WorldWideScience

Sample records for mediator tak1 regulates

  1. TAK1 regulates skeletal muscle mass and mitochondrial function

    Science.gov (United States)

    Hindi, Sajedah M.; Sato, Shuichi; Xiong, Guangyan; Bohnert, Kyle R.; Gibb, Andrew A.; Gallot, Yann S.; McMillan, Joseph D.; Hill, Bradford G.

    2018-01-01

    Skeletal muscle mass is regulated by a complex array of signaling pathways. TGF-β–activated kinase 1 (TAK1) is an important signaling protein, which regulates context-dependent activation of multiple intracellular pathways. However, the role of TAK1 in the regulation of skeletal muscle mass remains unknown. Here, we report that inducible inactivation of TAK1 causes severe muscle wasting, leading to kyphosis, in both young and adult mice.. Inactivation of TAK1 inhibits protein synthesis and induces proteolysis, potentially through upregulating the activity of the ubiquitin-proteasome system and autophagy. Phosphorylation and enzymatic activity of AMPK are increased, whereas levels of phosphorylated mTOR and p38 MAPK are diminished upon inducible inactivation of TAK1 in skeletal muscle. In addition, targeted inactivation of TAK1 leads to the accumulation of dysfunctional mitochondria and oxidative stress in skeletal muscle of adult mice. Inhibition of TAK1 does not attenuate denervation-induced muscle wasting in adult mice. Finally, TAK1 activity is highly upregulated during overload-induced skeletal muscle growth, and inactivation of TAK1 prevents myofiber hypertrophy in response to functional overload. Overall, our study demonstrates that TAK1 is a key regulator of skeletal muscle mass and oxidative metabolism. PMID:29415881

  2. HTLV-1 Tax-mediated TAK1 activation involves TAB2 adapter protein

    International Nuclear Information System (INIS)

    Yu Qingsheng; Minoda, Yasumasa; Yoshida, Ryoko; Yoshida, Hideyuki; Iha, Hidekatsu; Kobayashi, Takashi; Yoshimura, Akihiko; Takaesu, Giichi

    2008-01-01

    Human T cell leukemia virus type 1 (HTLV-1) Tax is an oncoprotein that plays a crucial role in the proliferation and transformation of HTLV-1-infected T lymphocytes. It has recently been reported that Tax activates a MAPKKK family, TAK1. However, the molecular mechanism of Tax-mediated TAK1 activation is not well understood. In this report, we investigated the role of TAK1-binding protein 2 (TAB2) in Tax-mediated TAK1 activation. We found that TAB2 physically interacts with Tax and augments Tax-induced NF-κB activity. Tax and TAB2 cooperatively activate TAK1 when they are coexpressed. Furthermore, TAK1 activation by Tax requires TAB2 binding as well as ubiquitination of Tax. We also found that the overexpression of TRAF2, 5, or 6 strongly induces Tax ubiquitination. These results suggest that TAB2 may be critically involved in Tax-mediated activation of TAK1 and that NF-κB-activating TRAF family proteins are potential cellular E3 ubiquitin ligases toward Tax

  3. Torilin Inhibits Inflammation by Limiting TAK1-Mediated MAP Kinase and NF-κB Activation

    Directory of Open Access Journals (Sweden)

    Mehari Endale

    2017-01-01

    Full Text Available Torilin, a sesquiterpene isolated from the fruits of Torilis japonica, has shown antimicrobial, anticancer, and anti-inflammatory properties. However, data on the mechanism of torilin action against inflammation is limited. This study aimed at determining the anti-inflammatory property of torilin in LPS-induced inflammation using in vitro model of inflammation. We examined torilin’s effect on expression levels of inflammatory mediators and cytokines in LPS-stimulated RAW 264.7 macrophages. The involvement of NF-kB and AP-1, MAP kinases, and adaptor proteins were assessed. Torilin strongly inhibited LPS-induced NO release, iNOS, PGE2, COX-2, NF-α, IL-1β, IL-6, and GM-CSF gene and protein expressions. In addition, MAPKs were also suppressed by torilin pretreatment. Involvement of ERK1/2, P38MAPK, and JNK1/2 was further confirmed by PD98059, SB203580, and SP600125 mediated suppression of iNOS and COX-2 proteins. Furthermore, torilin attenuated NF-kB and AP-1 translocation, DNA binding, and reporter gene transcription. Interestingly, torilin inhibited TAK1 kinase activation with the subsequent suppression of MAPK-mediated JNK, p38, ERK1/2, and AP-1 (ATF-2 and c-jun activation and IKK-mediated I-κBα degradation, p65/p50 activation, and translocation. Together, the results revealed the suppression of NF-κB and AP-1 regulated inflammatory mediator and cytokine expressions, suggesting the test compound’s potential as a candidate anti-inflammatory agent.

  4. Procarcinogenic effects of cyclosporine A are mediated through the activation of TAK1/TAB1 signaling pathway

    International Nuclear Information System (INIS)

    Xu, Jianmin; Walsh, Stephanie B.; Verney, Zoe M.; Kopelovich, Levy; Elmets, Craig A.; Athar, Mohammad

    2011-01-01

    Research highlights: → Organ transplant recipients are highly susceptible to early skin cancer development. → CsA-mediated TGFB1-dependent TAK1/TAB1 signaling augments invasive tumor growth. → CsA enhances accumulation of upstream kinases, ZMP, AMPK and IRAK to activate TAK1. → TAK1 mediates enhanced proliferation and reduced apoptosis via CsA-dependent NFκB. -- Abstract: Cyclosporine A (CsA) is an immunosuppressive drug commonly used for maintaining chronic immune suppression in organ transplant recipients. It is known that patients receiving CsA manifest increased growth of aggressive non-melanoma skin cancers. However, the underlying mechanism by which CsA augments tumor growth is not fully understood. Here, we show that CsA augments the growth of A431 epidermoid carcinoma xenograft tumors by activating tumor growth factor β-activated kinase1 (TAK1). The activation of TAK1 by CsA occurs at multiple levels by kinases ZMP, AMPK and IRAK. TAK1 forms heterodimeric complexes with TAK binding protein 1 and 2 (TAB1/TAB2) which in term activate nuclear factor κB (NFκB) and p38 MAP kinase. Transcriptional activation of NFκB is evidenced by IKKβ-mediated phosphorylation-dependent degradation of IκB and consequent nuclear translocation of p65. This also leads to enhancement in the expression of its transcriptional target genes cyclin D1, Bcl2 and COX-2. Similarly, activation of p38 leads to enhanced inflammation-related signaling shown by increased phosphorylation of MAPKAPK2 and which in turn phosphorylates its substrate HSP27. Activation of both NFκB and p38 MAP kinase provide mitogenic stimuli to augment the growth of SCCs.

  5. A non-redundant role for Drosophila Mkk4 and hemipterous/Mkk7 in TAK1-mediated activation of JNK.

    Directory of Open Access Journals (Sweden)

    Peter Geuking

    Full Text Available BACKGROUND: The JNK pathway is a mitogen-activated protein (MAP kinase pathway involved in the regulation of numerous physiological processes during development and in response to environmental stress. JNK activity is controlled by two MAPK kinases (MAPKK, Mkk4 and Mkk7. Mkk7 plays a prominent role upon Tumor Necrosis Factor (TNF stimulation. Eiger, the unique TNF-superfamily ligand in Drosophila, potently activates JNK signaling through the activation of the MAPKKK Tak1. METHODOLOGY/PRINCIPAL FINDINGS: In a dominant suppressor screen for new components of the Eiger/JNK-pathway in Drosophila, we have identified an allelic series of the Mkk4 gene. Our genetic and biochemical results demonstrate that Mkk4 is dispensable for normal development and host resistance to systemic bacterial infection but plays a non-redundant role as a MAPKK acting in parallel to Hemipterous/Mkk7 in dTAK1-mediated JNK activation upon Eiger and Imd pathway activation. CONCLUSIONS/SIGNIFICANCE: In contrast to mammals, it seems that in Drosophila both MAPKKs, Hep/Mkk7 and Mkk4, are required to induce JNK upon TNF or pro-inflammatory stimulation.

  6. TGF-β-activated kinase 1 (TAK1 signaling regulates TGF-β-induced WNT-5A expression in airway smooth muscle cells via Sp1 and β-catenin.

    Directory of Open Access Journals (Sweden)

    Kuldeep Kumawat

    Full Text Available WNT-5A, a key player in embryonic development and post-natal homeostasis, has been associated with a myriad of pathological conditions including malignant, fibroproliferative and inflammatory disorders. Previously, we have identified WNT-5A as a transcriptional target of TGF-β in airway smooth muscle cells and demonstrated its function as a mediator of airway remodeling. Here, we investigated the molecular mechanisms underlying TGF-β-induced WNT-5A expression. We show that TGF-β-activated kinase 1 (TAK1 is a critical mediator of WNT-5A expression as its pharmacological inhibition or siRNA-mediated silencing reduced TGF-β induction of WNT-5A. Furthermore, we show that TAK1 engages p38 and c-Jun N-terminal kinase (JNK signaling which redundantly participates in WNT-5A induction as only simultaneous, but not individual, inhibition of p38 and JNK suppressed TGF-β-induced WNT-5A expression. Remarkably, we demonstrate a central role of β-catenin in TGF-β-induced WNT-5A expression. Regulated by TAK1, β-catenin is required for WNT-5A induction as its silencing repressed WNT-5A expression whereas a constitutively active mutant augmented basal WNT-5A abundance. Furthermore, we identify Sp1 as the transcription factor for WNT-5A and demonstrate its interaction with β-catenin. We discover that Sp1 is recruited to the WNT-5A promoter in a TGF-β-induced and TAK1-regulated manner. Collectively, our findings describe a TAK1-dependent, β-catenin- and Sp1-mediated signaling cascade activated downstream of TGF-β which regulates WNT-5A induction.

  7. Blocking RhoA/ROCK inhibits the pathogenesis of pemphigus vulgaris by suppressing oxidative stress and apoptosis through TAK1/NOD2-mediated NF-κB pathway.

    Science.gov (United States)

    Liang, Junqin; Zeng, Xuewen; Halifu, Yilinuer; Chen, Wenjing; Hu, Fengxia; Wang, Peng; Zhang, Huan; Kang, Xiaojing

    2017-12-01

    Oxidative stress and apoptosis play critical roles in pemphigus vulgaris (PV). The main aim of the present study was to investigate the effects of RhoA/ROCK signaling on UVB-induced oxidative damage, and to delineate the molecular mechanisms involved in the UVB-mediated inflammatory and apoptotic response. In HaCaT cells, we observed that blockage of RhoA/ROCK signaling with the inhibitor CT04 or Y27632 greatly inhibited the UVB-mediated increase in intracellular reactive oxygen species (ROS). Additionally, inhibition of RhoA/ROCK signaling reduced UVB-induced apoptosis, as exemplified by a reduction in DNA fragmentation, and also elevated anti-apoptotic Bcl-2 protein, concomitant with reduced levels of pro-apoptotic protein Bax, caspase-3 cleavage and decreased PARP-1 protein. The release of inflammatory mediators TNF-α, IL-1β, and IL-6 was also attenuated. Mechanically, we observed that blockage of RhoA/ROCK repressed the TAK1/NOD2-mediated NF-κB pathway in HaCaT cells exposed to UVB. Taken together, these data reveal that RhoA/ROCK signaling is one of the regulators contributing to oxidative damage and apoptosis in human keratinocytes, suggesting that RhoA/ROCK signaling has strong potential to be used as a useful therapeutic target in skin diseases including PV.

  8. TAK1 modulates satellite stem cell homeostasis and skeletal muscle repair

    Science.gov (United States)

    Ogura, Yuji; Hindi, Sajedah M.; Sato, Shuichi; Xiong, Guangyan; Akira, Shizuo; Kumar, Ashok

    2015-01-01

    Satellite cells are resident adult stem cells that are required for regeneration of skeletal muscle. However, signalling mechanisms that regulate satellite cell function are less understood. Here we demonstrate that transforming growth factor-β-activated kinase 1 (TAK1) is important in satellite stem cell homeostasis and function. Inactivation of TAK1 in satellite cells inhibits muscle regeneration in adult mice. TAK1 is essential for satellite cell proliferation and its inactivation causes precocious differentiation. Moreover, TAK1-deficient satellite cells exhibit increased oxidative stress and undergo spontaneous cell death, primarily through necroptosis. TAK1 is required for the activation of NF-κB and JNK in satellite cells. Forced activation of NF-κB improves survival and proliferation of TAK1-deficient satellite cells. Furthermore, TAK1-mediated activation of JNK is essential to prevent oxidative stress and precocious differentiation of satellite cells. Collectively, our study suggests that TAK1 is required for maintaining the pool of satellite stem cells and for regenerative myogenesis. PMID:26648529

  9. Transforming growth factor beta-activated kinase 1 (TAK1)-dependent checkpoint in the survival of dendritic cells promotes immune homeostasis and function.

    Science.gov (United States)

    Wang, Yanyan; Huang, Gonghua; Vogel, Peter; Neale, Geoffrey; Reizis, Boris; Chi, Hongbo

    2012-02-07

    Homeostatic control of dendritic cell (DC) survival is crucial for adaptive immunity, but the molecular mechanism is not well defined. Moreover, how DCs influence immune homeostasis under steady state remains unclear. Combining DC-specific and -inducible deletion systems, we report that transforming growth factor beta-activated kinase 1 (TAK1) is an essential regulator of DC survival and immune system homeostasis and function. Deficiency of TAK1 in CD11c(+) cells induced markedly elevated apoptosis, leading to the depletion of DC populations, especially the CD8(+) and CD103(+) DC subsets in lymphoid and nonlymphoid tissues, respectively. TAK1 also contributed to DC development by promoting the generation of DC precursors. Prosurvival signals from Toll-like receptors, CD40 and receptor activator of nuclear factor-κB (RANK) are integrated by TAK1 in DCs, which in turn mediated activation of downstream NF-κB and AKT-Foxo pathways and established a gene-expression program. TAK1 deficiency in DCs caused a myeloid proliferative disorder characterized by expansion of neutrophils and inflammatory monocytes, disrupted T-cell homeostasis, and prevented effective T-cell priming and generation of regulatory T cells. Moreover, TAK1 signaling in DCs was required to prevent myeloid proliferation even in the absence of lymphocytes, indicating a previously unappreciated regulatory mechanism of DC-mediated control of myeloid cell-dependent inflammation. Therefore, TAK1 orchestrates a prosurvival checkpoint in DCs that affects the homeostasis and function of the immune system.

  10. Myostatin induces interstitial fibrosis in the heart via TAK1 and p38.

    Science.gov (United States)

    Biesemann, Nadine; Mendler, Luca; Kostin, Sawa; Wietelmann, Astrid; Borchardt, Thilo; Braun, Thomas

    2015-09-01

    Myostatin, a member of the TGF-β superfamily of secreted growth factors, is a negative regulator of skeletal muscle growth. In the heart, it is expressed at lower levels compared to skeletal muscle but up-regulated under disease conditions. Cre recombinase-mediated inactivation of myostatin in adult cardiomyocytes leads to heart failure and increased mortality but cardiac function of surviving mice is restored after several weeks probably due to compensatory expression in non-cardiomyocytes. To study long-term effects of increased myostatin expression in the heart and to analyze the putative crosstalk between cardiomyocytes and fibroblasts, we overexpressed myostatin in cardiomyocytes. Increased expression of myostatin in heart muscle cells caused interstitial fibrosis via activation of the TAK-1-MKK3/6-p38 signaling pathway, compromising cardiac function in older mice. Our results uncover a novel role of myostatin in the heart and highlight the necessity for tight regulation of myostatin to maintain normal heart function.

  11. TGFβ activated kinase 1 (TAK1 at the crossroad of B cell receptor and Toll-like receptor 9 signaling pathways in human B cells.

    Directory of Open Access Journals (Sweden)

    Dániel Szili

    Full Text Available B cell development and activation are regulated by combined signals mediated by the B cell receptor (BCR, receptors for the B-cell activating factor of the tumor necrosis factor family (BAFF-R and the innate receptor, Toll-like receptor 9 (TLR9. However, the underlying mechanisms by which these signals cooperate in human B cells remain unclear. Our aim was to elucidate the key signaling molecules at the crossroads of BCR, BAFF-R and TLR9 mediated pathways and to follow the functional consequences of costimulation.Therefore we stimulated purified human B cells by combinations of anti-Ig, B-cell activating factor of the tumor necrosis factor family (BAFF and the TLR9 agonist, CpG oligodeoxynucleotide. Phosphorylation status of various signaling molecules, B cell proliferation, cytokine secretion, plasma blast generation and the frequency of IgG producing cells were investigated. We have found that BCR induced signals cooperate with BAFF-R- and TLR9-mediated signals at different levels of cell activation. BCR and BAFF- as well as TLR9 and BAFF-mediated signals cooperate at NFκB activation, while BCR and TLR9 synergistically costimulate mitogen activated protein kinases (MAPKs, ERK, JNK and p38. We show here for the first time that the MAP3K7 (TGF beta activated kinase, TAK1 is responsible for the synergistic costimulation of B cells by BCR and TLR9, resulting in an enhanced cell proliferation, plasma blast generation, cytokine and antibody production. Specific inhibitor of TAK1 as well as knocking down TAK1 by siRNA abrogates the synergistic signals. We conclude that TAK1 is a key regulator of receptor crosstalk between BCR and TLR9, thus plays a critical role in B cell development and activation.

  12. Roles of the kinase TAK1 in TRAF6-dependent signaling by CD40 and its oncogenic viral mimic, LMP1.

    Directory of Open Access Journals (Sweden)

    Kelly M Arcipowski

    Full Text Available The Epstein-Barr virus (EBV-encoded protein latent membrane protein 1 (LMP1 is essential for EBV-mediated B cell transformation and plays a critical role in the development of post-transplant B cell lymphomas. LMP1 also contributes to the exacerbation of autoimmune diseases such as systemic lupus erythematosus (SLE. LMP1 is a functional mimic of the tumor necrosis factor receptor (TNFR superfamily member CD40, and relies on TNFR-associated factor (TRAF adaptor proteins to mediate signaling. However, LMP1 activation signals to the B cell are amplified and sustained compared to CD40 signals. We previously demonstrated that LMP1 and CD40 use TRAF molecules differently. Although associating with CD40 and LMP1 via separate mechanisms, TRAF6 plays a significant role in signal transduction by both. It is unknown whether TRAF6 mediates CD40 versus LMP1 functions via distinct or shared pathways. In this study, we tested the hypothesis that TRAF6 uses the kinase TAK1 to trigger important signaling pathways following both CD40 and LMP1 stimulation. We determined that TAK1 was required for JNK activation and interleukin-6 (IL-6 production mediated by CD40 and LMP1, in both mouse and human B cells. Additionally, TRAF3 negatively regulated TRAF6-dependent, CD40-mediated TAK1 activation by limiting TRAF6 recruitment. This mode of regulation was not observed for LMP1 and may contribute to the dysregulation of LMP1 compared to CD40 signals.

  13. Lack of TAK1 in dendritic cells inhibits the contact hypersensitivity response induced by trichloroethylene in local lymph node assay

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Pan; Hongqian, Chu; Qinghe, Meng; Lanqin, Shang; Jianjun, Jiang; Xiaohua, Yang; Xuetao, Wei; Weidong, Hao, E-mail: whao@bjmu.edu.cn

    2016-09-15

    Trichloroethylene (TCE) is a ubiquitous environmental contaminant. Occupational TCE exposure has been associated with severe, generalized contact hypersensitivity (CHS) skin disorder. The development of CHS depends on innate and adaptive immune functions. Transforming growth factor-β activated kinase-1 (TAK1) controls the survival of dendritic cells (DCs) that affect the immune system homeostasis. We aimed to investigate the role of TAK1 activity in DC on TCE-induced CHS response. Control mice and DC-specific TAK1 deletion mice were treated with 80% (v/v) TCE using local lymph node assay (LLNA) to establish a TCE-induced CHS model. The draining lymph nodes (DLNs) were excised and the lymphocytes were measure for proliferation by BrdU-ELISA, T-cell phenotype analysis by flow cytometry and signaling pathway activation by western blot. The ears were harvested for histopathological analysis. Control mice in the 80% TCE group displayed an inflammatory response in the ears, increased lymphocyte proliferation, elevated regulatory T-cell and activated T-cell percentages, and more IFN-γ producing CD8{sup +} T cells in DLNs. In contrast to control mice, DC-specific TAK1 deletion mice in the 80% TCE group showed an abolished CHS response and this was associated with defective T-cell expansion, activation and IFN-γ production. This effect may occur through Jnk and NF-κB signaling pathways. Overall, this study demonstrates a pivotal role of TAK1 in DCs in controlling TCE-induced CHS response and suggests that targeting TAK1 function in DCs may be a viable approach to preventing and treating TCE-related occupational health hazards. - Highlights: • Lack of TAK1 in DC caused an abolished TCE-induced CHS response. • TAK1 in DCs was essential to maintain the homeostasis of T cells in TCE-induced CHS. • Intact TAK1 in DCs was critical to promote T-cell priming in TCE-induced CHS. • DC-specific TAK1 deficiency abolished the TCE-mediated phosphorylation of Jnk.

  14. Lack of TAK1 in dendritic cells inhibits the contact hypersensitivity response induced by trichloroethylene in local lymph node assay

    International Nuclear Information System (INIS)

    Yao, Pan; Hongqian, Chu; Qinghe, Meng; Lanqin, Shang; Jianjun, Jiang; Xiaohua, Yang; Xuetao, Wei; Weidong, Hao

    2016-01-01

    Trichloroethylene (TCE) is a ubiquitous environmental contaminant. Occupational TCE exposure has been associated with severe, generalized contact hypersensitivity (CHS) skin disorder. The development of CHS depends on innate and adaptive immune functions. Transforming growth factor-β activated kinase-1 (TAK1) controls the survival of dendritic cells (DCs) that affect the immune system homeostasis. We aimed to investigate the role of TAK1 activity in DC on TCE-induced CHS response. Control mice and DC-specific TAK1 deletion mice were treated with 80% (v/v) TCE using local lymph node assay (LLNA) to establish a TCE-induced CHS model. The draining lymph nodes (DLNs) were excised and the lymphocytes were measure for proliferation by BrdU-ELISA, T-cell phenotype analysis by flow cytometry and signaling pathway activation by western blot. The ears were harvested for histopathological analysis. Control mice in the 80% TCE group displayed an inflammatory response in the ears, increased lymphocyte proliferation, elevated regulatory T-cell and activated T-cell percentages, and more IFN-γ producing CD8 + T cells in DLNs. In contrast to control mice, DC-specific TAK1 deletion mice in the 80% TCE group showed an abolished CHS response and this was associated with defective T-cell expansion, activation and IFN-γ production. This effect may occur through Jnk and NF-κB signaling pathways. Overall, this study demonstrates a pivotal role of TAK1 in DCs in controlling TCE-induced CHS response and suggests that targeting TAK1 function in DCs may be a viable approach to preventing and treating TCE-related occupational health hazards. - Highlights: • Lack of TAK1 in DC caused an abolished TCE-induced CHS response. • TAK1 in DCs was essential to maintain the homeostasis of T cells in TCE-induced CHS. • Intact TAK1 in DCs was critical to promote T-cell priming in TCE-induced CHS. • DC-specific TAK1 deficiency abolished the TCE-mediated phosphorylation of Jnk.

  15. Transcriptional corepressors HIPK1 and HIPK2 control angiogenesis via TGF-β-TAK1-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Yulei Shang

    Full Text Available Several critical events dictate the successful establishment of nascent vasculature in yolk sac and in the developing embryos. These include aggregation of angioblasts to form the primitive vascular plexus, followed by the proliferation, differentiation, migration, and coalescence of endothelial cells. Although transforming growth factor-β (TGF-β is known to regulate various aspects of vascular development, the signaling mechanism of TGF-β remains unclear. Here we show that homeodomain interacting protein kinases, HIPK1 and HIPK2, are transcriptional corepressors that regulate TGF-β-dependent angiogenesis during embryonic development. Loss of HIPK1 and HIPK2 leads to marked up-regulations of several potent angiogenic genes, including Mmp10 and Vegf, which result in excessive endothelial proliferation and poor adherens junction formation. This robust phenotype can be recapitulated by siRNA knockdown of Hipk1 and Hipk2 in human umbilical vein endothelial cells, as well as in endothelial cell-specific TGF-β type II receptor (TβRII conditional mutants. The effects of HIPK proteins are mediated through its interaction with MEF2C, and this interaction can be further enhanced by TGF-β in a TAK1-dependent manner. Remarkably, TGF-β-TAK1 signaling activates HIPK2 by phosphorylating a highly conserved tyrosine residue Y-361 within the kinase domain. Point mutation in this tyrosine completely eliminates the effect of HIPK2 as a transcriptional corepressor in luciferase assays. Our results reveal a previously unrecognized role of HIPK proteins in connecting TGF-β signaling pathway with the transcriptional programs critical for angiogenesis in early embryonic development.

  16. Altered cerebellar development in nuclear receptor TAK1/ TR4 null mice is associated with deficits in GLAST(+) glia, alterations in social behavior, motor learning, startle reactivity, and microglia.

    Science.gov (United States)

    Kim, Yong-Sik; Harry, G Jean; Kang, Hong Soon; Goulding, David; Wine, Rob N; Kissling, Grace E; Liao, Grace; Jetten, Anton M

    2010-09-01

    Previously, deficiency in the expression of the nuclear orphan receptor TAK1 was found to be associated with delayed cerebellar granule cell migration and Purkinje cell maturation with a permanent deficit in foliation of lobules VI–VII, suggesting a role for TAK1 in cerebellum development. In this study, we confirm that TAK1-deficient (TAK1(−/−)) mice have a smaller cerebellum and exhibit a disruption of lobules VI–VII. We extended these studies and show that at postnatal day 7, TAK1(−/−) mice exhibit a delay in monolayer maturation of dysmorphic calbindin 28K-positive Purkinje cells. The astrocyte-specific glutamate transporter (GLAST) was expressed within Bergmann fibers and internal granule cell layer at significantly lower levels in the cerebellum of TAK1(−/−) mice. At PND21, Golgi-positive Purkinje cells in TAK1(−/−) mice displayed a smaller soma (18%) and shorter distance to first branch point (35%). Neuronal death was not observed in TAK1(−/−) mice at PND21; however, activated microglia were present in the cerebellum, suggestive of earlier cell death. These structural deficits in the cerebellum were not sufficient to alter motor strength, coordination, or activity levels; however, deficits in acoustic startle response, prepulse startle inhibition, and social interactions were observed. Reactions to a novel environment were inhibited in a light/dark chamber, open-field, and home-cage running wheel. TAK1(−/−) mice displayed a plateau in performance on the running wheel, suggesting a deficit in learning to coordinate performance on a motor task. These data indicate that TAK1 is an important transcriptional modulator of cerebellar development and neurodevelopmentally regulated behavior.

  17. Belinostat-induced apoptosis and growth inhibition in pancreatic cancer cells involve activation of TAK1-AMPK signaling axis

    International Nuclear Information System (INIS)

    Wang, Bing; Wang, Xin-bao; Chen, Li-yu; Huang, Ling; Dong, Rui-zen

    2013-01-01

    Highlights: •Belinostat activates AMPK in cultured pancreatic cancer cells. •Activation of AMPK is important for belinostat-induced cytotoxic effects. •ROS and TAK1 are involved in belinostat-induced AMPK activation. •AMPK activation mediates mTOR inhibition by belinostat. -- Abstract: Pancreatic cancer accounts for more than 250,000 deaths worldwide each year. Recent studies have shown that belinostat, a novel pan histone deacetylases inhibitor (HDACi) induces apoptosis and growth inhibition in pancreatic cancer cells. However, the underlying mechanisms are not fully understood. In the current study, we found that AMP-activated protein kinase (AMPK) activation was required for belinostat-induced apoptosis and anti-proliferation in PANC-1 pancreatic cancer cells. A significant AMPK activation was induced by belinostat in PANC-1 cells. Inhibition of AMPK by RNAi knockdown or dominant negative (DN) mutation significantly inhibited belinostat-induced apoptosis in PANC-1 cells. Reversely, AMPK activator AICAR and A-769662 exerted strong cytotoxicity in PANC-1 cells. Belinostat promoted reactive oxygen species (ROS) production in PANC-1 cells, increased ROS induced transforming growth factor-β-activating kinase 1 (TAK1)/AMPK association to activate AMPK. Meanwhile, anti-oxidants N-Acetyl-Cysteine (NAC) and MnTBAP as well as TAK1 shRNA knockdown suppressed belinostat-induced AMPK activation and PANC-1 cell apoptosis. In conclusion, we propose that belinostat-induced apoptosis and growth inhibition require the activation of ROS-TAK1-AMPK signaling axis in cultured pancreatic cancer cells

  18. Belinostat-induced apoptosis and growth inhibition in pancreatic cancer cells involve activation of TAK1-AMPK signaling axis

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Bing, E-mail: wangbin69@yahoo.com; Wang, Xin-bao; Chen, Li-yu; Huang, Ling; Dong, Rui-zen

    2013-07-19

    Highlights: •Belinostat activates AMPK in cultured pancreatic cancer cells. •Activation of AMPK is important for belinostat-induced cytotoxic effects. •ROS and TAK1 are involved in belinostat-induced AMPK activation. •AMPK activation mediates mTOR inhibition by belinostat. -- Abstract: Pancreatic cancer accounts for more than 250,000 deaths worldwide each year. Recent studies have shown that belinostat, a novel pan histone deacetylases inhibitor (HDACi) induces apoptosis and growth inhibition in pancreatic cancer cells. However, the underlying mechanisms are not fully understood. In the current study, we found that AMP-activated protein kinase (AMPK) activation was required for belinostat-induced apoptosis and anti-proliferation in PANC-1 pancreatic cancer cells. A significant AMPK activation was induced by belinostat in PANC-1 cells. Inhibition of AMPK by RNAi knockdown or dominant negative (DN) mutation significantly inhibited belinostat-induced apoptosis in PANC-1 cells. Reversely, AMPK activator AICAR and A-769662 exerted strong cytotoxicity in PANC-1 cells. Belinostat promoted reactive oxygen species (ROS) production in PANC-1 cells, increased ROS induced transforming growth factor-β-activating kinase 1 (TAK1)/AMPK association to activate AMPK. Meanwhile, anti-oxidants N-Acetyl-Cysteine (NAC) and MnTBAP as well as TAK1 shRNA knockdown suppressed belinostat-induced AMPK activation and PANC-1 cell apoptosis. In conclusion, we propose that belinostat-induced apoptosis and growth inhibition require the activation of ROS-TAK1-AMPK signaling axis in cultured pancreatic cancer cells.

  19. Shrimp TAB1 interacts with TAK1 and p38 and activates the host innate immune response to bacterial infection.

    Science.gov (United States)

    Wang, Sheng; Li, Mengqiao; Yin, Bin; Li, Haoyang; Xiao, Bang; Lǚ, Kai; Huang, Zhijian; Li, Sedong; He, Jianguo; Li, Chaozheng

    2017-08-01

    Mammalian TAB1 has been previously identified as transforming growth factor-β (TGF-β)-activated kinase 1 (TAK1) binding protein, which functions as the activator of TAK1 and p38. This report, for the first time, identified and characterized the homolog of TAB1 in shrimp, to be specific, the homolog gene from Litopenaeus vannamei, containing a 1560-bp open reading frame (ORF) that encoded a putative protein of 519 amino acids with the conserved PP2Cc (Serine/threonine phosphatases, family 2C, catalytic) domain in N-terminal and a TAK1 binding motif in C-terminus, has been cloned and named LvTAB1. LvTAB1 was most abundant in gills and its expression could respond significantly to a series of stimuli, including LPS, Vibrio parahemolyticus and Staphylococcus aureus. Moreover, Co-immunoprecipitation (Co-IP) experiments showed that LvTAB1 could combine with LvTAK1 as well as Lvp38, two members of IMD-NF-κB/MAPK pathway, which meant LvTAB1 could have a role in regulating the activities of these kinases. Over-expression of LvTAB1 in drosophila S2 cells could improve the transcriptional levels of antimicrobial peptide genes (AMPs) such as Diptericin (Dpt), the hallmark of drosophila NF-κB activated genes, indicating its activation effect on NF-κB pathway. Furthermore, suppression of LvTAB1 expression in vivo by RNA-interference increased the sensibility of shrimps to V. parahaemolyticus infection, implying its protective role against bacterial infection. In conclusion, these results provide some insight into the function of LvTAB1 during bacterial infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Momordica charantia Inhibits Inflammatory Responses in Murine Macrophages via Suppression of TAK1.

    Science.gov (United States)

    Yang, Woo Seok; Yang, Eunju; Kim, Min-Jeong; Jeong, Deok; Yoon, Deok Hyo; Sung, Gi-Ho; Lee, Seungihm; Yoo, Byong Chul; Yeo, Seung-Gu; Cho, Jae Youl

    2018-01-01

    Momordica charantia known as bitter melon is a representative medicinal plant reported to exhibit numerous pharmacological activities such as antibacterial, antidiabetic, anti-inflammatory, anti-oxidant, antitumor, and hypoglycemic actions. Although this plant has high ethnopharmacological value for treating inflammatory diseases, the molecular mechanisms by which it inhibits the inflammatory response are not fully understood. In this study, we aim to identify the anti-inflammatory mechanism of this plant. To this end, we studied the effects of its methanol extract (Mc-ME) on lipopolysaccharide (LPS)-stimulated RAW264.7 macrophages. Specifically, we evaluated nitric oxide (NO) production, mRNA expression of inflammatory genes, luciferase reporter gene activity, and putative molecular targets. Mc-ME blocked NO production in a dose-dependent manner in RAW264.7 cells; importantly, no cytotoxicity was observed. Moreover, the mRNA expression levels of inducible NO synthase (iNOS) and cyclooxygenase (COX)-2 were decreased by Mc-ME treatment in a dose-dependent manner. Luciferase assays and nuclear lysate immunoblotting analyses strongly indicated that Mc-ME decreases the levels of p65 [a nuclear factor (NF)-[Formula: see text]B subunit] and c-Fos [an activator protein (AP)-1 subunit]. Whole lysate immunoblotting assays, luciferase assays, and overexpression experiments suggested that transforming growth factor [Formula: see text]-activated kinase 1 (TAK1) is targeted by Mc-ME, thereby suppressing NF-[Formula: see text]B and AP-1 activity via downregulation of extracellular signal-regulated kinases (ERKs) and AKT. These results strongly suggest that Mc-ME exerts its anti-inflammatory activity by reducing the action of TAK1, which also affects the activation of NF-[Formula: see text]B and AP-1.

  1. In vivo knockdown of TAK1 accelerates bone marrow proliferation/differentiation and induces systemic inflammation

    NARCIS (Netherlands)

    Vink, Paul M.; Smout, Wendy M.; Driessen-Engels, Lilian J.; de Bruin, Alex M.; Delsing, Dianne; Krajnc-Franken, Magda A.; Jansen, Aswin J.; Rovers, Eric F.; van Puijenbroek, André A.; Kaptein, Allard; Nolte, Martijn A.; Garritsen, Anja; van Eenennaam, Hans

    2013-01-01

    TAK1 (TGF-β Activated Kinase 1) is a MAPK kinase kinase, which activates the p38- and JNK-MAPK and NF-κB pathways downstream of receptors such as Toll-Like-, cytokine- and T-cell and B-cell receptors. Representing such an important node in the pro-inflammatory signal-transduction network, the

  2. Activation of TAK1 by MYD88 L265P drives malignant B-cell Growth in non-Hodgkin lymphoma

    International Nuclear Information System (INIS)

    Ansell, S M; Hodge, L S; Secreto, F J; Manske, M; Braggio, E; Price-Troska, T; Ziesmer, S; Li, Y; Johnson, S H; Hart, S N; Kocher, J-P A; Vasmatzis, G; Chanan-Kahn, A; Gertz, M; Fonseca, R; Dogan, A; Cerhan, J R; Novak, A J

    2014-01-01

    Massively parallel sequencing analyses have revealed a common mutation within the MYD88 gene (MYD88 L265P ) occurring at high frequencies in many non-Hodgkin lymphomas (NHLs) including the rare lymphoplasmacytic lymphoma, Waldenström's macroglobulinemia (WM). Using whole-exome sequencing, Sanger sequencing and allele-specific PCR, we validate the initial studies and detect the MYD88 L265P mutation in the tumor genome of 97% of WM patients analyzed (n=39). Due to the high frequency of MYD88 mutation in WM and other NHL, and its known effects on malignant B-cell survival, therapeutic targeting of MYD88 signaling pathways may be clinically useful. However, we are lacking a thorough characterization of the role of intermediary signaling proteins on the biology of MYD88 L265P -expressing B cells. We report here that MYD88 L265P signaling is constitutively active in both WM and diffuse large B-cell lymphoma cells leading to heightened MYD88 L265P , IRAK and TRAF6 oligomerization and NF-κB activation. Furthermore, we have identified the signaling protein, TAK1, to be an essential mediator of MYD88 L265P -driven signaling, cellular proliferation and cytokine secretion in malignant B cells. Our studies highlight the biological significance of MYD88 L265P in NHL and reveal TAK1 inhibition to be a potential therapeutic strategy for the treatment of WM and other diseases characterized by MYD88 L265P

  3. Lack of TAK1 in dendritic cells inhibits the contact hypersensitivity response induced by trichloroethylene in local lymph node assay.

    Science.gov (United States)

    Yao, Pan; Hongqian, Chu; Qinghe, Meng; Lanqin, Shang; Jianjun, Jiang; Xiaohua, Yang; Xuetao, Wei; Weidong, Hao

    2016-09-15

    Trichloroethylene (TCE) is a ubiquitous environmental contaminant. Occupational TCE exposure has been associated with severe, generalized contact hypersensitivity (CHS) skin disorder. The development of CHS depends on innate and adaptive immune functions. Transforming growth factor-β activated kinase-1 (TAK1) controls the survival of dendritic cells (DCs) that affect the immune system homeostasis. We aimed to investigate the role of TAK1 activity in DC on TCE-induced CHS response. Control mice and DC-specific TAK1 deletion mice were treated with 80% (v/v) TCE using local lymph node assay (LLNA) to establish a TCE-induced CHS model. The draining lymph nodes (DLNs) were excised and the lymphocytes were measure for proliferation by BrdU-ELISA, T-cell phenotype analysis by flow cytometry and signaling pathway activation by western blot. The ears were harvested for histopathological analysis. Control mice in the 80% TCE group displayed an inflammatory response in the ears, increased lymphocyte proliferation, elevated regulatory T-cell and activated T-cell percentages, and more IFN-γ producing CD8(+) T cells in DLNs. In contrast to control mice, DC-specific TAK1 deletion mice in the 80% TCE group showed an abolished CHS response and this was associated with defective T-cell expansion, activation and IFN-γ production. This effect may occur through Jnk and NF-κB signaling pathways. Overall, this study demonstrates a pivotal role of TAK1 in DCs in controlling TCE-induced CHS response and suggests that targeting TAK1 function in DCs may be a viable approach to preventing and treating TCE-related occupational health hazards. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Toll-Like Receptor 9-Dependent AMPKα Activation Occurs via TAK1 and Contributes to RhoA/ROCK Signaling and Actin Polymerization in Vascular Smooth Muscle Cells.

    Science.gov (United States)

    McCarthy, Cameron G; Wenceslau, Camilla F; Ogbi, Safia; Szasz, Theodora; Webb, R Clinton

    2018-04-01

    Traditionally, Toll-like receptor 9 (TLR9) signals through an MyD88-dependent cascade that results in proinflammatory gene transcription. Recently, it was reported that TLR9 also participates in a stress tolerance signaling cascade in nonimmune cells. In this noncanonical pathway, TLR9 binds to and inhibits sarcoplasmic/endoplasmic reticulum Ca 2+ -ATPase 2 (SERCA2), modulating intracellular calcium handling, and subsequently resulting in the activation of 5'-AMP-activated protein kinase α (AMPK α ). We have previously reported that TLR9 causes increased contraction in isolated arteries; however, the mechanisms underlying this vascular dysfunction need to be further clarified. Therefore, we hypothesized that noncanonical TLR9 signaling was also present in vascular smooth muscle cells (VSMCs) and that it mediates enhanced contractile responses through SERCA2 inhibition. To test these hypotheses, aortic microsomes, aortic VSMCs, and isolated arteries from male Sprague-Dawley rats were incubated with vehicle or TLR9 agonist (ODN2395). Despite clear AMPK α activation after treatment with ODN2395, SERCA2 activity was unaffected. Alternatively, ODN2395 caused the phosphorylation of AMPK α via transforming growth factor β -activated kinase 1 (TAK1), a kinase involved in TLR9 inflammatory signaling. Downstream, we hypothesized that that TLR9 activation of AMPK α may be important in mediating actin cytoskeleton reorganization. ODN2395 significantly increased the filamentous-to-globular actin ratio, as well as indices of RhoA/Rho-associated protein kinase (ROCK) activation, with the latter being prevented by AMPK α inhibition. In conclusion, AMPK α phosphorylation after TLR9 activation in VSMCs appears to be an extension of traditional inflammatory signaling via TAK1, as opposed to SERCA2 inhibition and the noncanonical pathway. Nonetheless, TLR9-AMPK α signaling can mediate VSMC function via RhoA/ROCK activation and actin polymerization. Copyright © 2018 by The

  5. TRAF6 promotes myogenic differentiation via the TAK1/p38 mitogen-activated protein kinase and Akt pathways.

    Directory of Open Access Journals (Sweden)

    Fang Xiao

    Full Text Available p38 mitogen-activated protein kinase (MAPK is an essential kinase involved in myogenic differentiation. Although many substrates of p38 MAPK have been identified, little is known about its upstream activators during myogenic differentiation. TRAF6 is known to function in cytokine signaling during inflammatory responses. However, not much is known about its role in myogenic differentiation and muscle regeneration. We showed here that TRAF6 and its intrinsic ubiquitin E3 ligase activity are required for myogenic differentiation. In mouse myoblasts, knockdown of TRAF6 compromised the p38 MAPK and Akt pathways, while deliberate activation of either pathway rescued the differentiation defect caused by TRAF6 knockdown. TAK1 acted as a key signal transducer downstream of TRAF6 in myogenic differentiation. In vivo, knockdown of TRAF6 in mouse muscles compromised the injury-induced muscle regeneration without impairing macrophage infiltration and myoblast proliferation. Collectively, we demonstrated that TRAF6 promotes myogenic differentiation and muscle regeneration via the TAK1/p38 MAPK and Akt pathways.

  6. Norisoboldine suppresses osteoclast differentiation through preventing the accumulation of TRAF6-TAK1 complexes and activation of MAPKs/NF-κB/c-Fos/NFATc1 Pathways.

    Directory of Open Access Journals (Sweden)

    Zhi-Feng Wei

    Full Text Available Norisoboldine (NOR is the main alkaloid constituent in the dry root of Lindera aggregata (Sims Kosterm. (L. strychnifolia Vill.. As reported previously, orally administered NOR displayed a robust inhibition of joint bone destruction present in both mouse collagen-induced arthritis and rat adjuvant-induced arthritis with lower efficacious doses than that required for ameliorating systemic inflammation. This attracted us to assess the effects of NOR on differentiation and function of osteoclasts, primary effector cells for inflammatory bone destruction, to get insight into its anti-rheumatoid arthritis mechanisms. Both RAW264.7 cells and mouse bone marrow-derived macrophages (BMMs were stimulated with RANKL (100 ng/mL to establish osteoclast differentiation models. ELISA, RT-PCR, gelatin zymography, western blotting, immunoprecipitation and EMSA were used to reveal related signalling pathways. NOR (10 and 30 µM, without significant cytotoxicity, showed significant reduction of the number of osteoclasts and the resorption pit areas, and it targeted osteoclast differentiation at the early stage. In conjunction with the anti-resorption effect of NOR, mRNA levels of cathepsin K and MMP-9 were decreased, and the activity of MMP-9 was attenuated. Furthermore, our mechanistic studies indicated that NOR obviously suppressed the ubiquitination of TRAF6, the accumulation of TRAF6-TAK1 complexes and the activation of ERK and p38 MAPK, and reduced the nuclear translocation of NF-κB-p65 and DNA-binding activity of NF-κB. However, NOR had little effect on expressions of TRAF6 or the phosphorylation and degradation of IκBα. Moreover, NOR markedly inhibited expressions of transcription factor NFATc1, but not c-Fos. Intriguingly, the subsequent nuclear translocations of c-Fos and NFATc1 were substantially down-regulated. Hence, we demonstrated for the first time that preventing the differentiation and function of osteoclasts at the early stage was an

  7. Regulation of metabolism by the Mediator complex.

    Science.gov (United States)

    Youn, Dou Yeon; Xiaoli, Alus M; Pessin, Jeffrey E; Yang, Fajun

    2016-01-01

    The Mediator complex was originally discovered in yeast, but it is conserved in all eukaryotes. Its best-known function is to regulate RNA polymerase II-dependent gene transcription. Although the mechanisms by which the Mediator complex regulates transcription are often complicated by the context-dependent regulation, this transcription cofactor complex plays a pivotal role in numerous biological pathways. Biochemical, molecular, and physiological studies using cancer cell lines or model organisms have established the current paradigm of the Mediator functions. However, the physiological roles of the mammalian Mediator complex remain poorly defined, but have attracted a great interest in recent years. In this short review, we will summarize some of the reported functions of selective Mediator subunits in the regulation of metabolism. These intriguing findings suggest that the Mediator complex may be an important player in nutrient sensing and energy balance in mammals.

  8. Transcription regulation by the Mediator complex.

    Science.gov (United States)

    Soutourina, Julie

    2018-04-01

    Alterations in the regulation of gene expression are frequently associated with developmental diseases or cancer. Transcription activation is a key phenomenon in the regulation of gene expression. In all eukaryotes, mediator of RNA polymerase II transcription (Mediator), a large complex with modular organization, is generally required for transcription by RNA polymerase II, and it regulates various steps of this process. The main function of Mediator is to transduce signals from the transcription activators bound to enhancer regions to the transcription machinery, which is assembled at promoters as the preinitiation complex (PIC) to control transcription initiation. Recent functional studies of Mediator with the use of structural biology approaches and functional genomics have revealed new insights into Mediator activity and its regulation during transcription initiation, including how Mediator is recruited to transcription regulatory regions and how it interacts and cooperates with PIC components to assist in PIC assembly. Novel roles of Mediator in the control of gene expression have also been revealed by showing its connection to the nuclear pore and linking Mediator to the regulation of gene positioning in the nuclear space. Clear links between Mediator subunits and disease have also encouraged studies to explore targeting of this complex as a potential therapeutic approach in cancer and fungal infections.

  9. The Mediator complex and transcription regulation

    Science.gov (United States)

    Poss, Zachary C.; Ebmeier, Christopher C.

    2013-01-01

    The Mediator complex is a multi-subunit assembly that appears to be required for regulating expression of most RNA polymerase II (pol II) transcripts, which include protein-coding and most non-coding RNA genes. Mediator and pol II function within the pre-initiation complex (PIC), which consists of Mediator, pol II, TFIIA, TFIIB, TFIID, TFIIE, TFIIF and TFIIH and is approximately 4.0 MDa in size. Mediator serves as a central scaffold within the PIC and helps regulate pol II activity in ways that remain poorly understood. Mediator is also generally targeted by sequence-specific, DNA-binding transcription factors (TFs) that work to control gene expression programs in response to developmental or environmental cues. At a basic level, Mediator functions by relaying signals from TFs directly to the pol II enzyme, thereby facilitating TF-dependent regulation of gene expression. Thus, Mediator is essential for converting biological inputs (communicated by TFs) to physiological responses (via changes in gene expression). In this review, we summarize an expansive body of research on the Mediator complex, with an emphasis on yeast and mammalian complexes. We focus on the basics that underlie Mediator function, such as its structure and subunit composition, and describe its broad regulatory influence on gene expression, ranging from chromatin architecture to transcription initiation and elongation, to mRNA processing. We also describe factors that influence Mediator structure and activity, including TFs, non-coding RNAs and the CDK8 module. PMID:24088064

  10. Mediator: A key regulator of plant development.

    Science.gov (United States)

    Buendía-Monreal, Manuel; Gillmor, C Stewart

    2016-11-01

    Mediator is a multiprotein complex that regulates transcription at the level of RNA pol II assembly, as well as through regulation of chromatin architecture, RNA processing and recruitment of epigenetic marks. Though its modular structure is conserved in eukaryotes, its subunit composition has diverged during evolution and varies in response to environmental and tissue-specific inputs, suggesting different functions for each subunit and/or Mediator conformation. In animals, Mediator has been implicated in the control of differentiation and morphogenesis through modulation of numerous signaling pathways. In plants, studies have revealed roles for Mediator in regulation of cell division, cell fate and organogenesis, as well as developmental timing and hormone responses. We begin this review with an overview of biochemical mechanisms of yeast and animal Mediator that are likely to be conserved in all eukaryotes, as well as a brief discussion of the role of Mediator in animal development. We then present a comprehensive review of studies of the role of Mediator in plant development. Finally, we point to important questions for future research on the role of Mediator as a master coordinator of development. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. HTLV-1 Tax Stimulates Ubiquitin E3 Ligase, Ring Finger Protein 8, to Assemble Lysine 63-Linked Polyubiquitin Chains for TAK1 and IKK Activation.

    Science.gov (United States)

    Ho, Yik-Khuan; Zhi, Huijun; Bowlin, Tara; Dorjbal, Batsukh; Philip, Subha; Zahoor, Muhammad Atif; Shih, Hsiu-Ming; Semmes, Oliver John; Schaefer, Brian; Glover, J N Mark; Giam, Chou-Zen

    2015-08-01

    Human T lymphotropic virus type 1 (HTLV-1) trans-activator/oncoprotein, Tax, impacts a multitude of cellular processes, including I-κB kinase (IKK)/NF-κB signaling, DNA damage repair, and mitosis. These activities of Tax have been implicated in the development of adult T-cell leukemia (ATL) in HTLV-1-infected individuals, but the underlying mechanisms remain obscure. IKK and its upstream kinase, TGFβ-activated kinase 1 (TAK1), contain ubiquitin-binding subunits, NEMO and TAB2/3 respectively, which interact with K63-linked polyubiquitin (K63-pUb) chains. Recruitment to K63-pUb allows cross auto-phosphorylation and activation of TAK1 to occur, followed by TAK1-catalyzed IKK phosphorylation and activation. Using cytosolic extracts of HeLa and Jurkat T cells supplemented with purified proteins we have identified ubiquitin E3 ligase, ring finger protein 8 (RNF8), and E2 conjugating enzymes, Ubc13:Uev1A and Ubc13:Uev2, to be the cellular factors utilized by Tax for TAK1 and IKK activation. In vitro, the combination of Tax and RNF8 greatly stimulated TAK1, IKK, IκBα and JNK phosphorylation. In vivo, RNF8 over-expression augmented while RNF8 ablation drastically reduced canonical NF-κB activation by Tax. Activation of the non-canonical NF-κB pathway by Tax, however, is unaffected by the loss of RNF8. Using purified components, we further demonstrated biochemically that Tax greatly stimulated RNF8 and Ubc13:Uev1A/Uev2 to assemble long K63-pUb chains. Finally, co-transfection of Tax with increasing amounts of RNF8 greatly induced K63-pUb assembly in a dose-dependent manner. Thus, Tax targets RNF8 and Ubc13:Uev1A/Uev2 to promote the assembly of K63-pUb chains, which signal the activation of TAK1 and multiple downstream kinases including IKK and JNK. Because of the roles RNF8 and K63-pUb chains play in DNA damage repair and cytokinesis, this mechanism may also explain the genomic instability of HTLV-1-transformed T cells and ATL cells.

  12. Depolarization-mediated regulation of alternative splicing

    Directory of Open Access Journals (Sweden)

    Alok eSharma

    2011-12-01

    Full Text Available Alternative splicing in eukaryotes plays an important role in regulating gene expression by selectively including alternative exons. A wealth of information has been accumulated that explains how alternative exons are selected in a developmental stage- or tissue-specific fashion. However, our knowledge of how cells respond to environmental changes to alter alternative splicing is very limited. For example, although a number of alternative exons have been shown to be regulated by calcium level alterations, the underlying mechanisms are not well understood. As calcium signaling in neurons plays a crucial role in essential neuronal functions such as learning and memory formation, it is important to understand how this process is regulated at every level in gene expression. The significance of the dynamic control of alternative splicing in response to changes of calcium levels has been largely unappreciated. In this communication, we will summarize the recent advances in calcium signaling-mediated alternative splicing that have provided some insights into the important regulatory mechanisms. In addition to describing the cis-acting RNA elements on the pre-mRNA molecules that respond to changes of intracellular calcium levels, we will summarize how splicing regulators change and affect alternative splicing in this process. We will also discuss a novel mode of calcium-mediated splicing regulation at the level of chromatin structure and transcription.

  13. Emotion regulation mediates age differences in emotions.

    Science.gov (United States)

    Yeung, Dannii Y; Wong, Carmen K M; Lok, David P P

    2011-04-01

    This study aimed at testing the proposition of socioemotional selectivity theory whether older people would use more antecedent-focused emotion regulatory strategies like cognitive reappraisal but fewer response-focused strategies like suppression. It also aimed at investigating the mediating role of emotion regulation on the relationship between age and emotions. The sample consisted of 654 younger and older adults aged between 18 and 64. Results showed that age was significantly associated with positive emotions and cognitive reappraisal. No difference was found in negative emotions and suppression between younger and older adults. Cognitive reappraisal partially mediated the effect of age on positive emotions. Findings of this study contribute to our understanding of the underlying mechanism of age variations in emotional experiences.

  14. Thyroid hormone activates rat liver adenosine 5,-monophosphate-activated protein kinase: relation to CaMKKb, TAK1 and LKB1 expression and energy status.

    Science.gov (United States)

    Vargas, R; Ortega, Y; Bozo, V; Andrade, M; Minuzzi, G; Cornejo, P; Fernandez, V; Videla, L A

    2013-01-01

    AMP-activated protein kinase (AMPK) is a sensor of energy status supporting cellular energy homeostasis that may represent the metabolic basis for 3,3,,5-triiodo-L-thyronine (T3) liver preconditioning. Functionally transient hyperthyroid state induced by T3 (single dose of 0.1 mg/kg) in fed rats led to upregulation of mRNA expression (RT-PCR) and protein phosphorylation (Western blot) of hepatic AMPK at 8 to 36 h after treatment. AMPK Thr 172 phosphorylation induced by T3 is associated with enhanced mRNA expression of the upstream kinases Ca2+ -calmodulin-dependent protein kinase kinase-beta (CaMKKbeta) and transforming growth-factor-beta-activated kinase-1 (TAK1), with increased protein levels of CaMKKbeta and higher TAK1 phosphorylation, without changes in those of the liver kinase B1 (LKB1) signaling pathway. Liver contents of AMP and ADP were augmented by 291 percent and 44 percent by T3 compared to control values (p less than 0.05), respectively, whereas those of ATP decreased by 64% (p less than 0.05), with no significant changes in the total content of adenine nucleotides (AMP + ADP + ATP) at 24 h after T3 administration. Consequently, hepatic ATP/ADP content ratios exhibited 64 percent diminution (p less than 0.05) and those of AMP/ATP increased by 425 percent (p less than 0.05) in T3-treated rats over controls. It is concluded that in vivoT3 administration triggers liver AMPK upregulation in association with significant enhancements in AMPK mRNA expression, AMPK phosphorylation coupled to CaMKKbeta and TAK1 activation, and in AMP/ATP ratios, which may promote enhanced AMPK activity to support T3-induced energy consuming processes such as those of liver preconditioning.

  15. Function and regulation of the Mediator complex.

    Science.gov (United States)

    Conaway, Ronald C; Conaway, Joan Weliky

    2011-04-01

    Over the past few years, advances in biochemical and genetic studies of the structure and function of the Mediator complex have shed new light on its subunit architecture and its mechanism of action in transcription by RNA polymerase II (pol II). The development of improved methods for reconstitution of recombinant Mediator subassemblies is enabling more in-depth analyses of basic features of the mechanisms by which Mediator interacts with and controls the activity of pol II and the general initiation factors. The discovery and characterization of multiple, functionally distinct forms of Mediator characterized by the presence or absence of the Cdk8 kinase module have led to new insights into how Mediator functions in both Pol II transcription activation and repression. Finally, progress in studies of the mechanisms by which the transcriptional activation domains (ADs) of DNA binding transcription factors target Mediator have brought to light unexpected complexities in the way Mediator participates in signal transduction. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. Investigating the Regulation of Estrogen Receptor-Mediated Transcription

    National Research Council Canada - National Science Library

    Thackray, Varykina

    2002-01-01

    ...-mediated regulation of specific target genes are still lacking. We have developed an estrogen responsive system in the fruit fly, Drosophila melanogaster in order to explore the functional interactions between ER and other cellular proteins...

  17. Investigating the Regulation of Estrogen Receptor-Mediated Transcription

    National Research Council Canada - National Science Library

    Thackray, Varykina

    2001-01-01

    ...-mediated regulation of specific target genes are still lacking. We have developed an estrogen responsive system in the fruit fly, Drosophila melanogaster in order to explore the functional interactions between ER and other cellular proteins...

  18. Therapeutic effect of methyl salicylate 2-O-β-d-lactoside on LPS-induced acute lung injury by inhibiting TAK1/NF-kappaB phosphorylation and NLRP3 expression.

    Science.gov (United States)

    Yang, Shengqian; Yu, Ziru; Yuan, Tianyi; Wang, Lin; Wang, Xue; Yang, Haiguang; Sun, Lan; Wang, Yuehua; Du, Guanhua

    2016-11-01

    Acute lung injury (ALI), characterized by pulmonary edema and inflammatory cell infiltration, is a common syndrome of acute hypoxemic respiratory failure. Methyl salicylate 2-O-β-d-lactoside (MSL), a natural derivative of salicylate extracted from Gaultheria yunnanensis (Franch.) Rehder, was reported to have potent anti-inflammatory effects on the progression of collagen or adjuvant-induced arthritis in vivo and in vitro. The aim of this study is to investigate the therapeutic effect of MSL on lipopolysaccharide (LPS)-induced acute lung injury and reveal underlying molecular mechanisms. Our results showed that MSL significantly ameliorated pulmonary edema and histological severities, and inhibited IL-6 and IL-1β production in LPS-induced ALI mice. MSL also reduced MPO activity in lung tissues and the number of inflammatory cells in BALF. Moreover, we found that MSL significantly inhibited LPS-induced TAK1 and NF-κB p65 phosphorylation, as well as the expression of NLRP3 protein in lung tissues. Furthermore, MSL significantly inhibited LPS-induced TAK1 and NF-κB p65 phosphorylation in Raw264.7 cells. In addition, MSL significantly inhibited nuclear translocation of NF-κB p65 in cells treated with LPS in vitro. Taken together, our results suggested that MSL exhibited a therapeutic effect on LPS-induced ALI by inhibiting TAK1/NF-κB phosphorylation and NLRP3 expression. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Negative regulators of brown adipose tissue (BAT)-mediated thermogenesis.

    Science.gov (United States)

    Sharma, Bal Krishan; Patil, Mallikarjun; Satyanarayana, Ande

    2014-12-01

    Brown adipose tissue (BAT) is specialized for energy expenditure, a process called adaptive thermogenesis. PET-CT scans recently demonstrated the existence of metabolically active BAT in adult humans, which revitalized our interest in BAT. Increasing the amount and/or activity of BAT holds tremendous promise for the treatment of obesity and its associated diseases. PGC1α is the master regulator of UCP1-mediated thermogenesis in BAT. A number of proteins have been identified to influence thermogenesis either positively or negatively through regulating the expression or transcriptional activity of PGC1α. Therefore, BAT activation can be achieved by either inducing the expression of positive regulators of PGC1α or by inhibiting the repressors of the PGC1α/UCP1 pathway. Here, we review the most important negative regulators of PGC1α/UCP1 signaling and their mechanism of action in BAT-mediated thermogenesis. © 2014 Wiley Periodicals, Inc.

  20. Theoretical studies on sRNA-mediated regulation in bacteria

    Science.gov (United States)

    Chang, Xiao-Xue; Xu, Liu-Fang; Shi, Hua-Lin

    2015-12-01

    Small RNA(sRNA)-mediated post-transcriptional regulation differs from protein-mediated regulation. Through base-pairing, sRNA can regulate the target mRNA in a catalytic or stoichiometric manner. Some theoretical models were built for comparison of the protein-mediated and sRNA-mediated modes in the steady-state behaviors and noise properties. Many experiments demonstrated that a single sRNA can regulate several mRNAs, which causes crosstalk between the targets. Here, we focus on some models in which two target mRNAs are silenced by the same sRNA to discuss their crosstalk features. Additionally, the sequence-function relationship of sRNA and its role in the kinetic process of base-pairing have been highlighted in model building. Project supported by the National Basic Research Program of China (Grant No. 2013CB834100), the National Natural Science Foundation of China (Grant Nos. 11121403 and 11274320), the Open Project Program of State Key Laboratory of Theoretical Physics, Institute of Theoretical Physics, Chinese Academy of Sciences, China (Grant No. Y4KF171CJ1), the National Natural Science Foundation for Young Scholar of China (Grant No. 11304115), and the China Postdoctoral Science Foundation (Grant No. 2013M541282).

  1. Pro-Resolving Mediators in Regulating and Conferring Macrophage Function

    Directory of Open Access Journals (Sweden)

    Jesmond Dalli

    2017-11-01

    Full Text Available Macrophages are central in coordinating the host response to both sterile and infective insults. Clearance of apoptotic cells and cellular debris is a key biological action preformed by macrophages that paves the way to the resolution of local inflammation, repair and regeneration of damaged tissues, and re-establishment of function. The essential fatty acid-derived autacoids termed specialized pro-resolving mediators (SPM play central roles in promoting these processes. In the present article, we will review the role of microvesicles in controlling macrophage efferocytosis and SPM production. We will also discuss the role of both apoptotic cells and microvesicles in providing substrate for transcellular biosynthesis of several SPM families during efferocyotsis. In addition, this article will discuss the biological actions of the recently uncovered macrophage-derived SPM termed maresins. These mediators are produced via 14-lipoxygenation of docosahexaenoic acid that is either enzymatically converted to mediators carrying two hydroxyl groups or to autacoids that are peptide-lipid conjugates, coined maresin conjugates in tissue regeneration. The formation of these mediators is temporally regulated during acute self-limited infectious-inflammation where they promote the uptake and clearance of apoptotic cells, regulate several aspects of the tissue repair and regeneration, and display potent anti-nociceptive actions.

  2. Histone deacetylase-mediated regulation of endolysosomal pH.

    Science.gov (United States)

    Prasad, Hari; Rao, Rajini

    2018-05-04

    The pH of the endolysosomal system is tightly regulated by a balance of proton pump and leak mechanisms that are critical for storage, recycling, turnover, and signaling functions in the cell. Dysregulation of endolysosomal pH has been linked to aging, amyloidogenesis, synaptic dysfunction, and various neurodegenerative disorders, including Alzheimer's disease. Therefore, understanding the mechanisms that regulate luminal pH may be key to identifying new targets for managing these disorders. Meta-analysis of yeast microarray databases revealed that nutrient-limiting conditions inhibited the histone deacetylase (HDAC) Rpd3 and thereby up-regulated transcription of the endosomal Na + /H + exchanger Nhx1, resulting in vacuolar alkalinization. Consistent with these findings, Rpd3 inhibition by the HDAC inhibitor and antifungal drug trichostatin A induced Nhx1 expression and vacuolar alkalinization. Bioinformatics analysis of Drosophila and mouse databases revealed that caloric control of the Nhx1 orthologs DmNHE3 and NHE6, respectively, is also mediated by HDACs. We show that NHE6 is a target of the transcription factor cAMP-response element-binding protein (CREB), a known regulator of cellular responses to low-nutrient conditions, providing a molecular mechanism for nutrient- and HDAC-dependent regulation of endosomal pH. Of note, pharmacological targeting of the CREB pathway to increase NHE6 expression helped regulate endosomal pH and correct defective clearance of amyloid Aβ in an apoE4 astrocyte model of Alzheimer's disease. These observations from yeast, fly, mouse, and cell culture models point to an evolutionarily conserved mechanism for HDAC-mediated regulation of endosomal NHE expression. Our insights offer new therapeutic strategies for modulation of endolysosomal pH in fungal infection and human disease. © 2018 Prasad and Rao.

  3. DMPD: Negative regulation of cytoplasmic RNA-mediated antiviral signaling. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 18703349 Negative regulation of cytoplasmic RNA-mediated antiviral signaling. Komur...Show Negative regulation of cytoplasmic RNA-mediated antiviral signaling. PubmedID 18703349 Title Negative r...egulation of cytoplasmic RNA-mediated antiviral signaling. Authors Komuro A, Bamm

  4. Crosstalk between Rac1-mediated actin regulation and ROS production.

    Science.gov (United States)

    Acevedo, Alejandro; González-Billault, Christian

    2018-02-20

    The small RhoGTPase Rac1 is implicated in a variety of events related to actin cytoskeleton rearrangement. Remarkably, another event that is completely different from those related to actin regulation has the same relevance; the Rac1-mediated production of reactive oxygen species (ROS) through NADPH oxidases (NOX). Each outcome involves different Rac1 downstream effectors; on one hand, events related to the actin cytoskeleton require Rac1 to bind to WAVEs proteins and PAKs that ultimately promote actin branching and turnover, on the other, NOX-derived ROS production demands active Rac1 to be bound to a cytosolic activator of NOX. How Rac1-mediated signaling ends up promoting actin-related events, NOX-derived ROS, or both is poorly understood. Rac1 regulators, including scaffold proteins, are known to exert tight control over its functions. Hence, evidence of Rac1 regulatory events leading to both actin remodeling and NOX-mediated ROS generation are discussed. Moreover, cellular functions linked to physiological and pathological conditions that exhibit crosstalk between Rac1 outcomes are analyzed, while plausible roles in neuronal functions (and dysfunctions) are highlighted. Together, discussed evidence shed light on cellular mechanisms which requires Rac1 to direct either actin- and/or ROS-related events, helping to understand crucial roles of Rac1 dual functionality. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Negative regulation of NOD1 mediated angiogenesis by PPARγ-regulated miR-125a

    International Nuclear Information System (INIS)

    Kang, Hyesoo; Park, Youngsook; Lee, Aram; Seo, Hyemin; Kim, Min Jung; Choi, Jihea; Jo, Ha-neul; Jeong, Ha-neul; Cho, Jin Gu; Chang, Woochul; Lee, Myeong-Sok; Jeon, Raok; Kim, Jongmin

    2017-01-01

    Infection with pathogens activates the endothelial cell and its sustained activation may result in impaired endothelial function. Endothelial dysfunction contributes to the pathologic angiogenesis that is characteristic of infection-induced inflammatory pathway activation. Nucleotide-binding oligomerization domain-containing protein 1 (NOD1) is a protein receptor which recognizes bacterial molecules and stimulates an immune reaction in various cells; however, the underlying molecular mechanisms in the regulation of inflammation-triggered angiogenesis are not fully understood. Here we report that peroxisome proliferator-activated receptor gamma (PPARγ)-mediated miR-125a serves as an important regulator of NOD1 agonist-mediated angiogenesis in endothelial cells by directly targeting NOD1. Treatment of human umbilical vein endothelial cells with natural PPARγ ligand, 15-Deoxy-Delta12,14-prostaglandin J2, led to inhibition of NOD1 expression; contrarily, protein levels of NOD1 were significantly increased by PPARγ knockdown. We report that PPARγ regulation of NOD1 expression is a novel microRNA-mediated regulation in endothelial cells. MiR-125a expression was markedly decreased in human umbilical vein endothelial cells subjected to PPARγ knockdown while 15-Deoxy-Delta12,14-prostaglandin J2 treatment increased the level of miR-125a. In addition, NOD1 is closely regulated by miR-125a, which directly targets the 3′ untranslated region of NOD1. Moreover, both overexpression of miR-125a and PPARγ activation led to inhibition of NOD1 agonist-induced tube formation in endothelial cells. Finally, NOD1 agonist increased the formation of cranial and subintestinal vessel plexus in zebrafish, and this effect was abrogated by concurrent PPARγ activation. Overall, these findings identify a PPARγ-miR-125a-NOD1 signaling axis in endothelial cells that is critical in the regulation of inflammation-mediated angiogenesis. - Highlights: • Expression of NOD1 is regulated by

  6. RIP1 regulates TNF-α-mediated lymphangiogenesis and lymphatic metastasis in gallbladder cancer by modulating the NF-κB-VEGF-C pathway.

    Science.gov (United States)

    Li, Cheng-Zong; Jiang, Xiao-Jie; Lin, Bin; Hong, Hai-Jie; Zhu, Si-Yuan; Jiang, Lei; Wang, Xiao-Qian; Tang, Nan-Hong; She, Fei-Fei; Chen, Yan-Ling

    2018-01-01

    Tumor necrosis factor alpha (TNF-α) enhances lymphangiogenesis in gallbladder carcinoma (GBC) via activation of nuclear factor (NF-κB)-dependent vascular endothelial growth factor-C (VEGF-C). Receptor-interacting protein 1 (RIP1) is a multifunctional protein in the TNF-α signaling pathway and is highly expressed in GBC. However, whether RIP1 participates in the signaling pathway of TNF-α-mediated VEGF-C expression that enhances lymphangiogenesis in GBC remains unclear. The RIP1 protein levels in the GBC-SD and NOZ cells upon stimulation with increasing concentrations of TNF-α as indicated was examined using Western blot. Lentiviral RIP1 shRNA and siIκBα were constructed and transduced respectively them into NOZ and GBC-SD cells, and then PcDNA3.1-RIP1 vectors was transduced into siRIP1 cell lines to reverse RIP1 expression. The protein expression of RIP1, inhibitor of NF-κB alpha (IκBα), p-IκBα, TAK1, NF-κB essential modulator were examined through immunoblotting or immunoprecipitation. Moreover, VEGF-C mRNA levels were measured by quantitative real-time polymerase chain reaction, VEGF-C protein levels were measured by immunoblotting and enzyme-linked immunosorbent assay, and VEGF-C promoter and NF-κB activities were quantified using a dual luciferase reporter assay. The association of NF-κB with the VEGF-C promoter was analysed by chromatin immunoprecipitation assay. A three-dimensional coculture method and orthotopic transplantation nude mice model were used to evaluate lymphatic tube-forming and metastasis ability in GBC cells. The expression of RIP1 protein, TNF-α protein and lymphatic vessels in human GBC tissues was examined by immunohistochemistry, and the dependence between RIP1 protein with TNF-α protein and lymphatic vessel density was analysed. TNF-α dose- and time-dependently increased RIP1 protein expression in the GBC-SD and NOZ cells of GBC, and the strongest effect was observed with a concentration of 50 ng/ml. RIP1 is fundamental

  7. ATM-mediated Snail Serine 100 phosphorylation regulates cellular radiosensitivity

    International Nuclear Information System (INIS)

    Boohaker, Rebecca J.; Cui, Xiaoli; Stackhouse, Murray; Xu, Bo

    2013-01-01

    Purpose: Activation of the DNA damage responsive protein kinase ATM is a critical step for cellular survival in response to ionizing irradiation (IR). Direct targets of ATM regulating radiosensitivity remain to be fully investigated. We have recently reported that ATM phosphorylates the transcriptional repressor Snail on Serine 100. We aimed to further study the functional significance of ATM-mediated Snail phosphorylation in response to IR. Material and methods: We transfected vector-only, wild-type, the Serine 100 to alanine (S100A) or to glutamic acid (S100E) substitution of Snail into various cell lines. We assessed colony formation, γ-H2AX focus formation and the invasion index in the cells treated with or without IR. Results: We found that over-expression of the S100A mutant Snail in HeLa cells significantly increased radiosensitivity. Meanwhile the expression of S100E, a phospho-mimicking mutation, resulted in enhanced radio-resistance. Interestingly, S100E could rescue the radiosensitive phenotype in ATM-deficient cells. We also found that expression of S100E increased γ-H2AX focus formation and compromised inhibition of invasion in response to IR independent of cell survival. Conclusion: ATM-mediated Snail Serine 100 phosphorylation in response to IR plays an important part in the regulation of radiosensitivity

  8. Fibroblast Growth Factor 21 Mediates Glycemic Regulation by Hepatic JNK

    Directory of Open Access Journals (Sweden)

    Santiago Vernia

    2016-03-01

    Full Text Available The cJun NH2-terminal kinase (JNK-signaling pathway is implicated in metabolic syndrome, including dysregulated blood glucose concentration and insulin resistance. Fibroblast growth factor 21 (FGF21 is a target of the hepatic JNK-signaling pathway and may contribute to the regulation of glycemia. To test the role of FGF21, we established mice with selective ablation of the Fgf21 gene in hepatocytes. FGF21 deficiency in the liver caused marked loss of FGF21 protein circulating in the blood. Moreover, the protective effects of hepatic JNK deficiency to suppress metabolic syndrome in high-fat diet-fed mice were not observed in mice with hepatocyte-specific FGF21 deficiency, including reduced blood glucose concentration and reduced intolerance to glucose and insulin. Furthermore, we show that JNK contributes to the regulation of hepatic FGF21 expression during fasting/feeding cycles. These data demonstrate that the hepatokine FGF21 is a key mediator of JNK-regulated metabolic syndrome.

  9. Flavonoids from Theobroma cacao down-regulate inflammatory mediators.

    Science.gov (United States)

    Ramiro, Emma; Franch, Angels; Castellote, Cristina; Pérez-Cano, Francisco; Permanyer, Joan; Izquierdo-Pulido, Maria; Castell, Margarida

    2005-11-02

    In the present study, we report the effects of a cocoa extract on the secretion and RNA expression of various proinflammatory mediators by macrophages. Monocyte chemoattractant protein 1 and tumor necrosis factor alpha (TNFalpha) were significantly and dose-dependently diminished by cocoa extract, and this effect was higher than that produced by equivalent concentrations of epicatechin but was lower than that produced by isoquercitrin. Interestingly, cocoa extract added prior to cell activation resulted in a significantly greater inhibition of TNFalpha secretion. Both cocoa extract and epicatechin decreased TNFalpha, interleukin (IL) 1alpha, and IL-6 mRNA expression, suggesting that their inhibitory effect on cytokine secretion is produced, in part, at the transcriptional level. Cocoa extract also significantly decreased NO secretion in a dose-dependent manner and with a greater effect than that produced by epicatechin. In conclusion, our study shows that cocoa flavonoids not only inhibit NO release from macrophages but also down-regulate inflammatory cytokines and chemokines.

  10. Tc1-mediated contact sensitivity reaction, its mechanism and regulation

    Directory of Open Access Journals (Sweden)

    Magdalena Zemelka-Wiącek

    2014-07-01

    Full Text Available The contact hypersensitivity reaction (CHS to haptens is a classic example of cell-mediated immune response. In the effector phase, two stages can be distinguished: an early component, that appears only 2 hours after subsequent contact with the hapten, and the late component that develops approximately 24 hours later which is mediated by TCRαβ+ cells. The effector lymphocytes may be CD4+ T helper 1 (Th1 cells or CD8+ T cytotoxic 1 (Tc1 cells, which depends on the employed hapten and/or mice strain. NKT lymphocytes play the crucial role in the CHS initiation, by supporting B1 cells in the antigen-specific IgM antibodies production. The development of an early component is essential for the recruitment of T effector (Teff cells to the side of hapten deposition and for the complete expansion of inflammatory reaction. The CHS reaction is under T regulatory (Treg cells control, both in the induction phase as well as in the effector phase. A new view of a negative regulation of the Tc1 mediated CHS response is based on the suppression induced by epicutaneous (EC application of protein antigen. The DNP-BSA skin application, on a gauze patch, leads to a state of immunosuppression. This maneuver results in rising the population of Treg cells with TCRαβ+CD4+CD25+Foxp3+ phenotype. The mechanism of suppression requires direct contact between Treg cells and Teff cells and the participation of CTLA-4 molecule is also necessary. The described method of evoking immune tolerance via EC immunization may contribute to elaborate a new method of allergic contact dermatitis therapy. This is because of its effectiveness, ease of induction and non-invasive protein antigen application.

  11. Approaches Mediating Oxytocin Regulation of the Immune System.

    Science.gov (United States)

    Li, Tong; Wang, Ping; Wang, Stephani C; Wang, Yu-Feng

    2016-01-01

    The hypothalamic neuroendocrine system is mainly composed of the neural structures regulating hormone secretion from the pituitary gland and has been considered as the higher regulatory center of the immune system. Recently, the hypothalamo-neurohypophysial system (HNS) emerged as an important component of neuroendocrine-immune network, wherein the oxytocin (OT)-secreting system (OSS) plays an essential role. The OSS, consisting of OT neurons in the supraoptic nucleus, paraventricular nucleus, their several accessory nuclei and associated structures, can integrate neural, endocrine, metabolic, and immune information and plays a pivotal role in the development and functions of the immune system. The OSS can promote the development of thymus and bone marrow, perform immune surveillance, strengthen immune defense, and maintain immune homeostasis. Correspondingly, OT can inhibit inflammation, exert antibiotic-like effect, promote wound healing and regeneration, and suppress stress-associated immune disorders. In this process, the OSS can release OT to act on immune system directly by activating OT receptors or through modulating activities of other hypothalamic-pituitary-immune axes and autonomic nervous system indirectly. However, our understandings of the role of the OSS in neuroendocrine regulation of immune system are largely incomplete, particularly its relationship with other hypothalamic-pituitary-immune axes and the vasopressin-secreting system that coexists with the OSS in the HNS. In addition, it remains unclear about the relationship between the OSS and peripherally produced OT in immune regulation, particularly intrathymic OT that is known to elicit central immunological self-tolerance of T-cells to hypophysial hormones. In this work, we provide a brief review of current knowledge of the features of OSS regulation of the immune system and of potential approaches that mediate OSS coordination of the activities of entire neuroendocrine-immune network.

  12. Need satisfaction, motivational regulations and exercise: moderation and mediation effects.

    Science.gov (United States)

    Weman-Josefsson, Karin; Lindwall, Magnus; Ivarsson, Andreas

    2015-05-20

    Based on the Self-determination theory process model, this study aimed to explore relationships between the latent constructs of psychological need satisfaction, autonomous motivation and exercise behaviour; the mediational role of autonomous motivation in the association of psychological need satisfaction with exercise behaviour; as well as gender and age differences in the aforementioned associations. Adult active members of an Internet-based exercise program (n = 1091) between 18 and 78 years of age completed a test battery on motivational aspects based on Self-determination theory. The Basic Psychological Needs in Exercise Scale and the Behavioural Regulation in Exercise Questionnaire-2 were used to measure need satisfaction and type of motivation and the Leisure Time Exercise Questionnaire to measure self-reported exercise. Need satisfaction predicted autonomous motivation, which in turn predicted exercise, especially for women. Autonomous motivation was found to mediate the association between need satisfaction and exercise. Age and gender moderated several of the paths in the model linking need satisfaction with motivation and exercise. The results demonstrated gender and age differences in the proposed sequential mechanisms between autonomous motivation and exercise in the process model. This study thus highlights a potential value in considering moderating factors and the need to further examine the underlying mechanisms between needs, autonomous motivation, and exercise behaviour.

  13. RNA-Mediated Regulation of HMGA1 Function

    Directory of Open Access Journals (Sweden)

    Arndt G. Benecke

    2015-05-01

    Full Text Available The high mobility group protein A1 (HMGA1 is a master regulator of chromatin structure mediating its major gene regulatory activity by direct interactions with A/T-rich DNA sequences located in the promoter and enhancer regions of a large variety of genes. HMGA1 DNA-binding through three AT-hook motifs results in an open chromatin structure and subsequently leads to changes in gene expression. Apart from its significant expression during development, HMGA1 is over-expressed in virtually every cancer, where HMGA1 expression levels correlate with tumor malignancy. The exogenous overexpression of HMGA1 can lead to malignant cell transformation, assigning the protein a key role during cancerogenesis. Recent studies have unveiled highly specific competitive interactions of HMGA1 with cellular and viral RNAs also through an AT-hook domain of the protein, significantly impacting the HMGA1-dependent gene expression. In this review, we discuss the structure and function of HMGA1-RNA complexes during transcription and epigenomic regulation and their implications in HMGA1-related diseases.

  14. Phosphotyrosine-Mediated Regulation of Enterohemorrhagic Escherichia coli Virulence

    Science.gov (United States)

    Robertson, Colin D.; Hazen, Tracy H.; Kaper, James B.

    2018-01-01

    ABSTRACT Enteric pathogens with low infectious doses rely on the ability to orchestrate the expression of virulence and metabolism-associated genes in response to environmental cues for successful infection. Accordingly, the human pathogen enterohemorrhagic Escherichia coli (EHEC) employs a complex multifaceted regulatory network to link the expression of type III secretion system (T3SS) components to nutrient availability. While phosphorylation of histidine and aspartate residues on two-component system response regulators is recognized as an integral part of bacterial signaling, the involvement of phosphotyrosine-mediated control is minimally explored in Gram-negative pathogens. Our recent phosphotyrosine profiling study of E. coli identified 342 phosphorylated proteins, indicating that phosphotyrosine modifications in bacteria are more prevalent than previously anticipated. The present study demonstrates that tyrosine phosphorylation of a metabolite-responsive LacI/GalR family regulator, Cra, negatively affects T3SS expression under glycolytic conditions that are typical for the colonic lumen environment where production of the T3SS is unnecessary. Our data suggest that Cra phosphorylation affects T3SS expression by modulating the expression of ler, which encodes the major activator of EHEC virulence gene expression. Phosphorylation of the Cra Y47 residue diminishes DNA binding to fine-tune the expression of virulence-associated genes, including those of the locus of enterocyte effacement pathogenicity island that encode the T3SS, and thereby negatively affects the formation of attaching and effacing lesions. Our data indicate that tyrosine phosphorylation provides an additional mechanism to control the DNA binding of Cra and other LacI/GalR family regulators, including LacI and PurR. This study describes an initial effort to unravel the role of global phosphotyrosine signaling in the control of EHEC virulence potential. PMID:29487233

  15. Phosphotyrosine-Mediated Regulation of Enterohemorrhagic Escherichia coli Virulence

    Directory of Open Access Journals (Sweden)

    Colin D. Robertson

    2018-02-01

    Full Text Available Enteric pathogens with low infectious doses rely on the ability to orchestrate the expression of virulence and metabolism-associated genes in response to environmental cues for successful infection. Accordingly, the human pathogen enterohemorrhagic Escherichia coli (EHEC employs a complex multifaceted regulatory network to link the expression of type III secretion system (T3SS components to nutrient availability. While phosphorylation of histidine and aspartate residues on two-component system response regulators is recognized as an integral part of bacterial signaling, the involvement of phosphotyrosine-mediated control is minimally explored in Gram-negative pathogens. Our recent phosphotyrosine profiling study of E. coli identified 342 phosphorylated proteins, indicating that phosphotyrosine modifications in bacteria are more prevalent than previously anticipated. The present study demonstrates that tyrosine phosphorylation of a metabolite-responsive LacI/GalR family regulator, Cra, negatively affects T3SS expression under glycolytic conditions that are typical for the colonic lumen environment where production of the T3SS is unnecessary. Our data suggest that Cra phosphorylation affects T3SS expression by modulating the expression of ler, which encodes the major activator of EHEC virulence gene expression. Phosphorylation of the Cra Y47 residue diminishes DNA binding to fine-tune the expression of virulence-associated genes, including those of the locus of enterocyte effacement pathogenicity island that encode the T3SS, and thereby negatively affects the formation of attaching and effacing lesions. Our data indicate that tyrosine phosphorylation provides an additional mechanism to control the DNA binding of Cra and other LacI/GalR family regulators, including LacI and PurR. This study describes an initial effort to unravel the role of global phosphotyrosine signaling in the control of EHEC virulence potential.

  16. Transforming growth factor β-activated kinase 1 negatively regulates interleukin-1α-induced stromal-derived factor-1 expression in vascular smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Bin [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Li, Wei [Department of Gerontology, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Zheng, Qichang [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Qin, Tao [Department of Hepatobiliary Pancreatic Surgery, People' s Hospital of Zhengzhou University, School of Medicine, Zhengzhou University, Zhengzhou 450003 (China); Wang, Kun; Li, Jinjin; Guo, Bing; Yu, Qihong; Wu, Yuzhe; Gao, Yang; Cheng, Xiang; Hu, Shaobo; Kumar, Stanley Naveen [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China); Liu, Sanguang, E-mail: sanguang1998@sina.com [Department of Hepatobiliary Surgery, The Second Hospital, Hebei Medical University, Shijiazhuang 050000 (China); Song, Zifang, E-mail: zsong@hust.edu.cn [Department of Hepatobiliary Surgery, Union Hospital, Tongji Medical College, Huangzhong University of Science and Technology, Wuhan 430022 (China)

    2015-07-17

    Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negative effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation.

  17. Transforming growth factor β-activated kinase 1 negatively regulates interleukin-1α-induced stromal-derived factor-1 expression in vascular smooth muscle cells

    International Nuclear Information System (INIS)

    Yang, Bin; Li, Wei; Zheng, Qichang; Qin, Tao; Wang, Kun; Li, Jinjin; Guo, Bing; Yu, Qihong; Wu, Yuzhe; Gao, Yang; Cheng, Xiang; Hu, Shaobo; Kumar, Stanley Naveen; Liu, Sanguang; Song, Zifang

    2015-01-01

    Stromal-derived Factor-1 (SDF-1) derived from vascular smooth muscle cells (VSMCs) contributes to vascular repair and remodeling in various vascular diseases. In this study, the mechanism underlying regulation of SDF-1 expression by interleukin-1α (IL-1α) was investigated in primary rat VSMCs. We found IL-1α promotes SDF-1 expression by up-regulating CCAAT-enhancer-binding protein β (C/EBPβ) in an IκB kinase β (IKKβ) signaling-dependent manner. Moreover, IL-1α-induced expression of C/EBPβ and SDF-1 was significantly potentiated by knockdown of transforming growth factor β-activated kinase 1 (TAK1), an upstream activator of IKKβ signaling. In addition, we also demonstrated that TAK1/p38 mitogen-activated protein kinase (p38 MAPK) signaling exerted negative effect on IL-1α-induced expression of C/EBPβ and SDF-1 through counteracting ROS-dependent up-regulation of nuclear factor erythroid 2-related factor 2 (NRF2). In conclusion, TAK1 acts as an important regulator of IL-1α-induced SDF-1 expression in VSMCs, and modulating activity of TAK1 may serve as a potential strategy for modulating vascular repair and remodeling. - Highlights: • IL-1α induces IKKβ signaling-dependent SDF-1 expression by up-regulating C/EBPβ. • Activation of TAK1 by IL-1α negatively regulates C/EBPβ-dependent SDF-1 expression. • IL-1α-induced TAK1/p38 MAPK signaling counteracts ROS-dependent SDF-1 expression. • TAK1 counteracts IL-1α-induced SDF-1 expression by attenuating NRF2 up-regulation

  18. Chaperone-Mediated Autophagy Protein BAG3 Negatively Regulates Ebola and Marburg VP40-Mediated Egress.

    Science.gov (United States)

    Liang, Jingjing; Sagum, Cari A; Bedford, Mark T; Sidhu, Sachdev S; Sudol, Marius; Han, Ziying; Harty, Ronald N

    2017-01-01

    Ebola (EBOV) and Marburg (MARV) viruses are members of the Filoviridae family which cause outbreaks of hemorrhagic fever. The filovirus VP40 matrix protein is essential for virus assembly and budding, and its PPxY L-domain motif interacts with WW-domains of specific host proteins, such as Nedd4 and ITCH, to facilitate the late stage of virus-cell separation. To identify additional WW-domain-bearing host proteins that interact with VP40, we used an EBOV PPxY-containing peptide to screen an array of 115 mammalian WW-domain-bearing proteins. Using this unbiased approach, we identified BCL2 Associated Athanogene 3 (BAG3), a member of the BAG family of molecular chaperone proteins, as a specific VP40 PPxY interactor. Here, we demonstrate that the WW-domain of BAG3 interacts with the PPxY motif of both EBOV and MARV VP40 and, unexpectedly, inhibits budding of both eVP40 and mVP40 virus-like particles (VLPs), as well as infectious VSV-EBOV recombinants. BAG3 is a stress induced protein that regulates cellular protein homeostasis and cell survival through chaperone-mediated autophagy (CMA). Interestingly, our results show that BAG3 alters the intracellular localization of VP40 by sequestering VP40 away from the plasma membrane. As BAG3 is the first WW-domain interactor identified that negatively regulates budding of VP40 VLPs and infectious virus, we propose that the chaperone-mediated autophagy function of BAG3 represents a specific host defense strategy to counteract the function of VP40 in promoting efficient egress and spread of virus particles.

  19. Chaperone-Mediated Autophagy Protein BAG3 Negatively Regulates Ebola and Marburg VP40-Mediated Egress.

    Directory of Open Access Journals (Sweden)

    Jingjing Liang

    2017-01-01

    Full Text Available Ebola (EBOV and Marburg (MARV viruses are members of the Filoviridae family which cause outbreaks of hemorrhagic fever. The filovirus VP40 matrix protein is essential for virus assembly and budding, and its PPxY L-domain motif interacts with WW-domains of specific host proteins, such as Nedd4 and ITCH, to facilitate the late stage of virus-cell separation. To identify additional WW-domain-bearing host proteins that interact with VP40, we used an EBOV PPxY-containing peptide to screen an array of 115 mammalian WW-domain-bearing proteins. Using this unbiased approach, we identified BCL2 Associated Athanogene 3 (BAG3, a member of the BAG family of molecular chaperone proteins, as a specific VP40 PPxY interactor. Here, we demonstrate that the WW-domain of BAG3 interacts with the PPxY motif of both EBOV and MARV VP40 and, unexpectedly, inhibits budding of both eVP40 and mVP40 virus-like particles (VLPs, as well as infectious VSV-EBOV recombinants. BAG3 is a stress induced protein that regulates cellular protein homeostasis and cell survival through chaperone-mediated autophagy (CMA. Interestingly, our results show that BAG3 alters the intracellular localization of VP40 by sequestering VP40 away from the plasma membrane. As BAG3 is the first WW-domain interactor identified that negatively regulates budding of VP40 VLPs and infectious virus, we propose that the chaperone-mediated autophagy function of BAG3 represents a specific host defense strategy to counteract the function of VP40 in promoting efficient egress and spread of virus particles.

  20. Regulation of Sirtuin-Mediated Protein Deacetylation by Cardioprotective Phytochemicals

    Directory of Open Access Journals (Sweden)

    Niria Treviño-Saldaña

    2017-01-01

    Full Text Available Modulation of posttranslational modifications (PTMs, such as protein acetylation, is considered a novel therapeutic strategy to combat the development and progression of cardiovascular diseases. Protein hyperacetylation is associated with the development of numerous cardiovascular diseases, including atherosclerosis, hypertension, cardiac hypertrophy, and heart failure. In addition, decreased expression and activity of the deacetylases Sirt1, Sirt3, and Sirt6 have been linked to the development and progression of cardiac dysfunction. Several phytochemicals exert cardioprotective effects by regulating protein acetylation levels. These effects are mainly exerted via activation of Sirt1 and Sirt3 and inhibition of acetyltransferases. Numerous studies support a cardioprotective role for sirtuin activators (e.g., resveratrol, as well as other emerging modulators of protein acetylation, including curcumin, honokiol, oroxilyn A, quercetin, epigallocatechin-3-gallate, bakuchiol, tyrosol, and berberine. Studies also point to a cardioprotective role for various nonaromatic molecules, such as docosahexaenoic acid, alpha-lipoic acid, sulforaphane, and caffeic acid ethanolamide. Here, we review the vast evidence from the bench to the clinical setting for the potential cardioprotective roles of various phytochemicals in the modulation of sirtuin-mediated deacetylation.

  1. Regulation of Sirtuin-Mediated Protein Deacetylation by Cardioprotective Phytochemicals

    Science.gov (United States)

    2017-01-01

    Modulation of posttranslational modifications (PTMs), such as protein acetylation, is considered a novel therapeutic strategy to combat the development and progression of cardiovascular diseases. Protein hyperacetylation is associated with the development of numerous cardiovascular diseases, including atherosclerosis, hypertension, cardiac hypertrophy, and heart failure. In addition, decreased expression and activity of the deacetylases Sirt1, Sirt3, and Sirt6 have been linked to the development and progression of cardiac dysfunction. Several phytochemicals exert cardioprotective effects by regulating protein acetylation levels. These effects are mainly exerted via activation of Sirt1 and Sirt3 and inhibition of acetyltransferases. Numerous studies support a cardioprotective role for sirtuin activators (e.g., resveratrol), as well as other emerging modulators of protein acetylation, including curcumin, honokiol, oroxilyn A, quercetin, epigallocatechin-3-gallate, bakuchiol, tyrosol, and berberine. Studies also point to a cardioprotective role for various nonaromatic molecules, such as docosahexaenoic acid, alpha-lipoic acid, sulforaphane, and caffeic acid ethanolamide. Here, we review the vast evidence from the bench to the clinical setting for the potential cardioprotective roles of various phytochemicals in the modulation of sirtuin-mediated deacetylation. PMID:29234485

  2. VE-Cadherin–Mediated Epigenetic Regulation of Endothelial Gene Expression

    Science.gov (United States)

    Morini, Marco F.; Giampietro, Costanza; Corada, Monica; Pisati, Federica; Lavarone, Elisa; Cunha, Sara I.; Conze, Lei L.; O’Reilly, Nicola; Joshi, Dhira; Kjaer, Svend; George, Roger; Nye, Emma; Ma, Anqi; Jin, Jian; Mitter, Richard; Lupia, Michela; Cavallaro, Ugo; Pasini, Diego; Calado, Dinis P.

    2018-01-01

    levels of claudin-5 and VE-PTP. Conclusions: These data extend the knowledge of polycomb-mediated regulation of gene expression to endothelial cell differentiation and vessel maturation. The identified mechanism opens novel therapeutic opportunities to modulate endothelial gene expression and induce vascular normalization through pharmacological inhibition of the polycomb-mediated repression system. PMID:29233846

  3. VE-Cadherin-Mediated Epigenetic Regulation of Endothelial Gene Expression.

    Science.gov (United States)

    Morini, Marco F; Giampietro, Costanza; Corada, Monica; Pisati, Federica; Lavarone, Elisa; Cunha, Sara I; Conze, Lei L; O'Reilly, Nicola; Joshi, Dhira; Kjaer, Svend; George, Roger; Nye, Emma; Ma, Anqi; Jin, Jian; Mitter, Richard; Lupia, Michela; Cavallaro, Ugo; Pasini, Diego; Calado, Dinis P; Dejana, Elisabetta; Taddei, Andrea

    2018-01-19

    data extend the knowledge of polycomb-mediated regulation of gene expression to endothelial cell differentiation and vessel maturation. The identified mechanism opens novel therapeutic opportunities to modulate endothelial gene expression and induce vascular normalization through pharmacological inhibition of the polycomb-mediated repression system. © 2017 The Authors.

  4. Emotion regulation as a mediator in the relationship between attachment and depressive symptomatology: A systematic review.

    Science.gov (United States)

    Malik, Sonia; Wells, Adrian; Wittkowski, Anja

    2015-02-01

    Attachment theory has been conceptualised as an emotion regulation theory. Research attributes the occurrence of depressive symptoms to a dysfunction of emotion regulation. Anxious attachment and avoidant attachment, which are two dimensions of insecure attachment, are hypothesised to lead to the development of hyperactivating and deactivating emotion regulation strategies. This systematic review examines the literature on the role of emotion regulation and its relationship with attachment and depressive symptomatology. Furthermore, we examined evidence for hyperactivating and deactivating strategies. Nineteen papers were identified. Adolescent studies demonstrated associations of varying strength and found unreliable and contradictory results for emotion regulation as a mediator. Conversely, adult studies provided strong evidence for emotion regulation as a mediator. The hypothesis that hyperactivating strategies mediate anxious attachment and depressive symptoms was consistently supported. Mixed evidence was provided for deactivating strategies as mediators to avoidant attachment and depressive symptomatology. Limitations of methodology and quality of studies are identified with particular attention drawn to problems with conceptual singularity and multicollinearity. Despite mixed variable findings, this review indicates that emotion regulation is a mediator between attachment and depression. Hyperactivating strategies, in particular, have been consistently noted as mediators for anxious attachment and depressive symptomatology, whereas evidence for deactivating strategies as mediators between avoidant attachment and depressive symptoms has been mixed. Future research should test the mediators of attachment and symptoms and examine theoretically grounded models of psychopathology, such as metacognitive and cognitive models using clinical samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Ligand Receptor-Mediated Regulation of Growth in Plants.

    Science.gov (United States)

    Haruta, Miyoshi; Sussman, Michael R

    2017-01-01

    Growth and development of multicellular organisms are coordinately regulated by various signaling pathways involving the communication of inter- and intracellular components. To form the appropriate body patterns, cellular growth and development are modulated by either stimulating or inhibiting these pathways. Hormones and second messengers help to mediate the initiation and/or interaction of the various signaling pathways in all complex multicellular eukaryotes. In plants, hormones include small organic molecules, as well as larger peptides and small proteins, which, as in animals, act as ligands and interact with receptor proteins to trigger rapid biochemical changes and induce the intracellular transcriptional and long-term physiological responses. During the past two decades, the availability of genetic and genomic resources in the model plant species, Arabidopsis thaliana, has greatly helped in the discovery of plant hormone receptors and the components of signal transduction pathways and mechanisms used by these immobile but highly complex organisms. Recently, it has been shown that two of the most important plant hormones, auxin and abscisic acid (ABA), act through signaling pathways that have not yet been recognized in animals. For example, auxins stimulate cell elongation by bringing negatively acting transcriptional repressor proteins to the proteasome to be degraded, thus unleashing the gene expression program required for increasing cell size. The "dormancy" inducing hormone, ABA, binds to soluble receptor proteins and inhibits a specific class of protein phosphatases (PP2C), which activates phosphorylation signaling leading to transcriptional changes needed for the desiccation of the seeds prior to entering dormancy. While these two hormone receptors have no known animal counterparts, there are also many similarities between animal and plant signaling pathways. For example, in plants, the largest single gene family in the genome is the protein kinase

  6. The Arabidopsis mediator complex subunits MED16, MED14, and MED2 regulate mediator and RNA polymerase II recruitment to CBF-responsive cold-regulated genes.

    Science.gov (United States)

    Hemsley, Piers A; Hurst, Charlotte H; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R; De Cothi, Elizabeth A; Steele, John F; Knight, Heather

    2014-01-01

    The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation-induced freezing tolerance. In addition, these three subunits are required for low temperature-induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced.

  7. Plant Mediator complex and its critical functions in transcription regulation.

    Science.gov (United States)

    Yang, Yan; Li, Ling; Qu, Li-Jia

    2016-02-01

    The Mediator complex is an important component of the eukaryotic transcriptional machinery. As an essential link between transcription factors and RNA polymerase II, the Mediator complex transduces diverse signals to genes involved in different pathways. The plant Mediator complex was recently purified and comprises conserved and specific subunits. It functions in concert with transcription factors to modulate various responses. In this review, we summarize the recent advances in understanding the plant Mediator complex and its diverse roles in plant growth, development, defense, non-coding RNA production, response to abiotic stresses, flowering, genomic stability and metabolic homeostasis. In addition, the transcription factors interacting with the Mediator complex are also highlighted. © 2015 Institute of Botany, Chinese Academy of Sciences.

  8. Attachment, emotion regulation, and adaptation to breast cancer: assessment of a mediational hypothesis.

    Science.gov (United States)

    Ávila, Marisa; Brandão, Tânia; Teixeira, Joana; Coimbra, Joaquim Luis; Matos, Paula Mena

    2015-11-01

    This study examines the links between attachment, adaptation to breast cancer, and the mediating role played by emotional regulation processes. Participants were 127 women with breast cancer recruited in two public hospitals of Porto and at the Portuguese Cancer League. Women completed measures of attachment, quality of life, and emotion regulation. Path models were used to examine the associations between the constructs and to test the mediational hypotheses. Significant associations were found between attachment and adaptation. Dimensions of emotion regulation totally or partially mediated the associations between attachment and adaptation outcomes. Attachment security effects on interpersonal relations were totally mediated by communicating emotions. Also, attachment anxiety effect on physical well-being was totally mediated by rumination. Attachment avoidance effects on psychological outcomes were totally mediated by emotional control and partially mediated by communicating emotions for the case of interpersonal relations. This study highlights the importance of addressing emotional regulation jointly with attachment to deepen the comprehension of the relational processes implicated in adaptation to breast cancer. Results supported a mediational hypothesis, presenting emotional regulation processes as relevant dimensions for the understanding of attachment associations with adaptation to breast cancer. Copyright © 2015 John Wiley & Sons, Ltd.

  9. Malleable machines in transcription regulation: the mediator complex.

    Directory of Open Access Journals (Sweden)

    Agnes Tóth-Petróczy

    2008-12-01

    Full Text Available The Mediator complex provides an interface between gene-specific regulatory proteins and the general transcription machinery including RNA polymerase II (RNAP II. The complex has a modular architecture (Head, Middle, and Tail and cryoelectron microscopy analysis suggested that it undergoes dramatic conformational changes upon interactions with activators and RNAP II. These rearrangements have been proposed to play a role in the assembly of the preinitiation complex and also to contribute to the regulatory mechanism of Mediator. In analogy to many regulatory and transcriptional proteins, we reasoned that Mediator might also utilize intrinsically disordered regions (IDRs to facilitate structural transitions and transmit transcriptional signals. Indeed, a high prevalence of IDRs was found in various subunits of Mediator from both Saccharomyces cerevisiae and Homo sapiens, especially in the Tail and the Middle modules. The level of disorder increases from yeast to man, although in both organisms it significantly exceeds that of multiprotein complexes of a similar size. IDRs can contribute to Mediator's function in three different ways: they can individually serve as target sites for multiple partners having distinctive structures; they can act as malleable linkers connecting globular domains that impart modular functionality on the complex; and they can also facilitate assembly and disassembly of complexes in response to regulatory signals. Short segments of IDRs, termed molecular recognition features (MoRFs distinguished by a high protein-protein interaction propensity, were identified in 16 and 19 subunits of the yeast and human Mediator, respectively. In Saccharomyces cerevisiae, the functional roles of 11 MoRFs have been experimentally verified, and those in the Med8/Med18/Med20 and Med7/Med21 complexes were structurally confirmed. Although the Saccharomyces cerevisiae and Homo sapiens Mediator sequences are only weakly conserved, the

  10. Regulation of stem-cell mediated host immunity by the sphingolipid ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Regulation of stem-cell mediated host immunity by the sphingolipid pathway ... in the generation of mature immune cells and the functioning of the surrounding ... methods with human cells and genetically engineered mice to examine how the ...

  11. The metazoan Mediator co-activator complex as an integrative hub for transcriptional regulation

    OpenAIRE

    Malik, Sohail; Roeder, Robert G.

    2010-01-01

    The Mediator is an evolutionarily conserved, multiprotein complex that is a key regulator of protein-coding genes. In metazoan cells, multiple pathways that are responsible for homeostasis, cell growth and differentiation converge on the Mediator through transcriptional activators and repressors that target one or more of the almost 30 subunits of this complex. Besides interacting directly with RNA polymerase II, Mediator has multiple functions and can interact with and coordinate the action ...

  12. Drinking motives mediate emotion regulation difficulties and problem drinking in college students.

    Science.gov (United States)

    Aurora, Pallavi; Klanecky, Alicia K

    2016-05-01

    Problem drinking in college places students at an increased risk for a wealth of negative consequences including alcohol use disorders. Most research has shown that greater emotion regulation difficulties are related to increased problem drinking, and studies generally assume that drinking is motivated by efforts to cope with or enhance affective experiences. However, there is a lack of research specifically testing this assumption. The current study sought to examine the mediating potential of drinking motives, specifically coping and enhancement, on the relationship between emotion regulation and problem drinking. College participants (N = 200) completed an online survey, consisting of a battery of measures assessing alcohol use behaviors and related variables. Coping drinking motives fully mediated the emotion regulation/problem drinking relationship, and enhancement motives partially mediated this relationship. Exploratory analyses indicated that all four drinking motives (i.e. coping, enhancement, social, and conformity) simultaneously mediated the relationship between emotion regulation and quantity/frequency of alcohol use. However, only coping and enhancement significantly mediated the relationship between emotion regulation and alcohol-related consequences (e.g. alcohol dependence symptoms, alcohol-related injuries). The current results offer direction for potentially modifying brief alcohol interventions in efforts to reduce students' engagement in problem drinking behaviors. For example, interventions might incorporate information on the risks of using alcohol as a means of emotion regulation and offer alternative emotion regulation strategies.

  13. Negative regulation of RIG-I-mediated antiviral signaling by TRK-fused gene (TFG) protein

    International Nuclear Information System (INIS)

    Lee, Na-Rae; Shin, Han-Bo; Kim, Hye-In; Choi, Myung-Soo; Inn, Kyung-Soo

    2013-01-01

    Highlights: •TRK-fused gene product (TFG) interacts with TRIM25 upon viral infection. •TFG negatively regulates RIG-I mediated antiviral signaling. •TFG depletion leads to enhanced viral replication. •TFG act downstream of MAVS. -- Abstract: RIG-I (retinoic acid inducible gene I)-mediated antiviral signaling serves as the first line of defense against viral infection. Upon detection of viral RNA, RIG-I undergoes TRIM25 (tripartite motif protein 25)-mediated K63-linked ubiquitination, leading to type I interferon (IFN) production. In this study, we demonstrate that TRK-fused gene (TFG) protein, previously identified as a TRIM25-interacting protein, binds TRIM25 upon virus infection and negatively regulates RIG-I-mediated type-I IFN signaling. RIG-I-mediated IFN production and nuclear factor (NF)-κB signaling pathways were upregulated by the suppression of TFG expression. Furthermore, vesicular stomatitis virus (VSV) replication was significantly inhibited by small inhibitory hairpin RNA (shRNA)-mediated knockdown of TFG, supporting the suppressive role of TFG in RIG-I-mediated antiviral signaling. Interestingly, suppression of TFG expression increased not only RIG-I-mediated signaling but also MAVS (mitochondrial antiviral signaling protein)-induced signaling, suggesting that TFG plays a pivotal role in negative regulation of RNA-sensing, RIG-I-like receptor (RLR) family signaling pathways

  14. Emotion Regulation and Aggressive Behavior in Preschoolers: The Mediating Role of Social Information Processing

    Science.gov (United States)

    Helmsen, Johanna; Koglin, Ute; Petermann, Franz

    2012-01-01

    This study examined whether the relation between maladaptive emotion regulation and aggression was mediated by deviant social information processing (SIP). Participants were 193 preschool children. Emotion regulation and aggression were rated by teachers. Deviant SIP (i.e., attribution of hostile intent, aggressive response generation, aggressive…

  15. USP21 regulates Hippo pathway activity by mediating MARK protein turnover

    DEFF Research Database (Denmark)

    Nguyen, Thanh Hung; Kugler, Jan-Michael; Loya, Anand Chainsukh

    2017-01-01

    observed in cancer and often correlates with worse survival. The activity and stability of Hippo pathway components, including YAP/TAZ, AMOT and LATS1/2, are regulated by ubiquitin-mediated protein degradation. Aberrant expression of ubiquitin ligase complexes that regulate the turnover of Hippo components...

  16. How Do Motivational Regulation Strategies Affect Achievement: Mediated by Effort Management and Moderated by Intelligence

    Science.gov (United States)

    Schwinger, Malte; Steinmayr, Ricarda; Spinath, Birgit

    2009-01-01

    It was assumed that the effect of motivational regulation strategies on achievement is mediated by effort management and moderated by intelligence. A sample of 231 11th and 12th grade German high-school students provided self-reports on their use of motivational regulation strategies and effort management and completed an intelligence test.…

  17. LYATK1 potently inhibits LPS-mediated pro-inflammatory response

    International Nuclear Information System (INIS)

    Xi, Feng; Liu, Yuan; Wang, Xiujuan; Kong, Wei; Zhao, Feng

    2016-01-01

    Lipopolysaccharide (LPS)-primed monocytes/macrophages produce pro-inflammatory cytokines, which could lead to endotoxin shock. TGF-β-activated kinase1 (TAK1) activation is involved in the process. In the current study, we studied the potential effect of a selective TAK1 inhibitor, LYTAK1, on LPS-stimulated response both in vitro and in vivo. We demonstrated that LYTAK1 inhibited LPS-induced mRNA expression and production of several pro-inflammatory cytokines [interleukin 1β (IL-1β), tumor necrosis factor-α (TNFα) and interleukin-6 (IL-6)] in RAW 264.7 macrophages. LYTAK1's activity was almost nullified with TAK1 shRNA-knockdown. Meanwhile, in both primary mouse bone marrow derived macrophages (BMDMs) and human peripheral blood mononuclear cells (PBMCs), LPS-induced pro-inflammatory cytokine production was again attenuated with LYTAK1 co-treatment. Molecularly, LYTAK1 dramatically inhibited LPS-induced TAK1-nuclear factor kappa B (NFκB) and mitogen-activated protein kinase (Erk, Jnk and p38) activation in RAW 264.7 cells, mouse BMDMs and human PBMCs. In vivo, oral administration of LYTAK1 inhibited LPS-induced activation of TAK1-NFκB-p38 in ex-vivo cultured PBMCs, and cytokine production and endotoxin shock in mice. Together, these results demonstrate that LYTAK1 inhibits LPS-induced production of several pro-inflammatory cytokines and endotoxin shock probably through blocking TAK1-regulated signalings. - Highlights: • LYTAK1 inhibits LPS-induced pro-inflammatory cytokine production in RAW 264.7 cells. • The effect by LYTAK1 is more potent than other known TAK1 inhibitors. • LYTAK1 inhibits LPS-induced cytokine production in primary macrophages/monocytes. • LYTAK1 inhibits LPS-induced TAK1-NFκB and MAPK activation in macrophages/monocytes. • LYTAK1 gavage inhibits LPS-induced endotoxin shock and cytokine production in mice.

  18. LYATK1 potently inhibits LPS-mediated pro-inflammatory response

    Energy Technology Data Exchange (ETDEWEB)

    Xi, Feng [Department of Intensive Care Unit, Taixing People" ' s Hospital, Taixing, Jiangsu Province, 225400 (China); Liu, Yuan [Department of Ophthalmology, Nanjing First Hospital, Nanjing Medical University, Nanjing (China); Wang, Xiujuan; Kong, Wei [Department of Intensive Care Unit, Taixing People" ' s Hospital, Taixing, Jiangsu Province, 225400 (China); Zhao, Feng, E-mail: taixingzhaofeng163@163.com [Department of Intensive Care Unit, Taixing People" ' s Hospital, Taixing, Jiangsu Province, 225400 (China)

    2016-01-29

    Lipopolysaccharide (LPS)-primed monocytes/macrophages produce pro-inflammatory cytokines, which could lead to endotoxin shock. TGF-β-activated kinase1 (TAK1) activation is involved in the process. In the current study, we studied the potential effect of a selective TAK1 inhibitor, LYTAK1, on LPS-stimulated response both in vitro and in vivo. We demonstrated that LYTAK1 inhibited LPS-induced mRNA expression and production of several pro-inflammatory cytokines [interleukin 1β (IL-1β), tumor necrosis factor-α (TNFα) and interleukin-6 (IL-6)] in RAW 264.7 macrophages. LYTAK1's activity was almost nullified with TAK1 shRNA-knockdown. Meanwhile, in both primary mouse bone marrow derived macrophages (BMDMs) and human peripheral blood mononuclear cells (PBMCs), LPS-induced pro-inflammatory cytokine production was again attenuated with LYTAK1 co-treatment. Molecularly, LYTAK1 dramatically inhibited LPS-induced TAK1-nuclear factor kappa B (NFκB) and mitogen-activated protein kinase (Erk, Jnk and p38) activation in RAW 264.7 cells, mouse BMDMs and human PBMCs. In vivo, oral administration of LYTAK1 inhibited LPS-induced activation of TAK1-NFκB-p38 in ex-vivo cultured PBMCs, and cytokine production and endotoxin shock in mice. Together, these results demonstrate that LYTAK1 inhibits LPS-induced production of several pro-inflammatory cytokines and endotoxin shock probably through blocking TAK1-regulated signalings. - Highlights: • LYTAK1 inhibits LPS-induced pro-inflammatory cytokine production in RAW 264.7 cells. • The effect by LYTAK1 is more potent than other known TAK1 inhibitors. • LYTAK1 inhibits LPS-induced cytokine production in primary macrophages/monocytes. • LYTAK1 inhibits LPS-induced TAK1-NFκB and MAPK activation in macrophages/monocytes. • LYTAK1 gavage inhibits LPS-induced endotoxin shock and cytokine production in mice.

  19. Mediator MED23 regulates basal transcription in vivo via an interaction with P-TEFb.

    Science.gov (United States)

    Wang, Wei; Yao, Xiao; Huang, Yan; Hu, Xiangming; Liu, Runzhong; Hou, Dongming; Chen, Ruichuan; Wang, Gang

    2013-01-01

    The Mediator is a multi-subunit complex that transduces regulatory information from transcription regulators to the RNA polymerase II apparatus. Growing evidence suggests that Mediator plays roles in multiple stages of eukaryotic transcription, including elongation. However, the detailed mechanism by which Mediator regulates elongation remains elusive. In this study, we demonstrate that Mediator MED23 subunit controls a basal level of transcription by recruiting elongation factor P-TEFb, via an interaction with its CDK9 subunit. The mRNA level of Egr1, a MED23-controlled model gene, is reduced 4-5 fold in Med23 (-/-) ES cells under an unstimulated condition, but Med23-deficiency does not alter the occupancies of RNAP II, GTFs, Mediator complex, or activator ELK1 at the Egr1 promoter. Instead, Med23 depletion results in a significant decrease in P-TEFb and RNAP II (Ser2P) binding at the coding region, but no changes for several other elongation regulators, such as DSIF and NELF. ChIP-seq revealed that Med23-deficiency partially reduced the P-TEFb occupancy at a set of MED23-regulated gene promoters. Further, we demonstrate that MED23 interacts with CDK9 in vivo and in vitro. Collectively, these results provide the mechanistic insight into how Mediator promotes RNAP II into transcription elongation.

  20. Activity-regulated genes as mediators of neural circuit plasticity.

    Science.gov (United States)

    Leslie, Jennifer H; Nedivi, Elly

    2011-08-01

    Modifications of neuronal circuits allow the brain to adapt and change with experience. This plasticity manifests during development and throughout life, and can be remarkably long lasting. Evidence has linked activity-regulated gene expression to the long-term structural and electrophysiological adaptations that take place during developmental critical periods, learning and memory, and alterations to sensory map representations in the adult. In all these cases, the cellular response to neuronal activity integrates multiple tightly coordinated mechanisms to precisely orchestrate long-lasting, functional and structural changes in brain circuits. Experience-dependent plasticity is triggered when neuronal excitation activates cellular signaling pathways from the synapse to the nucleus that initiate new programs of gene expression. The protein products of activity-regulated genes then work via a diverse array of cellular mechanisms to modify neuronal functional properties. Synaptic strengthening or weakening can reweight existing circuit connections, while structural changes including synapse addition and elimination create new connections. Posttranscriptional regulatory mechanisms, often also dependent on activity, further modulate activity-regulated gene transcript and protein function. Thus, activity-regulated genes implement varied forms of structural and functional plasticity to fine-tune brain circuit wiring. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Kinase-Mediated Regulation of P4-ATPases

    DEFF Research Database (Denmark)

    Frøsig, Merethe Mørch

    designed a fast and efficient screening strategy to identify novel regulator proteins of P4-ATPases. The system is based on heterologous expression in a specially designed yeast strain, and regulatory proteins can be identified via change in activity of the P4-ATPase of interest. Hereby the first steps...

  2. Warm and harsh parenting as mediators of the relation between maternal and adolescent emotion regulation.

    Science.gov (United States)

    Sarıtaş, Dilek; Grusec, Joan E; Gençöz, Tülin

    2013-12-01

    Maternal hostility/rejection and warmth were considered as potential mediators of the relation between mothers' and adolescents' emotion regulation. Participants were first-year high school students living in Ankara, Turkey and their mothers (N = 365). Scales assessing emotion regulation difficulties and maternal hostility/rejection and warmth were administered to both the adolescents and their mothers. Maternal hostility/rejection, but not warmth, mediated the relation between maternal and adolescent emotion regulation. For girls there was, additionally, a direct effect of maternal emotion regulation. The different roles played by parental rejection and parental warmth in the development of adolescents' emotion regulation accord with arguments that socialization occurs in different domains and that rejection and warmth are not aspects of the same domain. Copyright © 2013 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

  3. Emotional maltreatment and disordered eating in adolescents: testing the mediating role of emotion regulation.

    Science.gov (United States)

    Mills, Pamela; Newman, Emily Frances; Cossar, Jill; Murray, George

    2015-01-01

    The present study aimed to determine if emotion regulation mediates the relationship between emotional maltreatment and disordered eating behavior in adolescents. Participants were 222 secondary school pupils (aged 14-18 years) from a state high school in the UK. Standardized questionnaire measures were used to gather self-report data on emotional abuse and emotional neglect, functional and dysfunctional emotion regulation strategies and disordered eating behavior. Results showed that disordered eating was associated with emotional abuse, dysfunctional emotion regulation and being female. Multiple mediation analysis found an indirect relationship between emotional abuse and disordered eating through dysfunctional emotion regulation. Interestingly, emotional neglect predicted lower levels of functional emotion regulation. The findings support previous research showing emotion regulation to mediate the relationship between childhood abuse and disordered eating in adults and a differential effect of abuse and neglect on emotion regulation. Longitudinal studies are required to confirm the direction of relationships; however these data suggest that dysfunctional emotion regulation is a significant variable in the development of disordered eating and may be a useful target for intervention. Copyright © 2014. Published by Elsevier Ltd.

  4. KAP1 regulates type I interferon/STAT1-mediated IRF-1 gene expression

    International Nuclear Information System (INIS)

    Kamitani, Shinya; Ohbayashi, Norihiko; Ikeda, Osamu; Togi, Sumihito; Muromoto, Ryuta; Sekine, Yuichi; Ohta, Kazuhide; Ishiyama, Hironobu; Matsuda, Tadashi

    2008-01-01

    Signal transducers and activators of transcription (STATs) mediate cell proliferation, differentiation, and survival in immune responses, hematopoiesis, neurogenesis, and other biological processes. Recently, we showed that KAP1 is a novel STAT-binding partner that regulates STAT3-mediated transactivation. KAP1 is a universal co-repressor protein for the KRAB zinc finger protein superfamily of transcriptional repressors. In this study, we found KAP1-dependent repression of interferon (IFN)/STAT1-mediated signaling. We also demonstrated that endogenous KAP1 associates with endogenous STAT1 in vivo. Importantly, a small-interfering RNA-mediated reduction in KAP1 expression enhanced IFN-induced STAT1-dependent IRF-1 gene expression. These results indicate that KAP1 may act as an endogenous regulator of the IFN/STAT1 signaling pathway

  5. Maternal Emotion Regulation and Adolescent Behaviors: The Mediating Role of Family Functioning and Parenting.

    Science.gov (United States)

    Crandall, AliceAnn; Ghazarian, Sharon R; Day, Randal D; Riley, Anne W

    2016-11-01

    Prior research links poor maternal emotion regulation to maladaptive parenting and child behaviors, but little research is available on these relationships during the adolescent period. We use structural equation modeling to assess the influence of poor maternal emotion regulation, measured as emotional reactivity and distancing, on adolescent behaviors (measured as aggression and prosocial behaviors) among 478 adolescents (53 % female; baseline age 10-13 years) and their mothers over a 5 year period. We also tested the possible mediating roles of family functioning and parenting behaviors between maternal emotion regulation and adolescent behaviors. Results indicated that higher baseline maternal emotional distancing and reactivity were not directly predictive of adolescents' behaviors, but they were indirectly related through family functioning and parenting. Specifically, indulgent parenting mediated the relationship between maternal emotional reactivity and adolescent aggression. Maternal-reported family functioning significantly mediated the relationship between maternal emotional distancing and adolescent aggression. Family functioning also mediated the relationship between emotional distancing and regulation parenting. The results imply that poor maternal emotion regulation during their child's early adolescence leads to more maladaptive parenting and problematic behaviors during the later adolescent period. However, healthy family processes may ameliorate the negative impact of low maternal emotion regulation on parenting and adolescent behavioral outcomes. The implications for future research and interventions to improve parenting and adolescent outcomes are discussed.

  6. Mediator can regulate mitotic entry and direct periodic transcription in fission yeast.

    Science.gov (United States)

    Banyai, Gabor; Lopez, Marcela Davila; Szilagyi, Zsolt; Gustafsson, Claes M

    2014-11-01

    Cdk8 is required for correct timing of mitotic progression in fission yeast. How the activity of Cdk8 is regulated is unclear, since the kinase is not activated by T-loop phosphorylation and its partner, CycC, does not oscillate. Cdk8 is, however, a component of the multiprotein Mediator complex, a conserved coregulator of eukaryotic transcription that is connected to a number of intracellular signaling pathways. We demonstrate here that other Mediator components regulate the activity of Cdk8 in vivo and thereby direct the timing of mitotic entry. Deletion of Mediator components Med12 and Med13 leads to higher cellular Cdk8 protein levels, premature phosphorylation of the Cdk8 target Fkh2, and earlier entry into mitosis. We also demonstrate that Mediator is recruited to clusters of mitotic genes in a periodic fashion and that the complex is required for the transcription of these genes. We suggest that Mediator functions as a hub for coordinated regulation of mitotic progression and cell cycle-dependent transcription. The many signaling pathways and activator proteins shown to function via Mediator may influence the timing of these cell cycle events. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  7. Adolescent Depression and Negative Life Events, the Mediating Role of Cognitive Emotion Regulation

    Science.gov (United States)

    Stikkelbroek, Yvonne; Bodden, Denise H. M.; Kleinjan, Marloes; Reijnders, Mirjam; van Baar, Anneloes L.

    2016-01-01

    Background Depression during adolescence is a serious mental health problem. Difficulties in regulating evoked emotions after stressful life events are considered to lead to depression. This study examined if depressive symptoms were mediated by various cognitive emotion regulation strategies after stressful life events, more specifically, the loss of a loved one, health threats or relational challenges. Methods We used a sample of 398 adolescents (Mage = 16.94, SD = 2.90), including 52 depressed outpatients, who all reported stressful life event(s). Path analyses in Mplus were used to test mediation, for the whole sample as well as separately for participants scoring high versus low on depression, using multigroup analyses. Results Health threats and relational challenging stressful life events were associated with depressive symptoms, while loss was not. More frequent use of maladaptive strategies was related to more depressive symptoms. More frequent use of adaptive strategies was related to less depressive symptoms. Specific life events were associated with specific emotion regulation strategies. The relationship between challenging, stressful life events and depressive symptoms in the whole group was mediated by maladaptive strategies (self-blame, catastrophizing and rumination). No mediation effect was found for adaptive strategies. Conclusion The association between relational challenging, stressful life events and depressive symptoms was mediated by maladaptive, cognitive emotion regulation strategies. PMID:27571274

  8. Regulator of calcineurin 1 mediates pathological vascular wall remodeling

    Science.gov (United States)

    Esteban, Vanesa; Méndez-Barbero, Nerea; Jesús Jiménez-Borreguero, Luis; Roqué, Mercè; Novensá, Laura; Belén García-Redondo, Ana; Salaices, Mercedes; Vila, Luis; Arbonés, María L.

    2011-01-01

    Artery wall remodeling, a major feature of diseases such as hypertension, restenosis, atherosclerosis, and aneurysm, involves changes in the tunica media mass that reduce or increase the vessel lumen. The identification of molecules involved in vessel remodeling could aid the development of improved treatments for these pathologies. Angiotensin II (AngII) is a key effector of aortic wall remodeling that contributes to aneurysm formation and restenosis through incompletely defined signaling pathways. We show that AngII induces vascular smooth muscle cell (VSMC) migration and vessel remodeling in mouse models of restenosis and aneurysm. These effects were prevented by pharmacological inhibition of calcineurin (CN) or lentiviral delivery of CN-inhibitory peptides. Whole-genome analysis revealed >1,500 AngII-regulated genes in VSMCs, with just 11 of them requiring CN activation. Of these, the most sensitive to CN activation was regulator of CN 1 (Rcan1). Rcan1 was strongly activated by AngII in vitro and in vivo and was required for AngII-induced VSMC migration. Remarkably, Rcan1−/− mice were resistant to AngII-induced aneurysm and restenosis. Our results indicate that aneurysm formation and restenosis share mechanistic elements and identify Rcan1 as a potential therapeutic target for prevention of aneurysm and restenosis progression. PMID:21930771

  9. GSK3 is a regulator of RAR-mediated differentiation

    Science.gov (United States)

    Gupta, K; Gulen, F; Sun, L; Aguilera, R; Chakrabarti, A; Kiselar, J; Agarwal, MK; Wald, DN

    2015-01-01

    Acute myeloid leukemia (AML) is the most common form of leukemia in adults. Unfortunately, the standard therapeutic agents used for this disease have high toxicities and poor efficacy. The one exception to these poor outcomes is the use of the retinoid, all-trans retinoic acid (ATRA), for a rare subtype of AML (APL). The use of the differentiation agent, ATRA, in combination with low-dose chemotherapy leads to the long-term survival and presumed cure of 75–85% of patients. Unfortunately ATRA has not been clinically useful for other subtypes of AML. Though many non-APL leukemic cells respond to ATRA, they require significantly higher concentrations of ATRA for effective differentiation. Here we show that the combination of ATRA with glycogen synthase kinase 3 (GSK3) inhibition significantly enhances ATRA-mediated AML differentiation and growth inhibition. These studies have revealed that ATRA's receptor, the retinoic acid receptor (RAR), is a novel target of GSK3 phosphorylation and that GSK3 can impact the expression and transcriptional activity of the RAR. Overall, our studies suggest the clinical potential of ATRA and GSK3 inhibition for AML and provide a mechanistic framework to explain the promising activity of this combination regimen. PMID:22222598

  10. Distinct brain systems mediate the effects of nociceptive input and self-regulation on pain.

    Directory of Open Access Journals (Sweden)

    Choong-Wan Woo

    2015-01-01

    Full Text Available Cognitive self-regulation can strongly modulate pain and emotion. However, it is unclear whether self-regulation primarily influences primary nociceptive and affective processes or evaluative ones. In this study, participants engaged in self-regulation to increase or decrease pain while experiencing multiple levels of painful heat during functional magnetic resonance imaging (fMRI imaging. Both heat intensity and self-regulation strongly influenced reported pain, but they did so via two distinct brain pathways. The effects of stimulus intensity were mediated by the neurologic pain signature (NPS, an a priori distributed brain network shown to predict physical pain with over 90% sensitivity and specificity across four studies. Self-regulation did not influence NPS responses; instead, its effects were mediated through functional connections between the nucleus accumbens and ventromedial prefrontal cortex. This pathway was unresponsive to noxious input, and has been broadly implicated in valuation, emotional appraisal, and functional outcomes in pain and other types of affective processes. These findings provide evidence that pain reports are associated with two dissociable functional systems: nociceptive/affective aspects mediated by the NPS, and evaluative/functional aspects mediated by a fronto-striatal system.

  11. Ubiquitin regulates GGA3-mediated degradation of BACE1.

    Science.gov (United States)

    Kang, Eugene L; Cameron, Andrew N; Piazza, Fabrizio; Walker, Kendall R; Tesco, Giuseppina

    2010-07-30

    BACE1 (beta-site amyloid precursor protein-cleaving enzyme 1) is a membrane-tethered member of the aspartyl proteases, essential for the production of beta-amyloid, a toxic peptide that accumulates in the brain of subjects affected by Alzheimer disease. The BACE1 C-terminal fragment contains a DXXLL motif that has been shown to bind the VHS (VPS27, Hrs, and STAM) domain of GGA1-3 (Golgi-localized gamma-ear-containing ARF-binding proteins). GGAs are trafficking molecules involved in the transport of proteins containing the DXXLL signal from the Golgi complex to endosomes. Moreover, GGAs bind ubiquitin and traffic synthetic and endosomal ubiquitinated cargoes to lysosomes. We have previously shown that depletion of GGA3 results in increased BACE1 levels and activity because of impaired lysosomal degradation. Here, we report that the accumulation of BACE1 is rescued by the ectopic expression of GGA3 in H4 neuroglioma cells depleted of GGA3. Accordingly, the overexpression of GGA3 reduces the levels of BACE1 and beta-amyloid. We then established that mutations in the GGA3 VPS27, Hrs, and STAM domain (N91A) or in BACE1 di-leucine motif (L499A/L500A), able to abrogate their binding, did not affect the ability of ectopically expressed GGA3 to rescue BACE1 accumulation in cells depleted of GGA3. Instead, we found that BACE1 is ubiquitinated at lysine 501 and is mainly monoubiquitinated and Lys-63-linked polyubiquitinated. Finally, a GGA3 mutant with reduced ability to bind ubiquitin (GGA3L276A) was unable to regulate BACE1 levels both in rescue and overexpression experiments. These findings indicate that levels of GGA3 tightly and inversely regulate BACE1 levels via interaction with ubiquitin sorting machinery.

  12. Ubiquitin Regulates GGA3-mediated Degradation of BACE1*

    Science.gov (United States)

    Kang, Eugene L.; Cameron, Andrew N.; Piazza, Fabrizio; Walker, Kendall R.; Tesco, Giuseppina

    2010-01-01

    BACE1 (β-site amyloid precursor protein-cleaving enzyme 1) is a membrane-tethered member of the aspartyl proteases, essential for the production of β-amyloid, a toxic peptide that accumulates in the brain of subjects affected by Alzheimer disease. The BACE1 C-terminal fragment contains a DXXLL motif that has been shown to bind the VHS (VPS27, Hrs, and STAM) domain of GGA1–3 (Golgi-localized γ-ear-containing ARF-binding proteins). GGAs are trafficking molecules involved in the transport of proteins containing the DXXLL signal from the Golgi complex to endosomes. Moreover, GGAs bind ubiquitin and traffic synthetic and endosomal ubiquitinated cargoes to lysosomes. We have previously shown that depletion of GGA3 results in increased BACE1 levels and activity because of impaired lysosomal degradation. Here, we report that the accumulation of BACE1 is rescued by the ectopic expression of GGA3 in H4 neuroglioma cells depleted of GGA3. Accordingly, the overexpression of GGA3 reduces the levels of BACE1 and β-amyloid. We then established that mutations in the GGA3 VPS27, Hrs, and STAM domain (N91A) or in BACE1 di-leucine motif (L499A/L500A), able to abrogate their binding, did not affect the ability of ectopically expressed GGA3 to rescue BACE1 accumulation in cells depleted of GGA3. Instead, we found that BACE1 is ubiquitinated at lysine 501 and is mainly monoubiquitinated and Lys-63-linked polyubiquitinated. Finally, a GGA3 mutant with reduced ability to bind ubiquitin (GGA3L276A) was unable to regulate BACE1 levels both in rescue and overexpression experiments. These findings indicate that levels of GGA3 tightly and inversely regulate BACE1 levels via interaction with ubiquitin sorting machinery. PMID:20484053

  13. CodY-mediated regulation of Streptococcus pyogenes exoproteins

    Directory of Open Access Journals (Sweden)

    McDowell Emily J

    2012-06-01

    Full Text Available Abstract Background The production of Streptococcus pyogenes exoproteins, many of which contribute to virulence, is regulated in response to nutrient availability. CodY is a transcriptional regulator that controls gene expression in response to amino acid availability. The purpose of this study was to identify differences in the expression of streptococcal exoproteins associated with deletion of the codY gene. Results We compared the secreted proteins produced by wild-type S. pyogenes to a codY mutant in the post-exponential phase of growth. We used both one and two-dimensional gel electrophoresis to separate exoproteins. Proteins that were significantly different in abundance upon repeated analysis were identified with tandem mass spectrometry. The production of the secreted cysteine protease SpeB, a secreted chromosomally encoded nuclease (SdaB, and a putative adhesion factor (Spy49_0549 were more abundant in supernatant fluids obtained from the codY mutant. In addition, hyaluronidase (HylA, CAMP factor (Cfa, a prophage encoded nuclease (Spd-3, and an uncharacterized extracellular protein (Spy49_0015 were less abundant in supernatant fluids obtained from the codY mutant strain. Enzymatic assays showed greater DNase activity in culture supernatants isolated in the post-exponential phase of growth from the codY mutant strain compared to the wild-type strain. Because extracellular nucleases and proteases can influence biofilm formation, we also measured the ability of the strains to form biofilms during growth with both rich medium (Todd Hewitt yeast extract; THY and chemically defined media (CDM. No difference was observed with rich media but with CDM the biofilms formed by the codY mutant strain had less biomass compared to the wild-type strain. Conclusions Overall, the results indicate that CodY alters the abundance of a select group of S. pyogenes exoproteins, including DNases, a protease, and hylauronidase, which together may alleviate

  14. miRNA-mediated functional changes through co-regulating function related genes.

    Directory of Open Access Journals (Sweden)

    Jie He

    Full Text Available BACKGROUND: MicroRNAs play important roles in various biological processes involving fairly complex mechanism. Analysis of genome-wide miRNA microarray demonstrate that a single miRNA can regulate hundreds of genes, but the regulative extent on most individual genes is surprisingly mild so that it is difficult to understand how a miRNA provokes detectable functional changes with such mild regulation. RESULTS: To explore the internal mechanism of miRNA-mediated regulation, we re-analyzed the data collected from genome-wide miRNA microarray with bioinformatics assay, and found that the transfection of miR-181b and miR-34a in Hela and HCT-116 tumor cells regulated large numbers of genes, among which, the genes related to cell growth and cell death demonstrated high Enrichment scores, suggesting that these miRNAs may be important in cell growth and cell death. MiR-181b induced changes in protein expression of most genes that were seemingly related to enhancing cell growth and decreasing cell death, while miR-34a mediated contrary changes of gene expression. Cell growth assays further confirmed this finding. In further study on miR-20b-mediated osteogenesis in hMSCs, miR-20b was found to enhance osteogenesis by activating BMPs/Runx2 signaling pathway in several stages by co-repressing of PPARγ, Bambi and Crim1. CONCLUSIONS: With its multi-target characteristics, miR-181b, miR-34a and miR-20b provoked detectable functional changes by co-regulating functionally-related gene groups or several genes in the same signaling pathway, and thus mild regulation from individual miRNA targeting genes could have contributed to an additive effect. This might also be one of the modes of miRNA-mediated gene regulation.

  15. Csk Homologous Kinase, a Potential Regulator of CXCR4-mediated Breast Cancer Cell Metastasis

    Science.gov (United States)

    2010-08-31

    SH2 ) and SH3 domains and lacks the consensus tyrosine phosphorylation and myristylation sites found in Src family kinases . CHK has been shown to...0350 TITLE: Csk Homologous Kinase , a Potential Regulator of CXCR4-mediated Breast Cancer Cell Metastasis PRINCIPAL INVESTIGATOR: Byeong-Chel...1 AUG 2009 - 31 JUL 2010 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER W81XWH-09-1-0350 Csk Homologous Kinase , a Potential Regulator

  16. Depression and reduced heart rate variability after cardiac surgery: the mediating role of emotion regulation.

    Science.gov (United States)

    Patron, Elisabetta; Messerotti Benvenuti, Simone; Favretto, Giuseppe; Gasparotto, Renata; Palomba, Daniela

    2014-02-01

    Heart rate variability (HRV), as an index of autonomic nervous system (ANS) functioning, is reduced by depression after cardiac surgery, but the underlying mechanisms of this relationship are poorly understood. Poor emotion regulation as a core symptom of depression has also been associated with altered ANS functioning. The present study aimed to examine whether emotion dysregulation could be a mediator of the depression-reduced HRV relationship observed after cardiac surgery. Self-reported emotion regulation and four-minute HRV were measured in 25 depressed and 43 nondepressed patients after cardiac surgery. Mediation analysis was conducted to evaluate emotion regulation as a mediator of the depression-reduced HRV relationship. Compared to nondepressed patients, those with depression showed lower standard deviation of normal-to-normal (NN) intervals (pbehavior partially mediated the effect of depression on LF n.u. and HF n.u. Results confirmed previous findings showing that depression is associated with reduced HRV, especially a reduced vagal tone and a sympathovagal imbalance, after cardiac surgery. This study also provides preliminary evidence that increased trait levels of suppression of emotion-expressive behavior may mediate the depression-related sympathovagal imbalance after cardiac surgery. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Phasevarion mediated epigenetic gene regulation in Helicobacter pylori.

    Directory of Open Access Journals (Sweden)

    Yogitha N Srikhanta

    Full Text Available Many host-adapted bacterial pathogens contain DNA methyltransferases (mod genes that are subject to phase-variable expression (high-frequency reversible ON/OFF switching of gene expression. In Haemophilus influenzae and pathogenic Neisseria, the random switching of the modA gene, associated with a phase-variable type III restriction modification (R-M system, controls expression of a phase-variable regulon of genes (a "phasevarion", via differential methylation of the genome in the modA ON and OFF states. Phase-variable type III R-M systems are also found in Helicobacter pylori, suggesting that phasevarions may also exist in this key human pathogen. Phylogenetic studies on the phase-variable type III modH gene revealed that there are 17 distinct alleles in H. pylori, which differ only in their DNA recognition domain. One of the most commonly found alleles was modH5 (16% of isolates. Microarray analysis comparing the wild-type P12modH5 ON strain to a P12ΔmodH5 mutant revealed that six genes were either up- or down-regulated, and some were virulence-associated. These included flaA, which encodes a flagella protein important in motility and hopG, an outer membrane protein essential for colonization and associated with gastric cancer. This study provides the first evidence of this epigenetic mechanism of gene expression in H. pylori. Characterisation of H. pylori modH phasevarions to define stable immunological targets will be essential for vaccine development and may also contribute to understanding H. pylori pathogenesis.

  18. Sexual harassment in heterogeneous landscapes can mediate population regulation in a grasshopper

    NARCIS (Netherlands)

    Bauer, S.; Samietz, J.; Berger, U.

    2005-01-01

    Population regulation has been related to differences in the quality among habitats, which mediate differences in vital rates such that in poor habitats reproductive rates are lower than those in high-quality habitats. The spatial distribution of animals in such habitats depends on their preferences

  19. Herp regulates Hrd1-mediated ubiquitylation in a ubiquitin-like domain-dependent manner

    DEFF Research Database (Denmark)

    Kny, Melanie; Standera, Sybille; Hartmann-Petersen, Rasmus

    2011-01-01

    in ER-associated protein degradation (ERAD) and interacts directly with the ubiquitin ligase Hrd1, which is found in high molecular mass complexes of the ER membrane. Here we present the first evidence that Herp regulates Hrd1-mediated ubiquitylation in a ubiquitin-like (UBL) domain-dependent manner. We...

  20. β-Adrenergic regulation of the cardiac Na+-K+ ATPase mediated by oxidative signaling

    DEFF Research Database (Denmark)

    Galougahi, Keyvan Karimi; Liu, Chia-Chi; Bundgaard, Henning

    2012-01-01

    Activation of β-adrenergic receptors (ARs) elicits responses arising from protein kinase A (PKA)-mediated phosphorylation of target proteins that regulate Ca(2+)-dependent excitation-contraction coupling. Some important targets for β-AR- and PKA-dependent pathways, including the sarcolemmal Na(+)...

  1. Regulation of GPCR-mediated smooth muscle contraction : implications for asthma and pulmonary hypertension

    NARCIS (Netherlands)

    Wright, D B; Tripathi, S; Sikarwar, A; Santosh, K T; Perez-Zoghbi, J; Ojo, O O; Irechukwu, N; Ward, J P T; Schaafsma, D

    Contractile G-protein-coupled receptors (GPCRs) have emerged as key regulators of smooth muscle contraction, both under healthy and diseased conditions. This brief review will discuss some key topics and novel insights regarding GPCR-mediated airway and vascular smooth muscle contraction as

  2. Ligand-mediated negative regulation of a chimeric transmembrane receptor tyrosine phosphatase

    DEFF Research Database (Denmark)

    Desai, D M; Sap, J; Schlessinger, J

    1993-01-01

    CD45, a transmembrane protein tyrosine phosphatase (PTPase), is required for TCR signaling. Multiple CD45 isoforms, differing in the extracellular domain, are expressed in a tissue- and activation-specific manner, suggesting an important function for this domain. We report that a chimeric protein...... that ligand-mediated regulation of receptor-PTPases may have mechanistic similarities with receptor tyrosine kinases....

  3. VMAT2-mediated neurotransmission from midbrain leptin receptor neurons in feeding regulation

    Science.gov (United States)

    Leptin receptors (LepRs) expressed in the midbrain contribute to the action of leptin on feeding regulation. The midbrain neurons release a variety of neurotransmitters including dopamine (DA), glutamate and GABA. However, which neurotransmitter mediates midbrain leptin action on feeding remains unc...

  4. Culture as Mediator: Co-Regulation, Self-Regulation, and Middle School Mathematics Achievement

    Science.gov (United States)

    Hinnant-Crawford, Brandi Nicole; Faison, Morgan Z.; Chang, Mei-Lin

    2016-01-01

    Purpose: Self-regulation is defined as strategic, metacognitive behavior, motivation and cognition aimed at a goal (Zimmmerman and Schunk, 2011). Co-regulation, arguably more aligned with norms in communal cultures, is the process of learners sharing "a common problem-solving plane" through which self-regulatory strategies are learned…

  5. Phospho-Caveolin-1 Mediates Integrin-Regulated Membrane Domain Internalisation

    Science.gov (United States)

    del Pozo, Miguel A.; Alderson, Nazilla B.; Grande-García, Araceli; Balasubramanian, Nagaraj; Schwartz, Martin A.; Kiosses, William B.; Anderson, Richard G.W.

    2005-01-01

    Growth of normal cells is anchorage-dependent because signalling through multiple pathways including Erk, PI 3-kinase and Rac requires integrin-mediated cell adhesion 1. Components of these pathways localize to low density, cholesterol-rich domains in the plasma membrane named “lipid rafts” 2,3 or “cholesterol enriched membrane microdomains” (CEMM) 4. We previously reported that integrin-mediated adhesion regulates CEMM trafficking such that cell detachment from the extracellular matrix (ECM) triggers CEMM internalisation and clearance from the plasma membrane 5. We now report that this internalisation is mediated by dynamin-2 and caveolin-1. Internalisation requires phosphorylation of caveolin-1 on tyrosine 14. A shift in localisation of phospho-caveolin-1 from focal adhesions to caveolae induces CEMM internalisation upon cell detachment, which mediates inhibition of Erk, PI 3-kinase and Rac. These data define a novel molecular mechanism for growth and tumour suppression by caveolin-1. PMID:16113676

  6. The metazoan Mediator co-activator complex as an integrative hub for transcriptional regulation.

    Science.gov (United States)

    Malik, Sohail; Roeder, Robert G

    2010-11-01

    The Mediator is an evolutionarily conserved, multiprotein complex that is a key regulator of protein-coding genes. In metazoan cells, multiple pathways that are responsible for homeostasis, cell growth and differentiation converge on the Mediator through transcriptional activators and repressors that target one or more of the almost 30 subunits of this complex. Besides interacting directly with RNA polymerase II, Mediator has multiple functions and can interact with and coordinate the action of numerous other co-activators and co-repressors, including those acting at the level of chromatin. These interactions ultimately allow the Mediator to deliver outputs that range from maximal activation of genes to modulation of basal transcription to long-term epigenetic silencing.

  7. Emotion Regulation Feeding Practices Link Parents' Emotional Eating to Children's Emotional Eating: A Moderated Mediation Study.

    Science.gov (United States)

    Tan, Cin Cin; Holub, Shayla C

    2015-08-01

    Past research suggests an association between parents' and children's emotional eating, but research has yet to examine mechanisms underlying this association. The current study examined whether feeding for emotion regulation mediates the association between parents' and children's emotional eating, and whether this association is moderated by children's self-regulation in eating. 95 parents reported on their own and their children's emotional eating, their children's self-regulation in eating, as well as their feeding practices. Findings revealed that feeding for emotion regulation mediated the association between parents' and children's emotional eating when children's self-regulation in eating was low, but not when self-regulation in eating was high. The current findings demonstrate the complexity of the link between parents' and children's emotional eating, suggesting practitioners should consider both feeding practices and children's self-regulation in eating when designing intervention programs. © The Author 2015. Published by Oxford University Press on behalf of the Society of Pediatric Psychology. All rights reserved.For permissions, please e-mail: journals.permissions@oup.com.

  8. The dual regulation of substance P-mediated inflammation via human synovial mast cells in rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Yuki Okamura

    2017-09-01

    Conclusions: Activated synovial MCs may rapidly degrade SP, which may downregulate the SP-mediated activation of synoviocytes in RA. On the other hand, SP activates MCs to induce inflammatory mediators, suggesting the dual regulation of SP-mediated inflammation by MCs in RA.

  9. Poxviral protein A52 stimulates p38 mitogen-activated protein kinase (MAPK) activation by causing tumor necrosis factor receptor-associated factor 6 (TRAF6) self-association leading to transforming growth factor β-activated kinase 1 (TAK1) recruitment.

    Science.gov (United States)

    Stack, Julianne; Hurst, Tara P; Flannery, Sinead M; Brennan, Kiva; Rupp, Sebastian; Oda, Shun-ichiro; Khan, Amir R; Bowie, Andrew G

    2013-11-22

    Vaccinia virus encodes a number of proteins that inhibit and manipulate innate immune signaling pathways that also have a role in virulence. These include A52, a protein shown to inhibit IL-1- and Toll-like receptor-stimulated NFκB activation, via interaction with interleukin-1 receptor-associated kinase 2 (IRAK2). Interestingly, A52 was also found to activate p38 MAPK and thus enhance Toll-like receptor-dependent IL-10 induction, which was TRAF6-dependent, but the manner in which A52 manipulates TRAF6 to stimulate p38 activation was unclear. Here, we show that A52 has a non-canonical TRAF6-binding motif that is essential for TRAF6 binding and p38 activation but dispensable for NFκB inhibition and IRAK2 interaction. Wild-type A52, but not a mutant defective in p38 activation and TRAF6 binding (F154A), caused TRAF6 oligomerization and subsequent TRAF6-TAK1 association. The crystal structure of A52 shows that it adopts a Bcl2-like fold and exists as a dimer in solution. Residue Met-65 was identified as being located in the A52 dimer interface, and consistent with that, A52-M65E was impaired in its ability to dimerize. A52-M65E although capable of interacting with TRAF6, was unable to cause either TRAF6 self-association, induce the TRAF6-TAK1 association, or activate p38 MAPK. The results suggest that an A52 dimer causes TRAF6 self-association, leading to TAK1 recruitment and p38 activation. This reveals a molecular mechanism whereby poxviruses manipulate TRAF6 to activate MAPKs (which can be proviral) without stimulating antiviral NFκB activation.

  10. TPL-2 Regulates Macrophage Lipid Metabolism and M2 Differentiation to Control TH2-Mediated Immunopathology

    Science.gov (United States)

    Entwistle, Lewis J.; Khoury, Hania; Papoutsopoulou, Stamatia; Mahmood, Radma; Mansour, Nuha R.; Ching-Cheng Huang, Stanley; Pearce, Edward J.; Pedro S. de Carvalho, Luiz; Ley, Steven C.

    2016-01-01

    Persistent TH2 cytokine responses following chronic helminth infections can often lead to the development of tissue pathology and fibrotic scarring. Despite a good understanding of the cellular mechanisms involved in fibrogenesis, there are very few therapeutic options available, highlighting a significant medical need and gap in our understanding of the molecular mechanisms of TH2-mediated immunopathology. In this study, we found that the Map3 kinase, TPL-2 (Map3k8; Cot) regulated TH2-mediated intestinal, hepatic and pulmonary immunopathology following Schistosoma mansoni infection or S. mansoni egg injection. Elevated inflammation, TH2 cell responses and exacerbated fibrosis in Map3k8 –/–mice was observed in mice with myeloid cell-specific (LysM) deletion of Map3k8, but not CD4 cell-specific deletion of Map3k8, indicating that TPL-2 regulated myeloid cell function to limit TH2-mediated immunopathology. Transcriptional and metabolic assays of Map3k8 –/–M2 macrophages identified that TPL-2 was required for lipolysis, M2 macrophage activation and the expression of a variety of genes involved in immuno-regulatory and pro-fibrotic pathways. Taken together this study identified that TPL-2 regulated TH2-mediated inflammation by supporting lipolysis and M2 macrophage activation, preventing TH2 cell expansion and downstream immunopathology and fibrosis. PMID:27487182

  11. Emotion regulation strategies mediate the associations of positive and negative affect to upper extremity physical function.

    Science.gov (United States)

    Talaei-Khoei, Mojtaba; Nemati-Rezvani, Hora; Fischerauer, Stefan F; Ring, David; Chen, Neal; Vranceanu, Ana-Maria

    2017-05-01

    The Gross process model of emotion regulation holds that emotion-eliciting situations (e.g. musculoskeletal illness) can be strategically regulated to determine the final emotional and behavioral response. Also, there is some evidence that innate emotional traits may predispose an individual to a particular regulating coping style. We enrolled 107 patients with upper extremity musculoskeletal illness in this cross-sectional study. They completed self-report measures of positive and negative affect, emotion regulation strategies (cognitive reappraisal and expressive suppression), upper extremity physical function, pain intensity, and demographics. We used Preacher and Hayes' bootstrapping approach to process analysis to infer the direct effect of positive and negative affect on physical function as well as their indirect effects through activation of emotion regulation strategies. Negative affect was associated with decreased physical function. The association was partly mediated by expressive suppression (b (SE)=-.10 (.05), 95% BCa CI [-.21, -.02]). Positive affect was associated with increased physical function. Cognitive reappraisal partially mediated this association (b (SE)=.11 (.05), 95% BCa CI [.03, .24]). After controlling for pain intensity, the ratio of the mediated effect to total effect grew even larger in controlled model comparing to uncontrolled model (33% vs. 26% for expressive suppression and 32% vs. 30% for cognitive reappraisal). The relationships between affect, emotion regulation strategies and physical function appear to be more dependent on the emotional response to an orthopedic condition rather than the intensity of the nociceptive stimulation of the pain. Findings support integration of emotion regulation training in skill-based psychotherapy in this population to mitigate the effect of negative affect and enhance the influence of positive affect on physical function. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Prefrontal mediation of emotion regulation in social anxiety disorder during laughter perception.

    Science.gov (United States)

    Kreifelts, Benjamin; Brück, Carolin; Ethofer, Thomas; Ritter, Jan; Weigel, Lena; Erb, Michael; Wildgruber, Dirk

    2017-02-01

    Social anxiety disorder (SAD) is characterized by negatively biased perception of social cues and deficits in emotion regulation. While negatively biased perception is thought to maintain social anxiety, emotion regulation represents an ability necessary to overcome both biased perception and social anxiety. Here, we used laughter as a social threat in a functional magnetic resonance imaging (fMRI) study to identify cerebral mediators linking SAD with attention and interpretation biases and their modification through cognitive emotion regulation in the form of reappraisal. We found that reappraisal abolished the negative laughter interpretation bias in SAD and that this process was directly mediated through activation patterns of the left dorsolateral prefrontal cortex (DLPFC) serving as a cerebral pivot between biased social perception and its normalization through reappraisal. Connectivity analyses revealed reduced prefrontal control over threat-processing sensory cortices (here: the temporal voice area) during cognitive emotion regulation in SAD. Our results indicate a central role for the left DLPFC in SAD which might represent a valuable target for future research on interventions either aiming to directly modulate cognitive emotion regulation in SAD or to evaluate its potential as physiological marker for psychotherapeutic interventions relying on emotion regulation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Academic Stress and Self-Regulation among University Students in Malaysia: Mediator Role of Mindfulness.

    Science.gov (United States)

    Hj Ramli, Nur Hamizah; Alavi, Masoumeh; Mehrinezhad, Seyed Abolghasem; Ahmadi, Atefeh

    2018-01-15

    Academic stress is the most common emotional or mental state that students experience during their studies. Stress is a result of a wide range of issues, including test and exam burden, a demanding course, a different educational system, and thinking about future plans upon graduation. A sizeable body of literature in stress management research has found that self-regulation and being mindful will help students to cope up with the stress and dodge long-term negative consequences, such as substance abuse. The present study aims to investigate the influence of academic stress, self-regulation, and mindfulness among undergraduate students in Klang Valley, Malaysia, and to identify mindfulness as the mediator between academic stress and self-regulation. For this study, a total of 384 undergraduate students in Klang Valley, Malaysia were recruited. Using Correlational analysis, results revealed that there was a significant relationship between academic stress, self-regulation, and mindfulness. However, using SPSS mediational analysis, mindfulness did not prove the mediator role in the study.

  14. Importance of Mediator complex in the regulation and integration of diverse signaling pathways in plants.

    Science.gov (United States)

    Samanta, Subhasis; Thakur, Jitendra K

    2015-01-01

    Basic transcriptional machinery in eukaryotes is assisted by a number of cofactors, which either increase or decrease the rate of transcription. Mediator complex is one such cofactor, and recently has drawn a lot of interest because of its integrative power to converge different signaling pathways before channeling the transcription instructions to the RNA polymerase II machinery. Like yeast and metazoans, plants do possess the Mediator complex across the kingdom, and its isolation and subunit analyses have been reported from the model plant, Arabidopsis. Genetic, and molecular analyses have unraveled important regulatory roles of Mediator subunits at every stage of plant life cycle starting from flowering to embryo and organ development, to even size determination. It also contributes immensely to the survival of plants against different environmental vagaries by the timely activation of its resistance mechanisms. Here, we have provided an overview of plant Mediator complex starting from its discovery to regulation of stoichiometry of its subunits. We have also reviewed involvement of different Mediator subunits in different processes and pathways including defense response pathways evoked by diverse biotic cues. Wherever possible, attempts have been made to provide mechanistic insight of Mediator's involvement in these processes.

  15. Self-Regulation Mediates the Relationship between Learner Typology and Achievement in At - Risk Children

    Science.gov (United States)

    Weed, Keri; Keogh, Deborah; Borkowski, John G.; Whitman, Thomas; Noria, Christine W.

    2010-01-01

    A person-centered approach was used to explore the mediating role of self-regulation between learner typology at age 8 and academic achievement at age 14while controlling for domain-specific achievement in a longitudinal sample of 113 children born to adolescent mothers. Children were classified into one of 5 learner typologies at age 8based on interactive patterns of intellectual, achievement, and adaptive abilities. Typology classification explained significant variance in both reading and mathematics achievement at age 14. A bootstrapping approach confirmed that self-regulation mediated the relationship between typology and reading and mathematical achievement for children from all typologies except those classified as Cognitively and Adaptively Challenged. Implications of person-centered approaches for understanding processes involved with achievement are discussed. PMID:21278904

  16. Emotion regulation and depressive symptoms: examining the mediation effects of school connectedness in Chinese late adolescents.

    Science.gov (United States)

    Zhao, Yanhua; Zhao, Guoxiang

    2015-04-01

    This study tested Gross's process model of emotion regulation in a Chinese adolescent sample. It hypothesized that emotion regulation strategies (cognitive reappraisal and expressive suppression) would predict adolescents' perception of school connectedness and depressive symptoms. It also posited that school connectedness may be a possible mediator between emotion regulation and depressive symptoms. Participants were 504 adolescents aged 16-18 from two Chinese public upper secondary schools. Structural equation modeling analyses indicated that reappraisal and suppression significantly associated with school connectedness and depressive symptoms, and school connectedness mediated the link between emotion regulation and depressive symptoms, even when the general emotion experiences were controlled. Although boys unexpectedly reported higher level depressive symptoms, the hypothesized model was invariant across gender except for the link between suppression and depressive symptoms. These findings demonstrate that it is meaningful to involve both emotion regulation processes and school connectedness in explaining adolescent depressive symptoms. Copyright © 2015 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

  17. TRIM45 negatively regulates NF-κB-mediated transcription and suppresses cell proliferation

    International Nuclear Information System (INIS)

    Shibata, Mio; Sato, Tomonobu; Nukiwa, Ryota; Ariga, Tadashi; Hatakeyama, Shigetsugu

    2012-01-01

    Highlights: ► NF-κB plays an important role in cell survival and carcinogenesis. ► TRIM45 negatively regulates TNFα-induced NF-κB-mediated transcription. ► TRIM45 overexpression suppresses cell growth. ► TRIM45 acts as a repressor for the NF-κB signal and regulates cell growth. -- Abstract: The NF-κB signaling pathway plays an important role in cell survival, immunity, inflammation, carcinogenesis, and organogenesis. Activation of NF-κB is regulated by several posttranslational modifications including phosphorylation, neddylation and ubiquitination. The NF-κB signaling pathway is activated by two distinct signaling mechanisms and is strictly modulated by the ubiquitin–proteasome system. It has been reported that overexpression of TRIM45, one of the TRIM family ubiquitin ligases, suppresses transcriptional activities of Elk-1 and AP-1, which are targets of the MAPK signaling pathway. In this study, we showed that TRIM45 also negatively regulates TNFα-induced NF-κB-mediated transcription by a luciferase reporter assay and that TRIM45 lacking a RING domain also has an activity to inhibit the NF-κB signal. Moreover, we found that TRIM45 overexpression suppresses cell growth. These findings suggest that TRIM45 acts as a repressor for the NF-κB signal and regulates cell growth.

  18. Attachment, emotion regulation and coping in Portuguese emerging adults: a test of a mediation hypothesis.

    Science.gov (United States)

    Cabral, Joana; Matos, Paula M; Beyers, Wim; Soenens, Bart

    2012-11-01

    Although the quality of parent-adolescent emotional bonds has consistently been proposed as a major influence on young adult's psycho-emotional functioning, the precise means by which these bonds either facilitate or impede adaptive coping are not well-understood. In an effort to advance this inquiry, the present study examined interrelationships among measures of parental attachment, emotion regulation processes, and preferred coping strategies within a sample of 942 college freshmen. Structural Equation Modelling was used to test whether the link between attachment to parents and the use of particular coping strategies is mediated by differences in emotion regulation mechanisms. As hypothesized, differences in attachment to parents predicted differences in the use of emotion regulation mechanisms and coping strategies. More specifically, having a close emotional bond, feeling supported in autonomy processes and having (moderately) low levels of separation anxiety toward parents predict more constructive emotion regulation mechanisms and coping strategies. Additionally emotion regulation was found to (partly or totally) mediate the association between attachment and coping.

  19. Thermo-Regulation of Genes Mediating Motility and Plant Interactions in Pseudomonas syringae

    Science.gov (United States)

    Hockett, Kevin L.; Burch, Adrien Y.; Lindow, Steven E.

    2013-01-01

    Pseudomonas syringae is an important phyllosphere colonist that utilizes flagellum-mediated motility both as a means to explore leaf surfaces, as well as to invade into leaf interiors, where it survives as a pathogen. We found that multiple forms of flagellum-mediated motility are thermo-suppressed, including swarming and swimming motility. Suppression of swarming motility occurs between 28° and 30°C, which coincides with the optimal growth temperature of P. syringae. Both fliC (encoding flagellin) and syfA (encoding a non-ribosomal peptide synthetase involved in syringafactin biosynthesis) were suppressed with increasing temperature. RNA-seq revealed 1440 genes of the P. syringae genome are temperature sensitive in expression. Genes involved in polysaccharide synthesis and regulation, phage and IS elements, type VI secretion, chemosensing and chemotaxis, translation, flagellar synthesis and motility, and phytotoxin synthesis and transport were generally repressed at 30°C, while genes involved in transcriptional regulation, quaternary ammonium compound metabolism and transport, chaperone/heat shock proteins, and hypothetical genes were generally induced at 30°C. Deletion of flgM, a key regulator in the transition from class III to class IV gene expression, led to elevated and constitutive expression of fliC regardless of temperature, but did not affect thermo-regulation of syfA. This work highlights the importance of temperature in the biology of P. syringae, as many genes encoding traits important for plant-microbe interactions were thermo-regulated. PMID:23527276

  20. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition.

    Directory of Open Access Journals (Sweden)

    Arindam Deb

    Full Text Available Combinations of cis-regulatory elements (CREs present at the promoters facilitate the binding of several transcription factors (TFs, thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic

  1. Regulation of DC development and DC-mediated T-cell immunity via CISH

    OpenAIRE

    Miah, Mohammad Alam; Bae, Yong-Soo

    2013-01-01

    Cytokine inducible SH2-containing protein (CISH) plays a crucial role in type 1 dendritic cell (DC) development as well as in the DC-mediated activation of cytotoxic T lymphocytes (CTLs). CISH expression at late DC developmental stages shuts down the proliferation of DC progenitors by negatively regulating signal transducer and activator of transcription 5 (STAT5) and facilitates the differentiation of DCs into potent stimulators of CTLs.

  2. Regulation of DC development and DC-mediated T-cell immunity via CISH.

    Science.gov (United States)

    Miah, Mohammad Alam; Bae, Yong-Soo

    2013-03-01

    Cytokine inducible SH2-containing protein (CISH) plays a crucial role in type 1 dendritic cell (DC) development as well as in the DC-mediated activation of cytotoxic T lymphocytes (CTLs). CISH expression at late DC developmental stages shuts down the proliferation of DC progenitors by negatively regulating signal transducer and activator of transcription 5 (STAT5) and facilitates the differentiation of DCs into potent stimulators of CTLs.

  3. Salt Stress Represses Soybean Seed Germination by Negatively Regulating GA Biosynthesis While Positively Mediating ABA Biosynthesis

    OpenAIRE

    Kai Shu; Ying Qi; Feng Chen; Yongjie Meng; Xiaofeng Luo; Haiwei Shuai; Wenguan Zhou; Jun Ding; Junbo Du; Jiang Liu; Feng Yang; Qiang Wang; Weiguo Liu; Taiwen Yong; Xiaochun Wang

    2017-01-01

    Soybean is an important and staple oilseed crop worldwide. Salinity stress has adverse effects on soybean development periods, especially on seed germination and post-germinative growth. Improving seed germination and emergence will have positive effects under salt stress conditions on agricultural production. Here we report that NaCl delays soybean seed germination by negatively regulating gibberellin (GA) while positively mediating abscisic acid (ABA) biogenesis, which leads to a decrease i...

  4. ERK1/2 mediates glucose-regulated POMC gene expression in hypothalamic neurons.

    Science.gov (United States)

    Zhang, Juan; Zhou, Yunting; Chen, Cheng; Yu, Feiyuan; Wang, Yun; Gu, Jiang; Ma, Lian; Ho, Guyu

    2015-04-01

    Hypothalamic glucose-sensing neurons regulate the expression of genes encoding feeding-related neuropetides POMC, AgRP, and NPY - the key components governing metabolic homeostasis. AMP-activated protein kinase (AMPK) is postulated to be the molecular mediator relaying glucose signals to regulate the expression of these neuropeptides. Whether other signaling mediator(s) plays a role is not clear. In this study, we investigated the role of ERK1/2 using primary hypothalamic neurons as the model system. The primary neurons were differentiated from hypothalamic progenitor cells. The differentiated neurons possessed the characteristic neuronal cell morphology and expressed neuronal post-mitotic markers as well as leptin-regulated orexigenic POMC and anorexigenic AgRP/NPY genes. Treatment of cells with glucose dose-dependently increased POMC and decreased AgRP/NPY expression with a concurrent suppression of AMPK phosphorylation. In addition, glucose treatment dose-dependently increased the ERK1/2 phosphorylation. Blockade of ERK1/2 activity with its specific inhibitor PD98059 partially (approximately 50%) abolished glucose-induced POMC expression, but had little effect on AgRP/NPY expression. Conversely, blockade of AMPK activity with its specific inhibitor produced a partial (approximately 50%) reversion of low-glucose-suppressed POMC expression, but almost completely blunted the low-glucose-induced AgRP/NPY expression. The results indicate that ERK1/2 mediated POMC but not AgRP/NPY expression. Confirming the in vitro findings, i.c.v. administration of PD98059 in rats similarly attenuated glucose-induced POMC expression in the hypothalamus, but again had little effect on AgRP/NPY expression. The results are indicative of a novel role of ERK1/2 in glucose-regulated POMC expression and offer new mechanistic insights into hypothalamic glucose sensing. © 2015 Society for Endocrinology.

  5. Endogenous TasiRNAs mediate non-cell autonomous effects on gene regulation in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Rebecca Schwab

    Full Text Available BACKGROUND: Different classes of small RNAs (sRNAs refine the expression of numerous genes in higher eukaryotes by directing protein partners to complementary nucleic acids, where they mediate gene silencing. Plants encode a unique class of sRNAs, called trans-acting small interfering RNAs (tasiRNAs, which post-transcriptionally regulate protein-coding transcripts, as do microRNAs (miRNAs, and both sRNA classes control development through their targets. TasiRNA biogenesis requires multiple components of the siRNA pathway and also miRNAs. But while 21mer siRNAs originating from transgenes can mediate silencing across several cell layers, miRNA action seems spatially restricted to the producing or closely surrounding cells. PRINCIPAL FINDINGS: We have previously described the isolation of a genetrap reporter line for TAS3a, the major locus producing AUXIN RESPONS FACTOR (ARF-regulating tasiRNAs in the Arabidopsis shoot. Its activity is limited to the adaxial (upper side of leaf primordia, thus spatially isolated from ARF-activities, which are located in the abaxial (lower side. We show here by in situ hybridization and reporter fusions that the silencing activities of ARF-regulating tasiRNAs are indeed manifested non-cell autonomously to spatially control ARF activities. CONCLUSIONS/SIGNIFICANCE: Endogenous tasiRNAs are thus mediators of a mobile developmental signal and might provide effective gene silencing at a distance beyond the reach of most miRNAs.

  6. Work Environment Characteristics and Teacher Well-Being: The Mediation of Emotion Regulation Strategies

    Science.gov (United States)

    Yin, Hongbiao; Huang, Shenghua; Wang, Wenlan

    2016-01-01

    Based on an adjusted Job Demands-Resources (JD-R) model that considers the mediation of personal resources, this study examined the relationships between two characteristics of teachers’ work environment (i.e., emotional job demands and trust in colleagues) and two indicators of teachers’ well-being (i.e., teaching satisfaction and emotional exhaustion). In particular, the study focused on how emotion regulation strategies (i.e., reappraisal and suppression) mediate these relationships. Data collected from a questionnaire survey of 1115 primary school teachers in Hong Kong was analyzed to test the hypothesized relationships. The results of structural equation modeling indicated that: (1) the emotional job demands of teaching were detrimental to teacher well-being, whereas trust in colleagues was beneficial; (2) both emotion regulation strategies mediated the relationships between both emotional job demands and trust in colleagues and teacher well-being; and (3) teachers who tend to use more reappraisal may be psychologically healthier than those tend to adopt more suppression. These findings support the applicability of the JD-R model to school settings and highlight the role of teachers’ emotion regulation in teachers’ well-being. Implications for the improvement of school environments and teachers’ well-being are identified. PMID:27649216

  7. Strategies to regulate transcription factor-mediated gene positioning and interchromosomal clustering at the nuclear periphery.

    Science.gov (United States)

    Randise-Hinchliff, Carlo; Coukos, Robert; Sood, Varun; Sumner, Michael Chas; Zdraljevic, Stefan; Meldi Sholl, Lauren; Garvey Brickner, Donna; Ahmed, Sara; Watchmaker, Lauren; Brickner, Jason H

    2016-03-14

    In budding yeast, targeting of active genes to the nuclear pore complex (NPC) and interchromosomal clustering is mediated by transcription factor (TF) binding sites in the gene promoters. For example, the binding sites for the TFs Put3, Ste12, and Gcn4 are necessary and sufficient to promote positioning at the nuclear periphery and interchromosomal clustering. However, in all three cases, gene positioning and interchromosomal clustering are regulated. Under uninducing conditions, local recruitment of the Rpd3(L) histone deacetylase by transcriptional repressors blocks Put3 DNA binding. This is a general function of yeast repressors: 16 of 21 repressors blocked Put3-mediated subnuclear positioning; 11 of these required Rpd3. In contrast, Ste12-mediated gene positioning is regulated independently of DNA binding by mitogen-activated protein kinase phosphorylation of the Dig2 inhibitor, and Gcn4-dependent targeting is up-regulated by increasing Gcn4 protein levels. These different regulatory strategies provide either qualitative switch-like control or quantitative control of gene positioning over different time scales. © 2016 Randise-Hinchliff et al.

  8. Work Environment Characteristics and Teacher Well-Being: The Mediation of Emotion Regulation Strategies.

    Science.gov (United States)

    Yin, Hongbiao; Huang, Shenghua; Wang, Wenlan

    2016-09-13

    Based on an adjusted Job Demands-Resources (JD-R) model that considers the mediation of personal resources, this study examined the relationships between two characteristics of teachers' work environment (i.e., emotional job demands and trust in colleagues) and two indicators of teachers' well-being (i.e., teaching satisfaction and emotional exhaustion). In particular, the study focused on how emotion regulation strategies (i.e., reappraisal and suppression) mediate these relationships. Data collected from a questionnaire survey of 1115 primary school teachers in Hong Kong was analyzed to test the hypothesized relationships. The results of structural equation modeling indicated that: (1) the emotional job demands of teaching were detrimental to teacher well-being, whereas trust in colleagues was beneficial; (2) both emotion regulation strategies mediated the relationships between both emotional job demands and trust in colleagues and teacher well-being; and (3) teachers who tend to use more reappraisal may be psychologically healthier than those tend to adopt more suppression. These findings support the applicability of the JD-R model to school settings and highlight the role of teachers' emotion regulation in teachers' well-being. Implications for the improvement of school environments and teachers' well-being are identified.

  9. Work Environment Characteristics and Teacher Well-Being: The Mediation of Emotion Regulation Strategies

    Directory of Open Access Journals (Sweden)

    Hongbiao Yin

    2016-09-01

    Full Text Available Based on an adjusted Job Demands-Resources (JD-R model that considers the mediation of personal resources, this study examined the relationships between two characteristics of teachers’ work environment (i.e., emotional job demands and trust in colleagues and two indicators of teachers’ well-being (i.e., teaching satisfaction and emotional exhaustion. In particular, the study focused on how emotion regulation strategies (i.e., reappraisal and suppression mediate these relationships. Data collected from a questionnaire survey of 1115 primary school teachers in Hong Kong was analyzed to test the hypothesized relationships. The results of structural equation modeling indicated that: (1 the emotional job demands of teaching were detrimental to teacher well-being, whereas trust in colleagues was beneficial; (2 both emotion regulation strategies mediated the relationships between both emotional job demands and trust in colleagues and teacher well-being; and (3 teachers who tend to use more reappraisal may be psychologically healthier than those tend to adopt more suppression. These findings support the applicability of the JD-R model to school settings and highlight the role of teachers’ emotion regulation in teachers’ well-being. Implications for the improvement of school environments and teachers’ well-being are identified.

  10. Importance of Mediator complex in the regulation and integration of diverse signaling pathways in plants

    Directory of Open Access Journals (Sweden)

    Subhasis eSamanta

    2015-09-01

    Full Text Available Basic transcriptional machinery in eukaryotes is assisted by a number of cofactors, which either increase or decrease the rate of transcription. Mediator complex is one such cofactor, and recently has drawn a lot of interest because of its integrative power to converge different signaling pathways before channelling the transcription instructions to the RNA polymerase II machinery. Like yeast and metazoans, plants do possess the Mediator complex across the kingdom, and its isolation and subunit analyses have been reported from the model plant, Arabidopsis. Genetic and molecular analyses have unravelled important regulatory roles of Mediator subunits at every stage of plant life cycle starting from flowering to embryo and organ development, to even size determination. It also contributes immensely to the survival of plants against different environmental vagaries by the timely activation of its resistance mechanisms. Here, we have provided an overview of plant Mediator complex starting from its discovery to regulation of stoichiometry of its subunits. We have also reviewed involvement of different Mediator subunits in different processes and pathways including defense response pathways evoked by diverse biotic cues. Wherever possible, attempts have been made to provide mechanistic insight of Mediator’s involvement in these processes.

  11. CD177 modulates human neutrophil migration through activation-mediated integrin and chemoreceptor regulation.

    Science.gov (United States)

    Bai, Ming; Grieshaber-Bouyer, Ricardo; Wang, Junxia; Schmider, Angela B; Wilson, Zachary S; Zeng, Liling; Halyabar, Olha; Godin, Matthew D; Nguyen, Hung N; Levescot, Anaïs; Cunin, Pierre; Lefort, Craig T; Soberman, Roy J; Nigrovic, Peter A

    2017-11-09

    CD177 is a glycosylphosphatidylinositol (GPI)-anchored protein expressed by a variable proportion of human neutrophils that mediates surface expression of the antineutrophil cytoplasmic antibody antigen proteinase 3. CD177 associates with β2 integrins and recognizes platelet endothelial cell adhesion molecule 1 (PECAM-1), suggesting a role in neutrophil migration. However, CD177 pos neutrophils exhibit no clear migratory advantage in vivo, despite interruption of in vitro transendothelial migration by CD177 ligation. We sought to understand this paradox. Using a PECAM-1-independent transwell system, we found that CD177 pos and CD177 neg neutrophils migrated comparably. CD177 ligation selectively impaired migration of CD177 pos neutrophils, an effect mediated through immobilization and cellular spreading on the transwell membrane. Correspondingly, CD177 ligation enhanced its interaction with β2 integrins, as revealed by fluorescence lifetime imaging microscopy, leading to integrin-mediated phosphorylation of Src and extracellular signal-regulated kinase (ERK). CD177-driven cell activation enhanced surface β2 integrin expression and affinity, impaired internalization of integrin attachments, and resulted in ERK-mediated attenuation of chemokine signaling. We conclude that CD177 signals in a β2 integrin-dependent manner to orchestrate a set of activation-mediated mechanisms that impair human neutrophil migration. © 2017 by The American Society of Hematology.

  12. Mediator complex cooperatively regulates transcription of retinoic acid target genes with Polycomb Repressive Complex 2 during neuronal differentiation.

    Science.gov (United States)

    Fukasawa, Rikiya; Iida, Satoshi; Tsutsui, Taiki; Hirose, Yutaka; Ohkuma, Yoshiaki

    2015-11-01

    The Mediator complex (Mediator) plays key roles in transcription and functions as the nexus for integration of various transcriptional signals. Previously, we screened for Mediator cyclin-dependent kinase (CDK)-interacting factors and identified three proteins related to chromatin regulation. One of them, SUZ12 is required for both stability and activity of Polycomb Repressive Complex 2 (PRC2). PRC2 primarily suppresses gene expression through histone H3 lysine 27 trimethylation, resulting in stem cell maintenance and differentiation; perturbation of this process leads to oncogenesis. Recent work showed that Mediator contributes to the embryonic stem cell state through DNA loop formation, which is strongly associated with chromatin architecture; however, it remains unclear how Mediator regulates gene expression in cooperation with chromatin regulators (i.e. writers, readers and remodelers). We found that Mediator CDKs interact directly with the PRC2 subunit EZH2, as well as SUZ12. Known PRC2 target genes were deregulated by Mediator CDK knockdown during neuronal differentiation, and both Mediator and PRC2 complexes co-occupied the promoters of developmental genes regulated by retinoic acid. Our results provide a mechanistic link between Mediator and PRC2 during neuronal differentiation. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  13. IRBIT plays an important role in NHE3-mediated pHi regulation in HSG cells.

    Science.gov (United States)

    Tran, Tien Manh; Park, Moon-Yong; Lee, Jiyeon; Bae, Jun-Seok; Hwang, Sung-Min; Choi, Se-Young; Mikoshiba, Katsuhiko; Park, Kyungpyo

    2013-07-19

    Expression of inositol-1,4,5-trisphosphate (IP3) receptor-binding protein (IRBIT) has been reported in epithelial cells. However, its role in pHi regulation is not well understood. In this study, we investigated the role of IRBIT in pHi regulation, mediated by Na(+)/H(+) exchangers (NHEs), in salivary glands. We measured pHi recovery from cell acidification in BCECF-loaded salivary HSG cells. Western blot and co-immunoprecipitation (CO-IP) assays were also performed, showing that NHE1, 2 and 3 are expressed, and IRBIT binds to NHE3. HOE642, a specific NHE1 blocker, inhibited pHi recovery, but 40% pH(i) recovery was still observed even at the highest concentration of HOE642. Furthermore, pretreatment of the cells with siIRBIT significantly inhibited pHi recovery, indicating that NHE3 potentially plays a role in pHi recovery as well. The amount of membrane-localized NHE3 and its interaction with IRBIT are also significantly increased by cell acidification. In addition, we found that Ste20p-related proline alanine-rich kinase (SPAK) reverses the effect of IRBIT on membrane NHE3 translocation. Taken together, we conclude that IRBIT plays an important role in pHi regulation, mediated by NHE3, and further regulated by SPAK. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. C/EBPβ Mediates Growth Hormone-Regulated Expression of Multiple Target Genes

    Science.gov (United States)

    Cui, Tracy X.; Lin, Grace; LaPensee, Christopher R.; Calinescu, Anda-Alexandra; Rathore, Maanjot; Streeter, Cale; Piwien-Pilipuk, Graciela; Lanning, Nathan; Jin, Hui; Carter-Su, Christin; Qin, Zhaohui S.

    2011-01-01

    Regulation of c-Fos transcription by GH is mediated by CCAAT/enhancer binding protein β (C/EBPβ). This study examines the role of C/EBPβ in mediating GH activation of other early response genes, including Cyr61, Btg2, Socs3, Zfp36, and Socs1. C/EBPβ depletion using short hairpin RNA impaired responsiveness of these genes to GH, as seen for c-Fos. Rescue with wild-type C/EBPβ led to GH-dependent recruitment of the coactivator p300 to the c-Fos promoter. In contrast, rescue with C/EBPβ mutated at the ERK phosphorylation site at T188 failed to induce GH-dependent recruitment of p300, indicating that ERK-mediated phosphorylation of C/EBPβ at T188 is required for GH-induced recruitment of p300 to c-Fos. GH also induced the occupancy of phosphorylated C/EBPβ and p300 on Cyr61, Btg2, and Socs3 at predicted C/EBP-cAMP response element-binding protein motifs in their promoters. Consistent with a role for ERKs in GH-induced expression of these genes, treatment with U0126 to block ERK phosphorylation inhibited their GH-induced expression. In contrast, GH-dependent expression of Zfp36 and Socs1 was not inhibited by U0126. Thus, induction of multiple early response genes by GH in 3T3-F442A cells is mediated by C/EBPβ. A subset of these genes is regulated similarly to c-Fos, through a mechanism involving GH-stimulated ERK 1/2 activation, phosphorylation of C/EBPβ, and recruitment of p300. Overall, these studies suggest that C/EBPβ, like the signal transducer and activator of transcription proteins, regulates multiple genes in response to GH. PMID:21292824

  15. Regulation of the copper chaperone CCS by XIAP-mediated ubiquitination.

    Science.gov (United States)

    Brady, Graham F; Galbán, Stefanie; Liu, Xuwen; Basrur, Venkatesha; Gitlin, Jonathan D; Elenitoba-Johnson, Kojo S J; Wilson, Thomas E; Duckett, Colin S

    2010-04-01

    In order to balance the cellular requirements for copper with its toxic properties, an elegant set of mechanisms has evolved to regulate and buffer intracellular copper. The X-linked inhibitor of apoptosis (XIAP) protein was recently identified as a copper-binding protein and regulator of copper homeostasis, although the mechanism by which XIAP binds copper in the cytosol is unclear. Here we describe the identification of the copper chaperone for superoxide dismutase (CCS) as a mediator of copper delivery to XIAP in cells. We also find that CCS is a target of the E3 ubiquitin ligase activity of XIAP, although interestingly, ubiquitination of CCS by XIAP was found to lead to enhancement of its chaperone activity toward its physiologic target, superoxide dismutase 1, rather than proteasomal degradation. Collectively, our results reveal novel links among apoptosis, copper metabolism, and redox regulation through the XIAP-CCS complex.

  16. O-GlcNAc regulates NEDD4-1 stability via caspase-mediated pathway

    International Nuclear Information System (INIS)

    Jiang, Kuan; Bai, Bingyang; Ta, Yajie; Zhang, Tingling; Xiao, Zikang; Wang, Peng George; Zhang, Lianwen

    2016-01-01

    O-GlcNAc modification of cytosolic and nuclear proteins regulates essential cellular processes such as stress responses, transcription, translation, and protein degradation. Emerging evidence indicates O-GlcNAcylation has a dynamic interplay with ubiquitination in cellular regulation. Here, we report that O-GlcNAc indirectly targets a vital E3 ubiquitin ligase enzyme of NEDD4-1. The protein level of NEDD4-1 is accordingly decreased following an increase of overall O-GlcNAc level upon PUGNAc or glucosamine stimulation. O-GlcNAc transferase (OGT) knockdown, overexpression and mutation results confirm that the stability of NEDD4-1 is negatively regulated by cellular O-GlcNAc. Moreover, the NEDD4-1 degradation induced by PUGNAc or GlcN is significantly inhibited by the caspase inhibitor. Our study reveals a regulation mechanism of NEDD4-1 stability by O-GlcNAcylation. - Highlights: • Reduced NEDD4-1 correlates with increased overall O-GlcNAc level. • OGT negatively regulates NEDD4-1 stability. • O-GlcNAc regulates NEDD4-1 through caspase-mediated pathway.

  17. Nicotinamide clearance by Pnc1 directly regulates Sir2-mediated silencing and longevity.

    Science.gov (United States)

    Gallo, Christopher M; Smith, Daniel L; Smith, Jeffrey S

    2004-02-01

    The Saccharomyces cerevisiae Sir2 protein is an NAD(+)-dependent histone deacetylase (HDAC) that functions in transcriptional silencing and longevity. The NAD(+) salvage pathway protein, Npt1, regulates Sir2-mediated processes by maintaining a sufficiently high intracellular NAD(+) concentration. However, another NAD(+) salvage pathway component, Pnc1, modulates silencing independently of the NAD(+) concentration. Nicotinamide (NAM) is a by-product of the Sir2 deacetylase reaction and is a natural Sir2 inhibitor. Pnc1 is a nicotinamidase that converts NAM to nicotinic acid. Here we show that recombinant Pnc1 stimulates Sir2 HDAC activity in vitro by preventing the accumulation of NAM produced by Sir2. In vivo, telomeric, rDNA, and HM silencing are differentially sensitive to inhibition by NAM. Furthermore, PNC1 overexpression suppresses the inhibitory effect of exogenously added NAM on silencing, life span, and Hst1-mediated transcriptional repression. Finally, we show that stress suppresses the inhibitory effect of NAM through the induction of PNC1 expression. Pnc1, therefore, positively regulates Sir2-mediated silencing and longevity by preventing the accumulation of intracellular NAM during times of stress.

  18. Maternal emotion regulation mediates the association between adult attention-deficit/hyperactivity disorder symptoms and parenting.

    Science.gov (United States)

    Mazursky-Horowitz, Heather; Felton, Julia W; MacPherson, Laura; Ehrlich, Katherine B; Cassidy, Jude; Lejuez, C W; Chronis-Tuscano, Andrea

    2015-01-01

    Mothers with elevated Attention-Deficit/Hyperactivity Disorder (ADHD) symptoms demonstrate parenting deficits, as well as difficulties in emotion regulation (ER), which may further impact their ability to effectively parent. However, no empirical research has examined potential mediators that explain the relations between maternal ADHD symptoms and parenting. This prospective longitudinal study examined difficulties with ER as a mediator of the relation between adult ADHD symptoms and parenting among 234 mothers of adolescents recruited from the community when they were between the ages of nine to twelve. Maternal ratings of adult ADHD symptoms, difficulties with ER, and parenting responses to their adolescents' expressions of negative emotions were collected over the course of three years. We found that maternal ADHD symptoms were negatively associated with positive parenting responses to adolescents' negative emotions, and positively associated with harsh parenting and maternal distress reactions. Moreover, maternal ER mediated the relation between adult ADHD symptoms and harsh parenting responses, while controlling for adolescent ADHD and disruptive behavior symptoms. However, maternal ER did not mediate the relation between ADHD symptoms and positive or distressed parental responses. Thus, it appears that ER is one mechanism by which maternal ADHD symptoms are associated with harsh responses to their adolescents' expressions of negative emotion. These findings may have downstream implications for adolescent adjustment.

  19. Neuronal SIRT1 (Silent Information Regulator 2 Homologue 1) Regulates Glycolysis and Mediates Resveratrol-Induced Ischemic Tolerance.

    Science.gov (United States)

    Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A

    2017-11-01

    Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.

  20. Bistability and oscillations in gene regulation mediated by small noncoding RNAs.

    Directory of Open Access Journals (Sweden)

    Dengyu Liu

    Full Text Available The interplay of small noncoding RNAs (sRNAs, mRNAs, and proteins has been shown to play crucial roles in almost all cellular processes. As key post-transcriptional regulators of gene expression, the mechanisms and roles of sRNAs in various cellular processes still need to be fully understood. When participating in cellular processes, sRNAs mainly mediate mRNA degradation or translational repression. Here, we show how the dynamics of two minimal architectures is drastically affected by these two mechanisms. A comparison is also given to reveal the implication of the fundamental differences. This study may help us to analyze complex networks assembled by simple modules more easily. A better knowledge of the sRNA-mediated motifs is also of interest for bio-engineering and artificial control.

  1. KLF2 in Regulation of NF-κB-Mediated Immune Cell Function and Inflammation

    Directory of Open Access Journals (Sweden)

    Prerana Jha

    2017-11-01

    Full Text Available KLF2 (Kruppel-like factor 2 is a member of the zinc finger transcription factor family, which critically regulates embryonic lung development, function of endothelial cells and maintenance of quiescence in T-cells and monocytes. It is expressed in naïve T-cells and monocytes, however its level of expression decreases during activation and differentiation. KLF2 also plays critical regulatory role in various inflammatory diseases and their pathogenesis. Nuclear factor-kappaB (NF-κB is an important inducer of inflammation and the inflammation is mediated through the transcription of several proinflammatory cytokines, chemokines and adhesion molecules. So, both transcriptional factors KLF2 and NF-κB are being associated with the similar cellular functions and their maintenance. It was shown that KLF2 regulates most of the NF-κB-mediated activities. In this review, we focused on emphasizing the involvement of KLF2 in health and disease states and how they interact with transcriptional master regulator NF-κB.

  2. RGM regulates BMP-mediated secondary axis formation in the sea anemone Nematostella vectensis.

    Science.gov (United States)

    Leclère, Lucas; Rentzsch, Fabian

    2014-12-11

    Patterning of the metazoan dorsoventral axis is mediated by a complex interplay of BMP signaling regulators. Repulsive guidance molecule (RGM) is a conserved BMP coreceptor that has not been implicated in axis specification. We show that NvRGM is a key positive regulator of BMP signaling during secondary axis establishment in the cnidarian Nematostella vectensis. NvRGM regulates first the generation and later the shape of a BMP-dependent Smad1/5/8 gradient with peak activity on the side opposite the NvBMP/NvRGM/NvChordin expression domain. Full knockdown of Smad1/5/8 signaling blocks the formation of endodermal structures, the mesenteries, and the establishment of bilateral symmetry, while altering the gradient through partial NvRGM or NvBMP knockdown shifts the boundaries of asymmetric gene expression and the positioning of the mesenteries along the secondary axis. These findings provide insight into the diversification of axis specification mechanisms and identify a previously unrecognized role for RGM in BMP-mediated axial patterning. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Cyclic-AMP mediated regulation of ABCB mRNA expression in mussel haemocytes.

    Directory of Open Access Journals (Sweden)

    Silvia Franzellitti

    Full Text Available BACKGROUND: The multixenobiotic resistance system (MXR allows aquatic organisms to cope with their habitat despite high pollution levels by over-expressing membrane and intracellular transporters, including the P-glycoprotein (Pgp. In mammals transcription of the ABCB1 gene encoding Pgp is under cAMP/PKA-mediated regulation; whether this is true in mollusks is not fully clarified. METHODOLOGY/PRINCIPAL FINDINGS: cAMP/PKA regulation and ABCB mRNA expression were assessed in haemocytes from Mediterranean mussels (Mytilus galloprovincialis exposed in vivo for 1 week to 0.3 ng/L fluoxetine (FX alone or in combination with 0.3 ng/L propranolol (PROP. FX significantly decreased cAMP levels and PKA activity, and induced ABCB mRNA down-regulation. FX effects were abolished in the presence of PROP. In vitro experiments using haemocytes treated with physiological agonists (noradrenaline and serotonin and pharmacological modulators (PROP, forskolin, dbcAMP, and H89 of the cAMP/PKA system were performed to obtain clear evidence about the involvement of the signaling pathway in the transcriptional regulation of ABCB. Serotonin (5-HT decreased cAMP levels, PKA activity and ABCB mRNA expression but increased the mRNA levels for a putative 5-HT1 receptor. Interestingly, 5-HT1 was also over-expressed after in vivo exposures to FX. 5-HT effects were counteracted by PROP. Forskolin and dbcAMP increased PKA activity as well as ABCB mRNA expression; the latter effect was abolished in the presence of the PKA inhibitor H89. CONCLUSIONS: This study provides the first direct evidence for the cAMP/PKA-mediated regulation of ABCB transcription in mussels.

  4. Exercise motivational regulations and exercise addiction: The mediating role of passion.

    Science.gov (United States)

    Sicilia, Álvaro; Alcaraz-Ibáñez, Manuel; Lirola, María-Jesús; Burgueño, Rafael; Maher, Anthony

    2018-05-23

    Background and aims The study explored the mediating role of forms of passion in the relationship between motivational regulations in exercise and exercise addiction (EA). Methods A total of 485 university students (368 males and 117 females; M age  = 20.43, SD = 3.21) completed a questionnaire measuring the frequency and intensity of exercise, motivational regulations in exercise, passion for exercise, and EA. Controlling the effects of age, frequency, and intensity of practice, the relationships between the study variables were examined though a path analysis. Results Both self-determined and non-self-determined forms of motivation showed positive association with EA. The forms of motivation with greatest predictive power for EA were introjected and integrated regulations. Both forms of motivation had positive direct and indirect effects through obsessive passion (OP) on EA; however, integrated regulation also showed negative indirect effects through harmonious passion on EA. Conclusions Both forms of passion and, especially, OP, seem to affect how motivational regulations are associated with EA. These findings clarify the association found in previous studies between self-determined forms of motivation and EA.

  5. Difficulties in emotion regulation mediate negative and positive affects and craving in alcoholic patients.

    Science.gov (United States)

    Khosravani, Vahid; Sharifi Bastan, Farangis; Ghorbani, Fatemeh; Kamali, Zoleikha

    2017-08-01

    The aim of this study was to assess the mediating effects of difficulties in emotion regulation (DER) on the relations of negative and positive affects to craving in alcoholic patients. 205 treatment-seeking alcoholic outpatients were included. DER, positive and negative affects as well as craving were evaluated by the Difficulties in Emotion Regulation Scale (DERS), the Positive/Negative Affect Scales, and the Obsessive Compulsive Drinking Scale (OCDS) respectively. Clinical factors including depression and severity of alcohol dependence were investigated by the Alcohol Use Disorders Identification Test (AUDIT) and the Beck Depression Inventory-II (BDI-II) respectively. Results revealed that both increased negative affect and decreased positive affect indirectly influenced craving through limited access to emotion regulation strategies. It was concluded that limited access to emotion regulation strategies may be important in predicting craving for alcoholics who experience both increased negative affect and decreased positive affect. This suggests that treatment and prevention efforts focused on increasing positive affect, decreasing negative affect and teaching effective regulation strategies may be critical in reducing craving in alcoholic patients. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Does rumination mediate the relationship between emotion regulation ability and posttraumatic stress disorder?

    Directory of Open Access Journals (Sweden)

    Thomas Ehring

    2014-08-01

    Full Text Available Background and objectives: Trauma-related rumination has been suggested to be involved in the maintenance of posttraumatic stress disorder (PTSD. This view has empirically been supported by extensive evidence using cross-sectional, prospective, and experimental designs. However, it is unclear why trauma survivors engage in rumination despite its negative consequences. The current study aimed to explore the hypothesis that low emotion regulation ability underlies trauma-related rumination. Methods: Emotion regulation ability and trauma-related rumination were assessed in 93 road traffic accident survivors 2 weeks post-trauma. In addition, symptom levels of PTSD were assessed at 2 weeks as well as 1, 3, and 6 months follow-up. Results: Emotion regulation ability was significantly related to trauma-related rumination as well as levels of PTSD symptoms. In addition, the association between low emotion regulation ability and PTSD was mediated by rumination. Conclusions: The findings support the view that rumination is used as a dysfunctional emotion regulation strategy by trauma survivors.

  7. Stabilizing in vitro ultrasound-mediated gene transfection by regulating cavitation.

    Science.gov (United States)

    Lo, Chia-Wen; Desjouy, Cyril; Chen, Shing-Ru; Lee, Jyun-Lin; Inserra, Claude; Béra, Jean-Christophe; Chen, Wen-Shiang

    2014-03-01

    It is well known that acoustic cavitation can facilitate the inward transport of genetic materials across cell membranes (sonoporation). However, partially due to the unstationary behavior of the initiation and leveling of cavitation, the sonoporation effect is usually unstable, especially in low intensity conditions. A system which is able to regulate the cavitation level during sonication by modulating the applied acoustic intensity with a feedback loop is implemented and its effect on in vitro gene transfection is tested. The regulated system provided better time stability and reproducibility of the cavitation levels than the unregulated conditions. Cultured hepatoma cells (BNL) mixed with 10 μg luciferase plasmids are exposed to 1-MHz pulsed ultrasound with or without cavitation regulation, and the gene transfection efficiency and cell viability are subsequently assessed. Experimental results show that for all exposure intensities (low, medium, and high), stable and intensity dependent, although not higher, gene expression could be achieved in the regulated cavitation system than the unregulated conditions. The cavitation regulation system provides a better control of cavitation and its bioeffect which are crucial important for clinical applications of ultrasound-mediated gene transfection. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Relationship between cognitive emotion regulation, social support, resilience and acute stress responses in Chinese soldiers: Exploring multiple mediation model.

    Science.gov (United States)

    Cai, Wen-Peng; Pan, Yu; Zhang, Shui-Miao; Wei, Cun; Dong, Wei; Deng, Guang-Hui

    2017-10-01

    The current study aimed to explore the association of cognitive emotion regulation, social support, resilience and acute stress responses in Chinese soldiers and to understand the multiple mediation effects of social support and resilience on the relationship between cognitive emotion regulation and acute stress responses. A total of 1477 male soldiers completed mental scales, including the cognitive emotion regulation questionnaire-Chinese version, the perceived social support scale, the Chinese version of the Connor-Davidson resilience scale, and the military acute stress scale. As hypothesized, physiological responses, psychological responses, and acute stress were associated with negative-focused cognitive emotion regulation, and negatively associated with positive-focused cognitive emotion regulation, social supports and resilience. Besides, positive-focused cognitive emotion regulation, social support, and resilience were significantly associated with one another, and negative-focused cognitive emotion regulation was negatively associated with social support. Regression analysis and bootstrap analysis showed that social support and resilience had partly mediating effects on negative strategies and acute stress, and fully mediating effects on positive strategies and acute stress. These results thus indicate that military acute stress is significantly associated with cognitive emotion regulation, social support, and resilience, and that social support and resilience have multiple mediation effects on the relationship between cognitive emotion regulation and acute stress responses. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Cigarette smoke regulates VEGFR2-mediated survival signaling in rat lungs

    Directory of Open Access Journals (Sweden)

    Stevenson Christopher S

    2010-02-01

    Full Text Available Abstract Background Vascular endothelial growth factor (VEGF and VEGF receptor 2 (VEGFR2-mediated survival signaling is critical to endothelial cell survival, maintenance of the vasculature and alveolar structure and regeneration of lung tissue. Reduced VEGF and VEGFR2 expression in emphysematous lungs has been linked to increased endothelial cell death and vascular regression. Previously, we have shown that CS down-regulated the VEGFR2 and its downstream signaling in mouse lungs. However, the VEGFR2-mediated survival signaling in response to oxidants/cigarette smoke (CS is not known. We hypothesized that CS exposure leads to disruption of VEGFR2-mediated endothelial survival signaling in rat lungs. Methods Adult male Sprague-Dawley rats were exposed CS for 3 days, 8 weeks and 6 months to investigate the effect of CS on VEGFR2-mediated survival signaling by measuring the Akt/PI3-kinase/eNOS downstream signaling in rat lungs. Results and Discussion We show that CS disrupts VEGFR2/PI3-kinase association leading to decreased Akt and eNOS phosphorylation. This may further alter the phosphorylation of the pro-apoptotic protein Bad and increase the Bad/Bcl-xl association. However, this was not associated with a significant lung cell death as evidenced by active caspase-3 levels. These data suggest that although CS altered the VEGFR2-mediated survival signaling in the rat lungs, but it was not sufficient to cause lung cell death. Conclusion The rat lungs exposed to CS in acute, sub-chronic and chronic levels may be representative of smokers where survival signaling is altered but was not associated with lung cell death whereas emphysema is known to be associated with lung cell apoptosis.

  10. RNF4-mediated polyubiquitination regulates the Fanconi anemia/BRCA pathway.

    Science.gov (United States)

    Xie, Jenny; Kim, Hyungjin; Moreau, Lisa A; Puhalla, Shannon; Garber, Judy; Al Abo, Muthana; Takeda, Shunichi; D'Andrea, Alan D

    2015-04-01

    The Fanconi anemia/BRCA (FA/BRCA) pathway is a DNA repair pathway that is required for excision of DNA interstrand cross-links. The 17 known FA proteins, along with several FA-associated proteins (FAAPs), cooperate in this pathway to detect, unhook, and excise DNA cross-links and to subsequently repair the double-strand breaks generated in the process. In the current study, we identified a patient with FA with a point mutation in FANCA, which encodes a mutant FANCA protein (FANCAI939S). FANCAI939S failed to bind to the FAAP20 subunit of the FA core complex, leading to decreased stability. Loss of FAAP20 binding exposed a SUMOylation site on FANCA at amino acid residue K921, resulting in E2 SUMO-conjugating enzyme UBC9-mediated SUMOylation, RING finger protein 4-mediated (RNF4-mediated) polyubiquitination, and proteasome-mediated degradation of FANCA. Mutation of the SUMOylation site of FANCA rescued the expression of the mutant protein. Wild-type FANCA was also subject to SUMOylation, RNF4-mediated polyubiquitination, and degradation, suggesting that regulated release of FAAP20 from FANCA is a critical step in the normal FA pathway. Consistent with this model, cells lacking RNF4 exhibited interstrand cross-linker hypersensitivity, and the gene encoding RNF4 was epistatic with the other genes encoding members of the FA/BRCA pathway. Together, the results from our study underscore the importance of analyzing unique patient-derived mutations for dissecting complex DNA repair processes.

  11. Lycopene inhibits regulator of calcineurin 1-mediated apoptosis by reducing oxidative stress and down-regulating Nucling in neuronal cells.

    Science.gov (United States)

    Lim, Seiyoung; Hwang, Sinwoo; Yu, Ji Hoon; Lim, Joo Weon; Kim, Hyeyoung

    2017-05-01

    Regulator of calcineurin 1 (RCAN1) is located on the Down syndrome critical region (DSCR) locus in human chromosome 21. Oxidative stress and overexpression of RCAN1 are implicated in neuronal impairment in Down's syndrome (DS) and Alzheimer's disease (AD). Serum level of lycopene, an antioxidant pigment, is low in DS and AD patients, which may be related to neuronal damage. The present study is to investigate whether lycopene inhibits apoptosis by reducing ROS levels, NF-κB activation, expression of the apoptosis regulator Nucling, cell viability, and indices of apoptosis (cytochrome c release, caspase-3 activation) in RCAN1-overexpressing neuronal cells. Cells transfected with either pcDNA or RCAN1 were treated with or without lycopene. Lycopene decreased intracellular and mitochondrial ROS levels, NF-κB activity, and Nucling expression while it reversed decrease in mitochondrial membrane potential, mitochondrial respiration, and glycolytic function in RCAN1-overexpressing cells. Lycopene inhibited cell death, DNA fragmentation, caspase-3 activation, and cytochrome c release in RCAN1-overexpressing cells. Lycopene inhibits RCAN1-mediated apoptosis by reducing ROS levels and by inhibiting NF-κB activation, Nucling induction, and the increase in apoptotic indices in neuronal cells. Consumption of lycopene-rich foods may prevent oxidative stress-associated neuronal damage in some pathologic conditions such as DS or AD. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Redox regulation of the MED28 and MED32 mediator subunits is important for development and senescence.

    Science.gov (United States)

    Shaikhali, Jehad; Davoine, Céline; Björklund, Stefan; Wingsle, Gunnar

    2016-05-01

    Mediator is a conserved multi-protein complex that acts as a bridge between promoter-bound transcriptional regulators and RNA polymerase II. While redox signaling is important in adjusting plant metabolism and development, the involvement of Mediator in redox homeostasis and regulation only recently started to emerge. Our previous results show that the MED10a, MED28, and MED32 Mediator subunits form various types of covalent oligomers linked by intermolecular disulfide bonds in vitro. To link that with biological significance we have characterized Arabidopsis med32 and med28 mutants and found that they are affected in root development and senescence, phenotypes possibly associated to redox changes.

  13. Molecular Mechanisms Underlying Renin-Angiotensin-Aldosterone System Mediated Regulation of BK Channels

    Directory of Open Access Journals (Sweden)

    Zhen-Ye Zhang

    2017-09-01

    Full Text Available Large-conductance calcium-activated potassium channels (BK channels belong to a family of Ca2+-sensitive voltage-dependent potassium channels and play a vital role in various physiological activities in the human body. The renin-angiotensin-aldosterone system is acknowledged as being vital in the body's hormone system and plays a fundamental role in the maintenance of water and electrolyte balance and blood pressure regulation. There is growing evidence that the renin-angiotensin-aldosterone system has profound influences on the expression and bioactivity of BK channels. In this review, we focus on the molecular mechanisms underlying the regulation of BK channels mediated by the renin-angiotensin-aldosterone system and its potential as a target for clinical drugs.

  14. COPI-mediated retrograde trafficking from the Golgi to the ER regulates EGFR nuclear transport

    International Nuclear Information System (INIS)

    Wang, Ying-Nai; Wang, Hongmei; Yamaguchi, Hirohito; Lee, Hong-Jen; Lee, Heng-Huan; Hung, Mien-Chie

    2010-01-01

    Research highlights: → ARF1 activation is involved in the EGFR transport to the ER and the nucleus. → Assembly of γ-COP coatomer mediates EGFR transport to the ER and the nucleus. → Golgi-to-ER retrograde trafficking regulates nuclear transport of EGFR. -- Abstract: Emerging evidence indicates that cell surface receptors, such as the entire epidermal growth factor receptor (EGFR) family, have been shown to localize in the nucleus. A retrograde route from the Golgi to the endoplasmic reticulum (ER) is postulated to be involved in the EGFR trafficking to the nucleus; however, the molecular mechanism in this proposed model remains unexplored. Here, we demonstrate that membrane-embedded vesicular trafficking is involved in the nuclear transport of EGFR. Confocal immunofluorescence reveals that in response to EGF, a portion of EGFR redistributes to the Golgi and the ER, where its NH 2 -terminus resides within the lumen of Golgi/ER and COOH-terminus is exposed to the cytoplasm. Blockage of the Golgi-to-ER retrograde trafficking by brefeldin A or dominant mutants of the small GTPase ADP-ribosylation factor, which both resulted in the disassembly of the coat protein complex I (COPI) coat to the Golgi, inhibit EGFR transport to the ER and the nucleus. We further find that EGF-dependent nuclear transport of EGFR is regulated by retrograde trafficking from the Golgi to the ER involving an association of EGFR with γ-COP, one of the subunits of the COPI coatomer. Our findings experimentally provide a comprehensive pathway that nuclear transport of EGFR is regulated by COPI-mediated vesicular trafficking from the Golgi to the ER, and may serve as a general mechanism in regulating the nuclear transport of other cell surface receptors.

  15. Mediatization

    DEFF Research Database (Denmark)

    Hjarvard, Stig

    2017-01-01

    Mediatization research shares media effects studies' ambition of answering the difficult questions with regard to whether and how media matter and influence contemporary culture and society. The two approaches nevertheless differ fundamentally in that mediatization research seeks answers...... to these general questions by distinguishing between two concepts: mediation and mediatization. The media effects tradition generally considers the effects of the media to be a result of individuals being exposed to media content, i.e. effects are seen as an outcome of mediated communication. Mediatization...... research is concerned with long-term structural changes involving media, culture, and society, i.e. the influences of the media are understood in relation to how media are implicated in social and cultural changes and how these processes come to create new conditions for human communication and interaction...

  16. Influence of Student Learning Experience on Academic Performance: The Mediator and Moderator Effects of Self-Regulation and Motivation

    Science.gov (United States)

    Ning, Hoi Kwan; Downing, Kevin

    2012-01-01

    This study examined the mediator and moderator roles of self-regulation and motivation constructs in the relationship between learning experience and academic success. Self-reported measures of learning experience, self-regulation and motivation were obtained from 384 undergraduate students from a university in Hong Kong. Structural equation…

  17. Brassinosteroids regulate pavement cell growth by mediating BIN2-induced microtubule stabilization.

    Science.gov (United States)

    Liu, Xiaolei; Yang, Qin; Wang, Yuan; Wang, Linhai; Fu, Ying; Wang, Xuelu

    2018-02-23

    Brassinosteroids (BRs), a group of plant steroid hormones, play important roles in regulating plant development. The cytoskeleton also affects key developmental processes and a deficiency in BR biosynthesis or signaling leads to abnormal phenotypes similar to those of microtubule-defective mutants. However, how BRs regulate microtubule and cell morphology remains unknown. Here, using liquid chromatography-tandem mass spectrometry, we identified tubulin proteins that interact with Arabidopsis BRASSINOSTEROID INSENSITIVE2 (BIN2), a negative regulator of BR responses in plants. In vitro and in vivo pull-down assays confirmed that BIN2 interacts with tubulin proteins. High-speed co-sedimentation assays demonstrated that BIN2 also binds microtubules. The Arabidopsis genome also encodes two BIN2 homologs, BIN2-LIKE 1 (BIL1) and BIL2, which function redundantly with BIN2. In the bin2-3 bil1 bil2 triple mutant, cortical microtubules were more sensitive to treatment with the microtubule-disrupting drug oryzalin than in wild-type, whereas in the BIN2 gain-of-function mutant bin2-1, cortical microtubules were insensitive to oryzalin treatment. These results provide important insight into how BR regulates plant pavement cell and leaf growth by mediating the stabilization of microtubules by BIN2.

  18. Syndecan-2 regulates melanin synthesis via protein kinase C βII-mediated tyrosinase activation.

    Science.gov (United States)

    Jung, Hyejung; Chung, Heesung; Chang, Sung Eun; Choi, Sora; Han, Inn-Oc; Kang, Duk-Hee; Oh, Eok-Soo

    2014-05-01

    Syndecan-2, a transmembrane heparan sulfate proteoglycan that is highly expressed in melanoma cells, regulates melanoma cell functions (e.g. migration). Since melanoma is a malignant tumor of melanocytes, which largely function to synthesize melanin, we investigated the possible involvement of syndecan-2 in melanogenesis. Syndecan-2 expression was increased in human skin melanoma tissues compared with normal skin. In both mouse and human melanoma cells, siRNA-mediated knockdown of syndecan-2 was associated with reduced melanin synthesis, whereas overexpression of syndecan-2 increased melanin synthesis. Similar effects were also detected in human primary epidermal melanocytes. Syndecan-2 expression did not affect the expression of tyrosinase, a key enzyme in melanin synthesis, but instead enhanced the enzymatic activity of tyrosinase by increasing the membrane and melanosome localization of its regulator, protein kinase CβII. Furthermore, UVB caused increased syndecan-2 expression, and this up-regulation of syndecan-2 was required for UVB-induced melanin synthesis. Taken together, these data suggest that syndecan-2 regulates melanin synthesis and could be a potential therapeutic target for treating melanin-associated diseases. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Blimp-1-Dependent IL-10 Production by Tr1 Cells Regulates TNF-Mediated Tissue Pathology.

    Directory of Open Access Journals (Sweden)

    Marcela Montes de Oca

    2016-01-01

    Full Text Available Tumor necrosis factor (TNF is critical for controlling many intracellular infections, but can also contribute to inflammation. It can promote the destruction of important cell populations and trigger dramatic tissue remodeling following establishment of chronic disease. Therefore, a better understanding of TNF regulation is needed to allow pathogen control without causing or exacerbating disease. IL-10 is an important regulatory cytokine with broad activities, including the suppression of inflammation. IL-10 is produced by different immune cells; however, its regulation and function appears to be cell-specific and context-dependent. Recently, IL-10 produced by Th1 (Tr1 cells was shown to protect host tissues from inflammation induced following infection. Here, we identify a novel pathway of TNF regulation by IL-10 from Tr1 cells during parasitic infection. We report elevated Blimp-1 mRNA levels in CD4+ T cells from visceral leishmaniasis (VL patients, and demonstrate IL-12 was essential for Blimp-1 expression and Tr1 cell development in experimental VL. Critically, we show Blimp-1-dependent IL-10 production by Tr1 cells prevents tissue damage caused by IFNγ-dependent TNF production. Therefore, we identify Blimp-1-dependent IL-10 produced by Tr1 cells as a key regulator of TNF-mediated pathology and identify Tr1 cells as potential therapeutic tools to control inflammation.

  20. FGFR2c-mediated ERK-MAPK activity regulates coronal suture development

    Science.gov (United States)

    Pfaff, Miles J.; Xue, Ke; Li, Li; Horowitz, Mark C.; Steinbacher, Derek M.; Eswarakumar, Jacob V.P.

    2017-01-01

    Fibroblast growth factor receptor 2 (FGFR2) signaling is critical for proper craniofacial development. A gain-of-function mutation in the 2c splice variant of the receptor’s gene is associated with Crouzon syndrome, which is characterized by craniosynostosis, the premature fusion of one or more of the cranial vault sutures, leading to craniofacial maldevelopment. Insight into the molecular mechanism of craniosynostosis has identified the ERK-MAPK signaling cascade as a critical regulator of suture patency. The aim of this study is to investigate the role of FGFR2c-induced ERK-MAPK activation in the regulation of coronal suture development. Loss-of-function and gain-of-function Fgfr2c mutant mice have overlapping phenotypes, including coronal synostosis and craniofacial dysmorphia. In vivo analysis of coronal sutures in loss-of-function and gain-of-function models demonstrated fundamentally different pathogenesis underlying coronal suture synostosis. Calvarial osteoblasts from gain-of-function mice demonstrated enhanced osteoblastic function and maturation with concomitant increase in ERK-MAPK activation. In vitro inhibition with the ERK protein inhibitor U0126 mitigated ERK protein activation levels with a concomitant reduction in alkaline phosphatase activity. This study identifies FGFR2c-mediated ERK-MAPK signaling as a key mediator of craniofacial growth and coronal suture development. Furthermore, our results solve the apparent paradox between loss-of-function and gain-of-function FGFR2c mutants with respect to coronal suture synostosis. PMID:27034231

  1. Delicate regulation of the cGAS-MITA-mediated innate immune response.

    Science.gov (United States)

    Luo, Wei-Wei; Shu, Hong-Bing

    2018-02-19

    Although it has long been demonstrated that cytosolic DNA is a potent immune stimulant, it is only in recent years that the molecular mechanisms of DNA-stimulated innate immune responses have emerged. Studies have established critical roles for the DNA sensor cyclic GMP-AMP synthase (cGAS) and the adapter protein MITA/STING in the innate immune response to cytosolic DNA or DNA viruses. Although the regulation of cGAS-MITA/STING-mediated signaling remains to be fully investigated, understanding the processes involved may help to explain the mechanisms of innate immune signaling events and perhaps autoinflammatory diseases and to provide potential therapeutic targets for drug intervention. In this review, we summarize recent progress on the regulation of the cGAS-MITA/STING-mediated innate immune response to DNA viruses at the organelle-trafficking, post-translational and transcriptional levels.Cellular & Molecular Immunology advance online publication, 19 February 2018; doi:10.1038/cmi.2016.51.

  2. CISH is induced during DC development and regulates DC-mediated CTL activation.

    Science.gov (United States)

    Miah, Mohammad Alam; Yoon, Cheol-Hee; Kim, Joonoh; Jang, Jinah; Seong, Young-Rim; Bae, Yong-Soo

    2012-01-01

    The cytokine inducible SH2-domain protein (CISH) is a well-known STAT5 target gene, but its role in the immune system remains uncertain. In this study, we found that CISH is predominantly induced during dendritic cell (DC) development from mouse bone marrow (BM) cells and plays a crucial role in type 1 DC development and DC-mediated CTL activation. CISH knockdown reduced the expression of MHC class I, co-stimulatory molecules and pro-inflammatory cytokines in BMDCs. Meanwhile, the DC yield was markedly enhanced by CISH knockdown via cell-cycle activation and reduction of cell apoptosis. Down-regulation of cell proliferation at the later stage of DC development was found to be associated with CISH-mediated negative feedback regulation of STAT5 activation. In T-cell immunity, OT-1 T-cell proliferation was significantly reduced by CISH knockdown in DCs, whereas OT-2 T-cell proliferation was not affected by CISH knockdown. CTLs generated by DC vaccination were also markedly reduced by CISH knockdown, followed by significant impairment of DC-based tumor immunotherapy. Taken together, our data suggest that CISH expression at the later stage of DC development triggers the shutdown of DC progenitor cell proliferation and facilitates DC differentiation into a potent stimulator of CTLs. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. ANGUSTIFOLIA mediates one of the multiple SCRAMBLED signaling pathways regulating cell growth pattern in Arabidopsis thaliana.

    Science.gov (United States)

    Kwak, Su-Hwan; Song, Sang-Kee; Lee, Myeong Min; Schiefelbein, John

    2015-09-25

    In Arabidopsis thaliana, an atypical leucine-rich repeat receptor-like kinase, SCRAMBLED (SCM), is required for multiple developmental processes including root epidermal cell fate determination, silique dehiscence, inflorescence growth, ovule morphogenesis, and tissue morphology. Previous work suggested that SCM regulates these multiple pathways using distinct mechanisms via interactions with specific downstream factors. ANGUSTIFOLIA (AN) is known to regulate cell and tissue morphogenesis by influencing cortical microtubule arrangement, and recently, the AN protein was reported to interact with the SCM protein. Therefore, we examined whether AN might be responsible for mediating some of the SCM-dependent phenotypes. We discovered that both scm and an mutant lines cause an abnormal spiral or twisting growth of roots, but only the scm mutant affected root epidermal patterning. The siliques of the an and scm mutants also exhibited spiral growth, as previously reported, but only the scm mutant altered silique dehiscence. Interestingly, we discovered that the spiral growth of roots and siliques of the scm mutant is rescued by a truncated SCM protein that lacks its kinase domain, and that a juxtamembrane domain of SCM was sufficient for AN binding in the yeast two-hybrid analysis. These results suggest that the AN protein is one of the critical downstream factors of SCM pathways specifically responsible for mediating its effects on cell/tissue morphogenesis through cortical microtubule arrangement. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Regulation of DNA Methylation Patterns by CK2-Mediated Phosphorylation of Dnmt3a

    Directory of Open Access Journals (Sweden)

    Rachel Deplus

    2014-08-01

    Full Text Available DNA methylation is a central epigenetic modification that is established by de novo DNA methyltransferases. The mechanisms underlying the generation of genomic methylation patterns are still poorly understood. Using mass spectrometry and a phosphospecific Dnmt3a antibody, we demonstrate that CK2 phosphorylates endogenous Dnmt3a at two key residues located near its PWWP domain, thereby downregulating the ability of Dnmt3a to methylate DNA. Genome-wide DNA methylation analysis shows that CK2 primarily modulates CpG methylation of several repeats, most notably of Alu SINEs. This modulation can be directly attributed to CK2-mediated phosphorylation of Dnmt3a. We also find that CK2-mediated phosphorylation is required for localization of Dnmt3a to heterochromatin. By revealing phosphorylation as a mode of regulation of de novo DNA methyltransferase function and by uncovering a mechanism for the regulation of methylation at repetitive elements, our results shed light on the origin of DNA methylation patterns.

  5. Inhibition of Ubc13-mediated Ubiquitination by GPS2 Regulates Multiple Stages of B Cell Development.

    Science.gov (United States)

    Lentucci, Claudia; Belkina, Anna C; Cederquist, Carly T; Chan, Michelle; Johnson, Holly E; Prasad, Sherry; Lopacinski, Amanda; Nikolajczyk, Barbara S; Monti, Stefano; Snyder-Cappione, Jennifer; Tanasa, Bogdan; Cardamone, M Dafne; Perissi, Valentina

    2017-02-17

    Non-proteolytic ubiquitin signaling mediated by Lys 63 ubiquitin chains plays a critical role in multiple pathways that are key to the development and activation of immune cells. Our previous work indicates that GPS2 (G-protein Pathway Suppressor 2) is a multifunctional protein regulating TNFα signaling and lipid metabolism in the adipose tissue through modulation of Lys 63 ubiquitination events. However, the full extent of GPS2-mediated regulation of ubiquitination and the underlying molecular mechanisms are unknown. Here, we report that GPS2 is required for restricting the activation of TLR and BCR signaling pathways and the AKT/FOXO1 pathway in immune cells based on direct inhibition of Ubc13 enzymatic activity. Relevance of this regulatory strategy is confirmed in vivo by B cell-targeted deletion of GPS2, resulting in developmental defects at multiple stages of B cell differentiation. Together, these findings reveal that GPS2 genomic and non-genomic functions are critical for the development and cellular homeostasis of B cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Tolerization with BLP down-regulates HMGB1 a critical mediator of sepsis-related lethality.

    LENUS (Irish Health Repository)

    Coffey, J Calvin

    2012-02-03

    Tolerization with bacterial lipoprotein (BLP) affords a significant survival benefit in sepsis. Given that high mobility group box protein-1 (HMGB1) is a recognized mediator of sepsis-related lethality, we determined if tolerization with BLP leads to alterations in HMGB1. In vitro, BLP tolerization led to a reduction in HMGB1 gene transcription. This was mirrored at the protein level, as HMGB1 protein expression and release were reduced significantly in BLP-tolerized human THP-1 monocytic cells. BLP tolerance in vivo led to a highly significant, long-term survival benefit following challenge with lethal dose BLP in C57BL\\/6 mice. This was associated with an attenuation of HMGB1 release into the circulation, as evidenced by negligible serum HMGB1 levels in BLP-tolerized mice. Moreover, HMGB1 levels in peritoneal macrophages from BLP-tolerized mice were reduced significantly. Hence, tolerization with BLP leads to a down-regulation of HMGB1 protein synthesis and release. The improved survival associated with BLP tolerance could thus be explained by a reduction in HMGB1, were the latter associated with lethality in BLP-related sepsis. In testing this hypothesis, it was noted that neutralization of HMGB1, using anti-HMGB1 antibodies, abrogated BLP-associated lethality almost completely. To conclude, tolerization with BLP leads to a down-regulation of HMGB1, thus offering a novel means of targeting the latter. HMGB1 is also a mediator of lethality in BLP-related sepsis.

  7. GSK3 controls axon growth via CLASP-mediated regulation of growth cone microtubules

    Science.gov (United States)

    Hur, Eun-Mi; Saijilafu; Lee, Byoung Dae; Kim, Seong-Jin; Xu, Wen-Lin; Zhou, Feng-Quan

    2011-01-01

    Suppression of glycogen synthase kinase 3 (GSK3) activity in neurons yields pleiotropic outcomes, causing both axon growth promotion and inhibition. Previous studies have suggested that specific GSK3 substrates, such as adenomatous polyposis coli (APC) and collapsin response mediator protein 2 (CRMP2), support axon growth by regulating the stability of axonal microtubules (MTs), but the substrate(s) and mechanisms conveying axon growth inhibition remain elusive. Here we show that CLIP (cytoplasmic linker protein)-associated protein (CLASP), originally identified as a MT plus end-binding protein, displays both plus end-binding and lattice-binding activities in nerve growth cones, and reveal that the two MT-binding activities regulate axon growth in an opposing manner: The lattice-binding activity mediates axon growth inhibition induced by suppression of GSK3 activity via preventing MT protrusion into the growth cone periphery, whereas the plus end-binding property supports axon extension via stabilizing the growing ends of axonal MTs. We propose a model in which CLASP transduces GSK3 activity levels to differentially control axon growth by coordinating the stability and configuration of growth cone MTs. PMID:21937714

  8. Siderophore-mediated iron trafficking in humans is regulated by iron

    Science.gov (United States)

    Liu, Zhuoming; Lanford, Robert; Mueller, Sebastian; Gerhard, Glenn S.; Luscieti, Sara; Sanchez, Mayka; Devireddy, L.

    2013-01-01

    Siderophores are best known as small iron binding molecules that facilitate microbial iron transport. In our previous study we identified a siderophore-like molecule in mammalian cells and found that its biogenesis is evolutionarily conserved. A member of the short chain dehydrogenase family of reductases, 3-OH butyrate dehydrogenase (BDH2) catalyzes a rate-limiting step in the biogenesis of the mammalian siderophore. We have shown that depletion of the mammalian siderophore by inhibiting expression of bdh2 results in abnormal accumulation of cellular iron and mitochondrial iron deficiency. These observations suggest that the mammalian siderophore is a critical regulator of cellular iron homeostasis and facilitates mitochondrial iron import. By utilizing bioinformatics, we identified an iron-responsive element (IRE; a stem-loop structure that regulates genes expression post-transcriptionally upon binding to iron regulatory proteins or IRPs) in the 3′-untranslated region (3′-UTR) of the human BDH2 (hBDH2) gene. In cultured cells as well as in patient samples we now demonstrate that the IRE confers iron-dependent regulation on hBDH2 and binds IRPs in RNA electrophoretic mobility shift assays. In addition, we show that the hBDH2 IRE associates with IRPs in cells and that abrogation of IRPs by RNAi eliminates the iron-dependent regulation of hBDH2 mRNA. The key physiologic implication is that iron-mediated post-transcriptional regulation of hBDH2 controls mitochondrial iron homeostasis in human cells. These observations provide a new and an unanticipated mechanism by which iron regulates its intracellular trafficking. PMID:22527885

  9. The Arabidopsis Mediator Complex Subunits MED16, MED14, and MED2 Regulate Mediator and RNA Polymerase II Recruitment to CBF-Responsive Cold-Regulated Genes[C][W][OPEN

    Science.gov (United States)

    Hemsley, Piers A.; Hurst, Charlotte H.; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R.; De Cothi, Elizabeth A.; Steele, John F.; Knight, Heather

    2014-01-01

    The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation–induced freezing tolerance. In addition, these three subunits are required for low temperature–induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced. PMID:24415770

  10. Does Anger Regulation Mediate the Discrimination-Mental Health Link among Mexican-Origin Adolescents? A Longitudinal Mediation Analysis Using Multilevel Modeling

    Science.gov (United States)

    Park, Irene J. K.; Wang, Lijuan; Williams, David R.; Alegría, Margarita

    2017-01-01

    Although prior research has consistently documented the association between racial/ethnic discrimination and poor mental health outcomes, the mechanisms that underlie this link are still unclear. The present 3-wave longitudinal study tested the mediating role of anger regulation in the discrimination-mental health link among 269 Mexican-origin…

  11. Epigenetic Regulation in Particulate Matter-Mediated Cardiopulmonary Toxicities: A Systems Biology Perspective.

    Science.gov (United States)

    Wang, Ting; Garcia, Joe Gn; Zhang, Wei

    2012-12-01

    Particulate matter (PM) air pollution exerts significant adverse health effects in global populations, particularly in developing countries with extensive air pollution. Understanding of the mechanisms of PM-induced health effects including the risk for cardiovascular diseases remains limited. In addition to the direct cellular physiological responses such as mitochondrial dysfunction and oxidative stress, PM mediates remarkable dysregulation of gene expression, especially in cardiovascular tissues. The PM-mediated gene dysregulation is likely to be a complex mechanism affected by various genetic and non-genetic factors. Notably, PM is known to alter epigenetic markers (e.g., DNA methylation and histone modifications), which may contribute to air pollution-mediated health consequences including the risk for cardiovascular diseases. Notably, epigenetic changes induced by ambient PM exposure have emerged to play a critical role in gene regulation. Though the underlying mechanism(s) are not completely clear, the available evidence suggests that the modulated activities of DNA methyltransferase (DNMT), histone acetylase (HAT) and histone deacetylase (HDAC) may contribute to the epigenetic changes induced by PM or PM-related chemicals. By employing genome-wide epigenomic and systems biology approaches, PM toxicogenomics could conceivably progress greatly with the potential identification of individual epigenetic loci associated with dysregulated gene expression after PM exposure, as well the interactions between epigenetic pathways and PM. Furthermore, novel therapeutic targets based on epigenetic markers could be identified through future epigenomic studies on PM-mediated cardiopulmonary toxicities. These considerations collectively inform the future population health applications of genomics in developing countries while benefiting global personalized medicine at the same time.

  12. Self-Regulation of the Primary Auditory Cortex Attention Via Directed Attention Mediated By Real Time fMRI Neurofeedback

    Science.gov (United States)

    2017-05-05

    NELSON FROM: 59 MDW /SGYU SUBJECT: Professional Presentation Approval 1. Your paper, entitled Self - regulation of the Primary Auditory Cortex Attention via...DATE Sherwood - p.1 Self - regulation of the primary auditory cortex attention via directed attention mediated by real-time fMRI neurofeedback M S...auditory cortex hyperactivity by self - regulation of the primary auditory cortex (A 1) based on real-time functional magnetic resonance imaging neurofeedback

  13. Stathmin Mediates Hepatocyte Resistance to Death from Oxidative Stress by down Regulating JNK

    Science.gov (United States)

    Zhao, Enpeng; Amir, Muhammad; Lin, Yu; Czaja, Mark J.

    2014-01-01

    Stathmin 1 performs a critical function in cell proliferation by regulating microtubule polymerization. This proliferative function is thought to explain the frequent overexpression of stathmin in human cancer and its correlation with a bad prognosis. Whether stathmin also functions in cell death pathways is unclear. Stathmin regulates microtubules in part by binding free tubulin, a process inhibited by stathmin phosphorylation from kinases including c-Jun N-terminal kinase (JNK). The involvement of JNK activation both in stathmin phosphorylation, and in hepatocellular resistance to oxidative stress, led to an examination of the role of stathmin/JNK crosstalk in oxidant-induced hepatocyte death. Oxidative stress from menadione-generated superoxide induced JNK-dependent stathmin phosphorylation at Ser-16, Ser-25 and Ser-38 in hepatocytes. A stathmin knockdown sensitized hepatocytes to both apoptotic and necrotic cell death from menadione without altering levels of oxidant generation. The absence of stathmin during oxidative stress led to JNK overactivation that was the mechanism of cell death as a concomitant knockdown of JNK1 or JNK2 blocked death. Hepatocyte death from JNK overactivation was mediated by the effects of JNK on mitochondria. Mitochondrial outer membrane permeabilization occurred in stathmin knockdown cells at low concentrations of menadione that triggered apoptosis, whereas mitochondrial β-oxidation and ATP homeostasis were compromised at higher, necrotic menadione concentrations. Stathmin therefore mediates hepatocyte resistance to death from oxidative stress by down regulating JNK and maintaining mitochondrial integrity. These findings demonstrate a new mechanism by which stathmin promotes cell survival and potentially tumor growth. PMID:25285524

  14. Stathmin mediates hepatocyte resistance to death from oxidative stress by down regulating JNK.

    Directory of Open Access Journals (Sweden)

    Enpeng Zhao

    Full Text Available Stathmin 1 performs a critical function in cell proliferation by regulating microtubule polymerization. This proliferative function is thought to explain the frequent overexpression of stathmin in human cancer and its correlation with a bad prognosis. Whether stathmin also functions in cell death pathways is unclear. Stathmin regulates microtubules in part by binding free tubulin, a process inhibited by stathmin phosphorylation from kinases including c-Jun N-terminal kinase (JNK. The involvement of JNK activation both in stathmin phosphorylation, and in hepatocellular resistance to oxidative stress, led to an examination of the role of stathmin/JNK crosstalk in oxidant-induced hepatocyte death. Oxidative stress from menadione-generated superoxide induced JNK-dependent stathmin phosphorylation at Ser-16, Ser-25 and Ser-38 in hepatocytes. A stathmin knockdown sensitized hepatocytes to both apoptotic and necrotic cell death from menadione without altering levels of oxidant generation. The absence of stathmin during oxidative stress led to JNK overactivation that was the mechanism of cell death as a concomitant knockdown of JNK1 or JNK2 blocked death. Hepatocyte death from JNK overactivation was mediated by the effects of JNK on mitochondria. Mitochondrial outer membrane permeabilization occurred in stathmin knockdown cells at low concentrations of menadione that triggered apoptosis, whereas mitochondrial β-oxidation and ATP homeostasis were compromised at higher, necrotic menadione concentrations. Stathmin therefore mediates hepatocyte resistance to death from oxidative stress by down regulating JNK and maintaining mitochondrial integrity. These findings demonstrate a new mechanism by which stathmin promotes cell survival and potentially tumor growth.

  15. Regulation of Membrane-Type 4 Matrix Metalloproteinase by SLUG Contributes to Hypoxia-Mediated Metastasis

    Directory of Open Access Journals (Sweden)

    Chi-Hung Huang

    2009-12-01

    Full Text Available The hypoxic tumor environment has been shown to be critical to cancer metastasis through the promotion of angiogenesis, induction of epithelial-mesenchymal transition (EMT, and acquisition of invasive potential. However, the impact of hypoxia on the expression profile of the proteolytic enzymes involved in invasiveness is relatively unknown. Membrane-type 4 matrix metalloproteinase (MT4-MMP is a glycosyl-phosphatidyl inositol-anchored protease that has been shown to be overexpressed in human cancers. However, detailed mechanisms regarding the regulation and function of MT4-MMP expression in tumor cells remain unknown. Here, we demonstrate that hypoxia or overexpression of hypoxia-inducible factor-1α (HIF-1α induced MT4-MMP expression in human cancer cells. Activation of SLUG, a transcriptional factor regulating the EMT process of human cancers, by HIF-1α was critical for the induction of MT4-MMP under hypoxia. SLUG regulated the transcription of MT4-MMP through direct binding to the E-box located in its proximal promoter. Short-interference RNA-mediated knockdown of MT4-MMP attenuated in vitro invasiveness and in vivo pulmonary colonization of tumor cells without affecting cell migratory ability. MT4-MMP promoted invasiveness and pulmonary colonization through modulation of the expression profile of MMPs and angiogenic factors. Finally, coexpression of HIF-1α and MT4-MMP in human head and neck cancer was predictive of a worse clinical outcome. These findings establish a novel signaling pathway for hypoxia-mediated metastasis and elucidate the underlying regulatory mechanism and functional significance of MT4-MMP in cancer metastasis.

  16. Salt Stress Represses Soybean Seed Germination by Negatively Regulating GA Biosynthesis While Positively Mediating ABA Biosynthesis

    Directory of Open Access Journals (Sweden)

    Kai Shu

    2017-08-01

    Full Text Available Soybean is an important and staple oilseed crop worldwide. Salinity stress has adverse effects on soybean development periods, especially on seed germination and post-germinative growth. Improving seed germination and emergence will have positive effects under salt stress conditions on agricultural production. Here we report that NaCl delays soybean seed germination by negatively regulating gibberellin (GA while positively mediating abscisic acid (ABA biogenesis, which leads to a decrease in the GA/ABA ratio. This study suggests that fluridone (FLUN, an ABA biogenesis inhibitor, might be a potential plant growth regulator that can promote soybean seed germination under saline stress. Different soybean cultivars, which possessed distinct genetic backgrounds, showed a similar repressed phenotype during seed germination under exogenous NaCl application. Biochemical analysis revealed that NaCl treatment led to high MDA (malondialdehyde level during germination and the post-germinative growth stages. Furthermore, catalase, superoxide dismutase, and peroxidase activities also changed after NaCl treatment. Subsequent quantitative Real-Time Polymerase Chain Reaction analysis showed that the transcription levels of ABA and GA biogenesis and signaling genes were altered after NaCl treatment. In line with this, phytohormone measurement also revealed that NaCl considerably down-regulated active GA1, GA3, and GA4 levels, whereas the ABA content was up-regulated; and therefore ratios, such as GA1/ABA, GA3/ABA, and GA4/ABA, are decreased. Consistent with the hormonal quantification, FLUN partially rescued the delayed-germination phenotype caused by NaCl-treatment. Altogether, these results demonstrate that NaCl stress inhibits soybean seed germination by decreasing the GA/ABA ratio, and that FLUN might be a potential plant growth regulator that could promote soybean seed germination under salinity stress.

  17. Salt Stress Represses Soybean Seed Germination by Negatively Regulating GA Biosynthesis While Positively Mediating ABA Biosynthesis.

    Science.gov (United States)

    Shu, Kai; Qi, Ying; Chen, Feng; Meng, Yongjie; Luo, Xiaofeng; Shuai, Haiwei; Zhou, Wenguan; Ding, Jun; Du, Junbo; Liu, Jiang; Yang, Feng; Wang, Qiang; Liu, Weiguo; Yong, Taiwen; Wang, Xiaochun; Feng, Yuqi; Yang, Wenyu

    2017-01-01

    Soybean is an important and staple oilseed crop worldwide. Salinity stress has adverse effects on soybean development periods, especially on seed germination and post-germinative growth. Improving seed germination and emergence will have positive effects under salt stress conditions on agricultural production. Here we report that NaCl delays soybean seed germination by negatively regulating gibberellin (GA) while positively mediating abscisic acid (ABA) biogenesis, which leads to a decrease in the GA/ABA ratio. This study suggests that fluridone (FLUN), an ABA biogenesis inhibitor, might be a potential plant growth regulator that can promote soybean seed germination under saline stress. Different soybean cultivars, which possessed distinct genetic backgrounds, showed a similar repressed phenotype during seed germination under exogenous NaCl application. Biochemical analysis revealed that NaCl treatment led to high MDA (malondialdehyde) level during germination and the post-germinative growth stages. Furthermore, catalase, superoxide dismutase, and peroxidase activities also changed after NaCl treatment. Subsequent quantitative Real-Time Polymerase Chain Reaction analysis showed that the transcription levels of ABA and GA biogenesis and signaling genes were altered after NaCl treatment. In line with this, phytohormone measurement also revealed that NaCl considerably down-regulated active GA 1 , GA 3 , and GA 4 levels, whereas the ABA content was up-regulated; and therefore ratios, such as GA 1 /ABA, GA 3 /ABA, and GA 4 /ABA, are decreased. Consistent with the hormonal quantification, FLUN partially rescued the delayed-germination phenotype caused by NaCl-treatment. Altogether, these results demonstrate that NaCl stress inhibits soybean seed germination by decreasing the GA/ABA ratio, and that FLUN might be a potential plant growth regulator that could promote soybean seed germination under salinity stress.

  18. Hypoxia-inducible factor directs POMC gene to mediate hypothalamic glucose sensing and energy balance regulation.

    Directory of Open Access Journals (Sweden)

    Hai Zhang

    2011-07-01

    Full Text Available Hypoxia-inducible factor (HIF is a nuclear transcription factor that responds to environmental and pathological hypoxia to induce metabolic adaptation, vascular growth, and cell survival. Here we found that HIF subunits and HIF2α in particular were normally expressed in the mediobasal hypothalamus of mice. Hypothalamic HIF was up-regulated by glucose to mediate the feeding control of hypothalamic glucose sensing. Two underlying molecular pathways were identified, including suppression of PHDs by glucose metabolites to prevent HIF2α degradation and the recruitment of AMPK and mTOR/S6K to regulate HIF2α protein synthesis. HIF activation was found to directly control the transcription of POMC gene. Genetic approach was then employed to develop conditional knockout mice with HIF inhibition in POMC neurons, revealing that HIF loss-of-function in POMC neurons impaired hypothalamic glucose sensing and caused energy imbalance to promote obesity development. The metabolic effects of HIF in hypothalamic POMC neurons were independent of leptin signaling or pituitary ACTH pathway. Hypothalamic gene delivery of HIF counteracted overeating and obesity under conditions of nutritional excess. In conclusion, HIF controls hypothalamic POMC gene to direct the central nutrient sensing in regulation of energy and body weight balance.

  19. [Regulation of Positive and Negative Emotions as Mediator between Maternal Emotion Socialization and Child Problem Behavior].

    Science.gov (United States)

    Fäsche, Anika; Gunzenhauser, Catherine; Friedlmeier, Wolfgang; von Suchodoletz, Antje

    2015-01-01

    The present study investigated five to six year old children's ability to regulate negative and positive emotions in relation to psychosocial problem behavior (N=53). It was explored, whether mothers' supportive and nonsupportive strategies of emotion socialization influence children's problem behavior by shaping their emotion regulation ability. Mothers reported on children's emotion regulation and internalizing and externalizing problem behavior via questionnaire, and were interviewed about their preferences for socialization strategies in response to children's expression of negative affect. Results showed that children with more adaptive expression of adequate positive emotions had less internalizing behavior problems. When children showed more control of inadequate negative emotions, children were less internalizing as well as externalizing in their behavior. Furthermore, results indicated indirect relations of mothers' socialization strategies with children's problem behavior. Control of inadequate negative emotions mediated the link between non-supportive strategies on externalizing problem behavior. Results suggest that emotion regulatory processes should be part of interventions to reduce the development of problematic behavior in young children. Parents should be trained in dealing with children's emotions in a constructive way.

  20. Hypoxia-Inducible Factor Directs POMC Gene to Mediate Hypothalamic Glucose Sensing and Energy Balance Regulation

    Science.gov (United States)

    Zhang, Hai; Zhang, Guo; Gonzalez, Frank J.; Park, Sung-min; Cai, Dongsheng

    2011-01-01

    Hypoxia-inducible factor (HIF) is a nuclear transcription factor that responds to environmental and pathological hypoxia to induce metabolic adaptation, vascular growth, and cell survival. Here we found that HIF subunits and HIF2α in particular were normally expressed in the mediobasal hypothalamus of mice. Hypothalamic HIF was up-regulated by glucose to mediate the feeding control of hypothalamic glucose sensing. Two underlying molecular pathways were identified, including suppression of PHDs by glucose metabolites to prevent HIF2α degradation and the recruitment of AMPK and mTOR/S6K to regulate HIF2α protein synthesis. HIF activation was found to directly control the transcription of POMC gene. Genetic approach was then employed to develop conditional knockout mice with HIF inhibition in POMC neurons, revealing that HIF loss-of-function in POMC neurons impaired hypothalamic glucose sensing and caused energy imbalance to promote obesity development. The metabolic effects of HIF in hypothalamic POMC neurons were independent of leptin signaling or pituitary ACTH pathway. Hypothalamic gene delivery of HIF counteracted overeating and obesity under conditions of nutritional excess. In conclusion, HIF controls hypothalamic POMC gene to direct the central nutrient sensing in regulation of energy and body weight balance. PMID:21814490

  1. miR-150-Mediated Foxo1 Regulation Programs CD8+ T Cell Differentiation.

    Science.gov (United States)

    Ban, Young Ho; Oh, Se-Chan; Seo, Sang-Hwan; Kim, Seok-Min; Choi, In-Pyo; Greenberg, Philip D; Chang, Jun; Kim, Tae-Don; Ha, Sang-Jun

    2017-09-12

    MicroRNA (miR)-150 is a developmental regulator of several immune-cell types, but its role in CD8 + T cells is largely unexplored. Here, we show that miR-150 regulates the generation of memory CD8 + T cells. After acute virus infection, miR-150 knockout (KO) mice exhibited an accelerated differentiation of CD8 + T cells into memory cells and improved production of effector cytokines. Additionally, miR-150 KO CD8 + T cells displayed an enhanced recall response and improved protection against infections with another virus and bacteria. We found that forkhead box O1 (Foxo1) and T cell-specific transcription factor 1 (TCF1) are upregulated during the early activation phase in miR-150 KO CD8 + T cells and that miR-150 directly targets and suppresses Foxo1. These results suggest that miR-150-mediated suppression of Foxo1 regulates the balance between effector and memory cell differentiation, which might aid in the development of improved vaccines and T cell therapeutics. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Regulation of FOXO1-mediated transcription and cell proliferation by PARP-1

    Energy Technology Data Exchange (ETDEWEB)

    Sakamaki, Jun-ichi; Daitoku, Hiroaki; Yoshimochi, Kenji [Center for Tsukuba Advanced Research Alliance, Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki 305-8577 (Japan); Miwa, Masanao [Faculty of Bioscience, Nagahama Institute of Bio-Science and Technology, Nagahama, Shiga 526-0829 (Japan); Fukamizu, Akiyoshi, E-mail: akif@tara.tsukuba.ac.jp [Center for Tsukuba Advanced Research Alliance, Graduate School of Life and Environmental Sciences, University of Tsukuba, Tsukuba, Ibaraki 305-8577 (Japan)

    2009-05-08

    Forkhead box O (FOXO) transcription factors play an important role in a wide range of biological processes, including cell cycle control, apoptosis, detoxification of reactive oxygen species, and gluconeogenesis through regulation of gene expression. In this study, we demonstrated that PARP-1 functions as a negative regulator of FOXO1. We showed that PARP-1 directly binds to and poly(ADP-ribosyl)ates FOXO1 protein. PARP-1 represses FOXO1-mediated expression of cell cycle inhibitor p27{sup Kip1} gene. Notably, poly(ADP-ribosyl)ation activity was not required for the repressive effect of PARP-1 on FOXO1 function. Furthermore, knockdown of PARP-1 led to a decrease in cell proliferation in a manner dependent on FOXO1 function. Chromatin immunoprecipitation experiments confirmed that PARP-1 is recruited to the p27{sup Kip1} gene promoter through a binding to FOXO1. These results suggest that PARP-1 acts as a corepressor for FOXO1, which could play an important role in proper cell proliferation by regulating p27{sup Kip1} gene expression.

  3. EMMPRIN regulates β1 integrin-mediated adhesion through Kindlin-3 in human melanoma cells.

    Science.gov (United States)

    Delyon, Julie; Khayati, Farah; Djaafri, Ibtissem; Podgorniak, Marie-Pierre; Sadoux, Aurélie; Setterblad, Niclas; Boutalbi, Zineb; Maouche, Kamel; Maskos, Uwe; Menashi, Suzanne; Lebbé, Céleste; Mourah, Samia

    2015-06-01

    EMMPRIN is known to promote tumor invasion through extracellular matrix (ECM) degradation. Here we report that EMMPRIN can regulate melanoma cell adhesion to the ECM through an interaction with β1 integrin involving kindlin-3. In this study, EMMPRIN knockdown in the human melanoma cell line M10 using siRNA decreased cell invasion and significantly increased cell adhesion and spreading. A morphological change from a round to a spread shape was observed associated with enhanced phalloidin-labelled actin staining. In situ proximity ligation assay and co-immunoprecipitation revealed that EMMPRIN silencing increased the interaction of β1 integrin with kindlin-3, a focal adhesion protein. This was associated with an increase in β1 integrin activation and a decrease in the phosphorylation of the downstream integrin kinase FAK. Moreover, the expression at both the transcript and protein level of kindlin-3 and of β1 integrin was inversely regulated by EMMPRIN. EMMPRIN did not regulate either talin expression or its interaction with β1 integrin. These results are consistent with our in vivo demonstration that EMMPRIN inhibition increased β1 integrin activation and its interaction with kindlin-3. To conclude, these findings reveal a new role of EMMPRIN in tumor cell migration through ß1 integrin/kindlin-3-mediated adhesion pathway. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. MicroRNA-mediated networks underlie immune response regulation in papillary thyroid carcinoma

    Science.gov (United States)

    Huang, Chen-Tsung; Oyang, Yen-Jen; Huang, Hsuan-Cheng; Juan, Hsueh-Fen

    2014-09-01

    Papillary thyroid carcinoma (PTC) is a common endocrine malignancy with low death rate but increased incidence and recurrence in recent years. MicroRNAs (miRNAs) are small non-coding RNAs with diverse regulatory capacities in eukaryotes and have been frequently implied in human cancer. Despite current progress, however, a panoramic overview concerning miRNA regulatory networks in PTC is still lacking. Here, we analyzed the expression datasets of PTC from The Cancer Genome Atlas (TCGA) Data Portal and demonstrate for the first time that immune responses are significantly enriched and under specific regulation in the direct miRNA-target network among distinctive PTC variants to different extents. Additionally, considering the unconventional properties of miRNAs, we explore the protein-coding competing endogenous RNA (ceRNA) and the modulatory networks in PTC and unexpectedly disclose concerted regulation of immune responses from these networks. Interestingly, miRNAs from these conventional and unconventional networks share general similarities and differences but tend to be disparate as regulatory activities increase, coordinately tuning the immune responses that in part account for PTC tumor biology. Together, our systematic results uncover the intensive regulation of immune responses underlain by miRNA-mediated networks in PTC, opening up new avenues in the management of thyroid cancer.

  5. Protein Kinases C-Mediated Regulations of Drug Transporter Activity, Localization and Expression

    Directory of Open Access Journals (Sweden)

    Abdullah Mayati

    2017-04-01

    Full Text Available Drug transporters are now recognized as major actors in pharmacokinetics, involved notably in drug–drug interactions and drug adverse effects. Factors that govern their activity, localization and expression are therefore important to consider. In the present review, the implications of protein kinases C (PKCs in transporter regulations are summarized and discussed. Both solute carrier (SLC and ATP-binding cassette (ABC drug transporters can be regulated by PKCs-related signaling pathways. PKCs thus target activity, membrane localization and/or expression level of major influx and efflux drug transporters, in various normal and pathological types of cells and tissues, often in a PKC isoform-specific manner. PKCs are notably implicated in membrane insertion of bile acid transporters in liver and, in this way, are thought to contribute to cholestatic or choleretic effects of endogenous compounds or drugs. The exact clinical relevance of PKCs-related regulation of drug transporters in terms of drug resistance, pharmacokinetics, drug–drug interactions and drug toxicity remains however to be precisely determined. This issue is likely important to consider in the context of the development of new drugs targeting PKCs-mediated signaling pathways, for treating notably cancers, diabetes or psychiatric disorders.

  6. Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage

    International Nuclear Information System (INIS)

    Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru

    2005-01-01

    The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR

  7. Impulsivity, self-regulation,and pathological video gaming among youth: testing a mediation model.

    Science.gov (United States)

    Liau, Albert K; Neo, Eng Chuan; Gentile, Douglas A; Choo, Hyekyung; Sim, Timothy; Li, Dongdong; Khoo, Angeline

    2015-03-01

    Given the potential negative mental health consequences of pathological video gaming, understanding its etiology may lead to useful treatment developments. The purpose of the study was to examine the influence of impulsive and regulatory processes on pathological video gaming. Study 1 involved 2154 students from 6 primary and 4 secondary schools in Singapore. Study 2 involved 191 students from 2 secondary schools. The results of study 1 and study 2 supported the hypothesis that self-regulation is a mediator between impulsivity and pathological video gaming. Specifically, higher levels of impulsivity was related to lower levels of self-regulation, which in turn was related to higher levels of pathological video gaming. The use of impulsivity and self-regulation in predicting pathological video gaming supports the dual-system model of incorporating both impulsive and reflective systems in the prediction of self-control outcomes. The study highlights the development of self-regulatory resources as a possible avenue for future prevention and treatment research. © 2011 APJPH.

  8. Interaction and developmental activation of two neuroendocrine systems that regulate light-mediated skin pigmentation.

    Science.gov (United States)

    Bertolesi, Gabriel E; Song, Yi N; Atkinson-Leadbeater, Karen; Yang, Jung-Lynn J; McFarlane, Sarah

    2017-07-01

    Lower vertebrates use rapid light-regulated changes in skin colour for camouflage (background adaptation) or during circadian variation in irradiance levels. Two neuroendocrine systems, the eye/alpha-melanocyte-stimulating hormone (α-MSH) and the pineal complex/melatonin circuits, regulate the process through their respective dispersion and aggregation of pigment granules (melanosomes) in skin melanophores. During development, Xenopus laevis tadpoles raised on a black background or in the dark perceive less light sensed by the eye and darken in response to increased α-MSH secretion. As embryogenesis proceeds, the pineal complex/melatonin circuit becomes the dominant regulator in the dark and induces lightening of the skin of larvae. The eye/α-MSH circuit continues to mediate darkening of embryos on a black background, but we propose the circuit is shut down in complete darkness in part by melatonin acting on receptors expressed by pituitary cells to inhibit the expression of pomc, the precursor of α-MSH. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Phytomelatonin receptor PMTR1-mediated signaling regulates stomatal closure in Arabidopsis thaliana.

    Science.gov (United States)

    Wei, Jian; Li, Dong-Xu; Zhang, Jia-Rong; Shan, Chi; Rengel, Zed; Song, Zhong-Bang; Chen, Qi

    2018-04-27

    Melatonin has been detected in plants in 1995; however, the function and signaling pathway of this putative phytohormone are largely undetermined due to a lack of knowledge about its receptor. Here, we discovered the first phytomelatonin receptor (CAND2/PMTR1) in Arabidopsis thaliana and found that melatonin governs the receptor-dependent stomatal closure. The application of melatonin induced stomatal closure through the heterotrimeric G protein α subunit-regulated H 2 O 2 and Ca 2+ signals. The Arabidopsis mutant lines lacking AtCand2 that encodes a candidate G protein-coupled receptor were insensitive to melatonin-induced stomatal closure. Accordingly, the melatonin-induced H 2 O 2 production and Ca 2+ influx were completely abolished in cand2. CAND2 is a membrane protein that interacts with GPA1 and the expression of AtCand2 was tightly regulated by melatonin in various organs and guard cells. CAND2 showed saturable and specific 125 I-melatonin binding, with apparent K d (dissociation constant) of 0.73 ± 0.10 nmol/L (r 2  = .99), demonstrating this protein is a phytomelatonin receptor (PMTR1). Our results suggest that the phytomelatonin regulation of stomatal closure is dependent on its receptor CAND2/PMTR1-mediated H 2 O 2 and Ca 2+ signaling transduction cascade. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. CTCF Mediates the Cell-Type Specific Spatial Organization of the Kcnq5 Locus and the Local Gene Regulation

    OpenAIRE

    Ren, Licheng; Wang, Yang; Shi, Minglei; Wang, Xiaoning; Yang, Zhong; Zhao, Zhihu

    2012-01-01

    Chromatin loops play important roles in the dynamic spatial organization of genes in the nucleus. Growing evidence has revealed that the multivalent functional zinc finger protein CCCTC-binding factor (CTCF) is a master regulator of genome spatial organization, and mediates the ubiquitous chromatin loops within the genome. Using circular chromosome conformation capture (4C) methodology, we discovered that CTCF may be a master organizer in mediating the spatial organization of the kcnq5 gene l...

  11. Lin28 Mediates Cancer Chemotherapy Resistance via Regulation of miRNA Signaling.

    Science.gov (United States)

    Xu, Chaoyang; Xie, Shuduo; Song, Chunjiao; Huang, Liming; Jiang, Zhinong

    2014-06-01

    Chemotherapy resistance is one of the major obstacles limiting the success of cancer drug treatment. Among the mechanisms of resistance to chemotherapy treatment, there are those closely related to P-Glycoprotein, multidrug resistance-related protein, glutathione S-transferase pi and topoisomerase-II. Lin28 is a highly conserved RNA-binding protein, it consists of a cold shock domain and retroviral-type (CCHC) zinc finger motifs. In previous preclinical and clinical studies, positive Lin28 expression in cancer cells was correlated with decreased sensitivity to chemotherapy. And Lin28 could mediate cancer chemotherapy resistance via regulation of miR107 and Let-7 MiRNA. This article reviews current knowledge on predictive value of Lin28 in response to chemotherapy. Better understanding of its role may facilitate patient's selection of therapeutic regimen and lead to optimal clinical outcome.

  12. Autoimmunity in Arabidopsis acd11 Is Mediated by Epigenetic Regulation of an Immune Receptor

    DEFF Research Database (Denmark)

    Palma, K.; Thorgrimsen, S.; Malinovsky, F.G.

    2010-01-01

    . In a screen for lazarus (laz) mutants that suppress acd11 death we identified two genes, LAZ2 and LAZ5. LAZ2 encodes the histone lysine methyltransferase SDG8, previously shown to epigenetically regulate flowering time via modification of histone 3 (H3). LAZ5 encodes an RPS4-like R-protein, defined by several...... dominant negative alleles. Microarray and chromatin immunoprecipitation analyses showed that LAZ2/SDG8 is required for LAZ5 expression and H3 lysine 36 trimethylation at LAZ5 chromatin to maintain a transcriptionally active state. We hypothesize that LAZ5 triggers cell death in the absence of ACD11......, and that cell death in other lesion mimic mutants may also be caused by inappropriate activation of R genes. Moreover, SDG8 is required for basal and R protein-mediated pathogen resistance in Arabidopsis, revealing the importance of chromatin remodeling as a key process in plant innate immunity....

  13. sRNA-Mediated Regulation of P-Fimbriae Phase Variation in Uropathogenic Escherichia coli

    DEFF Research Database (Denmark)

    Khandige, Surabhi; Kronborg, Tina; Uhlin, Bernt Eric

    2015-01-01

    Uropathogenic Escherichia coli (UPEC) are capable of occupying physiologically distinct intracellular and extracellular niches within the urinary tract. This feat requires the timely regulation of gene expression and small RNAs (sRNAs) are known to mediate such rapid adjustments in response to ch...... to changing environmental cues. This study aimed to uncover sRNA-mediated gene regulation in the UPEC strain UTI89, during infection of bladder epithelial cells. Hfq is an RNA chaperone known to facilitate and stabilize sRNA and target mRNA interactions with bacterial cells. The co...... to the discovery of a novel virulence-associated trans-acting sRNA-PapR. Deletion of papR was found to enhance adhesion of UTI89 to both bladder and kidney cell lines in a manner independent of type-1 fimbriae. We demonstrate PapR mediated posttranscriptional repression of the P-fimbriae phase regulator gene pap...

  14. Nipbl and mediator cooperatively regulate gene expression to control limb development.

    Directory of Open Access Journals (Sweden)

    Akihiko Muto

    2014-09-01

    Full Text Available Haploinsufficiency for Nipbl, a cohesin loading protein, causes Cornelia de Lange Syndrome (CdLS, the most common "cohesinopathy". It has been proposed that the effects of Nipbl-haploinsufficiency result from disruption of long-range communication between DNA elements. Here we use zebrafish and mouse models of CdLS to examine how transcriptional changes caused by Nipbl deficiency give rise to limb defects, a common condition in individuals with CdLS. In the zebrafish pectoral fin (forelimb, knockdown of Nipbl expression led to size reductions and patterning defects that were preceded by dysregulated expression of key early limb development genes, including fgfs, shha, hand2 and multiple hox genes. In limb buds of Nipbl-haploinsufficient mice, transcriptome analysis revealed many similar gene expression changes, as well as altered expression of additional classes of genes that play roles in limb development. In both species, the pattern of dysregulation of hox-gene expression depended on genomic location within the Hox clusters. In view of studies suggesting that Nipbl colocalizes with the mediator complex, which facilitates enhancer-promoter communication, we also examined zebrafish deficient for the Med12 Mediator subunit, and found they resembled Nipbl-deficient fish in both morphology and gene expression. Moreover, combined partial reduction of both Nipbl and Med12 had a strongly synergistic effect, consistent with both molecules acting in a common pathway. In addition, three-dimensional fluorescent in situ hybridization revealed that Nipbl and Med12 are required to bring regions containing long-range enhancers into close proximity with the zebrafish hoxda cluster. These data demonstrate a crucial role for Nipbl in limb development, and support the view that its actions on multiple gene pathways result from its influence, together with Mediator, on regulation of long-range chromosomal interactions.

  15. COUP-TFII mediates progesterone regulation of uterine implantation by controlling ER activity.

    Directory of Open Access Journals (Sweden)

    Isao Kurihara

    2007-06-01

    Full Text Available Progesterone and estrogen are critical regulators of uterine receptivity. To facilitate uterine remodeling for embryo attachment, estrogen activity in the uterine epithelia is attenuated by progesterone; however, the molecular mechanism by which this occurs is poorly defined. COUP-TFII (chicken ovalbumin upstream promoter transcription factor II; also known as NR2F2, a member of the nuclear receptor superfamily, is highly expressed in the uterine stroma and its expression is regulated by the progesterone-Indian hedgehog-Patched signaling axis that emanates from the epithelium. To further assess COUP-TFII uterine function, a conditional COUP-TFII knockout mouse was generated. This mutant mouse is infertile due to implantation failure, in which both embryo attachment and uterine decidualization are impaired. Using this animal model, we have identified a novel genetic pathway in which BMP2 lies downstream of COUP-TFII. Epithelial progesterone-induced Indian hedgehog regulates stromal COUP-TFII, which in turn controls BMP2 to allow decidualization to manifest in vivo. Interestingly, enhanced epithelial estrogen activity, which impedes maturation of the receptive uterus, was clearly observed in the absence of stromal-derived COUP-TFII. This finding is consistent with the notion that progesterone exerts its control of implantation through uterine epithelial-stromal cross-talk and reveals that stromal-derived COUP-TFII is an essential mediator of this complex cross-communication pathway. This finding also provides a new signaling paradigm for steroid hormone regulation in female reproductive biology, with attendant implications for furthering our understanding of the molecular mechanisms that underlie dysregulation of hormonal signaling in such human reproductive disorders as endometriosis and endometrial cancer.

  16. Melatonin-Mediated Development of Ovine Cumulus Cells, Perhaps by Regulation of DNA Methylation

    Directory of Open Access Journals (Sweden)

    Yi Fang

    2018-02-01

    Full Text Available Cumulus cells of pre-pubertal domestic animals are dysfunctional, perhaps due to age-specific epigenetic events. This study was designed to determine effects of melatonin treatment of donors on methylation modification of pre-pubertal cumulus cells. Cumulus cells from germinal vesicle stage cumulus oocyte complexes (COCs were collected from eighteen lambs which were randomly divided into control group (C and melatonin group given an 18 mg melatonin implant subcutaneous (M. Compared to the C group, the M group had higher concentrations of melatonin in plasma and follicular fluid (p < 0.05, greater superovulation, a higher proportion of fully expanded COCs, and a lower proportion of apoptotic cumulus cells (p < 0.05. Real-time PCR results showed that melatonin up-regulated expression of genes MT1, Bcl2, DNMT1, DNMT3a and DNMT3b, but down-regulated expression of genes p53, Caspase 3 and Bax (p < 0.05. Furthermore, melatonin increased FI of FITC (global methylation level on cumulus cells (p < 0.05. To understand the regulation mechanism, the DNMTs promoter methylation sequence were analyzed. Compared to the C group, although there was less methylation at two CpG sites of DNMT1 (p < 0.05 and higher methylation at two CpG sites of DNMT3a (p < 0.05, there were no significant differences in methylation of the detected DNMT1 and DNMT3a promoter regions. However, there were lower methylation levels at five CpG sites of DNMT3b, which decreased methylation of detected DNMT3b promoter region on M group (p < 0.05. In conclusion, alterations of methylation regulated by melatonin may mediate development of cumulus cells in lambs.

  17. Rab20 regulates phagosome maturation in RAW264 macrophages during Fc gamma receptor-mediated phagocytosis.

    Directory of Open Access Journals (Sweden)

    Youhei Egami

    Full Text Available Rab20, a member of the Rab GTPase family, is known to be involved in membrane trafficking, however its implication in FcγR-mediated phagocytosis is unclear. We examined the spatiotemporal localization of Rab20 during phagocytosis of IgG-opsonized erythrocytes (IgG-Es in RAW264 macrophages. By the live-cell imaging of fluorescent protein-fused Rab20, it was shown that Rab20 was transiently associated with the phagosomal membranes. During the early stage of phagosome formation, Rab20 was not localized on the membranes of phagocytic cups, but was gradually recruited to the newly formed phagosomes. Although Rab20 was colocalized with Rab5 to some extent, the association of Rab20 with the phagosomes persisted even after the loss of Rab5 from the phagosomal membranes. Then, Rab20 was colocalized with Rab7 and Lamp1, late endosomal/lysosomal markers, on the internalized phagosomes. Moreover, our analysis of Rab20 mutant expression revealed that the maturation of phagosomes was significantly delayed in cells expressing the GDP-bound mutant Rab20-T19N. These data suggest that Rab20 is an important component of phagosome and regulates the phagosome maturation during FcγR-mediated phagocytosis.

  18. Ciliopathy proteins regulate paracrine signaling by modulating proteasomal degradation of mediators

    Science.gov (United States)

    Liu, Yangfan P.; Tsai, I-Chun; Morleo, Manuela; Oh, Edwin C.; Leitch, Carmen C.; Massa, Filomena; Lee, Byung-Hoon; Parker, David S.; Finley, Daniel; Zaghloul, Norann A.; Franco, Brunella; Katsanis, Nicholas

    2014-01-01

    Cilia are critical mediators of paracrine signaling; however, it is unknown whether proteins that contribute to ciliopathies converge on multiple paracrine pathways through a common mechanism. Here, we show that loss of cilopathy-associated proteins Bardet-Biedl syndrome 4 (BBS4) or oral-facial-digital syndrome 1 (OFD1) results in the accumulation of signaling mediators normally targeted for proteasomal degradation. In WT cells, several BBS proteins and OFD1 interacted with proteasomal subunits, and loss of either BBS4 or OFD1 led to depletion of multiple subunits from the centrosomal proteasome. Furthermore, overexpression of proteasomal regulatory components or treatment with proteasomal activators sulforaphane (SFN) and mevalonolactone (MVA) ameliorated signaling defects in cells lacking BBS1, BBS4, and OFD1, in morphant zebrafish embryos, and in induced neurons from Ofd1-deficient mice. Finally, we tested the hypothesis that other proteasome-dependent pathways not known to be associated with ciliopathies are defective in the absence of ciliopathy proteins. We found that loss of BBS1, BBS4, or OFD1 led to decreased NF-κB activity and concomitant IκBβ accumulation and that these defects were ameliorated with SFN treatment. Taken together, our data indicate that basal body proteasomal regulation governs paracrine signaling pathways and suggest that augmenting proteasomal function might benefit ciliopathy patients. PMID:24691443

  19. Sun-mediated mechanical LINC between nucleus and cytoskeleton regulates βcatenin nuclear access.

    Science.gov (United States)

    Uzer, Gunes; Bas, Guniz; Sen, Buer; Xie, Zhihui; Birks, Scott; Olcum, Melis; McGrath, Cody; Styner, Maya; Rubin, Janet

    2018-06-06

    βcatenin acts as a primary intracellular signal transducer for mechanical and Wnt signaling pathways to control cell function and fate. Regulation of βcatenin in the cytoplasm has been well studied but βcatenin nuclear trafficking and function remains unclear. In a previous study we showed that, in mesenchymal stem cells (MSC), mechanical blockade of adipogenesis relied on inhibition of βcatenin destruction complex element GSK3β (glycogen synthase kinase 3β) to increase nuclear βcatenin as well as the function of Linker of Cytoskeleton and Nucleoskeleton (LINC) complexes, suggesting that these two mechanisms may be linked. Here we show that shortly after inactivation of GSK3β due to either low intensity vibration (LIV), substrate strain or pharmacologic inhibition, βcatenin associates with the nucleoskeleton, defined as the insoluble nuclear fraction that provides structure to the integrated nuclear envelope, nuclear lamina and chromatin. Co-depleting LINC elements Sun-1 and Sun-2 interfered with both nucleoskeletal association and nuclear entry of βcatenin, resulting in decreased nuclear βcatenin levels. Our findings reveal that the insoluble structural nucleoskeleton actively participates in βcatenin dynamics. As the cytoskeleton transmits applied mechanical force to the nuclear surface to influence the nucleoskeleton and its LINC mediated interaction, our results suggest a pathway by which LINC mediated connectivity may play a role in signaling pathways that depend on nuclear access of βcatenin. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Nucleus accumbens cocaine-amphetamine regulated transcript mediates food intake during novelty conflict

    Science.gov (United States)

    Burghardt, PR; Krolewski, DM; Dykhuis, KE; Ching, J; Pinawin, AM; Britton, SL; Koch, LG; Watson, SJ; Akil, H.

    2016-01-01

    Obesity is a persistent and pervasive problem, particularly in industrialized nations. It has come to be appreciated that the metabolic health of an individual can influence brain function and subsequent behavioral patterns. To examine the relationship between metabolic phenotype and central systems that regulate behavior, we tested rats with divergent metabolic phenotypes (Low Capacity Runner: LCR vs. High Capacity Runner: HCR) for behavioral responses to the conflict between hunger and environmental novelty using the novelty suppressed feeding (NSF) paradigm. Additionally, we measured expression of mRNA, for peptides involved in energy management, in response to fasting. Following a 24-h fast, LCR rats showed lower latencies to begin eating in a novel environment compared to HCR rats. A 48-h fast equilibrated the latency to begin eating in the novel environment. A 24-h fast differentially affected expression of cocaine-amphetamine regulated transcript (CART) mRNA in the nucleus accumbens (NAc), where 24-h of fasting reduced CART mRNA in LCR rats. Bilateral microinjections of CART 55–102 peptide into the NAc increased the latency to begin eating in the NSF paradigm following a 24-h fast in LCR rats. These results indicate that metabolic phenotype influences how animals cope with the conflict between hunger and novelty, and that these differences are at least partially mediated by CART signaling in the NAc. For individuals with poor metabolic health who have to navigate food-rich and stressful environments, changes in central systems that mediate conflicting drives may feed into the rates of obesity and exacerbate the difficulty individuals have in maintaining weight loss. PMID:26926827

  1. Hypoxia-Mediated Epigenetic Regulation of Stemness in Brain Tumor Cells.

    Science.gov (United States)

    Prasad, Pankaj; Mittal, Shivani Arora; Chongtham, Jonita; Mohanty, Sujata; Srivastava, Tapasya

    2017-06-01

    Activation of pluripotency regulatory circuit is an important event in solid tumor progression and the hypoxic microenvironment is known to enhance the stemness feature of some cells. The distinct population of cancer stem cells (CSCs)/tumor initiating cells exist in a niche and augment invasion, metastasis, and drug resistance. Previously, studies have reported global hypomethylation and site-specific aberrant methylation in gliomas along with other epigenetic modifications as important contributors to genomic instability during glioma progression. Here, we have demonstrated the role of hypoxia-mediated epigenetic modifications in regulating expression of core pluripotency factors, OCT4 and NANOG, in glioma cells. We observe hypoxia-mediated induction of demethylases, ten-eleven-translocation (TET) 1 and 3, but not TET2 in our cell-line model. Immunoprecipitation studies reveal active demethylation and direct binding of TET1 and 3 at the Oct4 and Nanog regulatory regions. Tet1 and 3 silencing assays further confirmed induction of the pluripotency pathway involving Oct4, Nanog, and Stat3, by these paralogues, although with varying degrees. Knockdown of Tet1 and Tet3 inhibited the formation of neurospheres in hypoxic conditions. We observed independent roles of TET1 and TET3 in differentially regulating pluripotency and differentiation associated genes in hypoxia. Overall, this study demonstrates an active demethylation in hypoxia by TET1 and 3 as a mechanism of Oct4 and Nanog overexpression thus contributing to the formation of CSCs in gliomas. Stem Cells 2017;35:1468-1478. © 2017 AlphaMed Press.

  2. DMPD: Pivotal role of PGE2 and IL-10 in the cross-regulation of dendritic cell-derivedinflammatory mediators. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available l) (.csml) Show Pivotal role of PGE2 and IL-10 in the cross-regulation of dendritic cell-derivedinflammatory mediator...egulation of dendritic cell-derivedinflammatory mediators. Authors Harizi H, Gualde N. Publication Cell Mol ...16978535 Pivotal role of PGE2 and IL-10 in the cross-regulation of dendritic cell-derivedinflammatory mediat...ors. Harizi H, Gualde N. Cell Mol Immunol. 2006 Aug;3(4):271-7. (.png) (.svg) (.htm

  3. PINK1 positively regulates IL-1β-mediated signaling through Tollip and IRAK1 modulation

    Directory of Open Access Journals (Sweden)

    Lee Hyun Jung

    2012-12-01

    Full Text Available Abstract Background Parkinson disease (PD is characterized by a slow, progressive degeneration of dopaminergic neurons in the substantianigra. The cause of neuronal loss in PD is not well understood, but several genetic loci, including PTEN-induced putative kinase 1 (PINK1, have been linked to early-onset autosomal recessive forms of familial PD. Neuroinflammation greatly contributes to PD neuronal degeneration and pathogenesis. IL-1 is one of the principal cytokines that regulates various immune and inflammatory responses via the activation of the transcription factors NF-κB and activating protein-1. Despite the close relationship between PD and neuroinflammation, the functional roles of PD-linked genes during inflammatory processes remain poorly understood. Methods To explore the functional roles of PINK1 in response to IL-1β stimulation, HEK293 cells, mouse embryonic fibroblasts derived from PINK1-null (PINK1−/− and control (PINK1+/+ mice, and 293 IL-1RI cells stably expressing type 1 IL-1 receptor were used. Immunoprecipitation and western blot analysis were performed to detect protein–protein interaction and protein ubiquitination. To confirm the effect of PINK1 on NF-κB activation, NF-κB-dependent firefly luciferase reporter assay was conducted. Results PINK1 specifically binds two components of the IL-1-mediated signaling cascade, Toll-interacting protein (Tollip and IL-1 receptor-associated kinase 1 (IRAK1. The association of PINK1 with Tollip, a negative regulator of IL-1β signaling, increases upon IL-1β stimulation, which then facilitates the dissociation of Tollip from IRAK1 as well as the assembly of the IRAK1–TNF receptor-associated factor 6 (TRAF6 complex. PINK1 also enhances Lys63-linked polyubiquitination of IRAK1, an essential modification of recruitment of NF-κB essential modulator and subsequent IκB kinase activation, and increases formation of the intermediate signalosome including IRAK1, TRAF6, and

  4. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  5. RNAi-Mediated Reverse Genetic Screen Identified Drosophila Chaperones Regulating Eye and Neuromuscular Junction Morphology

    Directory of Open Access Journals (Sweden)

    Sandeep Raut

    2017-07-01

    Full Text Available Accumulation of toxic proteins in neurons has been linked with the onset of neurodegenerative diseases, which in many cases are characterized by altered neuronal function and synapse loss. Molecular chaperones help protein folding and the resolubilization of unfolded proteins, thereby reducing the protein aggregation stress. While most of the chaperones are expressed in neurons, their functional relevance remains largely unknown. Here, using bioinformatics analysis, we identified 95 Drosophila chaperones and classified them into seven different classes. Ubiquitous actin5C-Gal4-mediated RNAi knockdown revealed that ∼50% of the chaperones are essential in Drosophila. Knocking down these genes in eyes revealed that ∼30% of the essential chaperones are crucial for eye development. Using neuron-specific knockdown, immunocytochemistry, and robust behavioral assays, we identified a new set of chaperones that play critical roles in the regulation of Drosophila NMJ structural organization. Together, our data present the first classification and comprehensive analysis of Drosophila chaperones. Our screen identified a new set of chaperones that regulate eye and NMJ morphogenesis. The outcome of the screen reported here provides a useful resource for further elucidating the role of individual chaperones in Drosophila eye morphogenesis and synaptic development.

  6. FOXO3-mediated up-regulation of Bim contributes to rhein-induced cancer cell apoptosis.

    Science.gov (United States)

    Wang, Jiao; Liu, Shu; Yin, Yancun; Li, Mingjin; Wang, Bo; Yang, Li; Jiang, Yangfu

    2015-03-01

    The anthraquinone compound rhein is a natural agent in the traditional Chinese medicine rhubarb. Preclinical studies demonstrate that rhein has anticancer activity. Treatment of a variety of cancer cells with rhein may induce apoptosis. Here, we report that rhein induces atypical unfolded protein response in breast cancer MCF-7 cells and hepatoma HepG2 cells. Rhein induces CHOP expression, eIF2α phosphorylation and caspase cleavage, while it does not induce glucose-regulated protein 78 (GRP78) expression in both MCF-7 and HepG2 cells. Meanwhile, rhein inhibits thapsigargin-induced GRP78 expression and X box-binding protein 1 splicing. In addition, rhein inhibits Akt phosphorylation and stimulates FOXO transactivation activity. Rhein induces Bim expression in MCF-7 and HepG2 cells, which can be abrogated by FOXO3a knockdown. Knockdown of FOXO3a or Bim abrogates rhein-induced caspase cleavage and apoptosis. The chemical chaperone 4-phenylbutyrate acid antagonizes the induction of FOXO activation, Bim expression and caspase cleavage by rhein, indicating that protein misfolding may be involved in triggering these deleterious effects. We conclude that FOXO3a-mediated up-regulation of Bim is a key mechanism underlying rhein-induced cancer cells apoptosis.

  7. The ATPases of cohesin interface with regulators to modulate cohesin-mediated DNA tethering

    Science.gov (United States)

    Çamdere, Gamze; Guacci, Vincent; Stricklin, Jeremiah; Koshland, Douglas

    2015-01-01

    Cohesin tethers together regions of DNA, thereby mediating higher order chromatin organization that is critical for sister chromatid cohesion, DNA repair and transcriptional regulation. Cohesin contains a heterodimeric ATP-binding Cassette (ABC) ATPase comprised of Smc1 and Smc3 ATPase active sites. These ATPases are required for cohesin to bind DNA. Cohesin’s DNA binding activity is also promoted by the Eco1 acetyltransferase and inhibited by Wpl1. Recently we showed that after cohesin stably binds DNA, a second step is required for DNA tethering. This second step is also controlled by Eco1 acetylation. Here, we use genetic and biochemical analyses to show that this second DNA tethering step is regulated by cohesin ATPase. Furthermore, our results also suggest that Eco1 promotes cohesion by modulating the ATPase cycle of DNA-bound cohesin in a state that is permissive for DNA tethering and refractory to Wpl1 inhibition. DOI: http://dx.doi.org/10.7554/eLife.11315.001 PMID:26583750

  8. Role of cocaine- and amphetamine-regulated transcript in estradiol-mediated neuroprotection

    Science.gov (United States)

    Xu, Yun; Zhang, Wenri; Klaus, Judith; Young, Jennifer; Koerner, Ines; Sheldahl, Laird C.; Hurn, Patricia D.; Martínez-Murillo, Francisco; Alkayed, Nabil J.

    2006-09-01

    Estrogen reduces brain injury after experimental cerebral ischemia in part through a genomic mechanism of action. Using DNA microarrays, we analyzed the genomic response of the brain to estradiol, and we identified a transcript, cocaine- and amphetamine-regulated transcript (CART), that is highly induced in the cerebral cortex by estradiol under ischemic conditions. Using in vitro and in vivo models of neural injury, we confirmed and characterized CART mRNA and protein up-regulation by estradiol in surviving neurons, and we demonstrated that i.v. administration of a rat CART peptide is protective against ischemic brain injury in vivo. We further demonstrated binding of cAMP response element (CRE)-binding protein to a CART promoter CRE site in ischemic brain and rapid activation by CART of ERK in primary cultured cortical neurons. The findings suggest that CART is an important player in estrogen-mediated neuroprotection and a potential therapeutic agent for stroke and other neurodegenerative diseases. ischemia | stroke | estrogen

  9. PPARγ isoforms differentially regulate metabolic networks to mediate mouse prostatic epithelial differentiation.

    Science.gov (United States)

    Strand, D W; Jiang, M; Murphy, T A; Yi, Y; Konvinse, K C; Franco, O E; Wang, Y; Young, J D; Hayward, S W

    2012-08-09

    Recent observations indicate prostatic diseases are comorbidities of systemic metabolic dysfunction. These discoveries revealed fundamental questions regarding the nature of prostate metabolism. We previously showed that prostate-specific ablation of PPARγ in mice resulted in tumorigenesis and active autophagy. Here, we demonstrate control of overlapping and distinct aspects of prostate epithelial metabolism by ectopic expression of individual PPARγ isoforms in PPARγ knockout prostate epithelial cells. Expression and activation of either PPARγ 1 or 2 reduced de novo lipogenesis and oxidative stress and mediated a switch from glucose to fatty acid oxidation through regulation of genes including Pdk4, Fabp4, Lpl, Acot1 and Cd36. Differential effects of PPARγ isoforms included decreased basal cell differentiation, Scd1 expression and triglyceride fatty acid desaturation and increased tumorigenicity by PPARγ1. In contrast, PPARγ2 expression significantly increased basal cell differentiation, Scd1 expression and AR expression and responsiveness. Finally, in confirmation of in vitro data, a PPARγ agonist versus high-fat diet (HFD) regimen in vivo confirmed that PPARγ agonization increased prostatic differentiation markers, whereas HFD downregulated PPARγ-regulated genes and decreased prostate differentiation. These data provide a rationale for pursuing a fundamental metabolic understanding of changes to glucose and fatty acid metabolism in benign and malignant prostatic diseases associated with systemic metabolic stress.

  10. "Does anger regulation mediate the discrimination-mental health link among Mexican-origin adolescents? A longitudinal mediation analysis using multilevel modeling": Correction to Park et al. (2016).

    Science.gov (United States)

    2017-02-01

    Reports an error in "Does Anger Regulation Mediate the Discrimination-Mental Health Link Among Mexican-Origin Adolescents? A Longitudinal Mediation Analysis Using Multilevel Modeling" by Irene J. K. Park, Lijuan Wang, David R. Williams and Margarita Alegría ( Developmental Psychology , Advanced Online Publication, Nov 28, 2016, np). In the article, there were several typographical errors in the Recruitment and Procedures section. The percentage of mothers who responded to survey items should have been 99.3%. Additionally, the youths surveyed at T2 and T3 should have been n=246 . Accordingly, the percentage of youths surveyed in T2 and T3 should have been 91.4% and the percentage of mothers surveyed at T2 and T3 should have been 90.7%. Finally, the youths missing at T2 should have been n= 23, and therefore the attrition rate for youth participants should have been 8.6. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2016-57671-001.) Although prior research has consistently documented the association between racial/ethnic discrimination and poor mental health outcomes, the mechanisms that underlie this link are still unclear. The present 3-wave longitudinal study tested the mediating role of anger regulation in the discrimination-mental health link among 269 Mexican-origin adolescents ( M age = 14.1 years, SD = 1.6; 57% girls), 12 to 17 years old. Three competing anger regulation variables were tested as potential mediators: outward anger expression, anger suppression, and anger control. Longitudinal mediation analyses were conducted using multilevel modeling that disaggregated within-person effects from between-person effects. Results indicated that outward anger expression was a significant mediator; anger suppression and anger control were not significant mediators. Within a given individual, greater racial/ethnic discrimination was associated with more frequent outward anger expression. In turn

  11. FOG-2 mediated recruitment of the NuRD complex regulates cardiomyocyte proliferation during heart development.

    Science.gov (United States)

    Garnatz, Audrey S; Gao, Zhiguang; Broman, Michael; Martens, Spencer; Earley, Judy U; Svensson, Eric C

    2014-11-01

    FOG-2 is a multi-zinc finger protein that binds the transcriptional activator GATA4 and modulates GATA4-mediated regulation of target genes during heart development. Our previous work has demonstrated that the Nucleosome Remodeling and Deacetylase (NuRD) complex physically interacts with FOG-2 and is necessary for FOG-2 mediated repression of GATA4 activity in vitro. However, the relevance of this interaction for FOG-2 function in vivo has remained unclear. In this report, we demonstrate the importance of FOG-2/NuRD interaction through the generation and characterization of mice homozygous for a mutation in FOG-2 that disrupts NuRD binding (FOG-2(R3K5A)). These mice exhibit a perinatal lethality and have multiple cardiac malformations, including ventricular and atrial septal defects and a thin ventricular myocardium. To investigate the etiology of the thin myocardium, we measured the rate of cardiomyocyte proliferation in wild-type and FOG-2(R3K5A) developing hearts. We found cardiomyocyte proliferation was reduced by 31±8% in FOG-2(R3K5A) mice. Gene expression analysis indicated that the cell cycle inhibitor Cdkn1a (p21(cip1)) is up-regulated 2.0±0.2-fold in FOG-2(R3K5A) hearts. In addition, we demonstrate that FOG-2 can directly repress the activity of the Cdkn1a gene promoter, suggesting a model by which FOG-2/NuRD promotes ventricular wall thickening by repression of this cell cycle inhibitor. Consistent with this notion, the genetic ablation of Cdkn1a in FOG-2(R3K5A) mice leads to an improvement in left ventricular function and a partial rescue of left ventricular wall thickness. Taken together, our results define a novel mechanism in which FOG-2/NuRD interaction is required for cardiomyocyte proliferation by directly down-regulating the cell cycle inhibitor Cdkn1a during heart development. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Transcription factor RBP-J-mediated signalling regulates basophil immunoregulatory function in mouse asthma model.

    Science.gov (United States)

    Qu, Shuo-Yao; He, Ya-Long; Zhang, Jian; Wu, Chang-Gui

    2017-09-01

    Basophils (BA) play an important role in the promotion of aberrant T helper type 2 (Th2) immune responses in asthma. It is not only the effective cell, but also modulates the initiation of Th2 immune responses. We earlier demonstrated that Notch signalling regulates the biological function of BAin vitro. However, whether this pathway plays the same role in vivo is not clear. The purpose of the present study was to investigate the effect of Notch signalling on BA function in the regulation of allergic airway inflammation in a murine model of asthma. Bone marrow BA were prepared by bone marrow cell culture in the presence of recombinant interleukin-3 (rIL-3; 300 pg/ml) for 7 days, followed by isolation of the CD49b + microbeads. The recombination signal binding protein J (RBP-J -/- ) BA were co-cultured with T cells, and the supernatant and the T-cell subtypes were examined. The results indicated disruption of the capacity of BA for antigen presentation alongside an up-regulation of the immunoregulatory function. This was possibly due to the low expression of OX40L in the RBP-J -/- BA. Basophils were adoptively transferred to ovalbumin-sensitized recipient mice, to establish an asthma model. Lung pathology, cytokine profiles of brobchoalveolar fluid, airway hyperactivity and the absolute number of Th1/Th2 cells in lungs were determined. Overall, our results indicate that the RBP-J-mediated Notch signalling is critical for BA-dependent immunoregulation. Deficiency of RBP-J influences the immunoregulatory functions of BA, which include activation of T cells and their differentiation into T helper cell subtypes. The Notch signalling pathway is a potential therapeutic target for BA-based immunotherapy against asthma. © 2017 John Wiley & Sons Ltd.

  13. Tyrosine kinase chromosomal translocations mediate distinct and overlapping gene regulation events

    International Nuclear Information System (INIS)

    Kim, Hani; Gillis, Lisa C; Jarvis, Jordan D; Yang, Stuart; Huang, Kai; Der, Sandy; Barber, Dwayne L

    2011-01-01

    Leukemia is a heterogeneous disease commonly associated with recurrent chromosomal translocations that involve tyrosine kinases including BCR-ABL, TEL-PDGFRB and TEL-JAK2. Most studies on the activated tyrosine kinases have focused on proximal signaling events, but little is known about gene transcription regulated by these fusions. Oligonucleotide microarray was performed to compare mRNA changes attributable to BCR-ABL, TEL-PDGFRB and TEL-JAK2 after 1 week of activation of each fusion in Ba/F3 cell lines. Imatinib was used to control the activation of BCR-ABL and TEL-PDGFRB, and TEL-JAK2-mediated gene expression was examined 1 week after Ba/F3-TEL-JAK2 cells were switched to factor-independent conditions. Microarray analysis revealed between 800 to 2000 genes induced or suppressed by two-fold or greater by each tyrosine kinase, with a subset of these genes commonly induced or suppressed among the three fusions. Validation by Quantitative PCR confirmed that eight genes (Dok2, Mrvi1, Isg20, Id1, gp49b, Cxcl10, Scinderin, and collagen Vα1(Col5a1)) displayed an overlapping regulation among the three tested fusion proteins. Stat1 and Gbp1 were induced uniquely by TEL-PDGFRB. Our results suggest that BCR-ABL, TEL-PDGFRB and TEL-JAK2 regulate distinct and overlapping gene transcription profiles. Many of the genes identified are known to be involved in processes associated with leukemogenesis, including cell migration, proliferation and differentiation. This study offers the basis for further work that could lead to an understanding of the specificity of diseases caused by these three chromosomal translocations

  14. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

    2010-01-01

    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  15. Lack of Csk-mediated negative regulation in a unicellular SRC kinase.

    Science.gov (United States)

    Schultheiss, Kira P; Suga, Hiroshi; Ruiz-Trillo, Iñaki; Miller, W Todd

    2012-10-16

    Phosphotyrosine-based signaling plays a vital role in cellular communication in multicellular organisms. Unexpectedly, unicellular choanoflagellates (the closest phylogenetic group to metazoans) possess numbers of tyrosine kinases that are comparable to those in complex metazoans. Here, we have characterized tyrosine kinases from the filasterean Capsaspora owczarzaki, a unicellular protist representing the sister group to choanoflagellates and metazoans. Two Src-like tyrosine kinases have been identified in C. owczarzaki (CoSrc1 and CoSrc2), both of which have the arrangement of SH3, SH2, and catalytic domains seen in mammalian Src kinases. In Capsaspora cells, CoSrc1 and CoSrc2 localize to punctate structures in filopodia that may represent primordial focal adhesions. We have cloned, expressed, and purified both enzymes. CoSrc1 and CoSrc2 are active tyrosine kinases. Mammalian Src kinases are normally regulated in a reciprocal fashion by autophosphorylation in the activation loop (which increases activity) and by Csk-mediated phosphorylation of the C-terminal tail (which inhibits activity). Similar to mammalian Src kinases, the enzymatic activities of CoSrc1 and CoSrc2 are increased by autophosphorylation in the activation loop. We have identified a Csk-like kinase (CoCsk) in the genome of C. owczarzaki. We cloned, expressed, and purified CoCsk and found that it has no measurable tyrosine kinase activity. Furthermore, CoCsk does not phosphorylate or regulate CoSrc1 or CoSrc2 in cells or in vitro, and CoSrc1 and CoSrc2 are active in Capsaspora cell lysates. Thus, the function of Csk as a negative regulator of Src family kinases appears to have arisen with the emergence of metazoans.

  16. Adaptive emotion regulation mediates the relationship between self-compassion and depression in individuals with unipolar depression.

    Science.gov (United States)

    Diedrich, Alice; Burger, Julian; Kirchner, Mareike; Berking, Matthias

    2017-09-01

    To identify the mechanisms involved in the association between self-compassion and depression, we examined whether adaptive emotion regulation would mediate the relationship between self-compassion and depression in individuals with unipolar depression. Furthermore, we explored which specific emotion regulation skills would be most important in this relationship. Sixty-nine individuals with unipolar depression were assessed with the Self-Compassion Scale and the Emotion Regulation Skills Questionnaire at baseline and with the Beck Depression Inventory-II 1 week later. The results showed that successful application of emotion regulation skills mediates the association between self-compassion and depression. Among eight specific emotion regulation skills, only the ability to tolerate negative emotions was identified as a significant mediator in the self-compassion-depression relationship. These findings provide preliminary evidence that systematically fostering self-compassion might help depressed individuals cope with their symptoms by enhancing their abilities to tolerate undesired emotions. Systematically fostering self-compassion through specific compassion-focused interventions might facilitate a reduction in depressive symptoms by improving the person's emotion regulation abilities, especially by improving his or her ability to tolerate negative emotions. Hence, compassion-focused interventions might be particularly promising in depressed patients with a tendency to avoid negative emotions and deficits in tolerating them. © 2016 The British Psychological Society.

  17. Suppression of Mediator is regulated by Cdk8-dependent Grr1 turnover of the Med3 coactivator.

    Science.gov (United States)

    Gonzalez, Deyarina; Hamidi, Nurul; Del Sol, Ricardo; Benschop, Joris J; Nancy, Thomas; Li, Chao; Francis, Lewis; Tzouros, Manuel; Krijgsveld, Jeroen; Holstege, Frank C P; Conlan, R Steven

    2014-02-18

    Mediator, an evolutionary conserved large multisubunit protein complex with a central role in regulating RNA polymerase II-transcribed genes, serves as a molecular switchboard at the interface between DNA binding transcription factors and the general transcription machinery. Mediator subunits include the Cdk8 module, which has both positive and negative effects on activator-dependent transcription through the activity of the cyclin-dependent kinase Cdk8, and the tail module, which is required for positive and negative regulation of transcription, correct preinitiation complex formation in basal and activated transcription, and Mediator recruitment. Currently, the molecular mechanisms governing Mediator function remain largely undefined. Here we demonstrate an autoregulatory mechanism used by Mediator to repress transcription through the activity of distinct components of different modules. We show that the function of the tail module component Med3, which is required for transcription activation, is suppressed by the kinase activity of the Cdk8 module. Med3 interacts with, and is phosphorylated by, Cdk8; site-specific phosphorylation triggers interaction with and degradation by the Grr1 ubiquitin ligase, thereby preventing transcription activation. This active repression mechanism involving Grr1-dependent ubiquitination of Med3 offers a rationale for the substoichiometric levels of the tail module that are found in purified Mediator and the corresponding increase in tail components seen in cdk8 mutants.

  18. SEPTIN2 and STATHMIN Regulate CD99-Mediated Cellular Differentiation in Hodgkin's Lymphoma.

    Directory of Open Access Journals (Sweden)

    Wenjing Jian

    Full Text Available Hodgkin's lymphoma (HL is a lymphoid neoplasm characterized by Hodgkin's and Reed-Sternberg (H/RS cells, which is regulated by CD99. We previously reported that CD99 downregulation led to the transformation of murine B lymphoma cells (A20 into cells with an H/RS phenotype, while CD99 upregulation induced differentiation of classical Hodgkin's lymphoma (cHL cells (L428 into terminal B-cells. However, the molecular mechanism remains unclear. In this study, using fluorescence two-dimensional differential in-gel electrophoresis and matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS, we have analyzed the alteration of protein expression following CD99 upregulation in L428 cells as well as downregulation of mouse CD99 antigen-like 2 (mCD99L2 in A20 cells. Bioinformatics analysis showed that SEPTIN2 and STATHMIN, which are cytoskeleton proteins, were significantly differentially expressed, and chosen for further validation and functional analysis. Differential expression of SEPTIN2 was found in both models and was inversely correlated with CD99 expression. STATHMIN was identified in the A20 cell line model and its expression was positively correlated with that of CD99. Importantly, silencing of SEPTIN2 with siRNA substantially altered the cellular cytoskeleton in L428 cells. The downregulation of STATHMIN by siRNA promoted the differentiation of H/RS cells toward terminal B-cells. These results suggest that SEPTIN2-mediated cytoskeletal rearrangement and STATHMIN-mediated differentiation may contribute to changes in cell morphology and differentiation of H/RS cells with CD99 upregulation in HL.

  19. The Mediation Role of Intrinsic and Extrinsic Motivation in the Relationship between Creative Educational Environment and Metacognitive Self-Regulation

    Science.gov (United States)

    Maralani, Farnaz Mehdipour

    2016-01-01

    This study investigated the mediation role of intrinsic and extrinsic motivation in the relationship between creative educational environment and metacognitive self-regulation. Participants were 300 girls, selected randomly from the girl hostel in university of Tehran. Participants completed Akoal's creative educational environment questionnaire,…

  20. Cumulative Risk and Adolescent's Internalizing and Externalizing Problems: The Mediating Roles of Maternal Responsiveness and Self-Regulation

    Science.gov (United States)

    Doan, Stacey N.; Fuller-Rowell, Thomas E.; Evans, Gary W.

    2012-01-01

    The purpose of the present study was to examine longitudinal associations among maternal responsiveness, self-regulation, and behavioral adjustment in adolescents. The authors used structural equation modeling to test a model that demonstrates that the effects of early cumulative risk on behavioral problems is mediated by maternal responsiveness…

  1. The Mediation Effects of Dysfunctional Beliefs and Emotional Regulation on Children's Perceived Parental Conflict and Internalizing and Externalizing Problems

    Science.gov (United States)

    Lee, Ji-yeon; Wesbecher, Kristen; Lee, Mihwa; Lee, Jeeyon

    2015-01-01

    The purpose of this study was to examine the mediational effects of dysfunctional beliefs and difficulties in emotional regulation on children's perception of interparental conflict and subsequent internalizing and externalizing problems. The participants in this study were 335 fifth grade elementary school students in Korea. We hypothesized that…

  2. Links between Maternal and Child Psychopathology Symptoms: Mediation through Child Emotion Regulation and Moderation through Maternal Behavior

    Science.gov (United States)

    Suveg, Cynthia; Shaffer, Anne; Morelen, Diana; Thomassin, Kristel

    2011-01-01

    This study examined the intergenerational transmission of psychopathology symptoms with 7-12 year-old children (N = 97; 44 boys, 53 girls, M age = 9.14, SD = 1.38) and their mothers (M age = 38.46, SD = 6.86). Child emotion regulation mediated the links between maternal psychopathology and child internalizing and externalizing symptoms. In turn,…

  3. Receptor-like kinases as surface regulators for RAC/ROP-mediated pollen tube growth and interaction with the pistil

    Science.gov (United States)

    Zou, Yanjiao; Aggarwal, Mini; Zheng, Wen-Guang; Wu, Hen-Ming; Cheung, Alice Y.

    2011-01-01

    Background RAC/ROPs are RHO-type GTPases and are known to play diverse signalling roles in plants. Cytoplasmic RAC/ROPs are recruited to the cell membrane and activated in response to extracellular signals perceived and mediated by cell surface-located signalling assemblies, transducing the signals to regulate cellular processes. More than any other cell types in plants, pollen tubes depend on continuous interactions with an extracellular environment produced by their surrounding tissues as they grow within the female organ pistil to deliver sperm to the female gametophyte for fertilization. Scope We review studies on pollen tube growth that provide compelling evidence indicating that RAC/ROPs are crucial for regulating the cellular processes that underlie the polarized cell growth process. Efforts to identify cell surface regulators that mediate extracellular signals also point to RAC/ROPs being the molecular switches targeted by growth-regulating female factors for modulation to mediate pollination and fertilization. We discuss a large volume of work spanning more than two decades on a family of pollen-specific receptor kinases and some recent studies on members of the FERONIA family of receptor-like kinases (RLKs). Significance The research described shows the crucial roles that two RLK families play in transducing signals from growth regulatory factors to the RAC/ROP switch at the pollen tube apex to mediate and target pollen tube growth to the female gametophyte and signal its disintegration to achieve fertilization once inside the female chamber. PMID:22476487

  4. JMJD1C demethylates MDC1 to regulate the RNF8 and BRCA1-mediated chromatin response to DNA breaks

    DEFF Research Database (Denmark)

    Watanabe, Sugiko; Watanabe, Kenji; Akimov, Vyacheslav

    2013-01-01

    Chromatin ubiquitylation flanking DNA double-strand breaks (DSBs), mediated by RNF8 and RNF168 ubiquitin ligases, orchestrates a two-branch pathway, recruiting repair factors 53BP1 or the RAP80-BRCA1 complex. We report that human demethylase JMJD1C regulates the RAP80-BRCA1 branch of this DNA...

  5. The self-regulation of motivation: Motivational strategies as mediator between motivational beliefs and engagement for learning.

    NARCIS (Netherlands)

    Smit, Karin; De Brabander, Cornelis; Boekaerts, Monique; Martens, Rob

    2017-01-01

    In this research we studied students´ motivational self-regulation as mediator between motivational beliefs and motivational outcomes. Dutch students in pre-vocational secondary education (N=3602, mean age 14) completed a questionnaire on five motivational strategies (Environmental Control,

  6. Protective behavioral strategies as a mediator and moderator of the relationship between self-regulation and alcohol-related consequences in first-year college students.

    Science.gov (United States)

    D'Lima, Gabrielle Maria; Pearson, Matthew R; Kelley, Michelle L

    2012-06-01

    This study examined protective behavioral strategies (PBS) as a potential mediator and moderator of the relationship between self-regulation and alcohol-related consequences. Participants were 249 first-year undergraduate men and women. The use of PBS partially mediated the relationship between self-regulation and alcohol-related problems (i.e., supporting the "self-control equals drinking control" hypothesis). However, use of PBS appeared more important for those with poorer self-regulation abilities (supporting the "PBS protect the impaired" hypothesis). Because both mediation and moderation were supported, a moderated mediation model was tested. The moderated mediation model demonstrated that the negative relationship between self-regulation and alcohol-related consequences could be explained by use of PBS for individuals with poor-to-average self-regulation but not for individuals with above-average, self-regulation abilities. Implications of the study's findings are discussed.

  7. Drosophila MOF regulates DIAP1 and induces apoptosis in a JNK dependent pathway.

    Science.gov (United States)

    Pushpavalli, Sreerangam N C V L; Sarkar, Arpita; Ramaiah, M Janaki; Koteswara Rao, G; Bag, Indira; Bhadra, Utpal; Pal-Bhadra, Manika

    2016-03-01

    Histone modulations have been implicated in various cellular and developmental processes where in Drosophila Mof is involved in acetylation of H4K16. Reduction in the size of larval imaginal discs is observed in the null mutants of mof with increased apoptosis. Deficiency involving Hid, Reaper and Grim [H99] alleviated mof (RNAi) induced apoptosis in the eye discs. mof (RNAi) induced apoptosis leads to activation of caspases which is suppressed by over expression of caspase inhibitors like P35 and Diap1 clearly depicting the role of caspases in programmed cell death. Also apoptosis induced by knockdown of mof is rescued by JNK mutants of bsk and tak1 indicating the role of JNK in mof (RNAi) induced apoptosis. The adult eye ablation phenotype produced by ectopic expression of Hid, Rpr and Grim, was restored by over expression of Mof. Accumulation of Mof at the Diap1 promoter 800 bp upstream of the transcription start site in wild type larvae is significantly higher (up to twofolds) compared to mof (1) mutants. This enrichment coincides with modification of histone H4K16Ac indicating an induction of direct transcriptional up regulation of Diap1 by Mof. Based on these results we propose that apoptosis triggered by mof (RNAi) proceeds through a caspase-dependent and JNK mediated pathway.

  8. Extracellular calmodulin regulates growth and cAMP-mediated chemotaxis in Dictyostelium discoideum

    International Nuclear Information System (INIS)

    O’Day, Danton H.; Huber, Robert J.; Suarez, Andres

    2012-01-01

    Highlights: ► Extracellular calmodulin is present throughout growth and development in Dictyostelium. ► Extracellular calmodulin localizes within the ECM during development. ► Extracellular calmodulin inhibits cell proliferation and increases chemotaxis. ► Extracellular calmodulin exists in eukaryotic microbes. ► Extracellular calmodulin may be functionally as important as intracellular calmodulin. -- Abstract: The existence of extracellular calmodulin (CaM) has had a long and controversial history. CaM is a ubiquitous calcium-binding protein that has been found in every eukaryotic cell system. Calcium-free apo-CaM and Ca 2+ /CaM exert their effects by binding to and regulating the activity of CaM-binding proteins (CaMBPs). Most of the research done to date on CaM and its CaMBPs has focused on their intracellular functions. The presence of extracellular CaM is well established in a number of plants where it functions in proliferation, cell wall regeneration, gene regulation and germination. While CaM has been detected extracellularly in several animal species, including frog, rat, rabbit and human, its extracellular localization and functions are less well established. In contrast the study of extracellular CaM in eukaryotic microbes remains to be done. Here we show that CaM is constitutively expressed and secreted throughout asexual development in Dictyostelium where the presence of extracellular CaM dose-dependently inhibits cell proliferation but increases cAMP mediated chemotaxis. During development, extracellular CaM localizes within the slime sheath where it coexists with at least one CaMBP, the matricellular CaM-binding protein CyrA. Coupled with previous research, this work provides direct evidence for the existence of extracellular CaM in the Dictyostelium and provides insight into its functions in this model amoebozoan.

  9. Glucocorticoid mediated regulation of inflammation in human monocytes is associated with depressive mood and obesity.

    Science.gov (United States)

    Cheng, Tiefu; Dimitrov, Stoyan; Pruitt, Christopher; Hong, Suzi

    2016-04-01

    Dysregulation of the hypothalamic-pituitary-adrenal (HPA) axis is observed in various conditions, including depression and obesity, which are also often related. Glucocorticoid (GC) resistance and desensitization of peripheral GC receptors (GRs) are often the case in HPA dysregulation seen in depression, and GC plays a critical role in regulation of inflammation. Given the growing evidence that inflammation is a central feature of some depression cases and obesity, we aimed to investigate the immune-regulatory role of GC-GR in relation to depressive mood and obesity in 35 healthy men and women. Depressive mood and level of obesity were assessed, using Beck Depression Inventory (BDI-Ia) and body mass index (BMI), respectively. We measured plasma cortisol levels via enzyme-linked immunosorbent assay and lipopolysaccharide-stimulated intracellular tumor necrosis factor (TNF) production by monocytes, using flow cytometry. Cortisol sensitivity was determined by the difference in monocytic TNF production between the conditions of 1 and 0 μM cortisol incubation ("cortisol-mediated inflammation regulation, CoMIR"). GR vs. mineralocorticoid receptor (MR) antagonism for CoMIR was examined by using mifepristone and spironolactone. A series of multiple regression analyses were performed to investigate independent contribution of depressive mood vs. obesity after controlling for age, gender, systolic blood pressure (SBP), and plasma cortisol in predicting CoMIR. CoMIR was explained by somatic subcomponents of depressive mood (BDI-S: β=-0.499, p=0.001), or BMI (β=-0.466, pcortisol dose (1 μM). There was initial indication that greater obesity and somatic depressive symptoms were associated with smaller efficacy of the blockers, which warrants further investigation. Our findings, although in a preclinical sample, signify the shared pathophysiology of immune dysregulation in depression and obesity and warrant further mechanistic investigation. Published by Elsevier Ltd.

  10. PKC and Rab13 mediate Ca2+ signal-regulated GLUT4 traffic.

    Science.gov (United States)

    Deng, Bangli; Zhu, Xiaocui; Zhao, Yihe; Zhang, Da; Pannu, Alisha; Chen, Liming; Niu, Wenyan

    2018-01-08

    Exercise/muscle contraction increases cell surface glucose transporter 4 (GLUT4), leading to glucose uptake to regulate blood glucose level. Elevating cytosolic Ca 2+ mediates this effect, but the detailed mechanism is not clear yet. We used calcium ionophore ionomycin to raise intracellular cytosolic Ca 2+ level to explore the underlying mechanism. We showed that in L6 myoblast muscle cells stably expressing GLUT4myc, ionomycin increased cell surface GLUT4myc levels and the phosphorylation of AS160, TBC1D1. siPKCα and siPKCθ but not siPKCδ and siPKCε inhibited the ionomycin-increased cell surface GLUT4myc level. siPKCα, siPKCθ inhibited the phosphorylation of AS160 and TBC1D1 induced by ionomycin. siPKCα and siPKCθ prevented ionomycin-inhibited endocytosis of GLUT4myc. siPKCθ, but not siPKCα inhibited ionomycin-stimulated exocytosis of GLUT4myc. siRab13 but not siRab8a, siRab10 and siRab14 inhibited the exocytosis of GLUT4myc promoted by ionomycin. In summary, ionomycin-promoted exocytosis of GLUT4 is partly reversed by siPKCθ, whereas ionomycin-inhibited endocytosis of GLUT4 requires both siPKCα and siPKCθ. PKCα and PKCθ contribute to ionomycin-induced phosphorylation of AS160 and TBC1D1. Rab13 is required for ionomycin-regulated GLUT4 exocytosis. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. GlnR-mediated regulation of nitrogen metabolism in the actinomycete Saccharopolyspora erythraea.

    Science.gov (United States)

    Yao, Li-Li; Liao, Cheng-Heng; Huang, Gang; Zhou, Ying; Rigali, Sebastien; Zhang, Buchang; Ye, Bang-Ce

    2014-09-01

    Nitrogen source sensing, uptake, and assimilation are central for growth and development of microorganisms which requires the participation of a global control of nitrogen metabolism-associated genes at the transcriptional level. In soil-dwelling antibiotic-producing actinomycetes, this role is played by GlnR, an OmpR family regulator. In this work, we demonstrate that SACE_7101 is the ortholog of actinomycetes' GlnR global regulators in the erythromycin producer Saccharopolyspora erythraea. Indeed, the chromosomal deletion of SACE_7101 severely affects the viability of S. erythraea when inoculated in minimal media supplemented with NaNO3, NaNO2, NH4Cl, glutamine, or glutamate as sole nitrogen source. Combination of in silico prediction of cis-acting elements, subsequent in vitro (through gel shift assays) and in vivo (real-time reverse transcription polymerase chain reaction) validations of the predicted target genes revealed a very large GlnR regulon aimed at adapting the nitrogen metabolism of S. erythraea. Indeed, enzymes/proteins involved in (i) uptake and assimilation of ammonium, (ii) transport and utilization of urea, (iii) nitrite/nitrate, (iv) glutamate/glutamine, (v) arginine metabolism, (vi) nitric oxide biosynthesis, and (vii) signal transduction associated with the nitrogen source supplied have at least one paralog gene which expression is controlled by GlnR. Our work highlights a GlnR-binding site consensus sequence (t/gna/cAC-n6-GaAAc) which is similar although not identical to the consensus sequences proposed for other actinomycetes. Finally, we discuss the distinct and common features of the GlnR-mediated transcriptional control of nitrogen metabolism between S. erythraea and the model organism Streptomyces coelicolor.

  12. Cumulative childhood trauma and psychological maladjustment of sexually abused children in Korea: mediating effects of emotion regulation.

    Science.gov (United States)

    Choi, Ji Young; Oh, Kyung Ja

    2014-02-01

    The purpose of the present study was to identify the mediating effects of emotion regulation on the association between cumulative childhood trauma and behavior problems in sexually abused children in Korea, using structural equation modeling (SEM). Data were collected on 171 children (ages 6-13 years) referred to a public counseling center for sexual abuse in Seoul, Korea. Cumulative childhood traumas were defined on the basis of number of traumas (physical abuse, witnessing domestic violence, neglect, traumatic separation from parent, and sexual abuse) and the severity and duration of traumas. Children were evaluated by their parents on emotion regulation using the Emotion Regulation Checklist and internalizing and externalizing behavior problems using the Korean-Child Behavior Checklist. SEM analyses confirmed the complete mediation model, in which emotion dysregulation fully mediates the relationship between cumulative childhood traumas and internalizing/externalizing behavior problems. These findings indicate that emotion regulation is an important mechanism that can explain the negative effects of cumulative childhood traumas and that there is a need to focus on emotion regulation in sexually abused children exposed to cumulative trauma. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Using therapeutic jurisprudence and preventive law to examine disputants' best interests in mediating cases about physicians' practices: a guide for medical regulators.

    Science.gov (United States)

    Ferris, Lorraine E

    2004-01-01

    Therapeutic jurisprudence (TJ) and preventive law (PL) are used as two theoretical perspectives from which to examine the best interests of parties in mediation because of a dispute about a physician's practice. The focus is mediation provided by and/or for the medical regulator. The paper reviews the literature on TJ and PL, and their relationship to mediation, and demonstrates how medical regulators could benefit by working within a framework reflecting both these perspectives providing it does not involve an egregious matter. A TJ and PL framework would be of particular value in identifying cases for mediation and in evaluating resolutions to mediated disputes.

  14. Adhesion Regulating Molecule 1 Mediates HAP40 Overexpression-Induced Mitochondrial Defects

    Science.gov (United States)

    Huang, Zih-Ning; Chung, Her Min; Fang, Su-Chiung; Her, Lu-Shiun

    2017-01-01

    Striatal neuron death in Huntington's disease is associated with abnormal mitochondrial dynamics and functions. However, the mechanisms for this mitochondrial dysregulation remain elusive. Increased accumulation of Huntingtin-associated protein 40 (HAP40) has been shown to be associated with Huntington's disease. However, the link between increased HAP40 and Huntington's disease remains largely unknown. Here we show that HAP40 overexpression causes mitochondrial dysfunction and reduces cell viability in the immortalized mouse striatal neurons. HAP40-associated mitochondrial dysfunction is associated with reduction of adhesion regulating molecule 1 (ADRM1) protein. Consistently, depletion of ADRM1 by shRNAs impaired mitochondrial functions and increased mitochondrial fragmentation in mouse striatal cells. Moreover, reducing ADRM1 levels enhanced activity of fission factor dynamin-related GTPase protein 1 (Drp1) via increased phosphorylation at serine 616 of Drp1 (Drp1Ser616). Restoring ADRM1 protein levels was able to reduce HAP40-induced ROS levels and mitochondrial fragmentation and improved mitochondrial functions and cell viability. Moreover, reducing Drp1 activity by Drp1 inhibitor, Mdivi-1, ameliorates both HAP40 overexpression- and ADRM1 depletion-induced mitochondrial dysfunction. Taken together, our studies suggest that HAP40-mediated reduction of ADRM1 alters the mitochondrial fission activity and results in mitochondrial fragmentation and mitochondrial dysfunction. PMID:29209146

  15. Regulation of dynein-mediated autophagosomes trafficking by ASM in CASMCs.

    Science.gov (United States)

    Xu, Ming; Zhang, Qiufang; Li, Pin-Lan; Nguyen, Thaison; Li, Xiang; Zhang, Yang

    2016-01-01

    Acid sphingomyelinase (ASM; gene symbol Smpd1) has been shown to play a crucial role in autophagy maturation by controlling lysosomal fusion with autophagosomes in coronary arterial smooth muscle cells (CASMCs). However, the underlying molecular mechanism by which ASM controls autophagolysosomal fusion remains unknown. In primary cultured CASMCs, lysosomal Ca2+ induced by 7-ketocholesterol (7-Ket, an atherogenic stimulus and autophagy inducer) was markedly attenuated by ASM deficiency or TRPML1 gene silencing suggesting that ASM signaling is required for TRPML1 channel activity and subsequent lysosomal Ca(2+) release. In these CASMCs, ASM deficiency or TRPML1 gene silencing markedly inhibited 7-Ket-induced dynein activation. In addition, 7-Ket-induced autophagosome trafficking, an event associated with lysosomal Ca(2+) release and dynein activity, was significantly inhibited in ASM-deficient (Smpd1(-/-)) CASMCs compared to that in Smpd1(+/+) CASMCs. Finally, overexpression of TRPML1 proteins restored 7-Ket-induced lysosomal Ca(2+) release and autophagosome trafficking in Smpd1-/- CASMCs. Collectively, these results suggest that ASM plays a critical role in regulating lysosomal TRPML1-Ca(2+) signaling and subsequent dynein-mediated autophagosome trafficking, which leads its role in controlling autophagy maturation in CASMCs under atherogenic stimulation.

  16. ABI3 mediates dehydration stress recovery response in Arabidopsis thaliana by regulating expression of downstream genes.

    Science.gov (United States)

    Bedi, Sonia; Sengupta, Sourabh; Ray, Anagh; Nag Chaudhuri, Ronita

    2016-09-01

    ABI3, originally discovered as a seed-specific transcription factor is now implicated to act beyond seed physiology, especially during abiotic stress. In non-seed plants, ABI3 is known to act in desiccation stress signaling. Here we show that ABI3 plays a role in dehydration stress response in Arabidopsis. ABI3 gene was upregulated during dehydration stress and its expression was maintained during subsequent stress recovery phases. Comparative gene expression studies in response to dehydration stress and stress recovery were done with genes which had potential ABI3 binding sites in their upstream regulatory regions. Such studies showed that several genes including known seed-specific factors like CRUCIFERIN1, CRUCIFERIN3 and LEA-group of genes like LEA76, LEA6, DEHYDRIN LEA and LEA-LIKE got upregulated in an ABI3-dependent manner, especially during the stress recovery phase. ABI3 got recruited to regions upstream to the transcription start site of these genes during dehydration stress response through direct or indirect DNA binding. Interestingly, ABI3 also binds to its own promoter region during such stress signaling. Nucleosomes covering potential ABI3 binding sites in the upstream sequences of the above-mentioned genes alter positions, and show increased H3 K9 acetylation during stress-induced transcription. ABI3 thus mediates dehydration stress signaling in Arabidopsis through regulation of a group of genes that play a role primarily during stress recovery phase. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  17. TET proteins regulate the lineage specification and TCR-mediated expansion of iNKT cells.

    Science.gov (United States)

    Tsagaratou, Ageliki; González-Avalos, Edahí; Rautio, Sini; Scott-Browne, James P; Togher, Susan; Pastor, William A; Rothenberg, Ellen V; Chavez, Lukas; Lähdesmäki, Harri; Rao, Anjana

    2017-01-01

    TET proteins oxidize 5-methylcytosine in DNA to 5-hydroxymethylcytosine and other oxidation products. We found that simultaneous deletion of Tet2 and Tet3 in mouse CD4 + CD8 + double-positive thymocytes resulted in dysregulated development and proliferation of invariant natural killer T cells (iNKT cells). Tet2-Tet3 double-knockout (DKO) iNKT cells displayed pronounced skewing toward the NKT17 lineage, with increased DNA methylation and impaired expression of genes encoding the key lineage-specifying factors T-bet and ThPOK. Transfer of purified Tet2-Tet3 DKO iNKT cells into immunocompetent recipient mice resulted in an uncontrolled expansion that was dependent on the nonclassical major histocompatibility complex (MHC) protein CD1d, which presents lipid antigens to iNKT cells. Our data indicate that TET proteins regulate iNKT cell fate by ensuring their proper development and maturation and by suppressing aberrant proliferation mediated by the T cell antigen receptor (TCR).

  18. Transcription regulator TRIP-Br2 mediates ER stress-induced brown adipocytes dysfunction.

    Science.gov (United States)

    Qiang, Guifen; Whang Kong, Hyerim; Gil, Victoria; Liew, Chong Wee

    2017-01-09

    In contrast to white adipose tissue, brown adipose tissue (BAT) is known to play critical roles for both basal and inducible energy expenditure. Obesity is associated with reduction of BAT function; however, it is not well understood how obesity promotes BAT dysfunction, especially at the molecular level. Here we show that the transcription regulator TRIP-Br2 mediates ER stress-induced inhibition of lipolysis and thermogenesis in BAT. Using in vitro, ex vivo, and in vivo approaches, we demonstrate that obesity-induced inflammation upregulates brown adipocytes TRIP-Br2 expression via the ER stress pathway and amelioration of ER stress in mice completely abolishes high fat diet-induced upregulation of TRIP-Br2 in BAT. We find that increased TRIP-Br2 significantly inhibits brown adipocytes thermogenesis. Finally, we show that ablation of TRIP-Br2 ameliorates ER stress-induced inhibition on lipolysis, fatty acid oxidation, oxidative metabolism, and thermogenesis in brown adipocytes. Taken together, our current study demonstrates a role for TRIP-Br2 in ER stress-induced BAT dysfunction, and inhibiting TRIP-Br2 could be a potential approach for counteracting obesity-induced BAT dysfunction.

  19. NF-kappaB mediates FGF signal regulation of msx-1 expression.

    Science.gov (United States)

    Bushdid, P B; Chen, C L; Brantley, D M; Yull, F; Raghow, R; Kerr, L D; Barnett, J V

    2001-09-01

    The nuclear factor-kappaB (NF-kappaB) family of transcription factors is involved in proliferation, differentiation, and apoptosis in a stage- and cell-dependent manner. Recent evidence has shown that NF-kappaB activity is necessary for both chicken and mouse limb development. We report here that the NF-kappaB family member c-rel and the homeodomain gene msx-1 have partially overlapping expression patterns in the developing chick limb. In addition, inhibition of NF-kappaB activity resulted in a decrease in msx-1 mRNA expression. Sequence analysis of the msx-1 promoter revealed three potential kappaB-binding sites similar to the interferon-gamma (IFN-gamma) kappaB-binding site. These sites bound to c-Rel, as shown by electrophoretic mobility shift assay (EMSA). Furthermore, inhibition of NF-kappaB activity significantly reduced transactivation of the msx-1 promoter in response to FGF-2/-4, known stimulators of msx-1 expression. These results suggest that NF-kappaB mediates the FGF-2/-4 signal regulation of msx-1 gene expression. Copyright 2001 Academic Press.

  20. PKC α regulates netrin-1/UNC5B-mediated survival pathway in bladder cancer

    International Nuclear Information System (INIS)

    Liu, Jiao; Kong, Chui-ze; Gong, Da-xin; Zhang, Zhe; Zhu, Yu-yan

    2014-01-01

    Netrin-1 and its receptor UNC5B play important roles in angiogenesis, embryonic development, cancer and inflammation. However, their expression patttern and biological roles in bladder cancer have not been well characterized. The present study aims to investigating the clinical significance of PKC α, netrin-1 and UNC5B in bladder cancer as well as their association with malignant biological behavior of cancer cells. Netrin-1 and UNC5B expression was examined in 120 bladder cancer specimens using immunohistochemistry and in 40 fresh cancer tissues by western blot. Immunofluorescence was performed in cancer cell lines. PKC α agonist PMA and PKC siRNA was employed in bladder cancer cells. CCK-8, wound healing assays and flow cytometry analysis were used to examine cell proliferation, migration and cell cycle, respectively. Netrin-1 expression was positively correlated with histological grade, T stage, metastasis and poor prognosis in bladder cancer tissues. Immunofluorescence showed elevated netrin-1 and decreased UNC5B expression in bladder cancer cells compared with normal bladder cell line. Furthermore, cell proliferation, migration and cell cycle progression were promoted with PMA treatment while inhibited by calphostin C. In addition, PMA treatment could induce while calphostin C reduce netrin-1 expression in bladder cancer cells. The present study identified netrin-1/UNC5B, which could be regulated by PKC signaling, was important mediators of bladder cancer progression

  1. Ku proteins function as corepressors to regulate farnesoid X receptor-mediated gene expression

    International Nuclear Information System (INIS)

    Ohno, Masae; Kunimoto, Masaaki; Nishizuka, Makoto; Osada, Shigehiro; Imagawa, Masayoshi

    2009-01-01

    The farnesoid X receptor (FXR; NR1H4) is a member of the nuclear receptor superfamily and regulates the expression of genes involved in enterohepatic circulation and the metabolism of bile acids. Based on functional analyses, nuclear receptors are divided into regions A-F. To explore the cofactors interacting with FXR, we performed a pull-down assay using GST-fused to the N-terminal A/B region and the C region, which are required for the ligand-independent transactivation and DNA-binding, respectively, of FXR, and nuclear extracts from HeLa cells. We identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs), Ku80, and Ku70 as FXR associated factors. These proteins are known to have an important role in DNA repair, recombination, and transcription. DNA-PKcs mainly interacted with the A/B region of FXR, whereas the Ku proteins interacted with the C region and with the D region (hinge region). Chromatin immunoprecipitation assays revealed that the Ku proteins associated with FXR on the bile salt export pump (BSEP) promoter. Furthermore, we demonstrated that ectopic expression of the Ku proteins decreased the promoter activity and expression of BSEP gene mediated by FXR. These results suggest that the Ku proteins function as corepressors for FXR.

  2. PAX2 regulates ADAM10 expression and mediates anchorage-independent cell growth of melanoma cells.

    Directory of Open Access Journals (Sweden)

    Sophia Boyoung Lee

    Full Text Available PAX transcription factors play an important role during development and carcinogenesis. In this study, we investigated PAX2 protein levels in melanocytes and melanoma cells by Western Blot and immunofluorescence analysis and characterized the role of PAX2 in the pathogenesis of melanoma. In vitro we found weak PAX2 protein expression in keratinocytes and melanocytes. Compared to melanocytes increased PAX2 protein levels were detectable in melanoma cell lines. Interestingly, in tissue sections of melanoma patients nuclear PAX2 expression strongly correlated with nuclear atypia and the degree of prominent nucleoli, indicating an association of PAX2 with a more atypical cellular phenotype. In addition, with chromatin immunoprecipitation assay, PAX2 overexpression and PAX2 siRNA we present compelling evidence that PAX2 can regulate ADAM10 expression, a metalloproteinase known to play important roles in melanoma metastasis. In human tissue samples we found co-expression of PAX2 and ADAM10 in melanocytes of benign nevi and in melanoma cells of patients with malignant melanoma. Importantly, the downregulation of PAX2 by specific siRNA inhibited the anchorage independent cell growth and decreased the migratory and invasive capacity of melanoma cells. Furthermore, the downregulation of PAX2 abrogated the chemoresistance of melanoma cells against cisplatin, indicating that PAX2 expression mediates cell survival and plays important roles during melanoma progression.

  3. Cytosolic malate dehydrogenase regulates RANKL-mediated osteoclastogenesis via AMPK/c-Fos/NFATc1 signaling

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Se Jeong [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Gu, Dong Ryun [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Jin, Su Hyun [Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Park, Keun Ha [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Lee, Seoung Hoon, E-mail: leesh2@wku.ac.kr [Department of Oral Microbiology and Immunology, College of Dentistry, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Center for Metabolic Function Regulation (CMFR), School of Medicine, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of); Wonkwang Institute of Biomaterials and Implant, Wonkwang University, Iksan, Jeonbuk 54538 (Korea, Republic of)

    2016-06-17

    Cytosolic malate dehydrogenase (malate dehydrogenase 1, MDH1) plays pivotal roles in the malate/aspartate shuttle that might modulate metabolism between the cytosol and mitochondria. In this study, we investigated the role of MDH1 in osteoclast differentiation and formation. MDH1 expression was induced by receptor activator of nuclear factor kappa-B ligand (RANKL) treatment. Knockdown of MDH1 by infection with retrovirus containing MDH1-specific shRNA (shMDH1) reduced mature osteoclast formation and bone resorption activity. Moreover, the expression of marker genes associated with osteoclast differentiation was downregulated by shMDH1 treatment, suggesting a role of MDH1 in osteoclast differentiation. In addition, intracellular ATP production was reduced following the activation of adenosine 5′ monophosphate-activated protein kinase (AMPK), a cellular energy sensor and negative regulator of RANKL-induced osteoclast differentiation, in shMDH1-infected osteoclasts compared to control cells. In addition, the expression of c-Fos and nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1), a critical transcription factor of osteoclastogenesis, was decreased with MDH1 knockdown during RANKL-mediated osteoclast differentiation. These findings provide strong evidence that MDH1 plays a critical role in osteoclast differentiation and function via modulation of the intracellular energy status, which might affect AMPK activity and NFATc1 expression.

  4. Cytosolic malate dehydrogenase regulates RANKL-mediated osteoclastogenesis via AMPK/c-Fos/NFATc1 signaling

    International Nuclear Information System (INIS)

    Oh, Se Jeong; Gu, Dong Ryun; Jin, Su Hyun; Park, Keun Ha; Lee, Seoung Hoon

    2016-01-01

    Cytosolic malate dehydrogenase (malate dehydrogenase 1, MDH1) plays pivotal roles in the malate/aspartate shuttle that might modulate metabolism between the cytosol and mitochondria. In this study, we investigated the role of MDH1 in osteoclast differentiation and formation. MDH1 expression was induced by receptor activator of nuclear factor kappa-B ligand (RANKL) treatment. Knockdown of MDH1 by infection with retrovirus containing MDH1-specific shRNA (shMDH1) reduced mature osteoclast formation and bone resorption activity. Moreover, the expression of marker genes associated with osteoclast differentiation was downregulated by shMDH1 treatment, suggesting a role of MDH1 in osteoclast differentiation. In addition, intracellular ATP production was reduced following the activation of adenosine 5′ monophosphate-activated protein kinase (AMPK), a cellular energy sensor and negative regulator of RANKL-induced osteoclast differentiation, in shMDH1-infected osteoclasts compared to control cells. In addition, the expression of c-Fos and nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1), a critical transcription factor of osteoclastogenesis, was decreased with MDH1 knockdown during RANKL-mediated osteoclast differentiation. These findings provide strong evidence that MDH1 plays a critical role in osteoclast differentiation and function via modulation of the intracellular energy status, which might affect AMPK activity and NFATc1 expression.

  5. Apoptosis signal-regulating kinase 1 mediates denbinobin-induced apoptosis in human lung adenocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Pan Shiow-Lin

    2009-05-01

    Full Text Available Abstract In the present study, we explore the role of apoptosis signal-regulating kinase 1 (ASK1 in denbinobin-induced apoptosis in human lung adenocarcinoma (A549 cells. Denbinobin-induced cell apoptosis was attenuated by an ASK1 dominant-negative mutant (ASK1DN, two antioxidants (N-acetyl-L-cysteine (NAC and glutathione (GSH, a c-Jun N-terminal kinase (JNK inhibitor (SP600125, and an activator protein-1 (AP-1 inhibitor (curcumin. Treatment of A549 cells with denbinobin caused increases in ASK1 activity and reactive oxygen species (ROS production, and these effects were inhibited by NAC and GSH. Stimulation of A549 cells with denbinobin caused JNK activation; this effect was markedly inhibited by NAC, GSH, and ASK1DN. Denbinobin induced c-Jun phosphorylation, the formation of an AP-1-specific DNA-protein complex, and Bim expression. Bim knockdown using a bim short interfering RNA strategy also reduced denbinobin-induced A549 cell apoptosis. The denbinobin-mediated increases in c-Jun phosphorylation and Bim expression were inhibited by NAC, GSH, SP600125, ASK1DN, JNK1DN, and JNK2DN. These results suggest that denbinobin might activate ASK1 through ROS production to cause JNK/AP-1 activation, which in turn induces Bim expression, and ultimately results in A549 cell apoptosis.

  6. Autoimmunity in Arabidopsis acd11 is mediated by epigenetic regulation of an immune receptor.

    Directory of Open Access Journals (Sweden)

    Kristoffer Palma

    Full Text Available Certain pathogens deliver effectors into plant cells to modify host protein targets and thereby suppress immunity. These target modifications can be detected by intracellular immune receptors, or Resistance (R proteins, that trigger strong immune responses including localized host cell death. The accelerated cell death 11 (acd11 "lesion mimic" mutant of Arabidopsis thaliana exhibits autoimmune phenotypes such as constitutive defense responses and cell death without pathogen perception. ACD11 encodes a putative sphingosine transfer protein, but its precise role during these processes is unknown. In a screen for lazarus (laz mutants that suppress acd11 death we identified two genes, LAZ2 and LAZ5. LAZ2 encodes the histone lysine methyltransferase SDG8, previously shown to epigenetically regulate flowering time via modification of histone 3 (H3. LAZ5 encodes an RPS4-like R-protein, defined by several dominant negative alleles. Microarray and chromatin immunoprecipitation analyses showed that LAZ2/SDG8 is required for LAZ5 expression and H3 lysine 36 trimethylation at LAZ5 chromatin to maintain a transcriptionally active state. We hypothesize that LAZ5 triggers cell death in the absence of ACD11, and that cell death in other lesion mimic mutants may also be caused by inappropriate activation of R genes. Moreover, SDG8 is required for basal and R protein-mediated pathogen resistance in Arabidopsis, revealing the importance of chromatin remodeling as a key process in plant innate immunity.

  7. Hypothalamic AMPK and fatty acid metabolism mediate thyroid regulation of energy balance.

    Science.gov (United States)

    López, Miguel; Varela, Luis; Vázquez, María J; Rodríguez-Cuenca, Sergio; González, Carmen R; Velagapudi, Vidya R; Morgan, Donald A; Schoenmakers, Erik; Agassandian, Khristofor; Lage, Ricardo; Martínez de Morentin, Pablo Blanco; Tovar, Sulay; Nogueiras, Rubén; Carling, David; Lelliott, Christopher; Gallego, Rosalía; Oresic, Matej; Chatterjee, Krishna; Saha, Asish K; Rahmouni, Kamal; Diéguez, Carlos; Vidal-Puig, Antonio

    2010-09-01

    Thyroid hormones have widespread cellular effects; however it is unclear whether their effects on the central nervous system (CNS) contribute to global energy balance. Here we demonstrate that either whole-body hyperthyroidism or central administration of triiodothyronine (T3) decreases the activity of hypothalamic AMP-activated protein kinase (AMPK), increases sympathetic nervous system (SNS) activity and upregulates thermogenic markers in brown adipose tissue (BAT). Inhibition of the lipogenic pathway in the ventromedial nucleus of the hypothalamus (VMH) prevents CNS-mediated activation of BAT by thyroid hormone and reverses the weight loss associated with hyperthyroidism. Similarly, inhibition of thyroid hormone receptors in the VMH reverses the weight loss associated with hyperthyroidism. This regulatory mechanism depends on AMPK inactivation, as genetic inhibition of this enzyme in the VMH of euthyroid rats induces feeding-independent weight loss and increases expression of thermogenic markers in BAT. These effects are reversed by pharmacological blockade of the SNS. Thus, thyroid hormone-induced modulation of AMPK activity and lipid metabolism in the hypothalamus is a major regulator of whole-body energy homeostasis.

  8. Hypothalamic AMPK and fatty acid metabolism mediate thyroid regulation of energy balance

    Science.gov (United States)

    López, Miguel; Varela, Luis; Vázquez, María J.; Rodríguez-Cuenca, Sergio; González, Carmen R.; Velagapudi, Vidya R.; Morgan, Donald A.; Schoenmakers, Erik; Agassandian, Khristofor; Lage, Ricardo; de Morentin, Pablo Blanco Martínez; Tovar, Sulay; Nogueiras, Rubén; Carling, David; Lelliott, Christopher; Gallego, Rosalía; Orešič, Matej; Chatterjee, Krishna; Saha, Asish K.; Rahmouni, Kamal; Diéguez, Carlos; Vidal-Puig, Antonio

    2010-01-01

    Thyroid hormones have widespread cellular effects; however it is unclear whether their effects on the central nervous system (CNS) contribute to global energy balance. Here, we demonstrate that either whole body hyperthyroidism or central administration of triiodothyronine (T3) decreases the activity of hypothalamic AMP-activated protein kinase (AMPK), increases sympathetic nervous system (SNS) activity and upregulates thermogenic markers in brown adipose tissue (BAT). Inhibition of the lipogenic pathway in the ventromedial nucleus of the hypothalamus (VMH) prevents CNS-mediated activation of BAT by thyroid hormone and reverses the weight loss associated with hyperthyroidism. Similarly inhibition of thyroid hormone receptors (TRs) in the VMH reverses the weight loss associated with hyperthyroidism. This regulatory mechanism depends on AMPK inactivation as genetic ablation of this enzyme in the VMH of euthyroid rats induces feeding-independent weight loss and increases expression of thermogenic markers in BAT. These effects are reversed by pharmacological blockade of the SNS. Thus, thyroid-hormone-induced modulation of AMPK activity and lipid metabolism in the hypothalamus is an important regulator of energy homeostasis. PMID:20802499

  9. Calcium-mediated signaling and calmodulin-dependent kinase regulate hepatocyte-inducible nitric oxide synthase expression.

    Science.gov (United States)

    Zhang, Baochun; Crankshaw, Will; Nesemeier, Ryan; Patel, Jay; Nweze, Ikenna; Lakshmanan, Jaganathan; Harbrecht, Brian G

    2015-02-01

    Induced nitric oxide synthase (iNOS) is induced in hepatocytes by shock and inflammatory stimuli. Excessive NO from iNOS mediates shock-induced hepatic injury and death, so understanding the regulation of iNOS will help elucidate the pathophysiology of septic shock. In vitro, cytokines induce iNOS expression through activation of signaling pathways including mitogen-activated protein kinases and nuclear factor κB. Cytokines also induce calcium (Ca(2+)) mobilization and activate calcium-mediated intracellular signaling pathways, typically through activation of calmodulin-dependent kinases (CaMK). Calcium regulates NO production in macrophages but the role of calcium and calcium-mediated signaling in hepatocyte iNOS expression has not been defined. Primary rat hepatocytes were isolated, cultured, and induced to produce NO with proinflammatory cytokines. Calcium mobilization and Ca(2+)-mediated signaling were altered with ionophore, Ca(2+) channel blockers, and inhibitors of CaMK. The Ca(2+) ionophore A23187 suppressed cytokine-stimulated NO production, whereas Ethylene glycol tetraacetic acid and nifedipine increased NO production, iNOS messenger RNA, and iNOS protein expression. Inhibition of CaMK with KN93 and CBD increased NO production but the calcineurin inhibitor FK 506 decreased iNOS expression. These data demonstrate that calcium-mediated signaling regulates hepatocyte iNOS expression and does so through a mechanism independent of calcineurin. Changes in intracellular calcium levels may regulate iNOS expression during hepatic inflammation induced by proinflammatory cytokines. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. XAP5 CIRCADIAN TIMEKEEPER Positively Regulates RESISTANCE TO POWDERY MILDEW8.1–Mediated Immunity in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Yong-Ju Xu

    2017-11-01

    Full Text Available Ectopic expression of the Arabidopsis RESISTANCE TO POWDERY MILDEW8.1 (RPW8.1 boosts pattern-triggered immunity leading to enhanced resistance to different pathogens in Arabidopsis and rice. However, the underlying regulatory mechanism remains largely elusive. Here, we report that XAP5 CIRCADIAN TIMEKEEPER (XCT, At2g21150 positively regulates RPW8.1-mediated cell death and disease resistance. Forward genetic screen identified the b3-17 mutant that exhibited less cell death and susceptibility to powdery mildew and bacterial pathogens. Map-based cloning identified a G-to-A point mutation at the 3′ splice site of the 8th intron, which resulted in splice shift to 8-bp down-stream of the original splice site of XCT in b3-17, and introduced into a stop codon after two codons leading to a truncated XCT. XCT has previously been identified as a circadian clock gene required for small RNA biogenesis and acting down-stream of ETHYLENE-INSENSITIVE3 (EIN3 in the ethylene-signaling pathway. Here we further showed that mutation or down-regulation of XCT by artificial microRNA reduced RPW8.1-mediated immunity in R1Y4, a transgenic line expressing RPW8.1-YFP from the RPW8.1 native promoter. On the contrary, overexpression of XCT in R1Y4 background enhanced RPW8.1-mediated cell death, H2O2 production and resistance against powdery mildew. Consistently, the expression of RPW8.1 was down- and up-regulated in xct mutant and XCT overexpression lines, respectively. Taken together, these results indicate that XCT positively regulates RPW8.1-mediated cell death and disease resistance, and provide new insight into the regulatory mechanism of RPW8.1-mediated immunity.

  11. RhoA/Rho Kinase Mediates Neuronal Death Through Regulating cPLA2 Activation.

    Science.gov (United States)

    Wu, Xiangbing; Walker, Chandler L; Lu, Qingbo; Wu, Wei; Eddelman, Daniel B; Parish, Jonathan M; Xu, Xiao-Ming

    2017-11-01

    Activation of RhoA/Rho kinase leads to growth cone collapse and neurite retraction. Although RhoA/Rho kinase inhibition has been shown to improve axon regeneration, remyelination and functional recovery, its role in neuronal cell death remains unclear. To determine whether RhoA/Rho kinase played a role in neuronal death after injury, we investigated the relationship between RhoA/Rho kinase and cytosolic phospholipase A 2 (cPLA 2 ), a lipase that mediates inflammation and cell death, using an in vitro neuronal death model and an in vivo contusive spinal cord injury model performed at the 10th thoracic (T10) vertebral level. We found that co-administration of TNF-α and glutamate induced spinal neuron death, and activation of RhoA, Rho kinase and cPLA 2 . Inhibition of RhoA, Rho kinase and cPLA 2 significantly reduced TNF-α/glutamate-induced cell death by 33, 52 and 43 %, respectively (p < 0.001). Inhibition of RhoA and Rho kinase also significantly downregulated cPLA 2 activation by 66 and 60 %, respectively (p < 0.01). Furthermore, inhibition of RhoA and Rho kinase reduced the release of arachidonic acid, a downstream substrate of cPLA 2 . The immunofluorescence staining showed that ROCK 1 or ROCK 2 , two isoforms of Rho kinase, was co-localized with cPLA 2 in neuronal cytoplasm. Interestingly, co-immunoprecipitation (Co-IP) assay showed that ROCK 1 or ROCK 2 bonded directly with cPLA 2 and phospho-cPLA 2 . When the Rho kinase inhibitor Y27632 was applied in mice with T10 contusion injury, it significantly decreased cPLA 2 activation and expression and reduced injury-induced apoptosis at and close to the lesion site. Taken together, our results reveal a novel mechanism of RhoA/Rho kinase-mediated neuronal death through regulating cPLA 2 activation.

  12. Does anger regulation mediate the discrimination-mental health link among Mexican-origin adolescents? A longitudinal mediation analysis using multilevel modeling.

    Science.gov (United States)

    Park, Irene J K; Wang, Lijuan; Williams, David R; Alegría, Margarita

    2017-02-01

    [Correction Notice: An Erratum for this article was reported in Vol 53(2) of Developmental Psychology (see record 2017-04475-001). In the article, there were several typographical errors in the Recruitment and Procedures section. The percentage of mothers who responded to survey items should have been 99.3%. Additionally, the youths surveyed at T2 and T3 should have been n 246. Accordingly, the percentage of youths surveyed in T2 and T3 should have been 91.4% and the percentage of mothers surveyed at T2 and T3 should have been 90.7%. Finally, the youths missing at T2 should have been n 23, and therefore the attrition rate for youth participants should have been 8.6. All versions of this article have been corrected.] Although prior research has consistently documented the association between racial/ethnic discrimination and poor mental health outcomes, the mechanisms that underlie this link are still unclear. The present 3-wave longitudinal study tested the mediating role of anger regulation in the discrimination-mental health link among 269 Mexican-origin adolescents ( M age = 14.1 years, SD = 1.6; 57% girls), 12 to 17 years old. Three competing anger regulation variables were tested as potential mediators: outward anger expression, anger suppression, and anger control. Longitudinal mediation analyses were conducted using multilevel modeling that disaggregated within-person effects from between-person effects. Results indicated that outward anger expression was a significant mediator; anger suppression and anger control were not significant mediators. Within a given individual, greater racial/ethnic discrimination was associated with more frequent outward anger expression. In turn, more frequent outward anger expression was associated with higher levels of anxiety and depression at a given time point. Gender, age, and nativity status were not significant moderators of the hypothesized mediation models. By identifying outward anger expression as an explanatory

  13. Kin28 regulates the transient association of Mediator with core promoters.

    Science.gov (United States)

    Jeronimo, Célia; Robert, François

    2014-05-01

    Mediator is an essential, broadly used eukaryotic transcriptional coactivator. How and what Mediator communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence, upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity or in cells in which the RNAPII C-terminal domain is mutated to replace Ser5 with alanine, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is released quickly from promoters after phosphorylation of Ser5 by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter.

  14. Dihydrotestosterone regulating apolipoprotein M expression mediates via protein kinase C in HepG2 cells

    Directory of Open Access Journals (Sweden)

    Yi-zhou Ye

    2012-12-01

    Full Text Available Abstract Background Administration of androgens decreases plasma concentrations of high-density lipid cholesterol (HDL-C. However, the mechanisms by which androgens mediate lipid metabolism remain unknown. This present study used HepG2 cell cultures and ovariectomized C57BL/6 J mice to determine whether apolipoprotein M (ApoM, a constituent of HDL, was affected by dihydrotestosterone (DHT. Methods HepG2 cells were cultured in the presence of either DHT, agonist of protein kinase C (PKC, phorbol-12-myristate-13-acetate (PMA, blocker of androgen receptor flutamide together with different concentrations of DHT, or DHT together with staurosporine at different concentrations for 24 hrs. Ovariectomized C57BL/6 J mice were treated with DHT or vehicle for 7d or 14d and the levels of plasma ApoM and livers ApoM mRNA were measured. The mRNA levels of ApoM, ApoAI were determined by real-time RT-PCR. ApoM and ApoAI were determined by western blotting analysis. Results Addition of DHT to cell culture medium selectively down-regulated ApoM mRNA expression and ApoM secretion in a dose-dependent manner. At 10 nM DHT, the ApoM mRNA levels were about 20% lower than in untreated cells and about 40% lower at 1000 nM DHT than in the control cells. The secretion of ApoM into the medium was reduced to a similar extent. The inhibitory effect of DHT on ApoM secretion was not blocked by the classical androgen receptor blocker flutamide but by an antagonist of PKC, Staurosporine. Agonist of PKC, PMA, also reduced ApoM. At 0.5 μM PMA, the ApoM mRNA levels and the secretion of ApoM into the medium were about 30% lower than in the control cells. The mRNA expression levels and secretion of another HDL-associated apolipoprotein AI (ApoAI were not affected by DHT. The levels of plasma ApoM and liver ApoM mRNA of DHT-treated C57BL/6 J mice were lower than those of vehicle-treated mice. Conclusions DHT directly and selectively down-regulated the level of ApoM mRNA and the

  15. Extracellular signal regulated kinase 5 mediates signals triggered by the novel tumor promoter palytoxin

    International Nuclear Information System (INIS)

    Charlson, Aaron T.; Zeliadt, Nicholette A.; Wattenberg, Elizabeth V.

    2009-01-01

    Palytoxin is classified as a non-12-O-tetradecanoylphorbol-13-acetate (TPA)-type skin tumor because it does not bind to or activate protein kinase C. Palytoxin is thus a novel tool for investigating alternative signaling pathways that may affect carcinogenesis. We previously showed that palytoxin activates three major members of the mitogen activated protein kinase (MAPK) family, extracellular signal regulated kinase 1 and 2 (ERK1/2), c-Jun N-terminal kinase (JNK), and p38. Here we report that palytoxin also activates another MAPK family member, called ERK5, in HeLa cells and in keratinocytes derived from initiated mouse skin (308 cells). By contrast, TPA does not activate ERK5 in these cell lines. The major cell surface receptor for palytoxin is the Na+,K+-ATPase. Accordingly, ouabain blocked the ability of palytoxin to activate ERK5. Ouabain alone did not activate ERK5. ERK5 thus represents a divergence in the signaling pathways activated by these two agents that bind to the Na+,K+-ATPase. Cycloheximide, okadaic acid, and sodium orthovanadate did not mimic the effect of palytoxin on ERK5. These results indicate that the stimulation of ERK5 by palytoxin is not simply due to inhibition of protein synthesis or inhibition of serine/threonine or tyrosine phosphatases. Therefore, the mechanism by which palytoxin activates ERK5 differs from that by which it activates ERK1/2, JNK, and p38. Finally, studies that used pharmacological inhibitors and shRNA to block ERK5 action indicate that ERK5 contributes to palytoxin-stimulated c-Fos gene expression. These results suggest that ERK5 can act as an alternative mediator for transmitting diverse tumor promoter-stimulated signals.

  16. Sae regulator factor impairs the response to photodynamic inactivation mediated by Toluidine blue in Staphylococcus aureus.

    Science.gov (United States)

    Gándara, Lautaro; Mamone, Leandro; Dotto, Cristian; Buzzola, Fernanda; Casas, Adriana

    2016-12-01

    Photodynamic inactivation (PDI) involves the combined use of light and a photosensitizer, which, in the presence of oxygen, originates cytotoxic species capable of inactivating bacteria. Since the emergence of multi-resistant bacterial strains is becoming an increasing public health concern, PDI becomes an attractive choice. The aim of this work was to study the differential susceptibility to Toluidine blue (TB) mediated PDI (TB-PDI) of S. aureus mutants (RN6390 and Newman backgrounds) for different key regulators of virulence factors related to some extent to oxidative stress. Complete bacteria eradication of planktonic cultures of RN6390 S. aureus photosensitized with 13μM TB was obtained upon illumination with a low light dose of 4.2J/cm 2 from a non-coherent light source. Similarly, complete cell death was achieved applying 1.3μM TB and 19J/cm 2 light dose, showing that higher light doses can lead to equal cell death employing low photosensitizer concentrations. Interestingly, RN6390 in planktonic culture responded significantly better to TB-PDI than the Newman strain. We showed that deficiencies in rsbU, mgrA (transcription factors related to stress response) or agr (quorum sensing system involved in copper resistance to oxidative stress) did not modify the response of planktonic S. aureus to PDI. On the other hand, the two component system sae impaired the response to TB-PDI through a mechanism not related to the Eap adhesin. More severe conditions were needed to inactivate S. aureus biofilms (0.5mM TB, 157J/cm 2 laser light). In mutant sae biofilms, strain dependant differential susceptibilities are not noticed. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Survival of Listeria monocytogenes in Soil Requires AgrA-Mediated Regulation.

    Science.gov (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Gal, Laurent; Hartmann, Alain; Piveteau, Pascal

    2015-08-01

    In a recent paper, we demonstrated that inactivation of the Agr system affects the patterns of survival of Listeria monocytogenes (A.-L. Vivant, D. Garmyn, L. Gal, and P. Piveteau, Front Cell Infect Microbiol 4:160, http://dx.doi.org/10.3389/fcimb.2014.00160). In this study, we investigated whether the Agr-mediated response is triggered during adaptation in soil, and we compared survival patterns in a set of 10 soils. The fate of the parental strain L. monocytogenes L9 (a rifampin-resistant mutant of L. monocytogenes EGD-e) and that of a ΔagrA deletion mutant were compared in a collection of 10 soil microcosms. The ΔagrA mutant displayed significantly reduced survival in these biotic soil microcosms, and differential transcriptome analyses showed large alterations of the transcriptome when AgrA was not functional, while the variations in the transcriptomes between the wild type and the ΔagrA deletion mutant were modest under abiotic conditions. Indeed, in biotic soil environments, 578 protein-coding genes and an extensive repertoire of noncoding RNAs (ncRNAs) were differentially transcribed. The transcription of genes coding for proteins involved in cell envelope and cellular processes, including the phosphotransferase system and ABC transporters, and proteins involved in resistance to antimicrobial peptides was affected. Under sterilized soil conditions, the differences were limited to 86 genes and 29 ncRNAs. These results suggest that the response regulator AgrA of the Agr communication system plays important roles during the saprophytic life of L. monocytogenes in soil. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Hyperammonemia in cirrhosis induces transcriptional regulation of myostatin by an NF-κB–mediated mechanism

    Science.gov (United States)

    Qiu, Jia; Thapaliya, Samjhana; Runkana, Ashok; Yang, Yu; Tsien, Cynthia; Mohan, Maradumane L.; Narayanan, Arvind; Eghtesad, Bijan; Mozdziak, Paul E.; McDonald, Christine; Stark, George R.; Welle, Stephen; Naga Prasad, Sathyamangla V.; Dasarathy, Srinivasan

    2013-01-01

    Loss of muscle mass, or sarcopenia, is nearly universal in cirrhosis and adversely affects patient outcome. The underlying cross-talk between the liver and skeletal muscle mediating sarcopenia is not well understood. Hyperammonemia is a consistent abnormality in cirrhosis due to impaired hepatic detoxification to urea. We observed elevated levels of ammonia in both plasma samples and skeletal muscle biopsies from cirrhotic patients compared with healthy controls. Furthermore, skeletal muscle from cirrhotics had increased expression of myostatin, a known inhibitor of skeletal muscle accretion and growth. In vivo studies in mice showed that hyperammonemia reduced muscle mass and strength and increased myostatin expression in wild-type compared with postdevelopmental myostatin knockout mice. We postulated that hyperammonemia is an underlying link between hepatic dysfunction in cirrhosis and skeletal muscle loss. Therefore, murine C2C12 myotubes were treated with ammonium acetate resulting in intracellular concentrations similar to those in cirrhotic muscle. In this system, we demonstrate that hyperammonemia stimulated myostatin expression in a NF-κB–dependent manner. This finding was also observed in primary murine muscle cell cultures. Hyperammonemia triggered activation of IκB kinase, NF-κB nuclear translocation, binding of the NF-κB p65 subunit to specific sites within the myostatin promoter, and stimulation of myostatin gene transcription. Pharmacologic inhibition or gene silencing of NF-κB abolished myostatin up-regulation under conditions of hyperammonemia. Our work provides unique insights into hyperammonemia-induced myostatin expression and suggests a mechanism by which sarcopenia develops in cirrhotic patients. PMID:24145431

  19. Activity-dependent astrocyte swelling is mediated by pH-regulating mechanisms.

    Science.gov (United States)

    Larsen, Brian Roland; MacAulay, Nanna

    2017-10-01

    During neuronal activity in the mammalian brain, the K + released into the synaptic space is initially buffered by the astrocytic compartment. In parallel, the extracellular space (ECS) shrinks, presumably due to astrocytic cell swelling. With the Na + /K + /2Cl - cotransporter and the Kir4.1/AQP4 complex not required for the astrocytic cell swelling in the hippocampus, the molecular mechanisms underlying the activity-dependent ECS shrinkage have remained unresolved. To identify these molecular mechanisms, we employed ion-sensitive microelectrodes to measure changes in ECS, [K + ] o and [H + ] o /pH o during electrical stimulation of rat hippocampal slices. Transporters and receptors responding directly to the K + and glutamate released into the extracellular space (the K + /Cl - cotransporter, KCC, glutamate transporters and G protein-coupled receptors) did not modulate the extracellular space dynamics. The HCO3--transporting mechanism, which in astrocytes mainly constitutes the electrogenic Na + / HCO3- cotransporter 1 (NBCe1), is activated by the K + -mediated depolarization of the astrocytic membrane. Inhibition of this transporter reduced the ECS shrinkage by ∼25% without affecting the K + transients, pointing to NBCe1 as a key contributor to the stimulus-induced astrocytic cell swelling. Inhibition of the monocarboxylate cotransporters (MCT), like-wise, reduced the ECS shrinkage by ∼25% without compromising the K + transients. Isosmotic reduction of extracellular Cl - revealed a requirement for this ion in parts of the ECS shrinkage. Taken together, the stimulus-evoked astrocytic cell swelling does not appear to occur as a direct effect of the K + clearance, as earlier proposed, but partly via the pH-regulating transport mechanisms activated by the K + -induced astrocytic depolarization and the activity-dependent metabolism. © 2017 Wiley Periodicals, Inc.

  20. Biotin uptake by mouse and human pancreatic beta cells/islets: a regulated, lipopolysaccharide-sensitive carrier-mediated process

    Science.gov (United States)

    Ghosal, Abhisek; Sekar, Thillai V.

    2014-01-01

    Biotin is essential for the normal function of pancreatic beta cells. These cells obtain biotin from their surroundings via transport across their cell membrane. Little is known about the uptake mechanism involved, how it is regulated, and how it is affected by internal and external factors. We addressed these issues using the mouse-derived pancreatic beta-TC-6 cells and freshly isolated mouse and human primary pancreatic beta cells as models. The results showed biotin uptake by pancreatic beta-TC-6 cells occurs via a Na+-dependent, carrier-mediated process, that is sensitive to desthiobiotin, as well as to pantothenic acid and lipoate; the process is also saturable as a function of concentration (apparent Km = 22.24 ± 5.5 μM). These cells express the sodium-dependent multivitamin transporter (SMVT), whose knockdown (with doxycycline-inducible shRNA) led to a sever inhibition in biotin uptake. Similarly, uptake of biotin by mouse and human primary pancreatic islets is Na+-dependent and carrier-mediated, and both cell types express SMVT. Biotin uptake by pancreatic beta-TC-6 cells is also adaptively regulated (via transcriptional mechanism) by extracellular substrate level. Chronic treatment of pancreatic beta-TC-6 cells with bacterial lipopolysaccharides (LPS) leads to inhibition in biotin uptake. This inhibition is mediated via a Toll-Like receptor 4-mediated process and involves a decrease in membrane expression of SMVT. These findings show, for the first time, that pancreatic beta cells/islets take up biotin via a specific and regulated carrier-mediated process, and that the process is sensitive to the effect of LPS. PMID:24904078

  1. Expectancies for Social Support and Negative Mood Regulation Mediate the Relationship between Childhood Maltreatment and Self-Injury

    Directory of Open Access Journals (Sweden)

    Fiona Tresno

    2016-07-01

    Full Text Available Nonsuicidal self-injury (NSSI is common among young people. A majority of individuals who injure themselves do so to alleviate negative affect, as most self-injurers report difficulties with mood regulation. Trauma in childhood is an important risk factor that may cause individuals to develop poor interpersonal relations and impaired emotion-regulation, leading to the use of non-adaptive coping strategies such as NSSI. This study examined factors contributing to self-injury, focusing on the link from childhood maltreatment, through mood regulation expectancies and expectancies for social support (father, mother, and friends, to self-injury. Understanding how these variables relate to NSSI is crucial for early identification of individuals at risk of NSSI. Participants were 377 Japanese university students. Lifetime prevalence of self-injury was 20% among the sample. Results showed childhood maltreatment is a strong predictor that increases the risk for NSSI. However, expectancies for social support and mood regulation seem to be potential protective factors. Mood regulation expectancies mediate the relationship between childhood maltreatment and self-injury. In addition, expectancies for social support were indirectly linked with NSSI through negative mood regulation expectancies. It appears that perceived support from father and friends increases one's confidence in regulating difficult emotions, which in turn reduces risk for NSSI. Results suggest that strong expectancies for social support, especially from friends, increase one's confidence in regulating emotion, which contributes as a protective factor against self-injury.

  2. Rac1 regulates the NLRP3 inflammasome which mediates IL-1beta production in Chlamydophila pneumoniae infected human mononuclear cells.

    Directory of Open Access Journals (Sweden)

    Julia Eitel

    Full Text Available Chlamydophila pneumoniae causes acute respiratory tract infections and has been associated with development of asthma and atherosclerosis. The production of IL-1β, a key mediator of acute and chronic inflammation, is regulated on a transcriptional level and additionally on a posttranslational level by inflammasomes. In the present study we show that C. pneumoniae-infected human mononuclear cells produce IL-1β protein depending on an inflammasome consisting of NLRP3, the adapter protein ASC and caspase-1. We further found that the small GTPase Rac1 is activated in C. pneumoniae-infected cells. Importantly, studies with specific inhibitors as well as siRNA show that Rac1 regulates inflammasome activation in C. pneumoniae-infected cells. In conclusion, C. pneumoniae infection of mononuclear cells stimulates IL-1β production dependent on a NLRP3 inflammasome-mediated processing of proIL-1β which is controlled by Rac1.

  3. E2F1-Mediated Induction of NFYB Attenuates Apoptosis via Joint Regulation of a Pro-Survival Transcriptional Program.

    Directory of Open Access Journals (Sweden)

    Xiaolei Jiang

    Full Text Available The E2F1 transcription factor regulates cell proliferation and apoptosis through the control of a considerable variety of target genes. Previous work has detailed the role of other transcription factors in mediating the specificity of E2F function. Here we identify the NF-YB transcription factor as a novel direct E2F1 target. Genome-wide expression analysis of the effects of NFYB knockdown on E2F1-mediated transcription identified a large group of genes that are co-regulated by E2F1 and NFYB. We also provide evidence that knockdown of NFYB enhances E2F1-induced apoptosis, suggesting a pro-survival function of the NFYB/E2F1 joint transcriptional program. Bioinformatic analysis suggests that deregulation of these NFY-dependent E2F1 target genes might play a role in sarcomagenesis as well as drug resistance.

  4. p62 regulates CD40-mediated NFκB activation in macrophages through interaction with TRAF6

    Energy Technology Data Exchange (ETDEWEB)

    Seibold, Kristina; Ehrenschwender, Martin, E-mail: martin.ehrenschwender@ukr.de

    2015-08-14

    CD40 is a member of the tumor necrosis factor (TNF) receptor family. Activation-induced recruitment of adapter proteins, so-called TNF-receptor-associated factors (TRAFs) to the cytoplasmic tail of CD40 triggers signaling cascades important in the immune system, but has also been associated with excessive inflammation in diseases such as atherosclerosis and rheumatoid arthritis. Especially, pro-inflammatory nuclear factor κB (NFκB) signaling emanating from CD40-associated TRAF6 appears to be a key pathogenic driving force. Consequently, targeting the CD40-TRAF6 interaction is emerging as a promising therapeutic strategy, but the underlying molecular machinery of this signaling axis is to date poorly understood. Here, we identified the multifunctional adaptor protein p62 as a critical regulator in CD40-mediated NFκB signaling via TRAF6. CD40 activation triggered formation of a TRAF6-p62 complex. Disturbing this interaction tremendously reduced CD40-mediated NFκB signaling in macrophages, while TRAF6-independent signaling pathways remained unaffected. This highlights p62 as a potential target in hyper-inflammatory, CD40-associated pathologies. - Highlights: • CD40 activation triggers interaction of the adapter protein TRAF6 with p62. • TRAF6-p62 interaction regulates CD40-mediated NFκB signaling in macrophages. • Defective TRAF6-p62 interaction reduces CD40-mediated NFκB activation in macrophages.

  5. Mediator Complex Subunits MED2, MED5, MED16, and MED23 Genetically Interact in the Regulation of Phenylpropanoid Biosynthesis.

    Science.gov (United States)

    Dolan, Whitney L; Dilkes, Brian P; Stout, Jake M; Bonawitz, Nicholas D; Chapple, Clint

    2017-12-01

    The phenylpropanoid pathway is a major global carbon sink and is important for plant fitness and the engineering of bioenergy feedstocks. In Arabidopsis thaliana , disruption of two subunits of the transcriptional regulatory Mediator complex, MED5a and MED5b, results in an increase in phenylpropanoid accumulation. By contrast, the semidominant MED5b mutation reduced epidermal fluorescence4-3 ( ref4-3 ) results in dwarfism and constitutively repressed phenylpropanoid accumulation. Here, we report the results of a forward genetic screen for suppressors of ref4-3. We identified 13 independent lines that restore growth and/or phenylpropanoid accumulation in the ref4-3 background. Two of the suppressors restore growth without restoring soluble phenylpropanoid accumulation, indicating that the growth and metabolic phenotypes of the ref4-3 mutant can be genetically disentangled. Whole-genome sequencing revealed that all but one of the suppressors carry mutations in MED5b or other Mediator subunits. RNA-seq analysis showed that the ref4-3 mutation causes widespread changes in gene expression, including the upregulation of negative regulators of the phenylpropanoid pathway, and that the suppressors reverse many of these changes. Together, our data highlight the interdependence of individual Mediator subunits and provide greater insight into the transcriptional regulation of phenylpropanoid biosynthesis by the Mediator complex. © 2017 American Society of Plant Biologists. All rights reserved.

  6. Up-regulation of integrin β3 in radioresistant pancreatic cancer impairs adenovirus-mediated gene therapy

    International Nuclear Information System (INIS)

    Egami, Takuya; Ohuchida, Kenoki; Yasui, Takaharu; Onimaru, Manabu; Toma, Hiroki; Sato, Norihiro; Tanaka, Masao; Mizumoto, Kazuhiro; Matsumoto, Kunio

    2009-01-01

    Adenovirus-mediated gene therapy is a promising approach for the treatment of pancreatic cancer. We previously reported that radiation enhanced adenovirus-mediated gene expression in pancreatic cancer, suggesting that adenoviral gene therapy might be more effective in radioresistant pancreatic cancer cells. In the present study, we compared the transduction efficiency of adenovirus-delivered genes in radiosensitive and radioresistant cells, and investigated the underlying mechanisms. We used an adenovirus expressing the hepatocyte growth factor antagonist, NK4 (Ad-NK4), as a representative gene therapy. We established two radioresistant human pancreatic cancer cell lines using fractionated irradiation. Radiosensitive and radioresistant pancreatic cancer cells were infected with Ad-NK4, and NK4 levels in the cells were measured. In order to investigate the mechanisms responsible for the differences in the transduction efficiency between these cells, we measured expression of the genes mediating adenovirus infection and endocytosis. The results revealed that NK4 levels in radioresistant cells were significantly lower (P<0.01) than those in radiosensitive cells, although there were no significant differences in adenovirus uptake between radiosensitive cells and radioresistant cells. Integrin β3 was up-regulated and the Coxsackie virus and adenovirus receptor was down-regulated in radioresistant cells, and inhibition of integrin β3 promoted adenovirus gene transfer. These results suggest that inhibition of integrin β3 in radioresistant pancreatic cancer cells could enhance adenovirus-mediated gene therapy. (author)

  7. The brain cytoplasmic RNA BC1 regulates dopamine D-2 receptor-mediated transmission in the striatum

    OpenAIRE

    Centonze, Diego; Rossi, Silvia; Napoli, Ilaria; Mercaldo, Valentina; Lacoux, Caroline; Ferrari, Francesca; Ciotti, Maria Teresa; De Chiara, Valentina; Prosperetti, Chiara; Maccarrone, Mauro; Fezza, Filomena; Calabresi, Paolo; Bernardi, Giorgio; Bagni, Claudia

    2007-01-01

    Dopamine D-2 receptor (D2DR)-mediated transmission in the striatum is remarkably flexible, and changes in its efficacy have been heavily implicated in a variety of physiological and pathological conditions. Although receptor-associated proteins are clearly involved in specific forms of synaptic plasticity, the molecular mechanisms regulating the sensitivity of D-2 receptors in this brain area are essentially obscure. We have studied the physiological responses of the D2DR stimulations in mice...

  8. The mediational pathway among parenting styles, attachment styles and self-regulation with addiction susceptibility of adolescents*

    OpenAIRE

    Zeinali, Ali; Sharifi, Hassanpasha; Enayati, Mirsalahadine; Asgari, Parviz; Pasha, Gohlamreza

    2011-01-01

    Background: The purpose of present study was to create and test a model that illustrates variables that influence the development of addiction susceptibility and determine how different styles of parenting may indirectly influence the addiction susceptibility of children through the mediators of attachment style and self-regulation. Methods: Using random cluster sampling, 508 adolescent high school boys and girls aged 14-19 years were enrolled. Data were analyzed using structural equation...

  9. Adaptive and innate immune reactions regulating mast cell activation: from receptor-mediated signaling to responses

    DEFF Research Database (Denmark)

    Tkaczyk, Christine; Jensen, Bettina M; Iwaki, Shoko

    2006-01-01

    differentially activate multiple signaling pathways within the mast cells required for the generation and/or release of inflammatory mediators. Thus, the composition of the suite of mediators released and the physiologic ramifications of these responses are dependent on the stimuli and the microenvironment...

  10. Glutamate mediates the function of melanocortin receptor 4 on sim1 neurons in body weight regulation

    Science.gov (United States)

    The melanocortin receptor 4 (MC4R) is a well-established mediator of body weight homeostasis. However, the neurotransmitter(s) that mediate MC4R function remain largely unknown; as a result, little is known about the second-order neurons of the MC4R neural pathway. Single-minded 1 (Sim1)-expressing ...

  11. USP22 Induces Cisplatin Resistance in Lung Adenocarcinoma by Regulating γH2AX-Mediated DNA Damage Repair and Ku70/Bax-Mediated Apoptosis

    Directory of Open Access Journals (Sweden)

    Aman Wang

    2017-05-01

    Full Text Available Resistance to platinum-based chemotherapy is one of the most important reasons for treatment failure in advanced non-small cell lung cancer, but the underlying mechanism is extremely complex and unclear. The present study aimed to investigate the correlation of ubiquitin-specific peptidase 22 (USP22 with acquired resistance to cisplatin in lung adenocarcinoma. In this study, we found that overexpression of USP22 could lead to cisplatin resistance in A549 cells. USP22 and its downstream proteins γH2AX and Sirt1 levels are upregulated in the cisplatin- resistant A549/CDDP cell line. USP22 enhances DNA damage repair and induce cisplatin resistance by promoting the phosphorylation of histone H2AX via deubiquitinating histone H2A. In addition, USP22 decreases the acetylation of Ku70 by stabilizing Sirt1, thus inhibiting Bax-mediated apoptosis and inducing cisplatin resistance. The cisplatin sensitivity in cisplatin-resistant A549/CDDP cells was restored by USP22 inhibition in vivo and vitro. In summary, our findings reveal the dual mechanism of USP22 involvement in cisplatin resistance that USP22 can regulate γH2AX-mediated DNA damage repair and Ku70/Bax-mediated apoptosis. USP22 is a potential target in cisplatin-resistant lung adenocarcinoma and should be considered in future therapeutic practice.

  12. Type I NKT-cell-mediated TNF-α is a positive regulator of NLRP3 inflammasome priming.

    Science.gov (United States)

    Chow, Melvyn T; Duret, Helene; Andrews, Daniel M; Faveeuw, Christelle; Möller, Andreas; Smyth, Mark J; Paget, Christophe

    2014-07-01

    The NLRP3 inflammasome plays a crucial role in the innate immune response to pathogens and exogenous or endogenous danger signals. Its activity must be precisely and tightly regulated to generate tailored immune responses. However, the immune cell subsets and cytokines controlling NLRP3 inflammasome activity are still poorly understood. Here, we have shown a link between NKT-cell-mediated TNF-α and NLRP3 inflammasome activity. The NLRP3 inflammasome in APCs was critical to potentiate NKT-cell-mediated immune responses, since C57BL/6 NLRP3 inflammasome-deficient mice exhibited reduced responsiveness to α-galactosylceramide. Importantly, NKT cells were found to act as regulators of NLRP3 inflammasome signaling, as NKT-cell-derived TNF-α was required for optimal IL-1β and IL-18 production by myeloid cells in response to α-galactosylceramide, by acting on the NLRP3 inflammasome priming step. Thus, NKT cells play a role in the positive regulation of NLRP3 inflammasome priming by mediating the production of TNF-α, thus demonstrating another means by which NKT cells control early inflammation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Follistatin-mediated skeletal muscle hypertrophy is regulated by Smad3 and mTOR independently of myostatin

    Science.gov (United States)

    Winbanks, Catherine E.; Weeks, Kate L.; Thomson, Rachel E.; Sepulveda, Patricio V.; Beyer, Claudia; Qian, Hongwei; Chen, Justin L.; Allen, James M.; Lancaster, Graeme I.; Febbraio, Mark A.; Harrison, Craig A.; McMullen, Julie R.; Chamberlain, Jeffrey S.

    2012-01-01

    Follistatin is essential for skeletal muscle development and growth, but the intracellular signaling networks that regulate follistatin-mediated effects are not well defined. We show here that the administration of an adeno-associated viral vector expressing follistatin-288aa (rAAV6:Fst-288) markedly increased muscle mass and force-producing capacity concomitant with increased protein synthesis and mammalian target of rapamycin (mTOR) activation. These effects were attenuated by inhibition of mTOR or deletion of S6K1/2. Furthermore, we identify Smad3 as the critical intracellular link that mediates the effects of follistatin on mTOR signaling. Expression of constitutively active Smad3 not only markedly prevented skeletal muscle growth induced by follistatin but also potently suppressed follistatin-induced Akt/mTOR/S6K signaling. Importantly, the regulation of Smad3- and mTOR-dependent events by follistatin occurred independently of overexpression or knockout of myostatin, a key repressor of muscle development that can regulate Smad3 and mTOR signaling and that is itself inhibited by follistatin. These findings identify a critical role of Smad3/Akt/mTOR/S6K/S6RP signaling in follistatin-mediated muscle growth that operates independently of myostatin-driven mechanisms. PMID:22711699

  14. CAR-mediated repression of Foxo1 transcriptional activity regulates the cell cycle inhibitor p21 in mouse livers

    International Nuclear Information System (INIS)

    Kazantseva, Yuliya A.; Yarushkin, Andrei A.; Pustylnyak, Vladimir O.

    2014-01-01

    Highlights: • CAR activation decreased the level of Foxo1 in mouse livers. • CAR activation decreased the level of p21 in mouse livers. • CAR activation inhibited Foxo1 transcriptional activity in mouse livers. - Abstract: 1,4-Bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP), an agonist of constitutive androstane receptor (CAR), is a well-known strong primary chemical mitogen for the mouse liver. Despite extensive investigation of the role of CAR in the regulation of cell proliferation, our knowledge of the intricate mediating mechanism is incomplete. In this study, we demonstrated that long-term CAR activation by TCPOBOP increased liver-to-body weight ratio and decreased tumour suppressor Foxo1 expression and transcriptional activity, which were correlated with reduced expression of genes regulated by Foxo1, including the cell-cycle inhibitor Cdkn1a(p21), and upregulation of the cell-cycle regulator Cyclin D1. Moreover, we demonstrated the negative regulatory effect of TCPOBOP-activated CAR on the association of Foxo1 with the target Foxo1 itself and Cdkn1a(p21) promoters. Thus, we identified CAR-mediated repression of cell cycle inhibitor p21, as mediated by repression of FOXO1 expression and transcriptional activity. CAR-FOXO1 cross-talk may provide new opportunities for understanding liver diseases and developing more effective therapeutic approaches to better drug treatments

  15. AMP-activated protein kinase (AMPK mediates nutrient regulation of thioredoxin-interacting protein (TXNIP in pancreatic beta-cells.

    Directory of Open Access Journals (Sweden)

    Maayan Shaked

    Full Text Available Thioredoxin-interacting protein (TXNIP regulates critical biological processes including inflammation, stress and apoptosis. TXNIP is upregulated by glucose and is a critical mediator of hyperglycemia-induced beta-cell apoptosis in diabetes. In contrast, the saturated long-chain fatty acid palmitate, although toxic to the beta-cell, inhibits TXNIP expression. The mechanisms involved in the opposing effects of glucose and fatty acids on TXNIP expression are unknown. We found that both palmitate and oleate inhibited TXNIP in a rat beta-cell line and islets. Palmitate inhibition of TXNIP was independent of fatty acid beta-oxidation or esterification. AMP-activated protein kinase (AMPK has an important role in cellular energy sensing and control of metabolic homeostasis; therefore we investigated its involvement in nutrient regulation of TXNIP. As expected, glucose inhibited whereas palmitate stimulated AMPK. Pharmacologic activators of AMPK mimicked fatty acids by inhibiting TXNIP. AMPK knockdown increased TXNIP expression in presence of high glucose with and without palmitate, indicating that nutrient (glucose and fatty acids effects on TXNIP are mediated in part via modulation of AMPK activity. TXNIP is transcriptionally regulated by carbohydrate response element-binding protein (ChREBP. Palmitate inhibited glucose-stimulated ChREBP nuclear entry and recruitment to the Txnip promoter, thereby inhibiting Txnip transcription. We conclude that AMPK is an important regulator of Txnip transcription via modulation of ChREBP activity. The divergent effects of glucose and fatty acids on TXNIP expression result in part from their opposing effects on AMPK activity. In light of the important role of TXNIP in beta-cell apoptosis, its inhibition by fatty acids can be regarded as an adaptive/protective response to glucolipotoxicity. The finding that AMPK mediates nutrient regulation of TXNIP may have important implications for the pathophysiology and treatment

  16. Regulated internalization of NMDA receptors drives PKD1-mediated suppression of the activity of residual cell-surface NMDA receptors.

    Science.gov (United States)

    Fang, Xiao-Qian; Qiao, Haifa; Groveman, Bradley R; Feng, Shuang; Pflueger, Melissa; Xin, Wen-Kuan; Ali, Mohammad K; Lin, Shuang-Xiu; Xu, Jindong; Duclot, Florian; Kabbaj, Mohamed; Wang, Wei; Ding, Xin-Sheng; Santiago-Sim, Teresa; Jiang, Xing-Hong; Salter, Michael W; Yu, Xian-Min

    2015-11-19

    Constitutive and regulated internalization of cell surface proteins has been extensively investigated. The regulated internalization has been characterized as a principal mechanism for removing cell-surface receptors from the plasma membrane, and signaling to downstream targets of receptors. However, so far it is still not known whether the functional properties of remaining (non-internalized) receptor/channels may be regulated by internalization of the same class of receptor/channels. The N-methyl-D-aspartate receptor (NMDAR) is a principal subtype of glutamate-gated ion channel and plays key roles in neuronal plasticity and memory functions. NMDARs are well-known to undergo two types of regulated internalization - homologous and heterologous, which can be induced by high NMDA/glycine and DHPG, respectively. In the present work, we investigated effects of regulated NMDAR internalization on the activity of residual cell-surface NMDARs and neuronal functions. In electrophysiological experiments we discovered that the regulated internalization of NMDARs not only reduced the number of cell surface NMDARs but also caused an inhibition of the activity of remaining (non-internalized) surface NMDARs. In biochemical experiments we identified that this functional inhibition of remaining surface NMDARs was mediated by increased serine phosphorylation of surface NMDARs, resulting from the activation of protein kinase D1 (PKD1). Knockdown of PKD1 did not affect NMDAR internalization but prevented the phosphorylation and inhibition of remaining surface NMDARs and NMDAR-mediated synaptic functions. These data demonstrate a novel concept that regulated internalization of cell surface NMDARs not only reduces the number of NMDARs on the cell surface but also causes an inhibition of the activity of remaining surface NMDARs through intracellular signaling pathway(s). Furthermore, modulating the activity of remaining surface receptors may be an effective approach for treating receptor

  17. miR-34a-mediated regulation of XIST in female cells under inflammation

    Directory of Open Access Journals (Sweden)

    Shenoda BB

    2018-05-01

    Full Text Available Botros B Shenoda,1 Yuzhen Tian,1 Guillermo M Alexander,2 Enrique Aradillas-Lopez,2,3 Robert J Schwartzman,2 Seena K Ajit1 1Pharmacology and Physiology, Drexel University College of Medicine, Philadelphia, PA, USA; 2Neurology, Drexel University College of Medicine, Philadelphia, PA, USA; 3Vincera Institute, Philadelphia, PA, USA Background: Evidence is overwhelming for sex differences in pain, with women representing the majority of the chronic pain patient population. There is a need to explore novel avenues to elucidate this sex bias in the development of chronic inflammatory pain conditions. Complex regional pain syndrome (CRPS is a chronic neuropathic pain disorder, and the incidence of CRPS is greater in women than in men by ~4:1. Since neurogenic inflammation is a key feature of CRPS, dysregulation of inflammatory responses can be a factor in predisposing women to chronic pain.Methods: Our studies investigating alterations in circulating microRNAs (miRNAs in whole blood from female CRPS patients showed significant differential expression of miRNAs between responders and poor responders to ketamine treatment. Several of these miRNAs are predicted to target the long noncoding RNA, X-inactive-specific transcript (XIST. XIST mediates X-chromosome inactivation and is essential for equalizing the expression of X-linked genes between females and males. Based on the well-established role in inflammatory process, we focused on miR-34a, one of the miRNAs predicted to target XIST, and downregulated in CRPS patients responding poorly to ketamine. Results: Our in vitro and in vivo models of acute inflammation and data from patients with CRPS showed that miR-34a can regulate XIST under inflammation directly, and through proinflammatory transcription factor Yin-Yang 1 (YY1. XIST was significantly upregulated in a subset of CRPS patients responding poorly to ketamine.Conclusion: Since dysregulation of XIST can result in genes escaping inactivation or

  18. Nuclear exportin receptor CAS regulates the NPI-1-mediated nuclear import of HIV-1 Vpr.

    Directory of Open Access Journals (Sweden)

    Eri Takeda

    Full Text Available Vpr, an accessory protein of human immunodeficiency virus type 1, is a multifunctional protein that plays an important role in viral replication. We have previously shown that the region between residues 17 and 74 of Vpr (Vpr(N17C74 contained a bona fide nuclear localization signal and it is targeted Vpr(N17C74 to the nuclear envelope and then imported into the nucleus by importin α (Impα alone. The interaction between Impα and Vpr is important not only for the nuclear import of Vpr but also for HIV-1 replication in macrophages; however, it was unclear whether full-length Vpr enters the nucleus in a manner similar to Vpr(N17C74. This study investigated the nuclear import of full-length Vpr using the three typical Impα isoforms, Rch1, Qip1 and NPI-1, and revealed that full-length Vpr is selectively imported by NPI-1, but not Rch1 and Qip1, after it makes contact with the perinuclear region in digitonin-permeabilized cells. A binding assay using the three Impα isoforms showed that Vpr bound preferentially to the ninth armadillo repeat (ARM region (which is also essential for the binding of CAS, the export receptor for Impα in all three isoforms. Comparison of biochemical binding affinities between Vpr and the Impα isoforms using surface plasmon resonance analysis demonstrated almost identical values for the binding of Vpr to the full-length isoforms and to their C-terminal domains. By contrast, the data showed that, in the presence of CAS, Vpr was released from the Vpr/NPI-1 complex but was not released from Rch1 or Qip1. Finally, the NPI-1-mediated nuclear import of Vpr was greatly reduced in semi-intact CAS knocked-down cells and was recovered by the addition of exogenous CAS. This report is the first to show the requirement for and the regulation of CAS in the functioning of the Vpr-Impα complex.

  19. Genetic interaction of two abscisic acid signaling regulators, HY5 and FIERY1, in mediating lateral root formation

    KAUST Repository

    Chen, Hao

    2011-01-01

    Root architecture is continuously shaped in a manner that helps plants to better adapt to the environment. Gene regulation at the transcriptional or post-transcriptional levels largely controls this environmental response. Recently, RNA silencing has emerged as an important player in gene regulation and is involved in many aspects of plant development, including lateral root formation. In a recent study, we found that FIERY1, a bifunctional abiotic stress and abscisic acid (ABA) signaling regulator and an endogenous RNA silencing suppressor, mediates auxin response during lateral root formation in Arabidopsis. We proposed that FRY1 regulates lateral root development through its activity on adenosine 3,5-bisphosphate (PAP), a strong inhibitor of exoribonucleases (XRNs). Interestingly, some of the phenotypes of fry1, such as enhanced response to light in repressing hypocotyl elongation and hypersensitivity to ABA in lateral root growth, are opposite to those of another light- and ABA-signaling mutant, hy5. Here we analyzed the hy5 fry1 double mutant for root and hypocotyl growth. We found that the hy5 mutation can suppress the enhanced light sensitivity in fry1 hypocotyl elongation and restore the lateral root formation. The genetic interaction between HY5 and FRY1 indicates that HY5 and FRY1 may act in overlapping pathways that mediate light signaling and lateral root development. © 2011 Landes Bioscience.

  20. MicroRNA-mediated down-regulation of NKG2D ligands contributes to glioma immune escape.

    Science.gov (United States)

    Codo, Paula; Weller, Michael; Meister, Gunter; Szabo, Emese; Steinle, Alexander; Wolter, Marietta; Reifenberger, Guido; Roth, Patrick

    2014-09-15

    Malignant gliomas are intrinsic brain tumors with a dismal prognosis. They are well-adapted to hypoxic conditions and poorly immunogenic. NKG2D is one of the major activating receptors of natural killer (NK) cells and binds to several ligands (NKG2DL). Here we evaluated the impact of miRNA on the expression of NKG2DL in glioma cells including stem-like glioma cells. Three of the candidate miRNA predicted to target NKG2DL were expressed in various glioma cell lines as well as in glioblastomas in vivo: miR-20a, miR-93 and miR-106b. LNA inhibitor-mediated miRNA silencing up-regulated cell surface NKG2DL expression, which translated into increased susceptibility to NK cell-mediated lysis. This effect was reversed by neutralizing NKG2D antibodies, confirming that enhanced lysis upon miRNA silencing was mediated through the NKG2D system. Hypoxia, a hallmark of glioblastomas in vivo, down-regulated the expression of NKG2DL on glioma cells, associated with reduced susceptibility to NK cell-mediated lysis. This process, however, was not mediated through any of the examined miRNA. Accordingly, both hypoxia and the expression of miRNA targeting NKG2DL may contribute to the immune evasion of glioma cells at the level of the NKG2D recognition pathway. Targeting miRNA may therefore represent a novel approach to increase the immunogenicity of glioblastoma.

  1. Optogenetic inhibition of D1R containing nucleus accumbens neurons alters cocaine- mediated regulation of Tiam1

    Directory of Open Access Journals (Sweden)

    Ramesh eChandra

    2013-05-01

    Full Text Available Exposure to psychostimulants results in structural and synaptic plasticity in striatal medium spiny neurons (MSNs. These cellular adaptations arise from alterations in genes that are highly implicated in the rearrangement of the actin cytoskeleton, such as Tiam1. Previous studies have demonstrated a crucial role for dopamine receptor 1 (D1-containing striatal MSNs in mediating psychostimulant induced plasticity changes. These D1-MSNs in the nucleus accumbens (NAc positively regulate drug seeking, reward, and locomotor behavioral effects as well as the morphological adaptations of psychostimulant drugs. Here, we demonstrate that rats that actively self-administer cocaine display reduced levels of Tiam1 in the NAc. To further examine the cell type specific contribution to these changes in Tiam1 we used optogenetics to selectively manipulate NAc D1-MSNs or dopamine receptor 2 (D2 expressing MSNs. We find that repeated ChR2 activation of D1-MSNs but not D2-MSNs caused a down-regulation of Tiam1 levels similar to the effects of cocaine. Further, activation of D2-MSNs, which caused a late blunted cocaine-mediated locomotor behavioral response, did not alter Tiam1 levels. We then examined the contribution of D1-MSNs to the cocaine-mediated decrease of Tiam1. Using the light activated chloride pump, eNpHR3.0, we selectively inhibited D1-MSNs during cocaine exposure, which resulted in a behavioral blockade of cocaine-induced locomotor sensitization. Moreover, inhibiting these NAc D1-MSNs during cocaine exposure reversed the down-regulation of Tiam1 gene expression and protein levels. These data demonstrate that altering activity in specific neural circuits with optogenetics can impact the underlying molecular substrates of psychostimulant mediated behavior and function.

  2. Endoglin-mediated suppression of prostate cancer invasion is regulated by activin and bone morphogenetic protein type II receptors.

    Directory of Open Access Journals (Sweden)

    Michael J Breen

    Full Text Available Mortality from prostate cancer (PCa is due to the formation of metastatic disease. Understanding how that process is regulated is therefore critical. We previously demonstrated that endoglin, a type III transforming growth factor β (TGFβ superfamily receptor, suppresses human PCa cell invasion and metastasis. Endoglin-mediated suppression of invasion was also shown by us to be dependent upon the type I TGFβ receptor, activin receptor-like kinase 2 (ALK2, and the downstream effector, Smad1. In this study we demonstrate for the first time that two type II TGFβ receptors are required for endoglin-mediated suppression of invasion: activin A receptor type IIA (ActRIIA and bone morphogenetic protein receptor type II (BMPRII. Downstream signaling through these receptors is predominantly mediated by Smad1. ActRIIA stimulates Smad1 activation in a kinase-dependent manner, and this is required for suppression of invasion. In contrast BMPRII regulates Smad1 in a biphasic manner, promoting Smad1 signaling through its kinase domain but suppressing it through its cytoplasmic tail. BMPRII's Smad1-regulatory effects are dependent upon its expression level. Further, its ability to suppress invasion is independent of either kinase function or tail domain. We demonstrate that ActRIIA and BMPRII physically interact, and that each also interacts with endoglin. The current findings demonstrate that both BMPRII and ActRIIA are necessary for endoglin-mediated suppression of human PCa cell invasion, that they have differential effects on Smad1 signaling, that they make separate contributions to regulation of invasion, and that they functionally and physically interact.

  3. The brain cytoplasmic RNA BC1 regulates dopamine D2 receptor-mediated transmission in the striatum.

    Science.gov (United States)

    Centonze, Diego; Rossi, Silvia; Napoli, Ilaria; Mercaldo, Valentina; Lacoux, Caroline; Ferrari, Francesca; Ciotti, Maria Teresa; De Chiara, Valentina; Prosperetti, Chiara; Maccarrone, Mauro; Fezza, Filomena; Calabresi, Paolo; Bernardi, Giorgio; Bagni, Claudia

    2007-08-15

    Dopamine D(2) receptor (D(2)DR)-mediated transmission in the striatum is remarkably flexible, and changes in its efficacy have been heavily implicated in a variety of physiological and pathological conditions. Although receptor-associated proteins are clearly involved in specific forms of synaptic plasticity, the molecular mechanisms regulating the sensitivity of D(2) receptors in this brain area are essentially obscure. We have studied the physiological responses of the D(2)DR stimulations in mice lacking the brain cytoplasmic RNA BC1, a small noncoding dendritically localized RNA that is supposed to play a role in mRNA translation. We show that the efficiency of D(2)-mediated transmission regulating striatal GABA synapses is under the control of BC1 RNA, through a negative influence on D(2) receptor protein level affecting the functional pool of receptors. Ablation of the BC1 gene did not result in widespread dysregulation of synaptic transmission, because the sensitivity of cannabinoid CB(1) receptors was intact in the striatum of BC1 knock-out (KO) mice despite D(2) and CB(1) receptors mediated similar electrophysiological actions. Interestingly, the fragile X mental retardation protein FMRP, one of the multiple BC1 partners, is not involved in the BC1 effects on the D(2)-mediated transmission. Because D(2)DR mRNA is apparently equally translated in the BC1-KO and wild-type mice, whereas the protein level is higher in BC1-KO mice, we suggest that BC1 RNA controls D(2)DR indirectly, probably regulating translation of molecules involved in D(2)DR turnover and/or stability.

  4. Role of proopiomelanocortin neuron Stat3 in regulating arterial pressure and mediating the chronic effects of leptin.

    Science.gov (United States)

    Dubinion, John H; do Carmo, Jussara M; Adi, Ahmad; Hamza, Shereen; da Silva, Alexandre A; Hall, John E

    2013-05-01

    Although signal transducer and activator of transcription 3 (Stat3) is a key second messenger by which leptin regulates appetite and body weight, its role in specific neuronal populations in metabolic regulation and in mediating the chronic effects of leptin on blood pressure is unknown. The current study tested the hypothesis that Stat3 signaling in proopiomelanocortin (POMC) neurons mediates the chronic effects of leptin on mean arterial pressure (MAP), as well as on glucose regulation, energy expenditure, and food intake. Stat3(flox/flox) mice were crossed with POMC-Cre mice to generate mice with Stat3 deletion specifically in POMC neurons (Stat3(flox/flox)/POMC-Cre). Oxygen consumption (Vo2), carbon dioxide respiration (Vco2), motor activity, heat production, food intake, and MAP were measured 24 hours/d. After baseline measurements, leptin was infused (4 μg/kg per min, IP) for 7 days. Stat3(flox/flox)/POMC-Cre mice were hyperphagic, heavier, and had increased respiratory quotients compared with control Stat3(flox/flox) mice. Baseline MAP was not different between the groups, and chronic leptin infusion reduced food intake similarly in both groups (27 versus 29%). Vo2, Vco2, and heat production responses to leptin were not significantly different in control and Stat3(flox/flox)/POMC-Cre mice. However, leptin-mediated increases in MAP were completely abolished, and blood pressure responses to acute air-jet stress were attenuated in male Stat3(flox/flox)/POMC-Cre mice. These results indicate that Stat3 signaling in POMC neurons is essential for leptin-mediated increases in MAP, but not for anorexic or thermogenic effects of leptin.

  5. Two conserved modules of Schizosaccharomyces pombe Mediator regulate distinct cellular pathways

    DEFF Research Database (Denmark)

    Linder, Tomas; Rasmussen, Nina; Samuelsen, Camilla O

    2008-01-01

    Mediator is an evolutionary conserved coregulator complex required for transcription of almost all RNA polymerase II-dependent genes. The Schizosaccharomyces pombe Mediator consists of two dissociable components-a core complex organized into a head and middle domain as well as the Cdk8 regulatory...... subcomplex. In this work we describe a functional characterization of the S. pombe Mediator. We report the identification of the S. pombe Med20 head subunit and the isolation of ts alleles of the core head subunit encoding med17+. Biochemical analysis of med8(ts), med17(ts), Deltamed18, Deltamed20...... and Deltamed27 alleles revealed a stepwise head domain molecular architecture. Phenotypical analysis of Cdk8 and head module alleles including expression profiling classified the Mediator mutant alleles into one of two groups. Cdk8 module mutants flocculate due to overexpression of adhesive cell...

  6. The Relationship of Spiritual Health with Quality of Life,Mental Health, and Burnout: The Mediating Role of Emotional Regulation

    Directory of Open Access Journals (Sweden)

    mehdi akbari

    2018-02-01

    Full Text Available Objective: The World Health Organization's definition of health now stands open to severe criticism due to changes in today's world and the accompanying mental void; in addition to physical, psychological, and social aspects, spiritual health and its interaction with the other aspects has been studied in scientific literature and recent research. The present study was conducted to investigate the mediating role of emotional regulation in the relationship between spiritual health with quality of life, psychological health, and burnout.Method: In this study, 231 staff from Baqiyatallah University of Medical Sciences completed Spiritual Well-Being Scale (SWBS, Difficulties in Emotion Regulation Scale (DERS, World Health Organization Quality of Life-BREF (WHOQOL-BREF, General Health Questionnaire-28 (GHQ-28, and Maslach Burnout Inventory (MBI. The gathered data were analyzed using Pearson correlation, Hierarchical Regression analysis, and Sobel’s test.Results: All variables were correlated with one another (p<0.001. The hierarchical regression analysis and Sobel’s test indicated that the emotional regulation have a relative mediating role in the relationship between spiritual health and quality of life (ß=0.53, Z=4.05, p<0.001 and a complete mediating role in the relationship between spiritual health with mental health (ß=0.68, Z=5.62, p<0.001 and burnout (ß=0.70, Z=6.12, p<0.001.Conclusion: There is a complex and non-linear relationship between spiritual health and the areas of quality of life, mental health and burnout. This relationship is potentially influenced by emotional regulation.

  7. SALT-RESPONSIVE ERF1 is a negative regulator of grain filling and gibberellin-mediated seedling establishment in rice.

    Science.gov (United States)

    Schmidt, Romy; Schippers, Jos H M; Mieulet, Delphine; Watanabe, Mutsumi; Hoefgen, Rainer; Guiderdoni, Emmanuel; Mueller-Roeber, Bernd

    2014-02-01

    Grain quality is an important agricultural trait that is mainly determined by grain size and composition. Here, we characterize the role of the rice transcription factor (TF) SALT-RESPONSIVE ERF1 (SERF1) during grain development. Through genome-wide expression profiling and chromatin immunoprecipitation, we found that SERF1 directly regulates RICE PROLAMIN-BOX BINDING FACTOR (RPBF), a TF that functions as a positive regulator of grain filling. Loss of SERF1 enhances RPBF expression resulting in larger grains with increased starch content, while SERF1 overexpression represses RPBF resulting in smaller grains. Consistently, during grain filling, starch biosynthesis genes such as GRANULE-BOUND STARCH SYNTHASEI (GBSSI), STARCH SYNTHASEI (SSI), SSIIIa, and ADP-GLUCOSE PYROPHOSPHORYLASE LARGE SUBUNIT2 (AGPL2) are up-regulated in SERF1 knockout grains. Moreover, SERF1 is a direct upstream regulator of GBSSI. In addition, SERF1 negatively regulates germination by controlling RPBF expression, which mediates the gibberellic acid (GA)-induced expression of RICE AMYLASE1A (RAmy1A). Loss of SERF1 results in more rapid seedling establishment, while SERF1 overexpression has the opposite effect. Our study reveals that SERF1 represents a negative regulator of grain filling and seedling establishment by timing the expression of RPBF.

  8. Childhood maltreatment severity and alcohol use in adult psychiatric inpatients: The mediating role of emotion regulation difficulties.

    Science.gov (United States)

    Dutcher, Christina D; Vujanovic, Anka A; Paulus, Daniel J; Bartlett, Brooke A

    2017-09-01

    Emotion regulation difficulties are a potentially key mechanism underlying the association between childhood maltreatment and alcohol use in adulthood. The current study examined the mediating role of emotion regulation difficulties in the association between childhood maltreatment severity (i.e., Childhood Trauma Questionnaire total score) and past-month alcohol use severity, including alcohol consumption frequency and alcohol-related problems (i.e., number of days of alcohol problems, ratings of "bother" caused by alcohol problems, ratings of treatment importance for alcohol problems). Participants included 111 acute-care psychiatric inpatients (45.0% female; Mage=33.5, SD=10.6), who reported at least one DSM-5 posttraumatic stress disorder Criterion A traumatic event, indexed via the Life Events Checklist for DSM-5. Participants completed questionnaires regarding childhood maltreatment, emotion regulation difficulties, and alcohol use. A significant indirect effect of childhood maltreatment severity via emotion regulation difficulties in relation to alcohol use severity (β=0.07, SE=0.04, 99% CI [0.01, 0.21]) was documented. Specifically, significant indirect effects were found for childhood maltreatment severity via emotion regulation difficulties in relation to alcohol problems (β's between 0.05 and 0.12; all 99% bootstrapped CIs with 10,000 resamples did not include 0) but not alcohol consumption. Emotion regulation difficulties may play a significant role in the association between childhood maltreatment severity and alcohol outcomes. Clinical implications are discussed. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Attachment style and emotional eating in bariatric surgery candidates: The mediating role of difficulties in emotion regulation.

    Science.gov (United States)

    Taube-Schiff, Marlene; Van Exan, Jessica; Tanaka, Rika; Wnuk, Susan; Hawa, Raed; Sockalingam, Sanjeev

    2015-08-01

    Difficulties with emotion regulation is a hypothesized mechanism through which attachment insecurity may affect emotional eating. No studies have yet investigated this effect in the bariatric population. Because many obese individuals engage in emotional eating, difficulty regulating emotion may be an important underlying mechanism through which attachment insecurity is linked to emotional eating in bariatric surgery candidates. In this cross-sectional study, 1393 adult bariatric surgery candidates from the Toronto Western Hospital were recruited to complete the Emotional Eating Scale (EES), Patient Health Questionnaire-9 (PHQ9), Generalized Anxiety Disorder-7 (GAD7), Difficulties in Emotion Regulation Scale (DERS), Eating Disorder Examination Questionnaire (EDE-Q), and the Experiences for Close Relationships 16-item Scale (ECR-16) in order to explore the mediating role of emotion regulation on the relationship between attachment insecurity and emotional eating. Path analysis within a structural equation modeling framework examined direct and indirect effects of attachment insecurity on emotional eating. The indices of this overall model indicated that the specified set of direct and indirect pathways and corresponding correlations were a good fit with the data (RMSEAemotional eating were significant. Findings suggest that difficulties in emotion regulation may be an important mechanism to consider when examining the association between attachment insecurity and emotional eating in adult bariatric surgery candidates. Although causality cannot be concluded, these results shed light on the important role that emotion regulation may have in predicting problematic eating in bariatric patients. Copyright © 2015. Published by Elsevier Ltd.

  10. VirF-Independent Regulation of Shigella virB Transcription is Mediated by the Small RNA RyhB

    Science.gov (United States)

    Broach, William H.; Egan, Nicholas; Wing, Helen J.; Payne, Shelley M.; Murphy, Erin R.

    2012-01-01

    Infection of the human host by Shigella species requires the coordinated production of specific Shigella virulence factors, a process mediated largely by the VirF/VirB regulatory cascade. VirF promotes the transcription of virB, a gene encoding the transcriptional activator of several virulence-associated genes. This study reveals that transcription of virB is also regulated by the small RNA RyhB, and importantly, that this regulation is not achieved indirectly via modulation of VirF activity. These data are the first to demonstrate that the regulation of virB transcription can be uncoupled from the master regulator VirF. It is also established that efficient RyhB-dependent regulation of transcription is facilitated by specific nucleic acid sequences within virB. This study not only reveals RyhB-dependent regulation of virB transcription as a novel point of control in the central regulatory circuit modulating Shigella virulence, but also highlights the versatility of RyhB in controlling bacterial gene expression. PMID:22701677

  11. Understanding the social effects of emotion regulation: the mediating role of authenticity for individual differences in suppression.

    Science.gov (United States)

    English, Tammy; John, Oliver P

    2013-04-01

    Individuals differ in the strategies they use to regulate their emotions (e.g., suppression, reappraisal), and these regulatory strategies can differentially influence social outcomes. However, the mechanisms underlying these social effects remain to be specified. We examined one potential mediator that arises directly from emotion-regulatory effort (expression of positive emotion), and another mediator that does not involve emotion processes per se, but instead results from the link between regulation and self-processes (subjective inauthenticity). Across three studies, only inauthenticity mediated the link between habitual use of suppression and poor social functioning (lower relationship satisfaction, lower social support). These findings replicated across individuals socialized in Western and East Asian cultural contexts, younger and older adults, when predicting social functioning concurrently and a decade later, and even when broader adjustment was controlled. Thus, the social costs of suppression do not seem to be due to reduced positive emotion expression but rather the incongruence between inner-self and outer-behavior. Reappraisal was not consistently related to social functioning. Implications of these findings for emotion processes, self processes, and interpersonal relationships are discussed. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  12. PTSD, food addiction, and disordered eating in a sample of primarily older veterans: The mediating role of emotion regulation.

    Science.gov (United States)

    Mitchell, Karen S; Wolf, Erika J

    2016-09-30

    Posttraumatic stress disorder (PTSD) has been associated with eating disorders (EDs) and addictive behaviors, including the relatively new construct food addiction. However, few studies have investigated mechanisms that account for these associations, and men are underrepresented in studies of EDs and food addiction. We examined whether lifetime PTSD symptoms were associated with current food addiction and ED symptoms, and whether emotion regulation (expressive suppression and cognitive reappraisal), which has been associated with both PTSD and EDs, mediated these relations, in a sample of trauma-exposed, male (n=642) and female (n=55) veterans. Participants were recruited from the Knowledge Networks-GfK Research Panel and completed an online questionnaire. Structural equation modeling revealed that PTSD was directly associated with ED symptoms, food addiction, expressive suppression, and cognitive reappraisal in the full sample and with all constructs except cognitive reappraisal in the male subsample. Expressive suppression was significantly associated with ED symptoms and mediated the PTSD-ED relation. These results highlight the importance of investigating PTSD as a risk factor for food addiction and ED symptoms and the potential mediating role of emotion regulation in the development of PTSD and EDs in order to identify targets for treatments. Published by Elsevier Ireland Ltd.

  13. Post-intervention effects on screen behaviours and mediating effect of parental regulation: the HEalth In Adolescents study - a multi-component school-based randomized controlled trial

    NARCIS (Netherlands)

    Bergh, I.H.; van Stralen, M.M.; Bjelland, M.; Grydeland, M.; Lien, N.; Klepp, K.I.; Anderssen, S.A.; Ommundsen, Y.

    2014-01-01

    Background: To improve effectiveness of future screen behaviour interventions, one needs to know whether an intervention works via the proposed mediating mechanisms and whether the intervention is equally effective among subgroups. Parental regulation is identified as a consistent correlate of

  14. Psychological flexibility mediates change in intuitive eating regulation in acceptance and commitment therapy interventions.

    Science.gov (United States)

    Sairanen, Essi; Tolvanen, Asko; Karhunen, Leila; Kolehmainen, Marjukka; Järvelä-Reijonen, Elina; Lindroos, Sanni; Peuhkuri, Katri; Korpela, Riitta; Ermes, Miikka; Mattila, Elina; Lappalainen, Raimo

    2017-06-01

    Despite the promising results related to intuitive eating, few studies have attempted to explain the processes encouraging this adaptive eating behaviour. The focus of the present study was on exploring mechanisms of change in intuitive eating and weight in acceptance and commitment therapy (ACT) interventions. Mediation provides important information regarding the treatment processes and theoretical models related to specific treatment approaches. The study investigates whether psychological flexibility, mindfulness skills and sense of coherence mediated the interventions' effect on intuitive eating and weight. Secondary analysis of a randomized control trial. Mediation analysis compared two ACT interventions - face-to-face (in a group) and mobile (individually) - with a control group using a latent difference score model. Settings Data were collected in three Finnish towns. The participants were overweight or obese (n 219), reporting symptoms of perceived stress. The effect of the interventions on participants' (i) BMI, (ii) intuitive eating and its subscales, (iii) eating for physical rather than emotional reasons and (iv) reliance on internal hunger and satiety cues was mediated by changes in weight-related psychological flexibility in both ACT groups. These findings suggest that ACT interventions aiming for lifestyle changes mediate the intervention effects through the enhanced ability to continue with valued activities even when confronted with negative emotions and thoughts related to weight.

  15. Neural cell adhesion molecule-180-mediated homophilic binding induces epidermal growth factor receptor (EGFR) down-regulation and uncouples the inhibitory function of EGFR in neurite outgrowth

    DEFF Research Database (Denmark)

    Povlsen, Gro Klitgaard; Berezin, Vladimir; Bock, Elisabeth

    2008-01-01

    The neural cell adhesion molecule (NCAM) plays important roles in neuronal development, regeneration, and synaptic plasticity. NCAM homophilic binding mediates cell adhesion and induces intracellular signals, in which the fibroblast growth factor receptor plays a prominent role. Recent studies...... this NCAM-180-induced EGFR down-regulation involves increased EGFR ubiquitination and lysosomal EGFR degradation. Furthermore, NCAM-180-mediated EGFR down-regulation requires NCAM homophilic binding and interactions of the cytoplasmic domain of NCAM-180 with intracellular interaction partners, but does...

  16. Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide

    OpenAIRE

    Fomenko, Dmitri E.; Koc, Ahmet; Agisheva, Natalia; Jacobsen, Michael; Kaya, Alaattin; Malinouski, Mikalai; Rutherford, Julian C.; Siu, Kam-Leung; Jin, Dong-Yan; Winge, Dennis R.; Gladyshev, Vadim N.

    2011-01-01

    Hydrogen peroxide is thought to regulate cellular processes by direct oxidation of numerous cellular proteins, whereas antioxidants, most notably thiol peroxidases, are thought to reduce peroxides and inhibit H2O2 response. However, thiol peroxidases have also been implicated in activation of transcription factors and signaling. It remains unclear if these enzymes stimulate or inhibit redox regulation and whether this regulation is widespread or limited to a few cellular components. Herein, w...

  17. Self-regulation as a mediator between sibling relationship quality and early adolescents' positive and negative outcomes.

    Science.gov (United States)

    Padilla-Walker, Laura M; Harper, James M; Jensen, Alexander C

    2010-08-01

    The current study examined the role of adolescents' self-regulation as a mediator between sibling relationship quality and adolescent outcomes, after controlling for the quality of the parent-child relationship. Participants were 395 families (282 two parent; 113 single parent) with an adolescent child (M age of child at Time 1 = 11.15, SD = .96, 49% female) who took part in [project name masked for blind review] at both Time 1 and Time 2. Path analysis via structural equation modeling suggested that sibling affection was longitudinally and positively related to self-regulation and prosocial behaviors, and negatively related to externalizing behaviors; while sibling hostility was positively, and having a sister was negatively related to internalizing behaviors (in general, paths were stronger for adolescents from two- vs. single-parent families). There was also evidence that adolescents' self-regulation partially mediated the relation between sibling affection and positive and negative adolescent outcomes. The discussion focuses on the importance of continued research examining the mechanisms through which the sibling relationship influences development during adolescence.

  18. Adverse Life Experience and Psychological Distress in Adolescence: Moderating and Mediating Effects of Emotion Regulation and Rumination.

    Science.gov (United States)

    Boyes, Mark E; Hasking, Penelope A; Martin, Graham

    2016-10-01

    The current study tested whether emotion regulation and rumination moderated and/or mediated the relationship between accumulated adverse life experience and psychological distress in adolescence. In class, Australian high school students (n = 2637, 12-18 years, 68% female) from 41 schools completed well-validated measures of adverse life experience, emotion regulation, rumination and psychological distress, and were followed up 1 year later (n = 1973, 75% retention rate). Adjusting for age, gender and baseline psychological distress, adverse life experience predicted psychological distress 1 year later. Expressive suppression and rumination were positively associated with psychological distress. Cognitive reappraisal was negatively associated with psychological distress and moderated the relationship between adverse life experience and psychological distress. This relationship was also partially mediated by cognitive reappraisal, expressive suppression and rumination. Promoting cognitive reappraisal and minimizing expressive suppression and rumination may be useful strategies to improve mental health for adolescents who have experienced adverse life events. Future research should examine whether adolescents who have experienced adverse life events can be trained in effective emotion regulation strategies and whether this training can prevent development of psychological maladjustment. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  19. TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål).

    Science.gov (United States)

    Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang

    2016-03-28

    The "target of rapamycin" (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens.

  20. RISC-mediated control of selected chromatin regulators stabilizes ground state pluripotency of mouse embryonic stem cells.

    Science.gov (United States)

    Pandolfini, Luca; Luzi, Ettore; Bressan, Dario; Ucciferri, Nadia; Bertacchi, Michele; Brandi, Rossella; Rocchiccioli, Silvia; D'Onofrio, Mara; Cremisi, Federico

    2016-05-06

    Embryonic stem cells are intrinsically unstable and differentiate spontaneously if they are not shielded from external stimuli. Although the nature of such instability is still controversial, growing evidence suggests that protein translation control may play a crucial role. We performed an integrated analysis of RNA and proteins at the transition between naïve embryonic stem cells and cells primed to differentiate. During this transition, mRNAs coding for chromatin regulators are specifically released from translational inhibition mediated by RNA-induced silencing complex (RISC). This suggests that, prior to differentiation, the propensity of embryonic stem cells to change their epigenetic status is hampered by RNA interference. The expression of these chromatin regulators is reinstated following acute inactivation of RISC and it correlates with loss of stemness markers and activation of early cell differentiation markers in treated embryonic stem cells. We propose that RISC-mediated inhibition of specific sets of chromatin regulators is a primary mechanism for preserving embryonic stem cell pluripotency while inhibiting the onset of embryonic developmental programs.

  1. Down-regulation of inflammatory mediator synthesis and infiltration of inflammatory cells by MMP-3 in experimentally induced rat pulpitis.

    Science.gov (United States)

    Takimoto, Koyo; Kawashima, Nobuyuki; Suzuki, Noriyuki; Koizumi, Yu; Yamamoto, Mioko; Nakashima, Misako; Suda, Hideaki

    2014-09-01

    Matrix metalloproteinase (MMP)-3 is a member of the MMP family that degrades the extracellular matrix. Application of MMP-3 to injured pulp tissue induces angiogenesis and wound healing, but its anti-inflammatory effects are still unclear. Here, we evaluated the anti-inflammatory functions of MMP-3 in vitro and in vivo. Nitric oxide and inflammatory mediator synthesis in macrophages activated by lipopolysaccharide (LPS) was measured in the presence or absence of MMP-3. The mouse Mmp3 (mMmp3) expression vector containing full length cDNA sequence of mMmp3 or cDNA sequence of mMmp3 missing the signal peptide and pro-peptide regions was transfected to RAW264, a mouse macrophage cell line, and NO synthesis and inflammatory mediator expression were evaluated. Pulpal inflammation was histologically and immunohistochemically evaluated in a rat model of incisor pulpitis induced by the application of LPS for 9 hours in the presence or absence of MMP-3. NO and pro-inflammatory mediator synthesis promoted by LPS was significantly down-regulated by MMP-3 in vitro. The full length of mMmp3 down-regulated the LPS-induced NO synthesis and chemical mediator mRNA expression, however the mMmp3 missing the signal peptide failed to block the NO synthesis induced by LPS. The numbers of major histocompatibility complex class II+ and CD68+ cells, which infiltrated into the rat incisor pulp tissues in response to the topical application of LPS, were significantly decreased by the application of MMP-3 in vivo. These results indicate that MMP-3 possesses anti-inflammatory functions, suggesting its potential utility as an anti-inflammatory agent for pulpal inflammation. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  2. Fisetin Induces Apoptosis Through p53-Mediated Up-Regulation of DR5 Expression in Human Renal Carcinoma Caki Cells

    Directory of Open Access Journals (Sweden)

    Kyoung-jin Min

    2017-08-01

    Full Text Available Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose polymerase (PARP, which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5 expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.

  3. Fisetin Induces Apoptosis Through p53-Mediated Up-Regulation of DR5 Expression in Human Renal Carcinoma Caki Cells.

    Science.gov (United States)

    Min, Kyoung-Jin; Nam, Ju-Ock; Kwon, Taeg Kyu

    2017-08-02

    Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki) cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose) polymerase (PARP), which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk) inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5) expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.

  4. The mediational pathway among parenting styles, attachment styles and self-regulation with addiction susceptibility of adolescents.

    Science.gov (United States)

    Zeinali, Ali; Sharifi, Hassanpasha; Enayati, Mirsalahadine; Asgari, Parviz; Pasha, Gohlamreza

    2011-09-01

    The purpose of present study was to create and test a model that illustrates variables that influence the development of addiction susceptibility and determine how different styles of parenting may indirectly influence the addiction susceptibility of children through the mediators of attachment style and self-regulation. Using random cluster sampling, 508 adolescent high school boys and girls aged 14-19 years were enrolled. Data were analyzed using structural equations modeling (path analysis). The results showed that authoritative and permissive parenting styles were associated with secure attachment whereas authoritarian and neglectful parenting styles were associated with insecure attachment. Insecure attachment was associated with a low level of self-regulation whereas secure attachment was associated with a high level of self-regulation. We found that a low level of self-regulation increased the adolescent's addiction susceptibility whereas a high level of self-regulation decreased their addiction susceptibility. The findings of present study suggest the authoritative and permissive parenting styles as the most efficient styles and authoritarian and neglectful parenting styles as the most inefficient styles in terms of addiction susceptibility. Accordingly, efficient parenting style training to parents should be the main goal of drug demand reduction program.

  5. The mediational pathway among parenting styles, attachment styles and self-regulation with addiction susceptibility of adolescents*

    Science.gov (United States)

    Zeinali, Ali; Sharifi, Hassanpasha; Enayati, Mirsalahadine; Asgari, Parviz; Pasha, Gohlamreza

    2011-01-01

    BACKGROUND: The purpose of present study was to create and test a model that illustrates variables that influence the development of addiction susceptibility and determine how different styles of parenting may indirectly influence the addiction susceptibility of children through the mediators of attachment style and self-regulation. METHODS: Using random cluster sampling, 508 adolescent high school boys and girls aged 14-19 years were enrolled. Data were analyzed using structural equations modeling (path analysis). RESULTS: The results showed that authoritative and permissive parenting styles were associated with secure attachment whereas authoritarian and neglectful parenting styles were associated with insecure attachment. Insecure attachment was associated with a low level of self-regulation whereas secure attachment was associated with a high level of self-regulation. We found that a low level of self-regulation increased the adolescent's addiction susceptibility whereas a high level of self-regulation decreased their addiction susceptibility. CONCLUSIONS: The findings of present study suggest the authoritative and permissive parenting styles as the most efficient styles and authoritarian and neglectful parenting styles as the most inefficient styles in terms of addiction susceptibility. Accordingly, efficient parenting style training to parents should be the main goal of drug demand reduction program. PMID:22973379

  6. miRNA and mRNA Expression Profiles Reveal Insight into Chitosan-Mediated Regulation of Plant Growth.

    Science.gov (United States)

    Zhang, Xiaoqian; Li, Kecheng; Xing, Ronge; Liu, Song; Chen, Xiaolin; Yang, Haoyue; Li, Pengcheng

    2018-04-18

    Chitosan has been numerously studied as a plant growth regulator and stress tolerance inducer. To investigate the roles of chitosan as bioregulator on plant and unravel its possible metabolic responses mechanisms, we simultaneously investigated mRNAs and microRNAs (miRNAs) expression profiles of wheat seedlings in response to chitosan heptamer. We found 400 chitosan-responsive differentially expressed genes, including 268 up-regulated and 132 down-regulated mRNAs, many of which were related to photosynthesis, primary carbon and nitrogen metabolism, defense responses, and transcription factors. Moreover, miRNAs also participate in chitosan-mediated regulation on plant growth. We identified 87 known and 21 novel miRNAs, among which 56 miRNAs were induced or repressed by chitosan heptamer, such as miRNA156, miRNA159a, miRNA164, miRNA171a, miRNA319, and miRNA1127. The integrative analysis of miRNA and mRNA expression profiles in this case provides fundamental information for further investigation of regulation mechanisms of chitosan on plant growth and will facilitate its application in agriculture.

  7. Extracellular signal-regulated kinase 2 (ERK-2) mediated phosphorylation regulates nucleo-cytoplasmic shuttling and cell growth control of Ras-associated tumor suppressor protein, RASSF2

    International Nuclear Information System (INIS)

    Kumari, Gita; Mahalingam, S.

    2009-01-01

    Ras GTPase controls the normal cell growth through binding with an array of effector molecules, such as Raf and PI3-kinase in a GTP-dependent manner. RASSF2, a member of the Ras association domain family, is known to be involved in the suppression of cell growth and is frequently down-regulated in various tumor tissues by promoter hypermethylation. In the present study, we demonstrate that RASSF2 shuttles between nucleus and cytoplasm by a signal-mediated process and its export from the nucleus is sensitive to leptomycin B. Amino acids between 240 to 260 in the C-terminus of RASSF2 harbor a functional nuclear export signal (NES), which is necessary and sufficient for efficient export of RASSF2 from the nucleus. Substitution of conserved Ile254, Val257 and Leu259 within the minimal NES impaired RASSF2 export from the nucleus. In addition, wild type but not the nuclear export defective RASSF2 mutant interacts with export receptor, CRM-1 and exported from the nucleus. Surprisingly, we observed nucleolar localization for the nuclear export defective mutant suggesting the possibility that RASSF2 may localize in different cellular compartments transiently in a cell cycle dependent manner and the observed nuclear localization for wild type protein may be due to faster export kinetics from the nucleolus. Furthermore, our data suggest that RASSF2 is specifically phosphorylated by MAPK/ERK-2 and the inhibitors of MAPK pathway impair the phosphorylation and subsequently block the export of RASSF2 from the nucleus. These data clearly suggest that ERK-2 mediated phosphorylation plays an important role in regulating the nucleo-cytoplasmic shuttling of RASSF2. Interestingly, nuclear import defective mutant of RASSF2 failed to induce cell cycle arrest at G1/S phase and apoptosis suggesting that RASSF2 regulates cell growth in a nuclear localization dependent manner. Collectively, these data provided evidence for the first time that MAPK/ERK-2 mediated phosphorylation regulates

  8. Extracellular signal-regulated kinase 2 (ERK-2) mediated phosphorylation regulates nucleo-cytoplasmic shuttling and cell growth control of Ras-associated tumor suppressor protein, RASSF2

    Energy Technology Data Exchange (ETDEWEB)

    Kumari, Gita [Laboratory of Molecular Virology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad 500076 (India); Mahalingam, S., E-mail: mahalingam@iitm.ac.in [Laboratory of Molecular Virology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad 500076 (India); Department of Biotechnology, Laboratory of Molecular Virology and Cell Biology, Indian Institute of Technology-Madras, Chennai 600 036 (India)

    2009-10-01

    Ras GTPase controls the normal cell growth through binding with an array of effector molecules, such as Raf and PI3-kinase in a GTP-dependent manner. RASSF2, a member of the Ras association domain family, is known to be involved in the suppression of cell growth and is frequently down-regulated in various tumor tissues by promoter hypermethylation. In the present study, we demonstrate that RASSF2 shuttles between nucleus and cytoplasm by a signal-mediated process and its export from the nucleus is sensitive to leptomycin B. Amino acids between 240 to 260 in the C-terminus of RASSF2 harbor a functional nuclear export signal (NES), which is necessary and sufficient for efficient export of RASSF2 from the nucleus. Substitution of conserved Ile254, Val257 and Leu259 within the minimal NES impaired RASSF2 export from the nucleus. In addition, wild type but not the nuclear export defective RASSF2 mutant interacts with export receptor, CRM-1 and exported from the nucleus. Surprisingly, we observed nucleolar localization for the nuclear export defective mutant suggesting the possibility that RASSF2 may localize in different cellular compartments transiently in a cell cycle dependent manner and the observed nuclear localization for wild type protein may be due to faster export kinetics from the nucleolus. Furthermore, our data suggest that RASSF2 is specifically phosphorylated by MAPK/ERK-2 and the inhibitors of MAPK pathway impair the phosphorylation and subsequently block the export of RASSF2 from the nucleus. These data clearly suggest that ERK-2 mediated phosphorylation plays an important role in regulating the nucleo-cytoplasmic shuttling of RASSF2. Interestingly, nuclear import defective mutant of RASSF2 failed to induce cell cycle arrest at G1/S phase and apoptosis suggesting that RASSF2 regulates cell growth in a nuclear localization dependent manner. Collectively, these data provided evidence for the first time that MAPK/ERK-2 mediated phosphorylation regulates

  9. Current knowledge of microRNA-mediated regulation of drug metabolism in humans.

    Science.gov (United States)

    Nakano, Masataka; Nakajima, Miki

    2018-05-01

    Understanding the factors causing inter- and intra-individual differences in drug metabolism potencies is required for the practice of personalized or precision medicine, as well as for the promotion of efficient drug development. The expression of drug-metabolizing enzymes is controlled by transcriptional regulation by nuclear receptors and transcriptional factors, epigenetic regulation, such as DNA methylation and histone acetylation, and post-translational modification. In addition to such regulation mechanisms, recent studies revealed that microRNAs (miRNAs), endogenous ~22-nucleotide non-coding RNAs that regulate gene expression through the translational repression and degradation of mRNAs, significantly contribute to post-transcriptional regulation of drug-metabolizing enzymes. Areas covered: This review summarizes the current knowledge regarding miRNAs-dependent regulation of drug-metabolizing enzymes and transcriptional factors and its physiological and clinical significance. We also describe recent advances in miRNA-dependent regulation research, showing that the presence of pseudogenes, single-nucleotide polymorphisms, and RNA editing affects miRNA targeting. Expert opinion: It is unwavering fact that miRNAs are critical factors causing inter- and intra-individual differences in the expression of drug-metabolizing enzymes. Consideration of miRNA-dependent regulation would be a helpful tool for optimizing personalized and precision medicine.

  10. The Mediating Role of Metacognition in the Relationship between Executive Function and Self-Regulated Learning

    Science.gov (United States)

    Follmer, D. Jake; Sperling, Rayne A.

    2016-01-01

    Background: Researchers have demonstrated significant relations among executive function, metacognition, and self-regulated learning. However, prior research emphasized the use of indirect measures of executive function and did not evaluate how specific executive functions are related to participants' self-regulated learning. Aims: The primary…

  11. MicroRNA-301a mediated regulation of Kv4.2 in diabetes: identification of key modulators.

    Directory of Open Access Journals (Sweden)

    Siva K Panguluri

    Full Text Available Diabetes is a metabolic disorder that ultimately results in major pathophysiological complications in the cardiovascular system. Diabetics are predisposed to higher incidences of sudden cardiac deaths (SCD. Several studies have associated diabetes as a major underlying risk for heart diseases and its complications. The diabetic heart undergoes remodeling to cope up with the underlying changes, however ultimately fails. In the present study we investigated the changes associated with a key ion channel and transcriptional factors in a diabetic heart model. In the mouse db/db model, we identified key transcriptional regulators and mediators that play important roles in the regulation of ion channel expression. Voltage-gated potassium channel (Kv4.2 is modulated in diabetes and is down regulated. We hypothesized that Kv4.2 expression is altered by potassium channel interacting protein-2 (KChIP2 which is regulated upstream by NFkB and miR-301a. We utilized qRT-PCR analysis and identified the genes that are affected in diabetes in a regional specific manner in the heart. At protein level we identified and validated differential expression of Kv4.2 and KChIP2 along with NFkB in both ventricles of diabetic hearts. In addition, we identified up-regulation of miR-301a in diabetic ventricles. We utilized loss and gain of function approaches to identify and validate the role of miR-301a in regulating Kv4.2. Based on in vivo and in vitro studies we conclude that miR-301a may be a central regulator for the expression of Kv4.2 in diabetes. This miR-301 mediated regulation of Kv4.2 is independent of NFkB and Irx5 and modulates Kv4.2 by direct binding on Kv4.2 3'untranslated region (3'-UTR. Therefore targeting miR-301a may offer new potential for developing therapeutic approaches.

  12. Evidence for autocrine and paracrine regulation of allergen-induced mast cell mediator release in the guinea pig airways.

    Science.gov (United States)

    Yu, Li; Liu, Qi; Canning, Brendan J

    2018-03-05

    Mast cells play an essential role in immediate type hypersensitivity reactions and in chronic allergic diseases of the airways, including asthma. Mast cell mediator release can be modulated by locally released autacoids and circulating hormones, but surprisingly little is known about the autocrine effects of mediators released upon mast cell activation. We thus set out to characterize the autocrine and paracrine effects of mast cell mediators on mast cell activation in the guinea pig airways. By direct measures of histamine, cysteinyl-leukotriene and thromboxane release and with studies of allergen-evoked contractions of airway smooth muscle, we describe a complex interplay amongst these autacoids. Notably, we observed an autocrine effect of the cysteinyl-leukotrienes acting through cysLT 1 receptors on mast cell leukotriene release. We confirmed the results of previous studies demonstrating a marked enhancement of mast cell mediator release following cyclooxygenase inhibition, but we have extended these results by showing that COX-2 derived eicosanoids inhibit cysteinyl-leukotriene release and yet are without effect on histamine release. Given the prominent role of COX-1 inhibition in aspirin-sensitive asthma, these data implicate preformed mediators stored in granules as the initial drivers of these adverse reactions. Finally, we describe the paracrine signaling cascade leading to thromboxane synthesis in the guinea pig airways following allergen challenge, which occurs indirectly, secondary to cysLT 1 receptor activation on structural cells and/ or leukocytes within the airway wall, and a COX-2 dependent synthesis of the eicosanoid. The results highlight the importance of cell-cell and autocrine interactions in regulating allergic responses in the airways. Copyright © 2017. Published by Elsevier B.V.

  13. Microtubule Regulation of Kv7 Channels Orchestrates cAMP-Mediated Vasorelaxations in Rat Arterial Smooth Muscle

    DEFF Research Database (Denmark)

    Lindman, Johanna; Khammy, Makhala M; Lundegaard, Pia R

    2018-01-01

    Microtubules can regulate GPCR (G protein-coupled receptor) signaling in various cell types. In vascular smooth muscle, activation of the β-adrenoceptor leads to production of cAMP to mediate a vasorelaxation. Little is known about the role of microtubules in smooth muscle, and given the importance...... of renal and mesenteric arteries that the microtubule stabilizer, paclitaxel, prevented. Sharp microelectrode experiments showed that colchicine treatment caused increased hyperpolarization of mesenteric artery segments in response to isoprenaline. Application of the Kv7 channel blocker, XE991, attenuated...

  14. Intragenomic matching reveals a huge potential for miRNA-mediated regulation in plants

    DEFF Research Database (Denmark)

    Lindow, Morten; Jacobsen, Anders; Nygaard, Sanne

    2007-01-01

    indicates that only a few of the candidates are conserved between the species. We conclude that there is a large potential for miRNA-mediated regulatory interactions encoded in the genomes of the investigated plants. We hypothesize that some of these interactions may be realized under special environmental...

  15. TUSC5 regulates insulin-mediated adipose tissue glucose uptake by modulation of GLUT4 recycling

    Directory of Open Access Journals (Sweden)

    Nigel Beaton

    2015-11-01

    Conclusions: Collectively, these findings establish TUSC5 as an adipose tissue-specific protein that enables proper protein recycling, linking the ubiquitous vesicle traffic machinery with tissue-specific insulin-mediated glucose uptake into adipose tissue and the maintenance of a healthy metabolic phenotype in mice and humans.

  16. Self-Regulation Mediates the Link between Family Context and Socioemotional Competence in Turkish Preschoolers

    Science.gov (United States)

    Gündüz, Gizem; Yagmurlu, Bilge; Harma, Mehmet

    2015-01-01

    Research Findings: In this study, we examined self-regulatory skills, namely, effortful control and executive function, in Turkish preschoolers (N = 217) and their mediating roles in the associations between parenting and children's socioemotional competence. We also investigated the role of family socioeconomic status and maternal psychological…

  17. Protein Kinase C-{delta} mediates down-regulation of heterogeneous nuclear ribonucleoprotein K protein: involvement in apoptosis induction

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Feng-Hou [NO.3 People' s Hospital affiliated to Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 201900 (China); The Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of National Ministry of Education, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200025 (China); Wu, Ying-Li [The Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of National Ministry of Education, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200025 (China); Zhao, Meng [Institute of Health Science, SJTU-SM/Shanghai Institutes for Biological Science, Chinese Academy of Sciences, Shanghai (China); Liu, Chuan-Xu; Wang, Li-Shun [The Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of National Ministry of Education, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200025 (China); Chen, Guo-Qiang, E-mail: chengq@shsmu.edu.cn [The Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of National Ministry of Education, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200025 (China); Institute of Health Science, SJTU-SM/Shanghai Institutes for Biological Science, Chinese Academy of Sciences, Shanghai (China)

    2009-11-15

    We reported previously that NSC606985, a camptothecin analogue, induces apoptosis of acute myeloid leukemia (AML) cells through proteolytic activation of protein kinase C delta ({Delta}PKC-{delta}). By subcellular proteome analysis, heterogeneous nuclear ribonucleoprotein K (hnRNP K) was identified as being significantly down-regulated in NSC606985-treated leukemic NB4 cells. HnRNP K, a docking protein for DNA, RNA, and transcriptional or translational molecules, is implicated in a host of processes involving the regulation of gene expression. However, the molecular mechanisms of hnRNP K reduction and its roles during apoptosis are still not understood. In the present study, we found that, following the appearance of the {Delta}PKC-{delta}, hnRNP K protein was significantly down-regulated in NSC606985, doxorubicin, arsenic trioxide and ultraviolet-induced apoptosis. We further provided evidence that {Delta}PKC-{delta} mediated the down-regulation of hnRNP K protein during apoptosis: PKC-{delta} inhibitor could rescue the reduction of hnRNP K; hnRNP K failed to be decreased in PKC-{delta}-deficient apoptotic KG1a cells; conditional induction of {Delta}PKC-{delta} in U937T cells directly down-regulated hnRNP K protein. Moreover, the proteasome inhibitor also inhibited the down-regulation of hnRNP K protein by apoptosis inducer and the conditional expression of {Delta}PKC-{delta}. More intriguingly, the suppression of hnRNP K with siRNA transfection significantly induced apoptosis. To our knowledge, this is the first demonstration that proteolytically activated PKC-{delta} down-regulates hnRNP K protein in a proteasome-dependent manner, which plays an important role in apoptosis induction.

  18. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  19. Canonical TGF-β Signaling Negatively Regulates Neuronal Morphogenesis through TGIF/Smad Complex-Mediated CRMP2 Suppression.

    Science.gov (United States)

    Nakashima, Hideyuki; Tsujimura, Keita; Irie, Koichiro; Ishizu, Masataka; Pan, Miao; Kameda, Tomonori; Nakashima, Kinichi

    2018-05-16

    Functional neuronal connectivity requires proper neuronal morphogenesis and its dysregulation causes neurodevelopmental diseases. Transforming growth factor-β (TGF-β) family cytokines play pivotal roles in development, but little is known about their contribution to morphological development of neurons. Here we show that the Smad-dependent canonical signaling of TGF-β family cytokines negatively regulates neuronal morphogenesis during brain development. Mechanistically, activated Smads form a complex with transcriptional repressor TG-interacting factor (TGIF), and downregulate the expression of a neuronal polarity regulator, collapsin response mediator protein 2. We also demonstrate that TGF-β family signaling inhibits neurite elongation of human induced pluripotent stem cell-derived neurons. Furthermore, the expression of TGF-β receptor 1, Smad4, or TGIF, which have mutations found in patients with neurodevelopmental disorders, disrupted neuronal morphogenesis in both mouse (male and female) and human (female) neurons. Together, these findings suggest that the regulation of neuronal morphogenesis by an evolutionarily conserved function of TGF-β signaling is involved in the pathogenesis of neurodevelopmental diseases. SIGNIFICANCE STATEMENT Canonical transforming growth factor-β (TGF-β) signaling plays a crucial role in multiple organ development, including brain, and mutations in components of the signaling pathway associated with several human developmental disorders. In this study, we found that Smads/TG-interacting factor-dependent canonical TGF-β signaling regulates neuronal morphogenesis through the suppression of collapsin response mediator protein-2 (CRMP2) expression during brain development, and that function of this signaling is evolutionarily conserved in the mammalian brain. Mutations in canonical TGF-β signaling factors identified in patients with neurodevelopmental disorders disrupt the morphological development of neurons. Thus, our

  20. Transcriptional regulator-mediated activation of adaptation genes triggers CRISPR de novo spacer acquisition

    DEFF Research Database (Denmark)

    Liu, Tao; Li, Yingjun; Wang, Xiaodi

    2015-01-01

    Acquisition of de novo spacer sequences confers CRISPR-Cas with a memory to defend against invading genetic elements. However, the mechanism of regulation of CRISPR spacer acquisition remains unknown. Here we examine the transcriptional regulation of the conserved spacer acquisition genes in Type I......, it was demonstrated that the transcription level of csa1, cas1, cas2 and cas4 was significantly enhanced in a csa3a-overexpression strain and, moreover, the Csa1 and Cas1 protein levels were increased in this strain. Furthermore, we demonstrated the hyperactive uptake of unique spacers within both CRISPR loci...... in the presence of the csa3a overexpression vector. The spacer acquisition process is dependent on the CCN PAM sequence and protospacer selection is random and non-directional. These results suggested a regulation mechanism of CRISPR spacer acquisition where a single transcriptional regulator senses the presence...

  1. Lipid Bilayer – mediated Regulation of Ion Channel Function by Amphiphilic Drugs

    DEFF Research Database (Denmark)

    Lundbæk, Jens August

    2008-01-01

    that are transforming it into a subject of quantitative science. It is described how the hydrophobic interactions between a membrane protein and the host lipid bilayer provide the basis for a mechanism, whereby protein function is regulated by the bilayer physical properties. The use of gramicidin channels as single-molecule......Drugs that at pico- to nanomolar concentration regulate ion channel function by high-affi nity binding to their cognate receptor often have a “ secondary pharmacology, ” in which the same molecule at low micromolar concentrations regulates a diversity of membrane proteins in an apparently...... nonspecifi c manner. It has long been suspected that this promiscuous regulation of membrane protein function could be due to changes in the physical properties of the host lipid bilayer, but the underlying mechanisms have been poorly understood. Given that pharmacological research often involves drug...

  2. Preventing Cartilage Degeneration in Warfighters by Elucidating Novel Mechanisms Regulating Osteocyte-Mediated Perilacunar Bone Remodeling

    Science.gov (United States)

    2016-10-01

    hypothesis using mouse models and human PTOA tissue. We aim to determine: 1) the extent to which mechanical loading regulates PLR in a TGFβ- dependent manner ...the major goals of the project? Major Goals Aim 1: Determine the extent to which mechanical loading regulates PLR in a TGFβ- dependent manner . Aim...dependent manner . Overview: We conducted all of the analyses proposed in Aim 1. As described below, these studies convincingly demonstrate that PLR

  3. A Gibberellin-Mediated DELLA-NAC Signaling Cascade Regulates Cellulose Synthesis in Rice[OPEN

    Science.gov (United States)

    Huang, Debao; Wang, Shaogan; Zhang, Baocai; Shang-Guan, Keke; Shi, Yanyun; Zhang, Dongmei; Liu, Xiangling; Wu, Kun; Xu, Zuopeng; Fu, Xiangdong; Zhou, Yihua

    2015-01-01

    Cellulose, which can be converted into numerous industrial products, has important impacts on the global economy. It has long been known that cellulose synthesis in plants is tightly regulated by various phytohormones. However, the underlying mechanism of cellulose synthesis regulation remains elusive. Here, we show that in rice (Oryza sativa), gibberellin (GA) signals promote cellulose synthesis by relieving the interaction between SLENDER RICE1 (SLR1), a DELLA repressor of GA signaling, and NACs, the top-layer transcription factors for secondary wall formation. Mutations in GA-related genes and physiological treatments altered the transcription of CELLULOSE SYNTHASE genes (CESAs) and the cellulose level. Multiple experiments demonstrated that transcription factors NAC29/31 and MYB61 are CESA regulators in rice; NAC29/31 directly regulates MYB61, which in turn activates CESA expression. This hierarchical regulation pathway is blocked by SLR1-NAC29/31 interactions. Based on the results of anatomical analysis and GA content examination in developing rice internodes, this signaling cascade was found to be modulated by varied endogenous GA levels and to be required for internode development. Genetic and gene expression analyses were further performed in Arabidopsis thaliana GA-related mutants. Altogether, our findings reveal a conserved mechanism by which GA regulates secondary wall cellulose synthesis in land plants and provide a strategy for manipulating cellulose production and plant growth. PMID:26002868

  4. A Gibberellin-Mediated DELLA-NAC Signaling Cascade Regulates Cellulose Synthesis in Rice.

    Science.gov (United States)

    Huang, Debao; Wang, Shaogan; Zhang, Baocai; Shang-Guan, Keke; Shi, Yanyun; Zhang, Dongmei; Liu, Xiangling; Wu, Kun; Xu, Zuopeng; Fu, Xiangdong; Zhou, Yihua

    2015-06-01

    Cellulose, which can be converted into numerous industrial products, has important impacts on the global economy. It has long been known that cellulose synthesis in plants is tightly regulated by various phytohormones. However, the underlying mechanism of cellulose synthesis regulation remains elusive. Here, we show that in rice (Oryza sativa), gibberellin (GA) signals promote cellulose synthesis by relieving the interaction between SLENDER RICE1 (SLR1), a DELLA repressor of GA signaling, and NACs, the top-layer transcription factors for secondary wall formation. Mutations in GA-related genes and physiological treatments altered the transcription of CELLULOSE SYNTHASE genes (CESAs) and the cellulose level. Multiple experiments demonstrated that transcription factors NAC29/31 and MYB61 are CESA regulators in rice; NAC29/31 directly regulates MYB61, which in turn activates CESA expression. This hierarchical regulation pathway is blocked by SLR1-NAC29/31 interactions. Based on the results of anatomical analysis and GA content examination in developing rice internodes, this signaling cascade was found to be modulated by varied endogenous GA levels and to be required for internode development. Genetic and gene expression analyses were further performed in Arabidopsis thaliana GA-related mutants. Altogether, our findings reveal a conserved mechanism by which GA regulates secondary wall cellulose synthesis in land plants and provide a strategy for manipulating cellulose production and plant growth. © 2015 American Society of Plant Biologists. All rights reserved.

  5. Lunatic fringe-mediated Notch signaling regulates adult hippocampal neural stem cell maintenance.

    Science.gov (United States)

    Semerci, Fatih; Choi, William Tin-Shing; Bajic, Aleksandar; Thakkar, Aarohi; Encinas, Juan Manuel; Depreux, Frederic; Segil, Neil; Groves, Andrew K; Maletic-Savatic, Mirjana

    2017-07-12

    Hippocampal neural stem cells (NSCs) integrate inputs from multiple sources to balance quiescence and activation. Notch signaling plays a key role during this process. Here, we report that Lunatic fringe ( Lfng), a key modifier of the Notch receptor, is selectively expressed in NSCs. Further, Lfng in NSCs and Notch ligands Delta1 and Jagged1, expressed by their progeny, together influence NSC recruitment, cell cycle duration, and terminal fate. We propose a new model in which Lfng-mediated Notch signaling enables direct communication between a NSC and its descendants, so that progeny can send feedback signals to the 'mother' cell to modify its cell cycle status. Lfng-mediated Notch signaling appears to be a key factor governing NSC quiescence, division, and fate.

  6. Arabidopsis cryptochrome 1 is a soluble protein mediating blue light-dependent regulation of plant growth and development

    International Nuclear Information System (INIS)

    Lin ChenTao; Ahmad, M.; Cashmore, A.R.

    1996-01-01

    Cryptochrome 1 (CRY1) is a flavin-type blue type receptor of Arabidopsis thaliana which mediates inhibition of hypocotyl elongation. In the work described in this report it is demonstrated that CRY1 is a soluble protein expressed in both young seedlings grown either in the dark or under light, and in different organs of adult plants. The functional role of CRY1 was further investigated using transgenic Arabidopsis plants overexpressing CRY1. It is demonstrated that overexpression of CRY1 resulted in hypersensitivity to blue, UV-A, and green light for the inhibition of hypocotyl elongation response. Transgenic plants overexpressing CRY1 also exhibited a dwarf phenotype with reduced size in almost every organ. This was in keeping with the previous observation of reciprocal alterations found in hy4 mutant plants and is consistent with a hypothesis that CRY1 mediates a light-dependent process resulting in a general inhibitory effect on plant growth. In addition, transgenic plants overexpressing CRY1 showed increased anthocyanin accumulation in response to blue, UV-A, and green light in a fluence rate-dependent manner. This increase in anthocyanin accumulation in transgenic plants was shown to be concomitant with increased blue light-induction of CHS gene expression. It is concluded that CRY1 is a photoreceptor mediating blue light-dependent regulation of gene expression in addition to its affect on plant growth. (author)

  7. Lysosomal regulation of cholesterol homeostasis in tuberous sclerosis complex is mediated via NPC1 and LDL-R.

    Science.gov (United States)

    Filippakis, Harilaos; Alesi, Nicola; Ogorek, Barbara; Nijmeh, Julie; Khabibullin, Damir; Gutierrez, Catherine; Valvezan, Alexander J; Cunningham, James; Priolo, Carmen; Henske, Elizabeth P

    2017-06-13

    Tuberous sclerosis complex (TSC) is a multisystem disease associated with hyperactive mTORC1. The impact of TSC1/2 deficiency on lysosome-mediated processes is not fully understood. We report here that inhibition of lysosomal function using chloroquine (CQ) upregulates cholesterol homeostasis genes in TSC2-deficient cells. This TSC2-dependent transcriptional signature is associated with increased accumulation and intracellular levels of both total cholesterol and cholesterol esters. Unexpectedly, engaging this CQ-induced cholesterol uptake pathway together with inhibition of de novo cholesterol synthesis allows survival of TSC2-deficient, but not TSC2-expressing cells. The underlying mechanism of TSC2-deficient cell survival is dependent on exogenous cholesterol uptake via LDL-R, and endosomal trafficking mediated by Vps34. Simultaneous inhibition of lysosomal and endosomal trafficking inhibits uptake of esterified cholesterol and cell growth in TSC2-deficient, but not TSC2-expressing cells, highlighting the TSC-dependent lysosome-mediated regulation of cholesterol homeostasis and pointing toward the translational potential of these pathways for the therapy of TSC.

  8. The mediating role of state maladaptive emotion regulation in the relation between social anxiety symptoms and self-evaluation bias.

    Science.gov (United States)

    Sarfan, Laurel D; Cody, Meghan W; Clerkin, Elise M

    2018-03-16

    Although social anxiety symptoms are robustly linked to biased self-evaluations across time, the mechanisms of this relation remain unclear. The present study tested three maladaptive emotion regulation strategies - state post-event processing, state experiential avoidance, and state expressive suppression - as potential mediators of this relation. Undergraduate participants (N = 88; 61.4% Female) rated their social skill in an impromptu conversation task and then returned to the laboratory approximately two days later to evaluate their social skill in the conversation again. Consistent with expectations, state post-event processing and state experiential avoidance mediated the relation between social anxiety symptoms and worsening self-evaluations of social skill (controlling for research assistant evaluations), particularly for positive qualities (e.g. appeared confident, demonstrated social skill). State expressive suppression did not mediate the relation between social anxiety symptoms and changes in self-evaluation bias across time. These findings highlight the role that spontaneous, state experiential avoidance and state post-event processing may play in the relation between social anxiety symptoms and worsening self-evaluation biases of social skill across time.

  9. Ventral striatal regulation of CREM mediates impulsive action and drug addiction vulnerability

    OpenAIRE

    Miller, Michael L.; Ren, Yanhua; Szutorisz, Henrietta; Warren, Noël A.; Tessereau, Chloé; Egervári, Gábor; Mlodnicka, Agnieszka; Kapoor, Manav; Chaarani, Bader; Morris, Claudia V.; Schumann, Gunter; Garavan, Hugh; Goate, Alison M.; Bannon, Michael J.; Halperin, Jeffrey M.

    2017-01-01

    Impulsivity, a multifaceted behavioral hallmark of attention-deficit/hyperactivity disorder (ADHD), strongly influences addiction vulnerability and other psychiatric disorders that incur enormous medical and societal burdens yet the neurobiological underpinnings linking impulsivity to disease remain poorly understood. Here we report the critical role of ventral striatal cAMP-response element modulator (CREM) in mediating impulsivity relevant to drug abuse vulnerability. Using an ADHD rat mode...

  10. Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation.

    Science.gov (United States)

    Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping

    2009-11-01

    DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

  11. Ubiquitin carboxyl terminal hydrolase L1 negatively regulates TNFα-mediated vascular smooth muscle cell proliferation via suppressing ERK activation

    International Nuclear Information System (INIS)

    Ichikawa, Tomonaga; Li, Jinqing; Dong, Xiaoyu; Potts, Jay D.; Tang, Dong-Qi; Li, Dong-Sheng; Cui, Taixing

    2010-01-01

    Deubiquitinating enzymes (DUBs) appear to be critical regulators of a multitude of processes such as proliferation, apoptosis, differentiation, and inflammation. We have recently demonstrated that a DUB of ubiquitin carboxyl terminal hydrolase L1 (UCH-L1) inhibits vascular lesion formation via suppressing inflammatory responses in vasculature. However, the precise underlying mechanism remains to be defined. Herein, we report that a posttranscriptional up-regulation of UCH-L1 provides a negative feedback to tumor necrosis factor alpha (TNFα)-mediated activation of extracellular signal-regulated kinases (ERK) and proliferation in vascular smooth muscle cells (VSMCs). In rat adult VSMCs, adenoviral over-expression of UCH-L1 inhibited TNFα-induced activation of ERK and DNA synthesis. In contrast, over-expression of UCH-L1 did not affect platelet derived growth factor (PDGF)-induced VSMC proliferation and activation of growth stimulating cascades including ERK. TNFα hardly altered UCH-L1 mRNA expression and stability; however, up-regulated UCH-L1 protein expression via increasing UCH-L1 translation. These results uncover a novel mechanism by which UCH-L1 suppresses vascular inflammation.

  12. Acetylation within the N- and C-Terminal Domains of Src Regulates Distinct Roles of STAT3-Mediated Tumorigenesis.

    Science.gov (United States)

    Huang, Chao; Zhang, Zhe; Chen, Lihan; Lee, Hank W; Ayrapetov, Marina K; Zhao, Ting C; Hao, Yimei; Gao, Jinsong; Yang, Chunzhang; Mehta, Gautam U; Zhuang, Zhengping; Zhang, Xiaoren; Hu, Guohong; Chin, Y Eugene

    2018-06-01

    Posttranslational modifications of mammalian c-Src N-terminal and C-terminal domains regulate distinct functions. Myristoylation of G 2 controls its cell membrane association and phosphorylation of Y419/Y527 controls its activation or inactivation, respectively. We provide evidence that Src-cell membrane association-dissociation and catalytic activation-inactivation are both regulated by acetylation. In EGF-treated cells, CREB binding protein (CBP) acetylates an N-terminal lysine cluster (K5, K7, and K9) of c-Src to promote dissociation from the cell membrane. CBP also acetylates the C-terminal K401, K423, and K427 of c-Src to activate intrinsic kinase activity for STAT3 recruitment and activation. N-terminal domain phosphorylation (Y14, Y45, and Y68) of STAT3 by c-Src activates transcriptionally active dimers of STAT3. Moreover, acetyl-Src translocates into nuclei, where it forms the Src-STAT3 enhanceosome for gene regulation and cancer cell proliferation. Thus, c-Src acetylation in the N-terminal and C-terminal domains play distinct roles in Src activity and regulation. Significance: CBP-mediated acetylation of lysine clusters in both the N-terminal and C-terminal regions of c-Src provides additional levels of control over STAT3 transcriptional activity. Cancer Res; 78(11); 2825-38. ©2018 AACR . ©2018 American Association for Cancer Research.

  13. Intrusive fathering, children's self-regulation and social skills: a mediation analysis.

    Science.gov (United States)

    Stevenson, M; Crnic, K

    2013-06-01

    Fathers have unique influences on children's development, and particularly in the development of social skills. Although father-child relationship influences on children's social competence have received increased attention in general, research on fathering in families of children with developmental delays (DD) is scant. This study examined the pathway of influence among paternal intrusive behaviour, child social skills and child self-regulatory ability, testing a model whereby child regulatory behaviour mediates relations between fathering and child social skills. Participants were 97 families of children with early identified DD enrolled in an extensive longitudinal study. Father and mother child-directed intrusiveness was coded live in naturalistic home observations at child age 4.5, child behaviour dysregulation was coded from a video-taped laboratory problem-solving task at child age 5, and child social skills were measured using independent teacher reports at child age 6. Analyses tested for mediation of the relationship between fathers' intrusiveness and child social skills by child behaviour dysregulation. Fathers' intrusiveness, controlling for mothers' intrusiveness and child behaviour problems, was related to later child decreased social skills and this relationship was mediated by child behaviour dysregulation. Intrusive fathering appears to carry unique risk for the development of social skills in children with DD. Findings are discussed as they related to theories of fatherhood and parenting in children with DD, as well as implications for intervention and future research. © 2012 The Authors. Journal of Intellectual Disability Research © 2012 John Wiley & Sons Ltd, MENCAP & IASSID.

  14. Reports of adolescent emotion regulation and school engagement mediating the relation between parenting and adolescent functioning in India.

    Science.gov (United States)

    Raval, Vaishali V; Ward, Rose M; Raval, Pratiksha H; Trivedi, Shwetang S

    2017-02-07

    Much like other parts of Asia, late adolescence in India is a particularly stressful time with academic pressures of a highly competitive examination system that determines future occupational success. The present study examined interrelations among reports of parenting, adolescents' regulation of academics-related emotions, school engagement, adolescent socio-emotional functioning and state-exam performance. Four hundred and fifty 10th and 12th graders from suburban high schools in India participated, along with their mothers. At the beginning of the school year, mothers completed measures of parenting, and adolescents completed measures of emotion regulation, school engagement and behaviour problems. At the end of the school year, grades from state exams were obtained from the schools. A multiple mediator model was tested using structural equation modelling. Authoritarian parenting was positively related to adolescent behaviour problems, but not adolescent state-exam performance. Maternal non-supportive responses to adolescent negative emotion were indirectly positively related to adolescent behaviour problems through adolescent emotion dysregulation. Adolescent school engagement mediated the positive relation between maternal supportive responses to adolescent negative emotion and adolescent state-exam performance. These findings underscore the relevance of adolescent emotions for their academic functioning, with implications for the development of interventions for those who struggle during these highly stressful years. © 2017 International Union of Psychological Science.

  15. Predictive Effects of Good Self-Control and Poor Regulation on Alcohol-Related Outcomes: Do Protective Behavioral Strategies Mediate?

    Science.gov (United States)

    Pearson, Matthew R.; Kite, Benjamin A.; Henson, James M.

    2016-01-01

    In the present study, we examined whether use of protective behavioral strategies mediated the relationship between self-control constructs and alcohol-related outcomes. According to the two-mode model of self-control, good self-control (planfulness; measured with Future Time Perspective, Problem Solving, and Self-Reinforcement) and poor regulation (impulsivity; measured with Present Time Perspective, Poor Delay of Gratification, Distractibility) are theorized to be relatively independent constructs rather than opposite ends of a single continuum. The analytic sample consisted of 278 college student drinkers (68% women) who responded to a battery of surveys at a single time point. Using a structural equation model based on the two-mode model of self-control, we found that good self-control predicted increased use of three types of protective behavioral strategies (Manner of Drinking, Limiting/Stopping Drinking, and Serious Harm Reduction). Poor regulation was unrelated to use of protective behavioral strategies, but had direct effects on alcohol use and alcohol problems. Further, protective behavioral strategies mediated the relationship between good self-control and alcohol use. The clinical implications of these findings are discussed. PMID:22663345

  16. EMMPRIN promotes melanoma cells malignant properties through a HIF-2alpha mediated up-regulation of VEGF-receptor-2.

    Directory of Open Access Journals (Sweden)

    Faten Bougatef

    Full Text Available EMMPRIN's expression in melanoma tissue was reported to be predictive of poor prognosis. Here we demonstrate that EMMPRIN up-regulated VEGF receptor-2 (VEGFR-2 in two different primary melanoma cell lines and consequently increased migration and proliferation of these cells while inhibiting their apoptosis. SiRNA inhibition of VEGFR-2 expression abrogated these EMMPRIN effects. EMMPRIN regulation of VEGFR-2 was mediated through the over-expression of HIF-2alpha and its translocation to the nucleus where it forms heterodimers with HIF-1beta. These results were supported by an in vivo correlation between the expression of EMMPRIN with that of VEGFR-2 in human melanoma tissues as well as with the extent of HIF-2alpha localization in the nucleus. They demonstrate a novel mechanism by which EMMPRIN promotes tumor progression through HIF-2alpha/VEGFR-2 mediated mechanism, with an autocrine role in melanoma cell malignancy. The inhibition of EMMPRIN in cancer may thus simultaneously target both the VEGFR-2/VEGF system and the matrix degrading proteases to block tumor cell growth and invasion.

  17. Induced ER-chaperones regulate a novel receptor-like kinase to mediate a viral innate immune response

    Science.gov (United States)

    Caplan, Jeffrey L.; Zhu, Xiaohong; Mamillapalli, Padmavathi; Marathe, Rajendra; Anandalakshmi, Radhamani; Dinesh-Kumar, S. P.

    2009-01-01

    Summary The plant innate immune response requires a rapid, global reprogramming of cellular processes. Here we employed two complementary proteomic methods, two-dimensional differential in-gel electrophoresis (2D-DIGE) and iTRAQ, to identify differentially regulated proteins early during a defense response. Besides defense-related proteins, the constituents of the largest category of up-regulated proteins were cytoplasmic- and endoplasmic reticulum (ER)-residing molecular chaperones. Silencing of ER-resident protein disulfide isomerases, NbERp57 and NbP5, and the calreticulins, NbCRT2 and NbCRT3, lead to a partial loss of N immune receptor-mediated defense against Tobacco mosaic virus (TMV). Furthermore, NbCRT2 and NbCRT3 are required for the expression of a novel induced receptor-like kinase (IRK). IRK is a plasma membrane-localized protein required for the N-mediated hypersensitive response programmed cell death (HR-PCD) and resistance to TMV. These data support a model in which ER-resident chaperones are required for the accumulation of membrane bound or secreted proteins that are necessary for innate immunity. PMID:19917500

  18. Listening to music and physiological and psychological functioning: the mediating role of emotion regulation and stress reactivity.

    Science.gov (United States)

    Thoma, M V; Scholz, U; Ehlert, U; Nater, U M

    2012-01-01

    Music listening has been suggested to have short-term beneficial effects. The aim of this study was to investigate the association and potential mediating mechanisms between various aspects of habitual music-listening behaviour and physiological and psychological functioning. An internet-based survey was conducted in university students, measuring habitual music-listening behaviour, emotion regulation, stress reactivity, as well as physiological and psychological functioning. A total of 1230 individuals (mean = 24.89 ± 5.34 years, 55.3% women) completed the questionnaire. Quantitative aspects of habitual music-listening behaviour, i.e. average duration of music listening and subjective relevance of music, were not associated with physiological and psychological functioning. In contrast, qualitative aspects, i.e. reasons for listening (especially 'reducing loneliness and aggression', and 'arousing or intensifying specific emotions') were significantly related to physiological and psychological functioning (all p = 0.001). These direct effects were mediated by distress-augmenting emotion regulation and individual stress reactivity. The habitual music-listening behaviour appears to be a multifaceted behaviour that is further influenced by dispositions that are usually not related to music listening. Consequently, habitual music-listening behaviour is not obviously linked to physiological and psychological functioning.

  19. CXCL12 chemokine expression and secretion regulates colorectal carcinoma cell anoikis through Bim-mediated intrinsic apoptosis.

    Directory of Open Access Journals (Sweden)

    Luke J Drury

    Full Text Available BACKGROUND: Resistance to anoikis, apoptosis triggered by a loss of cellular adhesion to the underlying extracellular matrix, is a hallmark of metastatic cancer. Previously we have shown re-establishment of CXCL12 expression in colorectal carcinoma cells inhibits metastasis by enhancing anoikis sensitivity. The objective of these studies was to define the signaling mechanisms regulating CXCL12-mediated anoikis. METHODOLOGY/PRINCIPAL FINDINGS: Adhesion, examined by crystal violet staining, immunofluorescence microscopy, and immunoblot analysis indicated decreased focal adhesion signaling corresponding with loss of adhesion in cells constitutively simulated by CXCL12. Loss of adhesion was inhibited by pertussis toxin treatment, indicating CXCL12 regulating anoikis through G(αi-protein coupled receptors. Non-adherent HCT116 and HT29 colorectal carcinoma cells expressing CXCL12 exhibited enhanced anoikis sensitivity by propidium iodide staining, caspase activity assays, and immunoblot compared to GFP control cells. CXCL12 producing carcinomas cultured on poly-HEMA displayed heightened Bim and loss of Mcl-1 and Bcl-2 preceding cytochrome c release, and caspase-9 activation. RNAi knockdown of Bim reversed anoikis sensitivity of CXCL12-expressing cells and fostered increased soft-agar foci formation and hepatic tumors in an orthotopic mouse model of metastasis. CONCLUSIONS/SIGNIFICANCE: These data indicate CXCL12 provides a barrier to metastasis by increasing anoikis via activation of a Bim-mediated intrinsic apoptotic pathway. These results underscore the importance of retaining CXCL12 expression to sensitize colorectal carcinomas to anoikis and minimize tumor progression.

  20. Tumor-Promoting Circuits That Regulate a Cancer-Related Chemokine Cluster: Dominance of Inflammatory Mediators Over Oncogenic Alterations

    International Nuclear Information System (INIS)

    Leibovich-Rivkin, Tal; Buganim, Yosef; Solomon, Hilla; Meshel, Tsipi; Rotter, Varda; Ben-Baruch, Adit

    2012-01-01

    Here, we investigated the relative contribution of genetic/signaling components versus microenvironmental factors to the malignancy phenotype. In this system, we took advantage of non-transformed fibroblasts that carried defined oncogenic modifications in Ras and/or p53. These cells were exposed to microenvironmental pressures, and the expression of a cancer-related chemokine cluster was used as readout for the malignancy potential (CCL2, CCL5, CXCL8, CXCL10). In cells kept in-culture, synergism between Ras hyper-activation and p53 dysfunction was required to up-regulate the expression of the chemokine cluster. The in vivo passage of Ras High /p53 Low -modified cells has led to tumor formation, accompanied by potentiation of chemokine release, implicating a powerful role for the tumor microenvironment in up-regulating the chemokine cluster. Indeed, we found that inflammatory mediators which are prevalent in tumor sites, such as TNFα and IL-1β, had a predominant impact on the release of the chemokines, which was substantially higher than that obtained by the oncogenic modifications alone, possibly acting through the transcription factors AP-1 and NF-κB. Together, our results propose that in the unbiased model system that we were using, inflammatory mediators of the tumor milieu have dominating roles over oncogenic modifications in dictating the expression of a pro-malignancy chemokine readout

  1. Shoot bending promotes flower bud formation by miRNA-mediated regulation in apple (Malus domestica Borkh.).

    Science.gov (United States)

    Xing, Libo; Zhang, Dong; Zhao, Caiping; Li, Youmei; Ma, Juanjuan; An, Na; Han, Mingyu

    2016-02-01

    Flower induction in apple (Malus domestica Borkh.) trees plays an important life cycle role, but young trees produce fewer and inferior quality flower buds. Therefore, shoot bending has become an important cultural practice, significantly promoting the capacity to develop more flower buds during the growing seasons. Additionally, microRNAs (miRNAs) play essential roles in plant growth, flower induction and stress responses. In this study, we identified miRNAs potentially involved in the regulation of bud growth, and flower induction and development, as well as in the response to shoot bending. Of the 195 miRNAs identified, 137 were novel miRNAs. The miRNA expression profiles revealed that the expression levels of 68 and 27 known miRNAs were down-regulated and up-regulated, respectively, in response to shoot bending, and that the 31 differentially expressed novel miRNAs between them formed five major clusters. Additionally, a complex regulatory network associated with auxin, cytokinin, abscisic acid (ABA) and gibberellic acid (GA) plays important roles in cell division, bud growth and flower induction, in which related miRNAs and targets mediated regulation. Among them, miR396, 160, 393, and their targets associated with AUX, miR159, 319, 164, and their targets associated with ABA and GA, and flowering-related miRNAs and genes, regulate bud growth and flower bud formation in response to shoot bending. Meanwhile, the flowering genes had significantly higher expression levels during shoot bending, suggesting that they are involved in this regulatory process. This study provides a framework for the future analysis of miRNAs associated with multiple hormones and their roles in the regulation of bud growth, and flower induction and formation in response to shoot bending in apple trees. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  2. Parental Emotion Socialization and Child Psychological Adjustment among Chinese Urban Families: Mediation through Child Emotion Regulation and Moderation through Dyadic Collaboration

    Directory of Open Access Journals (Sweden)

    Zhuyun Jin

    2017-12-01

    Full Text Available The theoretical model of emotion regulation and many empirical findings have suggested that children’s emotion regulation may mediate the association between parents’ emotion socialization and children’s psychological adjustment. However, limited research has been conducted on moderators of these relations, despite the argument that the associations between parenting practices and children’s psychological adjustment are probabilistic rather than deterministic. This study examined the mediating role of children’s emotion regulation in linking parents’ emotion socialization and children’s psychological adjustment, and whether dyadic collaboration could moderate the proposed mediation model in a sample of Chinese parents and their children in their middle childhood. Participants were 150 Chinese children (87 boys and 63 girls, Mage = 8.54, SD = 1.67 and their parents (Mage = 39.22, SD = 4.07. Parent–child dyadic collaboration was videotaped and coded from an interaction task. Parents reported on their emotion socialization, children’s emotion regulation and psychopathological symptoms. Results indicated that child emotion regulation mediated the links between parental emotion socialization and child’s psychopathological symptoms. Evidence of moderated mediation was also found: supportive emotion socialization and child emotion regulation were positively correlated only at high and medium levels of dyadic collaboration, with child’s psychopathological symptoms as the dependent variables. Our findings suggested that higher-level parent–child collaboration might further potentiate the protective effect of parental supportive emotion socialization practices against child psychopathological symptoms.

  3. Parental Emotion Socialization and Child Psychological Adjustment among Chinese Urban Families: Mediation through Child Emotion Regulation and Moderation through Dyadic Collaboration

    Science.gov (United States)

    Jin, Zhuyun; Zhang, Xutong; Han, Zhuo Rachel

    2017-01-01

    The theoretical model of emotion regulation and many empirical findings have suggested that children’s emotion regulation may mediate the association between parents’ emotion socialization and children’s psychological adjustment. However, limited research has been conducted on moderators of these relations, despite the argument that the associations between parenting practices and children’s psychological adjustment are probabilistic rather than deterministic. This study examined the mediating role of children’s emotion regulation in linking parents’ emotion socialization and children’s psychological adjustment, and whether dyadic collaboration could moderate the proposed mediation model in a sample of Chinese parents and their children in their middle childhood. Participants were 150 Chinese children (87 boys and 63 girls, Mage = 8.54, SD = 1.67) and their parents (Mage = 39.22, SD = 4.07). Parent–child dyadic collaboration was videotaped and coded from an interaction task. Parents reported on their emotion socialization, children’s emotion regulation and psychopathological symptoms. Results indicated that child emotion regulation mediated the links between parental emotion socialization and child’s psychopathological symptoms. Evidence of moderated mediation was also found: supportive emotion socialization and child emotion regulation were positively correlated only at high and medium levels of dyadic collaboration, with child’s psychopathological symptoms as the dependent variables. Our findings suggested that higher-level parent–child collaboration might further potentiate the protective effect of parental supportive emotion socialization practices against child psychopathological symptoms. PMID:29326629

  4. Med1 subunit of the mediator complex in nuclear receptor-regulated energy metabolism, liver regeneration, and hepatocarcinogenesis.

    Science.gov (United States)

    Jia, Yuzhi; Viswakarma, Navin; Reddy, Janardan K

    2014-01-01

    Several nuclear receptors regulate diverse metabolic functions that impact on critical biological processes, such as development, differentiation, cellular regeneration, and neoplastic conversion. In the liver, some members of the nuclear receptor family, such as peroxisome proliferator-activated receptors (PPARs), constitutive androstane receptor (CAR), farnesoid X receptor (FXR), liver X receptor (LXR), pregnane X receptor (PXR), glucocorticoid receptor (GR), and others, regulate energy homeostasis, the formation and excretion of bile acids, and detoxification of xenobiotics. Excess energy burning resulting from increases in fatty acid oxidation systems in liver generates reactive oxygen species, and the resulting oxidative damage influences liver regeneration and liver tumor development. These nuclear receptors are important sensors of exogenous activators as well as receptor-specific endogenous ligands. In this regard, gene knockout mouse models revealed that some lipid-metabolizing enzymes generate PPARα-activating ligands, while others such as ACOX1 (fatty acyl-CoA oxidase1) inactivate these endogenous PPARα activators. In the absence of ACOX1, the unmetabolized ACOX1 substrates cause sustained activation of PPARα, and the resulting increase in energy burning leads to hepatocarcinogenesis. Ligand-activated nuclear receptors recruit the multisubunit Mediator complex for RNA polymerase II-dependent gene transcription. Evidence indicates that the Med1 subunit of the Mediator is essential for PPARα, PPARγ, CAR, and GR signaling in liver. Med1 null hepatocytes fail to respond to PPARα activators in that these cells do not show induction of peroxisome proliferation and increases in fatty acid oxidation enzymes. Med1-deficient hepatocytes show no increase in cell proliferation and do not give rise to liver tumors. Identification of nuclear receptor-specific coactivators and Mediator subunits should further our understanding of the complexities of metabolic

  5. Skp2 regulates androgen receptor through ubiquitin-mediated degradation independent of Akt/mTOR pathways in prostate cancer.

    Science.gov (United States)

    Li, Bo; Lu, Wenfu; Yang, Qing; Yu, Xiuping; Matusik, Robert J; Chen, Zhenbang

    2014-04-01

    The intervention of advanced prostate cancer (PCa) in patients has been commonly depending on androgen deprivation therapy. Despite of tremendous research efforts, however, molecular mechanisms on AR regulation remain poorly understood, particularly for castration resistant prostate cancer (CRPC). Targeting AR and associated factors is considered an effective strategy in PCa treatment. Human prostate cancer cells were used in this study. Manipulations of Skp2 expression were achieved by Skp2 shRNA/siRNA or overexpression of plasmids. Dual luciferase reporter assay was applied for AR activity assessment. Western blot, ubiquitination assay, immunoprecipitation, and immunofluorescence were applied to detect the proteins. Our results demonstrated that Skp2 directly involves the regulation of AR expression through ubiquitination-mediated degradation. Skp2 interacted with AR protein in PCa cells, and enforced expression of Skp2 resulted in a decreased level and activity of AR. By contrast, Skp2 knockdown increased the protein accumulation and activity of AR. Importantly, changes of AR contributed by Skp2 led to subsequent alterations of PSA level in PCa cells. AR ubiquitination was significantly increased upon Skp2 overexpression but greatly reduced upon Skp2 knockdown. AR mutant at K847R abrogated Skp2-mediated ubiquitination of AR. NVP-BEZ235, a dual PI3K/mTOR inhibitor, remarkably inhibited Skp2 level with a striking elevation of AR. The results indicate that Skp2 is an E3 ligase for proteasome-dependent AR degradation, and K847 on AR is the recognition site for Skp2-mediated ubiquitination. Our findings reveal an essential role of Skp2 in AR signaling. © 2013 Wiley Periodicals, Inc.

  6. Regulators of G-protein signaling 4: modulation of 5-HT1A-mediated neurotransmitter release in vivo.

    Science.gov (United States)

    Beyer, Chad E; Ghavami, Afshin; Lin, Qian; Sung, Amy; Rhodes, Kenneth J; Dawson, Lee A; Schechter, Lee E; Young, Kathleen H

    2004-10-01

    Regulators of G-protein signaling (RGS) play a key role in the signal transduction of G-protein-coupled receptors (GPCRs). Specifically, RGS proteins function as GTPase accelerating proteins (GAPs) to dampen or "negatively regulate" GPCR-mediated signaling. Our group recently showed that RGS4 effectively GAPs Galpha(i)-mediated signaling in CHO cells expressing the serotonin-1A (5-HT(1A)) receptor. However, whether a similar relationship exists in vivo has yet to be identified. In present studies, a replication-deficient herpes simplex virus (HSV) was used to elevate RGS4 mRNA in the rat dorsal raphe nuclei (DRN) while extracellular levels of 5-HT in the striatum were monitored by in vivo microdialysis. Initial experiments conducted with noninfected rats showed that acute administration of 8-OH-DPAT (0.01-0.3 mg/kg, subcutaneous [s.c.]) dose dependently decreased striatal levels of 5-HT, an effect postulated to result from activation of somatodendritic 5-HT(1A) autoreceptors in the DRN. In control rats receiving a single intra-DRN infusion of HSV-LacZ, 8-OH-DPAT (0.03 mg/kg, s.c.) decreased 5-HT levels to an extent similar to that observed in noninfected animals. Conversely, rats infected with HSV-RGS4 in the DRN showed a blunted neurochemical response to 8-OH-DPAT (0.03 mg/kg, s.c.); however, increasing the dose to 0.3 mg/kg reversed this effect. Together, these findings represent the first in vivo evidence demonstrating that RGS4 functions to GAP Galpha(i)-coupled receptors and suggest that drug discovery efforts targeting RGS proteins may represent a novel mechanism to manipulate 5-HT(1A)-mediated neurotransmitter release.

  7. Thiol peroxidases mediate specific genome-wide regulation of gene expression in response to hydrogen peroxide

    Science.gov (United States)

    Fomenko, Dmitri E.; Koc, Ahmet; Agisheva, Natalia; Jacobsen, Michael; Kaya, Alaattin; Malinouski, Mikalai; Rutherford, Julian C.; Siu, Kam-Leung; Jin, Dong-Yan; Winge, Dennis R.; Gladyshev, Vadim N.

    2011-01-01

    Hydrogen peroxide is thought to regulate cellular processes by direct oxidation of numerous cellular proteins, whereas antioxidants, most notably thiol peroxidases, are thought to reduce peroxides and inhibit H2O2 response. However, thiol peroxidases have also been implicated in activation of transcription factors and signaling. It remains unclear if these enzymes stimulate or inhibit redox regulation and whether this regulation is widespread or limited to a few cellular components. Herein, we found that Saccharomyces cerevisiae cells lacking all eight thiol peroxidases were viable and withstood redox stresses. They transcriptionally responded to various redox treatments, but were unable to activate and repress gene expression in response to H2O2. Further studies involving redox transcription factors suggested that thiol peroxidases are major regulators of global gene expression in response to H2O2. The data suggest that thiol peroxidases sense and transfer oxidative signals to the signaling proteins and regulate transcription, whereas a direct interaction between H2O2 and other cellular proteins plays a secondary role. PMID:21282621

  8. Estrogen regulation of chicken riboflavin carrier protein gene is mediated by ERE half sites without direct binding of estrogen receptor.

    Science.gov (United States)

    Bahadur, Urvashi; Ganjam, Goutham K; Vasudevan, Nandini; Kondaiah, Paturu

    2005-02-28

    Estrogen is an important steroid hormone that mediates most of its effects on regulation of gene expression by binding to intracellular receptors. The consensus estrogen response element (ERE) is a 13bp palindromic inverted repeat with a three nucleotide spacer. However, several reports suggest that many estrogen target genes are regulated by diverse elements, such as imperfect EREs and ERE half sites (ERE 1/2), which are either the proximal or the distal half of the palindrome. To gain more insight into ERE half site-mediated gene regulation, we used a region from the estrogen-regulated chicken riboflavin carrier protein (RCP) gene promoter that contains ERE half sites. Using moxestrol, an analogue of estrogen and transient transfection of deletion and mutation containing RCP promoter/reporter constructs in chicken hepatoma (LMH2A) cells, we identified an estrogen response unit (ERU) composed of two consensus ERE 1/2 sites and one non-consensus ERE 1/2 site. Mutation of any of these sites within this ERU abolishes moxestrol response. Further, the ERU is able to confer moxestrol responsiveness to a heterologous promoter. Interestingly, RCP promoter is regulated by moxestrol in estrogen responsive human MCF-7 cells, but not in other cell lines such as NIH3T3 and HepG2 despite estrogen receptor-alpha (ER-alpha) co transfection. Electrophoretic mobility shift assays (EMSAs) with promoter regions encompassing the half sites and nuclear extracts from LMH2A cells show the presence of a moxestrol-induced complex that is abolished by a polyclonal anti-ERalpha antibody. Surprisingly, estrogen receptor cannot bind to these promoter elements in isolation. Thus, there appears to be a definite requirement for some other factor(s) in addition to estrogen receptor, for the generation of a suitable response of this promoter to estrogen. Our studies therefore suggest a novel mechanism of gene regulation by estrogen, involving ERE half sites without direct binding of ER to the

  9. Xenosensor CAR mediates down-regulation of miR-122 and up-regulation of miR-122 targets in the liver

    Energy Technology Data Exchange (ETDEWEB)

    Kazantseva, Yuliya A.; Yarushkin, Andrei A.; Mostovich, Lyudmila A. [The Institute of Molecular Biology and Biophysics, Timakova str., 2/12, Novosibirsk 630117 (Russian Federation); Pustylnyak, Yuliya A. [Novosibirsk State University, Pirogova str., 2, Novosibirsk 630090 (Russian Federation); Pustylnyak, Vladimir O., E-mail: pustylnyak@ngs.ru [The Institute of Molecular Biology and Biophysics, Timakova str., 2/12, Novosibirsk 630117 (Russian Federation); Novosibirsk State University, Pirogova str., 2, Novosibirsk 630090 (Russian Federation); The Institute International Tomography Center of the Russian Academy of Sciences, Institutskaya str. 3-A, Novosibirsk 630090 (Russian Federation)

    2015-10-01

    MiR-122 is a major hepatic microRNA, accounting for more than 70% of the total liver miRNA population. It has been shown that miR-122 is associated with liver diseases, including hepatocellular carcinoma. Mir-122 is an intergenic miRNA with its own promoter. Pri-miR-122 expression is regulated by liver-enriched transcription factors, mainly by HNF4α, which mediates the expression via the interaction with a specific DR1 site. It has been shown that phenobarbital-mediated activation of constitutive androstane receptor (CAR), xenobiotic nuclear receptor, is associated with a decrease in miR-122 in the liver. In the present study, we investigated HNF4α–CAR cross-talk in the regulation of miR-122 levels and promitogenic signalling in mouse livers. The level of miR-122 was significantly repressed by treatment with 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP), which is an agonist of mouse CAR. ChIP assays demonstrated that TCPOBOP-activated CAR inhibited HNF4α transactivation by competing with HNF4α for binding to the DR1 site in the pri-miR-122 promoter. Such transcription factor replacement was strongly correlated with miR-122 down-regulation. Additionally, the decrease in miR-122 levels produced by CAR activation is accompanied by an increase in mRNA and cellular protein levels of E2f1 and its accumulation on the target cMyc gene promoter. The increase in accumulation of E2f1 on the target cMyc gene promoter is accompanied by an increase in cMyc levels and transcriptional activity. Thus, our results provide evidence to support the conclusion that CAR activation decreases miR-122 levels through suppression of HNF4α transcriptional activity and indirectly regulates the promitogenic protein cMyc. HNF4α–CAR cross-talk may provide new opportunities for understanding liver diseases and developing more effective therapeutic approaches to better drug treatments. - Highlights: • CAR activation decreased the level of miR-122 in mouse livers. • CAR decreases

  10. Xenosensor CAR mediates down-regulation of miR-122 and up-regulation of miR-122 targets in the liver

    International Nuclear Information System (INIS)

    Kazantseva, Yuliya A.; Yarushkin, Andrei A.; Mostovich, Lyudmila A.; Pustylnyak, Yuliya A.; Pustylnyak, Vladimir O.

    2015-01-01

    MiR-122 is a major hepatic microRNA, accounting for more than 70% of the total liver miRNA population. It has been shown that miR-122 is associated with liver diseases, including hepatocellular carcinoma. Mir-122 is an intergenic miRNA with its own promoter. Pri-miR-122 expression is regulated by liver-enriched transcription factors, mainly by HNF4α, which mediates the expression via the interaction with a specific DR1 site. It has been shown that phenobarbital-mediated activation of constitutive androstane receptor (CAR), xenobiotic nuclear receptor, is associated with a decrease in miR-122 in the liver. In the present study, we investigated HNF4α–CAR cross-talk in the regulation of miR-122 levels and promitogenic signalling in mouse livers. The level of miR-122 was significantly repressed by treatment with 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP), which is an agonist of mouse CAR. ChIP assays demonstrated that TCPOBOP-activated CAR inhibited HNF4α transactivation by competing with HNF4α for binding to the DR1 site in the pri-miR-122 promoter. Such transcription factor replacement was strongly correlated with miR-122 down-regulation. Additionally, the decrease in miR-122 levels produced by CAR activation is accompanied by an increase in mRNA and cellular protein levels of E2f1 and its accumulation on the target cMyc gene promoter. The increase in accumulation of E2f1 on the target cMyc gene promoter is accompanied by an increase in cMyc levels and transcriptional activity. Thus, our results provide evidence to support the conclusion that CAR activation decreases miR-122 levels through suppression of HNF4α transcriptional activity and indirectly regulates the promitogenic protein cMyc. HNF4α–CAR cross-talk may provide new opportunities for understanding liver diseases and developing more effective therapeutic approaches to better drug treatments. - Highlights: • CAR activation decreased the level of miR-122 in mouse livers. • CAR decreases

  11. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  12. RNA-Mediated cis Regulation in Acinetobacter baumannii Modulates Stress-Induced Phenotypic Variation.

    Science.gov (United States)

    Ching, Carly; Gozzi, Kevin; Heinemann, Björn; Chai, Yunrong; Godoy, Veronica G

    2017-06-01

    In the nosocomial opportunistic pathogen Acinetobacter baumannii , RecA-dependent mutagenesis, which causes antibiotic resistance acquisition, is linked to the DNA damage response (DDR). Notably, unlike the Escherichia coli paradigm, recA and DDR gene expression in A. baumannii is bimodal. Namely, there is phenotypic variation upon DNA damage, which may provide a bet-hedging strategy for survival. Thus, understanding recA gene regulation is key to elucidate the yet unknown DDR regulation in A. baumannii Here, we identify a structured 5' untranslated region (UTR) in the recA transcript which serves as a cis -regulatory element. We show that a predicted stem-loop structure in this 5' UTR affects mRNA half-life and underlies bimodal gene expression and thus phenotypic variation in response to ciprofloxacin treatment. We furthermore show that the stem-loop structure of the recA 5' UTR influences intracellular RecA protein levels and, in vivo , impairing the formation of the stem-loop structure of the recA 5' UTR lowers cell survival of UV treatment and decreases rifampin resistance acquisition from DNA damage-induced mutagenesis. We hypothesize that the 5' UTR allows for stable recA transcripts during stress, including antibiotic treatment, enabling cells to maintain suitable RecA levels for survival. This innovative strategy to regulate the DDR in A. baumannii may contribute to its success as a pathogen. IMPORTANCE Acinetobacter baumannii is an opportunistic pathogen quickly gaining antibiotic resistances. Mutagenesis and antibiotic resistance acquisition are linked to the DNA damage response (DDR). However, how the DDR is regulated in A. baumannii remains unknown, since unlike most bacteria, A. baumannii does not follow the regulation of the Escherichia coli paradigm. In this study, we have started to uncover the mechanisms regulating the novel A. baumannii DDR. We have found that a cis -acting 5' UTR regulates recA transcript stability, RecA protein levels, and DNA

  13. Climate-mediated changes in marine ecosystem regulation during El Niño

    DEFF Research Database (Denmark)

    Lindegren, Martin; Checkley, David M.; Koslow, J. Anthony

    2017-01-01

    concentrations and primary production). The shifts in ecosystem regulation are caused by changes in ocean-atmosphere forcing and triggered by highly variable climate conditions associated with El Niño. Furthermore, we show that biota respond differently to major El Niño events during positive or negative phases......, or whether the relative importance of bottom-up and top-down forcing may shift in response to climate change. In this study, we investigate the effects and relative importance of bottom-up, top-down and physical forcing during changing climate conditions on ecosystem regulation in the Southern California...

  14. Regulation of Membrane-Type 4 Matrix Metalloproteinase by SLUG Contributes to Hypoxia-Mediated Metastasis12

    Science.gov (United States)

    Huang, Chi-Hung; Yang, Wen-Hao; Chang, Shyue-Yih; Tai, Shyh-Kuan; Tzeng, Cheng-Hwei; Kao, Jung-Yie; Wu, Kou-Juey; Yang, Muh-Hwa

    2009-01-01

    The hypoxic tumor environment has been shown to be critical to cancer metastasis through the promotion of angiogenesis, induction of epithelial-mesenchymal transition (EMT), and acquisition of invasive potential. However, the impact of hypoxia on the expression profile of the proteolytic enzymes involved in invasiveness is relatively unknown. Membrane-type 4 matrix metalloproteinase (MT4-MMP) is a glycosyl-phosphatidyl inositol-anchored protease that has been shown to be overexpressed in human cancers. However, detailed mechanisms regarding the regulation and function of MT4-MMP expression in tumor cells remain unknown. Here, we demonstrate that hypoxia or overexpression of hypoxia-inducible factor-1α (HIF-1α) induced MT4-MMP expression in human cancer cells. Activation of SLUG, a transcriptional factor regulating the EMT process of human cancers, by HIF-1α was critical for the induction of MT4-MMP under hypoxia. SLUG regulated the transcription of MT4-MMP through direct binding to the E-box located in its proximal promoter. Short-interference RNA-mediated knockdown of MT4-MMP attenuated in vitro invasiveness and in vivo pulmonary colonization of tumor cells without affecting cell migratory ability. MT4-MMP promoted invasiveness and pulmonary colonization through modulation of the expression profile of MMPs and angiogenic factors. Finally, coexpression of HIF-1α and MT4-MMP in human head and neck cancer was predictive of a worse clinical outcome. These findings establish a novel signaling pathway for hypoxia-mediated metastasis and elucidate the underlying regulatory mechanism and functional significance of MT4-MMP in cancer metastasis. PMID:20019845

  15. β-Arrestin regulation of myosin light chain phosphorylation promotes AT1aR-mediated cell contraction and migration.

    Directory of Open Access Journals (Sweden)

    Elie Simard

    Full Text Available Over the last decade, it has been established that G-protein-coupled receptors (GPCRs signal not only through canonical G-protein-mediated mechanisms, but also through the ubiquitous cellular scaffolds β-arrestin-1 and β-arrestin-2. Previous studies have implicated β-arrestins as regulators of actin reorganization in response to GPCR stimulation while also being required for membrane protrusion events that accompany cellular motility. One of the most critical events in the active movement of cells is the cyclic phosphorylation and activation of myosin light chain (MLC, which is required for cellular contraction and movement. We have identified the myosin light chain phosphatase Targeting Subunit (MYPT-1 as a binding partner of the β-arrestins and found that β-arrestins play a role in regulating the turnover of phosphorylated myosin light chain. In response to stimulation of the angiotensin Type 1a Receptor (AT1aR, MLC phosphorylation is induced quickly and potently. We have found that β-arrestin-2 facilitates dephosphorylation of MLC, while, in a reciprocal fashion, β-arrestin 1 limits dephosphorylation of MLC. Intriguingly, loss of either β-arrestin-1 or 2 blocks phospho-MLC turnover and causes a decrease in the contraction of cells as monitored by atomic force microscopy (AFM. Furthermore, by employing the β-arrestin biased ligand [Sar(1,Ile(4,Ile(8]-Ang, we demonstrate that AT1aR-mediated cellular motility involves a β-arrestin dependent component. This suggests that the reciprocal regulation of MLC phosphorylation status by β-arrestins-1 and 2 causes turnover in the phosphorylation status of MLC that is required for cell contractility and subsequent chemotaxic motility.

  16. Polycomb-Mediated Repression and Sonic Hedgehog Signaling Interact to Regulate Merkel Cell Specification during Skin Development.

    Directory of Open Access Journals (Sweden)

    Carolina N Perdigoto

    2016-07-01

    Full Text Available An increasing amount of evidence indicates that developmental programs are tightly regulated by the complex interplay between signaling pathways, as well as transcriptional and epigenetic processes. Here, we have uncovered coordination between transcriptional and morphogen cues to specify Merkel cells, poorly understood skin cells that mediate light touch sensations. In murine dorsal skin, Merkel cells are part of touch domes, which are skin structures consisting of specialized keratinocytes, Merkel cells, and afferent neurons, and are located exclusively around primary hair follicles. We show that the developing primary hair follicle functions as a niche required for Merkel cell specification. We find that intraepidermal Sonic hedgehog (Shh signaling, initiated by the production of Shh ligand in the developing hair follicles, is required for Merkel cell specification. The importance of Shh for Merkel cell formation is further reinforced by the fact that Shh overexpression in embryonic epidermal progenitors leads to ectopic Merkel cells. Interestingly, Shh signaling is common to primary, secondary, and tertiary hair follicles, raising the possibility that there are restrictive mechanisms that regulate Merkel cell specification exclusively around primary hair follicles. Indeed, we find that loss of Polycomb repressive complex 2 (PRC2 in the epidermis results in the formation of ectopic Merkel cells that are associated with all hair types. We show that PRC2 loss expands the field of epidermal cells competent to differentiate into Merkel cells through the upregulation of key Merkel-differentiation genes, which are known PRC2 targets. Importantly, PRC2-mediated repression of the Merkel cell differentiation program requires inductive Shh signaling to form mature Merkel cells. Our study exemplifies how the interplay between epigenetic and morphogen cues regulates the complex patterning and formation of the mammalian skin structures.

  17. Polycomb-Mediated Repression and Sonic Hedgehog Signaling Interact to Regulate Merkel Cell Specification during Skin Development.

    Science.gov (United States)

    Perdigoto, Carolina N; Dauber, Katherine L; Bar, Carmit; Tsai, Pai-Chi; Valdes, Victor J; Cohen, Idan; Santoriello, Francis J; Zhao, Dejian; Zheng, Deyou; Hsu, Ya-Chieh; Ezhkova, Elena

    2016-07-01

    An increasing amount of evidence indicates that developmental programs are tightly regulated by the complex interplay between signaling pathways, as well as transcriptional and epigenetic processes. Here, we have uncovered coordination between transcriptional and morphogen cues to specify Merkel cells, poorly understood skin cells that mediate light touch sensations. In murine dorsal skin, Merkel cells are part of touch domes, which are skin structures consisting of specialized keratinocytes, Merkel cells, and afferent neurons, and are located exclusively around primary hair follicles. We show that the developing primary hair follicle functions as a niche required for Merkel cell specification. We find that intraepidermal Sonic hedgehog (Shh) signaling, initiated by the production of Shh ligand in the developing hair follicles, is required for Merkel cell specification. The importance of Shh for Merkel cell formation is further reinforced by the fact that Shh overexpression in embryonic epidermal progenitors leads to ectopic Merkel cells. Interestingly, Shh signaling is common to primary, secondary, and tertiary hair follicles, raising the possibility that there are restrictive mechanisms that regulate Merkel cell specification exclusively around primary hair follicles. Indeed, we find that loss of Polycomb repressive complex 2 (PRC2) in the epidermis results in the formation of ectopic Merkel cells that are associated with all hair types. We show that PRC2 loss expands the field of epidermal cells competent to differentiate into Merkel cells through the upregulation of key Merkel-differentiation genes, which are known PRC2 targets. Importantly, PRC2-mediated repression of the Merkel cell differentiation program requires inductive Shh signaling to form mature Merkel cells. Our study exemplifies how the interplay between epigenetic and morphogen cues regulates the complex patterning and formation of the mammalian skin structures.

  18. Negative Regulation of STAT3 Protein-mediated Cellular Respiration by SIRT1 Protein

    DEFF Research Database (Denmark)

    Bernier, Michel; Paul, Rajib K; Martin-Montalvo, Alejandro

    2011-01-01

    those of wild-type controls. Comparison of profiles of phospho-antibody array data indicated that the deletion of SirT1 was accompanied by constitutive activation of the pro-inflammatory NF-¿B pathway, which is key for STAT3 induction and increased cellular respiration in Sirt1-KO cells. Thus, SIRT1...... cells exhibited higher mitochondrial respiration as compared with wild-type MEFs. Two independent approaches, including ectopic expression of SIRT1 and siRNA-mediated knockdown of STAT3, led to reduction in intracellular ATP levels and increased lactate production in Sirt1-KO cells that were approaching...

  19. AMPA receptor mediated excitotoxicity in neocortical neurons is developmentally regulated and dependent upon receptor desensitization

    DEFF Research Database (Denmark)

    Jensen, J B; Schousboe, A; Pickering, D S

    1998-01-01

    with a fast and rapidly desensitizing response, this could explain the relatively low toxicity produced by 500 microM AMPA. This was investigated by blocking AMPA receptor desensitization with cyclothiazide. Using a lower concentration (25 microM) of AMPA, addition of 50 microM cyclothiazide increased...... the AMPA induced excitotoxicity in cultured cortical neurons at all DIV except for DIV 2. This combination of AMPA + cyclothiazide yielded 77% cell death for DIV 12 cultures. In contrast to the results observed with 500 microM AMPA, the neurotoxicity mediated directly by AMPA receptors when desensitization...

  20. The Mediator co-activator complex regulates Ty1 retromobility by controlling the balance between Ty1i and Ty1 promoters.

    Science.gov (United States)

    Salinero, Alicia C; Knoll, Elisabeth R; Zhu, Z Iris; Landsman, David; Curcio, M Joan; Morse, Randall H

    2018-02-01

    The Ty1 retrotransposons present in the genome of Saccharomyces cerevisiae belong to the large class of mobile genetic elements that replicate via an RNA intermediary and constitute a significant portion of most eukaryotic genomes. The retromobility of Ty1 is regulated by numerous host factors, including several subunits of the Mediator transcriptional co-activator complex. In spite of its known function in the nucleus, previous studies have implicated Mediator in the regulation of post-translational steps in Ty1 retromobility. To resolve this paradox, we systematically examined the effects of deleting non-essential Mediator subunits on the frequency of Ty1 retromobility and levels of retromobility intermediates. Our findings reveal that loss of distinct Mediator subunits alters Ty1 retromobility positively or negatively over a >10,000-fold range by regulating the ratio of an internal transcript, Ty1i, to the genomic Ty1 transcript. Ty1i RNA encodes a dominant negative inhibitor of Ty1 retromobility that blocks virus-like particle maturation and cDNA synthesis. These results resolve the conundrum of Mediator exerting sweeping control of Ty1 retromobility with only minor effects on the levels of Ty1 genomic RNA and the capsid protein, Gag. Since the majority of characterized intrinsic and extrinsic regulators of Ty1 retromobility do not appear to effect genomic Ty1 RNA levels, Mediator could play a central role in integrating signals that influence Ty1i expression to modulate retromobility.

  1. PPAR-alpha dependent regulation of vanin-1 mediates hepatic lipid metabolism

    NARCIS (Netherlands)

    Diepen, van J.A.; Jansen, P.A.; Ballak, D.B.; Hijmans, A.; Hooiveld, G.J.E.J.; Rommelaere, S.; Kersten, A.H.; Stienstra, R.

    2014-01-01

    Background & Aims Peroxisome proliferator-activated receptor alpha (PPARa) is a key regulator of hepatic fat oxidation that serves as an energy source during starvation. Vanin-1 has been described as a putative PPARa target gene in liver, but its function in hepatic lipid metabolism is unknown.

  2. Regulation of Dispute Resolution in Denmark: Mediation, Arbitration, Boards and Tribunals

    DEFF Research Database (Denmark)

    Adrian, Lin

    2013-01-01

    Bidraget indeholder en oversigt over alternativ konfliktløsning af konflikter - primært civilretlige konflikter, men strafferetlige konflikter berøres også. Oversigten vedrører såvel regulering som praksis. Bidraget munder ud i en diskussion af behovet for en international model lov, indholdet i ...

  3. Mammalian aPKC/Par polarity complex mediated regulation of epithelial division orientation and cell fate

    Energy Technology Data Exchange (ETDEWEB)

    Vorhagen, Susanne; Niessen, Carien M., E-mail: carien.niessen@uni-koeln.de

    2014-11-01

    Oriented cell division is a key regulator of tissue architecture and crucial for morphogenesis and homeostasis. Balanced regulation of proliferation and differentiation is an essential property of tissues not only to drive morphogenesis but also to maintain and restore homeostasis. In many tissues orientation of cell division is coupled to the regulation of differentiation producing daughters with similar (symmetric cell division, SCD) or differential fate (asymmetric cell division, ACD). This allows the organism to generate cell lineage diversity from a small pool of stem and progenitor cells. Division orientation and/or the ratio of ACD/SCD need to be tightly controlled. Loss of orientation or an altered ratio can promote overgrowth, alter tissue architecture and induce aberrant differentiation, and have been linked to morphogenetic diseases, cancer and aging. A key requirement for oriented division is the presence of a polarity axis, which can be established through cell intrinsic and/or extrinsic signals. Polarity proteins translate such internal and external cues to drive polarization. In this review we will focus on the role of the polarity complex aPKC/Par3/Par6 in the regulation of division orientation and cell fate in different mammalian epithelia. We will compare the conserved function of this complex in mitotic spindle orientation and distribution of cell fate determinants and highlight common and differential mechanisms in which this complex is used by tissues to adapt division orientation and cell fate to the specific properties of the epithelium.

  4. Sox4 mediates Tbx3 transcriptional regulation of the gap junction protein Cx43

    NARCIS (Netherlands)

    Boogerd, C.J.; Wong, L.Y.; van den Boogaard, M.; Bakker, M.A.J.; Tessadori, F.; Bakkers, J.; 't Hoen, P.A.C.; Moorman, A.F.; Christoffels, V.M.; Barnett, P.

    2011-01-01

    Tbx3, a T-box transcription factor, regulates key steps in development of the heart and other organ systems. Here, we identify Sox4 as an interacting partner of Tbx3. Pull-down and nuclear retention assays verify this interaction and in situ hybridization reveals Tbx3 and Sox4 to co-localize

  5. Pten regulates spindle pole movement through Dlg1-mediated recruitment of Eg5 to centrosomes

    NARCIS (Netherlands)

    Ree, J.H. van; Nam, H.J.; Jeganathan, K.B.; Kanakkanthara, A.; Deursen, J.M.A. van

    2016-01-01

    Phosphatase and tensin homologue (Pten) suppresses neoplastic growth by negatively regulating PI(3)K signalling through its phosphatase activity. To gain insight into the actions of non-catalytic Pten domains in normal physiological processes and tumorigenesis, we engineered mice lacking the

  6. Distinct phosphorylation events regulate p130- and p107-mediated repression of E2F-4

    DEFF Research Database (Denmark)

    Farkas, Thomas; Hansen, Klaus; Holm, Karin

    2002-01-01

    The "pocket proteins" pRb (retinoblastoma tumor suppressor protein), p107, and p130 regulate cell proliferation via phosphorylation-sensitive interactions with E2F transcription factors and other proteins. We previously identified 22 in vivo phosphorylation sites in human p130, including three...

  7. Parenting and Adolescent Self-Regulation Mediate between Family Socioeconomic Status and Adolescent Adjustment

    Science.gov (United States)

    Farley, Julee P.; Kim-Spoon, Jungmeen

    2017-01-01

    Using two waves of longitudinal data, we utilized the family stress model of economic hardship to test whether family socioeconomic status is related to adolescent adjustment (substance use and academic achievement) through parental knowledge and adolescent self-regulation (behavioral self-control and delay discounting). Participants included 220…

  8. Regulation of MRP2-mediated transport in shark rectal salt gland tubules.

    NARCIS (Netherlands)

    Miller, D.S.; Masereeuw, R.; Karnaky Jr, K.J.

    2002-01-01

    We examined endothelin-1 (ET-1) regulation of the xenobiotic efflux pump, multidrug resistance-associated protein isoform 2 (MRP2), in intact dogfish shark rectal salt gland tubules using a fluorescent substrate sulforhodamine 101 and confocal microscopy. Subnanomolar to nanomolar concentrations of

  9. Ribosome stalling regulates IRES-mediated translation in eukaryotes, a parallel to prokaryotic attenuation

    NARCIS (Netherlands)

    Fernandez, James; Yaman, Ibrahim; Huang, Charles; Liu, Haiyan; Lopez, Alex B.; Komar, Anton A.; Caprara, Mark G.; Merrick, William C.; Snider, Martin D.; Kaufman, Randal J.; Lamers, Wouter H.; Hatzoglou, Maria

    2005-01-01

    It was previously shown that the mRNA for the cat-1 Arg/Lys transporter is translated from an internal ribosome entry site (IRES) that is regulated by cellular stress. Amino acid starvation stimulated cat-1 translation via a mechanism that requires translation of an ORF in the mRNA leader and

  10. DNA Repair, Redox Regulation and Modulation of Estrogen Receptor Alpha Mediated Transcription

    Science.gov (United States)

    Curtis-Ducey, Carol Dianne

    2009-01-01

    Interaction of estrogen receptor [alpha] (ER[alpha]) with 17[beta]-estradiol (E[subscript 2]) facilitates binding of the receptor to estrogen response elements (EREs) in target genes, which in turn leads to recruitment of coregulatory proteins. To better understand how estrogen-responsive genes are regulated, our laboratory identified a number of…

  11. Neural fate decisions mediated by combinatorial regulation of Hes1 and miR-9.

    Science.gov (United States)

    Li, Shanshan; Liu, Yanwei; Liu, Zengrong; Wang, Ruiqi

    2016-01-01

    In the nervous system, Hes1 shows an oscillatory manner in neural progenitors but a persistent one in neurons. Many models involving Hes1 have been provided for the study of neural differentiation but few of them take the role of microRNA into account. It is known that a microRNA, miR-9, plays crucial roles in modulating Hes1 oscillations. However, the roles of miR-9 in controlling Hes1 oscillations and inducing transition between different cell fates still need to be further explored. Here we provide a mathematical model to show the interaction between miR-9 and Hes1, with the aim of understanding how the Hes1 oscillations are produced, how they are controlled, and further, how they are terminated. Based on the experimental findings, the model demonstrates the essential roles of Hes1 and miR-9 in regulating the dynamics of the system. In particular, the model suggests that the balance between miR-9 and Hes1 plays important roles in the choice between progenitor maintenance and neural differentiation. In addition, the synergistic (or antagonistic) effects of several important regulations are investigated so as to elucidate the effects of combinatorial regulation in neural decision-making. Our model provides a qualitative mechanism for understanding the process in neural fate decisions regulated by Hes1 and miR-9.

  12. Child Routines and Self-Regulation Serially Mediate Parenting Practices and Externalizing Problems in Preschool Children

    Science.gov (United States)

    Bater, Lovina Rose; Jordan, Sara Sytsma

    2017-01-01

    Background: Studies clearly indicate that parenting practices relate to child externalizing behaviors, although the mechanisms underlying this relation are less well understood. There has been limited evaluation of child routines and self-regulation in relation to these variables, and no known studies have evaluated all of these variables…

  13. Calcium-Mediated Regulation of Proton-Coupled Sodium Transport - Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Schumaker, Karen S [Professor

    2013-10-24

    The long-term goal of our experiments was to understand mechanisms that regulate energy coupling by ion currents in plants. Activities of living organisms require chemical, mechanical, osmotic or electrical work, the energy for which is supplied by metabolism. Adenosine triphosphate (ATP) has long been recognized as the universal energy currency, with metabolism supporting the synthesis of ATP and the hydrolysis of ATP being used for the subsequent work. However, ATP is not the only energy currency in living organisms. A second and very different energy currency links metabolism to work by the movement of ions passing from one side of a membrane to the other. These ion currents play a major role in energy capture and they support a range of physiological processes from the active transport of nutrients to the spatial control of growth and development. In Arabidopsis thaliana (Arabidopsis), the activity of a plasma membrane Na+/H+ exchanger, SALT OVERLY SENSITIVE1 (SOS1), is essential for regulation of sodium ion homeostasis during plant growth in saline conditions. Mutations in SOS1 result in severely reduced seedling growth in the presence of salt compared to the growth of wild type. SOS1 is a secondary active transporter coupling movement of sodium ions out of the cell using energy stored in the transplasma membrane proton gradient, thereby preventing the build-up of toxic levels of sodium in the cytosol. SOS1 is regulated by complexes containing the SOS2 and CALCINEURIN B-LIKE10 (CBL10) or SOS3 proteins. CBL10 and SOS3 (also identified as CBL4) encode EF-hand calcium sensors that interact physically with and activate SOS2, a serine/threonine protein kinase. The CBL10/SOS2 or SOS3/SOS2 complexes then activate SOS1 Na+/H+ exchange activity. We completed our studies to understand how SOS1 activity is regulated. Specifically, we asked: (1) how does CBL10 regulate SOS1 activity? (2) What role do two putative CBL10-interacting proteins play in SOS1 regulation? (3) Are

  14. Combinatorial action of Grainyhead, Extradenticle and Notch in regulating Hox mediated apoptosis in Drosophila larval CNS.

    Science.gov (United States)

    Khandelwal, Risha; Sipani, Rashmi; Govinda Rajan, Sriivatsan; Kumar, Raviranjan; Joshi, Rohit

    2017-10-01

    Hox mediated neuroblast apoptosis is a prevalent way to pattern larval central nervous system (CNS) by different Hox genes, but the mechanism of this apoptosis is not understood. Our studies with Abdominal-A (Abd-A) mediated larval neuroblast (pNB) apoptosis suggests that AbdA, its cofactor Extradenticle (Exd), a helix-loop-helix transcription factor Grainyhead (Grh), and Notch signaling transcriptionally contribute to expression of RHG family of apoptotic genes. We find that Grh, AbdA, and Exd function together at multiple motifs on the apoptotic enhancer. In vivo mutagenesis of these motifs suggest that they are important for the maintenance of the activity of the enhancer rather than its initiation. We also find that Exd function is independent of its known partner homothorax in this apoptosis. We extend some of our findings to Deformed expressing region of sub-esophageal ganglia where pNBs undergo a similar Hox dependent apoptosis. We propose a mechanism where common players like Exd-Grh-Notch work with different Hox genes through region specific enhancers to pattern respective segments of larval central nervous system.

  15. Calcium-dependent regulation of SNARE-mediated membrane fusion by calmodulin.

    Science.gov (United States)

    Di Giovanni, Jerome; Iborra, Cécile; Maulet, Yves; Lévêque, Christian; El Far, Oussama; Seagar, Michael

    2010-07-30

    Neuroexocytosis requires SNARE proteins, which assemble into trans complexes at the synaptic vesicle/plasma membrane interface and mediate bilayer fusion. Ca(2+) sensitivity is thought to be conferred by synaptotagmin, although the ubiquitous Ca(2+)-effector calmodulin has also been implicated in SNARE-dependent membrane fusion. To examine the molecular mechanisms involved, we examined the direct action of calmodulin and synaptotagmin in vitro, using fluorescence resonance energy transfer to assay lipid mixing between target- and vesicle-SNARE liposomes. Ca(2+)/calmodulin inhibited SNARE assembly and membrane fusion by binding to two distinct motifs located in the membrane-proximal regions of VAMP2 (K(D) = 500 nm) and syntaxin 1 (K(D) = 2 microm). In contrast, fusion was increased by full-length synaptotagmin 1 anchored in vesicle-SNARE liposomes. When synaptotagmin and calmodulin were combined, synaptotagmin overcame the inhibitory effects of calmodulin. Furthermore, synaptotagmin displaced calmodulin binding to target-SNAREs. These findings suggest that two distinct Ca(2+) sensors act antagonistically in SNARE-mediated fusion.

  16. Regulation of tissue factor and inflammatory mediators by Egr-1 in a mouse endotoxemia model.

    Science.gov (United States)

    Pawlinski, Rafal; Pedersen, Brian; Kehrle, Bettina; Aird, William C; Frank, Rolf D; Guha, Mausumee; Mackman, Nigel

    2003-05-15

    In septic shock, tissue factor (TF) activates blood coagulation, and cytokines and chemokines orchestrate an inflammatory response. In this study, the role of Egr-1 in lipopolysaccharide (LPS) induction of TF and inflammatory mediators in vivo was evaluated using Egr-1(+/+) and Egr-1(-/-) mice. Administration of LPS transiently increased the steady-state levels of Egr-1 mRNA in the kidneys and lungs of Egr-1(+/+) mice with maximal induction at one hour. Egr-1 was expressed in epithelial cells in the kidneys and lungs in untreated and LPS-treated mice. LPS induction of monocyte chemoattractant protein mRNA in the kidneys and lungs of Egr-1(-/-) mice was not affected at 3 hours, but its expression was significantly reduced at 8 hours compared with the expression observed in Egr-1(+/+) mice. Similarly, LPS induction of TF mRNA expression in the kidneys and lungs at 8 hours was reduced in Egr-1(-/-) mice. However, Egr-1 deficiency did not affect plasma levels of tumor necrosis factor alpha in endotoxemic mice. Moreover, Egr-1(+/+) and Egr-1(-/-) mice exhibited similar survival times in a model of acute endotoxemia. These data indicate that Egr-1 does not contribute to the early inflammatory response in the kidneys and lungs or the early systemic inflammatory response in endotoxemic mice. However, Egr-1 does contribute to the sustained expression of inflammatory mediators and to the maximal expression of TF at 8 hours in the kidneys and lungs.

  17. Regulation of Rad51-Mediated Homologous Recombination by BRCA2, DSS1 and RAD52

    DEFF Research Database (Denmark)

    Rants, Louise Olthaver Juhl

    Homologous recombination (HR) provides a mechanism to restore integrity and maintain stability of the genetic material. HR is a major pathway for repair of DNA double-strand breaks (DSB), recovery of broken replication forks and generation of meiotic crossovers. The defining step in HR is homolog......Homologous recombination (HR) provides a mechanism to restore integrity and maintain stability of the genetic material. HR is a major pathway for repair of DNA double-strand breaks (DSB), recovery of broken replication forks and generation of meiotic crossovers. The defining step in HR...... is homologous strand exchange directed by the RecA-related recombinase Rad51. BRCA2 participates in HR by mediating Rad51 homology-directed repair. Both BRCA2 and Rad51 are essential for HR, DNA repair, and the maintenance of genome stability. In the present study, we seek to understand the mechanism of BRCA2...... with RAD52-mediated repair at sites of CPT-induced DNA damage. The synthetic lethality approach using RAD52 small molecule inhibitors in brca-deficient cancers is a promising therapeutic strategy for cancer treatment....

  18. Regulation of Yersina pestis Virulence by AI-2 Mediated Quorum Sensing

    Energy Technology Data Exchange (ETDEWEB)

    Segelke, B; Hok, S; Lao, V; Corzett, M; Garcia, E

    2010-03-29

    The proposed research was motivated by an interest in understanding Y. pestis virulence mechanisms and bacteria cell-cell communication. It is expected that a greater understanding of virulence mechanisms will ultimately lead to biothreat countermeasures and novel therapeutics. Y. pestis is the etiological agent of plague, the most devastating disease in human history. Y. pestis infection has a high mortality rate and a short incubation before mortality. There is no widely available and effective vaccine for Y. pestis and multi-drug resistant strains are emerging. Y. pestis is a recognized biothreat agent based on the wide distribution of the bacteria in research laboratories around the world and on the knowledge that methods exist to produce and aerosolize large amounts of bacteria. We hypothesized that cell-cell communication via signaling molecules, or quorum sensing, by Y. pestis is important for the regulation of virulence factor gene expression during host invasion, though a causative link had never been established. Quorum sensing is a mode of intercellular communication which enables orchestration of gene expression for many bacteria as a function of population density and available evidence suggests there may be a link between quorum sensing and regulation of Y. pesits virulence. Several pathogenic bacteria have been shown to regulate expression of virulence factor genes, including genes encoding type III secretion, via quorum sensing. The Y. pestis genome encodes several cell-cell signaling pathways and the interaction of at least three of these are thought to be involved in one or more modes of host invasion. Furthermore, Y. pestis gene expression array studies carried out at LLNL have established a correlation between expression of known virulence factors and genes involved in processing of the AI-2 quorum sensing signal. This was a basic research project that was intended to provide new insights into bacterial intercellular communication and how it is

  19. CD4(+) type II NKT cells mediate ICOS and programmed death-1-dependent regulation of type 1 diabetes.

    Science.gov (United States)

    Kadri, Nadir; Korpos, Eva; Gupta, Shashank; Briet, Claire; Löfbom, Linda; Yagita, Hideo; Lehuen, Agnes; Boitard, Christian; Holmberg, Dan; Sorokin, Lydia; Cardell, Susanna L

    2012-04-01

    Type 1 diabetes (T1D) is a chronic autoimmune disease that results from T cell-mediated destruction of pancreatic β cells. CD1d-restricted NKT lymphocytes have the ability to regulate immunity, including autoimmunity. We previously demonstrated that CD1d-restricted type II NKT cells, which carry diverse TCRs, prevented T1D in the NOD mouse model for the human disease. In this study, we show that CD4(+) 24αβ type II NKT cells, but not CD4/CD8 double-negative NKT cells, were sufficient to downregulate diabetogenic CD4(+) BDC2.5 NOD T cells in adoptive transfer experiments. CD4(+) 24αβ NKT cells exhibited a memory phenotype including high ICOS expression, increased cytokine production, and limited display of NK cell markers, compared with double-negative 24αβ NKT cells. Blocking of ICOS or the programmed death-1/programmed death ligand 1 pathway was shown to abolish the regulation that occurred in the pancreas draining lymph nodes. To our knowledge, these results provide for the first time cellular and molecular information on how type II CD1d-restricted NKT cells regulate T1D.

  20. An ethanol extract of Piper betle Linn. mediates its anti-inflammatory activity via down-regulation of nitric oxide.

    Science.gov (United States)

    Ganguly, Sudipto; Mula, Soumyaditya; Chattopadhyay, Subrata; Chatterjee, Mitali

    2007-05-01

    The leaves of Piper betle (locally known as Paan) have long been in use in the Indian indigenous system of medicine for the relief of pain; however, the underlying molecular mechanisms of this effect have not been elucidated. The anti-inflammatory and immunomodulatory effects of an ethanolic extract of the leaves of P. betle (100 mg kg(-1); PB) were demonstrated in a complete Freund's adjuvant-induced model of arthritis in rats with dexamethasone (0.1 mg kg(-1)) as the positive control. At non-toxic concentrations of PB (5-25 microg mL(-1)), a dose-dependent decrease in extracellular production of nitric oxide in murine peritoneal macrophages was measured by the Griess assay and corroborated by flow cytometry using the nitric oxide specific probe, 4,5-diaminofluorescein-2 diacetate. This decreased generation of reactive nitrogen species was mediated by PB progressively down-regulating transcription of inducible nitric oxide synthase in macrophages, and concomitantly causing a dose-dependent decrease in the expression of interleukin-12 p40, indicating the ability of PB to down-regulate T-helper 1 pro-inflammatory responses. Taken together, the anti-inflammatory and anti-arthrotic activity of PB is attributable to its ability to down-regulate the generation of reactive nitrogen species, thus meriting further pharmacological investigation.

  1. Nanocurcumin-Mediated Down-Regulation of Telomerase Via Stimulating TGFβ1 Signaling Pathway in Hepatocellular Carcinoma Cells

    Science.gov (United States)

    Shariati, Molood; Hajigholami, Samira; Veisi Malekshahi, Ziba; Entezari, Maliheh; Bodaghabadi, Narges; Sadeghizadeh, Majid

    2017-10-10

    Curcumin, extracted from turmeric, represents enormous potential to serve as an anticancer agent. Telomerase is viewed as a prominent molecular target of curcumin, and Transforming growth factor-β1 (TGFβ1) has proven to be a major inhibitory signaling pathway for telomerase activity. In the current study, we aimed to explore suppressive effects of nanocurcumin on telomerase expression through TGFβ1 pathway in a hepatocellular carcinoma cell line (Huh7). MTT assay was used to determine the effect of nonocurcumin on viability of Huh7 cells. RT-PCR was used to analyze the gene expression patterns. MTT assay revealed that nanocurcumin acts in a dose- and time-dependent manner to diminish the cell viability. RT-PCR analysis indicated that nanocurcumin results in augmentation of TGFβ1 72 hours post treatment and leads to the reduction of telomerase expression 48 and 72 hours post exposure. Also, up-regulation of Smad3 and E2F1 and down-regulation of Smad7 confirmed the effect of nanocurcumin on intermediate components of TGFβ1 pathway. Furthermore, transfection of the proximal promoter of telomerase triggered a significant reduction in luciferase activity. The data from the present study lead us to develop a deeper understanding of the mechanisms underlying nanocurcumin-mediated regulation of telomerase expression, thereby presenting a new perspective to the landscape of using nanocurcumin as a cancer-oriented therapeutic agent.

  2. Regulatory RNAs in Bacillus subtilis: a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression

    Science.gov (United States)

    Mars, Ruben A. T.; Nicolas, Pierre; Denham, Emma L.

    2016-01-01

    SUMMARY Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5′ untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5′ ends of mRNA molecules. These can include 5′ secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. PMID:27784798

  3. Regulation of DNA Damage Response by Estrogen Receptor β-Mediated Inhibition of Breast Cancer Associated Gene 2

    Directory of Open Access Journals (Sweden)

    Yuan-Hao Lee

    2015-04-01

    Full Text Available Accumulating evidence suggests that ubiquitin E3 ligases are involved in cancer development as their mutations correlate with genomic instability and genetic susceptibility to cancer. Despite significant findings of cancer-driving mutations in the BRCA1 gene, estrogen receptor (ER-positive breast cancers progress upon treatment with DNA damaging-cytotoxic therapies. In order to understand the underlying mechanism by which ER-positive breast cancer cells develop resistance to DNA damaging agents, we employed an estrogen receptor agonist, Erb-041, to increase the activity of ERβ and negatively regulate the expression and function of the estrogen receptor α (ERα in MCF-7 breast cancer cells. Upon Erb-041-mediated ERα down-regulation, the transcription of an ERα downstream effector, BCA2 (Breast Cancer Associated gene 2, correspondingly decreased. The ubiquitination of chromatin-bound BCA2 was induced by ultraviolet C (UVC irradiation but suppressed by Erb-041 pretreatment, resulting in a blunted DNA damage response. Upon BCA2 silencing, DNA double-stranded breaks increased with Rad51 up-regulation and ataxia telangiectasia mutated (ATM activation. Mechanistically, UV-induced BCA2 ubiquitination and chromatin binding were found to promote DNA damage response and repair via the interaction of BCA2 with ATM, γH2AX and Rad51. Taken together, this study suggests that Erb-041 potentiates BCA2 dissociation from chromatin and co-localization with Rad51, resulting in inhibition of homologous recombination repair.

  4. SIRT1 Functions as an Important Regulator of Estrogen-Mediated Cardiomyocyte Protection in Angiotensin II-Induced Heart Hypertrophy

    Directory of Open Access Journals (Sweden)

    Tao Shen

    2014-01-01

    Full Text Available Background. Sirtuin 1 (SIRT1 is a member of the sirtuin family, which could activate cell survival machinery and has been shown to be protective in regulation of heart function. Here, we determined the mechanism by which SIRT1 regulates Angiotensin II- (AngII- induced cardiac hypertrophy and injury in vivo and in vitro. Methods. We analyzed SIRT1 expression in the hearts of control and AngII-induced mouse hypertrophy. Female C57BL/6 mice were ovariectomized and pretreated with 17β-estradiol to measure SIRT1 expression. Protein synthesis, cardiomyocyte surface area analysis, qRT-PCR, TUNEL staining, and Western blot were performed on AngII-induced mouse heart hypertrophy samples and cultured neonatal rat ventricular myocytes (NRVMs to investigate the function of SIRT1. Results. SIRT1 expression was slightly upregulated in AngII-induced mouse heart hypertrophy in vivo and in vitro, accompanied by elevated cardiomyocyte apoptosis. SIRT1 overexpression relieves AngII-induced cardiomyocyte hypertrophy and apoptosis. 17β-Estradiol was able to protect cardiomyocytes from AngII-induced injury with a profound upregulation of SIRT1 and activation of AMPK. Moreover, estrogen receptor inhibitor ICI 182,780 and SIRT1 inhibitor niacinamide could block SIRT1’s protective effect. Conclusions. These results indicate that SIRT1 functions as an important regulator of estrogen-mediated cardiomyocyte protection during AngII-induced heart hypertrophy and injury.

  5. Pnrc2 regulates 3'UTR-mediated decay of segmentation clock-associated transcripts during zebrafish segmentation.

    Science.gov (United States)

    Gallagher, Thomas L; Tietz, Kiel T; Morrow, Zachary T; McCammon, Jasmine M; Goldrich, Michael L; Derr, Nicolas L; Amacher, Sharon L

    2017-09-01

    Vertebrate segmentation is controlled by the segmentation clock, a molecular oscillator that regulates gene expression and cycles rapidly. The expression of many genes oscillates during segmentation, including hairy/Enhancer of split-related (her or Hes) genes, which encode transcriptional repressors that auto-inhibit their own expression, and deltaC (dlc), which encodes a Notch ligand. We previously identified the tortuga (tor) locus in a zebrafish forward genetic screen for genes involved in cyclic transcript regulation and showed that cyclic transcripts accumulate post-splicing in tor mutants. Here we show that cyclic mRNA accumulation in tor mutants is due to loss of pnrc2, which encodes a proline-rich nuclear receptor co-activator implicated in mRNA decay. Using an inducible in vivo reporter system to analyze transcript stability, we find that the her1 3'UTR confers Pnrc2-dependent instability to a heterologous transcript. her1 mRNA decay is Dicer-independent and likely employs a Pnrc2-Upf1-containing mRNA decay complex. Surprisingly, despite accumulation of cyclic transcripts in pnrc2-deficient embryos, we find that cyclic protein is expressed normally. Overall, we show that Pnrc2 promotes 3'UTR-mediated decay of developmentally-regulated segmentation clock transcripts and we uncover an additional post-transcriptional regulatory layer that ensures oscillatory protein expression in the absence of cyclic mRNA decay. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Regulatory RNAs in Bacillus subtilis: a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression.

    Science.gov (United States)

    Mars, Ruben A T; Nicolas, Pierre; Denham, Emma L; van Dijl, Jan Maarten

    2016-12-01

    Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5' untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5' ends of mRNA molecules. These can include 5' secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  7. P2X7 receptor-mediated PARP1 activity regulates astroglial death in the rat hippocampus following status epilepticus

    Directory of Open Access Journals (Sweden)

    Ji Yang eKim

    2015-09-01

    Full Text Available Poly(ADP-ribose polymerase-1 (PARP1 plays a regulatory role in apoptosis, necrosis, and other cellular processes after injury. Recently, we revealed that PARP1 regulates the differential neuronal/astroglial responses to pilocarpine-induced status epilepticus (SE in the distinct brain regions. In addition, P2X7 receptor (P2X7R, an ATP-gated ion channel, activation accelerates astroglial apoptosis, while it attenuates clasmatodendrosis (lysosome-derived autophagic astroglial death. Therefore, we investigated whether P2X7R regulates regional specific astroglial PARP1 expression/activation in response to SE. In the present study, P2X7R activation exacerbates SE-induced astroglial apoptosis, while P2X7R inhibition attenuates it accompanied by increasing PARP1 activity in the molecular layer of the dentate gyrus following SE. In the CA1 region, however, P2X7R inhibition deteriorates SE-induced clasmatodendrosis via PARP1 activation following SE. Taken together, our findings suggest that P2X7R function may affect SE-induced astroglial death by regulating PARP1 activation/expression in regional-specific manner. Therefore, the selective modulation of P2X7R-mediated PARP1 functions may be a considerable strategy for controls in various types of cell deaths.

  8. PRMT1-mediated methylation of the EGF receptor regulates signaling and cetuximab response

    KAUST Repository

    Liao, Hsin-Wei

    2015-11-16

    Posttranslational modifications to the intracellular domain of the EGFR are known to regulate EGFR functions; however, modifications to the extracellular domain and their effects remain relatively unexplored. Here, we determined that methylation at R198 and R200 of the EGFR extracellular domain by protein arginine methyltransferase 1 (PRMT1) enhances binding to EGF and subsequent receptor dimerization and signaling activation. In a mouse orthotopic colorectal cancer xenograft model, expression of a methylation-defective EGFR reduced tumor growth. Moreover, increased EGFR methylation sustained signaling activation and cell proliferation in the presence of the therapeutic EGFR monoclonal antibody cetuximab. In colorectal cancer patients, EGFR methylation level also correlated with a higher recurrence rate after cetuximab treatment and reduced overall survival. Together, these data indicate that R198/R200 methylation of the EGFR plays an important role in regulating EGFR functionality and resistance to cetuximab treatment.

  9. PRMT1-mediated methylation of the EGF receptor regulates signaling and cetuximab response

    Science.gov (United States)

    Liao, Hsin-Wei; Hsu, Jung-Mao; Xia, Weiya; Wang, Hung-Ling; Wang, Ying-Nai; Chang, Wei-Chao; Arold, Stefan T.; Chou, Chao-Kai; Tsou, Pei-Hsiang; Yamaguchi, Hirohito; Fang, Yueh-Fu; Lee, Hong-Jen; Lee, Heng-Huan; Tai, Shyh-Kuan; Yang, Mhu-Hwa; Morelli, Maria P.; Sen, Malabika; Ladbury, John E.; Chen, Chung-Hsuan; Grandis, Jennifer R.; Kopetz, Scott; Hung, Mien-Chie

    2015-01-01

    Posttranslational modifications to the intracellular domain of the EGFR are known to regulate EGFR functions; however, modifications to the extracellular domain and their effects remain relatively unexplored. Here, we determined that methylation at R198 and R200 of the EGFR extracellular domain by protein arginine methyltransferase 1 (PRMT1) enhances binding to EGF and subsequent receptor dimerization and signaling activation. In a mouse orthotopic colorectal cancer xenograft model, expression of a methylation-defective EGFR reduced tumor growth. Moreover, increased EGFR methylation sustained signaling activation and cell proliferation in the presence of the therapeutic EGFR monoclonal antibody cetuximab. In colorectal cancer patients, EGFR methylation level also correlated with a higher recurrence rate after cetuximab treatment and reduced overall survival. Together, these data indicate that R198/R200 methylation of the EGFR plays an important role in regulating EGFR functionality and resistance to cetuximab treatment. PMID:26571401

  10. PRMT1-mediated methylation of the EGF receptor regulates signaling and cetuximab response

    KAUST Repository

    Liao, Hsin-Wei; Hsu, Jung-Mao; Xia, Weiya; Wang, Hung-Ling; Wang, Ying-Nai; Chang, Wei-Chao; Arold, Stefan T.; Chou, Chao-Kai; Tsou, Pei-Hsiang; Yamaguchi, Hirohito; Fang, Yueh-Fu; Lee, Hong-Jen; Lee, Heng-Huan; Tai, Shyh-Kuan; Yang, Mhu-Hwa; Morelli, Maria P.; Sen, Malabika; Ladbury, John E.; Chen, Chung-Hsuan; Grandis, Jennifer R.; Kopetz, Scott; Hung, Mien-Chie

    2015-01-01

    Posttranslational modifications to the intracellular domain of the EGFR are known to regulate EGFR functions; however, modifications to the extracellular domain and their effects remain relatively unexplored. Here, we determined that methylation at R198 and R200 of the EGFR extracellular domain by protein arginine methyltransferase 1 (PRMT1) enhances binding to EGF and subsequent receptor dimerization and signaling activation. In a mouse orthotopic colorectal cancer xenograft model, expression of a methylation-defective EGFR reduced tumor growth. Moreover, increased EGFR methylation sustained signaling activation and cell proliferation in the presence of the therapeutic EGFR monoclonal antibody cetuximab. In colorectal cancer patients, EGFR methylation level also correlated with a higher recurrence rate after cetuximab treatment and reduced overall survival. Together, these data indicate that R198/R200 methylation of the EGFR plays an important role in regulating EGFR functionality and resistance to cetuximab treatment.

  11. Mitochondrial reactive oxygen species regulate the strength of inhibitory GABA-mediated synaptic transmission

    Science.gov (United States)

    Accardi, Michael V.; Daniels, Bryan A.; Brown, Patricia M. G. E.; Fritschy, Jean-Marc; Tyagarajan, Shiva K.; Bowie, Derek

    2014-01-01

    Neuronal communication imposes a heavy metabolic burden in maintaining ionic gradients essential for action potential firing and synaptic signalling. Although cellular metabolism is known to regulate excitatory neurotransmission, it is still unclear whether the brain’s energy supply affects inhibitory signalling. Here we show that mitochondrial-derived reactive oxygen species (mROS) regulate the strength of postsynaptic GABAA receptors at inhibitory synapses of cerebellar stellate cells. Inhibition is strengthened through a mechanism that selectively recruits α3-containing GABAA receptors into synapses with no discernible effect on resident α1-containing receptors. Since mROS promotes the emergence of postsynaptic events with unique kinetic properties, we conclude that newly recruited α3-containing GABAA receptors are activated by neurotransmitter released onto discrete postsynaptic sites. Although traditionally associated with oxidative stress in neurodegenerative disease, our data identify mROS as a putative homeostatic signalling molecule coupling cellular metabolism to the strength of inhibitory transmission.

  12. Glycosylation regulates NK cell-mediated effector function through PI3K pathway

    Czech Academy of Sciences Publication Activity Database

    Benson, Veronika; Grobárová, Valeria; Richter, Jan; Fišerová, Anna

    2010-01-01

    Roč. 22, č. 3 (2010), s. 167-177 ISSN 0953-8178 R&D Projects: GA AV ČR IAA500200620; GA AV ČR IAA500200509; GA ČR GA204/06/0771; GA ČR GD310/08/H077 Institutional research plan: CEZ:AV0Z50200510 Keywords : cytotoxic activity * gene regulation * glycoconjugate Subject RIV: EC - Immunology Impact factor: 3.301, year: 2010

  13. Flavonols Mediate Root Phototropism and Growth through Regulation of Proliferation-to-Differentiation Transition

    OpenAIRE

    Silva, Javier; Moreno Risueño, Miguel Ángel; Manzano, Concepción; Téllez Robledo, Bárbara; Navarro Neila, Sara; Carrasco Loba, Víctor; Pollmann, Stephan; Gallego, Javier; Pozo Benito, Juan Carlos del

    2016-01-01

    Roots normally grow in darkness, but they may be exposed to light. After perceiving light, roots bend to escape from light (root light avoidance) and reduce their growth. How root light avoidance responses are regulated is not well understood. Here, we show that illumination induces the accumulation of flavonols in Arabidopsis thaliana roots. During root illumination, flavonols rapidly accumulate at the side closer to light in the transition zone. This accumulation promotes asymmetrical cell ...

  14. Attachment, emotion regulation and coping in portuguese emerging adults: a test of a mediation hypothesis

    OpenAIRE

    Joana Cabral; Paula Mena Matos; Wim Beyers; Bart Soenens

    2012-01-01

    Although the quality of parent-adolescent emotional bonds has consistently been proposed as a major influence on young adult's psycho-emotional functioning, the precise means by which these bonds either facilitate or impede adaptive coping are not well-understood. In an effort to advance this inquiry, the present study examined interrelationships among measures of parental attachment, emotion regulation processes, and preferred coping strategies within a sample of 942 college freshmen. Struct...

  15. Does rumination mediate the relationship between emotion regulation ability and posttraumatic stress disorder?

    OpenAIRE

    Ehring, Thomas; Ehlers, Anke

    2014-01-01

    Background and objectives: Trauma-related rumination has been suggested to be involved in the maintenance of posttraumatic stress disorder (PTSD). This view has empirically been supported by extensive evidence using cross-sectional, prospective, and experimental designs. However, it is unclear why trauma survivors engage in rumination despite its negative consequences. The current study aimed to explore the hypothesis that low emotion regulation ability underlies trauma-related rumination.Met...

  16. MicroRNA-Mediated Regulation of ITGB3 and CHL1 Is Implicated in SSRI Action

    Directory of Open Access Journals (Sweden)

    Keren Oved

    2017-11-01

    Full Text Available Background: Selective serotonin reuptake inhibitor (SSRI antidepressant drugs are the first-line of treatment for major depressive disorder (MDD but are effective in <70% of patients. Our earlier genome-wide studies indicated that two genes encoding for cell adhesion proteins, close homolog of L1 (CHL1 and integrin beta-3 (ITGB3, and microRNAs, miR-151a-3p and miR-221/222, are implicated in the variable sensitivity and response of human lymphoblastoid cell lines (LCL from unrelated individuals to SSRI drugs.Methods: The microRNAs miR-221, miR-222, and miR-151-a-3p, along with their target gene binding sites, were explored in silico using miRBase, TargetScan, microRNAviewer, and the UCSC Genome Browser. Luciferase reporter assays were conducted for demonstrating the direct functional regulation of ITGB3 and CHL1 expression by miR-221/222 and miR-151a-3p, respectively. A human LCL exhibiting low sensitivity to paroxetine was utilized for studying the phenotypic effect of CHL1 regulation by miR-151a-3p on SSRI response.Results: By showing direct regulation of CHL1 and ITGB3 by miR-151a-3p and miR-221/222, respectively, we link these microRNAs and genes with cellular SSRI sensitivity phenotypes. We report that miR-151a-3p increases cell sensitivity to paroxetine via down-regulating CHL1 expression.Conclusions: miR-151a-3p, miR-221/222 and their (here confirmed respective target-genes, CHL1 and ITGB3, are implicated in SSRI responsiveness, and possibly in the clinical response to antidepressant drugs.

  17. Afferent nerves regulating the cough reflex: Mechanisms and Mediators of Cough in Disease

    Science.gov (United States)

    Canning, Brendan J.

    2010-01-01

    Bronchopulmonary C-fibers and acid-sensitive, capsaicin-insensitive mechanoreceptors innervating the larynx, trachea and large bronchi regulate the cough reflex. These vagal afferent nerves may interact centrally with sensory input arising from afferent nerves innervating the intrapulmonary airways or even extrapulmonary afferents such as those innervating the nasal mucosa and esophagus to produce chronic cough or enhanced cough responsiveness. The mechanisms of cough initiation in health and in disease are briefly described. PMID:20172253

  18. MiRNA-mediated regulation of cell signaling and homeostasis in the early mouse embryo.

    Science.gov (United States)

    Pernaute, Barbara; Spruce, Thomas; Rodriguez, Tristan A; Manzanares, Miguel

    2011-02-15

    At the time of implantation the mouse embryo is composed of three tissues the epiblast, trophectoderm and primitive endoderm. As development progresses the epiblast goes on to form the foetus whilst the trophectoderm and primitive endoderm give rise to extra-embryonic structures with important roles in embryo patterning and nutrition. Dramatic changes in gene expression occur during early embryo development and these require regulation at different levels. miRNAs are small non coding RNAs that have emerged over the last decade as important post-transcriptional repressors of gene expression. The roles played by miRNAs during early mammalian development are only starting to be elucidated. In order to gain insight into the function of miRNAs in the different lineages of the early mouse embryo we have analysed in depth the phenotype of embryos and extra-embryonic stem cells mutant for the miRNA maturation protein Dicer. This study revealed that miRNAs are involved in regulating cell signaling and homeostasis in the early embryo. Specifically, we identified a role for miRNAs in regulating the Erk signaling pathway in the extra-embryonic endoderm, cell cycle progression in extra-embryonic tissues and apoptosis in the epiblast.

  19. ROBO4-Mediated Vascular Integrity Regulates the Directionality of Hematopoietic Stem Cell Trafficking

    Directory of Open Access Journals (Sweden)

    Stephanie Smith-Berdan

    2015-02-01

    Full Text Available Despite the use of hematopoietic stem cells (HSCs in clinical therapy for over half a century, the mechanisms that regulate HSC trafficking, engraftment, and life-long persistence after transplantation are unclear. Here, we show that the vascular endothelium regulates HSC trafficking into and out of bone marrow (BM niches. Surprisingly, we found that instead of acting as barriers to cellular entry, vascular endothelial cells, via the guidance molecule ROBO4, actively promote HSC translocation across vessel walls into the BM space. In contrast, we found that the vasculature inhibits the reverse process, as induced vascular permeability led to a rapid increase in HSCs in the blood stream. Thus, the vascular endothelium reinforces HSC localization to BM niches both by promoting HSC extravasation from blood-to-BM and by forming vascular barriers that prevent BM-to-blood escape. Our results uncouple the mechanisms that regulate the directionality of HSC trafficking and show that the vasculature can be targeted to improve hematopoietic transplantation therapies.

  20. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  1. Negative regulation of retrovirus expression in embryonal carcinoma cells mediated by an intragenic domain.

    Science.gov (United States)

    Loh, T P; Sievert, L L; Scott, R W

    1988-11-01

    An intragenic region spanning the tRNA primer binding site of a Moloney murine leukemia virus recombinant retrovirus was found to restrict expression specifically in embryonal carcinoma (EC) cells. When the inhibitory domain was present, the levels of steady-state RNA synthesized from integrated recombinant templates in stable cotransformation assays were reduced 20-fold in EC cells but not in C2 myoblast cells. Transient-cotransfection assays showed that repression of a template containing the EC-specific inhibitory component was relieved by an excess of specific competitor DNA. In addition, repression mediated by the inhibitory component was orientation independent. This evidence demonstrates the presence of a saturable, trans-acting negative regulatory factor(s) in EC cells and suggests that the interaction of the factor(s) with the intragenic inhibitory component occurs at the DNA level.

  2. The cell-mediated immunity of Drosophila melanogaster: hemocyte lineages, immune compartments, microanatomy and regulation.

    Science.gov (United States)

    Honti, Viktor; Csordás, Gábor; Kurucz, Éva; Márkus, Róbert; Andó, István

    2014-01-01

    In the animal kingdom, innate immunity is the first line of defense against invading pathogens. The dangers of microbial and parasitic attacks are countered by similar mechanisms, involving the prototypes of the cell-mediated immune responses, the phagocytosis and encapsulation. Work on Drosophila has played an important role in promoting an understanding of the basic mechanisms of phylogenetically conserved modules of innate immunity. The aim of this review is to survey the developments in the identification and functional definition of immune cell types and the immunological compartments of Drosophila melanogaster. We focus on the molecular and developmental aspects of the blood cell types and compartments, as well as the dynamics of blood cell development and the immune response. Further advances in the characterization of the innate immune mechanisms in Drosophila will provide basic clues to the understanding of the importance of the evolutionary conserved mechanisms of innate immune defenses in the animal kingdom. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Connexin 43-Mediated Astroglial Metabolic Networks Contribute to the Regulation of the Sleep-Wake Cycle.

    Science.gov (United States)

    Clasadonte, Jerome; Scemes, Eliana; Wang, Zhongya; Boison, Detlev; Haydon, Philip G

    2017-09-13

    Astrocytes produce and supply metabolic substrates to neurons through gap junction-mediated astroglial networks. However, the role of astroglial metabolic networks in behavior is unclear. Here, we demonstrate that perturbation of astroglial networks impairs the sleep-wake cycle. Using a conditional Cre-Lox system in mice, we show that knockout of the gap junction subunit connexin 43 in astrocytes throughout the brain causes excessive sleepiness and fragmented wakefulness during the nocturnal active phase. This astrocyte-specific genetic manipulation silenced the wake-promoting orexin neurons located in the lateral hypothalamic area (LHA) by impairing glucose and lactate trafficking through astrocytic networks. This global wakefulness instability was mimicked with viral delivery of Cre recombinase to astrocytes in the LHA and rescued by in vivo injections of lactate. Our findings propose a novel regulatory mechanism critical for maintaining normal daily cycle of wakefulness and involving astrocyte-neuron metabolic interactions. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Autoimmunity in Arabidopsis acd11 Is Mediated by Epigenetic Regulation of an Immune Receptor

    DEFF Research Database (Denmark)

    Palma, K.; Thorgrimsen, S.; Malinovsky, F.G.

    2010-01-01

    Certain pathogens deliver effectors into plant cells to modify host protein targets and thereby suppress immunity. These target modifications can be detected by intracellular immune receptors, or Resistance (R) proteins, that trigger strong immune responses including localized host cell death....... The accelerated cell death 11 (acd11) "lesion mimic" mutant of Arabidopsis thaliana exhibits autoimmune phenotypes such as constitutive defense responses and cell death without pathogen perception. ACD11 encodes a putative sphingosine transfer protein, but its precise role during these processes is unknown......, and that cell death in other lesion mimic mutants may also be caused by inappropriate activation of R genes. Moreover, SDG8 is required for basal and R protein-mediated pathogen resistance in Arabidopsis, revealing the importance of chromatin remodeling as a key process in plant innate immunity....

  5. Curcumin-mediated regulation of intestinal barrier function: The mechanism underlying its beneficial effects.

    Science.gov (United States)

    Ghosh, Siddhartha S; He, Hongliang; Wang, Jing; Gehr, Todd W; Ghosh, Shobha

    2018-01-02

    Curcumin has anti-inflammatory, anti-oxidant and anti-proliferative properties established largely by in vitro studies. Accordingly, oral administration of curcumin beneficially modulates many diseases including diabetes, fatty-liver disease, atherosclerosis, arthritis, cancer and neurological disorders such as depression, Alzheimer's or Parkinson's disease. However, limited bioavailability and inability to detect curcumin in circulation or target tissues has hindered the validation of a causal role. We established curcumin-mediated decrease in the release of gut bacteria-derived lipopolysaccharide (LPS) into circulation by maintaining the integrity of the intestinal barrier function as the mechanism underlying the attenuation of metabolic diseases (diabetes, atherosclerosis, kidney disease) by curcumin supplementation precluding the need for curcumin absorption. In view of the causative role of circulating LPS and resulting chronic inflammation in the development of diseases listed above, this review summarizes the mechanism by which curcumin affects the several layers of the intestinal barrier and, despite negligible absorption, can beneficially modulate these diseases.

  6. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    International Nuclear Information System (INIS)

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C.; Ballestas, Mary E.; Elmets, Craig A.; Robbins, David J.; Matalon, Sadis; Deshane, Jessy S.; Afaq, Farrukh; Bickers, David R.; Athar, Mohammad

    2013-01-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions

  7. The Tumor Suppressor Hace1 Is a Critical Regulator of TNFR1-Mediated Cell Fate

    Directory of Open Access Journals (Sweden)

    Luigi Tortola

    2016-05-01

    Full Text Available Summary: The HECT domain E3 ligase HACE1 has been identified as a tumor suppressor in multiple cancers. Here, we report that HACE1 is a central gatekeeper of TNFR1-induced cell fate. Genetic inactivation of HACE1 inhibits TNF-stimulated NF-κB activation and TNFR1-NF-κB-dependent pathogen clearance in vivo. Moreover, TNF-induced apoptosis was impaired in hace1 mutant cells and knockout mice in vivo. Mechanistically, HACE1 is essential for the ubiquitylation of the adaptor protein TRAF2 and formation of the apoptotic caspase-8 effector complex. Intriguingly, loss of HACE1 does not impair TNFR1-mediated necroptotic cell fate via RIP1 and RIP3 kinases. Loss of HACE1 predisposes animals to colonic inflammation and carcinogenesis in vivo, which is markedly alleviated by genetic inactivation of RIP3 kinase and TNFR1. Thus, HACE1 controls TNF-elicited cell fate decisions and exerts tumor suppressor and anti-inflammatory activities via a TNFR1-RIP3 kinase-necroptosis pathway. : Tortola et al. report that the E3 ubiquitin ligase HACE1 is a gatekeeper of TNFR1-mediated cell fate. Hace1 deficiency impairs TNF-driven NF-κB activation and apoptosis and predisposes cells to necroptosis. Consequently, hace1–/– mice show enhanced colitis and colon cancer, which can be reverted by inactivation of pro-necroptotic kinase RIP3 and TNFR1.

  8. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Ballestas, Mary E. [Department of Pediatrics Infectious Disease, Children' s of Alabama, School of Medicine, University of Alabama at Birmingham, AL (United States); Elmets, Craig A. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Robbins, David J. [Department of Surgery, Molecular Oncology Program, Miller School of Medicine, University of Miami, Miami (United States); Matalon, Sadis [Department of Anesthesiology, University of Alabama at Birmingham, Birmingham, AL (United States); Deshane, Jessy S. [Department of Medicine, Division of Pulmonary, Allergy and Critical Care Medicine, University of Alabama at Birmingham, Birmingham, AL (United States); Afaq, Farrukh [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Bickers, David R. [Department of Dermatology, Columbia University Medical Center, New York (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States)

    2013-11-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions.

  9. Social isolation mediated anxiety like behavior is associated with enhanced expression and regulation of BDNF in the female mouse brain.

    Science.gov (United States)

    Kumari, Anita; Singh, Padmanabh; Baghel, Meghraj Singh; Thakur, M K

    2016-05-01

    Adverse early life experience is prominent risk factors for numerous psychiatric illnesses, including mood and anxiety disorders. It imposes serious long-term costs on the individual as well as health and social systems. Hence, developing therapies that prevent the long-term consequences of early life stress is of utmost importance, and necessitates a better understanding of the mechanisms by which early life stress triggers long-lasting alterations in gene expression and behavior. Post-weaning isolation rearing of rodents models the behavioral consequences of adverse early life experiences in humans and it is reported to cause anxiety like behavior which is more common in case of females. Therefore, in the present study, we have studied the impact of social isolation of young female mice for 8weeks on the anxiety like behavior and the underlying molecular mechanism. Elevated plus maze and open field test revealed that social isolation caused anxiety like behavior. BDNF, a well-known molecule implicated in the anxiety like behavior, was up-regulated both at the message and protein level in cerebral cortex by social isolation. CREB-1 and CBP, which play a crucial role in BDNF transcription, were up-regulated at mRNA level in cerebral cortex by social isolation. HDAC-2, which negatively regulates BDNF expression, was down-regulated at mRNA and protein level in cerebral cortex by social isolation. Furthermore, BDNF acts in concert with Limk-1, miRNA-132 and miRNA-134 for the regulation of structural and morphological plasticity. Social isolation resulted in up-regulation of Limk-1 mRNA and miRNA-132 expression in the cerebral cortex. MiRNA-134, which inhibits the translation of Limk-1, was decreased in cerebral cortex by social isolation. Taken together, our study suggests that social isolation mediated anxiety like behavior is associated with up-regulation of BDNF expression and concomitant increase in the expression of CBP, CREB-1, Limk-1 and miRNA-132, and decrease

  10. The Active Jasmonate JA-Ile Regulates a Specific Subset of Plant Jasmonate-Mediated Resistance to Herbivores in Nature

    Directory of Open Access Journals (Sweden)

    Meredith C. Schuman

    2018-06-01

    Full Text Available The jasmonate hormones are essential regulators of plant defense against herbivores and include several dozen derivatives of the oxylipin jasmonic acid (JA. Among these, the conjugate jasmonoyl isoleucine (JA-Ile has been shown to interact directly with the jasmonate co-receptor complex to regulate responses to jasmonate signaling. However, functional studies indicate that some aspects of jasmonate-mediated defense are not regulated by JA-Ile. Thus, it is not clear whether JA-Ile is best characterized as the master jasmonate regulator of defense, or if it regulates more specific aspects. We investigated possible functions of JA-Ile in anti-herbivore resistance of the wild tobacco Nicotiana attenuata, a model system for plant-herbivore interactions. We first analyzed the soluble and volatile secondary metabolomes of irJAR4xirJAR6, asLOX3, and WT plants, as well as an RNAi line targeting the jasmonate co-receptor CORONATINE INSENSITIVE 1 (irCOI1, following a standardized herbivory treatment. irJAR4xirJAR6 were the most similar to WT plants, having a ca. 60% overlap in differentially regulated metabolites with either asLOX3 or irCOI1. In contrast, while at least 25 volatiles differed between irCOI1 or asLOX3 and WT plants, there were few or no differences in herbivore-induced volatile emission between irJAR4xirJAR6 and WT plants, in glasshouse- or field-collected samples. We then measured the susceptibility of jasmonate-deficient vs. JA-Ile-deficient plants in nature, in comparison to wild-type (WT controls, and found that JA-Ile-deficient plants (irJAR4xirJAR6 are much better defended even than a mildly jasmonate-deficient line (asLOX3. The differences among lines could be attributed to differences in damage from specific herbivores, which appeared to prefer either one or the other jasmonate-deficient phenotype. We further investigated the elicitation of one herbivore-induced volatile known to be jasmonate-regulated and to mediate resistance to

  11. Glucose regulated proteins 78 and 75 bind to the receptor for hyaluronan mediated motility in interphase microtubules

    International Nuclear Information System (INIS)

    Kuwabara, Hiroko; Yoneda, Masahiko; Hayasaki, Hana; Nakamura, Toshiya; Mori, Hiroshi

    2006-01-01

    The receptor for hyaluronan mediated motility (RHAMM), which is a hyaluronan-binding protein, is a centrosomal and microtubal protein. Here, we have identified two RHAMM-binding proteins, glucose regulated protein (GRP) 78 and GRP75, using co-immunoprecipitation analysis. These two proteins directly bound to glutathione-S-transferase-RHAMM fusion proteins. By double immunostaining, GRP78 and GRP75 colocalized with RHAMM in interphase microtubules, but were separated in mitotic spindles. Prevention of microtubule polymerization by TN-16 and vincristine sulfate induced RHAMM overexpression without a significant change in GRP78/75. Taken together, GRP78/75 and RHAMM complexes may stabilize microtubules in the interphase, associated with a downregulation of RHAMM. These results reveal a new biochemical activity of RHAMM

  12. Mitochondrial Porin Isoform AtVDAC1 Regulates the Competence of Arabidopsis thaliana to Agrobacterium-Mediated Genetic Transformation.

    Science.gov (United States)

    Kwon, Tackmin

    2016-09-01

    The efficiency of Agrobacterium-mediated transformation in plants depends on the virulence of Agrobacterium strains, the plant tissue culture conditions, and the susceptibility of host plants. Understanding the molecular interactions between Agrobacterium and host plant cells is crucial when manipulating the susceptibility of recalcitrant crop plants and protecting orchard trees from crown gall disease. It was discovered that Arabidopsis voltage-dependent anion channel 1 (atvdac1) mutant has drastic effects on Agrobacterium-mediated tumorigenesis and growth developmental phenotypes, and that these effects are dependent on a Ws-0 genetic background. Genetic complementation of Arabidopsis vdac1 mutants and yeast porin1-deficient strain with members of the AtVDAC gene family revealed that AtVDAC1 is required for Agrobacterium-mediated transformation, and there is weak functional redundancy between AtVDAC1 and AtVDAC3, which is independent of porin activity. Furthermore, atvdac1 mutants were deficient in transient and stable transformation by Agrobacterium, suggesting that AtVDAC1 is involved in the early stages of Agrobacterium infection prior to transferred-DNA (T-DNA) integration. Transgenic plants overexpressing AtVDAC1 not only complemented the phenotypes of the atvdac1 mutant, but also showed high efficiency of transient T-DNA gene expression; however, the efficiency of stable transformation was not affected. Moreover, the effect of phytohormone treatment on competence to Agrobacterium was compromised in atvdac1 mutants. These data indicate that AtVDAC1 regulates the competence of Arabidopsis to Agrobacterium infection.

  13. Candida albicans Swi/Snf and Mediator Complexes Differentially Regulate Mrr1-Induced MDR1 Expression and Fluconazole Resistance.

    Science.gov (United States)

    Liu, Zhongle; Myers, Lawrence C

    2017-11-01

    Long-term azole treatment of patients with chronic Candida albicans infections can lead to drug resistance. Gain-of-function (GOF) mutations in the transcription factor Mrr1 and the consequent transcriptional activation of MDR1 , a drug efflux coding gene, is a common pathway by which this human fungal pathogen acquires fluconazole resistance. This work elucidates the previously unknown downstream transcription mechanisms utilized by hyperactive Mrr1. We identified the Swi/Snf chromatin remodeling complex as a key coactivator for Mrr1, which is required to maintain basal and induced open chromatin, and Mrr1 occupancy, at the MDR1 promoter. Deletion of snf2 , the catalytic subunit of Swi/Snf, largely abrogates the increases in MDR1 expression and fluconazole MIC observed in MRR1 GOF mutant strains. Mediator positively and negatively regulates key Mrr1 target promoters. Deletion of the Mediator tail module med3 subunit reduces, but does not eliminate, the increased MDR1 expression and fluconazole MIC conferred by MRR1 GOF mutations. Eliminating the kinase activity of the Mediator Ssn3 subunit suppresses the decreased MDR1 expression and fluconazole MIC of the snf2 null mutation in MRR1 GOF strains. Ssn3 deletion also suppresses MDR1 promoter histone displacement defects in snf2 null mutants. The combination of this work with studies on other hyperactive zinc cluster transcription factors that confer azole resistance in fungal pathogens reveals a complex picture where the induction of drug efflux pump expression requires the coordination of multiple coactivators. The observed variations in transcription factor and target promoter dependence of this process may make the search for azole sensitivity-restoring small molecules more complicated. Copyright © 2017 American Society for Microbiology.

  14. Can Environmental Regulations Promote Corporate Environmental Responsibility? Evidence from the Moderated Mediating Effect Model and an Empirical Study in China

    Directory of Open Access Journals (Sweden)

    Benhong Peng

    2018-02-01

    Full Text Available Based on the Stakeholder theory, a moderated mediating effect model is developed to reach the study objective, revealing an important connection that suggests environmental regulations (ERs influence corporate environmental responsibility (CER (Porter Hypothesis. In building the model, the validity of the questionnaire data was analyzed with factor analysis. By employing a two-step approach, a regression analysis is utilized to discuss the mediating effect of altruistic motivation and moderating effect of green innovation, and a structural equation model is used to explore the interactive mechanism of different variables. It is found that altruistic motivation plays a medium role in the relationship between ERs and CER, and green innovation engages a positive coordination in the relationship. The empirical study identifies factors affecting enterprises’ willingness to undertake environmental responsibility, including environment policies, corporate culture, and personal characters among others. It is also revealed that altruistic motivation is conducive to forming a community interests among enterprises and enhancing their resistance to market risks, which explains and corroborates the Stakeholder theory; and the higher the level of green innovation, the more willing enterprises are to implement environmentally friendly operations.

  15. Cytosolic Pellino-1-Mediated K63-Linked Ubiquitination of IRF5 in M1 Macrophages Regulates Glucose Intolerance in Obesity

    Directory of Open Access Journals (Sweden)

    Donghyun Kim

    2017-07-01

    Full Text Available IRF5 is a signature transcription factor that induces M1 macrophage polarization. However, little is known regarding cytosolic proteins that induce IRF5 activation for M1 polarization. Here, we report the interaction between ubiquitin E3 ligase Pellino-1 and IRF5 in the cytoplasm, which increased nuclear translocation of IRF5 by K63-linked ubiquitination in human and mouse M1 macrophages. LPS and/or IFN-γ increased Pellino-1 expression, and M1 polarization was attenuated in Pellino-1-deficient macrophages in vitro and in vivo. Defective M1 polarization in Pellino-1-deficient macrophages improved glucose intolerance in mice fed a high-fat diet. Furthermore, macrophages in adipose tissues from obese humans exhibited increased Pellino-1 expression and IRF5 nuclear translocation compared with nonobese subjects, and these changes are associated with insulin resistance index. This study demonstrates that cytosolic Pellino-1-mediated K63-linked ubiquitination of IRF5 in M1 macrophages regulates glucose intolerance in obesity, suggesting a cytosolic mediator function of Pellino-1 in TLR4/IFN-γ receptor-IRF5 axis during M1 polarization.

  16. Ceramide-mediated macroautophagy involves inhibition of protein kinase B and up-regulation of beclin 1.

    Science.gov (United States)

    Scarlatti, Francesca; Bauvy, Chantal; Ventruti, Annamaria; Sala, Giusy; Cluzeaud, Françoise; Vandewalle, Alain; Ghidoni, Riccardo; Codogno, Patrice

    2004-04-30

    The sphingolipid ceramide is involved in the cellular stress response. Here we demonstrate that ceramide controls macroautophagy, a major lysosomal catabolic pathway. Exogenous C(2)-ceramide stimulates macroautophagy (proteolysis and accumulation of autophagic vacuoles) in the human colon cancer HT-29 cells by increasing the endogenous pool of long chain ceramides as demonstrated by the use of the ceramide synthase inhibitor fumonisin B(1). Ceramide reverted the interleukin 13-dependent inhibition of macroautophagy by interfering with the activation of protein kinase B. In addition, C(2)-ceramide stimulated the expression of the autophagy gene product beclin 1. Ceramide is also the mediator of the tamoxifen-dependent accumulation of autophagic vacuoles in the human breast cancer MCF-7 cells. Monodansylcadaverine staining and electron microscopy showed that this accumulation was abrogated by myriocin, an inhibitor of de novo synthesis ceramide. The tamoxifen-dependent accumulation of vacuoles was mimicked by 1-phenyl-2-decanoylamino-3-morpholino-1-propanol, an inhibitor of glucosylceramide synthase. 1-Phenyl-2-decanoylamino-3-morpholino-1-propanol, tamoxifen, and C(2)-ceramide stimulated the expression of beclin 1, whereas myriocin antagonized the tamoxifen-dependent up-regulation. Tamoxifen and C(2)-ceramide interfere with the activation of protein kinase B, whereas myriocin relieved the inhibitory effect of tamoxifen. In conclusion, the control of macroautophagy by ceramide provides a novel function for this lipid mediator in a cell process with major biological outcomes.

  17. ROTUNDA3 function in plant development by phosphatase 2A-mediated regulation of auxin transporter recycling.

    Science.gov (United States)

    Karampelias, Michael; Neyt, Pia; De Groeve, Steven; Aesaert, Stijn; Coussens, Griet; Rolčík, Jakub; Bruno, Leonardo; De Winne, Nancy; Van Minnebruggen, Annemie; Van Montagu, Marc; Ponce, María Rosa; Micol, José Luis; Friml, Jiří; De Jaeger, Geert; Van Lijsebettens, Mieke

    2016-03-08

    The shaping of organs in plants depends on the intercellular flow of the phytohormone auxin, of which the directional signaling is determined by the polar subcellular localization of PIN-FORMED (PIN) auxin transport proteins. Phosphorylation dynamics of PIN proteins are affected by the protein phosphatase 2A (PP2A) and the PINOID kinase, which act antagonistically to mediate their apical-basal polar delivery. Here, we identified the ROTUNDA3 (RON3) protein as a regulator of the PP2A phosphatase activity in Arabidopsis thaliana. The RON3 gene was map-based cloned starting from the ron3-1 leaf mutant and found to be a unique, plant-specific gene coding for a protein with high and dispersed proline content. The ron3-1 and ron3-2 mutant phenotypes [i.e., reduced apical dominance, primary root length, lateral root emergence, and growth; increased ectopic stages II, IV, and V lateral root primordia; decreased auxin maxima in indole-3-acetic acid (IAA)-treated root apical meristems; hypergravitropic root growth and response; increased IAA levels in shoot apices; and reduced auxin accumulation in root meristems] support a role for RON3 in auxin biology. The affinity-purified PP2A complex with RON3 as bait suggested that RON3 might act in PIN transporter trafficking. Indeed, pharmacological interference with vesicle trafficking processes revealed that single ron3-2 and double ron3-2 rcn1 mutants have altered PIN polarity and endocytosis in specific cells. Our data indicate that RON3 contributes to auxin-mediated development by playing a role in PIN recycling and polarity establishment through regulation of the PP2A complex activity.

  18. Calmodulin-mediated activation of Akt regulates survival of c-Myc-overexpressing mouse mammary carcinoma cells.

    Science.gov (United States)

    Deb, Tushar B; Coticchia, Christine M; Dickson, Robert B

    2004-09-10

    c-Myc-overexpressing mammary epithelial cells are proapoptotic; their survival is strongly promoted by epidermal growth factor (EGF). We now demonstrate that EGF-induced Akt activation and survival in transgenic mouse mammary tumor virus-c-Myc mouse mammary carcinoma cells are both calcium/calmodulin-dependent. Akt activation is abolished by the phospholipase C-gamma inhibitor U-73122, by the intracellular calcium chelator BAPTA-AM, and by the specific calmodulin antagonist W-7. These results implicate calcium/calmodulin in the activation of Akt in these cells. In addition, Akt activation by serum and insulin is also inhibited by W-7. EGF-induced and calcium/calmodulin-mediated Akt activation occurs in both tumorigenic and non-tumorigenic mouse and human mammary epithelial cells, independent of their overexpression of c-Myc. These results imply that calcium/calmodulin may be a common regulator of Akt activation, irrespective of upstream receptor activator, mammalian species, and transformation status in mammary epithelial cells. However, only c-Myc-overexpressing mouse mammary carcinoma cells (but not normal mouse mammary epithelial cells) undergo apoptosis in the presence of the calmodulin antagonist W-7, indicating the vital selective role of calmodulin for survival of these cells. Calcium/calmodulin-regulated Akt activation is mediated directly by neither calmodulin kinases nor phosphatidylinositol 3-kinase (PI-3 kinase). Pharmacological inhibitors of calmodulin kinase kinase and calmodulin kinases II and III do not inhibit EGF-induced Akt activation, and calmodulin antagonist W-7 does not inhibit phosphotyrosine-associated PI-3 kinase activation. Akt is, however, co-immunoprecipitated with calmodulin in an EGF-dependent manner, which is inhibited by calmodulin antagonist W-7. We conclude that calmodulin may serve a vital regulatory function to direct the localization of Akt to the plasma membrane for its activation by PI-3 kinase.

  19. Anti-inflammatory effects of benfotiamine are mediated through the regulation of the arachidonic acid pathway in macrophages.

    Science.gov (United States)

    Shoeb, Mohammad; Ramana, Kota V

    2012-01-01

    Benfotiamine, a lipid-soluble analogue of vitamin B1, is a potent antioxidant that is used as a food supplement for the treatment of diabetic complications. Our recent study (U.C. Yadav et al., Free Radic. Biol. Med. 48:1423-1434, 2010) indicates a novel role for benfotiamine in the prevention of bacterial endotoxin, lipopolysaccharide (LPS)-induced cytotoxicity and inflammatory response in murine macrophages. Nevertheless, it remains unclear how benfotiamine mediates anti-inflammatory effects. In this study, we investigated the anti-inflammatory role of benfotiamine in regulating arachidonic acid (AA) pathway-generated inflammatory lipid mediators in RAW264.7 macrophages. Benfotiamine prevented the LPS-induced activation of cPLA2 and release of AA metabolites such as leukotrienes, prostaglandin E2, thromboxane 2 (TXB2), and prostacyclin (PGI2) in macrophages. Further, LPS-induced expression of AA-metabolizing enzymes such as COX-2, LOX-5, TXB synthase, and PGI2 synthase was significantly blocked by benfotiamine. Furthermore, benfotiamine prevented the LPS-induced phosphorylation of ERK1/2 and expression of transcription factors NF-κB and Egr-1. Benfotiamine also prevented the LPS-induced oxidative stress and protein-HNE adduct formation. Most importantly, compared to specific COX-2 and LOX-5 inhibitors, benfotiamine significantly prevented LPS-induced macrophage death and monocyte adhesion to endothelial cells. Thus, our studies indicate that the dual regulation of the COX and LOX pathways in AA metabolism could be a novel mechanism by which benfotiamine exhibits its potential anti-inflammatory response. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Anti-Inflammatory Effects of Benfotiamine are Mediated Through the Regulation of Arachidonic Acid Pathway in Macrophages

    Science.gov (United States)

    Shoeb, Mohammad; Ramana, Kota V

    2011-01-01

    Benfotiamine, a lipid-soluble analogue of vitamin B1, is a potent anti-oxidant that is used as a food supplement for the treatment of diabetic complications. Our recent study indicates a novel role of benfotiamine in the prevention of bacterial endotoxin, lipopolysaccharide (LPS)-induced cytotoxicity and inflammatory response in murine macrophages. Nevertheless, it remains unclear how benfotiamine mediates anti-inflammatory effects. In this study, we investigated the anti-inflammatory role of benfotiamine in regulating the arachidonic acid (AA) pathway generated inflammatory lipid mediators in RAW 264.7 macrophages. Benfotiamine prevented the LPS-induced activation of cPLA2 and release of AA metabolites such as leukotrienes (LTB4), prostaglandin E2 (PGE2), thromboxanes 2 (TXB2) and prostacyclin (PGI2) in macrophages. Further, LPS-induced expressions of AA metabolizing enzymes such as COX-2, LOX-5, TXB synthase and PGI2 synthase were significantly blocked by benfotiamine. Furthermore, benfotiamine prevented the LPS-induced phosphorylation of ERK1/2 and expression of transcription factors NF-kB, and Egr-1. Benfotiamine also prevented the LPS-induced oxidative stress and protein-HNE adducts formation. Most importantly, as compared to specific COX-2 and LOX-5 inhibitors, benfotiamine significantly prevented the LPS-induced macrophage death and monocytes adhesion to endothelial cells. Thus, our studies indicate that the dual regulation of COX and LOX pathways in AA metabolism could be a novel mechanism by which benfotiamine exhibits its potential anti-inflammatory response. PMID:22067901

  1. E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis.

    Science.gov (United States)

    Park, Kyeong-Su; Kim, Ju Hee; Shin, Hee Won; Chung, Kyung-Sook; Im, Dong-Soo; Lim, Jung Hwa; Jung, Cho-Rok

    2015-10-26

    Missense mutation of VHL gene is frequently detected in type 2 VHL diseases and linked to a wide range of pVHL functions and stability. Certain mutant pVHLs retain ability to regulate HIFs but lose their function by instability. In this case, regulating of degradation of mutant pVHLs, can be postulated as therapeutic method. The stability and cellular function of missense mutant pVHLs were determine in HEK293T transient expressing cell and 786-O stable cell line. Ubiquitination assay of mutant VHL proteins was performed in vitro system. Anticancer effect of adenovirus mediated shUCP expressing was evaluated using ex vivo mouse xenograft assay. Three VHL missense mutants (V155A, L158Q, and Q164R) are directly ubiquitinated by E2-EPF UCP (UCP) in vitro. Mutant pVHLs are more unstable than wild type in cell. Missense mutant pVHLs interact with UCP directly in both in vitro and cellular systems. Lacking all of lysine residues of pVHL result in resistance to ubiquitination thereby increase its stability. Missense mutant pVHLs maintained the function of E3 ligase to ubiquitinate HIF-1α in vitro. In cells expressing mutant pVHLs, Glut-1 and VEGF were relatively upregulated compared to their levels in cells expressing wild-type. Depletion of UCP restored missense mutant pVHLs levels and inhibited cell growth. Adenovirus-mediated shUCP RNA delivery inhibited tumor growth in ex vivo mouse xenograft model. These data suggest that targeting of UCP can be one of therapeutic method in type 2 VHL disease caused by unstable but functional missense mutant pVHL.

  2. Responsiveness to acidity via metal ion regulators mediates virulence in the gastric pathogen Helicobacter pylori.

    Science.gov (United States)

    Bury-Moné, Stéphanie; Thiberge, Jean-Michel; Contreras, Monica; Maitournam, Aboubakar; Labigne, Agnès; De Reuse, Hilde

    2004-07-01

    The virulence of pathogenic bacteria is dependent on their adaptation to and survival in the stressful conditions encountered in their hosts. Helicobacter pylori exclusively colonizes the acid stomach of primates, making it an ideal study model. Little is known about how H. pylori responds to the moderately acidic conditions encountered at its colonization site, the gastric mucus layer. Thus, we compared gene expression profiles of H. pylori 26695 grown at neutral and acidic pH, and validated the data for a selection of genes by real-time polymerase chain reaction, dot-blots or enzymatic assays. During growth in acidic conditions, 56 genes were upregulated and 45 genes downregulated. We found that acidity is a signal modulating the expression of several virulence factors. Regulation of genes related to metal ion homeostasis suggests protective mechanisms involving diminished transport and enhanced storage. Genes encoding subunits of the F0F1 ATPase and of a newly identified Na+/H+ antiporter (NhaC-HP0946) were downregulated, revealing that this bacterium uses original mechanisms to control proton entry. Five of the upregulated genes encoded proteins controlling intracellular ammonia synthesis, including urease, amidase and formamidase, underlining the major role of this buffering compound in the protection against acidity in H. pylori. Regulatory networks and transcriptome analysis as well as enzymatic assays implicated two metal-responsive transcriptional regulators (NikR and Fur) and an essential two-component response regulator (HP0166, OmpR-like) as effectors of the H. pylori acid response. Finally, a nikR-fur mutant is attenuated in the mouse model, emphasizing the link between response to acidity, metal metabolism and virulence in this gastric pathogen.

  3. Structural insights into GDP-mediated regulation of a bacterial acyl-CoA thioesterase.

    Science.gov (United States)

    Khandokar, Yogesh B; Srivastava, Parul; Cowieson, Nathan; Sarker, Subir; Aragao, David; Das, Shubagata; Smith, Kate M; Raidal, Shane R; Forwood, Jade K

    2017-12-15

    Thioesterases catalyze the cleavage of thioester bonds within many activated fatty acids and acyl-CoA substrates. They are expressed ubiquitously in both prokaryotes and eukaryotes and are subdivided into 25 thioesterase families according to their catalytic active site, protein oligomerization, and substrate specificity. Although many of these enzyme families are well-characterized in terms of function and substrate specificity, regulation across most thioesterase families is poorly understood. Here, we characterized a TE6 thioesterase from the bacterium Neisseria meningitidis Structural analysis with X-ray crystallographic diffraction data to 2.0-Å revealed that each protein subunit harbors a hot dog-fold and that the TE6 enzyme forms a hexamer with D3 symmetry. An assessment of thioesterase activity against a range of acyl-CoA substrates revealed the greatest activity against acetyl-CoA, and structure-guided mutagenesis of putative active site residues identified Asn 24 and Asp 39 as being essential for activity. Our structural analysis revealed that six GDP nucleotides bound the enzyme in close proximity to an intersubunit disulfide bond interactions that covalently link thioesterase domains in a double hot dog dimer. Structure-guided mutagenesis of residues within the GDP-binding pocket identified Arg 93 as playing a key role in the nucleotide interaction and revealed that GDP is required for activity. All mutations were confirmed to be specific and not to have resulted from structural perturbations by X-ray crystallography. This is the first report of a bacterial GDP-regulated thioesterase and of covalent linkage of thioesterase domains through a disulfide bond, revealing structural similarities with ADP regulation in the human ACOT12 thioesterase. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Origin of serpin-mediated regulation of coagulation and blood pressure.

    Directory of Open Access Journals (Sweden)

    Yunjie Wang

    Full Text Available Vertebrates evolved an endothelium-lined hemostatic system and a pump-driven pressurized circulation with a finely-balanced coagulation cascade and elaborate blood pressure control over the past 500 million years. Genome analyses have identified principal components of the ancestral coagulation system, however, how this complex trait was originally regulated is largely unknown. Likewise, little is known about the roots of blood pressure control in vertebrates. Here we studied three members of the serpin superfamily that interfere with procoagulant activity and blood pressure of lampreys, a group of basal vertebrates. Angiotensinogen from these jawless fish was found to fulfill a dual role by operating as a highly selective thrombin inhibitor that is activated by heparin-related glycosaminoglycans, and concurrently by serving as source of effector peptides that activate type 1 angiotensin receptors. Lampreys, uniquely among vertebrates, thus use angiotensinogen for interference with both coagulation and osmo- and pressure regulation. Heparin cofactor II from lampreys, in contrast to its paralogue angiotensinogen, is preferentially activated by dermatan sulfate, suggesting that these two serpins affect different facets of thrombin's multiple roles. Lampreys also express a lineage-specific serpin with anti-factor Xa activity, which demonstrates that another important procoagulant enzyme is under inhibitory control. Comparative genomics suggests that orthologues of these three serpins were key components of the ancestral hemostatic system. It appears that, early in vertebrate evolution, coagulation and osmo- and pressure regulation crosstalked through antiproteolytically active angiotensinogen, a feature that was lost during vertebrate radiation, though in gnathostomes interplay between these traits is effective.

  5. Procyanidin dimer B2-mediated IRAK-M induction negatively regulates TLR4 signaling in macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Sung, Nak-Yun [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Yang, Mi-So [Department of Microbiology, Infection Signaling Network Research Center, College of Medicine, Chungnam National University, Daejeon (Korea, Republic of); Song, Du-Sub [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); School of life sciences and Biotechnology, Korea University 5-ka, Anam-Dong, Sungbuk-ku, Seoul 136-701 (Korea, Republic of); Kim, Jae-Kyung; Park, Jong-Heum; Song, Beom-Seok; Park, Sang-Hyun; Lee, Ju-Woon [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Park, Hyun-Jin [School of life sciences and Biotechnology, Korea University 5-ka, Anam-Dong, Sungbuk-ku, Seoul 136-701 (Korea, Republic of); Kim, Jae-Hun [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Byun, Eui-Baek, E-mail: ebbyun80@kaeri.re.kr [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup 580-185 (Korea, Republic of); Byun, Eui-Hong, E-mail: ehbyun80@kongju.ac.k [Department of Food Science and Technology, Kongju National University, Yesan 340-800 (Korea, Republic of)

    2013-08-16

    Highlights: •Pro B2 elevated the expression of IRAK-M, a negative regulator of TLR signaling. •LPS-induced expression of cell surface molecules was inhibited by Pro B2. •LPS-induced production of pro-inflammatory cytokines was inhibited by Pro B2. •Pro B2 inhibited LPS-induced activation of MAPKs and NF-κB through IRAK-M. •Pro B2 inactivated naïve T cells by inhibiting LPS-induced cytokines via IRAK-M. -- Abstract: Polyphenolic compounds have been found to possess a wide range of physiological activities that may contribute to their beneficial effects against inflammation-related diseases; however, the molecular mechanisms underlying this anti-inflammatory activity are not completely characterized, and many features remain to be elucidated. In this study, we investigated the molecular basis for the down-regulation of toll-like receptor 4 (TLR4) signal transduction by procyanidin dimer B2 (Pro B2) in macrophages. Pro B2 markedly elevated the expression of the interleukin (IL)-1 receptor-associated kinase (IRAK)-M protein, a negative regulator of TLR signaling. Lipopolysaccharide (LPS)-induced expression of cell surface molecules (CD80, CD86, and MHC class I/II) and production of pro-inflammatory cytokines (tumor necrosis factor-α, IL-1β, IL-6, and IL-12p70) were inhibited by Pro B2, and this action was prevented by IRAK-M silencing. In addition, Pro B2-treated macrophages inhibited LPS-induced activation of mitogen-activated protein kinases such as extracellular signal-regulated kinase 1/2, p38, and c-Jun N-terminal kinase and the translocation of nuclear factor κB and p65 through IRAK-M. We also found that Pro B2-treated macrophages inactivated naïve T cells by inhibiting LPS-induced interferon-γ and IL-2 secretion through IRAK-M. These novel findings provide new insights into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and the immune-pharmacological role of Pro B2 in the immune response against the development

  6. MicroRNA-mediated regulation of glutathione and methionine metabolism and its relevance for liver disease.

    Science.gov (United States)

    Lu, Shelly C; Mato, José M; Espinosa-Diez, Cristina; Lamas, Santiago

    2016-11-01

    The discovery of the microRNA (miRNA) family of small RNAs as fundamental regulators of post-transcriptional gene expression has fostered research on their importance in every area of biology and clinical medicine. In the particular area of liver metabolism and disease, miRNAs are gaining increasing importance. By focusing on two fundamental hepatic biosynthetic pathways, glutathione and methionine, we review recent advances on the comprehension of the role of miRNAs in liver pathophysiology and more specifically of models of hepatic cholestasis/fibrosis and hepatocellular carcinoma. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Vitamin D regulates tyrosine hydroxylase expression: N-cadherin a possible mediator.

    Science.gov (United States)

    Cui, X; Pertile, R; Liu, P; Eyles, D W

    2015-09-24

    Vitamin D is a neuroactive steroid. Its genomic actions are mediated via the active form of vitamin D, 1,25(OH)2D3, binding to the vitamin D receptor (VDR). The VDR emerges in the rat mesencephalon at embryonic day 12, representing the peak period of dopaminergic cell birth. Our prior studies reveal that developmental vitamin D (DVD)-deficiency alters the ontogeny of dopaminergic neurons in the developing mesencephalon. There is also consistent evidence from others that 1,25(OH)2D3 promotes the survival of dopaminergic neurons in models of dopaminergic toxicity. In both developmental and toxicological studies it has been proposed that 1,25(OH)2D3 may modulate the differentiation and maturation of dopaminergic neurons; however, to date there is lack of direct evidence. The aim of the current study is to investigate this both in vitro using a human SH-SY5Y cell line transfected with rodent VDR and in vivo using a DVD-deficient model. Here we show that in VDR-expressing SH-SY5Y cells, 1,25(OH)2D3 significantly increased production of tyrosine hydroxylase (TH), the rate-limiting enzyme in dopamine synthesis. This effect was dose- and time-dependent, but was not due to an increase in TH-positive cell number, nor was it due to the production of trophic survival factors for dopamine neurons such as glial-derived neurotrophic factor (GDNF). In accordance with 1,25(OH)2D3's anti-proliferative actions in the brain, 1,25(OH)2D3 reduced the percentage of dividing cells from approximately 15-10%. Given the recently reported role of N-cadherin in the direct differentiation of dopaminergic neurons, we examined here whether it may be elevated by 1,25(OH)2D3. We confirmed this in vitro and more importantly, we showed DVD-deficiency decreases N-cadherin expression in the embryonic mesencephalon. In summary, in our in vitro model we have shown 1,25(OH)2D3 increases TH expression, decreases proliferation and elevates N-cadherin, a potential factor that mediates these processes

  8. Up-Regulation of P21 Inhibits TRAIL-Mediated Extrinsic Apoptosis, Contributing Resistance to SAHA in Acute Myeloid Leukemia Cells

    Directory of Open Access Journals (Sweden)

    Xing Wu

    2014-08-01

    Full Text Available Background/Aim: P21, a multifunctional cell cycle-regulatory molecule, regulates apoptotic cell death. In this study we examined the effect of altered p21 expression on the sensitivity of acute myeloid leukemia cells in response to HDAC inhibitor SAHA treatment and investigated the underlying mechanism. Methods: Stably transfected HL60 cell lines were established in RPMI-1640 with supplementation of G-418. Cell viability was measured by MTT assay. Western blot was applied to assess the protein expression levels of target genes. Cell apoptosis was monitored by AnnexinV-PE/7AAD assay. Results: We showed HL60 cells that that didn't up-regulate p21 expression were more sensitive to SAHA-mediated apoptosis than NB4 and U937 cells that had increased p21 level. Enforced expression of p21 in HL60 cells reduced sensitivity to SAHA and blocked TRAIL-mediated apoptosis. Conversely, p21 silencing in NB4 cells enhanced SAHA-mediated apoptosis and lethality. Finally, we found that combined treatment with SAHA and rapamycin down-regulated p21 and enhanced apoptosis in AML cells. Conclusion: We conclude that up-regulated p21 expression mediates resistance to SAHA via inhibition of TRAIL apoptotic pathway. P21 may serve as a candidate biomarker to predict responsiveness or resistance to SAHA-based therapy in AML patients. In addition, rapamycin may be an effective agent to override p21-mediated resistance to SAHA in AML patients.

  9. Bmp signaling mediates endoderm pouch morphogenesis by regulating Fgf signaling in zebrafish

    Science.gov (United States)

    Swartz, Mary E.; McCarthy, Neil; Norrie, Jacqueline L.; Eberhart, Johann K.

    2016-01-01

    The endodermal pouches are a series of reiterated structures that segment the pharyngeal arches and help pattern the vertebrate face. Multiple pathways regulate the complex process of endodermal development, including the Bone morphogenetic protein (Bmp) pathway. However, the role of Bmp signaling in pouch morphogenesis is poorly understood. Using genetic and chemical inhibitor approaches, we show that pouch morphogenesis requires Bmp signaling from 10-18 h post-fertilization, immediately following gastrulation. Blocking Bmp signaling during this window results in morphological defects to the pouches and craniofacial skeleton. Using genetic chimeras we show that Bmp signals directly to the endoderm for proper morphogenesis. Time-lapse imaging and analysis of reporter transgenics show that Bmp signaling is necessary for pouch outpocketing via the Fibroblast growth factor (Fgf) pathway. Double loss-of-function analyses demonstrate that Bmp and Fgf signaling interact synergistically in craniofacial development. Collectively, our analyses shed light on the tissue and signaling interactions that regulate development of the vertebrate face. PMID:27122171

  10. Crosstalk between KCNK3-Mediated Ion Current and Adrenergic Signaling Regulates Adipose Thermogenesis and Obesity.

    Science.gov (United States)

    Chen, Yi; Zeng, Xing; Huang, Xuan; Serag, Sara; Woolf, Clifford J; Spiegelman, Bruce M

    2017-11-02

    Adrenergic stimulation promotes lipid mobilization and oxidation in brown and beige adipocytes, where the harnessed energy is dissipated as heat in a process known as adaptive thermogenesis. The signaling cascades and energy-dissipating pathways that facilitate thermogenesis have been extensively described, yet little is known about the counterbalancing negative regulatory mechanisms. Here, we identify a two-pore-domain potassium channel, KCNK3, as a built-in rheostat negatively regulating thermogenesis. Kcnk3 is transcriptionally wired into the thermogenic program by PRDM16, a master regulator of thermogenesis. KCNK3 antagonizes norepinephrine-induced membrane depolarization by promoting potassium efflux in brown adipocytes. This limits calcium influx through voltage-dependent calcium channels and dampens adrenergic signaling, thereby attenuating lipolysis and thermogenic respiration. Adipose-specific Kcnk3 knockout mice display increased energy expenditure and are resistant to hypothermia and obesity. These findings uncover a critical K + -Ca 2+ -adrenergic signaling axis that acts to dampen thermogenesis, maintain tissue homeostasis, and reveal an electrophysiological regulatory mechanism of adipocyte function. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Microtubule-Mediated Inositol Lipid Signaling Plays Critical Roles in Regulation of Blebbing.

    Directory of Open Access Journals (Sweden)

    Tatsuroh Sugiyama

    Full Text Available Cells migrate by extending pseudopods such as lamellipodia and blebs. Although the signals leading to lamellipodia extension have been extensively investigated, those for bleb extension remain unclear. Here, we investigated signals for blebbing in Dictyostelium cells using a newly developed assay to induce blebbing. When cells were cut into two pieces with a microneedle, the anucleate fragments vigorously extended blebs. This assay enabled us to induce blebbing reproducibly, and analyses of knockout mutants and specific inhibitors identified candidate molecules that regulate blebbing. Blebs were also induced in anucleate fragments of leukocytes, indicating that this assay is generally applicable to animal cells. After cutting, microtubules in the anucleate fragments promptly depolymerized, followed by the extension of blebs. Furthermore, when intact cells were treated with a microtubule inhibitor, they frequently extended blebs. The depolymerization of microtubules induced the delocalization of inositol lipid phosphatidylinositol 3,4,5-trisphosphate from the cell membrane. PI3 kinase-null cells frequently extended blebs, whereas PTEN-null cells extended fewer blebs. From these observations, we propose a model in which microtubules play a critical role in bleb regulation via inositol lipid metabolism.

  12. Regulation of granulocyte colony-stimulating factor receptor-mediated granulocytic differentiation by C-mannosylation.

    Science.gov (United States)

    Otani, Kei; Niwa, Yuki; Suzuki, Takehiro; Sato, Natsumi; Sasazawa, Yukiko; Dohmae, Naoshi; Simizu, Siro

    2018-04-06

    Granulocyte colony-stimulating factor (G-CSF) receptor (G-CSFR) is a type I cytokine receptor which is involved in hematopoietic cell maturation. G-CSFR has three putative C-mannosylation sites at W253, W318, and W446; however, it is not elucidated whether G-CSFR is C-mannosylated or not. In this study, we first demonstrated that G-CSFR was C-mannosylated at only W318. We also revealed that C-mannosylation of G-CSFR affects G-CSF-dependent downstream signaling through changing ligand binding capability but not cell surface localization. Moreover, C-mannosylation of G-CSFR was functional and regulated granulocytic differentiation in myeloid 32D cells. In conclusion, we found that G-CSFR is C-mannosylated at W318 and that this C-mannosylation has role(s) for myeloid cell differentiation through regulating downstream signaling. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. Fas/Fas ligand regulation mediates cell death in human Ewing's sarcoma cells treated with melatonin

    Science.gov (United States)

    García-Santos, G; Martin, V; Rodríguez-Blanco, J; Herrera, F; Casado-Zapico, S; Sánchez-Sánchez, A M; Antolín, I; Rodríguez, C

    2012-01-01

    Background: Despite recent advances in cancer therapy, the 5-year survival rate for Ewing's sarcoma is still very low, and new therapeutic approaches are necessary. It was found previously that melatonin induces cell death in the Ewing's sarcoma cell line, SK-N-MC, by activating the extrinsic apoptotic pathway. Methods: Melatonin actions were analysed by metabolic viability/survival cell assays, flow cytometry, quantitative PCR for mRNA expression, western blot for protein activation/expression and electrophoretic mobility shift assay for transcription factor activation. Results: Melatonin increases the expression of Fas and its ligand Fas L, this increase being responsible for cell death induced by the indolamine. Melatonin also produces a transient increase in intracellular oxidants and activation of the redox-regulated transcription factor Nuclear factor-kappaB. Inhibition of such activation prevents cell death and Fas/Fas L upregulation. Cytotoxic effect and Fas/Fas L regulation occur in all Ewing's cell lines studied, and do not occur in the other tumour cell lines studied where melatonin does not induce cell death. Conclusion: Our data offers new insights in the study of alternative therapeutic strategies in the treatment of Ewing's sarcoma. Further attention deserves to be given to the differences in the cellular biology of sensitive tumours that could explain the cytotoxic effect of melatonin and the increase in the level of free radicals caused by this molecule, in particular cancer types. PMID:22382690

  14. 7a, 25-dihydroxycholesterol-mediated activation of EBI2 in immune regulation and diseases

    Directory of Open Access Journals (Sweden)

    Siquan eSun

    2015-03-01

    Full Text Available EBI2, aka GPR183, is a G-couple receptor originally identified in 1993 as one of main genes induced in Burkitt’s lymphoma cell line BL41 by Epstein-Barr virus (EBV infection. After it was reported in 2009 that the receptor played a key role in regulating B cell migration and responses, we initiated an effort in looking for its endogenous ligand. In 2011 we and another group reported the identification of 7a, 25-dihydroxyxcholesterol (7a, 25-OHC, an oxysterol, as the likely physiological ligand of EBI2. A few subsequently published studies further elucidated how 7a, 25-OHC bound to EBI2, and how a gradient of 7a, 25-OHC could be generated in vivo and regulated migration, activation, and functions of B cells, T cells, dendritic cells (DC, monocytes/macrophages and astrocytes. The identification of 7a, 25-OHC as a GPCR ligand revealed a previously unknown signaling system of oxysterols, a class of molecules which exert profound biological functions. Dysregulation of the synthesis or functions of these molecules is believed to contribute to inflammation and autoimmune diseases, cardiovascular diseases, neurodegenerative diseases, cancer as well as metabolic diseases such as diabetes, obesity, and dyslipidemia. Therefore EBI2 may represent a promising target for therapeutic interventions for human diseases.

  15. Exosome proteomics reveals transcriptional regulator proteins with potential to mediate downstream pathways.

    Science.gov (United States)

    Ung, Timothy H; Madsen, Helen J; Hellwinkel, Justin E; Lencioni, Alex M; Graner, Michael W

    2014-11-01

    Exosomes are virus-sized, membrane-enclosed vesicles with origins in the cellular endosomal system, but are released extracellularly. As a population, these tiny vesicles carry relatively enormous amounts of information in their protein, lipid and nucleic acid content, and the vesicles can have profound impacts on recipient cells. This review employs publically-available data combined with gene ontology applications to propose a novel concept, that exosomes transport transcriptional and translational machinery that may have direct impacts on gene expression in recipient cells. Here, we examine the previously published proteomic contents of medulloblastoma-derived exosomes, focusing on transcriptional regulators; we found that there are numerous proteins that may have potential roles in transcriptional and translational regulation with putative influence on downstream, cancer-related pathways. We expanded this search to all of the proteins in the Vesiclepedia database; using gene ontology approaches, we see that these regulatory factors are implicated in many of the processes involved in cancer initiation and progression. This information suggests that some of the effects of exosomes on recipient cells may be due to the delivery of protein factors that can directly and fundamentally change the transcriptional landscape of the cells. Within a tumor environment, this has potential to tilt the advantage towards the cancer. © 2014 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.

  16. Podocytic PKC-alpha is regulated in murine and human diabetes and mediates nephrin endocytosis.

    Directory of Open Access Journals (Sweden)

    Irini Tossidou

    Full Text Available BACKGROUND: Microalbuminuria is an early lesion during the development of diabetic nephropathy. The loss of high molecular weight proteins in the urine is usually associated with decreased expression of slit diaphragm proteins. Nephrin, is the major component of the glomerular slit diaphragm and loss of nephrin has been well described in rodent models of experimental diabetes as well as in human diabetic nephropathy. METHODOLOGY/PRINCIPAL FINDINGS: In this manuscript we analyzed the role of PKC-alpha (PKCalpha on endocytosis of nephrin in podocytes. We found that treatment of diabetic mice with a PKCalpha-inhibitor (GO6976 leads to preserved nephrin expression and reduced proteinuria. In vitro, we found that high glucose stimulation would induce PKCalpha protein expression in murine and human podocytes. We can demonstrate that PKCalpha mediates nephrin endocytosis in podocytes and that overexpression of PKCalpha leads to an augmented endocytosis response. After PKC-activation, we demonstrate an inducible association of PKCalpha, PICK1 and nephrin in podocytes. Moreover, we can demonstrate a strong induction of PKCalpha in podocytes of patients with diabetic nephropathy. CONCLUSIONS/SIGNIFICANCE: We therefore conclude that activation of PKCalpha is a pathomechanistic key event during the development of diabetic nephropathy. PKCalpha is involved in reduction of nephrin surface expression and therefore PKCalpha inhibition might be a novel target molecule for anti-proteinuric therapy.

  17. Protective Effect of Zingiber officinale Against Dalton's Lymphoma Ascites Tumour by Regulating Inflammatory Mediator and Cytokines.

    Science.gov (United States)

    Rubila, Sundararaj; Ranganathan, Thottiam Vasudevan; Sakthivel, Kunnathur Murugesan

    2016-12-01

    The aim of the present investigation was to evaluate Zingiber officinale paste against Dalton's lymphoma ascites (DLA)-induced tumours in Swiss albino mice. Experimental animals received Z. officinale paste (low dose 100 mg/kg bw and high dose 500 mg/kg bw) orally for eight alternative days. Treatment with Z. officinale paste showed significant increase in haemoglobin level and decrease in aspartate amino transferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP) and gamma glutamyl transferase (γ-GT) level. Z. officinale paste reduced the inflammatory mediators and cytokine levels, such as inducible nitric oxide (iNOS), tumour necrosis factor level (TNF-α) and interleukin-1β (IL-1β). Treatment with Z. officinale paste also significantly increased the antioxidant enzyme level, such as superoxide dismutase (SOD), catalase (CAT), reduced glutathione (GSH) and glutathione transferase (GST), and decreased the lipid peroxidation. Treatment also increased the vitamin C and E levels in treated animals compared with the DLA-bearing host. Histopathological studies also confirmed the protective influence of Z. officinale paste against DLA. The present study suggested that Z. officinale paste could be used as natural spice and a potent antitumour agent.

  18. G protein betagamma-subunits activated by serotonin mediate presynaptic inhibition by regulating vesicle fusion properties.

    Science.gov (United States)

    Photowala, Huzefa; Blackmer, Trillium; Schwartz, Eric; Hamm, Heidi E; Alford, Simon

    2006-03-14

    Neurotransmitters are thought to be released as quanta, where synaptic vesicles deliver packets of neurotransmitter to the synaptic cleft by fusion with the plasma membrane. However, synaptic vesicles may undergo incomplete fusion. We provide evidence that G protein-coupled receptors inhibit release by causing such incomplete fusion. 5-hydroxytryptamine (5-HT) receptor signaling potently inhibits excitatory postsynaptic currents (EPSCs) between lamprey reticulospinal axons and their postsynaptic targets by a direct action on the vesicle fusion machinery. We show that 5-HT receptor-mediated presynaptic inhibition, at this synapse, involves a reduction in EPSC quantal size. Quantal size was measured directly by comparing unitary quantal amplitudes of paired EPSCs before and during 5-HT application and indirectly by determining the effect of 5-HT on the relationship between mean-evoked EPSC amplitude and variance. Results from FM dye-labeling experiments indicate that 5-HT prevents full fusion of vesicles. 5-HT reduces FM1-43 staining of vesicles with a similar efficacy to its effect on the EPSC. However, destaining of FM1-43-labeled vesicles is abolished by lower concentrations of 5-HT that leave a substantial EPSC. The use of a water-soluble membrane impermeant quenching agent in the extracellular space reduced FM1-43 fluorescence during stimulation in 5-HT. Thus vesicles contact the extracellular space during inhibition of synaptic transmission by 5-HT. We conclude that 5-HT, via free Gbetagamma, prevents the collapse of synaptic vesicles into the presynaptic membrane.

  19. microRNA-mediated R gene regulation: molecular scabbards for double-edged swords.

    Science.gov (United States)

    Deng, Yingtian; Liu, Minglei; Li, Xiaofei; Li, Feng

    2018-02-01

    Plant resistance (R) proteins are immune receptors that recognize pathogen effectors and trigger rapid defense responses, namely effector-triggered immunity. R protein-mediated pathogen resistance is usually race specific. During plant-pathogen coevolution, plant genomes accumulated large numbers of R genes. Even though plant R genes provide important natural resources for breeding disease-resistant crops, their presence in the plant genome comes at a cost. Misregulation of R genes leads to developmental defects, such as stunted growth and reduced fertility. In the past decade, many microRNAs (miRNAs) have been identified to target various R genes in plant genomes. miRNAs reduce R gene levels under normal conditions and allow induction of R gene expression under various stresses. For these reasons, we consider R genes to be double-edged "swords" and miRNAs as molecular "scabbards". In the present review, we summarize the contributions and potential problems of these "swords" and discuss the features and production of the "scabbards", as well as the mechanisms used to pull the "sword" from the "scabbard" when needed.

  20. Lacrimal gland-derived IL-22 regulates IL-17-mediated ocular mucosal inflammation

    Science.gov (United States)

    Ji, Yong Woo; Mittal, Sharad K.; Hwang, Ho Sik; Chang, Eun-Ju; Lee, Joon H.; Seo, Yuri; Yeo, Areum; Noh, Hyemi; Lee, Hye Sun; Chauhan, Sunil K.; Lee, Hyung Keun

    2016-01-01

    Inflammatory damage of mucosal surface of the eye is a hallmark of dry eye disease (DED), and in severe cases can lead to significant discomfort, visual impairment, and blindness. DED is a multifactorial autoimmune disorder with a largely unknown pathogenesis. Using a cross-sectional patient study and a well-characterized murine model of DED, herein we investigated the immunoregulatory function of interleukin-22 (IL-22) in the pathogenesis of DED. We found that IL-22 levels were elevated in lacrimal fluids of DED patients and inversely correlated with severity of disease. Acinar cells of the lacrimal glands, not inflammatory immune cells, are the primary source of IL-22, which suppresses inflammation in ocular surface epithelial cells upon desiccating stress. Moreover, loss of function analyses using IL-22 knock-out mice demonstrated that IL-22 is essential for suppression of ocular surface infiltration of Th17 cells and inhibition of DED induction. Our novel findings elucidate immunoregulatory function of lacrimal gland-derived IL-22 in inhibiting IL-17-mediated ocular surface epitheliopathy in DED thus making IL-22 a new relevant therapeutic target. PMID:28051088

  1. PKCδ-mediated IRS-1 Ser24 phosphorylation negatively regulates IRS-1 function

    International Nuclear Information System (INIS)

    Greene, Michael W.; Ruhoff, Mary S.; Roth, Richard A.; Kim, Jeong-a; Quon, Michael J.; Krause, Jean A.

    2006-01-01

    The IRS-1 PH and PTB domains are essential for insulin-stimulated IRS-1 Tyr phosphorylation and insulin signaling, while Ser/Thr phosphorylation of IRS-1 disrupts these signaling events. To investigate consensus PKC phosphorylation sites in the PH-PTB domains of human IRS-1, we changed Ser24, Ser58, and Thr191 to Ala (3A) or Glu (3E), to block or mimic phosphorylation, respectively. The 3A mutant abrogated the inhibitory effect of PKCδ on insulin-stimulated IRS-1 Tyr phosphorylation, while reductions in insulin-stimulated IRS-1 Tyr phosphorylation, cellular proliferation, and Akt activation were observed with the 3E mutant. When single Glu mutants were tested, the Ser24 to Glu mutant had the greatest inhibitory effect on insulin-stimulated IRS-1 Tyr phosphorylation. PKCδ-mediated IRS-1 Ser24 phosphorylation was confirmed in cells with PKCδ catalytic domain mutants and by an RNAi method. Mechanistic studies revealed that IRS-1 with Ala and Glu point mutations at Ser24 impaired phosphatidylinositol-4,5-bisphosphate binding. In summary, our data are consistent with the hypothesis that Ser24 is a negative regulatory phosphorylation site in IRS-1

  2. Surface receptor Toso controls B cell-mediated regulation of T cell immunity.

    Science.gov (United States)

    Yu, Jinbo; Duong, Vu Huy Hoang; Westphal, Katrin; Westphal, Andreas; Suwandi, Abdulhadi; Grassl, Guntram A; Brand, Korbinian; Chan, Andrew C; Föger, Niko; Lee, Kyeong-Hee

    2018-05-01

    The immune system is tightly controlled by regulatory processes that allow for the elimination of invading pathogens, while limiting immunopathological damage to the host. In the present study, we found that conditional deletion of the cell surface receptor Toso on B cells unexpectedly resulted in impaired proinflammatory T cell responses, which led to impaired immune protection in an acute viral infection model and was associated with reduced immunopathological tissue damage in a chronic inflammatory context. Toso exhibited its B cell-inherent immunoregulatory function by negatively controlling the pool of IL-10-competent B1 and B2 B cells, which were characterized by a high degree of self-reactivity and were shown to mediate immunosuppressive activity on inflammatory T cell responses in vivo. Our results indicate that Toso is involved in the differentiation/maintenance of regulatory B cells by fine-tuning B cell receptor activation thresholds. Furthermore, we showed that during influenza A-induced pulmonary inflammation, the application of Toso-specific antibodies selectively induced IL-10-competent B cells at the site of inflammation and resulted in decreased proinflammatory cytokine production by lung T cells. These findings suggest that Toso may serve as a novel therapeutic target to dampen pathogenic T cell responses via the modulation of IL-10-competent regulatory B cells.

  3. Phytochrome B Mediates the Regulation of Chlorophyll Biosynthesis through Transcriptional Regulation of ChlH and GUN4 in Rice Seedlings

    Science.gov (United States)

    Kagawa, Takatoshi; Tanaka, Ayumi; Ueno, Osamu; Shimada, Hiroaki; Takano, Makoto

    2015-01-01

    Accurate regulation of chlorophyll synthesis is crucial for chloroplast formation during the greening process in angiosperms. In this study, we examined the role of phytochrome B (phyB) in the regulation of chlorophyll synthesis in rice seedlings (Oryza sativa L.) through the characterization of a pale-green phenotype observed in the phyB mutant grown under continuous red light (Rc) irradiation. Our results show that the Rc-induced chlorophyll accumulation can be divided into two components—a phyB-dependent and a phyB-independent component, and that the pale-green phenotype is caused by the absence of the phyB-dependent component. To elucidate the role of the missing component we established an Rc-induced greening experiment, the results of which revealed that several genes encoding proteins on the chlorophyll branch were repressed in the phyB mutant. Notable among them were ChlH and GUN4 genes, which encode subunit H and an activating factor of magnesium chelatase (Mg-chelatase), respectively, that were largely repressed in the mutant. Moreover, the kinetic profiles of chlorophyll precursors suggested that Mg-chelatase activity simultaneously decreased with the reduction in the transcript levels of ChlH and GUN4. These results suggest that phyB mediates the regulation of chlorophyll synthesis through transcriptional regulation of these two genes, whose products exert their action at the branching point of the chlorophyll biosynthesis pathway. Reduction of 5-aminolevulinic acid (5-ALA) synthesis could be detected in the mutant, but the kinetic profiles of chlorophyll precursors indicated that it was an event posterior to the reduction of the Mg-chelatase activity. It means that the repression of 5-ALA synthesis should not be a triggering event for the appearance of the pale-green phenotype. Instead, the repression of 5-ALA synthesis might be important for the subsequent stabilization of the pale-green phenotype for preventing excessive accumulation of hazardous

  4. Cyclin E-Mediated Human Proopiomelanocortin Regulation as a Therapeutic Target for Cushing Disease.

    Science.gov (United States)

    Liu, Ning-Ai; Araki, Takako; Cuevas-Ramos, Daniel; Hong, Jiang; Ben-Shlomo, Anat; Tone, Yukiko; Tone, Masahide; Melmed, Shlomo

    2015-07-01

    Cushing disease, due to pituitary corticotroph tumor ACTH hypersecretion, drives excess adrenal cortisol production with adverse morbidity and mortality. Loss of glucocorticoid negative feedback on the hypothalamic-pituitary-adrenal axis leads to autonomous transcription of the corticotroph precursor hormone proopiomelanocortin (POMC), consequent ACTH overproduction, and adrenal hypercortisolism. We previously reported that R-roscovitine (CYC202, seliciclib), a 2,6,9-trisubstituted purine analog, suppresses cyclin-dependent-kinase 2/cyclin E and inhibits ACTH in mice and zebrafish. We hypothesized that intrapituitary cyclin E signaling regulates corticotroph tumor POMC transcription independently of cell cycle progression. The aim was to investigate whether R-roscovitine inhibits human ACTH in corticotroph tumors by targeting the cyclin-dependent kinase 2/cyclin E signaling pathway. Primary cell cultures of surgically resected human corticotroph tumors were treated with or without R-roscovitine, ACTH measured by RIA and quantitative PCR, and/or Western blot analysis performed to investigate ACTH and lineage-specific transcription factors. Cyclin E and E2F transcription factor 1 (E2F1) small interfering RNA (siRNA) transfection was performed in murine corticotroph tumor AtT20 cells to elucidate mechanisms for drug action. POMC gene promoter activity in response to R-roscovitine treatment was analyzed using luciferase reporter and chromatin immunoprecipitation assays. R-roscovitine inhibits human corticotroph tumor POMC and Tpit/Tbx19 transcription with decreased ACTH expression. Cyclin E and E2F1 exhibit reciprocal positive regulation in corticotroph tumors. R-roscovitine disrupts E2F1 binding to the POMC gene promoter and suppresses Tpit/Tbx19 and other lineage-specific POMC transcription cofactors via E2F1-dependent and -independent pathways. R-roscovitine inhibits human pituitary corticotroph tumor ACTH by targeting the cyclin E/E2F1 pathway. Pituitary cyclin E

  5. Cyanide-induced death of dopaminergic cells is mediated by uncoupling protein-2 up-regulation and reduced Bcl-2 expression

    International Nuclear Information System (INIS)

    Zhang, X.; Li, L.; Zhang, L.; Borowitz, J.L.; Isom, G.E.

    2009-01-01

    Cyanide is a potent inhibitor of mitochondrial oxidative metabolism and produces mitochondria-mediated death of dopaminergic neurons and sublethal intoxications that are associated with a Parkinson-like syndrome. Cyanide toxicity is enhanced when mitochondrial uncoupling is stimulated following up-regulation of uncoupling protein-2 (UCP-2). In this study, the role of a pro-survival protein, Bcl-2, in cyanide-mediated cell death was determined in a rat dopaminergic immortalized mesencephalic cell line (N27 cells). Following pharmacological up-regulation of UCP-2 by treatment with Wy14,643, cyanide reduced cellular Bcl-2 expression by increasing proteasomal degradation of the protein. The increased turnover of Bcl-2 was mediated by an increase of oxidative stress following UCP-2 up-regulation. The oxidative stress involved depletion of mitochondrial glutathione (mtGSH) and increased H 2 O 2 generation. Repletion of mtGSH by loading cells with glutathione ethyl ester reduced H 2 O 2 generation and in turn blocked the cyanide-induced decrease of Bcl-2. To determine if UCP-2 mediated the response, RNAi knock down was conducted. The RNAi decreased cyanide-induced depletion of mtGSH, reduced H 2 O 2 accumulation, and inhibited down-regulation of Bcl-2, thus blocking cell death. To confirm the role of Bcl-2 down-regulation in the cell death, it was shown that over-expression of Bcl-2 by cDNA transfection attenuated the enhancement of cyanide toxicity after UCP-2 up-regulation. It was concluded that UCP-2 up-regulation sensitizes cells to cyanide by increasing cellular oxidative stress, leading to an increase of Bcl-2 degradation. Then the reduced Bcl-2 levels sensitize the cells to cyanide-mediated cell death.

  6. Alteration of Regulation of Fas/FasL Mediated Apoptosis in Gastric Cancer

    Directory of Open Access Journals (Sweden)

    Reggie García Robles

    2009-04-01

    Full Text Available Gastric cancer is an important neoplasticdisease in all around the world because its highincidence and mortality. Otherwise, apoptosis isa key process of programmed cell death duringembryogenesis, regulation of immune system,and holding the tissue homeostasis. Besides,the escape of apoptosis by different ways is anessential molecular aspect for the developmentof cancer. In this article we present an exhaustivereview of the current evidence of the roleof apoptosis through Fas/FasL pathway in thedevelopment of gastric carcinogenesis, includingsince early stages like in appearance of preneoplasticlesions. Finally, we think that a bettercomprehension of the signaling pathway Fas/FasL role in the different stages of gastric carcinogenesiscould let us know more about the implicatedmolecular ways and the physiopathologicalchanges in the appearance of this disease.

  7. Demodex canis regulates cholinergic system mediated immunosuppressive pathways in canine demodicosis.

    Science.gov (United States)

    Kumari, P; Nigam, R; Singh, A; Nakade, U P; Sharma, A; Garg, S K; Singh, S K

    2017-09-01

    Demodex canis infestation in dogs remains one of the main challenges in veterinary dermatology. The exact pathogenesis of canine demodicosis is unknown but an aberration in immune status is considered very significant. No studies have underpinned the nexus between induction of demodicosis and neural immunosuppressive pathways so far. We have evaluated the involvement of cholinergic pathways in association with cytokines regulation as an insight into the immuno-pathogenesis of canine demodicosis in the present study. Remarkable elevations in circulatory immunosuppressive cytokine interleukin-10 and cholinesterase activity were observed in dogs with demodicosis. Simultaneously, remarkable reduction in circulatory pro-inflammatory cytokine tumour necrosis factor-alpha level was observed in dogs with demodicosis. Findings of the present study evidently suggest that Demodex mites might be affecting the cholinergic pathways to induce immunosuppression in their host and then proliferate incessantly in skin microenvironment to cause demodicosis.

  8. Dopamine D2 Receptor-Mediated Regulation of Pancreatic β Cell Mass

    Directory of Open Access Journals (Sweden)

    Daisuke Sakano

    2016-07-01

    Full Text Available Understanding the molecular mechanisms that regulate β cell mass and proliferation is important for the treatment of diabetes. Here, we identified domperidone (DPD, a dopamine D2 receptor (DRD2 antagonist that enhances β cell mass. Over time, islet β cell loss occurs in dissociation cultures, and this was inhibited by DPD. DPD increased proliferation and decreased apoptosis of β cells through increasing intracellular cAMP. DPD prevented β cell dedifferentiation, which together highly contributed to the increased β cell mass. DRD2 knockdown phenocopied the effects of domperidone and increased the number of β cells. Drd2 overexpression sensitized the dopamine responsiveness of β cells and increased apoptosis. Further analysis revealed that the adenosine agonist 5′-N-ethylcarboxamidoadenosine, a previously identified promoter of β cell proliferation, acted with DPD to increase the number of β cells. In humans, dopamine also modulates β cell mass through DRD2 and exerts an inhibitory effect on adenosine signaling.

  9. Up-regulation of Hsp72 and keratin16 mediates wound healing in streptozotocin diabetic rats

    Directory of Open Access Journals (Sweden)

    Rasha R. Ahmed

    2015-01-01

    Full Text Available BACKGROUND: Impaired wound healing is a complication of diabetes and a serious problem in clinical practice. We previously found that whey protein (WP was able to regulate wound healing normally in streptozotocin (STZ-dia-betic models. This subsequent study was designed to assess the effect of WP on heat shock protein-72 (Hsp72 and keratin16 (Krt16 expression during wound healing in diabetic rats. METHODS: WP at a dosage of 100 mg/kg of body weight was orally administered daily to wounded normal and STZ-diabetic rats for 8 days. RESULTS: At day 4, the WP-treated diabetic wound was significantly reduced compared to that in the corresponding control. Diabetic wounded rats developed severe inflammatory infiltration and moderate capillary dilatation and regeneration. Treated rats had mild necrotic formation, moderate infiltration, moderate to severe capillary dilatation and regeneration, in addition to moderate epidermal formation. Hsp72 and Krt16 densities showed low and dense activity in diabetic wounded and diabetic wounded treated groups, respectively. At day 8, WP-treatment of diabetic wounded animals revealed great amelioration with complete recovery and closure of the wound. Reactivity of Hsp72 and Krt16 was reversed, showing dense and low, or medium and low, activity in the diabetic wounded and diabetic wounded treated groups, respectively. Hsp72 expression in the pancreas was found to show dense reactivity with WP-treated diabetic wound rats. CONCLUSION: This data provides evidence for the potential impact of WP in the up-regulation of Hsp72 and Krt16 in T1D, resulting in an improved wound healing process in diabetic models.

  10. EIN2 mediates direct regulation of histone acetylation in the ethylene response.

    Science.gov (United States)

    Zhang, Fan; Wang, Likai; Qi, Bin; Zhao, Bo; Ko, Eun Esther; Riggan, Nathaniel D; Chin, Kevin; Qiao, Hong

    2017-09-19

    Ethylene gas is essential for developmental processes and stress responses in plants. Although the membrane-bound protein EIN2 is critical for ethylene signaling, the mechanism by which the ethylene signal is transduced remains largely unknown. Here we show the levels of H3K14Ac and H3K23Ac are correlated with the levels of EIN2 protein and demonstrate EIN2 C terminus (EIN2-C) is sufficient to rescue the levels of H3K14/23Ac of ein2 -5 at the target loci, using CRISPR/dCas9-EIN2-C. Chromatin immunoprecipitation followed by deep sequencing (ChIP-seq) and ChIP-reChIP-seq analyses revealed that EIN2-C associates with histone partially through an interaction with EIN2 nuclear-associated protein1 (ENAP1), which preferentially binds to the genome regions that are associated with actively expressed genes both with and without ethylene treatments. Specifically, in the presence of ethylene, ENAP1-binding regions are more accessible upon the interaction with EIN2, and more EIN3 proteins bind to the loci where ENAP1 is enriched for a quick response. Together, these results reveal EIN2-C is the key factor regulating H3K14Ac and H3K23Ac in response to ethylene and uncover a unique mechanism by which ENAP1 interacts with chromatin, potentially preserving the open chromatin regions in the absence of ethylene; in the presence of ethylene, EIN2 interacts with ENAP1, elevating the levels of H3K14Ac and H3K23Ac, promoting more EIN3 binding to the targets shared with ENAP1 and resulting in a rapid transcriptional regulation.

  11. Calcineurin signaling and membrane lipid homeostasis regulates iron mediated multidrug resistance mechanisms in Candida albicans.

    Directory of Open Access Journals (Sweden)

    Saif Hameed

    2011-04-01

    Full Text Available We previously demonstrated that iron deprivation enhances drug susceptibility of Candida albicans by increasing membrane fluidity which correlated with the lower expression of ERG11 transcript and ergosterol levels. The iron restriction dependent membrane perturbations led to an increase in passive diffusion and drug susceptibility. The mechanisms underlying iron homeostasis and multidrug resistance (MDR, however, are not yet resolved. To evaluate the potential mechanisms, we used whole genome transcriptome and electrospray ionization tandem mass spectrometry (ESI-MS/MS based lipidome analyses of iron deprived Candida cells to examine the new cellular circuitry of the MDR of this pathogen. Our transcriptome data revealed a link between calcineurin signaling and iron homeostasis. Among the several categories of iron deprivation responsive genes, the down regulation of calcineurin signaling genes including HSP90, CMP1 and CRZ1 was noteworthy. Interestingly, iron deprived Candida cells as well as iron acquisition defective mutants phenocopied molecular chaperone HSP90 and calcineurin mutants and thus were sensitive to alkaline pH, salinity and membrane perturbations. In contrast, sensitivity to above stresses did not change in iron deprived DSY2146 strain with a hyperactive allele of calcineurin. Although, iron deprivation phenocopied compromised HSP90 and calcineurin, it was independent of protein kinase C signaling cascade. Notably, the phenotypes associated with iron deprivation in genetically impaired calcineurin and HSP90 could be reversed with iron supplementation. The observed down regulation of ergosterol (ERG1, ERG2, ERG11 and ERG25 and sphingolipid biosynthesis (AUR1 and SCS7 genes followed by lipidome analysis confirmed that iron deprivation not only disrupted ergosterol biosynthesis, but it also affected sphingolipid homeostasis in Candida cells. These lipid compositional changes suggested extensive remodeling of the membranes in iron

  12. Regulation of disease-responsive genes mediated by epigenetic factors: interaction of Arabidopsis-Pseudomonas.

    Science.gov (United States)

    De-La-Peña, Clelia; Rangel-Cano, Alicia; Alvarez-Venegas, Raúl

    2012-05-01

    Genes in eukaryotic organisms function within the context of chromatin, and the mechanisms that modulate the structure of chromatin are defined as epigenetic. In Arabidopsis, pathogen infection induces the expression of at least one histone deacetylase, suggesting that histone acetylation/deacetylation has an important role in the pathogenic response in plants. How/whether histone methylation affects gene response to pathogen infection is unknown. To gain a better understanding of the epigenetic mechanisms regulating the interaction between Pseudomonas syringae and Arabidopsis thaliana, we analysed three different Arabidopsis ash1-related (absent, small or homeotic discs 1) mutants. We found that the loss of function of ASHH2 and ASHR1 resulted in faster hypersensitive responses (HRs) to both mutant (hrpA) and pathogenic (DC3000) strains of P. syringae, whereas control (Col-0) and ashr3 mutants appeared to be more resistant to the infection after 2 days. Furthermore, we showed that, in the ashr3 background, the PR1 gene (PATHOGENESIS-RELATED GENE 1) displayed the highest expression levels on infection with DC3000, correlating with increased resistance against this pathogen. Our results show that, in both the ashr1 and ashh2 backgrounds, the histone H3 lysine 4 dimethylation (H3K4me2) levels decreased at the promoter region of PR1 on infection with the DC3000 strain, suggesting that an epigenetically regulated PR1 expression is involved in the plant defence. Our results suggest that histone methylation in response to pathogen infection may be a critical component in the signalling and defence processes occurring between plants and microbes. © 2011 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2011 BSPP AND BLACKWELL PUBLISHING LTD.

  13. microRNA-7 down-regulation mediates excessive collagen expression in localized scleroderma.

    Science.gov (United States)

    Etoh, Mitsuhiko; Jinnin, Masatoshi; Makino, Katsunari; Yamane, Keitaro; Nakayama, Wakana; Aoi, Jun; Honda, Noritoshi; Kajihara, Ikko; Makino, Takamitsu; Fukushima, Satoshi; Ihn, Hironobu

    2013-01-01

    Localized scleroderma (LSc), a connective tissue disorder restricted to the skin and subcutaneous tissue, is characterized by skin fibrosis due to an excessive deposition of types I collagen. The mechanism of such fibrosis is still unknown, but epigenetics may play some roles in the excessive collagen expression. In the present study, we investigated the mechanism of fibrosis seen in LSc, focusing on microRNA (miRNA). miRNA expression was determined by PCR array, real-time PCR, and in situ hybridization. The function of miRNA was evaluated using specific inhibitor. Immunoblotting was performed to detect α2(I) collagen protein. PCR array analysis using tissue miRNA demonstrated miR-7 level was significantly decreased in LSc skin as well as keloid tissue compared to normal skin in vivo. In situ hybridization also showed miR-7 expression in dermal fibroblasts was decreased in LSc dermis. The transfection of specific inhibitor for miR-7 into cultured normal dermal fibroblasts resulted in the up-regulation of α2(I) collagen protein in vitro. Also, the serum levels of miR-7 were significantly decreased in LSc patients compared with healthy controls, but serum miR-29a levels not. Systemic or local down-regulation of miR-7 may contribute to the pathogenesis of LSc via the overexpression of α2(I) collagen, and serum miR-7 may be useful as a disease marker. Investigation of the regulatory mechanisms of LSc by miRNA may lead to new treatments by the transfection into the lesional skin of this disease.

  14. Computer-Mediated Communication Preferences and Individual Differences in Neurocognitive Measures of Emotional Attention Capture, Reactivity and Regulation

    Science.gov (United States)

    Babkirk, Sarah; Luehring-Jones, Peter; Dennis, Tracy A.

    2016-01-01

    The use of computer-mediated communication (CMC) to engage socially has become increasingly prevalent, yet few studies examined individual differences that may shed light on implications of CMC for adjustment. The current study examined neurocognitive individual differences associated with preferences to use technology in relation to social-emotional outcomes. In Study 1 (N =91), a self-report measure, the Social Media Communication Questionnaire (SMCQ), was evaluated as an assessment of preferences for communicating positive and negative emotions on a scale ranging from purely via CMC to purely face-to-face. In Study 2, SMCQ preferences were examined in relation to event-related potentials (ERPs) associated with early emotional attention capture and reactivity (the frontal N1) and later sustained emotional processing and regulation [the late positive potential (LPP)]. Electroencephalography (EEG) was recorded while 22 participants passively viewed emotional and neutral pictures and completed an emotion regulation task with instructions to increase, decrease or maintain their emotional responses. A greater preference for CMC was associated with reduced size of and satisfaction with social support, greater early (N1) attention capture by emotional stimuli, and reduced LPP amplitudes to unpleasant stimuli in the increase emotion regulatory task. These findings are discussed in the context of possible emotion- and social-regulatory functions of CMC. PMID:26613269

  15. The obesity-induced transcriptional regulator TRIP-Br2 mediates visceral fat endoplasmic reticulum stress-induced inflammation.

    Science.gov (United States)

    Qiang, Guifen; Kong, Hyerim Whang; Fang, Difeng; McCann, Maximilian; Yang, Xiuying; Du, Guanhua; Blüher, Matthias; Zhu, Jinfang; Liew, Chong Wee

    2016-04-25

    The intimate link between location of fat accumulation and metabolic disease risk and depot-specific differences is well established, but how these differences between depots are regulated at the molecular level remains largely unclear. Here we show that TRIP-Br2 mediates endoplasmic reticulum (ER) stress-induced inflammatory responses in visceral fat. Using in vitro, ex vivo and in vivo approaches, we demonstrate that obesity-induced circulating factors upregulate TRIP-Br2 specifically in visceral fat via the ER stress pathway. We find that ablation of TRIP-Br2 ameliorates both chemical and physiological ER stress-induced inflammatory and acute phase response in adipocytes, leading to lower circulating levels of inflammatory cytokines. Using promoter assays, as well as molecular and pharmacological experiments, we show that the transcription factor GATA3 is responsible for the ER stress-induced TRIP-Br2 expression in visceral fat. Taken together, our study identifies molecular regulators of inflammatory response in visceral fat that-given that these pathways are conserved in humans-might serve as potential therapeutic targets in obesity.

  16. Clathrin-Mediated Auxin Efflux and Maxima Regulate Hypocotyl Hook Formation and Light-Stimulated Hook Opening in Arabidopsis.

    Science.gov (United States)

    Yu, Qinqin; Zhang, Ying; Wang, Juan; Yan, Xu; Wang, Chao; Xu, Jian; Pan, Jianwei

    2016-01-04

    The establishment of auxin maxima by PIN-FORMED 3 (PIN3)- and AUXIN RESISTANT 1/LIKE AUX1 (LAX) 3 (AUX1/LAX3)-mediated auxin transport is essential for hook formation in Arabidopsis hypocotyls. Until now, however, the underlying regulatory mechanism has remained poorly understood. Here, we show that loss of function of clathrin light chain CLC2 and CLC3 genes enhanced auxin maxima and thereby hook curvature, alleviated the inhibitory effect of auxin overproduction on auxin maxima and hook curvature, and delayed blue light-stimulated auxin maxima reduction and hook opening. Moreover, pharmacological experiments revealed that auxin maxima formation and hook curvature in clc2 clc3 were sensitive to auxin efflux inhibitors 1-naphthylphthalamic acid and 2,3,5-triiodobenzoic acid but not to the auxin influx inhibitor 1-naphthoxyacetic acid. Live-cell imaging analysis further uncovered that loss of CLC2 and CLC3 function impaired PIN3 endocytosis and promoted its lateralization in the cortical cells but did not affect AUX1 localization. Taken together, these results suggest that clathrin regulates auxin maxima and thereby hook formation through modulating PIN3 localization and auxin efflux, providing a novel mechanism that integrates developmental signals and environmental cues to regulate plant skotomorphogenesis and photomorphogenesis. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

  17. A discontinuous RNA platform mediates RNA virus replication: building an integrated model for RNA-based regulation of viral processes.

    Directory of Open Access Journals (Sweden)

    Baodong Wu

    2009-03-01

    Full Text Available Plus-strand RNA viruses contain RNA elements within their genomes that mediate a variety of fundamental viral processes. The traditional view of these elements is that of local RNA structures. This perspective, however, is changing due to increasing discoveries of functional viral RNA elements that are formed by long-range RNA-RNA interactions, often spanning thousands of nucleotides. The plus-strand RNA genomes of tombusviruses exemplify this concept by possessing different long-range RNA-RNA interactions that regulate both viral translation and transcription. Here we report that a third fundamental tombusvirus process, viral genome replication, requires a long-range RNA-based interaction spanning approximately 3000 nts. In vivo and in vitro analyses suggest that the discontinuous RNA platform formed by the interaction facilitates efficient assembly of the viral RNA replicase. This finding has allowed us to build an integrated model for the role of global RNA structure in regulating the reproduction of a eukaryotic RNA virus, and the insights gained have extended our understanding of the multifunctional nature of viral RNA genomes.

  18. Fluvastatin mediated breast cancer cell death: a proteomic approach to identify differentially regulated proteins in MDA-MB-231 cells.

    Directory of Open Access Journals (Sweden)

    Anantha Koteswararao Kanugula

    Full Text Available Statins are increasingly being recognized as anti-cancer agents against various cancers including breast cancer. To understand the molecular pathways targeted by fluvastatin and its differential sensitivity against metastatic breast cancer cells, we analyzed protein alterations in MDA-MB-231 cells treated with fluvastatin using 2-DE in combination with LC-MS/MS. Results revealed dys-regulation of 39 protein spots corresponding to 35 different proteins. To determine the relevance of altered protein profiles with breast cancer cell death, we mapped these proteins to major pathways involved in the regulation of cell-to-cell signaling and interaction, cell cycle, Rho GDI and proteasomal pathways using IPA analysis. Highly interconnected sub networks showed that vimentin and ERK1/2 proteins play a central role in controlling the expression of altered proteins. Fluvastatin treatment caused proteolysis of vimentin, a marker of epithelial to mesenchymal transition. This effect of fluvastatin was reversed in the presence of mevalonate, a downstream product of HMG-CoA and caspase-3 inhibitor. Interestingly, fluvastatin neither caused an appreciable cell death nor did modulate vimentin expression in normal mammary epithelial cells. In conclusion, fluvastatin alters levels of cytoskeletal proteins, primarily targeting vimentin through increased caspase-3- mediated proteolysis, thereby suggesting a role for vimentin in statin-induced breast cancer cell death.

  19. Local pH domains regulate NHE3-mediated Na+ reabsorption in the renal proximal tubule

    Science.gov (United States)

    Burford, James L.; McDonough, Alicia A.; Holstein-Rathlou, Niels-Henrik; Peti-Peterdi, Janos

    2014-01-01

    The proximal tubule Na+/H+ exchanger 3 (NHE3), located in the apical dense microvilli (brush border), plays a major role in the reabsorption of NaCl and water in the renal proximal tubule. In response to a rise in blood pressure NHE3 redistributes in the plane of the plasma membrane to the base of the brush border, where NHE3 activity is reduced. This NHE3 redistribution is assumed to provoke pressure natriuresis; however, it is unclear how NHE3 redistribution per se reduces NHE3 activity. To investigate if the distribution of NHE3 in the brush border can change the reabsorption rate, we constructed a spatiotemporal mathematical model of NHE3-mediated Na+ reabsorption across a proximal tubule cell and compare