrimination and formation of olfactory courtship memory are independent of the Gr68a-expressing neurons that subserve gustation and mechanosensation. This study suggests for the first time that mechanical signals generated by a female fly have a prominent effect on males' courtship in the dark and leads the way to studying how multimodal sensory information and arousal are integrated in behavioral decision making.

  17. Pomegranate juice enhances healthy lifespan in Drosophila melanogaster

    Padmavathy eVenkatasubramanian

    2014-12-01

    Full Text Available Exploring innovative ways to ensure healthy ageing of populations is a pre-requisite to contain rising healthcare costs. Scientific research into the principles and practices of traditional medicines can provide new insights and simple solutions to lead a healthy life. Rasayana is a dedicated branch of Ayurveda (an Indian medicine that deals with methods to increase vitality and delay aging through the use of diet, herbal supplements and other lifestyle practices. The life-span and health-span enhancing actions of the fruits of Pomegranate (Punica granatum L., a well-known Rasayana, were tested on Drosophila melanogaster (fruitfly model. Supplementation of standard corn meal with 10% (v/v pomegranate juice (PJ extended the life-span of male and female flies by 18% and 8% respectively. When male and female flies were mixed and reared together, there was 19% increase in the longevity of PJ fed flies, as assessed by MSD, the median survival day (24.8. MSD for control and resveratrol (RV groups was at 20.8 and 23.1 days respectively. A two-fold enhancement in fecundity, improved resistance to oxidative stress (H2O2 and paraquat induced and to Candida albicans infection were observed in PJ fed flies. Further, the flies in the PJ fed group were physically active over an extended period of time, as assessed by the climbing assay. PJ thus outperformed both control and RV groups in the life-span and health-span parameters tested. This study provides the scope to explore the potential of PJ as a nutraceutical to improve health span and lifespan in humans.

  18. Adaptive response in Drosophila melanogaster heat shock proteins mutant strains

    Shaposhnikov, M.V.; Moskalev, A.A.; Turysheva, E.V.

    2007-01-01

    Complete text of publication follows. The members of the heat shock proteins (Hsp) family function as molecular chaperones and assist intracellular folding of newly synthesized proteins. Also it is possible that molecular chaperones are induced during adaptive response to oxidative stress and radiation. The aim of our research was to exam the role of heat shock proteins in adaptive response to oxidative stress after low dose rate gamma-irradiation in Drosophila melanogaster. Drosophilamelanogaster strains were kindly provided by Bloomington Drosophila Stock Center (University of state of Indiana, Bloomington, USA). We used wild type strain (CS), heat shock protein mutant strains (Hsp22, Hsp70, Hsp83), and heat shock factor mutant strain (Hsf). Strains were chronically exposured to adaptive dose of gamma-irradiation in dose rate of 0.17 cGy/h during all stages of life history (from the embrional stage to the stage of matured imago). The rate of absorbed dose was 60 cGy. For oxidative-stress challenge twodays old flies were starved in empty vials for 6 h and then transferred to vials containing only filter paper soaked with 20 mM paraquat in 5% sucrose solution. Survival data were collected after 26 h of treatment. Dead flies were counted daily. The obtained data were subjected to survival analysis by Kaplan and Meier method and presented as survival curves. Statistical analysis was held by non-parametric methods. To test the significance of the difference between the two age distributions Kolmogorov-Smirnov test was applied. Gehan-Braslow- Wilcoxon and Cox-Mantel tests were used for estimation of median life span differences. In addition the minimal and maximal life span, time of 90% death, and mortality rate doubling time (MRDT) were estimated. The obtained results will be discussed in presentation.

  19. Low dose radiation enhances the Locomotor activity of D. melanogaster

    Seong, Ki Moon; Lee, Buyng Sub; Nam Seon Young; Kim, Ji Young; Yang, Kwang Hee; Choi, Tae In; Kim, Cha Soon [Radiation Effect Research Team, Radiation Health Research Institute, Korea Hydro and Nuclear Power Co., Ltd., Gyeongju (Korea, Republic of)

    2013-04-15

    Mild stresses at low level including radiation can induce the beneficial effects in many vertebrate and invertebrate species. However, a large amount of studies in radiation biology have focused on the detrimental effects of high dose radiation (HDR) such as the increased incidence of cancers and developmental diseases. Low dose radiation (LDR) induces biologically favorable effects in diverse fields, for example, cancer development, genomic instability, immune response, and longevity. Our previous data indicated that LDR promotes cells proliferation of which degree is not much but significant, and microarray data explained that LDR irradiated fruit flies showing the augmented immunity significantly changed the program for gene expression of many genes in Gene Ontology (GO) categories related to metabolic process. Metabolic process in development one of major contributors in organism growth, interbreeding, motility, and aging. Therefore, it is valuable to examine whether LDR change the physiological parameters related to metabolism, and how LDR regulates the metabolism in D. melanogaster. In this study, to investigate that LDR influences change of the metabolism, a representative parameter, locomotor activity. In addition, the activation of several cellular signal molecules was determined to investigate the specific molecular mechanism of LDR effects on the metabolism. We explored whether ionizing radiation affects the motility activity. We performed the RING assays to evaluate the locomotor activity, a representative parameter presenting motility of fruit flies. HDR dramatically decreased the motor activity of irradiated flies. Surprisingly, the irradiated flies at low dose radiation in both acute and chronic showed the significantly increased locomotor activity, compared to non-irradiated flies. Irradiation would induce change of the several signal pathways for flies to respond to it. The activation of some proteins involved in the cells proliferation and stress

  20. Calmodulin affects sensitization of Drosophila melanogaster odorant receptors

    Latha eMukunda

    2016-02-01

    Full Text Available Flying insects have developed a remarkably sensitive olfactory system to detect faint and turbulent odor traces. This ability is linked to the olfactory receptors class of odorant receptors (ORs, occurring exclusively in winged insects. ORs form heteromeric complexes of an odorant specific receptor protein (OrX and a highly conserved co-receptor protein (Orco. The ORs form ligand gated ion channels that are tuned by intracellular signaling systems. Repetitive subthreshold odor stimulation of olfactory sensory neurons sensitizes insect ORs. This OR sensitization process requires Orco activity. In the present study we first asked whether OR sensitization can be monitored with heterologously expressed OR proteins. Using electrophysiological and calcium imaging methods we demonstrate that D. melanogaster OR proteins expressed in CHO cells show sensitization upon repeated weak stimulation. This was found for OR channels formed by Orco as well as by Or22a or Or56a and Orco. Moreover, we show that inhibition of calmodulin (CaM action on OR proteins, expressed in CHO cells, abolishes any sensitization. Finally, we investigated the sensitization phenomenon using an ex vivo preparation of olfactory sensory neurons (OSNs expressing Or22a inside the fly’s antenna. Using calcium imaging, we observed sensitization in the dendrites as well as in the soma. Inhibition of calmodulin with W7 disrupted the sensitization within the outer dendritic shaft, whereas the sensitization remained in the other OSN compartments. Taken together, our results suggest that CaM action is involved in sensitizing the OR complex and that this mechanisms accounts for the sensitization in the outer dendrites, whereas further mechanisms contribute to the sensitization observed in the other OSN compartments. The use of heterologously expressed OR proteins appears to be suitable for further investigations on the mechanistic basis of OR sensitization, while investigations on native

  1. Genomic Variation in Natural Populations of Drosophila melanogaster

    Langley, Charles H.; Stevens, Kristian; Cardeno, Charis; Lee, Yuh Chwen G.; Schrider, Daniel R.; Pool, John E.; Langley, Sasha A.; Suarez, Charlyn; Corbett-Detig, Russell B.; Kolaczkowski, Bryan; Fang, Shu; Nista, Phillip M.; Holloway, Alisha K.; Kern, Andrew D.; Dewey, Colin N.; Song, Yun S.; Hahn, Matthew W.; Begun, David J.

    2012-01-01

    This report of independent genome sequences of two natural populations of Drosophila melanogaster (37 from North America and 6 from Africa) provides unique insight into forces shaping genomic polymorphism and divergence. Evidence of interactions between natural selection and genetic linkage is abundant not only in centromere- and telomere-proximal regions, but also throughout the euchromatic arms. Linkage disequilibrium, which decays within 1 kbp, exhibits a strong bias toward coupling of the more frequent alleles and provides a high-resolution map of recombination rate. The juxtaposition of population genetics statistics in small genomic windows with gene structures and chromatin states yields a rich, high-resolution annotation, including the following: (1) 5′- and 3′-UTRs are enriched for regions of reduced polymorphism relative to lineage-specific divergence; (2) exons overlap with windows of excess relative polymorphism; (3) epigenetic marks associated with active transcription initiation sites overlap with regions of reduced relative polymorphism and relatively reduced estimates of the rate of recombination; (4) the rate of adaptive nonsynonymous fixation increases with the rate of crossing over per base pair; and (5) both duplications and deletions are enriched near origins of replication and their density correlates negatively with the rate of crossing over. Available demographic models of X and autosome descent cannot account for the increased divergence on the X and loss of diversity associated with the out-of-Africa migration. Comparison of the variation among these genomes to variation among genomes from D. simulans suggests that many targets of directional selection are shared between these species. PMID:22673804

  2. Autosomal mutations affecting Y chromosome loops in Drosophila melanogaster

    Petrucci Romano

    2008-04-01

    Full Text Available Abstract Background The Y chromosome of Drosophila melanogaster harbors several genes required for male fertility. The genes for these fertility factors are very large in size and contain conspicuous amounts of repetitive DNA and transposons. Three of these loci (ks-1, kl-3 and kl-5 have the ability to develop giant lampbrush-like loops in primary spermatocytes, a cytological manifestation of their active state in these cells. Y-loops bind a number of non-Y encoded proteins, but the mechanisms regulating their development and their specific functions are still to be elucidated. Results Here we report the results of a screen of 726 male sterile lines to identify novel autosomal genes controlling Y-loop function. We analyzed mutant testis preparations both in vivo and by immunofluorescence using antibodies directed against Y-loop-associated proteins. This screen enabled us to isolate 17 mutations at 15 loci whose wild-type function is required for proper Y-loop morphogenesis. Six of these loci are likely to specifically control loop development, while the others display pleiotropic effects on both loops and meiotic processes such as spermiogenesis, sperm development and maturation. We also determined the map position of the mutations affecting exclusively Y-loop morphology. Conclusion Our cytological screening permitted us to identify novel genetic functions required for male spermatogenesis, some of which show pleiotropic effects. Analysis of these mutations also shows that loop development can be uncoupled from meiosis progression. These data represent a useful framework for the characterization of Y-loop development at a molecular level and for the study of the genetic control of heterochromatin.

  3. An experimental test for indirect benefits in Drosophila melanogaster

    Ödeen Anders

    2007-03-01

    Full Text Available Abstract Background Despite much empirical attention, tests for indirect benefits of mate choice have rarely considered the major components of sexual and nonsexual offspring fitness relevant to a population. Here we use a novel experimental design to test for the existence of any indirect benefits in a laboratory adapted population of D. melanogaster. Our experiment compared the fitness (mating success, longevity, and productivity of individuals possessing genomes that derived two generations previously from males that were either entirely successful (studs or wholly unsuccessful (duds at achieving mates in three subsequent rounds of mating trials. Results Males from the stud treatment were 30% more successful on average at securing mates than males from the dud treatment. In contrast, we found no difference between treatments in measures of productivity or of longevity when measured in a mixed-sex environment. In the absence of females, however, males in the stud treatment outlived males in the dud treatment. Conclusion Our results suggest that mating with successful males in this population provides an indirect benefit to females and that, at least in this environment, the benefit arises primarily through the production of more attractive male offspring. However, it is unclear whether this represents solely a traditional sexy sons benefit or whether there is an additional good genes component (with male offspring simply allocating their surplus condition to traits that enhance their mating success. The lack of any detectable differences in female fitness between the two treatments suggests the former, although the longevity advantage of males in the stud treatment when females were absent is consistent with the latter. Determining the effect of this indirect benefit on the evolution of female mate preferences (or resistance will require comparable data on the direct costs of mating with various males, and an understanding of how these costs

  4. Role of Host-Driven Mutagenesis in Determining Genome Evolution of Sigma Virus (DMelSV; Rhabdoviridae) in Drosophila melanogaster.

    Piontkivska, Helen; Matos, Luis F; Paul, Sinu; Scharfenberg, Brian; Farmerie, William G; Miyamoto, Michael M; Wayne, Marta L

    2016-10-05

    Sigma virus (DMelSV) is ubiquitous in natural populations of Drosophila melanogaster. Host-mediated, selective RNA editing of adenosines to inosines (ADAR) may contribute to control of viral infection by preventing transcripts from being transported into the cytoplasm or being translated accurately; or by increasing the viral genomic mutation rate. Previous PCR-based studies showed that ADAR mutations occur in DMelSV at low frequency. Here we use SOLiD TM deep sequencing of flies from a single host population from Athens, GA, USA to comprehensively evaluate patterns of sequence variation in DMelSV with respect to ADAR. GA dinucleotides, which are weak targets of ADAR, are strongly overrepresented in the positive strand of the virus, consistent with selection to generate ADAR resistance on this complement of the transient, double-stranded RNA intermediate in replication and transcription. Potential ADAR sites in a worldwide sample of viruses are more likely to be "resistant" if the sites do not vary among samples. Either variable sites are less constrained and hence are subject to weaker selection than conserved sites, or the variation is driven by ADAR. We also find evidence of mutations segregating within hosts, hereafter referred to as hypervariable sites. Some of these sites were variable only in one or two flies (i.e., rare); others were shared by four or even all five of the flies (i.e., common). Rare and common hypervariable sites were indistinguishable with respect to susceptibility to ADAR; however, polymorphism in rare sites were more likely to be consistent with the action of ADAR than in common ones, again suggesting that ADAR is deleterious to the virus. Thus, in DMelSV, host mutagenesis is constraining viral evolution both within and between hosts. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Role of Host-Driven Mutagenesis in Determining Genome Evolution of Sigma Virus (DMelSV; Rhabdoviridae) in Drosophila melanogaster

    Piontkivska, Helen; Matos, Luis F.; Paul, Sinu; Scharfenberg, Brian; Farmerie, William G.; Miyamoto, Michael M.; Wayne, Marta L.

    2016-01-01

    Abstract Sigma virus (DMelSV) is ubiquitous in natural populations of Drosophila melanogaster. Host-mediated, selective RNA editing of adenosines to inosines (ADAR) may contribute to control of viral infection by preventing transcripts from being transported into the cytoplasm or being translated accurately; or by increasing the viral genomic mutation rate. Previous PCR-based studies showed that ADAR mutations occur in DMelSV at low frequency. Here we use SOLiDTM deep sequencing of flies from a single host population from Athens, GA, USA to comprehensively evaluate patterns of sequence variation in DMelSV with respect to ADAR. GA dinucleotides, which are weak targets of ADAR, are strongly overrepresented in the positive strand of the virus, consistent with selection to generate ADAR resistance on this complement of the transient, double-stranded RNA intermediate in replication and transcription. Potential ADAR sites in a worldwide sample of viruses are more likely to be “resistant” if the sites do not vary among samples. Either variable sites are less constrained and hence are subject to weaker selection than conserved sites, or the variation is driven by ADAR. We also find evidence of mutations segregating within hosts, hereafter referred to as hypervariable sites. Some of these sites were variable only in one or two flies (i.e., rare); others were shared by four or even all five of the flies (i.e., common). Rare and common hypervariable sites were indistinguishable with respect to susceptibility to ADAR; however, polymorphism in rare sites were more likely to be consistent with the action of ADAR than in common ones, again suggesting that ADAR is deleterious to the virus. Thus, in DMelSV, host mutagenesis is constraining viral evolution both within and between hosts. PMID:27614234

  6. Cooperation of nuclear reactor controller ARM-5S and turbine TVER-02

    Wagner, K.; Lnenicka, B.; Pokorny, F.; Prochazka, F.

    1985-01-01

    Turbines of Czechoslovak make provided with controllers TVER-02 are installed in WWER-440 nuclear power plants under construction in Czechoslovakia. Reactor output is controlled using Soviet-made controllers ARM-5S which already comprise turbine controllers. The problems are analyzed of cooperation of both controllers, especially their parameters and transient processes in typical operating situations. The analysis uses the results of measurements performed during the power start-up of Unit 1 of the V-2 nuclear power plant at Jaslovske Bohunice. The results show that two types of control modes can be selected for the operation of the entire unit: the control to constant unit output, and control of unit output varying with turbine load selected on the TVER-02 controller or given by the demand of the power network. (Z.M.)

  7. Developmental study of mercury effects on the fruit fly (Drosophila melanogaster).

    Abnoos, Hamideh; Fereidoni, Masoud; Mahdavi-Shahri, Naser; Haddad, Farhang; Jalal, Razieh

    2013-03-01

    Environmental pollution caused by heavy metals such as mercury is one of the most important human problems. It might have severe teratogenic effects on embryonic development. Some pharmacological and physiological aspects of fruit flies (Drosophila melanogaster) are similar to humans. So the stages of egg to adult fruit fly, as a developmental model, were employed in the study. Wild adult insects were maintained in glass dishes containing standard medium at 25 °C in complete darkness. Five pairs of 3-day old flies were then transferred to standard culture dishes containing different concentrations of mercury ion. They were removed after 8 hours. We considered the following: The rate of larvae becoming pupae and pupae to adults; the time required for the development; the hatching rate in the second generation without mercury in the culture; the morphometric changes during development in both length and width of the eggs through two generations; larvae, pupae and adult thorax length and width. The results showed that mercury in culture (20-100 mg/l) increase the duration of larvae (p<0.01) and pupae (p<0.01) development, the rate of larvae becoming pupae (p<0.001); pupae maturation (p<0.05), the hatching rate (p<0.01), the length (p<0.05) and width of larvae (p<0.01) and pupae (p<0.001) and the length in the adult thorax (p<0.01) decreased significantly. There was no effect upon the size of eggs. There were also no larvae hatching in concentrations of 200 mg/l of mercury. Negative effects of mercury as a heavy metal are possibly due to the interference of this metal in cellular signaling pathways, such as: Notch signaling and protein synthesis during the period of development. Since it bonds chemically with the sulfur hydride groups of proteins, it causes damage to the cell membrane and decreases the amount of RNA. This is the cause of failure of many enzyme mechanisms.

  8. [Functional analysis of Grp and Iris, the gag and env domesticated errantivirus genes, in the Drosophila melanogaster genome].

    Makhnovskii, P A; Kuzmin, I V; Nefedova, L N; Kima, A I

    2016-01-01

    Drosophila melanogaster is the only invertebrate that contains endogenous retroviruses, which are called errantiviruses. Two domesticated genes, Grp and Iris, which originate from errantivirus gag and env, respectively, have been found in the D. melanogaster genome. The functions performed by the genes in Drosophila are still unclear. To identify the functions of domesticated gag and env in the D. melanogaster genome, expression of Iris and Grp was studied in strains differing by the presence or absence of the functional gypsy errantivirus. In addition, the expression levels were measured after injection of gram-positive and gram-negative bacteria, which activate different immune response pathways, and exposure to various abiotic stress factors. The presence of functional D. melanogaster retrovirus gypsy was found to increase the Grp expression level in somatic tissues of the carcass, while exerting no effect on the Iris expression level. Activation of the immune response in D. melanogaster by bacteria Bacillus cereus increased the Grp expression level and did not affect Iris expression. As for the effects of abiotic stress factors (oxidative stress, starvation, and heat and cold stress), the Grp expression level increased in response to starvation in D. melanogaster females, and the Iris expression level was downregulated in heat shock and oxidative stress. Based on the findings, Grp was assumed to play a direct role in the immune response in D. melanogaster; Iris is not involved in immune responses, but and apparently performs a cell function that is inhibited in stress.

  9. Extracellular RNA Communication (ExRNA)

    Federal Laboratory Consortium — Until recently, scientists believed RNA worked mostly inside the cell that produced it. Some types of RNA help translate genes into proteins that are necessary for...

  10. Strong nondipole effects in low-energy photoionization of the 5s and 5p subshells of xenon

    Johnson, W. R.; Cheng, K. T.

    2001-01-01

    Large nondipole effects are predicted in the angular distribution of photoelectrons from the 5s and 5p subshells of xenon for photon energies below 200 eV. The nondipole parameter γ 5s exhibits a dispersion-curve variation near the first minimum of the 5s cross section at 35 eV, reaching a minimum value of -0.8 near 40 eV. Rapid variation of γ 5s is also found near the second minimum of the 5s cross section at 150 eV, where γ 5s reaches a maximum value of 1.2. Smaller, but significant, nondipole effects are also found in the parameter ζ 5p =γ 5p +3δ 5p , which has a maximum value of 0.15 near 50 eV, and a second maximum value of 0.18 near 160 eV. The higher energy maxima in γ 5s and ζ 5p arise from correlation enhanced by shape resonances in the 4p→f quadrupole photoionization channels. These predictions are based on relativistic random-phase approximation calculations in which excitations from 5p, 5s, 4d, 4p, and 4s subshells are coupled

  11. Variations in 5S rDNAs in diploid and tetraploid offspring of red crucian carp × common carp.

    Ye, Lihai; Zhang, Chun; Tang, Xiaojun; Chen, Yiyi; Liu, Shaojun

    2017-08-08

    The allotetraploid hybrid fish (4nAT) that was created in a previous study through an intergeneric cross between red crucian carp (Carassius auratus red var., ♀) and common carp (Cyprinus carpio L., ♂) provided an excellent platform to investigate the effect of hybridization and polyploidization on the evolution of 5S rDNA. The 5S rDNAs of paternal common carp were made up of a coding sequence (CDS) and a non-transcribed spacer (NTS) unit, and while the 5S rDNAs of maternal red crucian carp contained a CDS and a NTS unit, they also contained a variable number of interposed regions (IPRs). The CDSs of the 5S rDNAs in both parental fishes were conserved, while their NTS units seemed to have been subjected to rapid evolution. The diploid hybrid 2nF 1 inherited all the types of 5S rDNAs in both progenitors and there were no signs of homeologous recombination in the 5S rDNAs of 2nF 1 by sequencing of PCR products. We obtained two segments of 5S rDNA with a total length of 16,457 bp from allotetraploid offspring 4nAT through bacterial artificial chromosome (BAC) sequencing. Using this sequence together with the 5S rDNA sequences amplified from the genomic DNA of 4nAT, we deduced that the 5S rDNAs of 4nAT might be inherited from the maternal progenitor red crucian carp. Additionally, the IPRs in the 5S rDNAs of 4nAT contained A-repeats and TA-repeats, which was not the case for the IPRs in the 5S rDNAs of 2nF 1 . We also detected two signals of a 200-bp fragment of 5S rDNA in the chromosomes of parental progenitors and hybrid progenies by fluorescence in situ hybridization (FISH). We deduced that during the evolution of 5S rDNAs in different ploidy hybrid fishes, interlocus gene conversion events and tandem repeat insertion events might occurred in the process of polyploidization. This study provided new insights into the relationship among the evolution of 5S rDNAs, hybridization and polyploidization, which were significant in clarifying the genome evolution of

  12. Pervasive gene expression responses to a fluctuating diet in Drosophila melanogaster

    Zandveld, Jelle; van den Heuvel, Joost; Mulder, Maarten

    2017-01-01

    Phenotypic plasticity is an important concept in life-history evolution, and most organisms, including Drosophila melanogaster, show a plastic life-history response to diet. However, little is known about how these life-history responses are mediated. In this study, we compared adult female flies...

  13. Study of radioadaptive response in Drosophila melanogaster at different oogenesis stages

    Glushkova, I.V.; Aksyutik, T.V.

    2005-01-01

    We study radioadaptive response in the Canton-S strain of Drosophila melanogaster at different oogenesis stages using the test of dominant lethal mutations (DLM). AR was not revealed at the stages of 14-7 and 7--1 oocytes in the studied Drosophila stock. It is likely to be associated with a genetic constitution of the Drosophila strain under study. (authors)

  14. Metabolic and functional phenotypic profiling of Drosophila melanogaster reveals reduced sex differentiation under stressful environmental conditions

    Orsted, Michael; Malmendal, Anders; Munoz, Joaquin

    2018-01-01

    Drosophila melanogaster (Diptera: Drosophilidae), and how this impacts the magnitude of sexual dimorphism. Experimental stressors that we exposed flies to during development were heat stress, poor nutrition, high acidity, high levels of ammonia and ethanol. Emerged male and female flies from the different...

  15. Editor's Highlight: Genetic Targets of Acute Toluene Inhalation in Drosophila melanogaster

    Interpretation and use of data from high-throughput assays for chemical toxicity require links between effects at molecular targets and adverse outcomes in whole animals. The well-characterized genome of Drosophila melanogaster provides a potential model system by which phenotypi...

  16. The effects of inbreeding and heat stress on male sterility in Drosophila melanogaster

    Pedersen, Louise Dybdahl; Pedersen, Asger Roer; Bijlsma, Kuke

    2011-01-01

    in benign and stressful environments using Drosophila melanogaster as a model organism. Male sterility was compared in 21 inbred lines and five non-inbred control lines at 25.0 and 29.0 °C. The effect of inbreeding on sterility was significant only at 29.0 °C. This stress-induced increase in sterility...

  17. Effect of low-level intensity EHF radiation on endurance and reproductivity of Drosophila Melanogaster

    Shakhbazov, V.G.; Chepel', L.M.; Bulgakov, B.M.; Sirenko, S.P.; Belous, O.I.; Fisun, A.I.

    1999-01-01

    The effect of the low-intensity microwaves on three gene-radiations of the imago Drosophila Melanogaster has been investigated out. The radiation source was tuned from 37 to 53 GHz. The thermoimmunity and reproductivity of the first generation of females and males of imago after processing by radiation. The obtained effect can be considered as physiological heterosis

  18. Proteomic characterization of a temperature-sensitive conditional lethal in Drosophila melanogaster

    Pedersen, Kamilla Sofie; Codrea, M.C; Vermeulen, Corneel

    2010-01-01

    Genetic variation that is expressed only under specific environmental conditions can contribute to additional adverse effects of inbreeding if environmental conditions change. We present a proteomic characterization of a conditional lethal found in an inbred line of Drosophila melanogaster. The l...

  19. The Drosophila melanogaster methuselah gene: a novel gene with ancient functions.

    Ana Rita Araújo

    Full Text Available The Drosophila melanogaster G protein-coupled receptor gene, methuselah (mth, has been described as a novel gene that is less than 10 million years old. Nevertheless, it shows a highly specific expression pattern in embryos, larvae, and adults, and has been implicated in larval development, stress resistance, and in the setting of adult lifespan, among others. Although mth belongs to a gene subfamily with 16 members in D. melanogaster, there is no evidence for functional redundancy in this subfamily. Therefore, it is surprising that a novel gene influences so many traits. Here, we explore the alternative hypothesis that mth is an old gene. Under this hypothesis, in species distantly related to D. melanogaster, there should be a gene with features similar to those of mth. By performing detailed phylogenetic, synteny, protein structure, and gene expression analyses we show that the D. virilis GJ12490 gene is the orthologous of mth in species distantly related to D. melanogaster. We also show that, in D. americana (a species of the virilis group of Drosophila, a common amino acid polymorphism at the GJ12490 orthologous gene is significantly associated with developmental time, size, and lifespan differences. Our results imply that GJ12490 orthologous genes are candidates for developmental time and lifespan differences in Drosophila in general.

  20. Pervasive gene expression responses to a fluctuating diet in Drosophila melanogaster

    Zandveld, Jelle; Heuvel, van den Joost; Mulder, Maarten; Brakefield, Paul M.; Kirkwood, Thomas B.L.; Shanley, Daryl P.; Zwaan, Bas J.

    2017-01-01

    Phenotypic plasticity is an important concept in life-history evolution, and most organisms, including Drosophila melanogaster, show a plastic life-history response to diet. However, little is known about how these life-history responses are mediated. In this study, we compared adult female flies

  1. Consistent effects of a major QTL for thermal resistance in field-released Drosophila melanogaster

    Loeschcke, Volker; Kristensen, Torsten Nygård; Norry, Fabian M

    2011-01-01

    Molecular genetic markers can be used to identify quantitative trait loci (QTL) for thermal resistance and this has allowed characterization of a major QTL for knockdown resistance to high temperature in Drosophila melanogaster. The QTL showed trade-off associations with cold resistance under lab...... of field fitness at different environmental temperatures with genotypic variation in a QTL for thermal tolerance. Graphical abstract...

  2. allele of the noncoding hsrω gene of Drosophila melanogaster is not ...

    , Martinez P. et al. 2000 Identification of genes that modify ataxin-1-induced neurodegeneration. Nature 408, 101–. 106. Lakhotia S. C. 2003 The non-coding, developmentally active and stress inducible hsrω gene of Drosophila melanogaster ...

  3. Mapping the pericentric heterochromatin by comparative genomic hybridization analysis and chromosome deletions in Drosophila melanogaster

    He, Bing; Caudy, Amy; Parsons, Lance; Rosebrock, Adam; Pane, Attilio; Raj, Sandeep; Wieschaus, Eric

    2012-01-01

    Heterochromatin represents a significant portion of eukaryotic genomes and has essential structural and regulatory functions. Its molecular organization is largely unknown due to difficulties in sequencing through and assembling repetitive sequences enriched in the heterochromatin. Here we developed a novel strategy using chromosomal rearrangements and embryonic phenotypes to position unmapped Drosophila melanogaster heterochromatic sequence to specific chromosomal regions. By excluding seque...

  4. Bowman-Birk inhibitor affects pathways associated with energy metabolism in Drosophila melanogaster

    Bowman-Birk inhibitor (BBI) is toxic when fed to certain insects, including the fruit fly, Drosophila melanogaster. Dietary BBI has been demonstrated to slow growth and increase insect mortality by inhibiting the digestive enzymes trypsin and chymotrypsin, resulting in a reduced supply of amino acid...

  5. Pharmacodynamic study on insomnia-curing effects of Shuangxia Decoction in Drosophila melanogaster.

    Zhang, Zhi-Qian; Degejin; Geng, Di; Zhang, Qi; Tian, Yan; Xi, Yuan; Wang, Wen-Qi; Tang, Hua-Qi; Xu, Bing; Lin, Hong-Ying; Sun, Yi-Kun

    2016-09-01

    The present study aimed to establish a pharmacodynamic method using the pySolo software to explore the influence of freeze-dried powders of Shuangxia Decoction (SXD) on the sleep of normal Drosophila melanogaster and the Drosophila melanogaster whose sleep was divested by light. The dose-effect and the time-effect relationships of SXD on sleep were examined. The effect-onset concentration of SXD was 0.25%, the plateau appeared at the concentration of 2.5% and the total sleep time showed a downtrend when the concentration was greater than 2.5%. The sleep time was the longest on the fourth day after SXD was given. The fruit fly sleep deprivation model was repeated by light stimulation at night. The middle dosage group (2.5%) had the best insomnia-curing effect. In conclusion, using the pySolo software, an approach for the pharmacodynamics study was established with Drosophila melanogaster as a model organism to determine the insomnia-curing effects of the traditional Chinese medicine (TCM). Our results demonstrated the reliability of this method. The freeze-dried powders of SXD could effectively improve the sleep quality of Drosophila melanogaster. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  6. Transcriptional Signatures in Response to Wheat Germ Agglutinin and Starvation in Drosophila melanogaster Larval Midgut

    One function of plant lectins such as wheat germ agglutinin (WGA) is to serve as defenses against herbivorous insects. The midgut is one critical site affected by dietary lectins. We observed marked cellular, structural, and gene expression changes in the midguts of Drosophila melanogaster third-i...

  7. Structure of glutaminyl cyclase from Drosophila melanogaster in space group I4

    Kolenko, Petr; Koch, B.; Rahfeld, J.-U.; Schilling, S.; Demuth, H.-U.; Stubbs, M. T.

    2013-01-01

    Roč. 69, č. 4 (2013), s. 358-361 ISSN 1744-3091 R&D Projects: GA MŠk EE2.3.30.0029 Institutional support: RVO:61389013 Keywords : glutaminyl cyclases * Drosophila melanogaster * soaking Subject RIV: CE - Biochemistry Impact factor: 0.568, year: 2013

  8. Influence of incorporated radionuclides on the life span of Drosophila melanogaster

    Koshel', N.M.; Vajserman, O.M.; Vojtenko, V.P.; Kutlakhmedov, Yu.O.; Mikhjejev, O.M.

    2004-01-01

    Influence of incorporated radionuclides ( 137 Cs and 90 Sr) on the life span of Drosophila melanogaster was studied. External irradiation modified the formation of cumulative dose of incorporated radionuclides. All influences leaded to significant (p 90 Sr was higher comparing to 137 Cs

  9. Somatic mutation and recombination induced by fast neutrons in the wing spot test of Drosophila Melanogaster

    Guzman R, J.; Varela, A.; Policroniades, R.; Delfin, A.; Graf, U.

    1994-01-01

    In the last decades, a large number of studies have been undertaken to evaluate the biological effects of gamma and X rays in Drosophila melanogaster. The majority of these investigations were performed on female and male germ cells. However, comparatively little is known in relation to the biological effects of fast neutrons, and especially in relation to their effects in somatic cells. (Author)

  10. Metabolomic profiling of rapid cold hardening and cold shock in Drosophila melanogaster

    Overgaard, Johannes; Malmendal, Anders; Sørensen, Jesper

    2007-01-01

    study used untargeted (1)H NMR metabolomic profiling to examine the metabolomic response in Drosophila melanogaster during the 72 h following RCH and cold shock treatment. These findings are discussed in relation to the costs and benefits of RCH that are measured in terms of survival and reproductive...

  11. Molecular Mechanisms for High Hydrostatic Pressure-Induced Wing Mutagenesis in Drosophila melanogaster.

    Wang, Hua; Wang, Kai; Xiao, Guanjun; Ma, Junfeng; Wang, Bingying; Shen, Sile; Fu, Xueqi; Zou, Guangtian; Zou, Bo

    2015-10-08

    Although High hydrostatic pressure (HHP) as an important physical and chemical tool has been increasingly applied to research of organism, the response mechanisms of organism to HHP have not been elucidated clearly thus far. To identify mutagenic mechanisms of HHP on organisms, here, we treated Drosophila melanogaster (D. melanogaster) eggs with HHP. Approximately 75% of the surviving flies showed significant morphological abnormalities from the egg to the adult stages compared with control flies (p melanogaster induced by HHP were used to investigate the mutagenic mechanisms of HHP on organism. Thus 285 differentially expressed genes associated with wing mutations were identified using Affymetrix Drosophila Genome Array 2.0 and verified with RT-PCR. We also compared wing development-related central genes in the mutant flies with control flies using DNA sequencing to show two point mutations in the vestigial (vg) gene. This study revealed the mutagenic mechanisms of HHP-induced mutagenesis in D. melanogaster and provided a new model for the study of evolution on organisms.

  12. Lethality and Developmental Delay of Drosophila melanogaster Following Ingestion of Selected Pseudomonas fluorescens Strains

    Pseudomonas fluorescens secretes antimicrobial compounds that promote plant health and provide protection from pathogens. We used a non-invasive feeding assay to study the toxicity of P. fluorescens strains Pf0-1, SBW25, and Pf-5 to Drosophila melanogaster. The three strains of P. fluorescens varie...

  13. Field tests reveal genetic variation for performance atlow temperatures in Drosophila melanogaster

    Overgaard, Johannes; Sørensen, Jesper Givskov; Jensen, Louise Toft

    2010-01-01

    investigated a population of Drosophila melanogaster for performance at low temperature conditions in the field using release recapture assays and in the laboratory using standard cold resistance assays. The aim of the study was to get a better understanding of the nature and underlying mechanisms of the trait...

  14. Endosymbiont-based immunity in Drosophila melanogaster against parasitic nematode infection.

    Yadav, Shruti; Frazer, Joanna; Banga, Ashima; Pruitt, Katherine; Harsh, Sneh; Jaenike, John; Eleftherianos, Ioannis

    2018-01-01

    Associations between endosymbiotic bacteria and their hosts represent a complex ecosystem within organisms ranging from humans to protozoa. Drosophila species are known to naturally harbor Wolbachia and Spiroplasma endosymbionts, which play a protective role against certain microbial infections. Here, we investigated whether the presence or absence of endosymbionts affects the immune response of Drosophila melanogaster larvae to infection by Steinernema carpocapsae nematodes carrying or lacking their mutualistic Gram-negative bacteria Xenorhabdus nematophila (symbiotic or axenic nematodes, respectively). We find that the presence of Wolbachia alone or together with Spiroplasma promotes the survival of larvae in response to infection with S. carpocapsae symbiotic nematodes, but not against axenic nematodes. We also find that Wolbachia numbers are reduced in Spiroplasma-free larvae infected with axenic compared to symbiotic nematodes, and they are also reduced in Spiroplasma-containing compared to Spiroplasma-free larvae infected with axenic nematodes. We further show that S. carpocapsae axenic nematode infection induces the Toll pathway in the absence of Wolbachia, and that symbiotic nematode infection leads to increased phenoloxidase activity in D. melanogaster larvae devoid of endosymbionts. Finally, infection with either type of nematode alters the metabolic status and the fat body lipid droplet size in D. melanogaster larvae containing only Wolbachia or both endosymbionts. Our results suggest an interaction between Wolbachia endosymbionts with the immune response of D. melanogaster against infection with the entomopathogenic nematodes S. carpocapsae. Results from this study indicate a complex interplay between insect hosts, endosymbiotic microbes and pathogenic organisms.

  15. Three Strains of Pseudomonas fluorescens Exhibit Differential Toxicity Against Drosophila melanogaster

    Three strains of Pseudomonas fluorescens were tested for toxicity to Drosophila melanogaster in an insect feeding assay. Insect eggs were placed on the surface of a non-nutritive agar plate supplemented with a food source that was non-inoculated or inoculated with P. fluorescens Pf0-1, SBW25, or Pf-...

  16. Structural basis for the changed substrate specificity of Drosophila melanogaster deoxyribonucleoside kinase mutant N64D

    Welin, M.; Skovgaard, T.; Knecht, Wolfgang

    2005-01-01

    The Drosophila melanogaster deoxyribonucleoside kinase (Dm-dNK) double mutant N45D/N64D was identified during a previous directed evolution study. This mutant enzyme had a decreased activity towards the natural substrates and decreased feedback inhibition with dTTP, whereas the activity with 3...

  17. Parallel Evolution of Copy-Number Variation across Continents in Drosophila melanogaster.

    Schrider, Daniel R; Hahn, Matthew W; Begun, David J

    2016-05-01

    Genetic differentiation across populations that is maintained in the presence of gene flow is a hallmark of spatially varying selection. In Drosophila melanogaster, the latitudinal clines across the eastern coasts of Australia and North America appear to be examples of this type of selection, with recent studies showing that a substantial portion of the D. melanogaster genome exhibits allele frequency differentiation with respect to latitude on both continents. As of yet there has been no genome-wide examination of differentiated copy-number variants (CNVs) in these geographic regions, despite their potential importance for phenotypic variation in Drosophila and other taxa. Here, we present an analysis of geographic variation in CNVs in D. melanogaster. We also present the first genomic analysis of geographic variation for copy-number variation in the sister species, D. simulans, in order to investigate patterns of parallel evolution in these close relatives. In D. melanogaster we find hundreds of CNVs, many of which show parallel patterns of geographic variation on both continents, lending support to the idea that they are influenced by spatially varying selection. These findings support the idea that polymorphic CNVs contribute to local adaptation in D. melanogaster In contrast, we find very few CNVs in D. simulans that are geographically differentiated in parallel on both continents, consistent with earlier work suggesting that clinal patterns are weaker in this species. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Effect of prosthesis endplate lordosis angles on L5-S1 kinematics after disc arthroplasty.

    Tsitsopoulos, Parmenion P; Wojewnik, Bartosz; Voronov, Leonard I; Havey, Robert M; Renner, Susan M; Zelenakova, Julia; McIntosh, Braden; Carandang, Gerard; Abjornson, Celeste; Patwardhan, Avinash G

    2012-06-01

    We hypothesized that L5-S1 kinematics will not be affected by the lordosis distribution between the prosthesis endplates. Twelve cadaveric lumbosacral spines (51.3 ± 9.8 years) were implanted with 6° or 11° prostheses (ProDisc-L) with four combinations of superior/inferior lordosis (6°/0°, 3°/3°, 11°/0°, 3°/8°). Specimens were tested intact and after prostheses implantation with different lordosis distributions. Center of rotation (COR) and range of motion (ROM) were quantified. Six-degree lordosis prostheses (n = 7) showed no difference in flexion-extension ROM, regardless of design (6°/0° or 3°/3°) (p > 0.05). In lateral bending (LB), both designs reduced ROM (p lordosis prostheses (n = 5) showed no difference in flexion-extension ROM for either design (p > 0.05). LB ROM decreased with distributed lordosis prostheses (3°/8°) (p lordosis distribution among the two prosthesis endplates. The ProDisc-L prosthesis design where all lordosis is concentrated in the superior endplate yielded COR locations that were anterior and caudal to intact controls. The prosthesis with lordosis distributed between the two endplates yielded a COR that tended to be closer to intact. Further clinical and biomechanical studies are needed to assess the long-term impact of lordosis angle distribution on the fate of the facet joints.

  19. Developmental environment mediates male seminal protein investment in Drosophila melanogaster.

    Wigby, Stuart; Perry, Jennifer C; Kim, Yon-Hee; Sirot, Laura K

    2016-03-01

    Males of many species fine-tune their ejaculates in response to sperm competition risk. Resource availability and the number of competitors during development can also strongly influence sperm production. However, despite the key role of seminal proteins in mediating reproductive processes, it is unclear whether seminal protein investment is dependent on the developmental environment.We manipulated the developmental environment of Drosophila melanogaster by rearing flies at low and high density. As expected, this resulted in large and small (i.e. high and low condition) adult phenotypes, respectively.As predicted, large males produced more of two key seminal proteins, sex peptide (SP) and ovulin, and were more successful at obtaining matings with both virgin and previously mated females. However, there was only a weak and non-significant trend for large males to transfer more absolute quantities of SP at mating, and thus, small males ejaculated proportionally more of their stored accessory gland SP resources.Males transferred more receptivity-inhibiting SP to large females. Despite this, large females remated more quickly than small females and thus responded to their developmental environment over and above the quantity of SP they received.The results are consistent with two non-mutually exclusive hypotheses. First, flies might respond to condition-dependent reproductive opportunities, with (i) small males investing heavily in ejaculates when mating opportunities arise and large males strategically partitioning SP resources and (ii) small females remating at reduced rates because they have higher mating costs or need to replenish sperm less often.Second, flies may be primed by their larval environment to deal with similar adult population densities, with (i) males perceiving high density as signalling increased competition, leading small males to invest proportionally more SP resources at mating and (ii) females perceiving high density as signalling abundant

  20. Genomic Evidence for Adaptive Inversion Clines in Drosophila melanogaster.

    Kapun, Martin; Fabian, Daniel K; Goudet, Jérôme; Flatt, Thomas

    2016-05-01

    Clines in chromosomal inversion polymorphisms-presumably driven by climatic gradients-are common but there is surprisingly little evidence for selection acting on them. Here we address this long-standing issue in Drosophila melanogaster by using diagnostic single nucleotide polymorphism (SNP) markers to estimate inversion frequencies from 28 whole-genome Pool-seq samples collected from 10 populations along the North American east coast. Inversions In(3L)P, In(3R)Mo, and In(3R)Payne showed clear latitudinal clines, and for In(2L)t, In(2R)NS, and In(3R)Payne the steepness of the clinal slopes changed between summer and fall. Consistent with an effect of seasonality on inversion frequencies, we detected small but stable seasonal fluctuations of In(2R)NS and In(3R)Payne in a temperate Pennsylvanian population over 4 years. In support of spatially varying selection, we observed that the cline in In(3R)Payne has remained stable for >40 years and that the frequencies of In(2L)t and In(3R)Payne are strongly correlated with climatic factors that vary latitudinally, independent of population structure. To test whether these patterns are adaptive, we compared the amount of genetic differentiation of inversions versus neutral SNPs and found that the clines in In(2L)t and In(3R)Payne are maintained nonneutrally and independent of admixture. We also identified numerous clinal inversion-associated SNPs, many of which exhibit parallel differentiation along the Australian cline and reside in genes known to affect fitness-related traits. Together, our results provide strong evidence that inversion clines are maintained by spatially-and perhaps also temporally-varying selection. We interpret our data in light of current hypotheses about how inversions are established and maintained. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).

    Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao

    2017-01-01

    In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.

  2. The nature of Zb states from a combined analysis of Υ(5S) → hb(mP)π+π- and Υ(5S) → B(*) anti B(*)π

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-01-01

    With a combined analysis of data on Υ(5S) → h b (1P, 2P)π + π - and Υ(5S) → B (*) anti B (*) π in an effective field theory approach, we determine resonance parameters of Z b states in two scenarios. In one scenario we assume that Z b states are pure molecular states, while in the other one we assume that Z b states contain compact components. We find that the present data favor that there should be some compact components inside Z b (') associated with themolecular components. By fitting the invariant mass spectra of Υ(5S) → h b (1P, 2P)π + π - and Υ(5S) → B (*) anti B * π, we determine that the probability of finding the compact components in Z b states may be as large as about 40 %. (orig.)

  3. An Intronic Polymorphism in couch potato Is Not Distributed Clinally in European Drosophila melanogaster Populations nor Does It Affect Diapause Inducibility.

    Zonato, Valeria; Fedele, Giorgio; Kyriacou, Charalambos P

    2016-01-01

    couch potato (cpo) encodes an RNA binding protein that has been reported to be expressed in the peripheral and central nervous system of embryos, larvae and adults, including the major endocrine organ, the ring gland. A polymorphism in the D. melanogaster cpo gene coding region displays a latitudinal cline in frequency in North American populations, but as cpo lies within the inversion In(3R)Payne, which is at high frequencies and itself shows a strong cline on this continent, interpretation of the cpo cline is not straightforward. A second downstream SNP in strong linkage disequilibrium with the first has been claimed to be primarily responsible for the latitudinal cline in diapause incidence in USA populations.Here, we investigate the frequencies of these two cpo SNPs in populations of Drosophila throughout continental Europe. The advantage of studying cpo variation in Europe is the very low frequency of In(3R)Payne, which we reveal here, does not appear to be clinally distributed. We observe a very different geographical scenario for cpo variation from the one in North America, suggesting that the downstream SNP does not play a role in diapause. In an attempt to verify whether the SNPs influence diapause we subsequently generated lines with different combinations of the two cpo SNPs on known timeless (tim) genetic backgrounds, because polymorphism in the clock gene tim plays a significant role in diapause inducibility. Our results reveal that the downstream cpo SNP does not seem to play any role in diapause induction in European populations in contrast to the upstream coding cpo SNP. Consequently, all future diapause studies on strains of D. melanogaster should initially determine their tim and cpo status.

  4. Studies on the role of NonA in mRNA biogenesis

    Kozlova, Natalia; Braga, Jose; Lundgren, Josefin; Rino, Jose; Young, Patrick; Carmo-Fonseca, Maria; Visa, Neus

    2006-01-01

    The NonA protein of Drosophila melanogaster is an abundant nuclear protein that belongs to the DBHS (Drosophila behavior, human splicing) protein family. The DBHS proteins bind both DNA and RNA in vitro and have been involved in different aspects of gene expression, including pre-mRNA splicing, transcription regulation and nuclear retention of mRNA. We have used double-stranded RNA interference in Drosophila S2 cells to silence the expression of NonA and to investigate its role in mRNA biogenesis. We show that knockdown of NonA does not affect transcription nor splicing. We demonstrate that NonA forms a complex with the essential nuclear export factor NXF1 in an RNA-dependent manner. We have constructed stable S2 cell lines that express full-length and truncated NXF1 fused to GFP in order to perform fluorescence recovery after photobleaching experiments. We show that knockdown of NonA reduces the intranuclear mobility of NXF1-GFP associated with poly(A) + RNA in vivo, while the mobility of the truncated NXF1-GFP that does not bind RNA is not affected. Our data suggest that NonA facilitates the intranuclear mobility of mRNP particles

  5. Conserved RNA-Binding Proteins Required for Dendrite Morphogenesis in Caenorhabditis elegans Sensory Neurons

    Antonacci, Simona; Forand, Daniel; Wolf, Margaret; Tyus, Courtney; Barney, Julia; Kellogg, Leah; Simon, Margo A.; Kerr, Genevieve; Wells, Kristen L.; Younes, Serena; Mortimer, Nathan T.; Olesnicky, Eugenia C.; Killian, Darrell J.

    2015-01-01

    The regulation of dendritic branching is critical for sensory reception, cell−cell communication within the nervous system, learning, memory, and behavior. Defects in dendrite morphology are associated with several neurologic disorders; thus, an understanding of the molecular mechanisms that govern dendrite morphogenesis is important. Recent investigations of dendrite morphogenesis have highlighted the importance of gene regulation at the posttranscriptional level. Because RNA-binding proteins mediate many posttranscriptional mechanisms, we decided to investigate the extent to which conserved RNA-binding proteins contribute to dendrite morphogenesis across phyla. Here we identify a core set of RNA-binding proteins that are important for dendrite morphogenesis in the PVD multidendritic sensory neuron in Caenorhabditis elegans. Homologs of each of these genes were previously identified as important in the Drosophila melanogaster dendritic arborization sensory neurons. Our results suggest that RNA processing, mRNA localization, mRNA stability, and translational control are all important mechanisms that contribute to dendrite morphogenesis, and we present a conserved set of RNA-binding proteins that regulate these processes in diverse animal species. Furthermore, homologs of these genes are expressed in the human brain, suggesting that these RNA-binding proteins are candidate regulators of dendrite development in humans. PMID:25673135

  6. RNAi Experiments in D. melanogaster : Solutions to the Overlooked Problem of Off-Targets Shared by Independent dsRNAs

    Seinen, Erwin; Burgerhof, Johannes G. M.; Jansen, Ritsert C.; Sibon, Ody C. M.; Polymenis, Michael

    2010-01-01

    Background: RNAi technology is widely used to downregulate specific gene products. Investigating the phenotype induced by downregulation of gene products provides essential information about the function of the specific gene of interest. When RNAi is applied in Drosophila melanogaster or

  7. Study of the variation of the nuclear transcriptional map during de initial development of Drosophyla melanogaster embryos

    Alonso, C.E.V.

    1987-01-01

    The variation of nuclear transcriptional map during the initial development of Drosophyla melanogaster embryos were studied. Thermic treatment, chromatographic techniques and liquid scintilation in embryos inoculated with radioactive uridine were used. (L.J.C.)

  8. Limitations in the use of Drosophila melanogaster as a model host for gram-positive bacterial infection

    Jensen, Rikke Lind; Pedersen, K.S.; Loeschcke, V

    2007-01-01

    resistance respectively, were subjected to infection by L. monocytogenes, S. aureus and E. coli. Mortality rates were comparable with that of the Oregon R strain. Conclusions: Use of the injection method shows the limitation of D. melanogaster as a model host for gram-positive bacteria as opportunistic......Aims: To examine sensitivities of various Drosophila melanogaster strains towards human pathogenic and nonpathogenic gram-positive bacteria. Methods and Results: The D. melanogaster Oregon R strain was infected by injecting the thorax with a needle containing Escherichia coli (negative control...... with the negative control. Infection with L. innocua, B. subtilis or C. maltaromaticum also resulted in a high fly mortality, whereas Lact. plantarum and P. acidilactici resulted in a slightly increased mortality. Four additional D. melanogaster lines, three of which had been selected for heat, cold and desiccation...

  9. Structural and optical properties of AgIn5S8

    Rincón, Carlos A. Durante; Durán, Larissa T.; Medina, Josefa Estévez; Castro, Jaime A.; León, Máximo; Fermín, Jose R.

    2017-12-01

    Compounds of the chalcogenide family Ag-In-VI (VI = S, Se, Te) are interesting materials due to their stoichiometric stability and potential application in nonlinear optics and solar cells. A polycrystalline ingot of AgIn5S8, an ordered vacancy semiconductor, was prepared by direct fusion of the stoichiometric mixture of the elements in an evacuated quartz ampoule. The presence of a single phase with cubic structure was confirmed by X-ray powder diffraction at room temperature. The lattice parameter, a, was calculated, giving 10.821750 Å. Samples in evacuated quartz ampoules were used to perform Differential Thermal Analysis measurements, showing congruent melting at 1110∘C. Transmittance and reflectivity measurements were used to calculate the absorption coefficient α. From the plot of (αhν)2 versus hν, two direct transitions are observed at 1.25 eV and 1.88 eV. While the higher energy direct transition has been observed by other authors, the direct nature of the lower energy transition was confirmed from the fitting of the plot of the reflectivity versus 1/hν between 0.53 eV-1 (1.89 eV) and 0.55 eV-1 (1.82 eV), obtaining a value of 1.29 eV. The real refractive index n and the high-frequency dielectric constant 𝜀∞ were also obtained from the fit of the reflectivity, resulting to be 2.68 and 7.2, respectively.

  10. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  11. Discussion on the method to increase the successful rate of L5/S1 intervertebral disc puncture

    Zhong Xianyi; Li Liangjun; Yu Chengxin

    2007-01-01

    Objective: To study the effective methods of L 5 /S 1 intervertebral disc puncture without drilling to solve the barriers from iliaca. Methods: (1) puncturing with belly-buttock sticking out: to enlarge waist sacro-iliaca angle to move the puncture point up; (2) puncturing through intervertebral edge: puncturing through L 5 to 1/3 intervertebral disc to make the puncture point move Up; (3) puncturing through L 5 /S 1 intervertebral disc with the self-made puncture location instrument. Results with the methods, 280 cases with L 5 /S 1 intervertebral disc protrusion have been successfully punctured, with successful rate 100%. Conclusion: These methods are ideal and easy to use to treat L 5 /S 1 intervertebral disc protrusion puncture, and worth popularizing. (authors)

  12. Effects of acclimation temperature on thermal tolerance and membrane phospholipid composition in the fruit fly Drosophila melanogaster

    Overgaard, Johannes; Tomcala, Ales; Sørensen, Jesper G

    2008-01-01

    and the composition of membrane GPLs in adult Drosophila melanogaster. Long-term cold survival was significantly improved by low acclimation temperature. After 60h at 0 degrees C, more than 80% of the 15 degrees C-acclimated flies survived while none of the 25 degrees C-acclimated flies survived. Cold shock tolerance...... acclimation temperature and correlated with the changes in GPL composition in membranes of adult D. melanogaster. Udgivelsesdato: 2008-Mar...

  13. Drosophila melanogaster cellular repressor of E1A-stimulated genes is a lysosomal protein essential for fly development

    Kowalewski-Nimmerfall, Elisabeth; Sch?hs, Philipp; Maresch, Daniel; Rendic, Dubravko; Kr?mer, Helmut; Mach, Lukas

    2014-01-01

    Mammalian cellular repressor of E1A-stimulated genes is a lysosomal glycoprotein implicated in cellular growth and differentiation. The genome of the fruit fly Drosophila melanogaster encodes a putative orthologue (dCREG), suggesting evolutionarily conserved physiological functions of this protein. In D. melanogaster S2 cells, dCREG was found to localize in lysosomes. Further studies revealed that intracellular dCREG is subject of proteolytic maturation. Processing and turnover could be subst...

  14. Factors Contributing To The Sustainability Of 5S Programmes In Government Hospitals In Regional Director Of Health Services Area Kurunegala

    Dr. K.W.C.U.K Kendangamuwa

    2015-03-01

    Full Text Available Abstract Introduction 5S is the stepping stone for many quality improvement concepts and its roots date back to 16th century. When successfully implemented 5S gives many benefits to the organization as well as its stakeholders. Though 5S itself has a tool to sustain most of the organizations find it difficult to sustain the 5S practice over the time. Therefore the objective of this study was to find out the factors contributing to sustainability of 5S programmes in Government Hospitals in RDHS area Kurunegala. Methodology This study was a descriptive cross sectional study with two components. First component was to identify the 5S sustaining hospitals from not sustaining hospitals by validated evaluation sheet. Second component was to determine the factors contributing to sustainability of 5S programmes in selected study setting. Self-administrated questionnaire was used for this purpose. Total study population was 543 employees of all the categories of hospital staff. Calculated sample size was 422 and 375 were responded to the questionnaire giving response rate of 88.9. Results The study revealed that the implemented 5S programmes were sustaining in eight hospitals out of ten i.e. sustaining rate was 80. When it considered the degree of sustainability 50 of the selected hospitals reported more than 70 sustainability. This was considered as favourable trend in government health sector in healthcare quality point of view. Ten factors were studied as contributing factors for the 5S sustainability. Socio- demographic factors were also considered. Those ten factors were top management commitment leadership of the organization commitment of middle amp frontline managers commitment amp satisfaction of employees training amp changing attitude of employees motivation of employees organizational culture group cohesiveness community participation and customer satisfaction. Study revealed that organizational leadership customer satisfaction community

  15. Gene silencing in non-model insects: Overcoming hurdles using symbiotic bacteria for trauma-free sustainable delivery of RNA interference: Sustained RNA interference in insects mediated by symbiotic bacteria: Applications as a genetic tool and as a biocide.

    Whitten, Miranda; Dyson, Paul

    2017-03-01

    Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.

  16. Absolute transition probabilities of 5s-5p transitions of Kr I from interferometric measurements in LTE-plasmas

    Kaschek, K.; Ernst, G.K.; Boetticher, W.

    1984-01-01

    Absolute transition probabilities of nine 5s-5p transitions of Kr I have been evaluated by using the hook method. The plasma was produced in a shock tube. The population density of the 5s-levels was calculated, under the assumption of LTE, from the electron density and the ground state number measured by means of a dual wavelength interferometer. An evaluation is given which proves the validity of the LTE assumption. (orig.)

  17. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    Garcia, S.; Crhák Khaitová, Lucie; Kovařík, Aleš

    2012-01-01

    Roč. 12, JUN 20 (2012), ID 95 ISSN 1471-2229 R&D Projects: GA ČR GAP501/10/0208; GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : ARABIDOPSIS-THALIANA * NUCLEOTIDE-SEQUENCES * DNA METHYLATION * GENUS ARTEMISIA Subject RIV: BO - Biophysics Impact factor: 4.354, year: 2012

  18. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    Garcia, S.; Panero, J.L.; Široký, Jiří; Kovařík, Aleš

    2010-01-01

    Roč. 10, č. 176 (2010), s. 1-18 ISSN 1471-2229 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : organization of rDNA unit * intergenic spacer * Asteraceae Subject RIV: BO - Biophysics Impact factor: 4.085, year: 2010

  19. Measurements of the Exclusive Decays of the Υ(5S) to B Meson Final States and Improved Bs* Mass Measurement

    Aquines, O.; Li, Z.; Lopez, A.; Mendez, H.; Ramirez, J.; Huang, G.S.; Miller, D.H.; Pavlunin, V.; Sanghi, B.; Shipsey, I.P.J.; Xin, B.; Adams, G.S.; Anderson, M.; Cummings, J.P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C.S.

    2006-01-01

    Using 420 pb -1 of data collected on the Υ(5S) resonance with the CLEO III detector, we reconstruct B mesons in 25 exclusive decay channels to measure or set upper limits on the decay rate of Υ(5S) into B meson final states. We measure the inclusive B cross section to be σ(Υ(5S)→BB(X))=(0.177±0.030±0.016) nb and make the first measurements of the production rates of σ(Υ(5S)→B*B*)=(0.131±0.025±0.014) nb and σ(Υ(5S)→BB*)=(0.043±0.016±0.006) nb, respectively. We set 90% confidence level limits of σ(Υ(5S)→BB) ( * ) B ( * ) π) s * mass to date, M(B s *)=(5411.7±1.6±0.6) MeV/c 2

  20. Incompatibility between X chromosome factor and pericentric heterochromatic region causes lethality in hybrids between Drosophila melanogaster and its sibling species.

    Cattani, M Victoria; Presgraves, Daven C

    2012-06-01

    The Dobzhansky-Muller model posits that postzygotic reproductive isolation results from the evolution of incompatible epistatic interactions between species: alleles that function in the genetic background of one species can cause sterility or lethality in the genetic background of another species. Progress in identifying and characterizing factors involved in postzygotic isolation in Drosophila has remained slow, mainly because Drosophila melanogaster, with all of its genetic tools, forms dead or sterile hybrids when crossed to its sister species, D. simulans, D. sechellia, and D. mauritiana. To circumvent this problem, we used chromosome deletions and duplications from D. melanogaster to map two hybrid incompatibility loci in F(1) hybrids with its sister species. We mapped a recessive factor to the pericentromeric heterochromatin of the X chromosome in D. simulans and D. mauritiana, which we call heterochromatin hybrid lethal (hhl), which causes lethality in F(1) hybrid females with D. melanogaster. As F(1) hybrid males hemizygous for a D. mauritiana (or D. simulans) X chromosome are viable, the lethality of deficiency hybrid females implies that a dominant incompatible partner locus exists on the D. melanogaster X. Using small segments of the D. melanogaster X chromosome duplicated onto the Y chromosome, we mapped a dominant factor that causes hybrid lethality to a small 24-gene region of the D. melanogaster X. We provide evidence suggesting that it interacts with hhl(mau). The location of hhl is consistent with the emerging theme that hybrid incompatibilities in Drosophila involve heterochromatic regions and factors that interact with the heterochromatin.